#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SLC2A7	155184	hgsc.bcm.edu	37	1	9074919	9074919	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:9074919T>C	ENST00000400906.1	-	7	723	c.724A>G	c.(724-726)Agg>Ggg	p.R242G		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	242					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		CCTCTCAGCCTCCTCAGAGCT	0.692																																					p.R242G		Atlas-SNP	.											.	SLC2A7	56	.	0			c.A724G						.						13.0	15.0	14.0					1																	9074919		2197	4296	6493	SO:0001583	missense	155184	exon7			TCAGCCTCCTCAG	AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.724A>G	chr1.hg19:g.9074919T>C	ENSP00000383698:p.Arg242Gly	17.0	0.0		37.0	4.0	NM_207420	A2A333	Missense_Mutation	SNP	ENST00000400906.1	hg19	CCDS98.2	.	.	.	.	.	.	.	.	.	.	T	11.26	1.585937	0.28268	.	.	ENSG00000197241	ENST00000400906	T	0.76186	-1.0	4.12	-1.16	0.09678	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.284899	0.31123	N	0.008214	T	0.77903	0.4200	M	0.93375	3.41	0.09310	N	1	B	0.30727	0.292	B	0.37731	0.257	T	0.71066	-0.4700	10	0.49607	T	0.09	.	5.9998	0.19515	0.0:0.2097:0.3487:0.4416	.	242	Q6PXP3	GTR7_HUMAN	G	242	ENSP00000383698:R242G	ENSP00000383698:R242G	R	-	1	2	SLC2A7	8997506	0.018000	0.18449	0.001000	0.08648	0.091000	0.18340	0.549000	0.23329	-0.108000	0.12066	0.402000	0.26972	AGG	.	.		0.692	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127768.3	NM_207420	
VPS13D	55187	hgsc.bcm.edu	37	1	12403094	12403094	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:12403094A>G	ENST00000358136.3	+	42	9001	c.8871A>G	c.(8869-8871)ggA>ggG	p.G2957G	VPS13D_ENST00000356315.4_Silent_p.G2932G	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAGCAAGAGGAAAGTTAAGAC	0.368																																					p.G2957G		Atlas-SNP	.											.	VPS13D	316	.	0			c.A8871G						.						83.0	78.0	80.0					1																	12403094		2203	4300	6503	SO:0001819	synonymous_variant	55187	exon42			AAGAGGAAAGTTA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8871A>G	chr1.hg19:g.12403094A>G		61.0	0.0		62.0	4.0	NM_015378		Silent	SNP	ENST00000358136.3	hg19	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	A	9.197	1.027583	0.19512	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.52	4.4	0.53042	.	.	.	.	.	T	0.58061	0.2096	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54289	-0.8316	4	.	.	.	.	7.6015	0.28079	0.7891:0.0:0.2109:0.0	.	.	.	.	G	1779	.	.	E	+	2	0	VPS13D	12325681	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.909000	0.48758	0.947000	0.37659	0.528000	0.53228	GAA	.	.		0.368	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
SPEN	23013	hgsc.bcm.edu	37	1	16254901	16254901	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:16254901T>C	ENST00000375759.3	+	11	2370	c.2166T>C	c.(2164-2166)atT>atC	p.I722I		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	722	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GGAGGCCGATTGAACGAAGTC	0.498																																					p.I722I		Atlas-SNP	.											.	SPEN	374	.	0			c.T2166C						.						94.0	94.0	94.0					1																	16254901		2203	4300	6503	SO:0001819	synonymous_variant	23013	exon11			GCCGATTGAACGA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.2166T>C	chr1.hg19:g.16254901T>C		144.0	0.0		95.0	4.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Silent	SNP	ENST00000375759.3	hg19	CCDS164.1																																																																																			.	.		0.498	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
EIF4G3	8672	hgsc.bcm.edu	37	1	21176020	21176020	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:21176020T>C	ENST00000264211.8	-	23	3802	c.3608A>G	c.(3607-3609)aAa>aGa	p.K1203R	EIF4G3_ENST00000536266.1_Missense_Mutation_p.K807R|EIF4G3_ENST00000602326.1_Missense_Mutation_p.K1209R|EIF4G3_ENST00000374937.3_Missense_Mutation_p.K1209R|EIF4G3_ENST00000374935.3_Missense_Mutation_p.K923R|EIF4G3_ENST00000537738.1_Missense_Mutation_p.K693R|EIF4G3_ENST00000400422.1_Missense_Mutation_p.K1203R	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	1203					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		AATTTCTGGTTTTGCTATTAG	0.318																																					p.K1239R		Atlas-SNP	.											.	EIF4G3	300	.	0			c.A3716G						.						77.0	71.0	73.0					1																	21176020		2203	4300	6503	SO:0001583	missense	8672	exon27			TCTGGTTTTGCTA	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.3608A>G	chr1.hg19:g.21176020T>C	ENSP00000264211:p.Lys1203Arg	151.0	0.0		84.0	4.0	NM_001198801	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	T	14.71	2.615994	0.46631	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266	T;T;T;T;T;T	0.08282	3.6;3.6;3.47;3.11;3.61;3.3	6.08	6.08	0.98989	.	0.318396	0.36519	N	0.002547	T	0.15003	0.0362	N	0.12182	0.205	0.80722	D	1	D;B;B;D;D	0.76494	0.999;0.33;0.165;0.997;0.985	D;B;B;D;P	0.79784	0.993;0.222;0.051;0.985;0.767	T	0.16394	-1.0404	10	0.62326	D	0.03	-19.0926	15.2149	0.73258	0.0:0.0:0.0:1.0	.	1398;923;807;1209;1203	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	R	1203;1399;1203;923;693;1209;807	ENSP00000264211:K1203R;ENSP00000383274:K1203R;ENSP00000364071:K923R;ENSP00000442010:K693R;ENSP00000364073:K1209R;ENSP00000444693:K807R	ENSP00000264211:K1203R	K	-	2	0	EIF4G3	21048607	1.000000	0.71417	0.575000	0.28536	0.047000	0.14425	5.384000	0.66225	2.333000	0.79357	0.533000	0.62120	AAA	.	.		0.318	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
EIF4G3	8672	hgsc.bcm.edu	37	1	21221985	21221985	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:21221985T>C	ENST00000264211.8	-	11	2035	c.1841A>G	c.(1840-1842)aAg>aGg	p.K614R	EIF4G3_ENST00000544689.1_Missense_Mutation_p.K157R|EIF4G3_ENST00000536266.1_Missense_Mutation_p.K218R|EIF4G3_ENST00000374933.3_5'UTR|EIF4G3_ENST00000602326.1_Missense_Mutation_p.K620R|EIF4G3_ENST00000374937.3_Missense_Mutation_p.K620R|EIF4G3_ENST00000374935.3_Missense_Mutation_p.K334R|EIF4G3_ENST00000537738.1_Missense_Mutation_p.K67R|EIF4G3_ENST00000400422.1_Missense_Mutation_p.K614R	NM_003760.4	NP_003751.2	O43432	IF4G3_HUMAN	eukaryotic translation initiation factor 4 gamma, 3	614					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of meiosis I (GO:0060903)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|regulation of translational initiation (GO:0006446)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(18)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(1)|urinary_tract(3)	70		all_lung(284;2.61e-06)|Lung NSC(340;2.81e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00149)|Ovarian(437;0.00338)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.023)|COAD - Colon adenocarcinoma(152;5.42e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000327)|GBM - Glioblastoma multiforme(114;0.000696)|Kidney(64;0.0018)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(64;0.0185)|READ - Rectum adenocarcinoma(331;0.124)|Lung(427;0.191)		ATCAGTAGGCTTCCAGGATTC	0.438																																					p.K620R		Atlas-SNP	.											.	EIF4G3	300	.	0			c.A1859G						.						94.0	96.0	95.0					1																	21221985		2203	4300	6503	SO:0001583	missense	8672	exon15			GTAGGCTTCCAGG	AF012072	CCDS214.1, CCDS55580.1, CCDS59192.1, CCDS72723.1	1p36.12	2008-02-05			ENSG00000075151	ENSG00000075151			3298	protein-coding gene	gene with protein product		603929				9418880	Standard	NM_001198801		Approved	eIF4GII	uc001bef.3	O43432	OTTHUMG00000002624	ENST00000264211.8:c.1841A>G	chr1.hg19:g.21221985T>C	ENSP00000264211:p.Lys614Arg	86.0	0.0		67.0	4.0	NM_001198802	B9EGQ7|Q15597|Q504Z1|Q5SWC3|Q8NEN1	Missense_Mutation	SNP	ENST00000264211.8	hg19	CCDS214.1	.	.	.	.	.	.	.	.	.	.	T	18.87	3.716201	0.68844	.	.	ENSG00000075151	ENST00000264211;ENST00000400415;ENST00000400422;ENST00000374935;ENST00000537738;ENST00000374937;ENST00000536266;ENST00000374933;ENST00000544689	T;T;T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77;0.77;0.77	4.72	4.72	0.59763	.	0.232507	0.44902	D	0.000416	T	0.55768	0.1941	L	0.39147	1.195	0.80722	D	1	P;B;B;D;B	0.58268	0.93;0.209;0.268;0.982;0.369	P;B;B;D;B	0.67548	0.554;0.055;0.209;0.952;0.064	T	0.55685	-0.8102	10	0.48119	T	0.1	-17.0836	10.6392	0.45584	0.0:0.0:0.1608:0.8392	.	809;334;218;620;614	Q59GJ0;Q504Z1;F5H564;B9EGQ7;O43432	.;.;.;.;IF4G3_HUMAN	R	614;810;614;334;67;620;218;157;157	ENSP00000264211:K614R;ENSP00000383274:K614R;ENSP00000364071:K334R;ENSP00000442010:K67R;ENSP00000364073:K620R;ENSP00000444693:K218R;ENSP00000444401:K157R	ENSP00000264211:K614R	K	-	2	0	EIF4G3	21094572	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.913000	0.48790	1.887000	0.54652	0.377000	0.23210	AAG	.	.		0.438	EIF4G3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000007467.3	NM_003760	
MACF1	23499	hgsc.bcm.edu	37	1	39751339	39751339	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:39751339C>A	ENST00000372915.3	+	13	1519	c.1432C>A	c.(1432-1434)Cag>Aag	p.Q478K	MACF1_ENST00000564288.1_Missense_Mutation_p.Q473K|MACF1_ENST00000567887.1_Missense_Mutation_p.Q510K|MACF1_ENST00000361689.2_Missense_Mutation_p.Q478K|MACF1_ENST00000545844.1_Missense_Mutation_p.Q478K|MACF1_ENST00000317713.7_Missense_Mutation_p.Q478K|MACF1_ENST00000539005.1_Missense_Mutation_p.Q478K			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	478					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			TATGTACATTCAGGAGTGTGA	0.483																																					p.Q478K		Atlas-SNP	.											.	MACF1	909	.	0			c.C1432A						.						110.0	98.0	102.0					1																	39751339		2203	4300	6503	SO:0001583	missense	23499	exon15			TACATTCAGGAGT	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1432C>A	chr1.hg19:g.39751339C>A	ENSP00000362006:p.Gln478Lys	257.0	0.0		194.0	153.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.	.	.	.	.	.	.	.	.	.	C	19.68	3.872429	0.72180	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.93189	-3.18;-3.18;-3.18;-3.18;-3.18;-3.18;-3.18	5.93	5.93	0.95920	.	.	.	.	.	D	0.92718	0.7685	M	0.65975	2.015	0.80722	D	1	B;P	0.44734	0.011;0.842	B;P	0.45276	0.022;0.475	D	0.89732	0.3927	9	0.02654	T	1	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	478;443	F8W8Q1;Q9UPN3-3	.;.	K	478;478;478;478;478;436;627;638	ENSP00000439537:Q478K;ENSP00000362006:Q478K;ENSP00000354573:Q478K;ENSP00000313438:Q478K;ENSP00000444364:Q478K;ENSP00000435070:Q436K;ENSP00000437059:Q627K	ENSP00000313438:Q478K	Q	+	1	0	MACF1	39523926	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.741000	0.68638	2.826000	0.97356	0.655000	0.94253	CAG	.	.		0.483	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
TMCO2	127391	hgsc.bcm.edu	37	1	40713792	40713792	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:40713792C>T	ENST00000372766.3	+	1	220	c.127C>T	c.(127-129)Cta>Tta	p.L43L	TMCO2_ENST00000468258.1_Intron	NM_001008740.3	NP_001008740.1	Q7Z6W1	TMCO2_HUMAN	transmembrane and coiled-coil domains 2	43						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)|ovary(1)	6	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;6.3e-18)			AAGTTTGGGACTATTAGATAA	0.393																																					p.L43L		Atlas-SNP	.											.	TMCO2	23	.	0			c.C127T						.						188.0	190.0	189.0					1																	40713792		2203	4300	6503	SO:0001819	synonymous_variant	127391	exon1			TTGGGACTATTAG	AL050341	CCDS30684.1	1p34.2	2014-02-12			ENSG00000188800	ENSG00000188800			23312	protein-coding gene	gene with protein product							Standard	NM_001008740		Approved	dJ39G22.2	uc001cfe.2	Q7Z6W1	OTTHUMG00000005764	ENST00000372766.3:c.127C>T	chr1.hg19:g.40713792C>T		104.0	0.0		77.0	4.0	NM_001008740		Silent	SNP	ENST00000372766.3	hg19	CCDS30684.1																																																																																			.	.		0.393	TMCO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015769.1	NM_001008740	
SZT2	23334	hgsc.bcm.edu	37	1	43890875	43890875	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:43890875A>G	ENST00000562955.1	+	18	2642	c.2642A>G	c.(2641-2643)gAc>gGc	p.D881G	SZT2_ENST00000372442.1_Missense_Mutation_p.D39G	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	881					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						TCCACCAAAGACAGGTGAGAC	0.567																																					p.D881G		Atlas-SNP	.											.	SZT2	383	.	0			c.A2642G						.						92.0	70.0	77.0					1																	43890875		2203	4300	6503	SO:0001583	missense	23334	exon18			CCAAAGACAGGTG	AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.2642A>G	chr1.hg19:g.43890875A>G	ENSP00000457168:p.Asp881Gly	125.0	0.0		77.0	5.0	NM_015284	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	ENST00000562955.1	hg19	CCDS30694.2	.	.	.	.	.	.	.	.	.	.	A	33	5.228427	0.95173	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.68595	0.3018	L	0.42245	1.32	0.37764	D	0.926442	P;D	0.76494	0.844;0.999	B;D	0.65443	0.42;0.935	T	0.74337	-0.3698	9	0.72032	D	0.01	.	15.9527	0.79855	1.0:0.0:0.0:0.0	.	881;881	Q5T011-4;Q5T011-5	.;.	G	39	.	ENSP00000361519:D39G	D	+	2	0	SZT2	43663462	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.151000	0.94674	2.173000	0.68751	0.533000	0.62120	GAC	.	.		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019517.3	NM_015284	
DOCK7	85440	hgsc.bcm.edu	37	1	62941000	62941000	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:62941000A>G	ENST00000340370.5	-	46	5908	c.5891T>C	c.(5890-5892)gTt>gCt	p.V1964A	DOCK7_ENST00000489185.1_5'UTR|DOCK7_ENST00000251157.5_Missense_Mutation_p.V1984A	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1995	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CTCAATAGCAACTTCAATTGG	0.383																																					p.V1984A		Atlas-SNP	.											.	DOCK7	184	.	0			c.T5951C						.						155.0	146.0	149.0					1																	62941000		2203	4300	6503	SO:0001583	missense	85440	exon46			ATAGCAACTTCAA		CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5891T>C	chr1.hg19:g.62941000A>G	ENSP00000340742:p.Val1964Ala	199.0	0.0		134.0	6.0	NM_001271999	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	ENST00000340370.5	hg19	CCDS30734.1	.	.	.	.	.	.	.	.	.	.	A	24.5	4.543161	0.86022	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	T;T	0.20200	2.09;2.09	5.74	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.48295	0.1492	M	0.82517	2.595	0.80722	D	1	D;D;D;D;D;D	0.76494	0.999;0.998;0.998;0.997;0.999;0.987	D;D;D;D;D;D	0.87578	0.998;0.973;0.995;0.99;0.998;0.96	T	0.52094	-0.8621	10	0.72032	D	0.01	.	11.7864	0.52045	0.9313:0.0:0.0687:0.0	.	1995;1984;1964;1953;1955;1986	Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	DOCK7_HUMAN;.;.;.;.;.	A	1995;1984;1964;725	ENSP00000251157:V1984A;ENSP00000340742:V1964A	ENSP00000251157:V1984A	V	-	2	0	DOCK7	62713588	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.296000	0.96104	0.999000	0.39023	0.533000	0.62120	GTT	.	.		0.383	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036806.1	NM_033407	
ROR1	4919	hgsc.bcm.edu	37	1	64605903	64605903	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:64605903T>C	ENST00000371079.1	+	6	1097	c.722T>C	c.(721-723)gTc>gCc	p.V241A	RP11-24J23.2_ENST00000424995.1_RNA|ROR1_ENST00000482426.1_3'UTR|ROR1_ENST00000371080.1_Missense_Mutation_p.V241A|ROR1_ENST00000545203.1_5'UTR	NM_005012.3	NP_005003.2	Q01973	ROR1_HUMAN	receptor tyrosine kinase-like orphan receptor 1	241	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				peptidyl-tyrosine phosphorylation (GO:0018108)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			breast(7)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(10)|ovary(6)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	51						ACTTCATCCGTCCCAAAGCCC	0.463																																					p.V241A		Atlas-SNP	.											.	ROR1	113	.	0			c.T722C						.						132.0	114.0	120.0					1																	64605903		2203	4300	6503	SO:0001583	missense	4919	exon6			CATCCGTCCCAAA	M97675	CCDS626.1, CCDS41344.1	1p32-p31	2013-01-11			ENSG00000185483	ENSG00000185483		"""Immunoglobulin superfamily / I-set domain containing"""	10256	protein-coding gene	gene with protein product		602336		NTRKR1		1334494, 8875995	Standard	NM_001083592		Approved		uc001dbj.3	Q01973	OTTHUMG00000009022	ENST00000371079.1:c.722T>C	chr1.hg19:g.64605903T>C	ENSP00000360120:p.Val241Ala	162.0	0.0		116.0	5.0	NM_001083592	Q5VVX6|Q66K77|Q92776	Missense_Mutation	SNP	ENST00000371079.1	hg19	CCDS626.1	.	.	.	.	.	.	.	.	.	.	T	0.026	-1.371417	0.01225	.	.	ENSG00000185483	ENST00000371080;ENST00000371079;ENST00000544776	T;T	0.74737	-0.87;-0.87	5.92	1.09	0.20402	Frizzled domain (2);Kringle (1);	0.607504	0.13432	N	0.388367	T	0.19525	0.0469	N	0.02315	-0.6	0.21220	N	0.99975	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.38499	-0.9658	10	0.06625	T	0.88	.	10.2088	0.43128	0.0:0.349:0.0:0.651	.	241;241	Q01973;Q66K77	ROR1_HUMAN;.	A	241;241;244	ENSP00000360121:V241A;ENSP00000360120:V241A	ENSP00000360120:V241A	V	+	2	0	ROR1	64378491	0.000000	0.05858	0.159000	0.22649	0.484000	0.33280	0.379000	0.20585	-0.050000	0.13356	-0.263000	0.10527	GTC	.	.		0.463	ROR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025002.1	NM_005012	
ERICH3	127254	hgsc.bcm.edu	37	1	75078418	75078418	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:75078418A>G	ENST00000326665.5	-	9	1294	c.1076T>C	c.(1075-1077)gTg>gCg	p.V359A	RP4-612J11.1_ENST00000416017.1_RNA|C1orf173_ENST00000420661.2_Missense_Mutation_p.V162A	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		359										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						TAACCTGTTCACCTGCATCCC	0.423																																					p.V359A		Atlas-SNP	.											.	C1orf173	380	.	0			c.T1076C						.						99.0	96.0	97.0					1																	75078418		2203	4300	6503	SO:0001583	missense	127254	exon9			CTGTTCACCTGCA																												ENST00000326665.5:c.1076T>C	chr1.hg19:g.75078418A>G	ENSP00000322609:p.Val359Ala	68.0	0.0		61.0	5.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	ENST00000326665.5	hg19	CCDS30755.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.872260	0.91587	.	.	ENSG00000178965	ENST00000326665;ENST00000420661	T;T	0.21031	2.47;2.03	5.63	5.63	0.86233	.	.	.	.	.	T	0.29126	0.0724	L	0.52364	1.645	0.51233	D	0.999916	D;D	0.89917	0.997;1.0	D;D	0.74674	0.941;0.984	T	0.01496	-1.1340	9	0.29301	T	0.29	-21.4021	15.8025	0.78463	1.0:0.0:0.0:0.0	.	162;359	Q5RHP9-3;Q5RHP9	.;CA173_HUMAN	A	359;162	ENSP00000322609:V359A;ENSP00000398581:V162A	ENSP00000322609:V359A	V	-	2	0	C1orf173	74851006	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.877000	0.92386	2.265000	0.75225	0.533000	0.62120	GTG	.	.		0.423	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
TYW3	127253	hgsc.bcm.edu	37	1	75199081	75199081	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:75199081C>T	ENST00000370867.3	+	1	242	c.153C>T	c.(151-153)ggC>ggT	p.G51G	CRYZ_ENST00000370872.3_5'Flank|TYW3_ENST00000457880.2_Silent_p.G51G|CRYZ_ENST00000340866.5_5'Flank|CRYZ_ENST00000417775.1_5'UTR|CRYZ_ENST00000370871.3_5'Flank|TYW3_ENST00000421739.2_Silent_p.G51G|TYW3_ENST00000479111.1_5'UTR	NM_138467.2	NP_612476.1	Q6IPR3	TYW3_HUMAN	tRNA-yW synthesizing protein 3 homolog (S. cerevisiae)	51					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|ovary(2)|prostate(1)|skin(1)	15						CCTGCGCTGGCCGCATCCTAC	0.587																																					p.G51G		Atlas-SNP	.											.	TYW3	36	.	0			c.C153T						.						89.0	77.0	81.0					1																	75199081		2203	4300	6503	SO:0001819	synonymous_variant	127253	exon1			CGCTGGCCGCATC	BX647591	CCDS666.1, CCDS53334.1	1p31.1	2008-02-05	2006-05-25	2006-05-25	ENSG00000162623	ENSG00000162623			24757	protein-coding gene	gene with protein product		611245	"""chromosome 1 open reading frame 171"""	C1orf171		17150819	Standard	NM_138467		Approved	FLJ40918	uc001dgn.3	Q6IPR3	OTTHUMG00000009641	ENST00000370867.3:c.153C>T	chr1.hg19:g.75199081C>T		62.0	0.0		43.0	5.0	NM_001162916	B4DSP9|E9PGR7|Q5HYJ0|Q8N7L1	Silent	SNP	ENST00000370867.3	hg19	CCDS666.1																																																																																			.	.		0.587	TYW3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026573.1	NM_138467	
CDC7	8317	hgsc.bcm.edu	37	1	91978625	91978625	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:91978625G>A	ENST00000428239.1	+	7	842	c.583G>A	c.(583-585)Gta>Ata	p.V195I	CDC7_ENST00000430031.2_Missense_Mutation_p.V167I|CDC7_ENST00000234626.6_Missense_Mutation_p.V195I	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		GTATGCCTTGGTAGACTTTGG	0.363																																					p.V195I		Atlas-SNP	.											.	CDC7	74	.	0			c.G583A						.						54.0	57.0	56.0					1																	91978625		2203	4300	6503	SO:0001583	missense	8317	exon7			GCCTTGGTAGACT	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.583G>A	chr1.hg19:g.91978625G>A	ENSP00000393139:p.Val195Ile	166.0	0.0		73.0	4.0	NM_001134419	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	hg19	CCDS734.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826243	0.90955	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.05513	3.43;3.43;3.43	5.54	5.54	0.83059	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.06600	0.0169	N	0.10916	0.065	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.58634	-0.7602	10	0.20519	T	0.43	-14.5766	19.4811	0.95009	0.0:0.0:1.0:0.0	.	167;195	B7Z5H7;O00311	.;CDC7_HUMAN	I	167;195;195	ENSP00000407477:V167I;ENSP00000234626:V195I;ENSP00000393139:V195I	ENSP00000234626:V195I	V	+	1	0	CDC7	91751213	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.439000	0.97543	2.580000	0.87095	0.563000	0.77884	GTA	.	.		0.363	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
CDC7	8317	hgsc.bcm.edu	37	1	91978829	91978829	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:91978829G>T	ENST00000428239.1	+	7	1046	c.787G>T	c.(787-789)Gca>Tca	p.A263S	CDC7_ENST00000430031.2_Missense_Mutation_p.A235S|CDC7_ENST00000234626.6_Missense_Mutation_p.A263S	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	263	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		CTACACAAATGCACAAATTCA	0.393																																					p.A263S		Atlas-SNP	.											.	CDC7	74	.	0			c.G787T						.						83.0	87.0	85.0					1																	91978829		2203	4300	6503	SO:0001583	missense	8317	exon7			ACAAATGCACAAA	AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.787G>T	chr1.hg19:g.91978829G>T	ENSP00000393139:p.Ala263Ser	192.0	0.0		125.0	20.0	NM_001134419	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	ENST00000428239.1	hg19	CCDS734.1	.	.	.	.	.	.	.	.	.	.	G	6.557	0.471144	0.12461	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.46063	0.88;1.04;1.04	5.89	0.572	0.17357	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.528279	0.20582	N	0.089503	T	0.03739	0.0106	N	0.03608	-0.345	0.25224	N	0.989889	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.41270	-0.9518	10	0.06494	T	0.89	-5.082	4.5672	0.12193	0.308:0.0:0.4429:0.2491	.	235;263	B7Z5H7;O00311	.;CDC7_HUMAN	S	235;263;263	ENSP00000407477:A235S;ENSP00000234626:A263S;ENSP00000393139:A263S	ENSP00000234626:A263S	A	+	1	0	CDC7	91751417	0.051000	0.20477	0.987000	0.45799	0.997000	0.91878	0.184000	0.16939	0.111000	0.17947	0.557000	0.71058	GCA	.	.		0.393	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027928.1	NM_003503	
PLPPR4	9890	hgsc.bcm.edu	37	1	99771896	99771896	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:99771896A>G	ENST00000370185.3	+	7	2119	c.1622A>G	c.(1621-1623)cAg>cGg	p.Q541R	LPPR4_ENST00000370184.1_Missense_Mutation_p.Q383R|LPPR4_ENST00000457765.1_Missense_Mutation_p.Q483R	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		541					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		GAGGAGACTCAGGAAAACATA	0.557																																					p.Q541R		Atlas-SNP	.											LPPR4,NS,carcinoma,0,1	LPPR4	143	.	0			c.A1622G						.						100.0	105.0	103.0					1																	99771896		2203	4300	6503	SO:0001583	missense	0	exon7			AGACTCAGGAAAA																												ENST00000370185.3:c.1622A>G	chr1.hg19:g.99771896A>G	ENSP00000359204:p.Gln541Arg	56.0	0.0		36.0	2.0	NM_014839	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Missense_Mutation	SNP	ENST00000370185.3	hg19	CCDS757.1	.	.	.	.	.	.	.	.	.	.	A	15.33	2.800675	0.50315	.	.	ENSG00000117600	ENST00000370185;ENST00000457765;ENST00000263178;ENST00000370184	T;T;T	0.24538	2.41;2.39;1.85	5.62	5.62	0.85841	.	0.060559	0.64402	D	0.000001	T	0.10035	0.0246	L	0.29908	0.895	0.49798	D	0.999823	B;B	0.33512	0.372;0.415	B;B	0.31495	0.116;0.131	T	0.09751	-1.0660	9	.	.	.	-11.4707	15.8077	0.78527	1.0:0.0:0.0:0.0	.	483;541	E7EPS1;Q7Z2D5	.;LPPR4_HUMAN	R	541;483;541;383	ENSP00000359204:Q541R;ENSP00000394913:Q483R;ENSP00000359203:Q383R	.	Q	+	2	0	RP4-788L13.1	99544484	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.853000	0.92222	2.131000	0.65755	0.482000	0.46254	CAG	.	.		0.557	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029670.2		
COL11A1	1301	hgsc.bcm.edu	37	1	103481281	103481281	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:103481281A>G	ENST00000370096.3	-	12	1743	c.1431T>C	c.(1429-1431)ccT>ccC	p.P477P	COL11A1_ENST00000353414.4_Silent_p.P438P|COL11A1_ENST00000358392.2_Silent_p.P489P|COL11A1_ENST00000512756.1_Silent_p.P361P	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	477	Collagen-like 1.|Triple-helical region (interrupted).				cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		CTGGTAAGCCAGGACGTCCTG	0.358																																					p.P489P		Atlas-SNP	.											.	COL11A1	972	.	0			c.T1467C						.						33.0	32.0	33.0					1																	103481281		2203	4298	6501	SO:0001819	synonymous_variant	1301	exon12			TAAGCCAGGACGT	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.1431T>C	chr1.hg19:g.103481281A>G		163.0	0.0		97.0	4.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Silent	SNP	ENST00000370096.3	hg19	CCDS778.1																																																																																			.	.		0.358	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
VAV3	10451	hgsc.bcm.edu	37	1	108292166	108292166	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:108292166T>A	ENST00000370056.4	-	14	1584	c.1310A>T	c.(1309-1311)gAt>gTt	p.D437V	VAV3_ENST00000527011.1_Missense_Mutation_p.D437V|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000371846.4_Missense_Mutation_p.D372V	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	437	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)			NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		TTCATAGTTATCACCTTTTCT	0.323																																					p.D437V		Atlas-SNP	.											.	VAV3	176	.	0			c.A1310T						.						151.0	135.0	141.0					1																	108292166		2202	4297	6499	SO:0001583	missense	10451	exon14			TAGTTATCACCTT	AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.1310A>T	chr1.hg19:g.108292166T>A	ENSP00000359073:p.Asp437Val	108.0	0.0		57.0	4.0	NM_006113	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	ENST00000370056.4	hg19	CCDS785.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.10|17.10	3.302722|3.302722	0.60195|0.60195	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000370056;ENST00000527011;ENST00000371846|ENST00000490388	D;D;D|.	0.88818|.	-2.43;-2.43;-2.43|.	5.83|5.83	5.83|5.83	0.93111|0.93111	Pleckstrin homology-type (1);Pleckstrin homology domain (3);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.67627|0.67627	0.2913|0.2913	M|M	0.71581|0.71581	2.175|2.175	0.80722|0.80722	D|D	1|1	B;P;B;B|.	0.35456|.	0.001;0.502;0.01;0.263|.	B;P;B;P|.	0.49922|.	0.037;0.626;0.056;0.521|.	T|T	0.68318|0.68318	-0.5440|-0.5440	10|5	0.87932|.	D|.	0|.	.|.	16.2141|16.2141	0.82191|0.82191	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	437;437;372;437|.	B7ZLR1;E9PQ97;B4DHL6;Q9UKW4|.	.;.;.;VAV3_HUMAN|.	V|L	437;437;372|432	ENSP00000359073:D437V;ENSP00000432540:D437V;ENSP00000360912:D372V|.	ENSP00000359073:D437V|.	D|I	-|-	2|1	0|0	VAV3|VAV3	108093689|108093689	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.698000|7.698000	0.84413|0.84413	2.224000|2.224000	0.72417|0.72417	0.528000|0.528000	0.53228|0.53228	GAT|ATA	.	.		0.323	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030242.2	NM_006113	
HENMT1	113802	hgsc.bcm.edu	37	1	109191529	109191529	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:109191529T>C	ENST00000370032.5	-	8	1261	c.841A>G	c.(841-843)Agc>Ggc	p.S281G	HENMT1_ENST00000402983.1_Missense_Mutation_p.S281G|HENMT1_ENST00000370031.1_Missense_Mutation_p.S312G|HENMT1_ENST00000493676.1_5'UTR	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	281					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						ACTCTTAAGCTTTCCACTTGT	0.488																																					p.S281G		Atlas-SNP	.											.	HENMT1	38	.	0			c.A841G						.						75.0	69.0	71.0					1																	109191529		2203	4300	6503	SO:0001583	missense	113802	exon8			TTAAGCTTTCCAC		CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.841A>G	chr1.hg19:g.109191529T>C	ENSP00000359049:p.Ser281Gly	97.0	0.0		63.0	4.0	NM_144584	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Missense_Mutation	SNP	ENST00000370032.5	hg19	CCDS787.1	.	.	.	.	.	.	.	.	.	.	T	9.608	1.130631	0.21041	.	.	ENSG00000162639	ENST00000402983;ENST00000370031;ENST00000370032;ENST00000420055	T;T;T;T	0.31247	1.92;1.9;1.92;1.5	5.6	2.09	0.27110	.	1.373870	0.03974	N	0.292129	T	0.04770	0.0129	N	0.08118	0	0.09310	N	1	B	0.27068	0.167	B	0.23275	0.045	T	0.29971	-0.9994	10	0.21540	T	0.41	-5.0206	5.885	0.18876	0.0:0.1572:0.3207:0.5221	.	281	Q5T8I9	HENMT_HUMAN	G	281;312;281;281	ENSP00000385655:S281G;ENSP00000359048:S312G;ENSP00000359049:S281G;ENSP00000403953:S281G	ENSP00000359048:S312G	S	-	1	0	HENMT1	108993052	0.000000	0.05858	0.001000	0.08648	0.065000	0.16274	-0.021000	0.12504	0.119000	0.18210	0.533000	0.62120	AGC	.	.		0.488	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000030592.1	NM_144584	
AMPD2	271	hgsc.bcm.edu	37	1	110173318	110173318	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:110173318A>G	ENST00000256578.3	+	17	2693	c.2333A>G	c.(2332-2334)gAg>gGg	p.E778G	AMPD2_ENST00000393688.3_Missense_Mutation_p.E659G|AMPD2_ENST00000528667.1_Missense_Mutation_p.E778G|AMPD2_ENST00000342115.4_Missense_Mutation_p.E697G|RP5-1160K1.6_ENST00000369843.3_RNA|AMPD2_ENST00000528454.1_Missense_Mutation_p.E660G|AMPD2_ENST00000358729.4_Missense_Mutation_p.E703G	NM_004037.7	NP_004028.3	Q01433	AMPD2_HUMAN	adenosine monophosphate deaminase 2	778			E -> D (in PCH9). {ECO:0000269|PubMed:23911318}.		cell death (GO:0008219)|cyclic purine nucleotide metabolic process (GO:0052652)|energy homeostasis (GO:0097009)|IMP biosynthetic process (GO:0006188)|IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			breast(1)|large_intestine(3)|ovary(2)|skin(1)	7		all_epithelial(167;2.5e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)|Breast(1374;0.244)		Lung(183;0.0425)|all cancers(265;0.0884)|Colorectal(144;0.109)|Epithelial(280;0.111)|LUSC - Lung squamous cell carcinoma(189;0.228)		CCGCTGATGGAGGAGTACAGC	0.647																																					p.E778G		Atlas-SNP	.											.	AMPD2	75	.	0			c.A2333G						.						39.0	35.0	37.0					1																	110173318		2203	4299	6502	SO:0001583	missense	271	exon17			TGATGGAGGAGTA	S47833	CCDS804.1, CCDS805.1, CCDS30796.1, CCDS58016.1	1p13.3	2014-03-03	2010-02-10		ENSG00000116337	ENSG00000116337	3.5.4.6		469	protein-coding gene	gene with protein product	"""AMPD isoform L"""	102771	"""adenosine monophosphate deaminase 2 (isoform L)"""			1400401, 24482476	Standard	NM_004037		Approved	SPG63	uc009wfh.2	Q01433	OTTHUMG00000011649	ENST00000256578.3:c.2333A>G	chr1.hg19:g.110173318A>G	ENSP00000256578:p.Glu778Gly	94.0	0.0		68.0	4.0	NM_004037	B4DK50|B4DZI5|E9PNG0|Q14856|Q14857|Q16686|Q16687|Q16688|Q16729|Q5T693|Q5T695|Q96IA1|Q9UDX8|Q9UDX9|Q9UMU4	Missense_Mutation	SNP	ENST00000256578.3	hg19	CCDS805.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.938647	0.92526	.	.	ENSG00000116337	ENST00000342115;ENST00000528667;ENST00000256578;ENST00000358729;ENST00000528454;ENST00000393688	D;D;D;D;D;D	0.85088	-1.94;-1.94;-1.94;-1.94;-1.94;-1.94	4.9	4.9	0.64082	Adenosine/AMP deaminase (1);	0.000000	0.85682	D	0.000000	D	0.92384	0.7583	M	0.90198	3.095	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.926;0.974;1.0;0.999	D	0.93847	0.7142	10	0.72032	D	0.01	-31.8313	14.3437	0.66646	1.0:0.0:0.0:0.0	.	703;659;778;697	Q01433-4;Q01433-3;Q01433;Q01433-2	.;.;AMPD2_HUMAN;.	G	697;778;778;703;660;659	ENSP00000345498:E697G;ENSP00000436541:E778G;ENSP00000256578:E778G;ENSP00000351573:E703G;ENSP00000437164:E660G;ENSP00000377292:E659G	ENSP00000256578:E778G	E	+	2	0	AMPD2	109974841	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.081000	0.94049	2.071000	0.62044	0.402000	0.26972	GAG	.	.		0.647	AMPD2-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390615.1		
PTPN22	26191	hgsc.bcm.edu	37	1	114367766	114367766	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:114367766T>C	ENST00000359785.5	-	19	2414	c.2279A>G	c.(2278-2280)aAg>aGg	p.K760R	PTPN22_ENST00000528414.1_Missense_Mutation_p.K705R|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000525799.1_Missense_Mutation_p.K633R|RP5-1073O3.2_ENST00000429398.1_RNA|PTPN22_ENST00000420377.2_Missense_Mutation_p.K760R|PTPN22_ENST00000538253.1_Missense_Mutation_p.K516R|RP5-1073O3.2_ENST00000448199.1_RNA	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	760					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAACTTACTCTTTTTCATGTT	0.219																																					p.K760R		Atlas-SNP	.											PTPN22,NS,carcinoma,0,1	PTPN22	90	.	0			c.A2279G						.						15.0	16.0	16.0					1																	114367766		2155	4228	6383	SO:0001583	missense	26191	exon19			TTACTCTTTTTCA	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.2279A>G	chr1.hg19:g.114367766T>C	ENSP00000352833:p.Lys760Arg	132.0	0.0		53.0	3.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.139383	0.77775	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799	T;T;T;T;T	0.61980	0.06;0.06;0.06;0.06;0.06	5.23	5.23	0.72850	.	0.000000	0.64402	D	0.000014	T	0.69940	0.3167	M	0.76328	2.33	0.42906	D	0.994248	D;D;D;D;D	0.89917	0.99;0.997;0.995;1.0;0.995	P;D;P;D;P	0.80764	0.864;0.921;0.849;0.994;0.804	T	0.70934	-0.4737	10	0.35671	T	0.21	.	11.804	0.52143	0.0:0.0:0.0:1.0	.	516;633;760;705;760	F5H2S8;E9PPI1;E9PMT0;E9PLD8;Q9Y2R2	.;.;.;.;PTN22_HUMAN	R	760;705;516;760;633	ENSP00000352833:K760R;ENSP00000435176:K705R;ENSP00000439372:K516R;ENSP00000388229:K760R;ENSP00000432674:K633R	ENSP00000352833:K760R	K	-	2	0	PTPN22	114169289	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	4.098000	0.57748	2.100000	0.63781	0.477000	0.44152	AAG	.	.		0.219	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
NOTCH2	4853	hgsc.bcm.edu	37	1	120458101	120458101	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:120458101A>G	ENST00000256646.2	-	34	7463	c.7244T>C	c.(7243-7245)cTg>cCg	p.L2415P		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2415					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGATGGTGTCAGGTAGGGATG	0.572			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																												p.L2415P		Atlas-SNP	.		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	.	NOTCH2	348	.	0			c.T7244C						.						115.0	105.0	108.0					1																	120458101		2203	4300	6503	SO:0001583	missense	4853	exon34	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	GGTGTCAGGTAGG	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.7244T>C	chr1.hg19:g.120458101A>G	ENSP00000256646:p.Leu2415Pro	150.0	0.0		108.0	5.0	NM_024408	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	ENST00000256646.2	hg19	CCDS908.1	.	.	.	.	.	.	.	.	.	.	A	18.29	3.590592	0.66219	.	.	ENSG00000134250	ENST00000256646	T	0.79141	-1.24	5.35	5.35	0.76521	Domain of unknown function DUF3454, notch (1);	0.000000	0.29722	U	0.011371	T	0.80048	0.4552	L	0.45581	1.43	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80125	-0.1513	10	0.39692	T	0.17	.	14.5066	0.67758	1.0:0.0:0.0:0.0	.	2415	Q04721	NOTC2_HUMAN	P	2415	ENSP00000256646:L2415P	ENSP00000256646:L2415P	L	-	2	0	NOTCH2	120259624	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.262000	0.95591	2.027000	0.59764	0.482000	0.46254	CTG	.	.		0.572	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033679.1	NM_024408	
SETDB1	9869	hgsc.bcm.edu	37	1	150933423	150933423	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:150933423C>G	ENST00000271640.5	+	16	3075	c.2885C>G	c.(2884-2886)tCa>tGa	p.S962*	SETDB1_ENST00000368969.4_Nonsense_Mutation_p.S962*	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1	962	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			GTTCCTCCCTCAATCCCTGTA	0.547																																					p.S962X		Atlas-SNP	.											.	SETDB1	204	.	0			c.C2885G						.						117.0	120.0	119.0					1																	150933423		2203	4300	6503	SO:0001587	stop_gained	9869	exon16			CTCCCTCAATCCC	D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.2885C>G	chr1.hg19:g.150933423C>G	ENSP00000271640:p.Ser962*	140.0	0.0		203.0	14.0	NM_012432	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Nonsense_Mutation	SNP	ENST00000271640.5	hg19	CCDS44217.1	.	.	.	.	.	.	.	.	.	.	C	34	5.297677	0.95574	.	.	ENSG00000143379	ENST00000271640;ENST00000368969;ENST00000498193	.	.	.	5.47	3.6	0.41247	.	1.371790	0.04323	N	0.351050	.	.	.	.	.	.	0.22975	N	0.998482	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.4496	0.44513	0.0:0.848:0.0:0.152	.	.	.	.	X	962	.	ENSP00000271640:S962X	S	+	2	0	SETDB1	149200047	0.000000	0.05858	0.002000	0.10522	0.483000	0.33249	0.430000	0.21428	0.670000	0.31165	0.462000	0.41574	TCA	.	.		0.547	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084717.2		
LMNA	4000	hgsc.bcm.edu	37	1	156108485	156108485	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:156108485C>T	ENST00000368300.4	+	11	2117	c.1905C>T	c.(1903-1905)ggC>ggT	p.G635G	LMNA_ENST00000473598.2_Silent_p.G536G|LMNA_ENST00000347559.2_Silent_p.G605G|LMNA_ENST00000448611.2_Silent_p.G523G|LMNA_ENST00000368299.3_Intron|LMNA_ENST00000496738.1_3'UTR	NM_170707.3	NP_733821.1	P02545	LMNA_HUMAN	lamin A/C	635	Tail.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to hypoxia (GO:0071456)|endoplasmic reticulum unfolded protein response (GO:0030968)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic nuclear envelope reassembly (GO:0007084)|muscle organ development (GO:0007517)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of cell aging (GO:0090343)|protein localization to nucleus (GO:0034504)|regulation of cell migration (GO:0030334)|regulation of protein localization to nucleus (GO:1900180)|sterol regulatory element binding protein import into nucleus (GO:0035105)|ventricular cardiac muscle cell development (GO:0055015)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament (GO:0005882)|lamin filament (GO:0005638)|nuclear envelope (GO:0005635)|nuclear lamina (GO:0005652)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|lung(3)|ovary(4)	10	Hepatocellular(266;0.158)					GTGGGGGTGGCAGCTTCGGGG	0.642									Werner syndrome;Hutchinson-Gilford Progeria Syndrome																												p.G635G		Atlas-SNP	.											.	LMNA	31	.	0			c.C1905T						.						23.0	24.0	23.0					1																	156108485		2203	4298	6501	SO:0001819	synonymous_variant	4000	exon11	Familial Cancer Database	WS, Adult Progeria;HGPS, Progeria	GGGTGGCAGCTTC	BC014507	CCDS1129.1, CCDS1131.1, CCDS58038.1, CCDS72941.1, CCDS72942.1	1q22	2014-09-17			ENSG00000160789	ENSG00000160789		"""Intermediate filaments type V, lamins"""	6636	protein-coding gene	gene with protein product		150330	"""cardiomyopathy, dilated 1A (autosomal dominant)"", ""limb girdle muscular dystrophy 1B (autosomal dominant)"", ""progeria 1 (Hutchinson-Gilford type)"", ""lamin A/C-like 1"""	LMN1, CMD1A, LGMD1B, PRO1, LMNL1		8511676, 8838815, 12702809	Standard	NM_005572		Approved	HGPS	uc001fni.3	P02545	OTTHUMG00000013961	ENST00000368300.4:c.1905C>T	chr1.hg19:g.156108485C>T		192.0	0.0		242.0	50.0	NM_170707	B4DI32|D3DVB0|D6RAQ3|E7EUI9|P02546|Q5I6Y4|Q5I6Y6|Q5TCJ2|Q5TCJ3|Q6UYC3|Q969I8|Q96JA2	Silent	SNP	ENST00000368300.4	hg19	CCDS1129.1																																																																																			.	.		0.642	LMNA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039200.2	NM_170707	
CD1D	912	hgsc.bcm.edu	37	1	158151417	158151417	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:158151417C>G	ENST00000368171.3	+	3	733	c.234C>G	c.(232-234)gaC>gaG	p.D78E		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	78					antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					CGTTCAGCGACCAGCAGTGGG	0.587																																					p.D78E		Atlas-SNP	.											.	CD1D	60	.	0			c.C234G						.						69.0	75.0	73.0					1																	158151417		2203	4300	6503	SO:0001583	missense	912	exon3			CAGCGACCAGCAG	BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.234C>G	chr1.hg19:g.158151417C>G	ENSP00000357153:p.Asp78Glu	50.0	0.0		54.0	5.0	NM_001766	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	ENST00000368171.3	hg19	CCDS1173.1	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853548	0.32791	.	.	ENSG00000158473	ENST00000368171	T	0.06371	3.31	4.33	-2.76	0.05896	MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	2.111690	0.01888	N	0.038335	T	0.01765	0.0056	L	0.54323	1.7	0.09310	N	1	B	0.14438	0.01	B	0.08055	0.003	T	0.45425	-0.9262	10	0.33141	T	0.24	-2.2381	0.7721	0.01026	0.2681:0.2197:0.3184:0.1939	.	78	P15813	CD1D_HUMAN	E	78	ENSP00000357153:D78E	ENSP00000357153:D78E	D	+	3	2	CD1D	156418041	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	-1.955000	0.01523	-0.383000	0.07858	0.655000	0.94253	GAC	.	.		0.587	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058340.1	NM_001766	
SPTA1	6708	hgsc.bcm.edu	37	1	158646052	158646052	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:158646052T>C	ENST00000368147.4	-	8	1171	c.991A>G	c.(991-993)Aca>Gca	p.T331A		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	331					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TGGGAAAGTGTCAGCTTCTCT	0.483																																					p.T331A		Atlas-SNP	.											.	SPTA1	720	.	0			c.A991G						.						211.0	199.0	203.0					1																	158646052		1928	4144	6072	SO:0001583	missense	6708	exon8			AAAGTGTCAGCTT	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.991A>G	chr1.hg19:g.158646052T>C	ENSP00000357129:p.Thr331Ala	128.0	0.0		148.0	6.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	ENST00000368147.4	hg19	CCDS41423.1	.	.	.	.	.	.	.	.	.	.	T	0.015	-1.546629	0.00926	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.32515	1.45;1.45	5.24	-2.44	0.06502	.	1.172060	0.06713	N	0.773574	T	0.02727	0.0082	N	0.03209	-0.39	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.40572	-0.9556	10	0.05721	T	0.95	.	7.9173	0.29825	0.0:0.1795:0.534:0.2865	.	331	P02549	SPTA1_HUMAN	A	331	ENSP00000357130:T331A;ENSP00000357129:T331A	ENSP00000357129:T331A	T	-	1	0	SPTA1	156912676	0.995000	0.38212	0.007000	0.13788	0.161000	0.22273	0.814000	0.27239	-0.211000	0.10124	-0.256000	0.11100	ACA	.	.		0.483	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
OR6K2	81448	hgsc.bcm.edu	37	1	158669522	158669522	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:158669522A>G	ENST00000359610.2	-	1	964	c.921T>C	c.(919-921)ggT>ggC	p.G307G		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					TCTTAGCTTGACCTATGTGCT	0.388																																					p.G307G		Atlas-SNP	.											.	OR6K2	104	.	0			c.T921C						.						76.0	74.0	75.0					1																	158669522		2203	4300	6503	SO:0001819	synonymous_variant	81448	exon1			AGCTTGACCTATG	BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.921T>C	chr1.hg19:g.158669522A>G		104.0	0.0		94.0	4.0	NM_001005279	B9EH33|Q6IFR6	Silent	SNP	ENST00000359610.2	hg19	CCDS30902.1																																																																																			.	.		0.388	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059061.1	NM_001005279	
ITLN2	142683	hgsc.bcm.edu	37	1	160922449	160922449	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:160922449T>C	ENST00000368029.3	-	3	211	c.154A>G	c.(154-156)Agc>Ggc	p.S52G	ITLN2_ENST00000494442.1_5'Flank|RP11-544M22.1_ENST00000356006.3_RNA	NM_080878.2	NP_543154.1	Q8WWU7	ITLN2_HUMAN	intelectin 2	52	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(4)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(1)	19	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)			TCTTTGCAGCTTCTAGGCAGG	0.468																																					p.S52G		Atlas-SNP	.											.	ITLN2	35	.	0			c.A154G						.						115.0	110.0	112.0					1																	160922449		2203	4300	6503	SO:0001583	missense	142683	exon3			TGCAGCTTCTAGG	AY065973	CCDS1212.1	1q22-q23.5	2013-02-06			ENSG00000158764	ENSG00000158764		"""Fibrinogen C domain containing"""	20599	protein-coding gene	gene with protein product		609874				11181563	Standard	NM_080878		Approved	HL-2	uc001fxd.3	Q8WWU7	OTTHUMG00000028605	ENST00000368029.3:c.154A>G	chr1.hg19:g.160922449T>C	ENSP00000357008:p.Ser52Gly	80.0	0.0		92.0	4.0	NM_080878	Q17RR2|Q5VYI0	Missense_Mutation	SNP	ENST00000368029.3	hg19	CCDS1212.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.565549	0.45694	.	.	ENSG00000158764	ENST00000368029	T	0.76709	-1.04	3.95	3.95	0.45737	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 1 (1);	0.082933	0.44483	U	0.000449	D	0.84009	0.5378	M	0.91561	3.22	0.30639	N	0.7567	D;P	0.55800	0.973;0.846	P;P	0.59643	0.861;0.79	T	0.82190	-0.0580	10	0.87932	D	0	-13.7152	10.7917	0.46436	0.0:0.0:0.0:1.0	.	51;52	A6NI51;Q8WWU7	.;ITLN2_HUMAN	G	52	ENSP00000357008:S52G	ENSP00000357008:S52G	S	-	1	0	ITLN2	159189073	0.997000	0.39634	0.990000	0.47175	0.049000	0.14656	1.990000	0.40717	1.627000	0.50400	0.459000	0.35465	AGC	.	.		0.468	ITLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071465.1	NM_080878	
FMO1	2326	hgsc.bcm.edu	37	1	171236701	171236701	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:171236701G>A	ENST00000354841.4	+	2	283	c.152G>A	c.(151-153)aGa>aAa	p.R51K	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Intron|FMO1_ENST00000367750.3_Missense_Mutation_p.R51K	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	51					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GAAGAAGGCAGAGCCAGTCTC	0.443																																					p.R51K		Atlas-SNP	.											.	FMO1	79	.	0			c.G152A						.						167.0	145.0	152.0					1																	171236701		2203	4300	6503	SO:0001583	missense	2326	exon3			AAGGCAGAGCCAG	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.152G>A	chr1.hg19:g.171236701G>A	ENSP00000346901:p.Arg51Lys	124.0	0.0		191.0	46.0	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	hg19	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	G	16.46	3.130494	0.56828	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000354841	T;T;T	0.58358	0.34;0.34;0.34	5.38	4.47	0.54385	.	0.000000	0.85682	D	0.000000	T	0.52693	0.1750	L	0.55990	1.75	0.80722	D	1	B;D	0.69078	0.179;0.997	B;D	0.63381	0.348;0.914	T	0.52786	-0.8529	10	0.34782	T	0.22	1.9125	12.9846	0.58583	0.0795:0.0:0.9205:0.0	.	51;51	B2RCG5;Q01740	.;FMO1_HUMAN	K	51	ENSP00000356724:R51K;ENSP00000406982:R51K;ENSP00000346901:R51K	ENSP00000346901:R51K	R	+	2	0	FMO1	169503325	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.609000	0.61148	1.252000	0.44001	-0.136000	0.14681	AGA	.	.		0.443	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
TNN	63923	hgsc.bcm.edu	37	1	175067580	175067580	+	Silent	SNP	T	T	G	rs61747978	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:175067580T>G	ENST00000239462.4	+	9	2081	c.1968T>G	c.(1966-1968)tcT>tcG	p.S656S		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	656	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GCTACACCTCTGCTGGTGGAG	0.612																																					p.S656S		Atlas-SNP	.											.	TNN	297	.	0			c.T1968G						.						96.0	92.0	93.0					1																	175067580		2203	4300	6503	SO:0001819	synonymous_variant	63923	exon9			CACCTCTGCTGGT	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1968T>G	chr1.hg19:g.175067580T>G		277.0	0.0		656.0	58.0	NM_022093	B9EGP3|Q5R360	Silent	SNP	ENST00000239462.4	hg19	CCDS30943.1																																																																																			.	T|0.981;C|0.019		0.612	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	
BRINP2	57795	hgsc.bcm.edu	37	1	177247856	177247856	+	Silent	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:177247856A>T	ENST00000361539.4	+	7	1482	c.1170A>T	c.(1168-1170)ctA>ctT	p.L390L	BRINP2_ENST00000478325.1_3'UTR	NM_021165.2	NP_066988.1	Q9C0B6	BRNP2_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 2	390			L -> V (in dbSNP:rs3176443).		cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	extracellular region (GO:0005576)											ATCGGATCCTACGCCGGCTCT	0.612																																					p.L390L		Atlas-SNP	.											.	FAM5B	191	.	0			c.A1170T						.						82.0	86.0	85.0					1																	177247856		2203	4300	6503	SO:0001819	synonymous_variant	57795	exon7			GATCCTACGCCGG		CCDS1320.1	1q24	2013-08-06	2013-08-06	2013-07-31	ENSG00000198797	ENSG00000198797			13746	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member B"""	FAM5B		15193423	Standard	NM_021165		Approved	DBCCR1L2	uc001glf.3	Q9C0B6	OTTHUMG00000034953	ENST00000361539.4:c.1170A>T	chr1.hg19:g.177247856A>T		117.0	0.0		116.0	49.0	NM_021165	O95560|Q6ZWC1|Q7LCZ9|Q8N360	Silent	SNP	ENST00000361539.4	hg19	CCDS1320.1																																																																																			.	.		0.612	BRINP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084599.1	NM_021165	
SEC16B	89866	hgsc.bcm.edu	37	1	177901667	177901667	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:177901667T>C	ENST00000308284.6	-	24	3059	c.2970A>G	c.(2968-2970)ggA>ggG	p.G990G	RP4-798P15.3_ENST00000354921.3_RNA|SEC16B_ENST00000495165.1_5'UTR	NM_033127.2	NP_149118.2	Q96JE7	SC16B_HUMAN	SEC16 homolog B (S. cerevisiae)	990					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|positive regulation of gene expression (GO:0010628)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endoplasmic reticulum (GO:0070972)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)				central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|skin(1)|stomach(1)	35						CCGCAGCTGCTCCCCCGCTGG	0.657																																					p.G990G		Atlas-SNP	.											.	SEC16B	92	.	0			c.A2970G						.						11.0	15.0	14.0					1																	177901667		2022	4111	6133	SO:0001819	synonymous_variant	89866	exon24			AGCTGCTCCCCCG	AK090411	CCDS44281.1	1q25.2	2012-10-08	2007-06-20	2007-06-20	ENSG00000120341	ENSG00000120341			30301	protein-coding gene	gene with protein product	"""regucalcin gene promotor region related protein"""	612855	"""leucine zipper transcription regulator 2"""	LZTR2		11572484, 11605020	Standard	NM_033127		Approved	RGPR, PGPR-p117	uc001gli.1	Q96JE7	OTTHUMG00000167206	ENST00000308284.6:c.2970A>G	chr1.hg19:g.177901667T>C		130.0	0.0		143.0	6.0	NM_033127	A3EYF1|Q5HYF6|Q8N7D6|Q96GX6	Silent	SNP	ENST00000308284.6	hg19	CCDS44281.1																																																																																			.	.		0.657	SEC16B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084773.16	NM_033127	
QSOX1	5768	hgsc.bcm.edu	37	1	180163522	180163522	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:180163522T>C	ENST00000367602.3	+	11	1537	c.1463T>C	c.(1462-1464)cTt>cCt	p.L488P	QSOX1_ENST00000367600.5_Missense_Mutation_p.L488P			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	488	ERV/ALR sulfhydryl oxidase. {ECO:0000255|PROSITE-ProRule:PRU00654}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						AATGCTCGCCTTGCAGGTAAG	0.597																																					p.L488P		Atlas-SNP	.											.	QSOX1	79	.	0			c.T1463C						.						63.0	52.0	56.0					1																	180163522		2203	4300	6503	SO:0001583	missense	5768	exon11			CTCGCCTTGCAGG	U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.1463T>C	chr1.hg19:g.180163522T>C	ENSP00000356574:p.Leu488Pro	130.0	0.0		98.0	5.0	NM_002826	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	ENST00000367602.3	hg19	CCDS1337.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.994310	0.54041	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.71103	-0.54;-0.54	4.75	4.75	0.60458	Erv1/Alr (3);ERV/ALR sulphydryl oxidase (1);	0.073163	0.56097	D	0.000022	D	0.86932	0.6052	M	0.93106	3.38	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.986;1.0	D	0.89955	0.4082	10	0.87932	D	0	-25.514	13.2551	0.60074	0.0:0.0:0.0:1.0	.	488;488;488;488	A8K4C2;A8K477;O00391;O00391-2	.;.;QSOX1_HUMAN;.	P	488	ENSP00000356574:L488P;ENSP00000356572:L488P	ENSP00000356572:L488P	L	+	2	0	QSOX1	178430145	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	7.322000	0.79097	1.786000	0.52430	0.379000	0.24179	CTT	.	.		0.597	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085289.1	NM_002826	
TPR	7175	hgsc.bcm.edu	37	1	186340129	186340129	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:186340129A>G	ENST00000367478.4	-	3	599	c.303T>C	c.(301-303)atT>atC	p.I101I	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	101	Necessary for interaction with HSF1.				carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		GATCCTGAGCAATTTCAAGTT	0.318			T	NTRK1	papillary thyroid																																p.I101I		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.T303C						.						192.0	176.0	181.0					1																	186340129		1828	4087	5915	SO:0001819	synonymous_variant	7175	exon3			CTGAGCAATTTCA	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.303T>C	chr1.hg19:g.186340129A>G		102.0	0.0		84.0	4.0	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	hg19	CCDS41446.1																																																																																			.	.		0.318	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
C1orf27	54953	hgsc.bcm.edu	37	1	186375351	186375351	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:186375351T>C	ENST00000287859.6	+	12	1262	c.1137T>C	c.(1135-1137)gaT>gaC	p.D379D	C1orf27_ENST00000367470.3_Silent_p.D356D|C1orf27_ENST00000419367.3_Silent_p.D347D|C1orf27_ENST00000432021.3_Silent_p.D356D	NM_017847.5	NP_060317.3	Q5SWX8	ODR4_HUMAN	chromosome 1 open reading frame 27	379						integral component of membrane (GO:0016021)	oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	9						AGATGTTGGATCACACAATTC	0.358																																					p.D379D		Atlas-SNP	.											.	C1orf27	41	.	0			c.T1137C						.						137.0	130.0	132.0					1																	186375351		1854	4103	5957	SO:0001819	synonymous_variant	54953	exon12			GTTGGATCACACA	BC003397	CCDS53448.1, CCDS53449.1, CCDS53450.1	1q25	2012-06-25			ENSG00000157181	ENSG00000157181			24299	protein-coding gene	gene with protein product	"""transactivated by recombinant transforming growth factor beta"""	609335				12868032	Standard	NM_017847		Approved	FLJ20505, odr-4, TTG1	uc021pgj.1	Q5SWX8	OTTHUMG00000035579	ENST00000287859.6:c.1137T>C	chr1.hg19:g.186375351T>C		79.0	0.0		73.0	4.0	NM_017847	B4DNY0|E9PFR7|Q19CC6|Q8WYB6|Q9BTS2|Q9H6A6|Q9NX06	Silent	SNP	ENST00000287859.6	hg19	CCDS53448.1																																																																																			.	.		0.358	C1orf27-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086352.2	NM_017847	
NR5A2	2494	hgsc.bcm.edu	37	1	199997033	199997033	+	Missense_Mutation	SNP	C	C	T	rs142187332		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:199997033C>T	ENST00000367362.3	+	1	304	c.58C>T	c.(58-60)Cct>Tct	p.P20S	NR5A2_ENST00000236914.3_Missense_Mutation_p.P20S	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	20					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					CGGACTTACACCTATTGGTAA	0.323																																					p.M20L	Melanoma(179;1138 2773 15678 26136)	Atlas-SNP	.											.	NR5A2	83	.	0			c.A58T						.	C	SER/PRO,SER/PRO	1,4405	2.1+/-5.4	0,1,2202	119.0	121.0	120.0		58,58	2.7	0.9	1	dbSNP_134	120	0,8600		0,0,4300	no	missense,missense	NR5A2	NM_003822.3,NM_205860.1	74,74	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign,benign	20/496,20/542	199997033	1,13005	2203	4300	6503	SO:0001583	missense	2494	exon1			CTTACACCTATTG	U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.58C>T	chr1.hg19:g.199997033C>T	ENSP00000356331:p.Pro20Ser	56.0	0.0		71.0	4.0	NM_003822	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	ENST00000367362.3	hg19	CCDS1401.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.870|4.870	0.161693|0.161693	0.09287|0.09287	2.27E-4|2.27E-4	0.0|0.0	ENSG00000116833|ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000537715;ENST00000542116|ENST00000447034	D;D|.	0.94138|.	-3.33;-3.36|.	5.77|5.77	2.68|2.68	0.31781|0.31781	.|.	0.124523|.	0.37095|.	N|.	0.002260|.	T|T	0.23492|0.23492	0.0568|0.0568	N|N	0.08118|0.08118	0|0	0.53005|0.53005	D|D	0.999965|0.999965	B;B|.	0.06786|.	0.0;0.001|.	B;B|.	0.06405|.	0.002;0.002|.	T|T	0.03784|0.03784	-1.1004|-1.1004	9|5	.|.	.|.	.|.	.|.	3.04|3.04	0.06135|0.06135	0.1289:0.4521:0.2655:0.1534|0.1289:0.4521:0.2655:0.1534	.|.	20;20|.	F1D8R9;O00482|.	.;NR5A2_HUMAN|.	S|I	20|8	ENSP00000356331:P20S;ENSP00000236914:P20S|.	.|.	P|T	+|+	1|2	0|0	NR5A2|NR5A2	198263656|198263656	0.760000|0.760000	0.28428|0.28428	0.855000|0.855000	0.33649|0.33649	0.536000|0.536000	0.34869|0.34869	0.659000|0.659000	0.24994|0.24994	0.757000|0.757000	0.33036|0.33036	0.655000|0.655000	0.94253|0.94253	CCT|ACC	.	C|1.000;T|0.000		0.323	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086497.2		
CR1	1378	hgsc.bcm.edu	37	1	207679429	207679429	+	Splice_Site	SNP	G	G	A	rs199647026		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:207679429G>A	ENST00000367049.4	+	2	301		c.e2+1		CR1_ENST00000400960.2_Splice_Site|CR1_ENST00000367052.1_Splice_Site|CR1_ENST00000367053.1_Splice_Site|CR1_ENST00000367050.4_Splice_Site|CR1_ENST00000367051.1_Splice_Site	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)						complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AGGTGCAGACGTAAGTAACTC	0.418																																					.		Atlas-SNP	.											.	CR1	354	.	0			c.301+1G>A						.						129.0	118.0	121.0					1																	207679429		1847	4088	5935	SO:0001630	splice_region_variant	1378	exon2			GCAGACGTAAGTA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.301+1G>A	chr1.hg19:g.207679429G>A		139.0	0.0		117.0	30.0	NM_000573	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Splice_Site	SNP	ENST00000367049.4	hg19	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	G	13.37	2.217183	0.39201	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049;ENST00000529814	.	.	.	4.13	4.13	0.48395	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0894	0.53717	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CR1	205746052	0.999000	0.42202	0.990000	0.47175	0.546000	0.35178	2.336000	0.43938	2.303000	0.77524	0.591000	0.81541	.	.	.		0.418	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	Intron
RCOR3	55758	hgsc.bcm.edu	37	1	211486825	211486825	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:211486825T>C	ENST00000367005.4	+	11	1344	c.1203T>C	c.(1201-1203)acT>acC	p.T401T	RCOR3_ENST00000367006.4_Missense_Mutation_p.S379P|RCOR3_ENST00000419091.2_Silent_p.T459T|RCOR3_ENST00000526255.1_3'UTR	NM_018254.3	NP_060724.1	Q9P2K3	RCOR3_HUMAN	REST corepressor 3	401	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(81;0.00961)|all cancers(67;0.0999)|Epithelial(68;0.171)		CATCATCCACTCCAACACCAA	0.572																																					p.S379P		Atlas-SNP	.											.	RCOR3	51	.	0			c.T1135C						.						144.0	108.0	120.0					1																	211486825		2203	4300	6503	SO:0001819	synonymous_variant	55758	exon11			ATCCACTCCAACA	AK001738	CCDS31016.1, CCDS44312.1, CCDS44313.1, CCDS44314.1	1q32.3	2008-02-05			ENSG00000117625	ENSG00000117625			25594	protein-coding gene	gene with protein product						10718198	Standard	NM_018254		Approved	FLJ10876	uc010psw.2	Q9P2K3	OTTHUMG00000036996	ENST00000367005.4:c.1203T>C	chr1.hg19:g.211486825T>C		122.0	0.0		127.0	6.0	NM_001136224	B3KYA2|B4DYY7|Q5VT47|Q7L9I5|Q8N5U3|Q9NV83	Missense_Mutation	SNP	ENST00000367005.4	hg19	CCDS31016.1	.	.	.	.	.	.	.	.	.	.	T	11.22	1.575110	0.28092	.	.	ENSG00000117625	ENST00000367006	T	0.51071	0.72	5.07	3.95	0.45737	.	.	.	.	.	T	0.35828	0.0945	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.08055	0.003	T	0.32903	-0.9889	8	0.59425	D	0.04	-13.3938	6.4228	0.21754	0.0:0.0806:0.1589:0.7605	.	379	Q9P2K3-2	.	P	379	ENSP00000355973:S379P	ENSP00000355973:S379P	S	+	1	0	RCOR3	209553448	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.812000	0.38952	1.910000	0.55303	0.528000	0.53228	TCC	.	.		0.572	RCOR3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000089821.1	NM_018254	
USH2A	7399	hgsc.bcm.edu	37	1	216373462	216373462	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:216373462A>G	ENST00000307340.3	-	17	3704	c.3318T>C	c.(3316-3318)agT>agC	p.S1106S	RP5-1099E6.3_ENST00000420867.1_RNA|USH2A_ENST00000366942.3_Splice_Site_p.S1106S|USH2A_ENST00000366943.2_Splice_Site_p.S1106S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1106	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AGTATTGAATACCTGAAATGA	0.318										HNSCC(13;0.011)																											p.S1106S		Atlas-SNP	.											.	USH2A	1168	.	0			c.T3318C						.						37.0	37.0	37.0					1																	216373462		2199	4300	6499	SO:0001630	splice_region_variant	7399	exon17			TTGAATACCTGAA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3317-1T>C	chr1.hg19:g.216373462A>G		41.0	0.0		17.0	10.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Silent	SNP	ENST00000307340.3	hg19	CCDS31025.1																																																																																			.	.		0.318	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	Silent
EPHX1	2052	hgsc.bcm.edu	37	1	226030103	226030103	+	Missense_Mutation	SNP	C	C	A	rs373882933		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:226030103C>A	ENST00000366837.4	+	7	1164	c.968C>A	c.(967-969)gCc>gAc	p.A323D	RP11-285F7.2_ENST00000424332.1_RNA|EPHX1_ENST00000272167.5_Missense_Mutation_p.A323D	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	323					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					GGTCTGGCTGCCTATATTCTA	0.587																																					p.A323D		Atlas-SNP	.											.	EPHX1	57	.	0			c.C968A						.						121.0	129.0	126.0					1																	226030103		2203	4300	6503	SO:0001583	missense	2052	exon7			TGGCTGCCTATAT	J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.968C>A	chr1.hg19:g.226030103C>A	ENSP00000355802:p.Ala323Asp	85.0	0.0		111.0	53.0	NM_001136018	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Missense_Mutation	SNP	ENST00000366837.4	hg19	CCDS1547.1	.	.	.	.	.	.	.	.	.	.	C	33	5.238492	0.95240	.	.	ENSG00000143819	ENST00000272167;ENST00000366837	T;T	0.15017	2.46;2.46	5.33	5.33	0.75918	Alpha/beta hydrolase fold-1 (1);	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	H	0.98351	4.21	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78698	-0.2103	10	0.87932	D	0	-4.0191	19.3842	0.94550	0.0:1.0:0.0:0.0	.	323	P07099	HYEP_HUMAN	D	323	ENSP00000272167:A323D;ENSP00000355802:A323D	ENSP00000272167:A323D	A	+	2	0	EPHX1	224096726	1.000000	0.71417	0.996000	0.52242	0.976000	0.68499	7.695000	0.84257	2.644000	0.89710	0.655000	0.94253	GCC	.	.		0.587	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092064.1	NM_000120	
LYST	1130	hgsc.bcm.edu	37	1	235945311	235945311	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:235945311T>C	ENST00000389794.3	-	15	5113	c.4939A>G	c.(4939-4941)Atg>Gtg	p.M1647V	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Missense_Mutation_p.M1647V			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1647					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.M1647V(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TGGCCAATCATGCAAAATGTT	0.363																																					p.M1647V		Atlas-SNP	.											LYST,NS,carcinoma,0,1	LYST	370	.	1	Substitution - Missense(1)	lung(1)	c.A4939G						.						103.0	101.0	102.0					1																	235945311		2203	4300	6503	SO:0001583	missense	1130	exon15			CAATCATGCAAAA	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.4939A>G	chr1.hg19:g.235945311T>C	ENSP00000374444:p.Met1647Val	90.0	0.0		100.0	4.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	ENST00000389794.3	hg19	CCDS31062.1	.	.	.	.	.	.	.	.	.	.	T	15.61	2.884273	0.51908	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	T;T	0.61980	0.06;0.06	5.57	4.43	0.53597	.	0.036259	0.85682	D	0.000000	T	0.56441	0.1985	M	0.62723	1.935	0.80722	D	1	P	0.40282	0.711	B	0.32980	0.156	T	0.61004	-0.7150	10	0.66056	D	0.02	.	13.0983	0.59206	0.0:0.0:0.134:0.866	.	1647	Q99698	LYST_HUMAN	V	1647	ENSP00000374444:M1647V;ENSP00000374443:M1647V	ENSP00000374443:M1647V	M	-	1	0	LYST	234011934	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.477000	0.81069	1.028000	0.39785	0.528000	0.53228	ATG	.	.		0.363	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
GPR137B	7107	hgsc.bcm.edu	37	1	236306000	236306000	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:236306000C>T	ENST00000366592.3	+	1	169	c.78C>T	c.(76-78)aaC>aaT	p.N26N	GPR137B_ENST00000366591.4_Silent_p.N26N	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	26						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)		p.N26N(2)		endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			CAGCCCGCAACGACTCGCTGC	0.746																																					p.N26N		Atlas-SNP	.											GPR137B_ENST00000366591,NS,carcinoma,0,2	GPR137B	57	.	2	Substitution - coding silent(2)	endometrium(2)	c.C78T						.						31.0	23.0	26.0					1																	236306000		2200	4298	6498	SO:0001819	synonymous_variant	7107	exon1			CCGCAACGACTCG	AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.78C>T	chr1.hg19:g.236306000C>T		36.0	0.0		27.0	2.0	NM_003272	Q53EK7|Q5TAE6|Q6FHI3	Silent	SNP	ENST00000366592.3	hg19	CCDS1609.1																																																																																			.	.		0.746	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092761.1	NM_003272	
RYR2	6262	hgsc.bcm.edu	37	1	237540721	237540721	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:237540721T>C	ENST00000366574.2	+	8	879	c.562T>C	c.(562-564)Tct>Cct	p.S188P	RYR2_ENST00000542537.1_Missense_Mutation_p.S172P|RYR2_ENST00000360064.6_Missense_Mutation_p.S186P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	188	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TAGCGTGTCCTCTGAAAGGTA	0.413																																					p.S188P		Atlas-SNP	.											.	RYR2	1273	.	0			c.T562C						.						115.0	114.0	114.0					1																	237540721		1976	4146	6122	SO:0001583	missense	6262	exon8			GTGTCCTCTGAAA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.562T>C	chr1.hg19:g.237540721T>C	ENSP00000355533:p.Ser188Pro	89.0	0.0		73.0	4.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.586663	0.86851	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.92149	-2.98;-2.98;-2.98	5.17	5.17	0.71159	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.000000	0.64402	D	0.000009	D	0.95239	0.8456	M	0.81239	2.535	0.80722	D	1	D	0.63880	0.993	P	0.60012	0.867	D	0.95784	0.8819	10	0.87932	D	0	.	14.2946	0.66302	0.0:0.0:0.0:1.0	.	188	Q92736	RYR2_HUMAN	P	188;186;172	ENSP00000355533:S188P;ENSP00000353174:S186P;ENSP00000443798:S172P	ENSP00000353174:S186P	S	+	1	0	RYR2	235607344	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.701000	0.84566	2.083000	0.62718	0.455000	0.32223	TCT	.	.		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
CHRM3	1131	hgsc.bcm.edu	37	1	240072218	240072218	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr1:240072218G>A	ENST00000255380.4	+	5	2246	c.1467G>A	c.(1465-1467)gcG>gcA	p.A489A		NM_000740.2	NP_000731.1	P20309	ACM3_HUMAN	cholinergic receptor, muscarinic 3	489					cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|nervous system development (GO:0007399)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of insulin secretion (GO:0050796)|regulation of vascular smooth muscle contraction (GO:0003056)|saliva secretion (GO:0046541)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|smooth muscle contraction (GO:0006939)	asymmetric synapse (GO:0032279)|axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|drug binding (GO:0008144)|G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)|receptor activity (GO:0004872)			breast(3)|endometrium(5)|kidney(2)|large_intestine(4)|lung(19)|ovary(4)|prostate(1)|skin(12)|upper_aerodigestive_tract(1)	51	Ovarian(103;0.127)	all_cancers(173;0.00567)|all_neural(198;0.203)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)		Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Cevimeline(DB00185)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Diphemanil Methylsulfate(DB00729)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxepin(DB01142)|Fesoterodine(DB06702)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Mepenzolate(DB04843)|Methacholine(DB06709)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Tramadol(DB00193)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	AGAAGAAAGCGGCCCAGACCC	0.507																																					p.A489A		Atlas-SNP	.											.	CHRM3	118	.	0			c.G1467A						.						139.0	131.0	134.0					1																	240072218		2203	4300	6503	SO:0001819	synonymous_variant	1131	exon5			GAAAGCGGCCCAG	U29589	CCDS1616.1	1q43	2012-09-20			ENSG00000133019	ENSG00000133019		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1952	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 3"""	118494					Standard	XM_005273032		Approved		uc001hyp.3	P20309	OTTHUMG00000039649	ENST00000255380.4:c.1467G>A	chr1.hg19:g.240072218G>A		148.0	0.0		147.0	36.0	NM_000740	Q0VAJ8|Q4QRI3|Q5VXY2|Q9HB60	Silent	SNP	ENST00000255380.4	hg19	CCDS1616.1																																																																																			.	.		0.507	CHRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095644.2	NM_000740	
COLEC11	78989	hgsc.bcm.edu	37	2	3691494	3691494	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:3691494T>C	ENST00000349077.4	+	7	705	c.602T>C	c.(601-603)gTc>gCc	p.V201A	COLEC11_ENST00000418971.2_Missense_Mutation_p.V215A|COLEC11_ENST00000404205.1_Missense_Mutation_p.V127A|COLEC11_ENST00000382062.2_Missense_Mutation_p.V177A|COLEC11_ENST00000487365.1_3'UTR|COLEC11_ENST00000236693.7_Missense_Mutation_p.V198A|COLEC11_ENST00000402794.1_Missense_Mutation_p.V151A|COLEC11_ENST00000402922.1_Missense_Mutation_p.V151A|COLEC11_ENST00000403096.3_Missense_Mutation_p.V175A	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	201	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		CTGGCCCGTGTCTTCATCGGC	0.662																																					p.V215A		Atlas-SNP	.											.	COLEC11	93	.	0			c.T644C						.						46.0	52.0	50.0					2																	3691494		2203	4300	6503	SO:0001583	missense	78989	exon8			CCCGTGTCTTCAT	BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.602T>C	chr2.hg19:g.3691494T>C	ENSP00000339168:p.Val201Ala	76.0	0.0		79.0	4.0	NM_001255985	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Missense_Mutation	SNP	ENST00000349077.4	hg19	CCDS1649.1	.	.	.	.	.	.	.	.	.	.	T	13.85	2.361178	0.41801	.	.	ENSG00000118004	ENST00000382062;ENST00000236693;ENST00000349077;ENST00000418971;ENST00000403096;ENST00000402794;ENST00000404205;ENST00000402922	T;T;T;T;T;T;T;T	0.19105	2.17;2.17;2.17;2.17;2.17;2.17;2.17;2.17	5.3	5.3	0.74995	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.055315	0.64402	D	0.000001	T	0.29817	0.0745	L	0.33189	0.99	0.80722	D	1	D;D;D;D;D;D;P;P;P	0.76494	0.997;0.999;0.999;0.982;0.999;0.999;0.885;0.906;0.812	D;D;D;D;D;D;P;P;P	0.81914	0.99;0.995;0.995;0.968;0.995;0.994;0.58;0.705;0.699	T	0.04216	-1.0968	10	0.02654	T	1	-28.5708	14.4159	0.67151	0.0:0.0:0.0:1.0	.	127;151;151;175;153;177;177;201;198	Q9BWP8-8;Q9BWP8-7;Q9BWP8-6;Q9BWP8-4;Q9BWP8-5;Q9BWP8-3;Q9BWP8-2;Q9BWP8;Q9BWP8-9	.;.;.;.;.;.;.;COL11_HUMAN;.	A	177;198;201;215;175;151;127;151	ENSP00000371494:V177A;ENSP00000236693:V198A;ENSP00000339168:V201A;ENSP00000411770:V215A;ENSP00000385130:V175A;ENSP00000384882:V151A;ENSP00000385827:V127A;ENSP00000385653:V151A	ENSP00000236693:V198A	V	+	2	0	COLEC11	3669369	1.000000	0.71417	0.997000	0.53966	0.018000	0.09664	6.140000	0.71738	1.996000	0.58369	0.383000	0.25322	GTC	.	.		0.662	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027	
ASAP2	8853	hgsc.bcm.edu	37	2	9533657	9533657	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:9533657C>A	ENST00000281419.3	+	24	2905	c.2565C>A	c.(2563-2565)agC>agA	p.S855R	ASAP2_ENST00000315273.4_Missense_Mutation_p.S810R|ASAP2_ENST00000491413.1_3'UTR	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	855	Pro-rich.				positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						AGACGCCCAGCGTAATGGAAG	0.701																																					p.S855R		Atlas-SNP	.											.	ASAP2	91	.	0			c.C2565A						.						14.0	15.0	15.0					2																	9533657		2201	4298	6499	SO:0001583	missense	8853	exon24			GCCCAGCGTAATG	AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2565C>A	chr2.hg19:g.9533657C>A	ENSP00000281419:p.Ser855Arg	71.0	0.0		80.0	12.0	NM_003887	D6W4Y8	Missense_Mutation	SNP	ENST00000281419.3	hg19	CCDS1661.1	.	.	.	.	.	.	.	.	.	.	C	5.440	0.266321	0.10294	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.59083	0.43;0.29	5.36	-6.75	0.01738	.	6.995770	0.00550	N	0.000258	T	0.42944	0.1225	L	0.34521	1.04	0.24168	N	0.995632	P;B	0.40794	0.729;0.123	B;B	0.42959	0.403;0.135	T	0.43261	-0.9402	10	0.28530	T	0.3	.	2.9644	0.05903	0.0926:0.3469:0.2278:0.3327	.	810;855	O43150-2;O43150	.;ASAP2_HUMAN	R	855;810	ENSP00000281419:S855R;ENSP00000316404:S810R	ENSP00000281419:S855R	S	+	3	2	ASAP2	9451108	0.041000	0.20044	0.000000	0.03702	0.011000	0.07611	-1.141000	0.03207	-1.110000	0.02992	0.462000	0.41574	AGC	.	.		0.701	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000237522.1	NM_003887	
PSME4	23198	hgsc.bcm.edu	37	2	54163250	54163250	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:54163250T>C	ENST00000404125.1	-	7	863	c.808A>G	c.(808-810)Ata>Gta	p.I270V	PSME4_ENST00000421748.2_Intron	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4	270					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			TCCCAATCTATGTACCCTATA	0.378																																					p.I270V		Atlas-SNP	.											.	PSME4	247	.	0			c.A808G						.						115.0	121.0	119.0					2																	54163250		2203	4300	6503	SO:0001583	missense	23198	exon7			AATCTATGTACCC	D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852	ENST00000404125.1:c.808A>G	chr2.hg19:g.54163250T>C	ENSP00000384211:p.Ile270Val	67.0	0.0		59.0	4.0	NM_014614	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	Missense_Mutation	SNP	ENST00000404125.1	hg19	CCDS33197.2	.	.	.	.	.	.	.	.	.	.	T	18.07	3.542602	0.65198	.	.	ENSG00000068878	ENST00000404125	T	0.24723	1.84	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.19805	0.0476	L	0.28344	0.845	0.80722	D	1	B	0.30542	0.284	B	0.31290	0.127	T	0.06391	-1.0829	10	0.16896	T	0.51	.	15.804	0.78477	0.0:0.0:0.0:1.0	.	270	Q14997	PSME4_HUMAN	V	270	ENSP00000384211:I270V	ENSP00000374643:I270V	I	-	1	0	PSME4	54016754	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.923000	0.63412	2.135000	0.66039	0.455000	0.32223	ATA	.	.		0.378	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324163.1	XM_040158	
BCL11A	53335	hgsc.bcm.edu	37	2	60687558	60687558	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:60687558T>G	ENST00000335712.6	-	4	2716	c.2489A>C	c.(2488-2490)aAt>aCt	p.N830T	BCL11A_ENST00000537768.1_Intron|BCL11A_ENST00000359629.5_Intron|BCL11A_ENST00000477659.1_5'UTR|BCL11A_ENST00000356842.4_Intron|BCL11A_ENST00000358510.4_Missense_Mutation_p.N796T|BCL11A_ENST00000538214.1_Intron	NM_022893.3	NP_075044.2	Q9H165	BC11A_HUMAN	B-cell CLL/lymphoma 11A (zinc finger protein)	830					B cell differentiation (GO:0030183)|negative regulation of axon extension (GO:0030517)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein homooligomerization (GO:0032463)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of dendrite development (GO:0050773)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription corepressor activity (GO:0003714)			NS(1)|breast(6)|central_nervous_system(6)|endometrium(4)|kidney(1)|large_intestine(8)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	59			LUSC - Lung squamous cell carcinoma(5;9.29e-08)|Lung(5;1.34e-06)|Epithelial(17;0.0562)|all cancers(80;0.199)			TTTTATATCATTATTCAACAC	0.443			T	IGH@	B-CLL																																p.N830T		Atlas-SNP	.		Dom	yes		2	2p13	53335	B-cell CLL/lymphoma 11A		L	.	BCL11A	298	.	0			c.A2489C						.						97.0	101.0	100.0					2																	60687558		2203	4300	6503	SO:0001583	missense	53335	exon4			ATATCATTATTCA	AJ404611	CCDS1861.1, CCDS1862.1, CCDS46295.1	2p16.1	2013-01-08	2002-05-08		ENSG00000119866	ENSG00000119866		"""Zinc fingers, C2H2-type"""	13221	protein-coding gene	gene with protein product		606557	"""ecotropic viral integration site 9"""	EVI9		11719382, 18245381	Standard	NM_018014		Approved	BCL11A-XL, BCL11A-L, BCL11A-S, CTIP1, HBFQTL5, ZNF856	uc002sae.1	Q9H165	OTTHUMG00000129420	ENST00000335712.6:c.2489A>C	chr2.hg19:g.60687558T>G	ENSP00000338774:p.Asn830Thr	84.0	0.0		50.0	31.0	NM_022893	D6W5D7|Q86W14|Q8WU92|Q96JL6|Q9H163|Q9H164|Q9H3G9|Q9NWA7	Missense_Mutation	SNP	ENST00000335712.6	hg19	CCDS1862.1	.	.	.	.	.	.	.	.	.	.	T	6.371	0.436556	0.12104	.	.	ENSG00000119866	ENST00000335712;ENST00000358510	T;T	0.06142	3.39;3.34	6.17	6.17	0.99709	.	0.191271	0.44688	D	0.000439	T	0.06600	0.0169	N	0.22421	0.69	0.80722	D	1	B;B	0.16166	0.002;0.016	B;B	0.16289	0.007;0.015	T	0.36696	-0.9737	10	0.41790	T	0.15	-2.1995	16.8222	0.85835	0.0:0.0:0.0:1.0	.	796;830	Q9H165-6;Q9H165	.;BC11A_HUMAN	T	830;796	ENSP00000338774:N830T;ENSP00000351307:N796T	ENSP00000338774:N830T	N	-	2	0	BCL11A	60541062	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.772000	0.55325	2.371000	0.80710	0.533000	0.62120	AAT	.	.		0.443	BCL11A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251579.2	NM_022893	
USP34	9736	hgsc.bcm.edu	37	2	61571021	61571021	+	Missense_Mutation	SNP	G	G	T	rs373411362	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:61571021G>T	ENST00000398571.2	-	16	2505	c.2429C>A	c.(2428-2430)gCg>gAg	p.A810E		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	810					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGTCAGTTCCGCATGTGAATT	0.373																																					p.A810E		Atlas-SNP	.											.	USP34	334	.	0			c.C2429A						.						156.0	144.0	148.0					2																	61571021		1915	4129	6044	SO:0001583	missense	9736	exon16			AGTTCCGCATGTG	AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.2429C>A	chr2.hg19:g.61571021G>T	ENSP00000381577:p.Ala810Glu	196.0	0.0		173.0	112.0	NM_014709	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	ENST00000398571.2	hg19	CCDS42686.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479739	0.84747	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.04194	3.68	5.67	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.07863	0.0197	L	0.40543	1.245	0.58432	D	0.999997	D	0.54397	0.966	P	0.46940	0.532	T	0.21177	-1.0253	10	0.46703	T	0.11	.	14.779	0.69751	0.0694:0.0:0.9306:0.0	.	810	Q70CQ2	UBP34_HUMAN	E	658;658;810	ENSP00000381577:A810E	ENSP00000263989:A658E	A	-	2	0	USP34	61424525	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	8.046000	0.89438	1.399000	0.46721	0.603000	0.83216	GCG	.	.		0.373	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325650.4		
ACTR2	10097	hgsc.bcm.edu	37	2	65466992	65466992	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:65466992A>G	ENST00000260641.5	+	2	212	c.55A>G	c.(55-57)Aag>Gag	p.K19E	ACTR2_ENST00000476840.1_3'UTR|ACTR2_ENST00000377982.4_Missense_Mutation_p.K19E|ACTR2_ENST00000542850.1_5'UTR	NM_005722.3	NP_005713.1	P61160	ARP2_HUMAN	ARP2 actin-related protein 2 homolog (yeast)	19					Arp2/3 complex-mediated actin nucleation (GO:0034314)|asymmetric cell division (GO:0008356)|cellular component movement (GO:0006928)|cilium assembly (GO:0042384)|cytoplasmic transport (GO:0016482)|establishment or maintenance of cell polarity (GO:0007163)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|meiotic chromosome movement towards spindle pole (GO:0016344)|meiotic cytokinesis (GO:0033206)|spindle localization (GO:0051653)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ATP binding (GO:0005524)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)	12						CCAGTTTGTGAAGTGTGGATA	0.348																																					p.K19E		Atlas-SNP	.											.	ACTR2	30	.	0			c.A55G						.						105.0	100.0	102.0					2																	65466992		2203	4300	6503	SO:0001583	missense	10097	exon2			TTTGTGAAGTGTG	AF006082	CCDS1881.1, CCDS46307.1	2p14	2008-05-20	2001-11-28		ENSG00000138071	ENSG00000138071			169	protein-coding gene	gene with protein product		604221	"""ARP2 (actin-related protein 2, yeast) homolog"""			9230079	Standard	NM_001005386		Approved	ARP2	uc002sdp.3	P61160	OTTHUMG00000129540	ENST00000260641.5:c.55A>G	chr2.hg19:g.65466992A>G	ENSP00000260641:p.Lys19Glu	104.0	0.0		93.0	4.0	NM_001005386	B2RCP5|D6W5F4|E9PF41|O15142|Q96C82	Missense_Mutation	SNP	ENST00000260641.5	hg19	CCDS1881.1	.	.	.	.	.	.	.	.	.	.	A	32	5.174135	0.94807	.	.	ENSG00000138071	ENST00000260641;ENST00000377982	D;D	0.96522	-4.04;-4.04	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	D	0.99184	0.9717	H	0.99859	4.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98609	1.0662	10	0.87932	D	0	-15.4274	16.5764	0.84681	1.0:0.0:0.0:0.0	.	19;19	P61160;E9PF41	ARP2_HUMAN;.	E	19	ENSP00000260641:K19E;ENSP00000367220:K19E	ENSP00000260641:K19E	K	+	1	0	ACTR2	65320496	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.287000	0.95975	2.371000	0.80710	0.533000	0.62120	AAG	.	.		0.348	ACTR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251730.1	NM_001005386	
ETAA1	54465	hgsc.bcm.edu	37	2	67632242	67632242	+	Missense_Mutation	SNP	A	A	G	rs375345566		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:67632242A>G	ENST00000272342.5	+	5	2558	c.2428A>G	c.(2428-2430)Agc>Ggc	p.S810G	ETAA1_ENST00000462772.1_3'UTR	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	810						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						TGAAGCTCAGAGCAACCTTAA	0.313																																					p.S810G		Atlas-SNP	.											.	ETAA1	88	.	0			c.A2428G						.						56.0	57.0	56.0					2																	67632242		2202	4300	6502	SO:0001583	missense	54465	exon5			GCTCAGAGCAACC	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2428A>G	chr2.hg19:g.67632242A>G	ENSP00000272342:p.Ser810Gly	77.0	0.0		73.0	5.0	NM_019002	Q05BT7|Q53SC4	Missense_Mutation	SNP	ENST00000272342.5	hg19	CCDS1882.1	.	.	.	.	.	.	.	.	.	.	A	10.32	1.318020	0.23994	.	.	ENSG00000143971	ENST00000272342	T	0.19532	2.14	5.39	0.0662	0.14360	.	0.825195	0.11209	N	0.587906	T	0.16811	0.0404	L	0.54323	1.7	0.09310	N	1	B	0.14438	0.01	B	0.12156	0.007	T	0.29640	-1.0005	10	0.48119	T	0.1	-11.9774	2.8321	0.05503	0.5576:0.1269:0.0708:0.2447	.	810	Q9NY74	ETAA1_HUMAN	G	810	ENSP00000272342:S810G	ENSP00000272342:S810G	S	+	1	0	ETAA1	67485746	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.940000	0.28992	0.397000	0.25310	-0.313000	0.08912	AGC	.	.		0.313	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
EXOC6B	23233	hgsc.bcm.edu	37	2	72707813	72707813	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:72707813T>C	ENST00000272427.6	-	17	1862	c.1732A>G	c.(1732-1734)Acc>Gcc	p.T578A	EXOC6B_ENST00000410104.1_Missense_Mutation_p.T578A	NM_015189.1	NP_056004.1	Q9Y2D4	EXC6B_HUMAN	exocyst complex component 6B	578					protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)	exocyst (GO:0000145)				breast(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	10						GTGATGTTGGTGATAAATTCT	0.383																																					p.T578A		Atlas-SNP	.											.	EXOC6B	93	.	0			c.A1732G						.						86.0	88.0	87.0					2																	72707813		1887	4114	6001	SO:0001583	missense	23233	exon17			TGTTGGTGATAAA	AB023136	CCDS46333.1	2p13.2	2013-01-22	2006-11-07	2006-11-07	ENSG00000144036	ENSG00000144036			17085	protein-coding gene	gene with protein product		607880	"""SEC15-like 2 (S. cerevisiae)"", ""SEC15 homolog B (S. cerevisiae)"""	SEC15L2, SEC15B		10231032, 11406615	Standard	NM_015189		Approved	KIAA0919	uc010fep.3	Q9Y2D4	OTTHUMG00000152723	ENST00000272427.6:c.1732A>G	chr2.hg19:g.72707813T>C	ENSP00000272427:p.Thr578Ala	111.0	0.0		76.0	4.0	NM_015189	B8ZZY3	Missense_Mutation	SNP	ENST00000272427.6	hg19	CCDS46333.1	.	.	.	.	.	.	.	.	.	.	T	14.34	2.505127	0.44558	.	.	ENSG00000144036	ENST00000272427;ENST00000410104;ENST00000290144	T;T	0.28069	1.63;1.63	5.07	5.07	0.68467	.	0.069207	0.64402	D	0.000015	T	0.29817	0.0745	L	0.56769	1.78	0.49798	D	0.999821	B;B	0.33345	0.409;0.321	B;B	0.38755	0.172;0.281	T	0.06954	-1.0798	10	0.02654	T	1	.	12.7493	0.57300	0.0:0.0:0.0:1.0	.	578;578	Q9Y2D4;Q9Y2D4-2	EXC6B_HUMAN;.	A	578	ENSP00000272427:T578A;ENSP00000386698:T578A	ENSP00000272427:T578A	T	-	1	0	EXOC6B	72561321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.197000	0.42696	1.906000	0.55180	0.496000	0.49642	ACC	.	.		0.383	EXOC6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327558.1	XM_039570	
DNAH6	1768	hgsc.bcm.edu	37	2	84924794	84924794	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:84924794A>G	ENST00000237449.6	+	46	7628	c.7620A>G	c.(7618-7620)ttA>ttG	p.L2540L	DNAH6_ENST00000602588.1_Silent_p.L512L|DNAH6_ENST00000398278.2_Silent_p.L2491L|DNAH6_ENST00000389394.3_Silent_p.L2540L			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	2540	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						AGCAGGTTTTAGCGGCCACCA	0.423																																					p.L2540L		Atlas-SNP	.											.	DNAH6	194	.	0			c.A7620G						.						127.0	119.0	121.0					2																	84924794		692	1591	2283	SO:0001819	synonymous_variant	1768	exon47			GGTTTTAGCGGCC	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.7620A>G	chr2.hg19:g.84924794A>G		83.0	0.0		64.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Silent	SNP	ENST00000237449.6	hg19	CCDS46348.1																																																																																			.	.		0.423	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
PTCD3	55037	hgsc.bcm.edu	37	2	86348628	86348628	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:86348628A>G	ENST00000254630.7	+	8	631	c.565A>G	c.(565-567)Aat>Gat	p.N189D	PTCD3_ENST00000409277.3_Silent_p.Q147Q|PTCD3_ENST00000465560.1_3'UTR	NM_017952.5	NP_060422.4	Q96EY7	PTCD3_HUMAN	pentatricopeptide repeat domain 3	189					mitochondrial translation (GO:0032543)|regulation of translation (GO:0006417)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|rRNA binding (GO:0019843)			NS(1)|breast(2)|endometrium(3)|kidney(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)	22						TGAAACAACAAATAGTCTCTT	0.378																																					p.N189D		Atlas-SNP	.											.	PTCD3	51	.	0			c.A565G						.						118.0	112.0	114.0					2																	86348628		2203	4300	6503	SO:0001583	missense	55037	exon8			ACAACAAATAGTC		CCDS33235.1	2p11.2	2014-02-12	2012-02-24		ENSG00000132300	ENSG00000132300			24717	protein-coding gene	gene with protein product		614918				8889548	Standard	NM_017952		Approved	FLJ20758, DKFZp666K071	uc002sqw.2	Q96EY7	OTTHUMG00000153168	ENST00000254630.7:c.565A>G	chr2.hg19:g.86348628A>G	ENSP00000254630:p.Asn189Asp	116.0	0.0		98.0	4.0	NM_017952	A6NHD2|D6W5M1|Q597H0|Q658Y9|Q9BUZ8|Q9NWL0	Missense_Mutation	SNP	ENST00000254630.7	hg19	CCDS33235.1	.	.	.	.	.	.	.	.	.	.	A	16.91	3.253542	0.59212	.	.	ENSG00000132300	ENST00000254630	T	0.31769	1.48	5.14	5.14	0.70334	.	0.228496	0.50627	D	0.000108	T	0.30978	0.0782	M	0.64567	1.98	0.80722	D	1	P	0.38617	0.64	B	0.32980	0.156	T	0.17018	-1.0383	10	0.52906	T	0.07	-12.0355	14.2408	0.65956	1.0:0.0:0.0:0.0	.	189	Q96EY7	PTCD3_HUMAN	D	189	ENSP00000254630:N189D	ENSP00000254630:N189D	N	+	1	0	PTCD3	86202139	1.000000	0.71417	0.976000	0.42696	0.961000	0.63080	4.593000	0.61034	2.054000	0.61138	0.533000	0.62120	AAT	.	.		0.378	PTCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329854.1	NM_017952	
FER1L5	90342	hgsc.bcm.edu	37	2	97365352	97365352	+	RNA	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:97365352A>G	ENST00000457909.1	+	0	4179							A0AVI2	FR1L5_HUMAN	fer-1-like family member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(9)|large_intestine(9)|lung(6)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	38						TATGACTTCGACCTATTTTCA	0.488																																					p.D1586G		Atlas-SNP	.											.	FER1L5	113	.	0			c.A4757G						.						239.0	237.0	238.0					2																	97365352		1969	4146	6115			90342	exon42			ACTTCGACCTATT	BC126368		2q11.2	2014-06-27	2014-06-27		ENSG00000249715	ENSG00000249715			19044	protein-coding gene	gene with protein product			"""fer-1-like 5 (C. elegans)"""				Standard	XM_006712826		Approved	DKFZp434I0121	uc010fia.3	A0AVI2	OTTHUMG00000154929		chr2.hg19:g.97365352A>G		105.0	0.0		106.0	5.0	NM_001113382	Q17RH2|Q6ZU24	Missense_Mutation	SNP	ENST00000457909.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.38	2.517859	0.44763	.	.	ENSG00000214272	ENST00000414152;ENST00000436930;ENST00000397978	.	.	.	5.29	5.29	0.74685	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.47455	U	0.000237	D	0.87912	0.6297	H	0.97390	3.995	.	.	.	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	D	0.92700	0.6174	8	0.87932	D	0	-24.998	14.2097	0.65756	1.0:0.0:0.0:0.0	.	303;1586;304	B7ZLI3;A0AVI2;A0AVI2-2	.;FR1L5_HUMAN;.	G	1586;1599;304	.	ENSP00000442027:D304G	D	+	2	0	FER1L5	96729079	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	9.097000	0.94193	2.006000	0.58801	0.528000	0.53228	GAC	.	.		0.488	FER1L5-001	KNOWN	basic|exp_conf	retained_intron	pseudogene	OTTHUMT00000339030.1	NM_001077400	
DPP10	57628	hgsc.bcm.edu	37	2	116593811	116593811	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:116593811A>C	ENST00000410059.1	+	22	2509	c.2029A>C	c.(2029-2031)Atc>Ctc	p.I677L	DPP10_ENST00000310323.8_Missense_Mutation_p.I670L|DPP10_ENST00000393147.2_Missense_Mutation_p.I681L|DPP10_ENST00000409163.1_Missense_Mutation_p.I627L	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	677						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GGTTGCACCTATCACAGACTT	0.348																																					p.I681L		Atlas-SNP	.											.	DPP10	415	.	0			c.A2041C						.						88.0	85.0	86.0					2																	116593811		2203	4300	6503	SO:0001583	missense	57628	exon22			GCACCTATCACAG	AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.2029A>C	chr2.hg19:g.116593811A>C	ENSP00000386565:p.Ile677Leu	142.0	0.0		118.0	17.0	NM_001178034	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	ENST00000410059.1	hg19	CCDS46400.1	.	.	.	.	.	.	.	.	.	.	A	19.89	3.911273	0.72983	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323	T;T;T;T	0.31510	1.49;1.49;1.49;1.49	5.81	4.65	0.58169	Peptidase S9, prolyl oligopeptidase, catalytic domain (1);	0.117279	0.64402	D	0.000016	T	0.53786	0.1818	L	0.56396	1.775	0.42488	D	0.992886	B;B;B;B	0.25486	0.069;0.127;0.085;0.085	P;P;P;P	0.56751	0.705;0.522;0.751;0.805	T	0.57189	-0.7854	10	0.56958	D	0.05	-9.7773	11.201	0.48741	0.9283:0.0:0.0717:0.0	.	670;681;673;677	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	L	677;627;681;670	ENSP00000386565:I677L;ENSP00000387038:I627L;ENSP00000376855:I681L;ENSP00000309066:I670L	ENSP00000309066:I670L	I	+	1	0	DPP10	116310281	0.999000	0.42202	0.995000	0.50966	0.992000	0.81027	3.883000	0.56168	1.011000	0.39340	0.533000	0.62120	ATC	.	.		0.348	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330580.4	NM_020868	
CNTNAP5	129684	hgsc.bcm.edu	37	2	125192079	125192079	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:125192079T>G	ENST00000431078.1	+	5	912	c.548T>G	c.(547-549)tTt>tGt	p.F183C		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	183	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		GTTGCTGACTTTGATGGCCGA	0.423																																					p.F183C		Atlas-SNP	.											.	CNTNAP5	405	.	0			c.T548G						.						124.0	113.0	117.0					2																	125192079		1921	4125	6046	SO:0001583	missense	129684	exon5			CTGACTTTGATGG	AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.548T>G	chr2.hg19:g.125192079T>G	ENSP00000399013:p.Phe183Cys	232.0	0.0		185.0	86.0	NM_130773	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Missense_Mutation	SNP	ENST00000431078.1	hg19	CCDS46401.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.956074	0.73902	.	.	ENSG00000155052	ENST00000431078	D	0.90732	-2.72	5.48	5.48	0.80851	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.48767	D	0.000162	D	0.95573	0.8561	M	0.91510	3.215	0.80722	D	1	D	0.71674	0.998	P	0.60173	0.87	D	0.96444	0.9329	10	0.87932	D	0	.	14.7735	0.69699	0.0:0.0:0.0:1.0	.	183	Q8WYK1	CNTP5_HUMAN	C	183	ENSP00000399013:F183C	ENSP00000399013:F183C	F	+	2	0	CNTNAP5	124908549	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.896000	0.87350	2.084000	0.62774	0.533000	0.62120	TTT	.	.		0.423	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330864.3		
CCDC148	130940	hgsc.bcm.edu	37	2	159035423	159035423	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:159035423T>C	ENST00000283233.5	-	12	1769	c.1456A>G	c.(1456-1458)Aga>Gga	p.R486G	CCDC148-AS1_ENST00000412781.2_RNA|CCDC148_ENST00000409187.1_Missense_Mutation_p.R495G	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	486										endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						CGCCGTGCTCTCTCTTTGTCT	0.363																																					p.R486G		Atlas-SNP	.											.	CCDC148	64	.	0			c.A1456G						.						94.0	94.0	94.0					2																	159035423		2203	4300	6503	SO:0001583	missense	130940	exon12			GTGCTCTCTCTTT		CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.1456A>G	chr2.hg19:g.159035423T>C	ENSP00000283233:p.Arg486Gly	91.0	0.0		89.0	4.0	NM_138803	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Missense_Mutation	SNP	ENST00000283233.5	hg19	CCDS33304.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.526812	0.44969	.	.	ENSG00000153237	ENST00000283233;ENST00000409187	T;T	0.33216	1.43;1.42	5.71	5.71	0.89125	.	.	.	.	.	T	0.36690	0.0976	L	0.27053	0.805	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.59357	0.856;0.813	T	0.18335	-1.0340	9	0.62326	D	0.03	-11.812	10.8974	0.47031	0.0:0.0:0.1573:0.8427	.	495;486	B8ZZV3;Q8NFR7	.;CC148_HUMAN	G	486;495	ENSP00000283233:R486G;ENSP00000386674:R495G	ENSP00000283233:R486G	R	-	1	2	CCDC148	158743669	0.985000	0.35326	1.000000	0.80357	0.282000	0.26991	2.011000	0.40922	2.178000	0.69098	0.533000	0.62120	AGA	.	.		0.363	CCDC148-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333270.1	NM_138803	
GALNT3	2591	hgsc.bcm.edu	37	2	166613715	166613715	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:166613715C>T	ENST00000392701.3	-	7	2009	c.1234G>A	c.(1234-1236)Gtt>Att	p.V412I	GALNT3_ENST00000409882.1_Missense_Mutation_p.V150I	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	412	Catalytic subdomain B.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TGTCCAACAACAGAGCAAGGC	0.398																																					p.V412I		Atlas-SNP	.											.	GALNT3	65	.	0			c.G1234A						.						110.0	104.0	106.0					2																	166613715		2203	4300	6503	SO:0001583	missense	2591	exon7			CAACAACAGAGCA		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1234G>A	chr2.hg19:g.166613715C>T	ENSP00000376465:p.Val412Ile	86.0	0.0		89.0	4.0	NM_004482	Q53TG9|Q7Z476	Missense_Mutation	SNP	ENST00000392701.3	hg19	CCDS2226.1	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754872	0.49362	.	.	ENSG00000115339	ENST00000392701;ENST00000409882;ENST00000412248	T;T;T	0.62941	-0.01;-0.01;-0.01	5.9	5.9	0.94986	.	0.122271	0.56097	D	0.000033	T	0.59252	0.2180	L	0.45581	1.43	0.53005	D	0.999962	B	0.14012	0.009	B	0.18561	0.022	T	0.51340	-0.8718	10	0.25751	T	0.34	.	20.2626	0.98452	0.0:1.0:0.0:0.0	.	412	Q14435	GALT3_HUMAN	I	412;150;412	ENSP00000376465:V412I;ENSP00000386955:V150I;ENSP00000412643:V412I	ENSP00000376465:V412I	V	-	1	0	GALNT3	166321961	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.372000	0.44257	2.802000	0.96397	0.650000	0.86243	GTT	.	.		0.398	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482	
BBS5	129880	hgsc.bcm.edu	37	2	170343593	170343593	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:170343593A>G	ENST00000295240.3	+	3	533	c.157A>G	c.(157-159)Aca>Gca	p.T53A	BBS5_ENST00000392663.2_Missense_Mutation_p.T53A|RP11-724O16.1_ENST00000513963.1_Missense_Mutation_p.T53A|BBS5_ENST00000554017.1_Missense_Mutation_p.T53A	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5	53					cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						ACTCTTGGTAACAAATTTAAG	0.343									Bardet-Biedl syndrome																												p.T53A		Atlas-SNP	.											.	BBS5	27	.	0			c.A157G						.						175.0	182.0	180.0					2																	170343593		2203	4300	6503	SO:0001583	missense	129880	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TTGGTAACAAATT	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.157A>G	chr2.hg19:g.170343593A>G	ENSP00000295240:p.Thr53Ala	87.0	0.0		83.0	4.0	NM_152384	D3DPC3|Q6PKN0	Missense_Mutation	SNP	ENST00000295240.3	hg19	CCDS2233.1	.	.	.	.	.	.	.	.	.	.	A	26.4	4.734544	0.89482	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	D	0.91147	0.7212	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.985;0.996;0.998	D	0.92831	0.6280	10	0.87932	D	0	-16.5329	15.6945	0.77484	1.0:0.0:0.0:0.0	.	53;53;53	E9PBE3;Q8N3I7-2;Q8N3I7	.;.;BBS5_HUMAN	A	53	ENSP00000295240:T53A;ENSP00000452313:T53A;ENSP00000376431:T53A;ENSP00000424363:T53A	ENSP00000295240:T53A	T	+	1	0	BBS5;RP11-724O16.1	170051839	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.012000	0.93624	2.094000	0.63399	0.533000	0.62120	ACA	.	.		0.343	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384	
TTN	7273	hgsc.bcm.edu	37	2	179401122	179401122	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:179401122A>G	ENST00000591111.1	-	307	95653	c.95429T>C	c.(95428-95430)gTc>gCc	p.V31810A	TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000590040.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V24578A|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V33451A|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V30883A|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.V24386A|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V24511A|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000415561.1_RNA|TTN-AS1_ENST00000450692.2_RNA			Q8WZ42	TITIN_HUMAN	titin	31810	Fibronectin type-III 131. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTGAAAAGACAGTTTCTCG	0.378																																					p.V33451A		Atlas-SNP	.											.	TTN	18412	.	0			c.T100352C						.						80.0	77.0	78.0					2																	179401122		1855	4102	5957	SO:0001583	missense	7273	exon357			GAAAAGACAGTTT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.95429T>C	chr2.hg19:g.179401122A>G	ENSP00000465570:p.Val31810Ala	119.0	0.0		99.0	4.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.65	2.599264	0.46318	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55930	0.49;0.49;0.49;0.49	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.48750	0.1517	N	0.16708	0.43	0.42993	D	0.994499	P;P;P;P	0.48503	0.835;0.835;0.835;0.911	P;P;P;P	0.49752	0.468;0.468;0.468;0.621	T	0.56420	-0.7982	9	0.87932	D	0	.	16.0677	0.80897	1.0:0.0:0.0:0.0	.	24386;24511;24578;31810	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	A	30883;24386;24578;24511;24383	ENSP00000343764:V30883A;ENSP00000434586:V24386A;ENSP00000340554:V24578A;ENSP00000352154:V24511A	ENSP00000340554:V24578A	V	-	2	0	TTN	179109368	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.088000	0.50175	2.185000	0.69588	0.460000	0.39030	GTC	.	.		0.378	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179648880	179648880	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:179648880C>T	ENST00000591111.1	-	16	2916	c.2692G>A	c.(2692-2694)Gtg>Atg	p.V898M	TTN_ENST00000342175.6_Missense_Mutation_p.V852M|TTN_ENST00000589042.1_Missense_Mutation_p.V898M|TTN_ENST00000342992.6_Missense_Mutation_p.V898M|TTN_ENST00000460472.2_Missense_Mutation_p.V852M|TTN_ENST00000359218.5_Missense_Mutation_p.V852M|TTN_ENST00000360870.5_Missense_Mutation_p.V898M			Q8WZ42	TITIN_HUMAN	titin	33935					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTTTTTCACCTCAACGCCA	0.552																																					p.V898M		Atlas-SNP	.											.	TTN	18412	.	0			c.G2692A						.						159.0	126.0	137.0					2																	179648880		2203	4300	6503	SO:0001583	missense	7273	exon16			TTTTCACCTCAAC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.2692G>A	chr2.hg19:g.179648880C>T	ENSP00000465570:p.Val898Met	256.0	0.0		259.0	12.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	C	12.79	2.042797	0.36085	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.63580	-0.05;0.21;0.2;0.18;0.32	5.52	5.52	0.82312	Ribonuclease H-like (1);	.	.	.	.	T	0.62841	0.2461	L	0.29908	0.895	0.22468	N	0.999075	P;P;P;P;D	0.59357	0.868;0.868;0.868;0.868;0.985	B;B;B;B;P	0.58391	0.38;0.38;0.38;0.38;0.838	T	0.56721	-0.7932	9	0.87932	D	0	.	7.5186	0.27614	0.0:0.802:0.0:0.198	.	852;852;852;898;898	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	M	898;852;852;852;852;898	ENSP00000343764:V898M;ENSP00000434586:V852M;ENSP00000340554:V852M;ENSP00000352154:V852M;ENSP00000354117:V898M	ENSP00000340554:V852M	V	-	1	0	TTN	179357125	0.999000	0.42202	1.000000	0.80357	0.752000	0.42762	1.504000	0.35726	2.767000	0.95098	0.655000	0.94253	GTG	.	.		0.552	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
NDUFS1	4719	hgsc.bcm.edu	37	2	207008850	207008850	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:207008850G>A	ENST00000233190.6	-	10	1145	c.879C>T	c.(877-879)gcC>gcT	p.A293A	NDUFS1_ENST00000440274.1_Silent_p.A257A|NDUFS1_ENST00000455934.2_Silent_p.A307A|NDUFS1_ENST00000457011.1_Silent_p.A177A|NDUFS1_ENST00000432169.1_Silent_p.A182A|NDUFS1_ENST00000449699.1_Silent_p.A293A|NDUFS1_ENST00000423725.1_Silent_p.A236A	NM_005006.6	NP_004997.4	P28331	NDUS1_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 1, 75kDa (NADH-coenzyme Q reductase)	293	4Fe-4S Mo/W bis-MGD-type. {ECO:0000255|PROSITE-ProRule:PRU01004}.				apoptotic mitochondrial changes (GO:0008637)|ATP metabolic process (GO:0046034)|cellular metabolic process (GO:0044237)|cellular respiration (GO:0045333)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|reactive oxygen species metabolic process (GO:0072593)|regulation of mitochondrial membrane potential (GO:0051881)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)	2 iron, 2 sulfur cluster binding (GO:0051537)|4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(15)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GCCCATCATAGGCAAATCTAG	0.358																																					p.A307A		Atlas-SNP	.											.	NDUFS1	82	.	0			c.C921T						.						90.0	88.0	88.0					2																	207008850		2203	4300	6503	SO:0001819	synonymous_variant	4719	exon10			ATCATAGGCAAAT		CCDS2366.1, CCDS56162.1, CCDS56163.1, CCDS56164.1, CCDS56165.1	2q33-q34	2011-07-04	2002-08-29		ENSG00000023228	ENSG00000023228	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7707	protein-coding gene	gene with protein product	"""complex I 75kDa subunit"", ""NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial"""	157655	"""NADH dehydrogenase (ubiquinone) Fe-S protein 1 (75kD) (NADH-coenzyme Q reductase)"""			1935949	Standard	NM_005006		Approved	CI-75k	uc010ziq.2	P28331	OTTHUMG00000132892	ENST00000233190.6:c.879C>T	chr2.hg19:g.207008850G>A		84.0	0.0		67.0	4.0	NM_001199984	B4DIN9|B4DJA0|B4DPG1|B4DUC1|E7ENF3|Q53TR8|Q8N1C4|Q8TCC9	Silent	SNP	ENST00000233190.6	hg19	CCDS2366.1																																																																																			.	.		0.358	NDUFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256391.4	NM_005006	
UNC80	285175	hgsc.bcm.edu	37	2	210761117	210761117	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:210761117A>G	ENST00000439458.1	+	27	4443	c.4363A>G	c.(4363-4365)Aga>Gga	p.R1455G	UNC80_ENST00000272845.6_Missense_Mutation_p.R1450G	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1455					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GAATTACCACAGAAACATGTC	0.483																																					p.R1455G		Atlas-SNP	.											.	UNC80	280	.	0			c.A4363G						.						120.0	114.0	116.0					2																	210761117		692	1591	2283	SO:0001583	missense	285175	exon27			TACCACAGAAACA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.4363A>G	chr2.hg19:g.210761117A>G	ENSP00000391088:p.Arg1455Gly	98.0	0.0		93.0	5.0	NM_032504	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	A	16.05	3.012867	0.54468	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.32023	1.47;1.47	5.9	3.38	0.38709	.	0.054098	0.64402	D	0.000001	T	0.25644	0.0624	L	0.43152	1.355	0.80722	D	1	B	0.30281	0.275	B	0.24155	0.051	T	0.11131	-1.0600	10	0.72032	D	0.01	-19.3615	12.7213	0.57144	0.4978:0.5022:0.0:0.0	.	1455	Q8N2C7	UNC80_HUMAN	G	1455;1450	ENSP00000391088:R1455G;ENSP00000272845:R1450G	ENSP00000272845:R1450G	R	+	1	2	UNC80	210469362	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.131000	0.31406	1.047000	0.40274	-0.313000	0.08912	AGA	.	.		0.483	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
MREG	55686	hgsc.bcm.edu	37	2	216861060	216861060	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:216861060A>G	ENST00000263268.6	-	2	519	c.224T>C	c.(223-225)gTc>gCc	p.V75A		NM_018000.2	NP_060470.2	Q8N565	MREG_HUMAN	melanoregulin	75						plasma membrane (GO:0005886)				large_intestine(1)|lung(2)	3		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)		ATTACGAATGACTATCAAATT	0.448																																					p.V75A		Atlas-SNP	.											.	MREG	10	.	0			c.T224C						.						106.0	107.0	107.0					2																	216861060		1933	4139	6072	SO:0001583	missense	55686	exon2			CGAATGACTATCA	AK000978	CCDS46513.1	2q35	2013-09-27			ENSG00000118242	ENSG00000118242			25478	protein-coding gene	gene with protein product		609207				19240024, 22275436	Standard	NM_018000		Approved	FLJ10116, DSU, WDT2	uc002vfo.3	Q8N565	OTTHUMG00000154828	ENST00000263268.6:c.224T>C	chr2.hg19:g.216861060A>G	ENSP00000263268:p.Val75Ala	93.0	0.0		85.0	5.0	NM_018000	Q53R89|Q53TC1|Q5XKB6|Q9NWC9|Q9P1S1	Missense_Mutation	SNP	ENST00000263268.6	hg19	CCDS46513.1	.	.	.	.	.	.	.	.	.	.	A	12.18	1.860193	0.32884	.	.	ENSG00000118242	ENST00000236976;ENST00000263268;ENST00000439791;ENST00000424992;ENST00000420348	T	0.43688	0.94	5.33	5.33	0.75918	.	0.380247	0.31484	N	0.007577	T	0.31482	0.0798	L	0.44542	1.39	0.39279	D	0.964533	B	0.29590	0.25	B	0.26969	0.075	T	0.17992	-1.0351	10	0.24483	T	0.36	-11.4091	8.6043	0.33764	0.8293:0.0:0.0:0.1707	.	75	Q8N565	MREG_HUMAN	A	75;75;21;21;21	ENSP00000263268:V75A	ENSP00000236976:V75A	V	-	2	0	MREG	216569305	0.513000	0.26194	0.848000	0.33437	0.986000	0.74619	3.225000	0.51246	2.244000	0.73946	0.528000	0.53228	GTC	.	.		0.448	MREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337297.1	NM_018000	
PSMD1	5707	hgsc.bcm.edu	37	2	232028362	232028362	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:232028362A>G	ENST00000308696.6	+	21	2564	c.2402A>G	c.(2401-2403)cAg>cGg	p.Q801R	PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000373635.4_Intron	NM_002807.3	NP_002798.2	Q99460	PSMD1_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 1	801					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)	31		Ovarian(221;0.000626)|Medulloblastoma(418;0.0109)|Renal(207;0.0112)|Lung NSC(271;0.0538)|all_lung(227;0.0713)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;4e-26)|LUSC - Lung squamous cell carcinoma(224;0.0138)|Lung(119;0.0168)	Bortezomib(DB00188)	CCGAAAGTTCAGTATAAATCG	0.373																																					p.Q801R		Atlas-SNP	.											.	PSMD1	77	.	0			c.A2402G						.						110.0	108.0	109.0					2																	232028362		2203	4300	6503	SO:0001583	missense	5707	exon21			AAGTTCAGTATAA	D44466	CCDS2482.1, CCDS54436.1	2q37.1	2008-05-22			ENSG00000173692	ENSG00000173692		"""Proteasome (prosome, macropain) subunits"""	9554	protein-coding gene	gene with protein product						8816993	Standard	NM_002807		Approved	S1, P112, Rpn2	uc002vrn.2	Q99460	OTTHUMG00000133223	ENST00000308696.6:c.2402A>G	chr2.hg19:g.232028362A>G	ENSP00000309474:p.Gln801Arg	80.0	0.0		75.0	4.0	NM_002807	B8ZZH9|Q24JU0|Q53TI2|Q6GMU5|Q6P2P4|Q6PJM7|Q6PKG9|Q86VU1|Q8IV79	Missense_Mutation	SNP	ENST00000308696.6	hg19	CCDS2482.1	.	.	.	.	.	.	.	.	.	.	A	17.08	3.297464	0.60086	.	.	ENSG00000173692	ENST00000308696	.	.	.	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.55305	0.1912	L	0.42686	1.345	0.80722	D	1	B	0.22211	0.066	B	0.22753	0.041	T	0.54589	-0.8271	9	0.44086	T	0.13	-12.0276	14.5377	0.67973	1.0:0.0:0.0:0.0	.	801	Q99460	PSMD1_HUMAN	R	801	.	ENSP00000309474:Q801R	Q	+	2	0	PSMD1	231736606	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.139000	0.94554	2.002000	0.58637	0.454000	0.30748	CAG	.	.		0.373	PSMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256958.2		
AGXT	189	hgsc.bcm.edu	37	2	241813472	241813472	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr2:241813472A>G	ENST00000307503.3	+	6	1060	c.673A>G	c.(673-675)Aag>Gag	p.K225E		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	225					cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	CTTCAGTGACAAGGCCAAGTG	0.647																																					p.K225E		Atlas-SNP	.											AGXT,NS,adenoma,0,1	AGXT	50	.	0			c.A673G						.						79.0	71.0	74.0					2																	241813472		2203	4300	6503	SO:0001583	missense	189	exon6			AGTGACAAGGCCA	D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.673A>G	chr2.hg19:g.241813472A>G	ENSP00000302620:p.Lys225Glu	69.0	1.0		79.0	4.0	NM_000030	Q53QU6	Missense_Mutation	SNP	ENST00000307503.3	hg19	CCDS2543.1	.	.	.	.	.	.	.	.	.	.	A	13.80	2.343753	0.41498	.	.	ENSG00000172482	ENST00000307503	D	0.93076	-3.16	4.1	4.1	0.47936	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.271874	0.41294	D	0.000904	D	0.91355	0.7273	L	0.58925	1.835	0.39174	D	0.96264	B	0.26195	0.144	B	0.32289	0.143	D	0.90652	0.4583	10	0.62326	D	0.03	-25.1712	10.5155	0.44887	0.8247:0.1752:0.0:0.0	.	225	P21549	SPYA_HUMAN	E	225	ENSP00000302620:K225E	ENSP00000302620:K225E	K	+	1	0	AGXT	241462145	0.272000	0.24172	0.998000	0.56505	0.507000	0.33981	1.577000	0.36515	1.634000	0.50500	0.472000	0.43445	AAG	.	.		0.647	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257186.1	NM_000030	
CNTN6	27255	hgsc.bcm.edu	37	3	1337367	1337367	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:1337367A>G	ENST00000446702.2	+	6	1164	c.537A>G	c.(535-537)ggA>ggG	p.G179G	CNTN6_ENST00000539053.1_Silent_p.G107G|CNTN6_ENST00000350110.2_Silent_p.G179G			Q9UQ52	CNTN6_HUMAN	contactin 6	179	Ig-like C2-type 2.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		AAGAGACGGGAAACTTGTACA	0.418																																					p.G179G		Atlas-SNP	.											.	CNTN6	245	.	0			c.A537G						.						105.0	96.0	99.0					3																	1337367		2203	4300	6503	SO:0001819	synonymous_variant	27255	exon6			GACGGGAAACTTG	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.537A>G	chr3.hg19:g.1337367A>G		123.0	0.0		78.0	4.0	NM_014461	Q2KHM2	Silent	SNP	ENST00000446702.2	hg19	CCDS2557.1																																																																																			.	.		0.418	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
CNTN4	152330	hgsc.bcm.edu	37	3	3097904	3097904	+	Nonstop_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:3097904A>G	ENST00000397461.1	+	24	3465	c.3081A>G	c.(3079-3081)tgA>tgG	p.*1027W	CNTN4_ENST00000427331.1_Nonstop_Mutation_p.*1027W|CNTN4-AS1_ENST00000442749.2_RNA|CNTN4_ENST00000448906.2_Nonstop_Mutation_p.*699W|CNTN4_ENST00000358480.3_Nonstop_Mutation_p.*808W|CNTN4_ENST00000397459.2_Nonstop_Mutation_p.*699W|CNTN4_ENST00000418658.1_Nonstop_Mutation_p.*1027W	NM_001206955.1	NP_001193884.1	Q8IWV2	CNTN4_HUMAN	contactin 4	0					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|brain development (GO:0007420)|negative regulation of neuron differentiation (GO:0045665)|nervous system development (GO:0007399)|neuron cell-cell adhesion (GO:0007158)|neuron projection development (GO:0031175)|regulation of synaptic plasticity (GO:0048167)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)		p.*699W(1)|p.*1027W(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(19)|ovary(2)|pancreas(4)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Ovarian(110;0.156)		Epithelial(13;0.000695)|all cancers(10;0.0047)|OV - Ovarian serous cystadenocarcinoma(96;0.01)		CCAGTTTATGACAAAAGTTAT	0.398																																					p.X1027W		Atlas-SNP	.											CNTN4_ENST00000418658,rectum,carcinoma,0,2	CNTN4	335	.	2	Nonstop extension(2)	large_intestine(2)	c.A3081G						.						103.0	92.0	95.0					3																	3097904		2203	4300	6503	SO:0001578	stop_lost	152330	exon25			TTTATGACAAAAG	AW665944	CCDS2558.1, CCDS43041.1	3p26.3	2013-02-11			ENSG00000144619	ENSG00000144619		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2174	protein-coding gene	gene with protein product		607280				8586965, 12202991	Standard	NM_175607		Approved	BIG-2	uc003bpc.3	Q8IWV2	OTTHUMG00000119031	ENST00000397461.1:c.3081A>G	chr3.hg19:g.3097904A>G	ENSP00000380602:p.*1027Trpext*16	74.0	0.0		48.0	2.0	NM_175607	B2RAX3|Q8IX14|Q8TC35	Missense_Mutation	SNP	ENST00000397461.1	hg19	CCDS43041.1	.	.	.	.	.	.	.	.	.	.	A	15.37	2.813180	0.50527	.	.	ENSG00000144619	ENST00000418658;ENST00000397461;ENST00000427331;ENST00000358480;ENST00000397459;ENST00000448906	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6012	0.76626	1.0:0.0:0.0:0.0	.	.	.	.	W	1027;1027;1027;808;699;699	.	.	X	+	3	0	CNTN4	3072904	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	8.167000	0.89668	2.094000	0.63399	0.482000	0.46254	TGA	.	.		0.398	CNTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239236.2		
CAND2	23066	hgsc.bcm.edu	37	3	12858556	12858556	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:12858556C>T	ENST00000456430.2	+	10	2166	c.2125C>T	c.(2125-2127)Cat>Tat	p.H709Y	CAND2_ENST00000295989.5_Missense_Mutation_p.H616Y	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	709					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						GAGCGACATGCATGTGGCCCA	0.677																																					p.H709Y	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.C2125T						.						27.0	28.0	28.0					3																	12858556		2162	4266	6428	SO:0001583	missense	23066	exon10			GACATGCATGTGG		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.2125C>T	chr3.hg19:g.12858556C>T	ENSP00000387641:p.His709Tyr	81.0	0.0		88.0	4.0	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	hg19	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112438	0.77210	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.52057	0.68;0.68	4.98	4.98	0.66077	Armadillo-like helical (1);Armadillo-type fold (1);	0.057587	0.64402	D	0.000002	T	0.71871	0.3391	M	0.87758	2.905	0.80722	D	1	D;D	0.76494	0.999;0.962	D;D	0.72982	0.979;0.946	T	0.75269	-0.3377	10	0.45353	T	0.12	-41.4719	16.104	0.81205	0.0:1.0:0.0:0.0	.	709;616	O75155;O75155-2	CAND2_HUMAN;.	Y	616;709	ENSP00000295989:H616Y;ENSP00000387641:H709Y	ENSP00000295989:H616Y	H	+	1	0	CAND2	12833556	1.000000	0.71417	0.990000	0.47175	0.953000	0.61014	5.875000	0.69660	2.451000	0.82905	0.561000	0.74099	CAT	.	.		0.677	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
ZNF860	344787	hgsc.bcm.edu	37	3	32030646	32030646	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:32030646T>C	ENST00000360311.4	+	2	624	c.75T>C	c.(73-75)acT>acC	p.T25T		NM_001137674.2	NP_001131146.2	A6NHJ4	ZN860_HUMAN	zinc finger protein 860	25	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(4)|ovary(1)	8						GACACTTGACTTTTAGGGATG	0.478																																					p.T25T		Atlas-SNP	.											.	ZNF860	96	.	0			c.T75C						.						48.0	44.0	45.0					3																	32030646		692	1591	2283	SO:0001819	synonymous_variant	344787	exon2			CTTGACTTTTAGG	AK294003	CCDS46784.1	3p24.1	2013-01-08			ENSG00000197385	ENSG00000197385		"""Zinc fingers, C2H2-type"", ""-"""	34513	protein-coding gene	gene with protein product							Standard	NM_001137674		Approved		uc011axg.2	A6NHJ4	OTTHUMG00000155838	ENST00000360311.4:c.75T>C	chr3.hg19:g.32030646T>C		135.0	0.0		72.0	4.0	NM_001137674	B4DFA4	Silent	SNP	ENST00000360311.4	hg19	CCDS46784.1																																																																																			.	.		0.478	ZNF860-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341957.1		
GLB1	2720	hgsc.bcm.edu	37	3	33110429	33110429	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:33110429T>C	ENST00000399402.3	-	3	320	c.189A>G	c.(187-189)ccA>ccG	p.P63P	GLB1_ENST00000445488.2_Silent_p.P141P|GLB1_ENST00000307377.8_Intron|GLB1_ENST00000307363.5_Silent_p.P93P	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	93					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				GGTACTGTCCTGGCCAGGGCT	0.532																																					p.P93P		Atlas-SNP	.											.	GLB1	51	.	0			c.A279G						.						102.0	101.0	101.0					3																	33110429		1950	4142	6092	SO:0001819	synonymous_variant	2720	exon3			CTGTCCTGGCCAG	M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.189A>G	chr3.hg19:g.33110429T>C		136.0	0.0		95.0	4.0	NM_000404	B2R7H8|B7Z6B0|P16279	Silent	SNP	ENST00000399402.3	hg19	CCDS43062.1																																																																																			.	.		0.532	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000341570.2	NM_000404	
XIRP1	165904	hgsc.bcm.edu	37	3	39226588	39226588	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:39226588A>G	ENST00000340369.3	-	2	4577	c.4349T>C	c.(4348-4350)aTg>aCg	p.M1450T	XIRP1_ENST00000421646.1_Missense_Mutation_p.M133T|XIRP1_ENST00000396251.1_3'UTR	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	1450					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		GGAACCTTCCATGGGCTGCTC	0.627																																					p.M1450T		Atlas-SNP	.											.	XIRP1	173	.	0			c.T4349C						.						53.0	65.0	61.0					3																	39226588		2203	4300	6503	SO:0001583	missense	165904	exon2			CCTTCCATGGGCT	AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.4349T>C	chr3.hg19:g.39226588A>G	ENSP00000343140:p.Met1450Thr	64.0	0.0		49.0	14.0	NM_194293	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	ENST00000340369.3	hg19	CCDS2683.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.300437	0.23650	.	.	ENSG00000168334	ENST00000340369;ENST00000421646	T;T	0.20069	3.77;2.1	4.33	-8.67	0.00863	.	1.219840	0.05617	U	0.579108	T	0.08447	0.0210	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.30794	-0.9966	10	0.13853	T	0.58	.	0.8619	0.01195	0.1928:0.2363:0.338:0.2329	.	1450	Q702N8	XIRP1_HUMAN	T	1450;133	ENSP00000343140:M1450T;ENSP00000391645:M133T	ENSP00000343140:M1450T	M	-	2	0	XIRP1	39201592	0.000000	0.05858	0.000000	0.03702	0.493000	0.33554	-0.032000	0.12266	-1.801000	0.01245	0.533000	0.62120	ATG	.	.		0.627	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254065.1	XM_093522	
ULK4	54986	hgsc.bcm.edu	37	3	41439687	41439687	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:41439687A>G	ENST00000301831.4	-	35	4023	c.3561T>C	c.(3559-3561)taT>taC	p.Y1187Y		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1187					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TTTCCCCTCCATACAGCTGAA	0.393																																					p.Y1187Y		Atlas-SNP	.											.	ULK4	150	.	0			c.T3561C						.						90.0	86.0	88.0					3																	41439687		1840	4081	5921	SO:0001819	synonymous_variant	54986	exon35			CCCTCCATACAGC	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3561T>C	chr3.hg19:g.41439687A>G		115.0	0.0		73.0	4.0	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	ENST00000301831.4	hg19	CCDS43071.1																																																																																			.	.		0.393	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
CCK	885	hgsc.bcm.edu	37	3	42305118	42305118	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:42305118T>C	ENST00000396169.2	-	4	910	c.5A>G	c.(4-6)aAc>aGc	p.N2S	CCK_ENST00000434608.1_Missense_Mutation_p.N2S|CCK_ENST00000334681.5_Missense_Mutation_p.N2S	NM_000729.4	NP_000720.1	P06307	CCKN_HUMAN	cholecystokinin	2					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axonogenesis (GO:0007409)|behavioral fear response (GO:0001662)|eating behavior (GO:0042755)|negative regulation of appetite (GO:0032099)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein oligomerization (GO:0032461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of sensory perception of pain (GO:0051930)|release of cytochrome c from mitochondria (GO:0001836)|signal transduction (GO:0007165)	axon (GO:0030424)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|dendrite (GO:0030425)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|perikaryon (GO:0043204)|terminal bouton (GO:0043195)	hormone activity (GO:0005179)|neuropeptide hormone activity (GO:0005184)			central_nervous_system(1)|large_intestine(1)|lung(3)|skin(1)	6		Ovarian(412;0.0728)		KIRC - Kidney renal clear cell carcinoma(284;0.219)		CACGCCGCTGTTCATGGCTGT	0.692																																					p.N2S		Atlas-SNP	.											.	CCK	15	.	0			c.A5G						.						7.0	8.0	8.0					3																	42305118		2133	4141	6274	SO:0001583	missense	885	exon4			CCGCTGTTCATGG		CCDS2696.1	3p22.1	2013-02-25			ENSG00000187094	ENSG00000187094		"""Endogenous ligands"""	1569	protein-coding gene	gene with protein product	"""prepro-cholecystokinin"", ""cholecystokinin triacontatriapeptide"""	118440				3856870	Standard	NM_001174138		Approved		uc021wwk.1	P06307	OTTHUMG00000131796	ENST00000396169.2:c.5A>G	chr3.hg19:g.42305118T>C	ENSP00000379472:p.Asn2Ser	52.0	0.0		51.0	4.0	NM_000729		Missense_Mutation	SNP	ENST00000396169.2	hg19	CCDS2696.1	.	.	.	.	.	.	.	.	.	.	T	5.712	0.315814	0.10789	.	.	ENSG00000187094	ENST00000396169;ENST00000334681;ENST00000434608	T;T;T	0.21543	2.0;2.0;2.0	5.26	5.26	0.73747	Gastrin/cholecystokinin peptide hormone (1);	0.313869	0.38720	N	0.001593	T	0.34337	0.0894	M	0.69185	2.1	0.27807	N	0.942295	D;P	0.56968	0.978;0.684	P;B	0.58077	0.832;0.272	T	0.30995	-0.9959	10	0.05833	T	0.94	-28.8149	14.6476	0.68772	0.0:0.0:0.0:1.0	.	2;2	B7Z6Q9;P06307	.;CCKN_HUMAN	S	2	ENSP00000379472:N2S;ENSP00000335657:N2S;ENSP00000409124:N2S	ENSP00000335657:N2S	N	-	2	0	CCK	42280122	1.000000	0.71417	0.944000	0.38274	0.152000	0.21847	4.459000	0.60102	2.116000	0.64780	0.533000	0.62120	AAC	.	.		0.692	CCK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343380.1	NM_000729	
CDCP1	64866	hgsc.bcm.edu	37	3	45153758	45153758	+	Missense_Mutation	SNP	C	C	G	rs149422328	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:45153758C>G	ENST00000296129.1	-	3	606	c.472G>C	c.(472-474)Gga>Cga	p.G158R	CDCP1_ENST00000490471.1_5'Flank|CDCP1_ENST00000425231.2_Missense_Mutation_p.G158R	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	158						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TGAGTGACTCCGTCTGGGCAG	0.557																																					p.G158R		Atlas-SNP	.											.	CDCP1	61	.	0			c.G472C						.						149.0	147.0	148.0					3																	45153758		2203	4300	6503	SO:0001583	missense	64866	exon3			TGACTCCGTCTGG	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.472G>C	chr3.hg19:g.45153758C>G	ENSP00000296129:p.Gly158Arg	94.0	0.0		60.0	28.0	NM_178181	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Missense_Mutation	SNP	ENST00000296129.1	hg19	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	C	10.79	1.448476	0.26074	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	T;T	0.42900	1.98;0.96	5.42	4.46	0.54185	.	0.725192	0.14128	N	0.339564	T	0.46190	0.1380	L	0.57536	1.79	0.09310	N	1	D;D	0.60575	0.988;0.966	P;P	0.53450	0.659;0.726	T	0.29882	-0.9997	10	0.18276	T	0.48	.	7.5699	0.27900	0.3663:0.5146:0.1191:0.0	.	158;158	Q9H5V8-3;Q9H5V8	.;CDCP1_HUMAN	R	158	ENSP00000296129:G158R;ENSP00000399342:G158R	ENSP00000296129:G158R	G	-	1	0	CDCP1	45128762	0.001000	0.12720	0.117000	0.21633	0.206000	0.24218	1.015000	0.29963	2.537000	0.85549	0.563000	0.77884	GGA	.	C|1.000;T|0.000		0.557	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
SHISA5	51246	hgsc.bcm.edu	37	3	48510952	48510952	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:48510952A>G	ENST00000296444.2	-	5	787	c.451T>C	c.(451-453)Tcc>Ccc	p.S151P	SHISA5_ENST00000465449.1_5'UTR|SHISA5_ENST00000426002.1_Missense_Mutation_p.S48P|SHISA5_ENST00000444115.1_Missense_Mutation_p.S120P|SHISA5_ENST00000442747.1_Missense_Mutation_p.S120P|SHISA5_ENST00000443308.2_Missense_Mutation_p.S144P	NM_001272065.1|NM_016479.3	NP_001258994.1|NP_057563.3	Q8N114	SHSA5_HUMAN	shisa family member 5	151	Poly-Thr.				intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			large_intestine(1)|lung(1)	2						ACAGTGGTGGATGTGGTGGTG	0.612																																					p.S151P		Atlas-SNP	.											.	SHISA5	10	.	0			c.T451C						.						99.0	94.0	96.0					3																	48510952		2203	4300	6503	SO:0001583	missense	51246	exon5			TGGTGGATGTGGT	AF520698	CCDS2770.1, CCDS63621.1, CCDS63622.1, CCDS63623.1	3p21.31	2013-07-31	2013-07-31		ENSG00000164054	ENSG00000164054		"""Shisa homologs"""	30376	protein-coding gene	gene with protein product		607290	"""shisa homolog 5 (Xenopus laevis)"""			11042152, 12135983	Standard	NM_016479		Approved	SCOTIN, hShisa5	uc011bbk.1	Q8N114	OTTHUMG00000133529	ENST00000296444.2:c.451T>C	chr3.hg19:g.48510952A>G	ENSP00000296444:p.Ser151Pro	114.0	0.0		91.0	5.0	NM_016479	B3KW99|F8W9N8|Q69YY9|Q7Z433|Q8NHL9|Q96MW8|Q9BV58	Missense_Mutation	SNP	ENST00000296444.2	hg19	CCDS2770.1	.	.	.	.	.	.	.	.	.	.	A	13.45	2.240734	0.39598	.	.	ENSG00000164054	ENST00000296444;ENST00000444115;ENST00000426002;ENST00000442747;ENST00000443308	T;T;T;T;T	0.50277	0.75;0.75;0.75;0.75;0.75	5.05	-7.29	0.01451	.	0.591742	0.16951	N	0.192888	T	0.31765	0.0807	L	0.29908	0.895	0.09310	N	0.999997	B;P;P;B	0.42123	0.13;0.729;0.771;0.039	B;B;B;B	0.43052	0.059;0.284;0.406;0.059	T	0.38045	-0.9679	10	0.52906	T	0.07	-15.2617	11.0558	0.47918	0.7015:0.223:0.0:0.0755	.	48;144;151;48	Q8N114-4;F8W9N8;Q8N114;Q8N114-3	.;.;SHSA5_HUMAN;.	P	151;120;48;120;144	ENSP00000296444:S151P;ENSP00000407957:S120P;ENSP00000390388:S48P;ENSP00000408223:S120P;ENSP00000395373:S144P	ENSP00000296444:S151P	S	-	1	0	SHISA5	48485956	0.000000	0.05858	0.012000	0.15200	0.933000	0.57130	-1.311000	0.02723	-1.218000	0.02601	-0.445000	0.05633	TCC	.	.		0.612	SHISA5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257504.3	NM_016479	
DOCK3	1795	hgsc.bcm.edu	37	3	51378810	51378810	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:51378810A>G	ENST00000266037.9	+	38	3932	c.3909A>G	c.(3907-3909)aaA>aaG	p.K1303K		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1303	DHR-2.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ACTTCAACAAAGGCAAGGTAT	0.542																																					p.K1303K		Atlas-SNP	.											.	DOCK3	397	.	0			c.A3909G						.						69.0	70.0	69.0					3																	51378810		2082	4227	6309	SO:0001819	synonymous_variant	1795	exon38			CAACAAAGGCAAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.3909A>G	chr3.hg19:g.51378810A>G		153.0	0.0		99.0	4.0	NM_004947	O15017	Silent	SNP	ENST00000266037.9	hg19	CCDS46835.1																																																																																			.	.		0.542	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
SFMBT1	51460	hgsc.bcm.edu	37	3	52962211	52962211	+	Silent	SNP	A	A	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:52962211A>C	ENST00000394752.3	-	9	1426	c.1044T>G	c.(1042-1044)ccT>ccG	p.P348P	SFMBT1_ENST00000394750.1_Silent_p.P348P|SFMBT1_ENST00000358080.2_Silent_p.P348P|SFMBT1_ENST00000296295.6_Silent_p.P348P	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	348					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GTGCACCTGGAGGGGGGCTGA	0.527																																					p.P348P		Atlas-SNP	.											.	SFMBT1	53	.	0			c.T1044G						.						122.0	118.0	120.0					3																	52962211		2203	4300	6503	SO:0001819	synonymous_variant	51460	exon9			ACCTGGAGGGGGG	AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.1044T>G	chr3.hg19:g.52962211A>C		48.0	0.0		28.0	12.0	NM_016329	Q402F7|Q96C73|Q9Y4Q9	Silent	SNP	ENST00000394752.3	hg19	CCDS2867.1																																																																																			.	.		0.527	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353040.3	NM_016329	
PTPRG	5793	hgsc.bcm.edu	37	3	62180755	62180755	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:62180755T>C	ENST00000474889.1	+	10	1615	c.1238T>C	c.(1237-1239)gTc>gCc	p.V413A	PTPRG_ENST00000295874.10_Missense_Mutation_p.V413A	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	413	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		ATTAGCCATGTCTCACCCGAT	0.502																																					p.V413A		Atlas-SNP	.											.	PTPRG	153	.	0			c.T1238C						.						149.0	135.0	139.0					3																	62180755		2203	4300	6503	SO:0001583	missense	5793	exon10			GCCATGTCTCACC	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1238T>C	chr3.hg19:g.62180755T>C	ENSP00000418112:p.Val413Ala	131.0	0.0		80.0	6.0	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	hg19	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	T	19.56	3.850405	0.71719	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.57436	0.4;0.4	5.81	5.81	0.92471	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.120930	0.56097	D	0.000031	T	0.51381	0.1671	L	0.32530	0.975	0.58432	D	0.999999	P;P	0.38597	0.604;0.639	B;B	0.44085	0.183;0.44	T	0.55860	-0.8074	10	0.87932	D	0	.	16.155	0.81657	0.0:0.0:0.0:1.0	.	413;413	P23470-2;P23470	.;PTPRG_HUMAN	A	413	ENSP00000418112:V413A;ENSP00000295874:V413A	ENSP00000295874:V413A	V	+	2	0	PTPRG	62155795	1.000000	0.71417	0.982000	0.44146	0.996000	0.88848	7.541000	0.82084	2.221000	0.72209	0.533000	0.62120	GTC	.	.		0.502	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
KBTBD8	84541	hgsc.bcm.edu	37	3	67049555	67049555	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:67049555A>G	ENST00000417314.2	+	2	216	c.167A>G	c.(166-168)gAt>gGt	p.D56G	KBTBD8_ENST00000469661.1_3'UTR|KBTBD8_ENST00000460576.1_Intron|KBTBD8_ENST00000295568.4_Missense_Mutation_p.D30G			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	56	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.					cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		GTGGAAGTGGATCACGGGAAA	0.448																																					p.D56G		Atlas-SNP	.											.	KBTBD8	101	.	0			c.A167G						.						190.0	170.0	177.0					3																	67049555		2203	4300	6503	SO:0001583	missense	84541	exon2			AAGTGGATCACGG	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.167A>G	chr3.hg19:g.67049555A>G	ENSP00000401878:p.Asp56Gly	139.0	0.0		94.0	4.0	NM_032505	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	hg19	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	A	15.71	2.912815	0.52439	.	.	ENSG00000163376	ENST00000295568;ENST00000417314;ENST00000460784	T;T;T	0.64618	-0.11;-0.11;-0.11	5.62	5.62	0.85841	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.152533	0.64402	D	0.000019	T	0.43634	0.1256	N	0.03268	-0.37	0.53688	D	0.999977	P	0.43231	0.801	P	0.48952	0.596	T	0.44544	-0.9321	10	0.08381	T	0.77	.	11.232	0.48918	0.8634:0.0:0.0:0.1366	.	56	Q8NFY9	KBTB8_HUMAN	G	30;56;30	ENSP00000295568:D30G;ENSP00000401878:D56G;ENSP00000418075:D30G	ENSP00000295568:D30G	D	+	2	0	KBTBD8	67132245	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.425000	0.80255	2.267000	0.75376	0.383000	0.25322	GAT	.	.		0.448	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505	
EPHA6	285220	hgsc.bcm.edu	37	3	96533714	96533714	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:96533714T>C	ENST00000389672.5	+	1	285	c.247T>C	c.(247-249)Tct>Cct	p.S83P	EPHA6_ENST00000470610.2_Missense_Mutation_p.S83P|EPHA6_ENST00000542517.1_5'UTR	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	0	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						CCGCCACTTCTCTTTAAGGGA	0.577																																					p.S83P		Atlas-SNP	.											.	EPHA6	439	.	0			c.T247C						.						13.0	18.0	16.0					3																	96533714		1910	4074	5984	SO:0001583	missense	285220	exon1			CACTTCTCTTTAA	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.247T>C	chr3.hg19:g.96533714T>C	ENSP00000374323:p.Ser83Pro	128.0	0.0		109.0	5.0	NM_001080448	D6RAL5	Missense_Mutation	SNP	ENST00000389672.5	hg19	CCDS46876.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.809|8.809	0.934807|0.934807	0.18206|0.18206	.|.	.|.	ENSG00000080224|ENSG00000080224	ENST00000506569|ENST00000470610;ENST00000389672	.|T;T	.|0.75477	.|4.96;-0.94	5.35|5.35	1.46|1.46	0.22682|0.22682	.|.	.|.	.|.	.|.	.|.	T|T	0.48370|0.48370	0.1496|0.1496	N|N	0.08118|0.08118	0|0	0.18873|0.18873	N|N	0.999988|0.999988	.|B;B	.|0.21821	.|0.026;0.061	.|B;B	.|0.21546	.|0.029;0.035	T|T	0.33033|0.33033	-0.9884|-0.9884	5|9	.|0.34782	.|T	.|0.22	.|.	1.4965|1.4965	0.02467|0.02467	0.1773:0.0957:0.1847:0.5423|0.1773:0.0957:0.1847:0.5423	.|.	.|83;83	.|B3KS12;E7EU71	.|.;.	P|P	27|83	.|ENSP00000420598:S83P;ENSP00000374323:S83P	.|ENSP00000374323:S83P	L|S	+|+	2|1	0|0	EPHA6|EPHA6	98016404|98016404	0.857000|0.857000	0.29778|0.29778	0.387000|0.387000	0.26183|0.26183	0.258000|0.258000	0.26162|0.26162	1.437000|1.437000	0.34991|0.34991	0.271000|0.271000	0.22005|0.22005	0.477000|0.477000	0.44152|0.44152	CTC|TCT	.	.		0.577	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
KIAA2018	205717	hgsc.bcm.edu	37	3	113379962	113379962	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:113379962A>G	ENST00000478658.1	-	5	584	c.567T>C	c.(565-567)acT>acC	p.T189T	KIAA2018_ENST00000316407.4_Silent_p.T189T|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	189						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						CAAGATTGCAAGTCCTCTGTA	0.463																																					p.T189T		Atlas-SNP	.											KIAA2018,NS,carcinoma,0,1	KIAA2018	180	.	0			c.T567C						.						128.0	130.0	129.0					3																	113379962		1934	4132	6066	SO:0001819	synonymous_variant	205717	exon7			ATTGCAAGTCCTC	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.567T>C	chr3.hg19:g.113379962A>G		98.0	0.0		97.0	4.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Silent	SNP	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.		0.463	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
GRAMD1C	54762	hgsc.bcm.edu	37	3	113601609	113601609	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:113601609C>T	ENST00000358160.4	+	6	962	c.470C>T	c.(469-471)aCa>aTa	p.T157I	GRAMD1C_ENST00000479212.1_3'UTR|GRAMD1C_ENST00000452134.2_5'UTR	NM_017577.4	NP_060047.3	Q8IYS0	GRM1C_HUMAN	GRAM domain containing 1C	157						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	26						TTTTTCTTCACATCTTTTGGT	0.358																																					p.T157I		Atlas-SNP	.											.	GRAMD1C	71	.	0			c.C470T						.						169.0	172.0	171.0					3																	113601609		2203	4300	6503	SO:0001583	missense	54762	exon6			TCTTCACATCTTT		CCDS33826.1, CCDS54625.1	3q13.31	2005-11-02			ENSG00000178075	ENSG00000178075			25252	protein-coding gene	gene with protein product						12975309	Standard	NM_017577		Approved	DKFZp434C0328	uc003eaq.4	Q8IYS0	OTTHUMG00000159340	ENST00000358160.4:c.470C>T	chr3.hg19:g.113601609C>T	ENSP00000350881:p.Thr157Ile	137.0	0.0		123.0	5.0	NM_017577	A8K9Y1|A8KA99|Q6AW94|Q6UWN1|Q8N6S0|Q9UF46	Missense_Mutation	SNP	ENST00000358160.4	hg19	CCDS33826.1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.025097	0.75390	.	.	ENSG00000178075	ENST00000358160	T	0.36878	1.23	5.52	5.52	0.82312	.	0.481200	0.22915	N	0.054096	T	0.56046	0.1959	M	0.81802	2.56	0.80722	D	1	D	0.59767	0.986	P	0.53954	0.738	T	0.60068	-0.7335	10	0.52906	T	0.07	.	16.9402	0.86216	0.0:1.0:0.0:0.0	.	157	Q8IYS0	GRM1C_HUMAN	I	157	ENSP00000350881:T157I	ENSP00000350881:T157I	T	+	2	0	GRAMD1C	115084299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.427000	0.59888	2.587000	0.87381	0.643000	0.83706	ACA	.	.		0.358	GRAMD1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354733.1	NM_017577	
ARHGAP31	57514	hgsc.bcm.edu	37	3	119133131	119133131	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:119133131T>C	ENST00000264245.4	+	12	2887	c.2355T>C	c.(2353-2355)ccT>ccC	p.P785P		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	785	Pro-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						CACCTGCTCCTCCCCCTCCAA	0.537																																					p.P785P	Pancreas(7;176 297 5394 51128 51241)	Atlas-SNP	.											.	ARHGAP31	175	.	0			c.T2355C						.						52.0	55.0	54.0					3																	119133131		1924	4126	6050	SO:0001819	synonymous_variant	57514	exon12			TGCTCCTCCCCCT		CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2355T>C	chr3.hg19:g.119133131T>C		56.0	0.0		40.0	4.0	NM_020754	Q9ULL6	Silent	SNP	ENST00000264245.4	hg19	CCDS43135.1																																																																																			.	.		0.537	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354942.2		
LRRC58	116064	hgsc.bcm.edu	37	3	120053943	120053943	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:120053943T>C	ENST00000295628.3	-	3	768	c.673A>G	c.(673-675)Aca>Gca	p.T225A		NM_001099678.1	NP_001093148.1	Q96CX6	LRC58_HUMAN	leucine rich repeat containing 58	225										large_intestine(2)|lung(5)	7				GBM - Glioblastoma multiforme(114;0.147)		GGCAGATATGTCAGCAAGTTA	0.348																																					p.T225A		Atlas-SNP	.											.	LRRC58	18	.	0			c.A673G						.						101.0	92.0	95.0					3																	120053943		1871	4106	5977	SO:0001583	missense	116064	exon3			GATATGTCAGCAA	BC013757	CCDS46892.1	3q13.33	2006-01-06			ENSG00000163428	ENSG00000163428			26968	protein-coding gene	gene with protein product							Standard	NM_001099678		Approved		uc003edr.2	Q96CX6	OTTHUMG00000159407	ENST00000295628.3:c.673A>G	chr3.hg19:g.120053943T>C	ENSP00000295628:p.Thr225Ala	53.0	0.0		73.0	4.0	NM_001099678		Missense_Mutation	SNP	ENST00000295628.3	hg19	CCDS46892.1	.	.	.	.	.	.	.	.	.	.	T	14.54	2.566493	0.45694	.	.	ENSG00000163428	ENST00000295628	T	0.27104	1.69	5.37	4.14	0.48551	.	0.045963	0.85682	D	0.000000	T	0.23727	0.0574	M	0.72894	2.215	0.51233	D	0.999914	P	0.38827	0.649	B	0.36186	0.219	T	0.03231	-1.1058	10	0.12766	T	0.61	-6.669	9.2641	0.37630	0.1605:0.0:0.0:0.8395	.	225	Q96CX6	LRC58_HUMAN	A	225	ENSP00000295628:T225A	ENSP00000295628:T225A	T	-	1	0	LRRC58	121536633	1.000000	0.71417	0.998000	0.56505	0.921000	0.55340	5.840000	0.69402	2.036000	0.60181	0.533000	0.62120	ACA	.	.		0.348	LRRC58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355142.1	XM_057296	
STXBP5L	9515	hgsc.bcm.edu	37	3	120941989	120941989	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:120941989A>G	ENST00000273666.6	+	11	1367	c.1096A>G	c.(1096-1098)Acg>Gcg	p.T366A	STXBP5L_ENST00000492541.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000471454.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000472879.1_Missense_Mutation_p.T366A|STXBP5L_ENST00000497029.1_Missense_Mutation_p.T366A	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	366					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TTTATGTGAAACGCCCTATCC	0.294																																					p.T366A		Atlas-SNP	.											.	STXBP5L	159	.	0			c.A1096G						.						113.0	106.0	108.0					3																	120941989		1842	4091	5933	SO:0001583	missense	9515	exon11			TGTGAAACGCCCT	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1096A>G	chr3.hg19:g.120941989A>G	ENSP00000273666:p.Thr366Ala	72.0	0.0		60.0	4.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	hg19	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	18.11	3.550852	0.65311	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.37752	1.87;1.87;1.67;1.18;1.67;1.88	4.5	4.5	0.54988	WD40 repeat-like-containing domain (1);Lethal giant larvae homologue 2 (1);	0.000000	0.85682	D	0.000000	T	0.48370	0.1496	L	0.37800	1.135	0.80722	D	1	P;D	0.71674	0.693;0.998	B;D	0.80764	0.41;0.994	T	0.42050	-0.9474	10	0.39692	T	0.17	-19.3352	13.9784	0.64287	1.0:0.0:0.0:0.0	.	366;366	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	A	366	ENSP00000273666:T366A;ENSP00000420019:T366A;ENSP00000419627:T366A;ENSP00000420287:T366A;ENSP00000420666:T366A;ENSP00000420167:T366A	ENSP00000273666:T366A	T	+	1	0	STXBP5L	122424679	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.139000	0.94554	1.878000	0.54408	0.379000	0.24179	ACG	.	.		0.294	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
UROC1	131669	hgsc.bcm.edu	37	3	126229602	126229602	+	Silent	SNP	C	C	T	rs557996880		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:126229602C>T	ENST00000290868.2	-	2	215	c.162G>A	c.(160-162)ccG>ccA	p.P54P	UROC1_ENST00000383579.3_Silent_p.P54P	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	54					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		CCTGGACATCCGGGGGGAAGT	0.637													C|||	1	0.000199681	0.0	0.0	5008	,	,		17990	0.0		0.0	False		,,,				2504	0.001				p.P54P		Atlas-SNP	.											.	UROC1	150	.	0			c.G162A						.						52.0	49.0	50.0					3																	126229602		2203	4300	6503	SO:0001819	synonymous_variant	131669	exon2			GACATCCGGGGGG	AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.162G>A	chr3.hg19:g.126229602C>T		39.0	0.0		45.0	9.0	NM_001165974	E9PE13|Q14C64|Q68CJ7	Silent	SNP	ENST00000290868.2	hg19	CCDS3038.1																																																																																			.	.		0.637	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370325.2	NM_144639	
PLXND1	23129	hgsc.bcm.edu	37	3	129291728	129291728	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:129291728T>C	ENST00000324093.4	-	14	3072	c.2894A>G	c.(2893-2895)aAc>aGc	p.N965S	PLXND1_ENST00000393239.1_Missense_Mutation_p.N965S	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	965	IPT/TIG 1.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						CTTAGAGGCGTTCACGGTCAC	0.687																																					p.N965S	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.A2894G						.						67.0	57.0	61.0					3																	129291728		2203	4300	6503	SO:0001583	missense	23129	exon14			GAGGCGTTCACGG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.2894A>G	chr3.hg19:g.129291728T>C	ENSP00000317128:p.Asn965Ser	66.0	0.0		94.0	4.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	hg19	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	T	11.60	1.687798	0.29962	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.77098	-1.07;-1.07	5.1	5.1	0.69264	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.339429	0.30210	N	0.010145	T	0.70237	0.3201	L	0.28458	0.855	0.40700	D	0.982472	P	0.45428	0.858	P	0.47705	0.555	T	0.66999	-0.5781	10	0.08381	T	0.77	.	13.4772	0.61316	0.0:0.0:0.0:1.0	.	965	Q9Y4D7	PLXD1_HUMAN	S	965	ENSP00000317128:N965S;ENSP00000376931:N965S	ENSP00000317128:N965S	N	-	2	0	PLXND1	130774418	0.998000	0.40836	0.997000	0.53966	0.330000	0.28571	3.838000	0.55828	1.916000	0.55485	0.533000	0.62120	AAC	.	.		0.687	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
COL6A5	256076	hgsc.bcm.edu	37	3	130098302	130098302	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:130098302C>A	ENST00000432398.2	+	4	1203	c.709C>A	c.(709-711)Ctc>Atc	p.L237I	COL6A5_ENST00000265379.6_Missense_Mutation_p.L237I	NM_153264.5	NP_694996.5	A8TX70	CO6A5_HUMAN	collagen, type VI, alpha 5	237	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				endometrium(6)|kidney(4)|large_intestine(8)|lung(19)|pancreas(2)|prostate(3)|stomach(1)|urinary_tract(1)	44						ACTCGCTGACCTCGTGTTCCT	0.463																																					p.L237I		Atlas-SNP	.											.	COL6A5	205	.	0			c.C709A						.						65.0	55.0	58.0					3																	130098302		692	1591	2283	SO:0001583	missense	256076	exon4			GCTGACCTCGTGT	AK093199		3q21.3	2013-01-16	2010-05-24	2010-05-24	ENSG00000172752	ENSG00000172752		"""Collagens"""	26674	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 4"""	611916	"""collagen, type XXIX, alpha 1"""	COL29A1		17850181	Standard	NM_153264		Approved	FLJ35880, VWA4	uc010htk.2	A8TX70	OTTHUMG00000159712	ENST00000432398.2:c.709C>A	chr3.hg19:g.130098302C>A	ENSP00000390895:p.Leu237Ile	163.0	0.0		201.0	90.0	NM_153264	A9J6L2|A9J6L4|A9J6L6|A9J6L7|A9J6M0|A9J6M1|A9J6M2|B5MEA7|Q6ZW26|Q8NA36	Missense_Mutation	SNP	ENST00000432398.2	hg19		.	.	.	.	.	.	.	.	.	.	C	4.968	0.179746	0.09443	.	.	ENSG00000172752	ENST00000432398;ENST00000265379	T;T	0.81247	-1.47;-1.47	5.31	-2.66	0.06077	.	.	.	.	.	T	0.53012	0.1770	N	0.04373	-0.215	0.23050	N	0.998372	B	0.15719	0.014	B	0.16722	0.016	T	0.48364	-0.9042	9	0.02654	T	1	.	9.4981	0.38999	0.4544:0.1671:0.3785:0.0	.	237	A8TX70-2	.	I	237	ENSP00000390895:L237I;ENSP00000265379:L237I	ENSP00000265379:L237I	L	+	1	0	COL6A5	131580992	0.046000	0.20272	0.030000	0.17652	0.147000	0.21601	0.094000	0.15107	-0.321000	0.08627	-0.302000	0.09304	CTC	.	.		0.463	COL6A5-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_153264	
ASTE1	28990	hgsc.bcm.edu	37	3	130735014	130735014	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:130735014A>G	ENST00000264992.3	-	5	2124	c.1683T>C	c.(1681-1683)acT>acC	p.T561T	ATP2C1_ENST00000504381.1_Missense_Mutation_p.S870G|ASTE1_ENST00000514044.1_Silent_p.T561T|ATP2C1_ENST00000533801.2_Missense_Mutation_p.S920G|ATP2C1_ENST00000328560.8_Missense_Mutation_p.E883G|ATP2C1_ENST00000359644.3_Missense_Mutation_p.S925G|ATP2C1_ENST00000422190.2_Missense_Mutation_p.S915G|ATP2C1_ENST00000507488.2_Missense_Mutation_p.S899G|ATP2C1_ENST00000513801.1_Missense_Mutation_p.S899G|ATP2C1_ENST00000393221.4_Missense_Mutation_p.S949G	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	561					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						CTGGGAGAGGAGTGGACAGCA	0.468																																					p.S949G		Atlas-SNP	.											.	ATP2C1	94	.	0			c.A2845G						.						115.0	106.0	109.0					3																	130735014		2203	4300	6503	SO:0001819	synonymous_variant	27032	exon28			GAGAGGAGTGGAC	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1683T>C	chr3.hg19:g.130735014A>G		74.0	0.0		105.0	5.0	NM_001199180	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	hg19	CCDS3068.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.343|9.343	1.063646|1.063646	0.20067|0.20067	.|.	.|.	ENSG00000017260|ENSG00000017260	ENST00000328560|ENST00000504381;ENST00000507488;ENST00000393221;ENST00000533801;ENST00000513801;ENST00000359644;ENST00000422190;ENST00000347421	D|D;D;D;D;D;D;D	0.92699|0.92495	-3.09|-3.04;-3.0;-3.0;-3.05;-3.0;-2.99;-3.0	5.71|5.71	-11.4|-11.4	0.00090|0.00090	.|.	.|.	.|.	.|.	.|.	T|T	0.80259|0.80259	0.4590|0.4590	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	B|B;B;B;B	0.02656|0.02656	0.0|0.0;0.0;0.0;0.0	B|B;B;B;B	0.01281|0.01281	0.0|0.0;0.0;0.0;0.0	T|T	0.47649|0.47649	-0.9101|-0.9101	8|7	0.06365|.	T|.	0.9|.	-4.0654|-4.0654	6.6922|6.6922	0.23179|0.23179	0.135:0.5575:0.1563:0.1512|0.135:0.5575:0.1563:0.1512	.|.	883|949;920;915;949	P98194-2|G3XAH8;B4DSW3;P98194-5;B7Z3X9	.|.;.;.;.	G|G	883|870;899;949;920;899;925;915;934	ENSP00000329664:E883G|ENSP00000425320:S870G;ENSP00000421326:S899G;ENSP00000376914:S949G;ENSP00000432956:S920G;ENSP00000422872:S899G;ENSP00000352665:S925G;ENSP00000402677:S915G	ENSP00000329664:E883G|.	E|S	+|+	2|1	0|0	ATP2C1|ATP2C1	132217704|132217704	0.000000|0.000000	0.05858|0.05858	0.021000|0.021000	0.16686|0.16686	0.328000|0.328000	0.28507|0.28507	-1.785000|-1.785000	0.01767|0.01767	-3.068000|-3.068000	0.00254|0.00254	-0.250000|-0.250000	0.11733|0.11733	GAG|AGT	.	.		0.468	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
U2SURP	23350	hgsc.bcm.edu	37	3	142740318	142740318	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:142740318T>C	ENST00000473835.2	+	10	863	c.773T>C	c.(772-774)cTt>cCt	p.L258P	U2SURP_ENST00000397933.2_5'UTR|U2SURP_ENST00000493598.2_Missense_Mutation_p.L257P	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	258					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						GCCCTAGTTCTTGATGATTAC	0.328																																					p.L258P		Atlas-SNP	.											.	U2SURP	66	.	0			c.T773C						.						81.0	72.0	75.0					3																	142740318		1822	4085	5907	SO:0001583	missense	23350	exon10			TAGTTCTTGATGA	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.773T>C	chr3.hg19:g.142740318T>C	ENSP00000418563:p.Leu258Pro	152.0	0.0		98.0	4.0	NM_001080415	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	ENST00000473835.2	hg19	CCDS46928.1	.	.	.	.	.	.	.	.	.	.	T	13.97	2.394831	0.42512	.	.	ENSG00000163714	ENST00000473835;ENST00000319822;ENST00000493598	T;T	0.11277	2.79;2.79	5.55	5.55	0.83447	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.11367	0.0277	L	0.41236	1.265	0.80722	D	1	B;B;B	0.09022	0.0;0.002;0.0	B;B;B	0.09377	0.0;0.004;0.001	T	0.08371	-1.0725	10	0.29301	T	0.29	-15.9505	15.7038	0.77563	0.0:0.0:0.0:1.0	.	258;257;258	B4DK81;O15042-2;O15042	.;.;SR140_HUMAN	P	258;258;257	ENSP00000418563:L258P;ENSP00000422011:L257P	ENSP00000322376:L258P	L	+	2	0	U2SURP	144223008	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	7.698000	0.84413	2.105000	0.64084	0.383000	0.25322	CTT	.	.		0.328	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354603.2	NM_001080415	
LRRIQ4	344657	hgsc.bcm.edu	37	3	169548290	169548290	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:169548290A>G	ENST00000340806.6	+	3	1205	c.1205A>G	c.(1204-1206)gAg>gGg	p.E402G		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	402										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						AGTCTCAAAGAGCTATATATA	0.368																																					p.E402G		Atlas-SNP	.											.	LRRIQ4	68	.	0			c.A1205G						.						46.0	44.0	45.0					3																	169548290		1831	4088	5919	SO:0001583	missense	344657	exon3			TCAAAGAGCTATA		CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.1205A>G	chr3.hg19:g.169548290A>G	ENSP00000342188:p.Glu402Gly	62.0	0.0		66.0	4.0	NM_001080460		Missense_Mutation	SNP	ENST00000340806.6	hg19	CCDS46951.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.881762	0.51908	.	.	ENSG00000188306	ENST00000340806	T	0.59772	0.24	5.84	5.84	0.93424	.	0.000000	0.64402	D	0.000001	T	0.70133	0.3189	L	0.49699	1.58	0.45183	D	0.99819	D	0.89917	1.0	D	0.91635	0.999	T	0.66131	-0.6000	10	0.25751	T	0.34	.	15.8917	0.79303	1.0:0.0:0.0:0.0	.	402	A6NIV6	LRIQ4_HUMAN	G	402	ENSP00000342188:E402G	ENSP00000342188:E402G	E	+	2	0	LRRIQ4	171030984	1.000000	0.71417	0.999000	0.59377	0.080000	0.17528	6.302000	0.72788	2.228000	0.72767	0.533000	0.62120	GAG	.	.		0.368	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378698.1	NM_001080460	
MFN1	55669	hgsc.bcm.edu	37	3	179095207	179095207	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:179095207A>G	ENST00000471841.1	+	12	1426	c.1300A>G	c.(1300-1302)Aat>Gat	p.N434D	MFN1_ENST00000280653.7_Missense_Mutation_p.N434D|MFN1_ENST00000263969.5_Missense_Mutation_p.N434D	NM_033540.2	NP_284941	Q8IWA4	MFN1_HUMAN	mitofusin 1	434					mitochondrial fusion (GO:0008053)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(3)|prostate(1)|urinary_tract(1)	31	all_cancers(143;1.67e-16)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.00225)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			GTTTCATCCTAATCCAGATGT	0.279																																					p.N434D		Atlas-SNP	.											.	MFN1	72	.	0			c.A1300G						.						68.0	71.0	70.0					3																	179095207		2198	4294	6492	SO:0001583	missense	55669	exon12			CATCCTAATCCAG	AF054986	CCDS3228.1	3q26.32	2006-12-13			ENSG00000171109	ENSG00000171109			18262	protein-coding gene	gene with protein product		608506				8358434, 11181170	Standard	NM_033540		Approved	FLJ20693	uc003fjs.3	Q8IWA4	OTTHUMG00000157385	ENST00000471841.1:c.1300A>G	chr3.hg19:g.179095207A>G	ENSP00000420617:p.Asn434Asp	107.0	0.0		96.0	4.0	NM_033540	B2RAR1|D3DNR6|O15323|O60639|Q9BZB5|Q9NWQ2	Missense_Mutation	SNP	ENST00000471841.1	hg19	CCDS3228.1	.	.	.	.	.	.	.	.	.	.	A	12.59	1.983662	0.35036	.	.	ENSG00000171109	ENST00000471841;ENST00000280653;ENST00000539169;ENST00000263969;ENST00000474903	D;D;D;D	0.85484	-1.99;-1.99;-1.99;-1.99	5.49	2.92	0.33932	.	0.198932	0.56097	D	0.000036	T	0.65217	0.2670	N	0.04203	-0.255	0.28201	N	0.927348	B;B;B	0.19817	0.039;0.028;0.028	B;B;B	0.15484	0.008;0.013;0.008	T	0.53725	-0.8398	10	0.19147	T	0.46	-7.8035	9.1892	0.37189	0.4081:0.0:0.0:0.5919	.	434;462;434	Q8IWA4-3;Q4AEJ4;Q8IWA4	.;.;MFN1_HUMAN	D	434;434;434;434;297	ENSP00000420617:N434D;ENSP00000280653:N434D;ENSP00000263969:N434D;ENSP00000419926:N297D	ENSP00000263969:N434D	N	+	1	0	MFN1	180577901	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.258000	0.58822	0.880000	0.35969	0.482000	0.46254	AAT	.	.		0.279	MFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348654.2	NM_017927	
CCDC39	339829	hgsc.bcm.edu	37	3	180361933	180361933	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:180361933A>G	ENST00000442201.2	-	12	1759	c.1640T>C	c.(1639-1641)cTt>cCt	p.L547P	CCDC39_ENST00000273654.4_Missense_Mutation_p.L631P	NM_181426.1	NP_852091.1	Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	547					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)		p.L631R(1)|p.L547R(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			GGCTTTATCAAGTTCTTTCTC	0.308																																					p.L547P		Atlas-SNP	.											CCDC39_ENST00000442201,caecum,carcinoma,0,2	CCDC39	242	.	2	Substitution - Missense(2)	large_intestine(2)	c.T1640C						.						160.0	145.0	150.0					3																	180361933		1488	3303	4791	SO:0001583	missense	339829	exon12			TTATCAAGTTCTT	BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000442201.2:c.1640T>C	chr3.hg19:g.180361933A>G	ENSP00000405708:p.Leu547Pro	97.0	0.0		81.0	5.0	NM_181426	B4E2H1	Missense_Mutation	SNP	ENST00000442201.2	hg19	CCDS46964.1	.	.	.	.	.	.	.	.	.	.	A	14.59	2.581707	0.46006	.	.	ENSG00000145075	ENST00000273654;ENST00000442201	T;T	0.23552	1.9;1.9	5.56	5.56	0.83823	.	0.162313	0.41396	D	0.000899	T	0.53899	0.1825	M	0.81239	2.535	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59295	-0.7481	10	0.72032	D	0.01	-5.8948	15.0019	0.71479	1.0:0.0:0.0:0.0	.	547	Q9UFE4	CCD39_HUMAN	P	631;547	ENSP00000273654:L631P;ENSP00000405708:L547P	ENSP00000273654:L631P	L	-	2	0	CCDC39	181844627	0.999000	0.42202	0.926000	0.36857	0.128000	0.20619	5.752000	0.68728	2.240000	0.73641	0.533000	0.62120	CTT	.	.		0.308	CCDC39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349783.3	XM_291028	
ABCC5	10057	hgsc.bcm.edu	37	3	183655819	183655819	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:183655819G>A	ENST00000334444.6	-	26	3964	c.3724C>T	c.(3724-3726)Cgt>Tgt	p.R1242C	ABCC5_ENST00000265586.6_Missense_Mutation_p.R1199C	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	1242	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	TCCACCAGACGGAAGAGGGCC	0.507																																					p.R1242C		Atlas-SNP	.											.	ABCC5	142	.	0			c.C3724T						.						90.0	89.0	89.0					3																	183655819		2022	4196	6218	SO:0001583	missense	10057	exon26			CCAGACGGAAGAG	AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.3724C>T	chr3.hg19:g.183655819G>A	ENSP00000333926:p.Arg1242Cys	126.0	0.0		124.0	27.0	NM_005688	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	ENST00000334444.6	hg19	CCDS43176.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516365	0.85495	.	.	ENSG00000114770	ENST00000334444;ENST00000265586	D;D	0.92397	-3.03;-3.03	5.73	5.73	0.89815	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.054165	0.85682	D	0.000000	D	0.97021	0.9027	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97312	0.9938	10	0.87932	D	0	-12.7027	19.8948	0.96954	0.0:0.0:1.0:0.0	.	1199;1242	Q86UX3;O15440	.;MRP5_HUMAN	C	1242;1199	ENSP00000333926:R1242C;ENSP00000265586:R1199C	ENSP00000265586:R1199C	R	-	1	0	ABCC5	185138513	1.000000	0.71417	0.998000	0.56505	0.908000	0.53690	4.345000	0.59360	2.699000	0.92147	0.655000	0.94253	CGT	.	.		0.507	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346350.1	NM_005688	
PPP2R2C	5522	hgsc.bcm.edu	37	4	6377634	6377634	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:6377634A>T	ENST00000382599.4	-	4	575	c.359T>A	c.(358-360)aTt>aAt	p.I120N	PPP2R2C_ENST00000507294.1_Missense_Mutation_p.I113N|PPP2R2C_ENST00000314348.8_5'UTR|PPP2R2C_ENST00000506140.1_Missense_Mutation_p.I113N|PPP2R2C_ENST00000335585.5_Missense_Mutation_p.I120N|PPP2R2C_ENST00000515571.1_Missense_Mutation_p.I103N			Q9Y2T4	2ABG_HUMAN	protein phosphatase 2, regulatory subunit B, gamma	120					regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	28						TCGTTCGGTAATCTTCCATAA	0.428																																					p.I120N		Atlas-SNP	.											.	PPP2R2C	63	.	0			c.T359A						.						118.0	119.0	119.0					4																	6377634		2203	4300	6503	SO:0001583	missense	5522	exon4			TCGGTAATCTTCC	AF086924	CCDS3388.1, CCDS56304.1, CCDS56305.1, CCDS3387.1	4p16.1	2013-01-10	2010-04-14		ENSG00000074211	ENSG00000074211	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9306	protein-coding gene	gene with protein product	"""PP2A subunit B isoform gamma"""	605997	"""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), gamma isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, gamma isoform"""			10574460, 10945473	Standard	NM_020416		Approved	PR52, IMYPNO, MGC33570, PR55G	uc003gja.3	Q9Y2T4	OTTHUMG00000090445	ENST00000382599.4:c.359T>A	chr4.hg19:g.6377634A>T	ENSP00000372042:p.Ile120Asn	208.0	0.0		190.0	92.0	NM_181876	A8MSY7|B7Z3Y1|Q7Z4V7|Q8NEC4|Q9H3G7	Missense_Mutation	SNP	ENST00000382599.4	hg19		.	.	.	.	.	.	.	.	.	.	A	22.9	4.343812	0.82022	.	.	ENSG00000074211	ENST00000335585;ENST00000506140;ENST00000515571;ENST00000382599;ENST00000507294	T;T;T;T;T	0.33216	1.42;1.42;1.42;1.42;1.42	4.32	4.32	0.51571	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.182769	0.48767	D	0.000167	T	0.54415	0.1857	M	0.75447	2.3	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.996;0.998;0.993;0.993;0.993	T	0.60239	-0.7302	10	0.87932	D	0	-24.9874	13.1313	0.59385	1.0:0.0:0.0:0.0	.	113;216;120;103;120	B7Z3Y1;Q59GC6;Q9Y2T4;Q9Y2T4-3;Q9Y2T4-2	.;.;2ABG_HUMAN;.;.	N	120;113;103;120;113	ENSP00000335083:I120N;ENSP00000423649:I113N;ENSP00000422374:I103N;ENSP00000372042:I120N;ENSP00000425247:I113N	ENSP00000335083:I120N	I	-	2	0	PPP2R2C	6428535	1.000000	0.71417	0.911000	0.35937	0.984000	0.73092	8.404000	0.90210	1.937000	0.56155	0.459000	0.35465	ATT	.	.		0.428	PPP2R2C-001	NOVEL	overlapping_uORF|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000206889.2	NM_181876	
WDR1	9948	hgsc.bcm.edu	37	4	10090367	10090367	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:10090367T>C	ENST00000499869.2	-	6	752		c.e6-2		WDR1_ENST00000382451.2_Splice_Site|WDR1_ENST00000515743.1_Splice_Site|WDR1_ENST00000382452.2_Splice_Site|WDR1_ENST00000502702.1_Splice_Site			O75083	WDR1_HUMAN	WD repeat domain 1						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|sensory perception of sound (GO:0007605)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				endometrium(3)|lung(5)|ovary(2)|pancreas(1)|urinary_tract(1)	12				STAD - Stomach adenocarcinoma(129;0.000703)|Colorectal(103;0.0057)|LUSC - Lung squamous cell carcinoma(721;0.0232)		GCTGTGGTCCTGCAGGAAAAC	0.522																																					.		Atlas-SNP	.											.	WDR1	93	.	0			c.139-2A>G						.						37.0	39.0	38.0					4																	10090367		1969	4158	6127	SO:0001630	splice_region_variant	9948	exon4			TGGTCCTGCAGGA	AF020260	CCDS54739.1, CCDS54740.1	4p16.1	2013-01-09			ENSG00000071127	ENSG00000071127		"""WD repeat domain containing"""	12754	protein-coding gene	gene with protein product		604734				10036186	Standard	NM_017491		Approved		uc021xlv.1	O75083	OTTHUMG00000160253	ENST00000499869.2:c.559-2A>G	chr4.hg19:g.10090367T>C		66.0	0.0		70.0	5.0	NM_005112	A8K6E9|A8MPU4|O75313|Q8N6E5|Q9UG05|Q9UG78|Q9UQE0	Splice_Site	SNP	ENST00000499869.2	hg19	CCDS54740.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384800	0.82792	.	.	ENSG00000071127	ENST00000499869;ENST00000382452;ENST00000382451;ENST00000443592;ENST00000502702;ENST00000439733;ENST00000508079	.	.	.	5.44	5.44	0.79542	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6845	0.69040	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	WDR1	9699465	1.000000	0.71417	0.987000	0.45799	0.952000	0.60782	7.389000	0.79806	2.065000	0.61736	0.383000	0.25322	.	.	.		0.522	WDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359877.1		Intron
CC2D2A	57545	hgsc.bcm.edu	37	4	15539668	15539668	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:15539668A>G	ENST00000503292.1	+	17	2091	c.1911A>G	c.(1909-1911)agA>agG	p.R637R	CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000389652.5_Silent_p.R588R|CC2D2A_ENST00000424120.1_Silent_p.R637R|CC2D2A_ENST00000413206.1_Silent_p.R637R	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	637					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						TGAGGGAGAGAGCAGCCCAGA	0.627																																					p.R637R		Atlas-SNP	.											.	CC2D2A	158	.	0			c.A1911G						.						42.0	52.0	48.0					4																	15539668		2173	4278	6451	SO:0001819	synonymous_variant	57545	exon17			GGAGAGAGCAGCC	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1911A>G	chr4.hg19:g.15539668A>G		84.0	0.0		117.0	5.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Silent	SNP	ENST00000503292.1	hg19	CCDS47026.1																																																																																			.	.		0.627	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
PPARGC1A	10891	hgsc.bcm.edu	37	4	23816124	23816124	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:23816124A>G	ENST00000264867.2	-	8	1101	c.982T>C	c.(982-984)Tca>Cca	p.S328P	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	328	Interaction with PPARG.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				GGCTTCTTTGATGGTGGTGGC	0.502																																					p.S328P	Esophageal Squamous(29;694 744 13796 34866 44181)	Atlas-SNP	.											.	PPARGC1A	129	.	0			c.T982C						.						129.0	132.0	131.0					4																	23816124		2203	4300	6503	SO:0001583	missense	10891	exon8			TCTTTGATGGTGG	AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.982T>C	chr4.hg19:g.23816124A>G	ENSP00000264867:p.Ser328Pro	100.0	0.0		79.0	4.0	NM_013261	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	ENST00000264867.2	hg19	CCDS3429.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.388839	0.25118	.	.	ENSG00000109819	ENST00000264867	T	0.26957	1.7	6.06	2.11	0.27256	.	0.444709	0.24156	N	0.041025	T	0.11707	0.0285	N	0.13003	0.285	0.80722	D	1	P	0.48764	0.915	B	0.37650	0.255	T	0.10613	-1.0622	10	0.36615	T	0.2	-0.055	7.3728	0.26810	0.5074:0.1224:0.0:0.3702	.	328	Q9UBK2	PRGC1_HUMAN	P	328	ENSP00000264867:S328P	ENSP00000264867:S328P	S	-	1	0	PPARGC1A	23425222	0.972000	0.33761	0.581000	0.28614	0.915000	0.54546	1.094000	0.30951	0.126000	0.18424	-0.336000	0.08194	TCA	.	.		0.502	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214976.1	NM_013261	
PCDH7	5099	hgsc.bcm.edu	37	4	30724545	30724545	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:30724545T>C	ENST00000361762.2	+	1	2509	c.1501T>C	c.(1501-1503)Ttc>Ctc	p.F501L	PCDH7_ENST00000543491.1_Missense_Mutation_p.F501L	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	501	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CACCCGGGAGTTCAACGTGGT	0.592																																					p.F501L		Atlas-SNP	.											.	PCDH7	215	.	0			c.T1501C						.						73.0	60.0	65.0					4																	30724545		2203	4300	6503	SO:0001583	missense	5099	exon1			CGGGAGTTCAACG	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1501T>C	chr4.hg19:g.30724545T>C	ENSP00000355243:p.Phe501Leu	62.0	0.0		73.0	4.0	NM_032457	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	ENST00000361762.2	hg19	CCDS33971.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.45|16.45	3.125807|3.125807	0.56721|0.56721	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.52983|.	0.64;0.64|.	5.26|5.26	5.26|5.26	0.73747|0.73747	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	T|T	0.53818|0.53818	0.1820|0.1820	L|L	0.27053|0.27053	0.805|0.805	0.58432|0.58432	D|D	0.999993|0.999993	B;B;B|.	0.22604|.	0.059;0.059;0.072|.	B;B;B|.	0.32980|.	0.097;0.097;0.156|.	T|T	0.50668|0.50668	-0.8801|-0.8801	9|5	0.87932|.	D|.	0|.	.|.	15.3401|15.3401	0.74290|0.74290	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	501;454;501|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	L|A	501;501;454|190	ENSP00000355243:F501L;ENSP00000441802:F501L|.	ENSP00000330302:F454L|.	F|V	+|+	1|2	0|0	PCDH7|PCDH7	30333643|30333643	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.868000|7.868000	0.87116|0.87116	2.208000|2.208000	0.71279|0.71279	0.533000|0.533000	0.62120|0.62120	TTC|GTT	.	.		0.592	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
ARAP2	116984	hgsc.bcm.edu	37	4	36069848	36069848	+	Missense_Mutation	SNP	T	T	C	rs202134005		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:36069848T>C	ENST00000303965.4	-	33	5285	c.4796A>G	c.(4795-4797)gAg>gGg	p.E1599G		NM_015230.3	NP_056045.2	Q8WZ64	ARAP2_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2	1599					regulation of ARF GTPase activity (GO:0032312)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(32)|ovary(2)|pancreas(1)|prostate(3)|skin(7)|urinary_tract(1)	82						GTCCACGGACTCTTTATCACA	0.458																																					p.E1599G		Atlas-SNP	.											.	ARAP2	210	.	0			c.A4796G						.						78.0	82.0	81.0					4																	36069848		2203	4300	6503	SO:0001583	missense	116984	exon33			ACGGACTCTTTAT	AF411982	CCDS3441.1	4p15.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000047365	ENSG00000047365		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16924	protein-coding gene	gene with protein product		606645	"""centaurin, delta 1"""	CENTD1			Standard	NM_015230		Approved	PARX	uc003gsq.2	Q8WZ64	OTTHUMG00000097811	ENST00000303965.4:c.4796A>G	chr4.hg19:g.36069848T>C	ENSP00000302895:p.Glu1599Gly	59.0	0.0		57.0	4.0	NM_015230	Q4W5D2|Q7Z2L5|Q96L70|Q96P49|Q9Y4E4	Missense_Mutation	SNP	ENST00000303965.4	hg19	CCDS3441.1	.	.	.	.	.	.	.	.	.	.	T	5.928	0.355203	0.11239	.	.	ENSG00000047365	ENST00000303965	T	0.10099	2.91	6.08	-0.583	0.11706	.	0.707951	0.14215	N	0.333783	T	0.05502	0.0145	L	0.29908	0.895	0.09310	N	1	P	0.36282	0.546	B	0.30401	0.115	T	0.30534	-0.9975	10	0.62326	D	0.03	.	1.3284	0.02130	0.133:0.2237:0.1386:0.5047	.	1599	Q8WZ64	ARAP2_HUMAN	G	1599	ENSP00000302895:E1599G	ENSP00000302895:E1599G	E	-	2	0	ARAP2	35746243	0.309000	0.24518	0.000000	0.03702	0.001000	0.01503	1.463000	0.35277	-0.270000	0.09285	-1.137000	0.01932	GAG	.	T|0.999;A|0.001		0.458	ARAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215074.2	NM_015230	
NWD2	57495	hgsc.bcm.edu	37	4	37447599	37447599	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:37447599T>A	ENST00000309447.5	+	7	4837	c.3989T>A	c.(3988-3990)aTc>aAc	p.I1330N		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1330										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						AGAGGGGAAATCATTTACTCC	0.418																																					p.I1330N		Atlas-SNP	.											.	KIAA1239	79	.	0			c.T3989A						.						74.0	59.0	64.0					4																	37447599		692	1591	2283	SO:0001583	missense	57495	exon7			GGGAAATCATTTA																												ENST00000309447.5:c.3989T>A	chr4.hg19:g.37447599T>A	ENSP00000309501:p.Ile1330Asn	127.0	0.0		129.0	6.0	NM_001144990	A8MRU1	Missense_Mutation	SNP	ENST00000309447.5	hg19	CCDS47040.1	.	.	.	.	.	.	.	.	.	.	T	3.498	-0.102362	0.06967	.	.	ENSG00000174145	ENST00000309447	T	0.34667	1.35	6.17	5.01	0.66863	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.287880	0.34156	N	0.004220	T	0.16385	0.0394	N	0.08118	0	0.33473	D	0.586408	B	0.28128	0.201	B	0.21360	0.034	T	0.15954	-1.0419	10	0.32370	T	0.25	.	7.0054	0.24833	0.1328:0.0687:0.0:0.7985	.	1330	Q9ULI1	K1239_HUMAN	N	1330	ENSP00000309501:I1330N	ENSP00000309501:I1330N	I	+	2	0	KIAA1239	37123994	1.000000	0.71417	1.000000	0.80357	0.176000	0.22953	3.877000	0.56123	2.371000	0.80710	0.533000	0.62120	ATC	.	.		0.418	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347551.2		
AFP	174	hgsc.bcm.edu	37	4	74308085	74308085	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:74308085T>C	ENST00000395792.2	+	5	655	c.555T>C	c.(553-555)taT>taC	p.Y185Y	AFP_ENST00000226359.2_Silent_p.Y185Y	NM_001134.1	NP_001125.1	P02771	FETA_HUMAN	alpha-fetoprotein	185	Albumin 1. {ECO:0000255|PROSITE- ProRule:PRU00769}.				ovulation from ovarian follicle (GO:0001542)|progesterone metabolic process (GO:0042448)|SMAD protein signal transduction (GO:0060395)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|urinary_tract(1)	22	Breast(15;0.00102)		Epithelial(6;2.42e-05)|all cancers(17;0.000268)|OV - Ovarian serous cystadenocarcinoma(6;0.000324)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CTGCTCGCTATGACAAAATAA	0.383									Alpha-Fetoprotein, Hereditary Persistence of																												p.Y185Y		Atlas-SNP	.											.	AFP	60	.	0			c.T555C						.						97.0	92.0	94.0					4																	74308085		2203	4300	6503	SO:0001819	synonymous_variant	174	exon5	Familial Cancer Database	HPAFP	TCGCTATGACAAA	V01514	CCDS3556.1	4q13.3	2012-05-16			ENSG00000081051	ENSG00000081051			317	protein-coding gene	gene with protein product		104150		HPAFP			Standard	NM_001134		Approved	FETA	uc003hgz.1	P02771	OTTHUMG00000130011	ENST00000395792.2:c.555T>C	chr4.hg19:g.74308085T>C		114.0	0.0		63.0	4.0	NM_001134	B2RBU3	Silent	SNP	ENST00000395792.2	hg19	CCDS3556.1																																																																																			.	.		0.383	AFP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252284.3		
SDAD1	55153	hgsc.bcm.edu	37	4	76882410	76882410	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:76882410T>C	ENST00000356260.5	-	15	1351	c.1233A>G	c.(1231-1233)gaA>gaG	p.E411E	SDAD1_ENST00000513089.1_5'UTR|SDAD1_ENST00000395711.4_Silent_p.E374E	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	411					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGAGAAGTTCTTCAGTCATGG	0.383																																					p.E411E		Atlas-SNP	.											.	SDAD1	47	.	0			c.A1233G						.						147.0	133.0	138.0					4																	76882410		2203	4300	6503	SO:0001819	synonymous_variant	55153	exon15			AAGTTCTTCAGTC	AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1233A>G	chr4.hg19:g.76882410T>C		142.0	0.0		87.0	4.0	NM_018115	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	ENST00000356260.5	hg19	CCDS3573.2																																																																																			.	.		0.383	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252418.3	NM_018115	
FRAS1	80144	hgsc.bcm.edu	37	4	79204044	79204044	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:79204044A>G	ENST00000325942.6	+	12	1618	c.1178A>G	c.(1177-1179)gAg>gGg	p.E393G	FRAS1_ENST00000264899.6_Missense_Mutation_p.E393G|FRAS1_ENST00000264895.6_Missense_Mutation_p.E393G	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	393	VWFC 6. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACTTGCTACGAGCCCTCTTGC	0.552																																					p.E393G		Atlas-SNP	.											.	FRAS1	779	.	0			c.A1178G						.						82.0	88.0	86.0					4																	79204044		2017	4169	6186	SO:0001583	missense	80144	exon12			GCTACGAGCCCTC	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1178A>G	chr4.hg19:g.79204044A>G	ENSP00000326330:p.Glu393Gly	131.0	0.0		97.0	6.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.83|10.83	1.461386|1.461386	0.26248|0.26248	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899;ENST00000534913|ENST00000502446	T;T;T|.	0.55588|.	0.51;0.51;0.51|.	5.6|5.6	4.43|4.43	0.53597|0.53597	von Willebrand factor, type C (3);|.	0.378731|.	0.26944|.	N|.	0.021701|.	T|T	0.41465|0.41465	0.1160|0.1160	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	0.999999|0.999999	B;B;P;P|.	0.37914|.	0.088;0.228;0.611;0.61|.	B;B;B;B|.	0.36186|.	0.045;0.071;0.159;0.219|.	T|T	0.30387|0.30387	-0.9980|-0.9980	10|5	0.25751|.	T|.	0.34|.	.|.	6.7757|6.7757	0.23619|0.23619	0.6439:0.281:0.0751:0.0|0.6439:0.281:0.0751:0.0	.|.	393;393;393;393|.	E9PHH6;Q86XX4;E7EWM9;A2RRR8|.	.;FRAS1_HUMAN;.;.|.	G|G	393;393;393;133|322	ENSP00000326330:E393G;ENSP00000264895:E393G;ENSP00000264899:E393G|.	ENSP00000264895:E393G|.	E|S	+|+	2|1	0|0	FRAS1|FRAS1	79423068|79423068	0.986000|0.986000	0.35501|0.35501	0.938000|0.938000	0.37757|0.37757	0.180000|0.180000	0.23129|0.23129	1.302000|1.302000	0.33459|0.33459	2.127000|2.127000	0.65507|0.65507	0.460000|0.460000	0.39030|0.39030	GAG|AGC	.	.		0.552	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
PRKG2	5593	hgsc.bcm.edu	37	4	82027009	82027009	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:82027009T>C	ENST00000395578.1	-	16	2137	c.2021A>G	c.(2020-2022)aAg>aGg	p.K674R	PRKG2_ENST00000264399.1_Missense_Mutation_p.K674R|PRKG2_ENST00000509169.1_5'UTR|PRKG2_ENST00000545647.1_Missense_Mutation_p.K254R|PRKG2_ENST00000418486.2_Missense_Mutation_p.K645R			Q13237	KGP2_HUMAN	protein kinase, cGMP-dependent, type II	674	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|circadian regulation of gene expression (GO:0032922)|nitric oxide metabolic process (GO:0046209)|protein phosphorylation (GO:0006468)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)|protein kinase activity (GO:0004672)			NS(1)|breast(4)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	37						TCGTGTTATCTTCCTGGGAAA	0.423																																					p.K674R		Atlas-SNP	.											.	PRKG2	195	.	0			c.A2021G						.						132.0	126.0	128.0					4																	82027009		2203	4300	6503	SO:0001583	missense	5593	exon15			GTTATCTTCCTGG	X94612	CCDS3589.1, CCDS75150.1	4q13.1-q21.1	2009-07-10			ENSG00000138669	ENSG00000138669	2.7.11.1		9416	protein-coding gene	gene with protein product		601591				7498513	Standard	XM_005263126		Approved	cGKII, PRKGR2	uc003hmh.2	Q13237	OTTHUMG00000130296	ENST00000395578.1:c.2021A>G	chr4.hg19:g.82027009T>C	ENSP00000378945:p.Lys674Arg	142.0	0.0		92.0	4.0	NM_006259	B4DMX3|E7EPE6|O00125|O60916	Missense_Mutation	SNP	ENST00000395578.1	hg19	CCDS3589.1	.	.	.	.	.	.	.	.	.	.	t	9.445	1.089091	0.20390	.	.	ENSG00000138669	ENST00000395578;ENST00000264399;ENST00000418486;ENST00000545647	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.175610	0.64402	D	0.000011	T	0.43590	0.1254	N	0.21617	0.685	0.46203	D	0.998929	B;B	0.06786	0.0;0.001	B;B	0.12837	0.005;0.008	T	0.34700	-0.9818	10	0.19147	T	0.46	-25.3915	7.7601	0.28946	0.1355:0.0:0.1409:0.7236	.	645;674	E7EPE6;Q13237	.;KGP2_HUMAN	R	674;674;645;254	ENSP00000378945:K674R;ENSP00000264399:K674R;ENSP00000389038:K645R;ENSP00000439967:K254R	ENSP00000264399:K674R	K	-	2	0	PRKG2	82246033	0.948000	0.32251	1.000000	0.80357	0.933000	0.57130	1.311000	0.33562	2.064000	0.61679	0.402000	0.26972	AAG	.	.		0.423	PRKG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252639.1	NM_006259	
SEC31A	22872	hgsc.bcm.edu	37	4	83778913	83778913	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:83778913A>G	ENST00000395310.2	-	15	1813	c.1631T>C	c.(1630-1632)aTt>aCt	p.I544T	SEC31A_ENST00000432794.1_Missense_Mutation_p.I544T|SEC31A_ENST00000505984.1_Missense_Mutation_p.I505T|SEC31A_ENST00000264405.5_Missense_Mutation_p.I277T|SEC31A_ENST00000500777.2_Missense_Mutation_p.I505T|SEC31A_ENST00000509142.1_Missense_Mutation_p.I544T|SEC31A_ENST00000448323.1_Missense_Mutation_p.I544T|SEC31A_ENST00000508479.1_Missense_Mutation_p.I544T|SEC31A_ENST00000326950.5_Missense_Mutation_p.I505T|SEC31A_ENST00000443462.2_Missense_Mutation_p.I539T|SEC31A_ENST00000348405.4_Missense_Mutation_p.I505T|SEC31A_ENST00000508502.1_Missense_Mutation_p.I544T|SEC31A_ENST00000355196.2_Missense_Mutation_p.I544T|SEC31A_ENST00000311785.7_Missense_Mutation_p.I544T|SEC31A_ENST00000505472.1_Missense_Mutation_p.I544T|SEC31A_ENST00000513858.1_Missense_Mutation_p.I505T	NM_001077207.2|NM_001077208.2|NM_014933.3	NP_001070675.1|NP_001070676.1|NP_055748.2	O94979	SC31A_HUMAN	SEC31 homolog A (S. cerevisiae)	544					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|response to calcium ion (GO:0051592)	COPII vesicle coat (GO:0030127)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle (GO:0030134)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|vesicle coat (GO:0030120)	calcium-dependent protein binding (GO:0048306)	p.I544T(1)	SEC31A/ALK(3)|SEC31A/JAK2(4)	breast(1)	1		Hepatocellular(203;0.114)				TTCCTCTTTAATGTGCTAAAG	0.323																																					p.I544T		Atlas-SNP	.											SEC31A_ENST00000395310,NS,malignant_melanoma,0,1	SEC31A	227	.	1	Substitution - Missense(1)	NS(1)	c.T1631C						.						92.0	97.0	96.0					4																	83778913		2203	4300	6503	SO:0001583	missense	22872	exon15			TCTTTAATGTGCT	AB018358	CCDS3596.1, CCDS3597.1, CCDS43244.1, CCDS47088.1, CCDS54773.1, CCDS75155.1, CCDS75156.1	4q21.3	2013-01-10	2006-10-05	2006-09-07	ENSG00000138674	ENSG00000138674		"""WD repeat domain containing"""	17052	protein-coding gene	gene with protein product		610257	"""SEC31-like 1 (S. cerevisiae)"", ""Sec31 homolog A (S. cerevisiae)"""	SEC31L1		10048485, 10788476	Standard	NM_001077206		Approved	KIAA0905, ABP125, ABP130	uc003hnh.3	O94979	OTTHUMG00000130297	ENST00000395310.2:c.1631T>C	chr4.hg19:g.83778913A>G	ENSP00000378721:p.Ile544Thr	50.0	0.0		21.0	2.0	NM_001077206	B4DIW6|B7ZKZ7|B7ZL00|H7C2W3|Q17RR5|Q5H9P6|Q5XG74|Q659G7|Q6ZU90|Q7LCX9|Q86TJ0|Q8IZH4|Q9P048|Q9P0A6|Q9UM05|Q9UM06	Missense_Mutation	SNP	ENST00000395310.2	hg19	CCDS3596.1	.	.	.	.	.	.	.	.	.	.	A	0.943	-0.709004	0.03230	.	.	ENSG00000138674	ENST00000348405;ENST00000513858;ENST00000395310;ENST00000443462;ENST00000509142;ENST00000432794;ENST00000448323;ENST00000326950;ENST00000311785;ENST00000505472;ENST00000500777;ENST00000508502;ENST00000355196;ENST00000264405;ENST00000505984;ENST00000508479;ENST00000510167	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.37058	1.43;1.27;2.46;2.47;1.31;2.35;2.46;1.43;1.31;1.22;1.27;2.46;2.46;3.31;2.42;2.34;2.29	5.85	0.223	0.15292	.	0.923261	0.09376	N	0.810635	T	0.15696	0.0378	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B;B;B;B;B	0.15473	0.0;0.0;0.0;0.013;0.0;0.012;0.001;0.0;0.001	B;B;B;B;B;B;B;B;B	0.13407	0.001;0.0;0.001;0.009;0.001;0.009;0.002;0.001;0.004	T	0.31861	-0.9928	10	0.02654	T	1	-0.7542	1.8387	0.03145	0.5093:0.1293:0.2359:0.1255	.	539;505;544;505;505;544;544;544;277	B4DIW6;B7ZL00;D6RHZ5;O94979-6;O94979-4;O94979-3;O94979-2;O94979;O94979-7	.;.;.;.;.;.;.;SC31A_HUMAN;.	T	505;505;544;539;544;544;544;505;544;544;505;544;544;277;505;544;132	ENSP00000337602:I505T;ENSP00000426886:I505T;ENSP00000378721:I544T;ENSP00000408027:I539T;ENSP00000426569:I544T;ENSP00000407944:I544T;ENSP00000400926:I544T;ENSP00000325087:I505T;ENSP00000309070:I544T;ENSP00000421633:I544T;ENSP00000421464:I505T;ENSP00000424635:I544T;ENSP00000347329:I544T;ENSP00000264405:I277T;ENSP00000424451:I505T;ENSP00000425999:I544T;ENSP00000422267:I132T	ENSP00000264405:I277T	I	-	2	0	SEC31A	83997937	0.000000	0.05858	0.402000	0.26371	0.850000	0.48378	0.107000	0.15375	0.444000	0.26612	0.533000	0.62120	ATT	.	.		0.323	SEC31A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252640.1	NM_016211	
AFF1	4299	hgsc.bcm.edu	37	4	88052964	88052964	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:88052964T>A	ENST00000307808.6	+	17	3520	c.3100T>A	c.(3100-3102)Tcc>Acc	p.S1034T	AFF1_ENST00000395146.4_Missense_Mutation_p.S1041T|AFF1_ENST00000544085.1_Missense_Mutation_p.S672T	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	1034					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		GTCATTAAAATCCTTCTCAGA	0.308																																					p.S1041T		Atlas-SNP	.											.	AFF1	102	.	0			c.T3121A						.						110.0	106.0	107.0					4																	88052964		2203	4300	6503	SO:0001583	missense	4299	exon18			TTAAAATCCTTCT	L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.3100T>A	chr4.hg19:g.88052964T>A	ENSP00000305689:p.Ser1034Thr	181.0	0.0		104.0	19.0	NM_001166693	B4DTU1|E9PBM3	Missense_Mutation	SNP	ENST00000307808.6	hg19	CCDS3616.1	.	.	.	.	.	.	.	.	.	.	T	0.509	-0.867598	0.02590	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.63913	-0.07;-0.07;-0.07	5.42	1.47	0.22746	.	0.646159	0.15139	N	0.278410	T	0.43523	0.1251	L	0.37850	1.14	0.24807	N	0.992668	B;B;B	0.21071	0.051;0.051;0.051	B;B;B	0.21151	0.033;0.033;0.033	T	0.19160	-1.0314	10	0.19147	T	0.46	-6.1251	3.4385	0.07454	0.2542:0.2297:0.0:0.5161	.	1041;1034;1034	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	T	1041;1034;672	ENSP00000378578:S1041T;ENSP00000305689:S1034T;ENSP00000440843:S672T	ENSP00000305689:S1034T	S	+	1	0	AFF1	88271988	0.997000	0.39634	0.997000	0.53966	0.046000	0.14306	0.140000	0.16056	0.374000	0.24650	-0.290000	0.09829	TCC	.	.		0.308	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253053.3	NM_005935	
MEPE	56955	hgsc.bcm.edu	37	4	88766777	88766777	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:88766777T>C	ENST00000424957.3	+	4	830	c.757T>C	c.(757-759)Tct>Cct	p.S253P	MEPE_ENST00000361056.3_Missense_Mutation_p.S253P|MEPE_ENST00000540395.1_Missense_Mutation_p.S140P|MEPE_ENST00000497649.2_Missense_Mutation_p.S229P|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000395102.4_Missense_Mutation_p.S284P|MEPE_ENST00000560249.1_Missense_Mutation_p.S140P	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	253					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		CAATGATATATCTCCTTTCAG	0.428																																					p.S253P		Atlas-SNP	.											.	MEPE	86	.	0			c.T757C						.						67.0	68.0	68.0					4																	88766777		2203	4300	6503	SO:0001583	missense	56955	exon4			GATATATCTCCTT	AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.757T>C	chr4.hg19:g.88766777T>C	ENSP00000416984:p.Ser253Pro	118.0	0.0		78.0	4.0	NM_020203	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Missense_Mutation	SNP	ENST00000424957.3	hg19	CCDS3625.1	.	.	.	.	.	.	.	.	.	.	T	9.418	1.082280	0.20309	.	.	ENSG00000152595	ENST00000535138;ENST00000424957;ENST00000395102;ENST00000497649;ENST00000540395;ENST00000361056	T;T;T;T;T	0.54866	0.56;0.57;0.55;0.57;0.56	4.7	-2.57	0.06248	.	1.040440	0.07586	N	0.921176	T	0.39279	0.1072	L	0.47716	1.5	0.09310	N	1	B	0.31931	0.347	B	0.35353	0.201	T	0.33214	-0.9877	10	0.35671	T	0.21	0.7078	0.6275	0.00788	0.1777:0.2003:0.3115:0.3105	.	253	Q9NQ76	MEPE_HUMAN	P	253;253;284;229;140;253	ENSP00000416984:S253P;ENSP00000378534:S284P;ENSP00000422747:S229P;ENSP00000443491:S140P;ENSP00000354341:S253P	ENSP00000354341:S253P	S	+	1	0	MEPE	88985801	0.000000	0.05858	0.000000	0.03702	0.596000	0.36781	0.060000	0.14342	-0.600000	0.05790	0.459000	0.35465	TCT	.	.		0.428	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253038.1		
SPRY1	10252	hgsc.bcm.edu	37	4	124323669	124323669	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:124323669A>G	ENST00000394339.2	+	2	1263	c.923A>G	c.(922-924)gAg>gGg	p.E308G	SPRY1_ENST00000339241.1_Missense_Mutation_p.E308G	NM_001258039.1|NM_005841.2	NP_001244968.1|NP_005832.1	O43609	SPY1_HUMAN	sprouty homolog 1, antagonist of FGF signaling (Drosophila)	308	Cys-rich.				epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				NS(1)|large_intestine(4)|lung(2)|ovary(1)|skin(3)	11						TGTAAGCTGGAGAGCTGCCCC	0.488																																					p.E308G		Atlas-SNP	.											.	SPRY1	28	.	0			c.A923G						.						90.0	93.0	92.0					4																	124323669		2203	4300	6503	SO:0001583	missense	10252	exon2			AGCTGGAGAGCTG	AF041037	CCDS3731.1	4q	2009-04-17	2001-11-28		ENSG00000164056	ENSG00000164056			11269	protein-coding gene	gene with protein product		602465	"""sprouty (Drosophila) homolog 1 (antagonist of FGF signaling)"""			9458049, 15962011	Standard	NM_001258038		Approved	hSPRY1	uc003ifa.4	O43609	OTTHUMG00000133071	ENST00000394339.2:c.923A>G	chr4.hg19:g.124323669A>G	ENSP00000377871:p.Glu308Gly	132.0	0.0		92.0	4.0	NM_001258039	D3DNX6|Q6PNE0	Missense_Mutation	SNP	ENST00000394339.2	hg19	CCDS3731.1	.	.	.	.	.	.	.	.	.	.	A	13.52	2.260928	0.39995	.	.	ENSG00000164056	ENST00000339241;ENST00000394339	T;T	0.56611	0.45;0.45	5.06	2.6	0.31112	.	0.151388	0.42172	D	0.000748	T	0.35038	0.0918	L	0.36672	1.1	0.39071	D	0.960712	P	0.37781	0.608	B	0.32980	0.156	T	0.10520	-1.0626	9	.	.	.	-7.9472	7.2843	0.26328	0.7778:0.1462:0.0759:0.0	.	308	O43609	SPY1_HUMAN	G	308	ENSP00000343785:E308G;ENSP00000377871:E308G	.	E	+	2	0	SPRY1	124543119	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.897000	0.63231	0.393000	0.25203	0.459000	0.35465	GAG	.	.		0.488	SPRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256711.1		
ANKRD50	57182	hgsc.bcm.edu	37	4	125592939	125592939	+	Missense_Mutation	SNP	T	T	C	rs200716397		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:125592939T>C	ENST00000504087.1	-	4	2530	c.1493A>G	c.(1492-1494)cAg>cGg	p.Q498R	ANKRD50_ENST00000515641.1_Missense_Mutation_p.Q319R	NM_020337.2	NP_065070.1	Q9ULJ7	ANR50_HUMAN	ankyrin repeat domain 50	498										NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(14)|lung(18)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	55						AACCAACAGCTGTAGCACTTC	0.448																																					p.Q498R		Atlas-SNP	.											.	ANKRD50	136	.	0			c.A1493G						.						96.0	92.0	93.0					4																	125592939		2203	4300	6503	SO:0001583	missense	57182	exon4			AACAGCTGTAGCA	AB033049	CCDS34060.1, CCDS54802.1	4q28.1	2013-01-10			ENSG00000151458	ENSG00000151458		"""Ankyrin repeat domain containing"""	29223	protein-coding gene	gene with protein product							Standard	NM_020337		Approved	KIAA1223	uc010inw.3	Q9ULJ7	OTTHUMG00000161398	ENST00000504087.1:c.1493A>G	chr4.hg19:g.125592939T>C	ENSP00000425658:p.Gln498Arg	116.0	0.0		76.0	4.0	NM_020337	A8K4V3|B4DHJ6|E9PDW0|Q6N064|Q6ZSE6	Missense_Mutation	SNP	ENST00000504087.1	hg19	CCDS34060.1	.	.	.	.	.	.	.	.	.	.	T	13.04	2.117095	0.37339	.	.	ENSG00000151458	ENST00000504087;ENST00000515641	T;T	0.62639	0.01;2.4	4.93	4.93	0.64822	Ankyrin repeat-containing domain (3);	0.140256	0.49305	D	0.000151	T	0.47284	0.1437	N	0.20357	0.565	0.58432	D	0.999997	B	0.22414	0.069	B	0.28709	0.093	T	0.38845	-0.9642	10	0.13108	T	0.6	.	14.7385	0.69434	0.0:0.0:0.0:1.0	.	498	Q9ULJ7	ANR50_HUMAN	R	498;319	ENSP00000425658:Q498R;ENSP00000425355:Q319R	ENSP00000425658:Q498R	Q	-	2	0	ANKRD50	125812389	1.000000	0.71417	0.997000	0.53966	0.711000	0.40976	7.365000	0.79537	2.083000	0.62718	0.454000	0.30748	CAG	.	T|0.999;C|0.001		0.448	ANKRD50-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364775.1	NM_020337	
UCP1	7350	hgsc.bcm.edu	37	4	141484605	141484605	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:141484605C>T	ENST00000262999.3	-	3	468	c.393G>A	c.(391-393)ggG>ggA	p.G131G		NM_021833.4	NP_068605.1	P25874	UCP1_HUMAN	uncoupling protein 1 (mitochondrial, proton carrier)	131					brown fat cell differentiation (GO:0050873)|cellular metabolic process (GO:0044237)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|stomach(1)	16	all_hematologic(180;0.162)					CTGTGGGTTGCCCAATGAATA	0.433																																					p.G131G		Atlas-SNP	.											.	UCP1	33	.	0			c.G393A						.						119.0	104.0	109.0					4																	141484605		2203	4300	6503	SO:0001819	synonymous_variant	7350	exon3			GGGTTGCCCAATG	X51955	CCDS3753.1	4q28-q31	2013-05-22			ENSG00000109424	ENSG00000109424		"""Solute carriers"""	12517	protein-coding gene	gene with protein product		113730		UCP		2380264	Standard	NM_021833		Approved	SLC25A7	uc011chj.2	P25874	OTTHUMG00000133415	ENST00000262999.3:c.393G>A	chr4.hg19:g.141484605C>T		110.0	0.0		72.0	32.0	NM_021833	Q13218|Q4KMZ3|Q68G66	Silent	SNP	ENST00000262999.3	hg19	CCDS3753.1																																																																																			.	.		0.433	UCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257273.1		
RNF150	57484	hgsc.bcm.edu	37	4	141888829	141888829	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:141888829A>G	ENST00000515673.2	-	2	716	c.683T>C	c.(682-684)gTc>gCc	p.V228A	RNF150_ENST00000379512.2_Missense_Mutation_p.V87A|RNF150_ENST00000507500.1_Missense_Mutation_p.V228A|RNF150_ENST00000420921.2_Missense_Mutation_p.V87A|RNF150_ENST00000515057.1_5'UTR|RNF150_ENST00000306799.3_Intron			Q9ULK6	RN150_HUMAN	ring finger protein 150	228						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|large_intestine(10)|lung(7)|ovary(1)	19	all_hematologic(180;0.162)					GTAATAAAAGACGAGCCATGC	0.408																																					p.V228A		Atlas-SNP	.											.	RNF150	94	.	0			c.T683C						.						110.0	105.0	107.0					4																	141888829		2203	4300	6503	SO:0001583	missense	57484	exon2			TAAAAGACGAGCC	AB033040	CCDS34065.1	4q31.1	2013-01-09			ENSG00000170153	ENSG00000170153		"""RING-type (C3HC4) zinc fingers"""	23138	protein-coding gene	gene with protein product						10574462	Standard	XM_005263150		Approved	KIAA1214	uc003iio.1	Q9ULK6	OTTHUMG00000161380	ENST00000515673.2:c.683T>C	chr4.hg19:g.141888829A>G	ENSP00000425840:p.Val228Ala	124.0	0.0		97.0	5.0	NM_020724	Q3T1D0|Q6ZNW6	Missense_Mutation	SNP	ENST00000515673.2	hg19	CCDS34065.1	.	.	.	.	.	.	.	.	.	.	A	28.3	4.909328	0.92107	.	.	ENSG00000170153	ENST00000379512;ENST00000420921;ENST00000515673;ENST00000507500;ENST00000506101	T;T;T;T;T	0.16073	2.37;2.37;3.35;3.38;2.4	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.31888	0.0811	L	0.39245	1.2	0.80722	D	1	P;D	0.63880	0.729;0.993	B;P	0.62298	0.444;0.9	T	0.00896	-1.1523	10	0.48119	T	0.1	.	16.6277	0.84984	1.0:0.0:0.0:0.0	.	228;228	Q9ULK6-3;Q9ULK6	.;RN150_HUMAN	A	87;87;228;228;59	ENSP00000368827:V87A;ENSP00000394581:V87A;ENSP00000425840:V228A;ENSP00000425568:V228A;ENSP00000425947:V59A	ENSP00000368827:V87A	V	-	2	0	RNF150	142108279	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.330000	0.79161	0.528000	0.53228	GTC	.	.		0.408	RNF150-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364739.2	XM_291090	
POU4F2	5458	hgsc.bcm.edu	37	4	147561644	147561644	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:147561644T>C	ENST00000281321.3	+	2	1162	c.914T>C	c.(913-915)cTc>cCc	p.L305P	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	305	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					TTCGAGTCCCTCACACTGTCC	0.617																																					p.L305P		Atlas-SNP	.											.	POU4F2	83	.	0			c.T914C						.						76.0	77.0	76.0					4																	147561644		2203	4300	6503	SO:0001583	missense	5458	exon2			AGTCCCTCACACT	U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.914T>C	chr4.hg19:g.147561644T>C	ENSP00000281321:p.Leu305Pro	76.0	0.0		51.0	4.0	NM_004575	B1PJR6|B2RC84|Q13883|Q14987	Missense_Mutation	SNP	ENST00000281321.3	hg19	CCDS34074.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472386	0.63737	.	.	ENSG00000151615	ENST00000281321	D	0.86865	-2.18	5.37	5.37	0.77165	POU-specific (4);Lambda repressor-like, DNA-binding (2);POU (1);	0.000000	0.85682	D	0.000000	D	0.94925	0.8359	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96064	0.9041	10	0.87932	D	0	.	15.3779	0.74625	0.0:0.0:0.0:1.0	.	305	Q12837	PO4F2_HUMAN	P	305	ENSP00000281321:L305P	ENSP00000281321:L305P	L	+	2	0	POU4F2	147781094	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	8.018000	0.88722	2.045000	0.60652	0.459000	0.35465	CTC	.	.		0.617	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367020.1	NM_004575	
TTC29	83894	hgsc.bcm.edu	37	4	147860979	147860979	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:147860979A>G	ENST00000325106.4	-	3	295	c.69T>C	c.(67-69)ccT>ccC	p.P23P	TTC29_ENST00000398886.4_Silent_p.P49P|RP11-292D4.2_ENST00000515530.1_RNA|TTC29_ENST00000513335.1_Silent_p.P49P	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	23										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TGGAGGAGCAAGGCAGCTTCT	0.433																																					p.P23P		Atlas-SNP	.											.	TTC29	63	.	0			c.T69C						.						79.0	84.0	83.0					4																	147860979		1871	4097	5968	SO:0001819	synonymous_variant	83894	exon3			GGAGCAAGGCAGC	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.69T>C	chr4.hg19:g.147860979A>G		175.0	0.0		74.0	4.0	NM_031956	A4GU95|Q9BXB6	Silent	SNP	ENST00000325106.4	hg19	CCDS47141.1																																																																																			.	.		0.433	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956	
LRBA	987	hgsc.bcm.edu	37	4	151773418	151773418	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:151773418A>G	ENST00000357115.3	-	23	3687	c.3444T>C	c.(3442-3444)ttT>ttC	p.F1148F	LRBA_ENST00000510413.1_Silent_p.F1148F|LRBA_ENST00000535741.1_Silent_p.F1148F|LRBA_ENST00000507224.1_Silent_p.F1148F	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1148						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CATCATTACCAAACATGTCCA	0.388																																					p.F1148F		Atlas-SNP	.											.	LRBA	253	.	0			c.T3444C						.						85.0	85.0	85.0					4																	151773418		2203	4300	6503	SO:0001819	synonymous_variant	987	exon23			ATTACCAAACATG	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3444T>C	chr4.hg19:g.151773418A>G		118.0	0.0		52.0	4.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Silent	SNP	ENST00000357115.3	hg19	CCDS3773.1																																																																																			.	.		0.388	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
DCHS2	54798	hgsc.bcm.edu	37	4	155156115	155156115	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:155156115T>C	ENST00000357232.4	-	25	8323	c.8324A>G	c.(8323-8325)gAc>gGc	p.D2775G		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2775					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GTGATAGTTGTCTTTTCCATC	0.398																																					p.D2775G		Atlas-SNP	.											.	DCHS2	594	.	0			c.A8324G						.						109.0	106.0	107.0					4																	155156115		2203	4300	6503	SO:0001583	missense	54798	exon25			TAGTTGTCTTTTC	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8324A>G	chr4.hg19:g.155156115T>C	ENSP00000349768:p.Asp2775Gly	171.0	0.0		89.0	4.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	C	10.19	1.283224	0.23392	.	.	ENSG00000197410	ENST00000357232	T	0.29397	1.57	5.94	3.23	0.37069	.	0.755250	0.12439	N	0.468821	T	0.07188	0.0182	N	0.00446	-1.495	0.48452	D	0.999652	B	0.02656	0.0	B	0.01281	0.0	T	0.32693	-0.9897	10	0.02654	T	1	.	7.7008	0.28621	0.2363:0.6398:0.0:0.1239	.	2775	Q6V1P9	PCD23_HUMAN	G	2775	ENSP00000349768:D2775G	ENSP00000349768:D2775G	D	-	2	0	DCHS2	155375565	0.000000	0.05858	0.001000	0.08648	0.921000	0.55340	0.489000	0.22387	0.113000	0.18004	-0.226000	0.12346	GAC	.	.		0.398	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DCHS2	54798	hgsc.bcm.edu	37	4	155278418	155278418	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:155278418T>C	ENST00000357232.4	-	6	752	c.753A>G	c.(751-753)gaA>gaG	p.E251E	DCHS2_ENST00000339452.1_Intron	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	251	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		tgttcattacttccttgtctg	0.433																																					p.E251E		Atlas-SNP	.											.	DCHS2	594	.	0			c.A753G						.						138.0	144.0	142.0					4																	155278418		2203	4300	6503	SO:0001819	synonymous_variant	54798	exon6			CATTACTTCCTTG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.753A>G	chr4.hg19:g.155278418T>C		42.0	0.0		33.0	4.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000357232.4	hg19	CCDS3785.1																																																																																			.	.		0.433	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
DDX60L	91351	hgsc.bcm.edu	37	4	169282339	169282339	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:169282339T>C	ENST00000511577.1	-	37	5199	c.4952A>G	c.(4951-4953)aAg>aGg	p.K1651R	DDX60L_ENST00000260184.7_Missense_Mutation_p.K1651R			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1651							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTTCAAACACTTTAAAAGCTG	0.279																																					p.K1651R		Atlas-SNP	.											DDX60L,colon,carcinoma,0,1	DDX60L	116	.	0			c.A4952G						.						85.0	78.0	80.0					4																	169282339		1817	4084	5901	SO:0001583	missense	91351	exon37			AAACACTTTAAAA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.4952A>G	chr4.hg19:g.169282339T>C	ENSP00000422423:p.Lys1651Arg	113.0	0.0		94.0	4.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.	.	.	.	.	.	.	.	.	.	T	0.165	-1.077056	0.01903	.	.	ENSG00000181381	ENST00000260184;ENST00000511577	T;T	0.17054	2.3;2.3	2.06	-4.12	0.03916	.	.	.	.	.	T	0.05868	0.0153	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.24440	-1.0160	9	0.27785	T	0.31	.	0.815	0.01100	0.4195:0.2578:0.1442:0.1785	.	1651	Q5H9U9	DDX6L_HUMAN	R	1651	ENSP00000260184:K1651R;ENSP00000422423:K1651R	ENSP00000260184:K1651R	K	-	2	0	DDX60L	169518914	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-3.425000	0.00475	-2.886000	0.00317	-0.756000	0.03474	AAG	.	.		0.279	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DDX60L	91351	hgsc.bcm.edu	37	4	169317190	169317190	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:169317190T>C	ENST00000511577.1	-	27	3824	c.3577A>G	c.(3577-3579)Aag>Gag	p.K1193E	DDX60L_ENST00000260184.7_Missense_Mutation_p.K1193E|DDX60L_ENST00000505890.1_Missense_Mutation_p.K1194E			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	1193							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TCCAGAATCTTCAGATTCTCC	0.338																																					p.K1193E		Atlas-SNP	.											.	DDX60L	116	.	0			c.A3577G						.						77.0	70.0	72.0					4																	169317190		1799	4067	5866	SO:0001583	missense	91351	exon27			GAATCTTCAGATT	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.3577A>G	chr4.hg19:g.169317190T>C	ENSP00000422423:p.Lys1193Glu	207.0	0.0		146.0	6.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.222|3.222	-0.159294|-0.159294	0.06544|0.06544	.|.	.|.	ENSG00000181381|ENSG00000181381	ENST00000514580|ENST00000260184;ENST00000511577;ENST00000505890	.|T;T;T	.|0.41065	.|1.01;1.01;2.21	1.91|1.91	-0.84|-0.84	0.10755|0.10755	.|.	.|0.177811	.|0.25906	.|N	.|0.027530	T|T	0.15739|0.15739	0.0379|0.0379	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.10296	.|0.003;0.001;0.003	.|B;B;B	.|0.09377	.|0.004;0.003;0.004	T|T	0.22626|0.22626	-1.0211|-1.0211	5|10	.|0.11485	.|T	.|0.65	.|.	5.5504|5.5504	0.17087|0.17087	0.0:0.3043:0.0:0.6957|0.0:0.3043:0.0:0.6957	.|.	.|1193;1194;1193	.|E9PAP8;D6R906;Q5H9U9	.|.;.;DDX6L_HUMAN	G|E	80|1193;1193;1194	.|ENSP00000260184:K1193E;ENSP00000422423:K1193E;ENSP00000422202:K1194E	.|ENSP00000260184:K1193E	E|K	-|-	2|1	0|0	DDX60L|DDX60L	169553765|169553765	0.965000|0.965000	0.33210|0.33210	0.001000|0.001000	0.08648|0.08648	0.024000|0.024000	0.10985|0.10985	1.677000|1.677000	0.37576|0.37576	-0.190000|-0.190000	0.10465|0.10465	0.260000|0.260000	0.18958|0.18958	GAA|AAG	.	.		0.338	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
ASB5	140458	hgsc.bcm.edu	37	4	177190150	177190150	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:177190150A>G	ENST00000296525.3	-	1	223	c.110T>C	c.(109-111)aTc>aCc	p.I37T		NM_080874.3	NP_543150.1	Q8WWX0	ASB5_HUMAN	ankyrin repeat and SOCS box containing 5	37					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(2)|kidney(1)|large_intestine(9)|lung(18)|prostate(2)|skin(2)	34		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.13e-20)|Epithelial(43;9.94e-18)|OV - Ovarian serous cystadenocarcinoma(60;2e-09)|GBM - Glioblastoma multiforme(59;0.000254)|STAD - Stomach adenocarcinoma(60;0.000653)|LUSC - Lung squamous cell carcinoma(193;0.0393)		ATGACTGAGGATGGCAAGGCT	0.393																																					p.I37T		Atlas-SNP	.											.	ASB5	88	.	0			c.T110C						.						111.0	102.0	105.0					4																	177190150		2203	4300	6503	SO:0001583	missense	140458	exon1			CTGAGGATGGCAA	AY057053	CCDS3827.1	4q34.1	2013-01-10	2011-01-25		ENSG00000164122	ENSG00000164122		"""Ankyrin repeat domain containing"""	17180	protein-coding gene	gene with protein product		615050	"""ankyrin repeat and SOCS box-containing 5"""				Standard	NM_080874		Approved		uc003iuq.2	Q8WWX0	OTTHUMG00000160793	ENST00000296525.3:c.110T>C	chr4.hg19:g.177190150A>G	ENSP00000296525:p.Ile37Thr	101.0	0.0		77.0	4.0	NM_080874	Q8N7B5	Missense_Mutation	SNP	ENST00000296525.3	hg19	CCDS3827.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.807455	0.90623	.	.	ENSG00000164122	ENST00000296525	T	0.39406	1.08	5.84	5.84	0.93424	.	0.052352	0.64402	D	0.000001	T	0.45155	0.1328	L	0.36672	1.1	0.80722	D	1	D	0.53151	0.958	P	0.49502	0.613	T	0.45527	-0.9255	10	0.87932	D	0	-24.5455	16.2233	0.82274	1.0:0.0:0.0:0.0	.	37	Q8WWX0	ASB5_HUMAN	T	37	ENSP00000296525:I37T	ENSP00000296525:I37T	I	-	2	0	ASB5	177427144	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.328000	0.96403	2.243000	0.73865	0.482000	0.46254	ATC	.	.		0.393	ASB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362344.1		
FAM149A	25854	hgsc.bcm.edu	37	4	187077241	187077241	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:187077241T>C	ENST00000356371.5	+	7	1344	c.1344T>C	c.(1342-1344)tgT>tgC	p.C448C	FAM149A_ENST00000514153.1_Silent_p.C157C|FAM149A_ENST00000227065.4_Silent_p.C157C|FAM149A_ENST00000389354.5_Silent_p.C157C|FAM149A_ENST00000514829.1_3'UTR|FAM149A_ENST00000502970.1_Silent_p.C157C|FAM149A_ENST00000503432.1_Silent_p.C157C			A5PLN7	F149A_HUMAN	family with sequence similarity 149, member A	448										breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(2)	25		all_cancers(14;4.27e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.0066)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.19e-10)|BRCA - Breast invasive adenocarcinoma(30;1.22e-05)|GBM - Glioblastoma multiforme(59;0.000122)|STAD - Stomach adenocarcinoma(60;0.000288)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.166)		CGCGTGACTGTGTCAAAGATG	0.448																																					p.C157C		Atlas-SNP	.											.	FAM149A	52	.	0			c.T471C						.						128.0	116.0	120.0					4																	187077241		2203	4300	6503	SO:0001819	synonymous_variant	25854	exon6			TGACTGTGTCAAA	AK057166	CCDS34117.1	4q35.1	2012-04-19			ENSG00000109794	ENSG00000109794			24527	protein-coding gene	gene with protein product							Standard	NM_015398		Approved	DKFZP564J102, MST119, MSTP119	uc010isl.3	A5PLN7	OTTHUMG00000160565	ENST00000356371.5:c.1344T>C	chr4.hg19:g.187077241T>C		108.0	0.0		71.0	4.0	NM_001006655	B5MDB8|Q2TAN6|Q7Z2S5|Q9Y4T9	Silent	SNP	ENST00000356371.5	hg19																																																																																				.	.		0.448	FAM149A-201	KNOWN	basic	protein_coding	protein_coding		NM_001006655	
KLKB1	3818	hgsc.bcm.edu	37	4	187175807	187175807	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr4:187175807A>G	ENST00000264690.6	+	12	1566	c.1379A>G	c.(1378-1380)gAt>gGt	p.D460G	KLKB1_ENST00000513864.1_Missense_Mutation_p.D460G	NM_000892.3	NP_000883.2	P03952	KLKB1_HUMAN	kallikrein B, plasma (Fletcher factor) 1	460	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|plasminogen activation (GO:0031639)|positive regulation of fibrinolysis (GO:0051919)|proteolysis (GO:0006508)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	40		all_cancers(14;1.55e-52)|all_epithelial(14;7.69e-39)|all_lung(41;1.34e-13)|Lung NSC(41;3.58e-13)|Melanoma(20;1.91e-06)|Colorectal(36;0.00664)|Hepatocellular(41;0.00886)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;1.29e-10)|BRCA - Breast invasive adenocarcinoma(30;3.8e-05)|GBM - Glioblastoma multiforme(59;0.000131)|STAD - Stomach adenocarcinoma(60;0.000292)|LUSC - Lung squamous cell carcinoma(40;0.00241)|READ - Rectum adenocarcinoma(43;0.168)		ATTACAAAAGATACACCTTTC	0.373																																					p.D460G		Atlas-SNP	.											.	KLKB1	155	.	0			c.A1379G						.						110.0	110.0	110.0					4																	187175807		2203	4300	6503	SO:0001583	missense	3818	exon12			CAAAAGATACACC	M13143	CCDS34120.1	4q35	2008-02-05			ENSG00000164344	ENSG00000164344		"""Kallikreins"""	6371	protein-coding gene	gene with protein product		229000		KLK3		9535413, 3521732	Standard	XM_005262987		Approved		uc003iyy.3	P03952	OTTHUMG00000150347	ENST00000264690.6:c.1379A>G	chr4.hg19:g.187175807A>G	ENSP00000264690:p.Asp460Gly	136.0	0.0		79.0	4.0	NM_000892	A6NH96|B2R8H9|Q17RE8|Q17RE9|Q4W5C3	Missense_Mutation	SNP	ENST00000264690.6	hg19	CCDS34120.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.100|6.100	0.386632|0.386632	0.11524|0.11524	.|.	.|.	ENSG00000164344|ENSG00000164344	ENST00000264690;ENST00000513864;ENST00000418715|ENST00000511608	D;D|.	0.88201|.	-2.35;-2.35|.	5.8|5.8	4.58|4.58	0.56647|0.56647	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);|.	0.588693|.	0.18084|.	N|.	0.152207|.	T|T	0.16257|0.16257	0.0391|0.0391	N|N	0.02213|0.02213	-0.635|-0.635	0.09310|0.09310	N|N	1|1	B;B;B|.	0.15473|.	0.013;0.0;0.013|.	B;B;B|.	0.24006|.	0.05;0.007;0.05|.	T|T	0.13308|0.13308	-1.0514|-1.0514	10|5	0.24483|.	T|.	0.36|.	.|.	11.9666|11.9666	0.53038|0.53038	0.7285:0.2715:0.0:0.0|0.7285:0.2715:0.0:0.0	.|.	422;460;460|.	E7EQA8;A8K9A9;P03952|.	.;.;KLKB1_HUMAN|.	G|V	460;460;422|508	ENSP00000264690:D460G;ENSP00000424469:D460G|.	ENSP00000264690:D460G|.	D|I	+|+	2|1	0|0	KLKB1|KLKB1	187412801|187412801	0.813000|0.813000	0.29090|0.29090	0.970000|0.970000	0.41538|0.41538	0.050000|0.050000	0.14768|0.14768	3.885000|3.885000	0.56182|0.56182	2.220000|2.220000	0.72140|0.72140	0.533000|0.533000	0.62120|0.62120	GAT|ATA	.	.		0.373	KLKB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317732.1	NM_000892	
ICE1	23379	hgsc.bcm.edu	37	5	5454689	5454689	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:5454689A>G	ENST00000296564.7	+	11	851	c.629A>G	c.(628-630)gAa>gGa	p.E210G	KIAA0947_ENST00000512608.1_3'UTR	NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		210					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						CTTCTGAAGGAACTCTGGCTC	0.453																																					p.E210G		Atlas-SNP	.											.	KIAA0947	301	.	0			c.A629G						.						59.0	63.0	61.0					5																	5454689		1943	4145	6088	SO:0001583	missense	23379	exon11			TGAAGGAACTCTG																												ENST00000296564.7:c.629A>G	chr5.hg19:g.5454689A>G	ENSP00000296564:p.Glu210Gly	64.0	0.0		83.0	4.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	A	28.1	4.886501	0.91814	.	.	ENSG00000164151	ENST00000296564	T	0.16597	2.33	5.25	5.25	0.73442	.	0.237224	0.33040	N	0.005353	T	0.30854	0.0778	L	0.32530	0.975	0.33444	D	0.582714	D	0.89917	1.0	D	0.87578	0.998	T	0.41822	-0.9487	10	0.87932	D	0	-29.1098	13.3984	0.60868	1.0:0.0:0.0:0.0	.	210	Q9Y2F5	K0947_HUMAN	G	210	ENSP00000296564:E210G	ENSP00000296564:E210G	E	+	2	0	KIAA0947	5507689	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	5.027000	0.64109	2.109000	0.64355	0.528000	0.53228	GAA	.	.		0.453	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
CDH9	1007	hgsc.bcm.edu	37	5	26906841	26906841	+	Silent	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:26906841C>A	ENST00000231021.4	-	4	802	c.630G>T	c.(628-630)gtG>gtT	p.V210V		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	210	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						ATTCTGGGTCCACTGAAAAAT	0.328																																					p.V210V	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.G630T						.						106.0	96.0	99.0					5																	26906841		2203	4300	6503	SO:0001819	synonymous_variant	1007	exon4			TGGGTCCACTGAA	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.630G>T	chr5.hg19:g.26906841C>A		87.0	0.0		73.0	20.0	NM_016279	Q3B7I5	Silent	SNP	ENST00000231021.4	hg19	CCDS3893.1																																																																																			.	.		0.328	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
RICTOR	253260	hgsc.bcm.edu	37	5	38958582	38958582	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:38958582A>T	ENST00000357387.3	-	24	2413	c.2383T>A	c.(2383-2385)Tcc>Acc	p.S795T	RICTOR_ENST00000296782.5_Missense_Mutation_p.S795T|RICTOR_ENST00000503698.1_5'UTR	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					CCAAGGTGGGATAACGCTGGT	0.318																																					p.S795T		Atlas-SNP	.											.	RICTOR	182	.	0			c.T2383A						.						89.0	96.0	94.0					5																	38958582		2203	4300	6503	SO:0001583	missense	253260	exon24			GGTGGGATAACGC		CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.2383T>A	chr5.hg19:g.38958582A>T	ENSP00000349959:p.Ser795Thr	220.0	0.0		217.0	93.0	NM_152756		Missense_Mutation	SNP	ENST00000357387.3	hg19	CCDS34148.1	.	.	.	.	.	.	.	.	.	.	A	9.671	1.146620	0.21288	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.43294	0.95;0.95	5.11	5.11	0.69529	Armadillo-type fold (1);	0.051792	0.85682	D	0.000000	T	0.29389	0.0732	N	0.19112	0.55	0.49915	D	0.999835	B;B	0.11235	0.004;0.002	B;B	0.15052	0.012;0.005	T	0.10567	-1.0624	10	0.87932	D	0	-7.6383	11.249	0.49015	0.9254:0.0:0.0746:0.0	.	795;795	Q6R327;Q6R327-3	RICTR_HUMAN;.	T	795	ENSP00000349959:S795T;ENSP00000296782:S795T	ENSP00000296782:S795T	S	-	1	0	RICTOR	38994339	1.000000	0.71417	0.994000	0.49952	0.974000	0.67602	5.423000	0.66458	2.059000	0.61396	0.460000	0.39030	TCC	.	.		0.318	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366985.1	NM_152756	
OXCT1	5019	hgsc.bcm.edu	37	5	41794835	41794835	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:41794835A>G	ENST00000196371.5	-	12	1276	c.1116T>C	c.(1114-1116)acT>acC	p.T372T	OXCT1_ENST00000513081.1_5'Flank|OXCT1_ENST00000512084.1_5'Flank|OXCT1_ENST00000510634.1_5'Flank|OXCT1_ENST00000509987.1_Silent_p.T186T	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	372					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	CTGGAAGAATAGTAACTGTTT	0.398																																					p.T372T		Atlas-SNP	.											.	OXCT1	54	.	0			c.T1116C						.						65.0	63.0	64.0					5																	41794835		2203	4300	6503	SO:0001819	synonymous_variant	5019	exon12			AAGAATAGTAACT	U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1116T>C	chr5.hg19:g.41794835A>G		46.0	0.0		66.0	4.0	NM_000436	B2R5V2|B7Z528	Silent	SNP	ENST00000196371.5	hg19	CCDS3937.1																																																																																			.	.		0.398	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211594.2	NM_000436	
FAM169A	26049	hgsc.bcm.edu	37	5	74130327	74130327	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:74130327A>G	ENST00000389156.4	-	5	504	c.414T>C	c.(412-414)tgT>tgC	p.C138C	FAM169A_ENST00000380515.3_Intron|FAM169A_ENST00000510496.1_Silent_p.C138C	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	138						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						TACTGCTATGACACAGGAATG	0.383																																					p.C138C		Atlas-SNP	.											.	FAM169A	61	.	0			c.T414C						.						138.0	125.0	129.0					5																	74130327		1850	4094	5944	SO:0001819	synonymous_variant	26049	exon5			GCTATGACACAGG		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.414T>C	chr5.hg19:g.74130327A>G		119.0	0.0		99.0	4.0	NM_015566	A8K1T9|Q6MZT0|Q9H989	Silent	SNP	ENST00000389156.4	hg19	CCDS43330.1																																																																																			.	.		0.383	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2		
ACOT12	134526	hgsc.bcm.edu	37	5	80655835	80655835	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:80655835A>G	ENST00000307624.3	-	5	411	c.383T>C	c.(382-384)cTt>cCt	p.L128P	ACOT12_ENST00000513751.1_Missense_Mutation_p.L128P	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	128					acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TTCAGTTAGAAGTGTGACTGG	0.313																																					p.L128P		Atlas-SNP	.											.	ACOT12	57	.	0			c.T383C						.						102.0	103.0	103.0					5																	80655835		2203	4298	6501	SO:0001583	missense	134526	exon5			GTTAGAAGTGTGA	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.383T>C	chr5.hg19:g.80655835A>G	ENSP00000303246:p.Leu128Pro	73.0	0.0		83.0	4.0	NM_130767	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	hg19	CCDS4055.1	.	.	.	.	.	.	.	.	.	.	A	5.472	0.272129	0.10349	.	.	ENSG00000172497	ENST00000307624;ENST00000513751	T;T	0.25749	1.78;1.78	5.04	3.88	0.44766	.	0.158933	0.43579	N	0.000556	T	0.17023	0.0409	N	0.26130	0.795	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.001;0.002	T	0.04900	-1.0919	10	0.30854	T	0.27	-4.5878	10.0132	0.41999	0.9184:0.0:0.0816:0.0	.	128;128	Q5FWE9;Q8WYK0	.;ACO12_HUMAN	P	128	ENSP00000303246:L128P;ENSP00000421628:L128P	ENSP00000303246:L128P	L	-	2	0	ACOT12	80691591	1.000000	0.71417	0.500000	0.27589	0.085000	0.17905	4.204000	0.58460	0.876000	0.35872	0.533000	0.62120	CTT	.	.		0.313	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767	
SLCO6A1	133482	hgsc.bcm.edu	37	5	101755554	101755554	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:101755554G>A	ENST00000506729.1	-	8	1619	c.1448C>T	c.(1447-1449)gCt>gTt	p.A483V	SLCO6A1_ENST00000389019.3_Missense_Mutation_p.A421V|SLCO6A1_ENST00000513675.1_Intron|SLCO6A1_ENST00000379807.3_Missense_Mutation_p.A483V|SLCO6A1_ENST00000514551.1_5'Flank|SLCO6A1_ENST00000379810.1_Intron			Q86UG4	SO6A1_HUMAN	solute carrier organic anion transporter family, member 6A1	483						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(17)|lung(22)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	60		all_cancers(142;8e-09)|all_epithelial(76;2.83e-12)|Prostate(80;0.00125)|Colorectal(57;0.00342)|Ovarian(225;0.024)|Lung NSC(167;0.0259)|all_lung(232;0.0323)		Epithelial(69;1.47e-15)|COAD - Colon adenocarcinoma(37;0.0113)		ATTGATCCCAGCAAATTGCAC	0.313																																					p.A483V		Atlas-SNP	.											.	SLCO6A1	153	.	0			c.C1448T						.						105.0	111.0	109.0					5																	101755554		2203	4300	6503	SO:0001583	missense	133482	exon8			ATCCCAGCAAATT	AF505657	CCDS34206.1, CCDS75282.1	5q21.2	2013-05-22			ENSG00000205359	ENSG00000205359		"""Solute carriers"""	23613	protein-coding gene	gene with protein product	"""cancer/testis antigen 48"""	613365					Standard	XM_005271874		Approved	OATP6A1, OATPY, MGC26949, CT48	uc003knp.3	Q86UG4	OTTHUMG00000162759	ENST00000506729.1:c.1448C>T	chr5.hg19:g.101755554G>A	ENSP00000421339:p.Ala483Val	243.0	0.0		195.0	13.0	NM_173488	A6NHC1|Q6ZMY5|Q86UV2|Q8IYU5	Missense_Mutation	SNP	ENST00000506729.1	hg19	CCDS34206.1	.	.	.	.	.	.	.	.	.	.	G	14.89	2.670638	0.47781	.	.	ENSG00000205359	ENST00000506729;ENST00000379807;ENST00000389019	T;T;T	0.40225	1.04;1.04;1.04	4.99	4.13	0.48395	Major facilitator superfamily domain, general substrate transporter (1);	0.182863	0.36591	N	0.002520	T	0.66187	0.2764	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.76575	0.988;0.873	T	0.71817	-0.4478	10	0.87932	D	0	.	10.8295	0.46652	0.0895:0.0:0.9105:0.0	.	421;483	Q86UG4-2;Q86UG4	.;SO6A1_HUMAN	V	483;483;421	ENSP00000421339:A483V;ENSP00000369135:A483V;ENSP00000373671:A421V	ENSP00000369135:A483V	A	-	2	0	SLCO6A1	101783453	1.000000	0.71417	0.997000	0.53966	0.041000	0.13682	3.794000	0.55492	1.473000	0.48159	0.655000	0.94253	GCT	.	.		0.313	SLCO6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370335.1	NM_173488	
PPIP5K2	23262	hgsc.bcm.edu	37	5	102490644	102490644	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:102490644A>G	ENST00000358359.3	+	13	1909	c.1400A>G	c.(1399-1401)gAg>gGg	p.E467G	PPIP5K2_ENST00000513500.1_3'UTR|PPIP5K2_ENST00000414217.1_Missense_Mutation_p.E467G|PPIP5K2_ENST00000321521.9_Missense_Mutation_p.E467G	NM_001276277.1	NP_001263206.1	O43314	VIP2_HUMAN	diphosphoinositol pentakisphosphate kinase 2	467					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						ACTGTATTAGAGATGTGAGTA	0.323																																					p.E467G		Atlas-SNP	.											.	PPIP5K2	98	.	0			c.A1400G						.						72.0	72.0	72.0					5																	102490644		2203	4298	6501	SO:0001583	missense	23262	exon12			TATTAGAGATGTG	AB007893	CCDS34207.1, CCDS64212.1, CCDS75283.1	5q21.1	2014-05-06	2010-01-26	2010-01-26	ENSG00000145725	ENSG00000145725	2.7.4.24		29035	protein-coding gene	gene with protein product		611648	"""histidine acid phosphatase domain containing 1"""	HISPPD1		9455477, 17690096, 18981179	Standard	NM_001276277		Approved	KIAA0433, VIP2	uc003koe.4	O43314	OTTHUMG00000181461	ENST00000358359.3:c.1400A>G	chr5.hg19:g.102490644A>G	ENSP00000351126:p.Glu467Gly	68.0	0.0		55.0	4.0	NM_015216	A1NI53|A6NGS8|Q8TB50	Missense_Mutation	SNP	ENST00000358359.3	hg19		.	.	.	.	.	.	.	.	.	.	A	25.6	4.657462	0.88154	.	.	ENSG00000145725	ENST00000321521;ENST00000507921;ENST00000358359;ENST00000451606;ENST00000414217	T;T;T;T	0.36520	1.25;1.25;1.25;1.25	5.11	5.11	0.69529	.	0.000000	0.64402	D	0.000003	T	0.63616	0.2526	M	0.82823	2.61	0.80722	D	1	D;P;D	0.89917	1.0;0.684;1.0	D;P;D	0.91635	0.995;0.703;0.999	T	0.70193	-0.4939	10	0.87932	D	0	-15.3301	15.1899	0.73035	1.0:0.0:0.0:0.0	.	389;467;467	D6RBU4;O43314-2;O43314	.;.;VIP2_HUMAN	G	467;389;467;467;467	ENSP00000313070:E467G;ENSP00000422525:E389G;ENSP00000351126:E467G;ENSP00000416016:E467G	ENSP00000313070:E467G	E	+	2	0	PPIP5K2	102518543	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.243000	0.95416	2.040000	0.60383	0.533000	0.62120	GAG	.	.		0.323	PPIP5K2-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000370487.1	NM_015216	
EFNA5	1946	hgsc.bcm.edu	37	5	106763128	106763128	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:106763128G>T	ENST00000333274.6	-	2	489	c.208C>A	c.(208-210)Cca>Aca	p.P70T	EFNA5_ENST00000509503.1_Missense_Mutation_p.P70T	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	70	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		TTATCTTCTGGGACGGAGTCC	0.448																																					p.P70T		Atlas-SNP	.											.	EFNA5	16	.	0			c.C208A						.						133.0	133.0	133.0					5																	106763128		2202	4300	6502	SO:0001583	missense	1946	exon2			CTTCTGGGACGGA	U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.208C>A	chr5.hg19:g.106763128G>T	ENSP00000328777:p.Pro70Thr	123.0	0.0		97.0	4.0	NM_001962		Missense_Mutation	SNP	ENST00000333274.6	hg19	CCDS4097.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245779	0.80024	.	.	ENSG00000184349	ENST00000333274;ENST00000509503	D;D	0.92647	-3.08;-3.08	6.06	6.06	0.98353	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.92838	0.7722	M	0.69185	2.1	0.80722	D	1	P;B	0.35011	0.48;0.13	B;B	0.41332	0.354;0.136	D	0.90068	0.4161	10	0.28530	T	0.3	-5.8591	20.6208	0.99490	0.0:0.0:1.0:0.0	.	70;70	D6RDV5;P52803	.;EFNA5_HUMAN	T	70	ENSP00000328777:P70T;ENSP00000426989:P70T	ENSP00000328777:P70T	P	-	1	0	EFNA5	106791027	1.000000	0.71417	0.965000	0.40720	0.993000	0.82548	9.476000	0.97823	2.882000	0.98803	0.655000	0.94253	CCA	.	.		0.448	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250652.1	NM_001962	
FER	2241	hgsc.bcm.edu	37	5	108380491	108380491	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:108380491A>G	ENST00000281092.4	+	15	2208	c.1824A>G	c.(1822-1824)gaA>gaG	p.E608E	FER_ENST00000438717.2_Silent_p.E433E	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	608	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		TTTTACAAGAAGCCAAGTGAG	0.244																																					p.E608E	Colon(146;1051 1799 9836 27344 47401)	Atlas-SNP	.											.	FER	100	.	0			c.A1824G						.						45.0	50.0	48.0					5																	108380491		2187	4288	6475	SO:0001819	synonymous_variant	2241	exon15			ACAAGAAGCCAAG	J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1824A>G	chr5.hg19:g.108380491A>G		108.0	0.0		95.0	4.0	NM_005246	B2RCR4|B4DSQ2|H2FLB8	Silent	SNP	ENST00000281092.4	hg19	CCDS4098.1																																																																																			.	.		0.244	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250664.1	NM_005246	
YTHDC2	64848	hgsc.bcm.edu	37	5	112903376	112903376	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:112903376C>T	ENST00000161863.4	+	23	3287	c.3074C>T	c.(3073-3075)gCa>gTa	p.A1025V		NM_022828.3	NP_073739.3	Q9H6S0	YTDC2_HUMAN	YTH domain containing 2	1025					ATP catabolic process (GO:0006200)|positive regulation by host of viral genome replication (GO:0044829)|response to interleukin-1 (GO:0070555)|response to tumor necrosis factor (GO:0034612)	endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA polymerase binding (GO:0070063)|RNA-dependent ATPase activity (GO:0008186)			NS(2)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(13)|lung(10)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	43		all_cancers(142;7.69e-05)|all_epithelial(76;6.42e-07)|Colorectal(10;0.00278)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Lung NSC(810;0.143)|all_lung(232;0.163)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;7.2e-08)|Epithelial(69;8.83e-08)|all cancers(49;6.9e-06)|COAD - Colon adenocarcinoma(37;0.0458)|Colorectal(14;0.0594)		GGTCAAGCTGCAGCAATTAAG	0.343																																					p.A1025V		Atlas-SNP	.											.	YTHDC2	118	.	0			c.C3074T						.						61.0	58.0	59.0					5																	112903376		2202	4300	6502	SO:0001583	missense	64848	exon23			AAGCTGCAGCAAT	AK000915	CCDS4113.1	5q22.3	2008-02-05			ENSG00000047188	ENSG00000047188			24721	protein-coding gene	gene with protein product						12477932	Standard	NM_022828		Approved	FLJ2194, FLJ10053, DKFZp564A186	uc003kqn.3	Q9H6S0	OTTHUMG00000128837	ENST00000161863.4:c.3074C>T	chr5.hg19:g.112903376C>T	ENSP00000161863:p.Ala1025Val	96.0	0.0		90.0	4.0	NM_022828	B2RP66	Missense_Mutation	SNP	ENST00000161863.4	hg19	CCDS4113.1	.	.	.	.	.	.	.	.	.	.	C	15.83	2.947965	0.53186	.	.	ENSG00000047188	ENST00000161863;ENST00000511372	T	0.02525	4.26	5.47	4.55	0.56014	Domain of unknown function DUF1605 (1);	0.247198	0.39210	N	0.001422	T	0.03959	0.0111	L	0.40543	1.245	0.80722	D	1	B	0.25007	0.116	B	0.30401	0.115	T	0.49688	-0.8913	10	0.37606	T	0.19	.	12.9506	0.58399	0.2839:0.7161:0.0:0.0	.	1025	Q9H6S0	YTDC2_HUMAN	V	1025;935	ENSP00000161863:A1025V	ENSP00000161863:A1025V	A	+	2	0	YTHDC2	112931275	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.662000	0.54510	2.561000	0.86390	0.655000	0.94253	GCA	.	.		0.343	YTHDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250776.2	NM_022828	
GRAMD3	65983	hgsc.bcm.edu	37	5	125813469	125813469	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:125813469T>C	ENST00000285689.3	+	6	1033	c.572T>C	c.(571-573)gTc>gCc	p.V191A	GRAMD3_ENST00000515200.1_Missense_Mutation_p.V168A|RP11-517I3.1_ENST00000512500.1_RNA|GRAMD3_ENST00000511134.1_Missense_Mutation_p.V175A|GRAMD3_ENST00000544396.1_Missense_Mutation_p.V87A|RP11-517I3.1_ENST00000515808.1_RNA|GRAMD3_ENST00000543198.1_Missense_Mutation_p.V168A|GRAMD3_ENST00000502348.1_Missense_Mutation_p.V82A|GRAMD3_ENST00000513040.1_Missense_Mutation_p.V206A|GRAMD3_ENST00000542322.1_Missense_Mutation_p.V199A	NM_023927.2	NP_076416.2	Q96HH9	GRAM3_HUMAN	GRAM domain containing 3	191						cytoplasmic microtubule (GO:0005881)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		Prostate(80;0.0928)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0401)|OV - Ovarian serous cystadenocarcinoma(64;0.0604)|all cancers(49;0.108)		ATAGCAACAGTCACAGACAGG	0.498																																					p.V206A		Atlas-SNP	.											.	GRAMD3	30	.	0			c.T617C						.						93.0	95.0	94.0					5																	125813469		2203	4300	6503	SO:0001583	missense	65983	exon6			CAACAGTCACAGA	BC008590	CCDS4136.1, CCDS54891.1, CCDS54892.1, CCDS54893.1, CCDS54894.1	5q23.2	2014-02-12	2005-11-03		ENSG00000155324	ENSG00000155324			24911	protein-coding gene	gene with protein product	"""HCV NS3 transactivated protein 2"""					12477932	Standard	NM_023927		Approved	NS3TP2, FLJ21313	uc011cwt.2	Q96HH9	OTTHUMG00000128943	ENST00000285689.3:c.572T>C	chr5.hg19:g.125813469T>C	ENSP00000285689:p.Val191Ala	87.0	0.0		91.0	4.0	NM_001146319	B7Z1F2|B7Z3R1|B7Z6D8|B7Z8T2|D3DSZ3|Q9H753	Missense_Mutation	SNP	ENST00000285689.3	hg19	CCDS4136.1	.	.	.	.	.	.	.	.	.	.	T	4.550	0.102200	0.08731	.	.	ENSG00000155324	ENST00000513040;ENST00000506445;ENST00000543367;ENST00000285689;ENST00000515200;ENST00000542322;ENST00000544396;ENST00000543198;ENST00000502348;ENST00000511134	T;T;T;T;T;T;T;T;T	0.28666	1.6;1.6;1.61;1.62;1.6;1.65;1.62;1.64;1.61	5.55	4.35	0.52113	.	0.474819	0.24945	N	0.034352	T	0.40546	0.1121	M	0.65975	2.015	0.36053	D	0.840867	D;B;B;D;D	0.63046	0.992;0.007;0.039;0.991;0.992	P;B;B;P;P	0.54759	0.749;0.01;0.018;0.76;0.749	T	0.47898	-0.9081	10	0.08837	T	0.75	.	11.676	0.51430	0.133:0.0:0.0:0.867	.	175;87;199;206;191	B7Z8T2;B7Z1F2;B7Z3R1;B7Z6D8;Q96HH9	.;.;.;.;GRAM3_HUMAN	A	206;205;175;191;168;199;87;168;82;175	ENSP00000426120:V206A;ENSP00000424985:V205A;ENSP00000285689:V191A;ENSP00000426143:V168A;ENSP00000441876:V199A;ENSP00000444049:V87A;ENSP00000442902:V168A;ENSP00000427596:V82A;ENSP00000426088:V175A	ENSP00000285689:V191A	V	+	2	0	GRAMD3	125841368	0.003000	0.15002	0.961000	0.40146	0.683000	0.39861	0.754000	0.26390	0.986000	0.38683	0.533000	0.62120	GTC	.	.		0.498	GRAMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250922.2	NM_023927	
PCDHA4	56144	hgsc.bcm.edu	37	5	140188502	140188502	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:140188502T>C	ENST00000530339.1	+	1	1730	c.1730T>C	c.(1729-1731)gTg>gCg	p.V577A	PCDHA4_ENST00000512229.2_Missense_Mutation_p.V577A|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000356878.4_Missense_Mutation_p.V577A|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	577					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGTGGCGCAGTGAGCGAGCTG	0.662																																					p.V577A		Atlas-SNP	.											.	PCDHA4	419	.	0			c.T1730C						.						93.0	87.0	89.0					5																	140188502		2202	4299	6501	SO:0001583	missense	56144	exon1			GCGCAGTGAGCGA	AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1730T>C	chr5.hg19:g.140188502T>C	ENSP00000435300:p.Val577Ala	60.0	0.0		94.0	4.0	NM_031500	O75285|Q2M253	Missense_Mutation	SNP	ENST00000530339.1	hg19	CCDS54916.1	.	.	.	.	.	.	.	.	.	.	t	0.011	-1.736368	0.00681	.	.	ENSG00000204967	ENST00000512229;ENST00000356878;ENST00000530339	T;T;T	0.38240	1.15;1.15;1.15	4.08	2.86	0.33363	Cadherin-like (1);	1.047260	0.07710	U	0.941924	T	0.23094	0.0558	N	0.21583	0.68	0.09310	N	1	B;B;B	0.18610	0.005;0.029;0.019	B;B;B	0.21151	0.012;0.033;0.02	T	0.31752	-0.9932	10	0.21540	T	0.41	.	4.7115	0.12875	0.0:0.1405:0.1829:0.6766	.	577;577;577	Q9UN74-2;Q9UN74;D6RA20	.;PCDA4_HUMAN;.	A	577	ENSP00000423470:V577A;ENSP00000349344:V577A;ENSP00000435300:V577A	ENSP00000349344:V577A	V	+	2	0	PCDHA4	140168686	0.013000	0.17824	0.165000	0.22776	0.045000	0.14185	0.521000	0.22893	0.529000	0.28599	0.397000	0.26171	GTG	.	.		0.662	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372864.2	NM_018907	
PCDHB14	56122	hgsc.bcm.edu	37	5	140605206	140605206	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:140605206C>T	ENST00000239449.4	+	1	2129	c.2129C>T	c.(2128-2130)gCg>gTg	p.A710V	PCDHB14_ENST00000515856.2_Missense_Mutation_p.A557V	NM_018934.2	NP_061757.1	Q9Y5E9	PCDBE_HUMAN	protocadherin beta 14	710					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A710V(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(21)|ovary(2)|prostate(3)|skin(6)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGTTCGTGGCGGTGCGGCTG	0.706																																					p.A710V	Ovarian(141;50 1831 27899 33809 37648)	Atlas-SNP	.											PCDHB14,NS,carcinoma,0,1	PCDHB14	132	.	1	Substitution - Missense(1)	prostate(1)	c.C2129T						.						69.0	84.0	79.0					5																	140605206		2180	4234	6414	SO:0001583	missense	56122	exon1			TCGTGGCGGTGCG	AF152493	CCDS4256.1	5q31	2010-01-26			ENSG00000120327	ENSG00000120327		"""Cadherins / Protocadherins : Clustered"""	8685	other	protocadherin		606340				10380929	Standard	NM_018934		Approved	PCDH-BETA14	uc003ljb.3	Q9Y5E9	OTTHUMG00000129619	ENST00000239449.4:c.2129C>T	chr5.hg19:g.140605206C>T	ENSP00000239449:p.Ala710Val	34.0	0.0		57.0	4.0	NM_018934	B4DPE2|Q4FZA4|Q4KN11	Missense_Mutation	SNP	ENST00000239449.4	hg19	CCDS4256.1	.	.	.	.	.	.	.	.	.	.	-	15.77	2.930353	0.52866	.	.	ENSG00000120327	ENST00000515856;ENST00000239449	T;T	0.15603	2.41;2.41	4.36	0.0913	0.14467	.	.	.	.	.	T	0.25344	0.0616	M	0.91561	3.22	0.09310	N	1	B	0.22541	0.071	B	0.17722	0.019	T	0.26189	-1.0110	9	0.45353	T	0.12	.	6.8613	0.24067	0.0:0.5331:0.2524:0.2145	.	710	Q9Y5E9	PCDBE_HUMAN	V	557;710	ENSP00000444518:A557V;ENSP00000239449:A710V	ENSP00000239449:A710V	A	+	2	0	PCDHB14	140585390	0.000000	0.05858	0.066000	0.19879	0.362000	0.29581	-0.294000	0.08309	0.027000	0.15297	-0.181000	0.13052	GCG	.	.		0.706	PCDHB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251814.2	NM_018934	
PCDHGA5	56110	hgsc.bcm.edu	37	5	140744024	140744024	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:140744024T>C	ENST00000518069.1	+	1	127	c.127T>C	c.(127-129)Tcc>Ccc	p.S43P	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018918.2|NM_032054.1	NP_061741.1|NP_114443.1	Q9Y5G8	PCDG5_HUMAN	protocadherin gamma subfamily A, 5	43	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(5)|upper_aerodigestive_tract(3)	18			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACAAAGGCTCCTTCGTCGG	0.647																																					p.S43P		Atlas-SNP	.											.	PCDHGA5	215	.	0			c.T127C						.						36.0	46.0	43.0					5																	140744024		2194	4299	6493	SO:0001583	missense	56110	exon1			AAAGGCTCCTTCG	AF152512	CCDS54925.1, CCDS75333.1	5q31	2010-01-26				ENSG00000253485		"""Cadherins / Protocadherins : Clustered"""	8703	other	protocadherin	"""cadherin ME3"""	606292				10380929	Standard	NM_018918		Approved	CDH-GAMMA-A5, ME3, PCDH-GAMMA-A5		Q9Y5G8		ENST00000518069.1:c.127T>C	chr5.hg19:g.140744024T>C	ENSP00000429834:p.Ser43Pro	108.0	0.0		90.0	4.0	NM_032054	Q2M3F5|Q9Y5D2	Missense_Mutation	SNP	ENST00000518069.1	hg19	CCDS54925.1	.	.	.	.	.	.	.	.	.	.	.	17.77	3.472337	0.63737	.	.	ENSG00000253485	ENST00000518069	T	0.39997	1.05	5.38	2.84	0.33178	Cadherin, N-terminal (1);Cadherin (1);Cadherin-like (1);	.	.	.	.	T	0.77478	0.4136	H	0.99156	4.45	0.29025	N	0.886035	D;D	0.64830	0.976;0.994	D;D	0.71656	0.935;0.974	T	0.75628	-0.3252	9	0.87932	D	0	.	12.0617	0.53566	0.0:0.0:0.2729:0.7271	.	43;43	Q9Y5G8-2;Q9Y5G8	.;PCDG5_HUMAN	P	43	ENSP00000429834:S43P	ENSP00000429834:S43P	S	+	1	0	PCDHGA5	140724208	0.047000	0.20315	0.997000	0.53966	0.970000	0.65996	0.300000	0.19156	0.385000	0.24970	0.456000	0.33151	TCC	.	.		0.647	PCDHGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374742.1	NM_018918	
ARAP3	64411	hgsc.bcm.edu	37	5	141059772	141059772	+	Silent	SNP	G	G	A	rs146312944		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:141059772G>A	ENST00000239440.4	-	2	347	c.282C>T	c.(280-282)ccC>ccT	p.P94P	ARAP3_ENST00000508305.1_Silent_p.P16P	NM_022481.5	NP_071926.4	Q8WWN8	ARAP3_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3	94	Pro-rich.				cytoskeleton organization (GO:0007010)|negative regulation of cell migration (GO:0030336)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Rho protein signal transduction (GO:0035024)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(1)|prostate(2)|skin(4)|stomach(1)	53						GCTTCGGCACGGGCTTAGGGG	0.652																																					p.P94P		Atlas-SNP	.											.	ARAP3	139	.	0			c.C282T						.	G		0,4406		0,0,2203	48.0	58.0	54.0		282	-7.8	1.0	5	dbSNP_134	54	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ARAP3	NM_022481.5		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		94/1545	141059772	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64411	exon2			CGGCACGGGCTTA	AJ310567	CCDS4266.1	5q31.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000120318	ENSG00000120318		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	24097	protein-coding gene	gene with protein product		606647	"""centaurin, delta 3"""	CENTD3		11804589, 12015138	Standard	XM_005268497		Approved	FLJ21065, DRAG1	uc003llm.3	Q8WWN8	OTTHUMG00000129610	ENST00000239440.4:c.282C>T	chr5.hg19:g.141059772G>A		150.0	0.0		134.0	66.0	NM_022481	B4DIT1|D3DQE3	Silent	SNP	ENST00000239440.4	hg19	CCDS4266.1																																																																																			.	G|1.000;A|0.000		0.652	ARAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251805.1	NM_022481	
FAT2	2196	hgsc.bcm.edu	37	5	150945475	150945475	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:150945475C>A	ENST00000261800.5	-	1	3030	c.3018G>T	c.(3016-3018)agG>agT	p.R1006S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1006	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGCTAGGGGCCTCCCACCAT	0.607																																					p.R1006S		Atlas-SNP	.											.	FAT2	465	.	0			c.G3018T						.						47.0	39.0	41.0					5																	150945475		2203	4300	6503	SO:0001583	missense	2196	exon1			TAGGGGCCTCCCA	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3018G>T	chr5.hg19:g.150945475C>A	ENSP00000261800:p.Arg1006Ser	128.0	0.0		154.0	9.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.546049	0.27652	.	.	ENSG00000086570	ENST00000261800	T	0.52295	0.67	5.29	2.37	0.29283	Cadherin (4);Cadherin-like (1);	0.469806	0.21212	N	0.078281	T	0.22666	0.0547	N	0.03029	-0.43	0.39950	D	0.974527	B	0.23540	0.087	B	0.34590	0.186	T	0.06534	-1.0821	10	0.10636	T	0.68	.	8.4861	0.33071	0.0:0.6866:0.0:0.3134	.	1006	Q9NYQ8	FAT2_HUMAN	S	1006	ENSP00000261800:R1006S	ENSP00000261800:R1006S	R	-	3	2	FAT2	150925668	0.042000	0.20092	0.998000	0.56505	0.986000	0.74619	-0.122000	0.10627	1.141000	0.42275	-0.345000	0.07892	AGG	.	.		0.607	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
SGCD	6444	hgsc.bcm.edu	37	5	155935693	155935693	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:155935693A>T	ENST00000435422.3	+	3	759	c.272A>T	c.(271-273)aAa>aTa	p.K91I	SGCD_ENST00000517913.1_Missense_Mutation_p.K92I|SGCD_ENST00000337851.4_Missense_Mutation_p.K92I|SGCD_ENST00000447401.1_Missense_Mutation_p.K92I	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	91					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CTCTACGCCAAAGAAATCCAG	0.428																																					p.K92I		Atlas-SNP	.											.	SGCD	52	.	0			c.A275T						.						91.0	82.0	85.0					5																	155935693		1852	4105	5957	SO:0001583	missense	6444	exon4			ACGCCAAAGAAAT	BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.272A>T	chr5.hg19:g.155935693A>T	ENSP00000403003:p.Lys91Ile	70.0	0.0		63.0	32.0	NM_000337	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	ENST00000435422.3	hg19	CCDS47327.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.683865	0.88639	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	5.49	5.49	0.81192	.	0.046978	0.85682	D	0.000000	D	0.96772	0.8946	M	0.75085	2.285	0.58432	D	0.999999	D;D;D	0.89917	0.997;0.997;1.0	D;D;D	0.85130	0.995;0.991;0.997	D	0.96600	0.9444	10	0.46703	T	0.11	-7.3453	14.4502	0.67379	1.0:0.0:0.0:0.0	.	91;92;92	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	I	92;91;92;92	ENSP00000429378:K92I;ENSP00000403003:K91I;ENSP00000338343:K92I;ENSP00000408324:K92I	ENSP00000338343:K92I	K	+	2	0	SGCD	155868271	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.832000	0.92079	2.205000	0.71048	0.477000	0.44152	AAA	.	.		0.428	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000373469.3		
CYFIP2	26999	hgsc.bcm.edu	37	5	156755023	156755023	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:156755023C>G	ENST00000521420.1	+	18	2135	c.2044C>G	c.(2044-2046)Cag>Gag	p.Q682E	CYFIP2_ENST00000347377.6_Missense_Mutation_p.Q708E|CYFIP2_ENST00000318218.6_Missense_Mutation_p.Q733E|CYFIP2_ENST00000377576.3_Missense_Mutation_p.Q708E|CYFIP2_ENST00000435847.2_Missense_Mutation_p.Q407E|CYFIP2_ENST00000522463.1_Missense_Mutation_p.Q512E|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Missense_Mutation_p.Q633E					cytoplasmic FMR1 interacting protein 2											breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCTGGCAGACCAGATCTTTGC	0.473																																					p.Q708E		Atlas-SNP	.											.	CYFIP2	354	.	0			c.C2122G						.						80.0	78.0	79.0					5																	156755023		1930	4147	6077	SO:0001583	missense	26999	exon19			GCAGACCAGATCT	AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.2044C>G	chr5.hg19:g.156755023C>G	ENSP00000430904:p.Gln682Glu	115.0	0.0		108.0	21.0	NM_001037332		Missense_Mutation	SNP	ENST00000521420.1	hg19		.	.	.	.	.	.	.	.	.	.	C	23.8	4.464423	0.84425	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.24723	1.84;1.84;1.84;1.84;1.84;1.84;1.84	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	M	0.75085	2.285	0.80722	D	1	P;P;D;P;P;B	0.54772	0.792;0.952;0.968;0.951;0.705;0.303	P;P;P;P;B;P	0.56960	0.519;0.81;0.764;0.6;0.343;0.471	T	0.28490	-1.0042	10	0.33141	T	0.24	-31.9868	19.8968	0.96969	0.0:1.0:0.0:0.0	.	572;512;682;708;708;733	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	E	733;512;682;708;708;633;407	ENSP00000325817:Q733E;ENSP00000428009:Q512E;ENSP00000430904:Q682E;ENSP00000313567:Q708E;ENSP00000366799:Q708E;ENSP00000444645:Q633E;ENSP00000403793:Q407E	ENSP00000325817:Q733E	Q	+	1	0	CYFIP2	156687601	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.776000	0.85560	2.691000	0.91804	0.655000	0.94253	CAG	.	.		0.473	CYFIP2-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000373710.1	NM_001037332	
HMMR	3161	hgsc.bcm.edu	37	5	162911119	162911119	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr5:162911119T>G	ENST00000358715.3	+	16	1863	c.1827T>G	c.(1825-1827)aaT>aaG	p.N609K	RP11-80G7.1_ENST00000521666.1_RNA|HMMR_ENST00000353866.3_Missense_Mutation_p.N594K|RP11-80G7.1_ENST00000514724.2_RNA|HMMR_ENST00000432118.2_Missense_Mutation_p.N523K|HMMR_ENST00000393915.4_Missense_Mutation_p.N610K			O75330	HMMR_HUMAN	hyaluronan-mediated motility receptor (RHAMM)	609					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)			cervix(1)|kidney(3)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	23	Renal(175;0.000281)	Medulloblastoma(196;0.00853)|all_neural(177;0.0408)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0296)|OV - Ovarian serous cystadenocarcinoma(192;0.0423)|Epithelial(171;0.0848)	Hyaluronan(DB08818)	CATTGTTGAATGAACATGGTG	0.299																																					p.N610K		Atlas-SNP	.											.	HMMR	64	.	0			c.T1830G						.						46.0	50.0	48.0					5																	162911119		2203	4298	6501	SO:0001583	missense	3161	exon16			GTTGAATGAACAT	U29343	CCDS4362.1, CCDS4363.1, CCDS47334.1, CCDS47335.1	5q34	2013-09-19			ENSG00000072571	ENSG00000072571		"""CD molecules"""	5012	protein-coding gene	gene with protein product		600936					Standard	NM_001142556		Approved	RHAMM, CD168	uc003lzh.3	O75330	OTTHUMG00000130381	ENST00000358715.3:c.1827T>G	chr5.hg19:g.162911119T>G	ENSP00000351554:p.Asn609Lys	127.0	0.0		133.0	9.0	NM_001142556	A8K3G2|B4E114|D3DQK9|D3DQL0|E9PCS0|Q32N02|Q92767	Missense_Mutation	SNP	ENST00000358715.3	hg19	CCDS4362.1	.	.	.	.	.	.	.	.	.	.	T	18.93	3.726716	0.69074	.	.	ENSG00000072571	ENST00000416990;ENST00000353866;ENST00000393915;ENST00000426586;ENST00000432118;ENST00000358715	T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94	5.45	5.45	0.79879	.	0.126941	0.64402	D	0.000001	T	0.18467	0.0443	M	0.75264	2.295	0.43399	D	0.99552	P;P;P;P	0.51791	0.825;0.948;0.911;0.911	B;B;P;P	0.46885	0.444;0.439;0.53;0.53	T	0.04635	-1.0937	10	0.22109	T	0.4	-12.7716	12.8745	0.57982	0.0:0.0:0.1355:0.8645	.	523;610;594;609	O75330-4;O75330-3;O75330-2;O75330	.;.;.;HMMR_HUMAN	K	495;594;610;586;523;609	ENSP00000400527:N495K;ENSP00000185942:N594K;ENSP00000377492:N610K;ENSP00000402673:N523K;ENSP00000351554:N609K	ENSP00000185942:N594K	N	+	3	2	HMMR	162843697	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.327000	0.52045	2.189000	0.69895	0.528000	0.53228	AAT	.	.		0.299	HMMR-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252752.1	NM_012484	
KIF13A	63971	hgsc.bcm.edu	37	6	17834225	17834225	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:17834225T>C	ENST00000259711.6	-	12	1338	c.1233A>G	c.(1231-1233)gaA>gaG	p.E411E	KIF13A_ENST00000378816.5_Silent_p.E411E|KIF13A_ENST00000378843.2_Silent_p.E411E|KIF13A_ENST00000378826.2_Silent_p.E411E|KIF13A_ENST00000378814.5_Silent_p.E411E	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	411					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			TCAGCTTCTCTTCCCAAGTCA	0.373																																					p.E411E		Atlas-SNP	.											.	KIF13A	276	.	0			c.A1233G						.						161.0	147.0	151.0					6																	17834225		1844	4086	5930	SO:0001819	synonymous_variant	63971	exon12			CTTCTCTTCCCAA	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.1233A>G	chr6.hg19:g.17834225T>C		115.0	0.0		125.0	5.0	NM_001105567	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Silent	SNP	ENST00000259711.6	hg19	CCDS47381.1																																																																																			.	.		0.373	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
HIST1H1E	3008	hgsc.bcm.edu	37	6	26156843	26156843	+	Missense_Mutation	SNP	G	G	T	rs150948103	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:26156843G>T	ENST00000304218.3	+	1	285	c.225G>T	c.(223-225)aaG>aaT	p.K75N	HIST1H2BD_ENST00000377777.4_5'Flank|HIST1H2BD_ENST00000289316.2_5'Flank	NM_005321.2	NP_005312.1	P10412	H14_HUMAN	histone cluster 1, H1e	75	H15. {ECO:0000255|PROSITE- ProRule:PRU00837}.				nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)	extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			NS(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	26						ACGTGGAGAAGAACAACAGCC	0.592																																					p.K75N		Atlas-SNP	.											HIST1H1E,NS,carcinoma,0,1	HIST1H1E	69	.	0			c.G225T						.						43.0	47.0	45.0					6																	26156843		2203	4300	6503	SO:0001583	missense	3008	exon1			GGAGAAGAACAAC	M60748	CCDS4586.1	6p22.1	2012-05-04	2006-10-11	2003-02-21	ENSG00000168298	ENSG00000168298		"""Histones / Replication-dependent"""	4718	protein-coding gene	gene with protein product		142220	"""H1 histone family, member 4"", ""histone 1, H1e"""	H1F4		1916825, 12408966	Standard	NM_005321		Approved	H1.4, H1e, H1s-4	uc003ngq.3	P10412	OTTHUMG00000014422	ENST00000304218.3:c.225G>T	chr6.hg19:g.26156843G>T	ENSP00000307705:p.Lys75Asn	129.0	0.0		118.0	28.0	NM_005321	Q4VB25	Missense_Mutation	SNP	ENST00000304218.3	hg19	CCDS4586.1	.	.	.	.	.	.	.	.	.	.	.	20.4	3.984303	0.74474	.	.	ENSG00000168298	ENST00000304218	T	0.12672	2.66	5.35	3.56	0.40772	Histone H1/H5 (3);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.099310	0.64402	D	0.000002	T	0.15782	0.0380	L	0.55990	1.75	0.58432	D	0.999993	P	0.38048	0.616	P	0.54460	0.753	T	0.00904	-1.1520	10	0.87932	D	0	-1.8185	10.4346	0.44428	0.2217:0.0:0.7783:0.0	.	75	P10412	H14_HUMAN	N	75	ENSP00000307705:K75N	ENSP00000307705:K75N	K	+	3	2	HIST1H1E	26264822	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.912000	0.39946	0.738000	0.32606	0.561000	0.74099	AAG	.	G|0.994;A|0.006		0.592	HIST1H1E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040084.1	NM_005321	
PRRC2A	7916	hgsc.bcm.edu	37	6	31599888	31599888	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:31599888T>C	ENST00000376033.2	+	16	3672	c.3438T>C	c.(3436-3438)ccT>ccC	p.P1146P	PRRC2A_ENST00000376007.4_Silent_p.P1146P	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1146	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						GAGCCCCACCTTCACCAGCCC	0.677																																					p.P1146P		Atlas-SNP	.											.	PRRC2A	152	.	0			c.T3438C						.						31.0	41.0	38.0					6																	31599888		1509	2707	4216	SO:0001819	synonymous_variant	7916	exon16			CCCACCTTCACCA	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3438T>C	chr6.hg19:g.31599888T>C		90.0	0.0		87.0	4.0	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	ENST00000376033.2	hg19	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	T	5.099	0.203843	0.09704	.	.	ENSG00000204469	ENST00000424184;ENST00000435052	.	.	.	5.29	-9.35	0.00633	.	.	.	.	.	T	0.27063	0.0663	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55341	-0.8156	5	0.87932	D	0	-0.929	0.8815	0.01235	0.198:0.2525:0.2908:0.2587	.	.	.	.	L	1144;1133	.	ENSP00000407986:F1144L	F	+	1	0	PRRC2A	31707867	0.000000	0.05858	0.192000	0.23308	0.930000	0.56654	-0.456000	0.06754	-1.260000	0.02465	-0.912000	0.02778	TTC	.	.		0.677	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	
BAG6	7917	hgsc.bcm.edu	37	6	31610072	31610072	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:31610072G>A	ENST00000375964.6	-	15	2375	c.2062C>T	c.(2062-2064)Cct>Tct	p.P688S	BAG6_ENST00000404765.2_Missense_Mutation_p.P718S|BAG6_ENST00000470875.1_5'UTR|BAG6_ENST00000362049.6_Missense_Mutation_p.P682S|BAG6_ENST00000439687.2_Missense_Mutation_p.P556S|BAG6_ENST00000375976.4_Missense_Mutation_p.P682S|BAG6_ENST00000211379.5_Missense_Mutation_p.P682S	NM_004639.3|NM_080703.2	NP_004630.3|NP_542434.1	P46379	BAG6_HUMAN	BCL2-associated athanogene 6	688					brain development (GO:0007420)|cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|embryo development (GO:0009790)|immune system process (GO:0002376)|internal peptidyl-lysine acetylation (GO:0018393)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|kidney development (GO:0001822)|lung development (GO:0030324)|negative regulation of apoptotic process (GO:0043066)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of proteolysis (GO:0045861)|protein stabilization (GO:0050821)|regulation of cell proliferation (GO:0042127)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)|tail-anchored membrane protein insertion into ER membrane (GO:0071816)|transport (GO:0006810)|ubiquitin-dependent protein catabolic process (GO:0006511)	BAT3 complex (GO:0071818)|cytosol (GO:0005829)|nucleus (GO:0005634)	polyubiquitin binding (GO:0031593)|proteasome binding (GO:0070628)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(2)|pancreas(2)|skin(3)|urinary_tract(2)	36						AGGCCTCCAGGACTCCCTGCG	0.682																																					p.P688S		Atlas-SNP	.											.	BAG6	73	.	0			c.C2062T						.						9.0	9.0	9.0					6																	31610072		1497	2694	4191	SO:0001583	missense	7917	exon15			CTCCAGGACTCCC	M31294	CCDS4709.1, CCDS47403.1, CCDS56414.1, CCDS56415.1	6p21.3	2011-06-14	2010-12-09	2010-12-09	ENSG00000204463	ENSG00000204463			13919	protein-coding gene	gene with protein product		142590	"""HLA-B associated transcript 3"""	BAT3		2156268	Standard	NM_004639		Approved	G3, D6S52E	uc003nvf.4	P46379	OTTHUMG00000031171	ENST00000375964.6:c.2062C>T	chr6.hg19:g.31610072G>A	ENSP00000365131:p.Pro688Ser	66.0	0.0		102.0	7.0	NM_004639	A2ADJ7|A3KQ42|A3KQ44|A6NGY6|A6PWF7|B0UX84|B4DZ12|B4E3V4|E7EMZ4|F8VXY4|O95874|Q5HYL9|Q5SQ35|Q5SQ36|Q5SQ37|Q5SQ41|Q5SRP8|Q5SRP9|Q5STC1|Q5STX1|Q5STX3|Q96SA6|Q9BCN4	Missense_Mutation	SNP	ENST00000375964.6	hg19	CCDS47403.1	.	.	.	.	.	.	.	.	.	.	G	11.40	1.626236	0.28978	.	.	ENSG00000204463	ENST00000375976;ENST00000375964;ENST00000211379;ENST00000404765;ENST00000439687;ENST00000362049;ENST00000437771	T;T;T;T;T;T;T	0.53206	1.52;1.51;1.52;1.51;0.63;1.49;0.82	5.75	4.83	0.62350	.	0.067860	0.56097	D	0.000030	T	0.19927	0.0479	N	0.19112	0.55	0.32818	D	0.502398	B;B;B;B	0.23185	0.043;0.073;0.081;0.056	B;B;B;B	0.25405	0.027;0.06;0.014;0.022	T	0.08249	-1.0731	10	0.42905	T	0.14	.	13.5612	0.61790	0.0:0.1562:0.8438:0.0	.	556;682;688;682	E7EMZ4;F8VXY4;P46379;P46379-2	.;.;BAG6_HUMAN;.	S	682;688;682;718;556;682;718	ENSP00000365143:P682S;ENSP00000365131:P688S;ENSP00000211379:P682S;ENSP00000384494:P718S;ENSP00000402856:P556S;ENSP00000354875:P682S;ENSP00000397978:P718S	ENSP00000211379:P682S	P	-	1	0	BAG6	31718051	0.965000	0.33210	0.998000	0.56505	0.984000	0.73092	1.762000	0.38451	2.731000	0.93534	0.650000	0.86243	CCT	.	.		0.682	BAG6-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_080703	
FAM83B	222584	hgsc.bcm.edu	37	6	54805894	54805894	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:54805894A>G	ENST00000306858.7	+	5	2241	c.2125A>G	c.(2125-2127)Agc>Ggc	p.S709G	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	709										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					AAGTTCTAAAAGCATGCACAA	0.403																																					p.S709G		Atlas-SNP	.											.	FAM83B	186	.	0			c.A2125G						.						91.0	93.0	92.0					6																	54805894		2203	4300	6503	SO:0001583	missense	222584	exon5			TCTAAAAGCATGC	AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.2125A>G	chr6.hg19:g.54805894A>G	ENSP00000304078:p.Ser709Gly	72.0	0.0		78.0	4.0	NM_001010872	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	ENST00000306858.7	hg19	CCDS34479.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.005123	0.54254	.	.	ENSG00000168143	ENST00000306858	T	0.34859	1.34	5.55	5.55	0.83447	.	3.202220	0.00924	N	0.002632	T	0.56202	0.1969	M	0.69823	2.125	0.45962	D	0.998789	D	0.69078	0.997	D	0.75020	0.985	T	0.21999	-1.0229	10	0.45353	T	0.12	-21.4701	15.9896	0.80193	1.0:0.0:0.0:0.0	.	709	Q5T0W9	FA83B_HUMAN	G	709	ENSP00000304078:S709G	ENSP00000304078:S709G	S	+	1	0	FAM83B	54913853	1.000000	0.71417	0.995000	0.50966	0.583000	0.36354	6.540000	0.73861	2.238000	0.73509	0.533000	0.62120	AGC	.	.		0.403	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040994.1	XM_294139	
FAM46A	55603	hgsc.bcm.edu	37	6	82461742	82461742	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:82461742G>A	ENST00000320172.6	-	2	431	c.117C>T	c.(115-117)ggC>ggT	p.G39G	FAM46A_ENST00000369756.3_Silent_p.G120G|FAM46A_ENST00000369754.3_Silent_p.G58G	NM_017633.2	NP_060103.2	Q96IP4	FA46A_HUMAN	family with sequence similarity 46, member A	39			Missing. {ECO:0000269|PubMed:12054608, ECO:0000269|PubMed:16545789}.		regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)		poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	12		all_cancers(76;6.74e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000282)|all_epithelial(107;0.0104)		BRCA - Breast invasive adenocarcinoma(397;0.0428)		cgaagtcgccgccgccgaagt	0.667																																					p.G39G		Atlas-SNP	.											.	FAM46A	37	.	0			c.C117T						.						7.0	8.0	8.0					6																	82461742		1601	3424	5025	SO:0001819	synonymous_variant	55603	exon2			GTCGCCGCCGCCG	AF350451	CCDS34489.1	6q14	2008-07-03	2004-08-19	2004-08-26	ENSG00000112773	ENSG00000112773			18345	protein-coding gene	gene with protein product		611357	"""chromosome 6 open reading frame 37"""	C6orf37		12054608, 17803723	Standard	NM_017633		Approved	FLJ20037	uc003pjg.3	Q96IP4	OTTHUMG00000015097	ENST00000320172.6:c.117C>T	chr6.hg19:g.82461742G>A		14.0	0.0		34.0	4.0	NM_017633	A8K7U4|Q5TF86|Q8NFZ9|Q9BW32|Q9NXV5	Silent	SNP	ENST00000320172.6	hg19	CCDS34489.1																																																																																			.	.		0.667	FAM46A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041331.1		
PGM3	5238	hgsc.bcm.edu	37	6	83889643	83889643	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:83889643T>C	ENST00000283977.4	-	6	714	c.588A>G	c.(586-588)ggA>ggG	p.G196G	PGM3_ENST00000512866.1_Silent_p.G277G|PGM3_ENST00000513973.1_Silent_p.G277G|PGM3_ENST00000506587.1_Silent_p.G305G					phosphoglucomutase 3											NS(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	18		all_cancers(76;0.000504)|Acute lymphoblastic leukemia(125;3.85e-06)|all_hematologic(105;0.0017)|all_epithelial(107;0.068)		BRCA - Breast invasive adenocarcinoma(397;0.0478)		TGTCTGCATCTCCATCAAAAG	0.343																																					p.G305G		Atlas-SNP	.											.	PGM3	39	.	0			c.A915G						.						147.0	124.0	132.0					6																	83889643		2203	4300	6503	SO:0001819	synonymous_variant	5238	exon8			TGCATCTCCATCA	BC001258	CCDS4997.1, CCDS56435.1, CCDS56436.1, CCDS75487.1	6q14.1-q15	2012-10-02			ENSG00000013375	ENSG00000013375	5.4.2.3		8907	protein-coding gene	gene with protein product	"""acetylglucosamine phosphomutase"""	172100				12174217, 10721701	Standard	NM_001199917		Approved	AGM1, DKFZP434B187, PAGM	uc011dyz.2	O95394	OTTHUMG00000015110	ENST00000283977.4:c.588A>G	chr6.hg19:g.83889643T>C		116.0	0.0		108.0	5.0	NM_001199917		Silent	SNP	ENST00000283977.4	hg19																																																																																				.	.		0.343	PGM3-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000366385.2	NM_015599	
MDN1	23195	hgsc.bcm.edu	37	6	90428856	90428856	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:90428856T>C	ENST00000369393.3	-	41	6171	c.6056A>G	c.(6055-6057)cAg>cGg	p.Q2019R	MDN1_ENST00000428876.1_Splice_Site_p.Q2019R			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	2019					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCTCCTTACCTGAACATCATA	0.413																																					p.Q2019R		Atlas-SNP	.											.	MDN1	478	.	0			c.A6056G						.						102.0	93.0	96.0					6																	90428856		2203	4300	6503	SO:0001630	splice_region_variant	23195	exon41			CTTACCTGAACAT	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.6057+1A>G	chr6.hg19:g.90428856T>C		60.0	0.0		57.0	4.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	hg19	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	14.32	2.499108	0.44455	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03553	3.89;3.89	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	T	0.02807	0.0084	M	0.70275	2.135	0.58432	D	0.99999	B	0.16166	0.016	B	0.27076	0.076	T	0.32508	-0.9904	10	0.18276	T	0.48	.	14.3369	0.66598	0.0:0.0:0.0:1.0	.	2019	Q9NU22	MDN1_HUMAN	R	2019	ENSP00000358400:Q2019R;ENSP00000413970:Q2019R	ENSP00000358400:Q2019R	Q	-	2	0	MDN1	90485577	1.000000	0.71417	0.998000	0.56505	0.784000	0.44337	5.493000	0.66899	1.954000	0.56735	0.455000	0.32223	CAG	.	.		0.413	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		Missense_Mutation
MANEA	79694	hgsc.bcm.edu	37	6	96053973	96053973	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:96053973A>G	ENST00000358812.4	+	5	1215	c.1081A>G	c.(1081-1083)Ata>Gta	p.I361V		NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	361	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		CCCAGGATACATAGATACCAG	0.428																																					p.I361V		Atlas-SNP	.											.	MANEA	58	.	0			c.A1081G						.						94.0	102.0	100.0					6																	96053973		2203	4300	6503	SO:0001583	missense	79694	exon5			GGATACATAGATA	AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.1081A>G	chr6.hg19:g.96053973A>G	ENSP00000351669:p.Ile361Val	59.0	0.0		46.0	4.0	NM_024641	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Missense_Mutation	SNP	ENST00000358812.4	hg19	CCDS5032.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.759533	0.49468	.	.	ENSG00000172469	ENST00000358812	.	.	.	6.17	4.95	0.65309	.	0.042725	0.85682	D	0.000000	T	0.41236	0.1150	L	0.54965	1.715	0.51767	D	0.999931	P	0.46277	0.875	P	0.45037	0.467	T	0.28744	-1.0034	9	0.16896	T	0.51	-22.0161	12.5523	0.56233	0.8614:0.1386:0.0:0.0	.	361	Q5SRI9	MANEA_HUMAN	V	361	.	ENSP00000351669:I361V	I	+	1	0	MANEA	96160694	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.638000	0.46562	2.371000	0.80710	0.533000	0.62120	ATA	.	.		0.428	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043644.1	NM_024641	
NDUFAF4	29078	hgsc.bcm.edu	37	6	97339243	97339243	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:97339243C>T	ENST00000316149.7	-	3	344	c.265G>A	c.(265-267)Gag>Aag	p.E89K	NDUFAF4_ENST00000489477.1_5'UTR	NM_014165.3	NP_054884.1	Q9P032	NDUF4_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 4	89					mitochondrial respiratory chain complex I assembly (GO:0032981)	mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)				large_intestine(5)|lung(3)|ovary(1)|skin(1)	10						TCCTTCGGCTCTTGACATGTT	0.338																																					p.E89K		Atlas-SNP	.											NDUFAF4,colon,carcinoma,0,1	NDUFAF4	16	.	0			c.G265A						.						73.0	76.0	75.0					6																	97339243		2202	4300	6502	SO:0001583	missense	29078	exon3			TCGGCTCTTGACA	AF161474	CCDS5037.1	6q16.3	2012-10-12	2012-05-08	2009-03-18	ENSG00000123545	ENSG00000123545		"""Mitochondrial respiratory chain complex assembly factors"""	21034	protein-coding gene	gene with protein product		611776	"""chromosome 6 open reading frame 66"", ""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, assembly factor 4"""	C6orf66		11042152, 18179882	Standard	NM_014165		Approved	HSPC125, bA22L21.1, My013, HRPAP20	uc003pow.3	Q9P032	OTTHUMG00000015246	ENST00000316149.7:c.265G>A	chr6.hg19:g.97339243C>T	ENSP00000358272:p.Glu89Lys	48.0	0.0		38.0	2.0	NM_014165	B2R4J5	Missense_Mutation	SNP	ENST00000316149.7	hg19	CCDS5037.1	.	.	.	.	.	.	.	.	.	.	C	0.006	-2.095262	0.00364	.	.	ENSG00000123545	ENST00000316149	D	0.82526	-1.62	3.88	-0.359	0.12571	.	0.376069	0.27084	N	0.021007	T	0.41858	0.1177	L	0.36672	1.1	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.42816	-0.9429	10	0.02654	T	1	-7.467	4.2716	0.10789	0.0:0.3023:0.3191:0.3785	.	89	Q9P032	NDUF4_HUMAN	K	89	ENSP00000358272:E89K	ENSP00000358272:E89K	E	-	1	0	NDUFAF4	97445964	0.000000	0.05858	0.028000	0.17463	0.052000	0.14988	-0.796000	0.04575	-0.086000	0.12550	0.655000	0.94253	GAG	.	.		0.338	NDUFAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041567.1	NM_014165	
ASCC3	10973	hgsc.bcm.edu	37	6	101109765	101109765	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:101109765T>C	ENST00000369162.2	-	16	2964	c.2620A>G	c.(2620-2622)Agc>Ggc	p.S874G		NM_006828.2	NP_006819.2	Q8N3C0	ASCC3_HUMAN	activating signal cointegrator 1 complex subunit 3	874	Helicase C-terminal 1. {ECO:0000255|PROSITE-ProRule:PRU00542}.				cell proliferation (GO:0008283)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA duplex unwinding (GO:0032508)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(20)|liver(1)|lung(36)|ovary(6)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	92		all_cancers(76;1.45e-07)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(87;0.00149)|Hepatocellular(1;0.0893)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0539)|all cancers(137;0.103)|GBM - Glioblastoma multiforme(226;0.199)		AGGTAATGGCTGAGTTTATCA	0.398																																					p.S874G		Atlas-SNP	.											.	ASCC3	205	.	0			c.A2620G						.						194.0	187.0	190.0					6																	101109765		2203	4300	6503	SO:0001583	missense	10973	exon16			AATGGCTGAGTTT	AJ223948	CCDS5046.1, CCDS5047.1, CCDS75497.1	6q16	2008-02-05		2004-07-28	ENSG00000112249	ENSG00000112249			18697	protein-coding gene	gene with protein product	"""RNA helicase family"""	614217	"""helicase, ATP binding 1"""	HELIC1		10218103	Standard	NM_006828		Approved	RNAH, ASC1p200, dJ121G13.4, dJ467N11.1	uc003pqk.3	Q8N3C0	OTTHUMG00000015279	ENST00000369162.2:c.2620A>G	chr6.hg19:g.101109765T>C	ENSP00000358159:p.Ser874Gly	108.0	0.0		110.0	5.0	NM_006828	E7EW23|O43738|Q4G1A0|Q5VTN2|Q9H1I9|Q9H5A2|Q9NTR0	Missense_Mutation	SNP	ENST00000369162.2	hg19	CCDS5046.1	.	.	.	.	.	.	.	.	.	.	T	18.80	3.701149	0.68501	.	.	ENSG00000112249	ENST00000369162	D	0.91351	-2.83	5.76	5.76	0.90799	Helicase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83797	0.5332	L	0.42008	1.315	0.80722	D	1	P	0.51449	0.945	B	0.41466	0.358	D	0.85473	0.1174	10	0.45353	T	0.12	.	16.3786	0.83431	0.0:0.0:0.0:1.0	.	874	Q8N3C0	HELC1_HUMAN	G	874	ENSP00000358159:S874G	ENSP00000358159:S874G	S	-	1	0	ASCC3	101216486	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.043000	0.71004	2.323000	0.78572	0.528000	0.53228	AGC	.	.		0.398	ASCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041632.2	NM_006828	
FRK	2444	hgsc.bcm.edu	37	6	116263618	116263618	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:116263618T>C	ENST00000606080.1	-	8	1923	c.1477A>G	c.(1477-1479)Aca>Gca	p.T493A	FRK_ENST00000538210.1_Missense_Mutation_p.T351A	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	493					cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	GAAGAGTCTGTTTCAAAATAG	0.348																																					p.T493A		Atlas-SNP	.											.	FRK	78	.	0			c.A1477G						.						121.0	119.0	120.0					6																	116263618		2203	4300	6503	SO:0001583	missense	2444	exon8			AGTCTGTTTCAAA	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.1477A>G	chr6.hg19:g.116263618T>C	ENSP00000476145:p.Thr493Ala	143.0	0.0		102.0	5.0	NM_002031	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	hg19	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	T	9.235	1.036780	0.19669	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.73258	-0.73;-0.7	5.07	-2.3	0.06785	.	1.288910	0.05491	N	0.556561	T	0.22205	0.0535	N	0.04148	-0.265	0.23215	N	0.998102	B	0.02656	0.0	B	0.01281	0.0	T	0.15178	-1.0446	10	0.56958	D	0.05	.	3.1631	0.06527	0.1057:0.2662:0.0989:0.5292	.	493	P42685	FRK_HUMAN	A	493;351	ENSP00000357615:T493A;ENSP00000443075:T351A	ENSP00000357615:T493A	T	-	1	0	FRK	116370311	0.000000	0.05858	0.946000	0.38457	0.776000	0.43924	0.034000	0.13776	-0.144000	0.11314	0.482000	0.46254	ACA	.	.		0.348	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
ZUFSP	221302	hgsc.bcm.edu	37	6	116987986	116987986	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:116987986T>C	ENST00000368576.3	-	2	613	c.370A>G	c.(370-372)Act>Gct	p.T124A	ZUFSP_ENST00000368573.1_Missense_Mutation_p.T124A|ZUFSP_ENST00000471919.1_5'UTR	NM_145062.2	NP_659499.2	Q96AP4	ZUFSP_HUMAN	zinc finger with UFM1-specific peptidase domain	124							metal ion binding (GO:0046872)	p.T124A(1)		NS(1)|endometrium(2)|kidney(6)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21				GBM - Glioblastoma multiforme(226;0.0258)|all cancers(137;0.0368)|OV - Ovarian serous cystadenocarcinoma(136;0.0464)|Epithelial(106;0.186)		CTAGATTCAGTTAAGTTCTCT	0.353																																					p.T124A		Atlas-SNP	.											ZUFSP,NS,carcinoma,0,1	ZUFSP	46	.	1	Substitution - Missense(1)	kidney(1)	c.A370G						.						109.0	103.0	105.0					6																	116987986		2203	4298	6501	SO:0001583	missense	221302	exon2			ATTCAGTTAAGTT	AK054582	CCDS5110.1	6q22.31	2013-01-28	2008-03-25	2008-03-25	ENSG00000153975	ENSG00000153975		"""Zinc fingers, C2H2-type"""	21224	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 113"""	C6orf113			Standard	NM_145062		Approved	dJ412I7.3	uc003pxf.2	Q96AP4	OTTHUMG00000015445	ENST00000368576.3:c.370A>G	chr6.hg19:g.116987986T>C	ENSP00000357565:p.Thr124Ala	171.0	1.0		134.0	6.0	NM_145062	Q5TD92|Q6PJH7|Q96NV6	Missense_Mutation	SNP	ENST00000368576.3	hg19	CCDS5110.1	.	.	.	.	.	.	.	.	.	.	T	10.69	1.420125	0.25552	.	.	ENSG00000153975	ENST00000368576;ENST00000368573	T	0.42900	0.96	5.75	0.136	0.14780	.	0.916720	0.09557	N	0.786063	T	0.07954	0.0199	L	0.27053	0.805	0.28771	N	0.900391	B	0.06786	0.001	B	0.04013	0.001	T	0.36163	-0.9759	10	0.08179	T	0.78	-9.1578	5.5646	0.17163	0.0:0.152:0.2707:0.5773	.	124	Q96AP4	ZUFSP_HUMAN	A	124	ENSP00000357565:T124A	ENSP00000357562:T124A	T	-	1	0	ZUFSP	117094679	0.510000	0.26171	0.950000	0.38849	0.954000	0.61252	0.185000	0.16958	0.075000	0.16796	-0.316000	0.08728	ACT	.	.		0.353	ZUFSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041961.1	NM_145062	
GJA1	2697	hgsc.bcm.edu	37	6	121768871	121768871	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:121768871G>A	ENST00000282561.3	+	2	1035	c.878G>A	c.(877-879)aGa>aAa	p.R293K		NM_000165.3	NP_000156.1	P17302	CXA1_HUMAN	gap junction protein, alpha 1, 43kDa	293					adult heart development (GO:0007512)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|atrial cardiac muscle cell action potential (GO:0086014)|atrial ventricular junction remodeling (GO:0003294)|blood vessel morphogenesis (GO:0048514)|cell communication by chemical coupling (GO:0010643)|cell communication by electrical coupling (GO:0010644)|cell-cell signaling (GO:0007267)|cellular response to mechanical stimulus (GO:0071260)|chronic inflammatory response (GO:0002544)|embryonic digit morphogenesis (GO:0042733)|endothelium development (GO:0003158)|epithelial cell maturation (GO:0002070)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lens development in camera-type eye (GO:0002088)|membrane organization (GO:0061024)|milk ejection (GO:0060156)|muscle contraction (GO:0006936)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of gene expression (GO:0010629)|neuron migration (GO:0001764)|neuron projection morphogenesis (GO:0048812)|osteoblast differentiation (GO:0001649)|positive regulation of behavioral fear response (GO:2000987)|positive regulation of cell communication by chemical coupling (GO:0010652)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein oligomerization (GO:0051259)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of bone mineralization (GO:0030500)|regulation of bone remodeling (GO:0046850)|regulation of calcium ion transport (GO:0051924)|regulation of tight junction assembly (GO:2000810)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to fluid shear stress (GO:0034405)|response to peptide hormone (GO:0043434)|response to pH (GO:0009268)|signal transduction (GO:0007165)|skeletal muscle tissue regeneration (GO:0043403)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vascular transport (GO:0010232)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|contractile fiber (GO:0043292)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gap junction (GO:0005921)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle membrane (GO:0030660)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial outer membrane (GO:0005741)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	gap junction channel activity (GO:0005243)|ion transmembrane transporter activity (GO:0015075)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(2)|large_intestine(10)|liver(2)|lung(13)|ovary(2)	33				GBM - Glioblastoma multiforme(226;0.00252)	Carvedilol(DB01136)	ACTGGCGACAGAAACAATTCT	0.493																																					p.R293K		Atlas-SNP	.											.	GJA1	61	.	0			c.G878A						.						70.0	71.0	71.0					6																	121768871		2203	4300	6503	SO:0001583	missense	2697	exon2			GCGACAGAAACAA	BC026329	CCDS5123.1	6q22.31	2013-05-10	2007-01-16		ENSG00000152661	ENSG00000152661		"""Ion channels / Gap junction proteins (connexins)"""	4274	protein-coding gene	gene with protein product	"""oculodentodigital dysplasia (syndactyly type III)"", ""connexin 43"""	121014	"""gap junction protein, alpha-like"", ""gap junction protein, alpha 1, 43kDa (connexin 43)"""	ODDD, GJAL		10331943, 1646158	Standard	NM_000165		Approved	CX43, ODD, ODOD, SDTY3	uc003pyr.3	P17302	OTTHUMG00000015479	ENST00000282561.3:c.878G>A	chr6.hg19:g.121768871G>A	ENSP00000282561:p.Arg293Lys	85.0	0.0		50.0	6.0	NM_000165	B2R5U9|Q6FHU1|Q9Y5I8	Missense_Mutation	SNP	ENST00000282561.3	hg19	CCDS5123.1	.	.	.	.	.	.	.	.	.	.	G	3.809	-0.040069	0.07497	.	.	ENSG00000152661	ENST00000440608;ENST00000282561	T	0.81415	-1.49	5.18	5.18	0.71444	Gap junction alpha-1 protein (Cx43), C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.51924	0.1703	N	0.14661	0.345	0.45403	D	0.998381	B	0.09022	0.002	B	0.19148	0.024	T	0.55630	-0.8111	10	0.07644	T	0.81	.	18.8905	0.92399	0.0:0.0:1.0:0.0	.	293	P17302	CXA1_HUMAN	K	277;293	ENSP00000282561:R293K	ENSP00000282561:R293K	R	+	2	0	GJA1	121810570	1.000000	0.71417	1.000000	0.80357	0.201000	0.24016	6.511000	0.73733	2.694000	0.91930	0.585000	0.79938	AGA	.	.		0.493	GJA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042023.1	NM_000165	
CENPW	387103	hgsc.bcm.edu	37	6	126661441	126661441	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:126661441T>C	ENST00000368328.4	+	1	122	c.22T>C	c.(22-24)Tcc>Ccc	p.S8P	CENPW_ENST00000368326.1_Missense_Mutation_p.S8P|CENPW_ENST00000368325.1_Missense_Mutation_p.S8P			Q5EE01	CENPW_HUMAN	centromere protein W	8					CENP-A containing nucleosome assembly (GO:0034080)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|kinetochore (GO:0000776)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(2)|large_intestine(1)|lung(3)	6						GACCATAGTCTCCCAGAGGAA	0.552																																					p.S8P		Atlas-SNP	.											.	CENPW	7	.	0			c.T22C						.						92.0	82.0	86.0					6																	126661441		2203	4300	6503	SO:0001583	missense	387103	exon1			ATAGTCTCCCAGA	BC039556	CCDS34529.1, CCDS69196.1, CCDS75516.1	6q22.32	2013-11-05	2010-04-16	2010-04-16	ENSG00000203760	ENSG00000203760			21488	protein-coding gene	gene with protein product	"""cancer-upregulated gene 2"""	611264	"""chromosome 6 open reading frame 173"""	C6orf173		17610844, 19070575	Standard	NM_001286524		Approved	CUG2	uc003qao.3	Q5EE01	OTTHUMG00000015518	ENST00000368328.4:c.22T>C	chr6.hg19:g.126661441T>C	ENSP00000357311:p.Ser8Pro	66.0	0.0		68.0	4.0	NM_001012507	A6NIR0|A6NJC2	Missense_Mutation	SNP	ENST00000368328.4	hg19	CCDS34529.1	.	.	.	.	.	.	.	.	.	.	T	14.18	2.457897	0.43634	.	.	ENSG00000203760	ENST00000368326;ENST00000368325;ENST00000368328	.	.	.	5.52	-3.96	0.04106	.	0.613491	0.14700	N	0.303603	T	0.08891	0.0220	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.21586	-1.0241	8	0.59425	D	0.04	-2.9097	2.1334	0.03755	0.1209:0.2813:0.1235:0.4743	.	8	Q5EE01	CENPW_HUMAN	P	8	.	ENSP00000357308:S8P	S	+	1	0	CENPW	126703134	0.001000	0.12720	0.000000	0.03702	0.199000	0.23934	0.550000	0.23345	-0.302000	0.08869	-0.371000	0.07208	TCC	.	.		0.552	CENPW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042104.1		
PTPRK	5796	hgsc.bcm.edu	37	6	128388889	128388889	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:128388889T>C	ENST00000368215.3	-	12	1931	c.1932A>G	c.(1930-1932)agA>agG	p.R644R	PTPRK_ENST00000368227.3_Silent_p.R644R|PTPRK_ENST00000368226.4_Silent_p.R644R|PTPRK_ENST00000368207.3_Silent_p.R644R|PTPRK_ENST00000368210.3_Silent_p.R644R|PTPRK_ENST00000368213.5_Silent_p.R644R|PTPRK_ENST00000532331.1_Silent_p.R644R|RP11-103C16.2_ENST00000417390.1_RNA|PTPRK_ENST00000524481.1_5'UTR			Q15262	PTPRK_HUMAN	protein tyrosine phosphatase, receptor type, K	644	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.	Cleavage. {ECO:0000305}.			cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to reactive oxygen species (GO:0034614)|cellular response to UV (GO:0034644)|focal adhesion assembly (GO:0048041)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of keratinocyte proliferation (GO:0010839)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|protein localization to cell surface (GO:0034394)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)		PTPRK/RSPO3(10)	autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(14)|lung(24)|ovary(3)|pancreas(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	72				all cancers(137;0.0118)|GBM - Glioblastoma multiforme(226;0.0372)|OV - Ovarian serous cystadenocarcinoma(136;0.24)		CTCCGGCTTCTCTCTTGGTTC	0.463																																					p.R644R		Atlas-SNP	.											.	PTPRK	330	.	0			c.A1932G						.						74.0	79.0	78.0					6																	128388889		2203	4300	6503	SO:0001819	synonymous_variant	5796	exon12			GGCTTCTCTCTTG	L77886	CCDS5137.1, CCDS47473.1, CCDS75517.1	6q22.2-q22.3	2013-02-11			ENSG00000152894	ENSG00000152894		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9674	protein-coding gene	gene with protein product		602545				9047348, 8663237	Standard	NM_002844		Approved	R-PTP-kappa	uc010kfc.3	Q15262	OTTHUMG00000015536	ENST00000368215.3:c.1932A>G	chr6.hg19:g.128388889T>C		97.0	0.0		83.0	4.0	NM_001135648	B2RTQ8|B7ZMG0|Q14763|Q5TG10|Q5TG11	Silent	SNP	ENST00000368215.3	hg19																																																																																				.	.		0.463	PTPRK-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000042163.1		
MOXD1	26002	hgsc.bcm.edu	37	6	132649228	132649228	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:132649228T>C	ENST00000367963.3	-	6	988	c.870A>G	c.(868-870)ggA>ggG	p.G290G	MOXD1_ENST00000336749.3_Silent_p.G222G|MOXD1_ENST00000489128.1_5'Flank	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	290						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		CAAGGGATAATCCAACATGAG	0.398																																					p.G290G		Atlas-SNP	.											.	MOXD1	136	.	0			c.A870G						.						100.0	96.0	98.0					6																	132649228		2203	4300	6503	SO:0001819	synonymous_variant	26002	exon6			GGATAATCCAACA	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.870A>G	chr6.hg19:g.132649228T>C		118.0	0.0		102.0	5.0	NM_015529	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Silent	SNP	ENST00000367963.3	hg19	CCDS5152.2																																																																																			.	.		0.398	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529	
HBS1L	10767	hgsc.bcm.edu	37	6	135323935	135323935	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:135323935A>G	ENST00000367837.5	-	5	682	c.476T>C	c.(475-477)gTg>gCg	p.V159A	HBS1L_ENST00000527578.1_5'UTR|HBS1L_ENST00000367826.2_Missense_Mutation_p.V117A|HBS1L_ENST00000367824.4_5'UTR|HBS1L_ENST00000415177.2_Missense_Mutation_p.V94A|HBS1L_ENST00000314674.3_3'UTR|HBS1L_ENST00000445176.2_Intron	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase	159					signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		AACTTTTGGCACAATTTCAGA	0.388																																					p.V159A		Atlas-SNP	.											.	HBS1L	75	.	0			c.T476C						.						115.0	106.0	109.0					6																	135323935		2203	4300	6503	SO:0001583	missense	10767	exon5			TTTGGCACAATTT	U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.476T>C	chr6.hg19:g.135323935A>G	ENSP00000356811:p.Val159Ala	152.0	0.0		125.0	5.0	NM_006620	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	ENST00000367837.5	hg19	CCDS5173.1	.	.	.	.	.	.	.	.	.	.	A	16.31	3.086398	0.55861	.	.	ENSG00000112339	ENST00000367837;ENST00000415177;ENST00000367826;ENST00000533274;ENST00000524715	T;T;T;T	0.65732	-0.04;-0.02;-0.03;-0.17	6.13	4.91	0.64330	.	0.053770	0.64402	D	0.000001	T	0.46756	0.1409	M	0.61703	1.905	0.80722	D	1	B;B	0.17038	0.02;0.012	B;B	0.18871	0.023;0.019	T	0.52200	-0.8607	10	0.46703	T	0.11	-15.1372	13.2493	0.60041	0.8678:0.1322:0.0:0.0	.	117;159	Q9Y450-4;Q9Y450	.;HBS1L_HUMAN	A	159;94;117;29;137	ENSP00000356811:V159A;ENSP00000389826:V94A;ENSP00000356800:V117A;ENSP00000434533:V29A	ENSP00000356800:V117A	V	-	2	0	HBS1L	135365628	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	6.768000	0.74980	2.367000	0.80283	0.529000	0.55759	GTG	.	.		0.388	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042339.2		
KIAA1244	57221	hgsc.bcm.edu	37	6	138576727	138576727	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:138576727T>C	ENST00000251691.4	+	10	1091	c.925T>C	c.(925-927)Tgc>Cgc	p.C309R		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGGCTGCTCCTGCACTGCGCC	0.637																																					p.C309R		Atlas-SNP	.											.	KIAA1244	236	.	0			c.T925C						.						68.0	63.0	64.0					6																	138576727		2203	4300	6503	SO:0001583	missense	57221	exon10			TGCTCCTGCACTG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.925T>C	chr6.hg19:g.138576727T>C	ENSP00000251691:p.Cys309Arg	86.0	0.0		85.0	4.0	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	hg19	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	T	13.89	2.371438	0.42003	.	.	ENSG00000112379	ENST00000251691	T	0.16597	2.33	5.68	4.5	0.54988	.	0.275771	0.43260	D	0.000595	T	0.03871	0.0109	N	0.08118	0	0.58432	D	0.999995	B	0.18166	0.026	B	0.15484	0.013	T	0.20773	-1.0265	10	0.52906	T	0.07	-3.334	12.8709	0.57965	0.0:0.0:0.1361:0.8638	.	309	Q5TH69	BIG3_HUMAN	R	309	ENSP00000251691:C309R	ENSP00000251691:C309R	C	+	1	0	KIAA1244	138618420	1.000000	0.71417	0.987000	0.45799	0.628000	0.37860	6.248000	0.72418	0.972000	0.38314	0.533000	0.62120	TGC	.	.		0.637	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
HIVEP2	3097	hgsc.bcm.edu	37	6	143092668	143092668	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:143092668A>G	ENST00000367604.1	-	4	3847	c.3208T>C	c.(3208-3210)Tca>Cca	p.S1070P	HIVEP2_ENST00000012134.2_Missense_Mutation_p.S1070P|HIVEP2_ENST00000367603.2_Missense_Mutation_p.S1070P			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1070					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		CTGGACGGTGATACCGTGGAG	0.557																																					p.S1070P	Esophageal Squamous(107;843 1510 13293 16805 42198)	Atlas-SNP	.											.	HIVEP2	225	.	0			c.T3208C						.						35.0	37.0	37.0					6																	143092668		2021	4170	6191	SO:0001583	missense	3097	exon5			ACGGTGATACCGT	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3208T>C	chr6.hg19:g.143092668A>G	ENSP00000356576:p.Ser1070Pro	78.0	0.0		95.0	4.0	NM_006734	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	ENST00000367604.1	hg19	CCDS43510.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332044	0.81801	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.57752	0.38;0.38;0.38	5.67	5.67	0.87782	.	0.049534	0.85682	D	0.000000	T	0.63698	0.2533	M	0.71581	2.175	0.58432	D	0.999995	D	0.89917	1.0	D	0.71870	0.975	T	0.64007	-0.6508	10	0.38643	T	0.18	-23.8527	15.9165	0.79524	1.0:0.0:0.0:0.0	.	1070	P31629	ZEP2_HUMAN	P	1070	ENSP00000356576:S1070P;ENSP00000356575:S1070P;ENSP00000012134:S1070P	ENSP00000012134:S1070P	S	-	1	0	HIVEP2	143134361	1.000000	0.71417	0.025000	0.17156	0.228000	0.25075	4.072000	0.57563	2.169000	0.68431	0.460000	0.39030	TCA	.	.		0.557	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
SHPRH	257218	hgsc.bcm.edu	37	6	146243946	146243946	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:146243946A>G	ENST00000367505.2	-	19	3836	c.3572T>C	c.(3571-3573)tTc>tCc	p.F1191S	SHPRH_ENST00000438092.2_Missense_Mutation_p.F1195S|SHPRH_ENST00000367503.3_Missense_Mutation_p.F1195S|SHPRH_ENST00000275233.7_Missense_Mutation_p.F1191S			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	1191					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		TGTAAGTAAGAACTGAAGACC	0.403																																					p.F1195S		Atlas-SNP	.											.	SHPRH	169	.	0			c.T3584C						.						93.0	87.0	89.0					6																	146243946		1888	4099	5987	SO:0001583	missense	257218	exon19			AGTAAGAACTGAA	AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.3572T>C	chr6.hg19:g.146243946A>G	ENSP00000356475:p.Phe1191Ser	91.0	0.0		78.0	4.0	NM_173082	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Missense_Mutation	SNP	ENST00000367505.2	hg19	CCDS43513.2	.	.	.	.	.	.	.	.	.	.	A	21.0	4.084493	0.76642	.	.	ENSG00000146414	ENST00000367505;ENST00000367503;ENST00000438092;ENST00000275233	T;T;T;T	0.74526	-0.85;-0.85;-0.85;-0.85	5.44	4.13	0.48395	.	0.142264	0.48767	D	0.000162	T	0.64962	0.2646	L	0.43152	1.355	0.46336	D	0.998993	P;D;D	0.63880	0.664;0.987;0.993	B;P;P	0.56916	0.143;0.649;0.809	T	0.63033	-0.6727	10	0.23891	T	0.37	-16.797	8.4383	0.32799	0.6169:0.0:0.0:0.3831	.	390;1191;1195	B3KX98;Q149N8;Q149N8-4	.;SHPRH_HUMAN;.	S	1191;1195;1195;1191	ENSP00000356475:F1191S;ENSP00000356473:F1195S;ENSP00000412797:F1195S;ENSP00000275233:F1191S	ENSP00000275233:F1191S	F	-	2	0	SHPRH	146285639	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.328000	0.65887	2.187000	0.69744	0.528000	0.53228	TTC	.	.		0.403	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000042571.2	NM_173082	
ESR1	2099	hgsc.bcm.edu	37	6	152265434	152265434	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:152265434T>C	ENST00000206249.3	+	4	1249	c.887T>C	c.(886-888)cTc>cCc	p.L296P	ESR1_ENST00000443427.1_Missense_Mutation_p.L296P|ESR1_ENST00000440973.1_Missense_Mutation_p.L296P|ESR1_ENST00000338799.5_Missense_Mutation_p.L296P|ESR1_ENST00000406599.1_Intron|ESR1_ENST00000427531.2_Missense_Mutation_p.L123P|ESR1_ENST00000482101.1_3'UTR|ESR1_ENST00000456483.2_Intron	NM_000125.3	NP_000116.2	P03372	ESR1_HUMAN	estrogen receptor 1	296	Hinge.|Interaction with AKAP13.|Mediates interaction with DNTTIP2.|Self-association.				androgen metabolic process (GO:0008209)|antral ovarian follicle growth (GO:0001547)|cellular response to estradiol stimulus (GO:0071392)|chromatin remodeling (GO:0006338)|epithelial cell development (GO:0002064)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|gene expression (GO:0010467)|intracellular estrogen receptor signaling pathway (GO:0030520)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|male gonad development (GO:0008584)|mammary gland alveolus development (GO:0060749)|mammary gland branching involved in pregnancy (GO:0060745)|negative regulation of gene expression (GO:0010629)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|regulation of apoptotic process (GO:0042981)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of transcription, DNA-templated (GO:0006355)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|uterus development (GO:0060065)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|transcriptionally active chromatin (GO:0035327)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|enzyme binding (GO:0019899)|estrogen receptor activity (GO:0030284)|estrogen response element binding (GO:0034056)|estrogen-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0038052)|identical protein binding (GO:0042802)|nitric-oxide synthase regulator activity (GO:0030235)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(19)|ovary(1)|prostate(2)|skin(1)	49		Ovarian(120;0.0448)	BRCA - Breast invasive adenocarcinoma(37;0.0841)	OV - Ovarian serous cystadenocarcinoma(155;4.55e-10)	Allylestrenol(DB01431)|Clomifene(DB00882)|Conjugated Estrogens(DB00286)|Danazol(DB01406)|Desogestrel(DB00304)|Dienestrol(DB00890)|Diethylstilbestrol(DB00255)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Estropipate(DB04574)|Ethinyl Estradiol(DB00977)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluoxymesterone(DB01185)|Fulvestrant(DB00947)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Melatonin(DB01065)|Mestranol(DB01357)|Naloxone(DB01183)|Norgestimate(DB00957)|Ospemifene(DB04938)|Progesterone(DB00396)|Quinestrol(DB04575)|Raloxifene(DB00481)|Tamoxifen(DB00675)|Toremifene(DB00539)|Trilostane(DB01108)	CCAAGCCCGCTCATGATCAAA	0.562																																					p.L296P		Atlas-SNP	.											.	ESR1	94	.	0			c.T887C						.						114.0	112.0	113.0					6																	152265434		2203	4300	6503	SO:0001583	missense	2099	exon4			GCCCGCTCATGAT	X03635	CCDS5234.1	6q24-q27	2013-01-16			ENSG00000091831	ENSG00000091831		"""Nuclear hormone receptors"""	3467	protein-coding gene	gene with protein product		133430		ESR		3754034	Standard	NM_000125		Approved	NR3A1, Era	uc003qon.4	P03372	OTTHUMG00000016103	ENST00000206249.3:c.887T>C	chr6.hg19:g.152265434T>C	ENSP00000206249:p.Leu296Pro	99.0	0.0		109.0	5.0	NM_000125	Q13511|Q14276|Q5T5H7|Q6MZQ9|Q9NU51|Q9UDZ7|Q9UIS7	Missense_Mutation	SNP	ENST00000206249.3	hg19	CCDS5234.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.310|8.310	0.821943|0.821943	0.16678|0.16678	.|.	.|.	ENSG00000091831|ENSG00000091831	ENST00000440973;ENST00000338799;ENST00000431219;ENST00000443427;ENST00000206249;ENST00000431590;ENST00000544394|ENST00000427531	D;D;D;D;D|.	0.93547|.	-3.14;-3.14;-3.14;-3.14;-3.24|.	5.66|5.66	5.66|5.66	0.87406|0.87406	Nuclear hormone receptor, ligand-binding (1);|.	0.430373|.	0.24752|.	N|.	0.035893|.	T|T	0.55705|0.55705	0.1937|0.1937	M|M	0.68952|0.68952	2.095|2.095	0.43598|0.43598	D|D	0.995954|0.995954	P;B;D;B;P;P|.	0.59767|.	0.955;0.001;0.986;0.006;0.699;0.574|.	P;B;D;B;P;B|.	0.66351|.	0.616;0.011;0.943;0.006;0.474;0.282|.	T|T	0.59989|0.59989	-0.7350|-0.7350	10|5	0.34782|.	T|.	0.22|.	.|.	10.2659|10.2659	0.43455|0.43455	0.0:0.0738:0.0:0.9262|0.0:0.0738:0.0:0.9262	.|.	200;77;38;295;296;296|.	B0QYW6;E7EVR3;Q9Y2W8;A8KAF4;G4XH65;P03372|.	.;.;.;.;.;ESR1_HUMAN|.	P|P	296;296;77;296;296;224;123|201	ENSP00000405330:L296P;ENSP00000342630:L296P;ENSP00000387500:L296P;ENSP00000206249:L296P;ENSP00000445454:L123P|.	ENSP00000206249:L296P|.	L|S	+|+	2|1	0|0	ESR1|ESR1	152307127|152307127	0.761000|0.761000	0.28439|0.28439	0.078000|0.078000	0.20375|0.20375	0.458000|0.458000	0.32498|0.32498	2.704000|2.704000	0.47118|0.47118	2.164000|2.164000	0.68074|0.68074	0.533000|0.533000	0.62120|0.62120	CTC|TCA	.	.		0.562	ESR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043308.1		
MTRF1L	54516	hgsc.bcm.edu	37	6	153313995	153313995	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:153313995T>C	ENST00000367233.5	-	5	801	c.802A>G	c.(802-804)Aca>Gca	p.T268A	MTRF1L_ENST00000367230.1_Missense_Mutation_p.T232A|MTRF1L_ENST00000367231.5_Missense_Mutation_p.T268A|MTRF1L_ENST00000464135.1_5'UTR	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	268						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		TACACACCTGTTGGAAGATGA	0.408																																					p.T268A		Atlas-SNP	.											.	MTRF1L	21	.	0			c.A802G						.						90.0	89.0	89.0					6																	153313995		2203	4300	6503	SO:0001583	missense	54516	exon5			CACCTGTTGGAAG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.802A>G	chr6.hg19:g.153313995T>C	ENSP00000356202:p.Thr268Ala	42.0	0.0		63.0	4.0	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	hg19	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.610409	0.87258	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771;ENST00000448966	T;T;T;T;T	0.25250	1.81;1.81;1.81;1.81;1.81	5.02	5.02	0.67125	Peptide chain release factor class I/class II (1);	0.000000	0.85682	D	0.000000	T	0.55449	0.1921	H	0.95079	3.62	0.80722	D	1	P;P;D;P	0.60575	0.754;0.831;0.988;0.87	P;P;D;P	0.70935	0.518;0.459;0.971;0.484	T	0.71474	-0.4582	10	0.87932	D	0	.	14.7403	0.69448	0.0:0.0:0.0:1.0	.	232;268;232;268	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	A	268;268;232;119;132	ENSP00000356202:T268A;ENSP00000356200:T268A;ENSP00000356199:T232A;ENSP00000414383:T119A;ENSP00000415113:T132A	ENSP00000356199:T232A	T	-	1	0	MTRF1L	153355688	1.000000	0.71417	0.980000	0.43619	0.871000	0.50021	8.008000	0.88588	1.901000	0.55032	0.528000	0.53228	ACA	.	.		0.408	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
NOX3	50508	hgsc.bcm.edu	37	6	155775983	155775983	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:155775983T>C	ENST00000159060.2	-	3	319	c.217A>G	c.(217-219)Agt>Ggt	p.S73G		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	73	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)			cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		AGGTTTCGACTGACAGGTATT	0.373																																					p.S73G		Atlas-SNP	.											.	NOX3	93	.	0			c.A217G						.						68.0	67.0	67.0					6																	155775983		2203	4300	6503	SO:0001583	missense	50508	exon3			TTCGACTGACAGG	AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.217A>G	chr6.hg19:g.155775983T>C	ENSP00000159060:p.Ser73Gly	60.0	0.0		80.0	4.0	NM_015718	Q9HBJ9	Missense_Mutation	SNP	ENST00000159060.2	hg19	CCDS5250.1	.	.	.	.	.	.	.	.	.	.	T	14.00	2.404765	0.42613	.	.	ENSG00000074771	ENST00000159060	D	0.95342	-3.68	5.91	4.73	0.59995	Flavoprotein transmembrane component (1);	0.072971	0.64402	D	0.000016	D	0.90947	0.7154	L	0.54323	1.7	0.34075	D	0.658918	P	0.40578	0.722	P	0.45998	0.5	D	0.90484	0.4462	10	0.87932	D	0	-10.2081	10.4134	0.44307	0.3703:0.0:0.0:0.6297	.	73	Q9HBY0	NOX3_HUMAN	G	73	ENSP00000159060:S73G	ENSP00000159060:S73G	S	-	1	0	NOX3	155817675	1.000000	0.71417	0.932000	0.37286	0.987000	0.75469	1.650000	0.37292	1.025000	0.39708	0.528000	0.53228	AGT	.	.		0.373	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042819.1		
AGPAT4	56895	hgsc.bcm.edu	37	6	161567572	161567572	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:161567572T>C	ENST00000320285.4	-	7	1039	c.827A>G	c.(826-828)aAg>aGg	p.K276R	AGPAT4_ENST00000366911.5_3'UTR|AGPAT4_ENST00000366908.5_3'UTR|AGPAT4_ENST00000457520.2_Missense_Mutation_p.K114R	NM_020133.2	NP_064518.1	Q9NRZ5	PLCD_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 4	276					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(10)|lung(10)|ovary(2)|skin(2)	25		Breast(66;0.000289)|Ovarian(120;0.0266)|Prostate(117;0.0285)		OV - Ovarian serous cystadenocarcinoma(65;2.23e-17)|BRCA - Breast invasive adenocarcinoma(81;3.58e-05)		CTGGTAGAGCTTGTGCAGCCA	0.602																																					p.K276R		Atlas-SNP	.											.	AGPAT4	50	.	0			c.A827G						.						128.0	98.0	108.0					6																	161567572		2203	4300	6503	SO:0001583	missense	56895	exon7			TAGAGCTTGTGCA	AF156776	CCDS5280.1	6q25.3	2013-02-05	2013-02-05		ENSG00000026652	ENSG00000026652	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20885	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, delta"""	614795	"""1-acylglycerol-3-phosphate O-acyltransferase 4 (lysophosphatidic acid acyltransferase, delta)"""				Standard	XM_005267052		Approved	LPAAT-delta, dJ473J16.2	uc003qtr.1	Q9NRZ5	OTTHUMG00000015966	ENST00000320285.4:c.827A>G	chr6.hg19:g.161567572T>C	ENSP00000314036:p.Lys276Arg	68.0	0.0		64.0	4.0	NM_020133	B4DSF9|Q5TEF0	Missense_Mutation	SNP	ENST00000320285.4	hg19	CCDS5280.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.89|15.89	2.966761|2.966761	0.53507|0.53507	.|.	.|.	ENSG00000026652|ENSG00000026652	ENST00000320285;ENST00000457520|ENST00000437165	D|.	0.93547|.	-3.24|.	4.95|4.95	2.55|2.55	0.30701|0.30701	.|.	0.049400|.	0.85682|.	D|.	0.000000|.	T|T	0.59742|0.59742	0.2216|0.2216	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	B;B|.	0.21606|.	0.058;0.032|.	B;B|.	0.20184|.	0.028;0.012|.	T|T	0.60063|0.60063	-0.7336|-0.7336	10|5	0.51188|.	T|.	0.08|.	-32.4046|-32.4046	7.8161|7.8161	0.29260|0.29260	0.0:0.1759:0.0:0.8241|0.0:0.1759:0.0:0.8241	.|.	114;276|.	B4DSF9;Q9NRZ5|.	.;PLCD_HUMAN|.	R|G	276;114|55	ENSP00000314036:K276R|.	ENSP00000314036:K276R|.	K|S	-|-	2|1	0|0	AGPAT4|AGPAT4	161487562|161487562	0.998000|0.998000	0.40836|0.40836	0.997000|0.997000	0.53966|0.53966	0.907000|0.907000	0.53573|0.53573	2.512000|2.512000	0.45485|0.45485	0.331000|0.331000	0.23511|0.23511	0.459000|0.459000	0.35465|0.35465	AAG|AGC	.	.		0.602	AGPAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042983.1	NM_020133	
PDE10A	10846	hgsc.bcm.edu	37	6	165863852	165863852	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:165863852T>C	ENST00000366882.1	-	5	350		c.e5-2		PDE10A_ENST00000354448.4_Splice_Site|PDE10A_ENST00000539869.2_Splice_Site			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A						blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	ATCTTGGTACTTTGGATTAAA	0.299																																					.	Esophageal Squamous(22;308 615 5753 12038 40624)	Atlas-SNP	.											.	PDE10A	154	.	0			c.226-2A>G						.						92.0	85.0	88.0					6																	165863852		2203	4300	6503	SO:0001630	splice_region_variant	10846	exon5			TGGTACTTTGGAT	AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.196-2A>G	chr6.hg19:g.165863852T>C		100.0	0.0		84.0	5.0	NM_001130690	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Splice_Site	SNP	ENST00000366882.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.44	3.391248	0.62066	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	.	.	.	4.61	4.61	0.57282	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3089	0.66403	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PDE10A	165783842	1.000000	0.71417	0.711000	0.30485	0.532000	0.34746	7.708000	0.84633	1.843000	0.53566	0.460000	0.39030	.	.	.		0.299	PDE10A-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000043031.1		Intron
PDCD2	5134	hgsc.bcm.edu	37	6	170886665	170886665	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:170886665A>G	ENST00000541970.1	-	6	1095	c.1017T>C	c.(1015-1017)gaT>gaC	p.D339D	PDCD2_ENST00000392090.2_Silent_p.D306D	NM_001199462.1|NM_002598.3	NP_001186391.1|NP_002589.2	Q16342	PDCD2_HUMAN	programmed cell death 2	339					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(1)|lung(5)	9		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;6.91e-23)|BRCA - Breast invasive adenocarcinoma(81;4.82e-06)|GBM - Glioblastoma multiforme(31;0.142)		TATCTGTTACATCCTGCTTCC	0.423																																					p.D339D	Colon(60;1476 1726 39478)	Atlas-SNP	.											.	PDCD2	13	.	0			c.T1017C						.						91.0	85.0	87.0					6																	170886665		2203	4300	6503	SO:0001819	synonymous_variant	5134	exon6			TGTTACATCCTGC	AJ420535	CCDS5316.1, CCDS47521.1, CCDS56460.1, CCDS56461.1, CCDS56462.1, CCDS75557.1	6q27	2008-02-05			ENSG00000071994	ENSG00000071994		"""Zinc fingers, MYND-type"""	8762	protein-coding gene	gene with protein product		600866				7606924	Standard	NM_002598		Approved	ZMYND7, RP8	uc003qxw.3	Q16342	OTTHUMG00000016083	ENST00000541970.1:c.1017T>C	chr6.hg19:g.170886665A>G		107.0	0.0		99.0	4.0	NM_002598	E9PCU7|F5GYS7|Q58HM9|Q58HN0|Q9UH12	Silent	SNP	ENST00000541970.1	hg19	CCDS5316.1																																																																																			.	.		0.423	PDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043269.2	NM_002598	
CARD11	84433	hgsc.bcm.edu	37	7	2963882	2963882	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:2963882T>C	ENST00000396946.4	-	15	2328	c.1925A>G	c.(1924-1926)aAg>aGg	p.K642R		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	642					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		CAGAGAGAACTTCCTGAACAT	0.592			Mis		DLBCL																																p.K642R		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.A1925G						.						79.0	63.0	69.0					7																	2963882		2203	4300	6503	SO:0001583	missense	84433	exon15			GAGAACTTCCTGA	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1925A>G	chr7.hg19:g.2963882T>C	ENSP00000380150:p.Lys642Arg	82.0	0.0		91.0	4.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	T	12.17	1.858781	0.32884	.	.	ENSG00000198286	ENST00000396946;ENST00000355508	T;T	0.50813	0.73;0.73	5.15	5.15	0.70609	PDZ/DHR/GLGF (1);	0.054299	0.64402	D	0.000001	T	0.39911	0.1096	N	0.14661	0.345	0.58432	D	0.999998	D	0.54601	0.967	P	0.53266	0.722	T	0.15235	-1.0444	10	0.12103	T	0.63	-52.0719	13.5571	0.61765	0.0:0.0:0.0:1.0	.	642	Q9BXL7	CAR11_HUMAN	R	642;113	ENSP00000380150:K642R;ENSP00000347695:K113R	ENSP00000347695:K113R	K	-	2	0	CARD11	2930408	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.135000	0.77276	1.957000	0.56846	0.454000	0.30748	AAG	.	.		0.592	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
ICA1	3382	hgsc.bcm.edu	37	7	8198174	8198175	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:8198174_8198175TG>CT	ENST00000402384.3	-	7	953_954	c.687_688CA>AG	c.(685-690)caCAtg>caAGtg	p.229_230HM>QV	ICA1_ENST00000422063.2_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000406470.2_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000265577.7_Missense_Mutation_p.228_229HM>QV|ICA1_ENST00000407906.1_Missense_Mutation_p.229_230HM>QV|ICA1_ENST00000401396.1_Missense_Mutation_p.217_218HM>QV|ICA1_ENST00000396675.3_Missense_Mutation_p.229_230HM>QV			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	229	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GTTGCTAGCATGTGAGACAAGA	0.371																																					p.M230V|p.H229Q		Atlas-SNP	.											.	ICA1	65	.	0			c.A688G|c.C687A						.																																			SO:0001583	missense	3382	exon7			CTAGCATGTGAGA|TAGCATGTGAGAC		CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.687_688delinsCT	chr7.hg19:g.8198174_8198175delinsCT	ENSP00000385570:p.H229_M230delinsQV	134.0	0.0		108.0|111.0	46.0|47.0	NM_022307	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	SNP	ENST00000402384.3	hg19	CCDS34602.1																																																																																			.	.		0.371	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324793.1	NM_004968	
VWDE	221806	hgsc.bcm.edu	37	7	12391294	12391294	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:12391294A>G	ENST00000275358.3	-	19	3979	c.3791T>C	c.(3790-3792)cTc>cCc	p.L1264P		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	1264						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						AGATCTTGTGAGAACCACAGT	0.348																																					p.L1264P		Atlas-SNP	.											.	VWDE	123	.	0			c.T3791C						.						181.0	161.0	167.0					7																	12391294		692	1590	2282	SO:0001583	missense	221806	exon19			CTTGTGAGAACCA		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.3791T>C	chr7.hg19:g.12391294A>G	ENSP00000275358:p.Leu1264Pro	80.0	0.0		92.0	4.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	A	9.217	1.032301	0.19590	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	T	0.68903	-0.36	3.06	0.593	0.17478	.	1.479880	0.04248	N	0.338134	T	0.56906	0.2017	L	0.52573	1.65	0.09310	N	1	B	0.33073	0.396	B	0.31614	0.133	T	0.41893	-0.9483	10	0.41790	T	0.15	.	2.5334	0.04709	0.6356:0.0:0.1326:0.2318	.	1264	Q8N2E2	VWDE_HUMAN	P	1264;718	ENSP00000275358:L1264P	ENSP00000275358:L1264P	L	-	2	0	VWDE	12357819	0.009000	0.17119	0.006000	0.13384	0.218000	0.24690	0.622000	0.24433	0.125000	0.18397	0.459000	0.35465	CTC	.	.		0.348	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
PKD1L1	168507	hgsc.bcm.edu	37	7	47849144	47849144	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:47849144A>G	ENST00000289672.2	-	51	7663	c.7613T>C	c.(7612-7614)cTc>cCc	p.L2538P	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron|PKD1L1_ENST00000462350.1_5'UTR	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2538					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TTGAACACAGAGGTGGATCAG	0.458																																					p.L2538P		Atlas-SNP	.											.	PKD1L1	328	.	0			c.T7613C						.						56.0	50.0	52.0					7																	47849144		2203	4300	6503	SO:0001583	missense	168507	exon51			ACACAGAGGTGGA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.7613T>C	chr7.hg19:g.47849144A>G	ENSP00000289672:p.Leu2538Pro	45.0	0.0		45.0	5.0	NM_138295	Q6UWK1	Missense_Mutation	SNP	ENST00000289672.2	hg19	CCDS34633.1	.	.	.	.	.	.	.	.	.	.	A	10.82	1.459366	0.26248	.	.	ENSG00000158683	ENST00000289672	T	0.71461	-0.57	5.19	4.03	0.46877	Polycystin cation channel, PKD1/PKD2 (1);	0.232977	0.26840	N	0.022235	T	0.76695	0.4023	L	0.50333	1.59	0.50632	D	0.999881	D	0.76494	0.999	D	0.77004	0.989	T	0.75575	-0.3270	10	0.66056	D	0.02	-12.1737	6.8389	0.23951	0.8166:0.0:0.1834:0.0	.	2538	Q8TDX9	PK1L1_HUMAN	P	2538	ENSP00000289672:L2538P	ENSP00000289672:L2538P	L	-	2	0	PKD1L1	47815669	0.102000	0.21896	0.011000	0.14972	0.021000	0.10359	2.223000	0.42936	0.812000	0.34326	0.460000	0.39030	CTC	.	.		0.458	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
GNAI1	2770	hgsc.bcm.edu	37	7	79764532	79764532	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:79764532T>C	ENST00000351004.3	+	1	429	c.56T>C	c.(55-57)aTc>aCc	p.I19T	GNAI1_ENST00000457358.2_5'Flank|GNAI1_ENST00000490206.1_3'UTR	NM_002069.5	NP_002060.4	P63096	GNAI1_HUMAN	guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1	19					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|cell cycle (GO:0007049)|cell division (GO:0051301)|G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|response to peptide hormone (GO:0043434)|synaptic transmission (GO:0007268)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	19						AGTAAGATGATCGACCGCAAC	0.731																																					p.I19T		Atlas-SNP	.											.	GNAI1	44	.	0			c.T56C						.						14.0	15.0	15.0					7																	79764532		2186	4284	6470	SO:0001583	missense	2770	exon1			AGATGATCGACCG	AL049933	CCDS5595.1, CCDS59061.1	7q21-q22	2008-07-18			ENSG00000127955	ENSG00000127955			4384	protein-coding gene	gene with protein product	"""Gi1 protein alpha subunit"""	139310				3110783	Standard	NM_002069		Approved		uc003uhb.1	P63096	OTTHUMG00000023523	ENST00000351004.3:c.56T>C	chr7.hg19:g.79764532T>C	ENSP00000343027:p.Ile19Thr	82.0	0.0		98.0	4.0	NM_002069	A8KA88|B4E2V1|C9J3A4|P04898|P11015|P31871|Q5U074|Q8TAN5|Q9UGA4	Missense_Mutation	SNP	ENST00000351004.3	hg19	CCDS5595.1	.	.	.	.	.	.	.	.	.	.	T	33	5.204931	0.95033	.	.	ENSG00000127955	ENST00000442586;ENST00000351004	D	0.89270	-2.49	3.91	3.91	0.45181	.	0.054690	0.64402	N	0.000001	D	0.94981	0.8376	H	0.94385	3.53	0.80722	D	1	P	0.48640	0.913	P	0.60012	0.867	D	0.95709	0.8756	9	.	.	.	.	11.6898	0.51508	0.0:0.0:0.0:1.0	.	19	P63096	GNAI1_HUMAN	T	19	ENSP00000343027:I19T	.	I	+	2	0	GNAI1	79602468	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.302000	0.78861	1.631000	0.50456	0.372000	0.22366	ATC	.	.		0.731	GNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253254.1	NM_002069	
PCLO	27445	hgsc.bcm.edu	37	7	82581498	82581498	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:82581498A>T	ENST00000333891.9	-	5	9108	c.8771T>A	c.(8770-8772)aTa>aAa	p.I2924K	PCLO_ENST00000423517.2_Missense_Mutation_p.I2924K|PCLO_ENST00000437081.1_5'Flank	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTCATCTTCTATTATTTTGGT	0.433																																					p.I2924K		Atlas-SNP	.											Q9Y6V0-3,colon,carcinoma,-1,3	PCLO	1506	.	0			c.T8771A						.						145.0	142.0	143.0					7																	82581498		1909	4123	6032	SO:0001583	missense	27445	exon5			TCTTCTATTATTT	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.8771T>A	chr7.hg19:g.82581498A>T	ENSP00000334319:p.Ile2924Lys	41.0	2.0		48.0	5.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	A	12.71	2.018568	0.35606	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.19394	2.15;2.16	5.68	5.68	0.88126	.	.	.	.	.	T	0.30696	0.0773	L	0.50333	1.59	0.80722	D	1	P;P	0.46220	0.874;0.874	P;P	0.48227	0.447;0.571	T	0.02758	-1.1114	9	0.87932	D	0	.	15.9242	0.79603	1.0:0.0:0.0:0.0	.	2924;2924	Q9Y6V0-5;Q9Y6V0-6	.;.	K	2855;2924;2924	ENSP00000334319:I2924K;ENSP00000388393:I2924K	ENSP00000334319:I2924K	I	-	2	0	PCLO	82419434	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.606000	0.74159	2.152000	0.67230	0.460000	0.39030	ATA	.	.		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
FZD1	8321	hgsc.bcm.edu	37	7	90894459	90894459	+	Silent	SNP	A	A	G	rs71292991|rs139480179	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:90894459A>G	ENST00000287934.2	+	1	677	c.264A>G	c.(262-264)caA>caG	p.Q88Q		NM_003505.1	NP_003496.1	Q9UP38	FZD1_HUMAN	frizzled class receptor 1	88					autocrine signaling (GO:0035425)|axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in mesenchymal stem cell differentiation (GO:0044338)|canonical Wnt signaling pathway involved in osteoblast differentiation (GO:0044339)|cell-cell signaling (GO:0007267)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hard palate development (GO:0060022)|lung alveolus development (GO:0048286)|membranous septum morphogenesis (GO:0003149)|muscular septum morphogenesis (GO:0003150)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|outflow tract morphogenesis (GO:0003151)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|response to drug (GO:0042493)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.Q88_P89insP(2)|p.Q88_P89insA(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24	all_cancers(62;3.1e-10)|all_epithelial(64;1.66e-08)|Breast(17;0.000635)|Lung NSC(181;0.153)|all_lung(186;0.154)|all_hematologic(106;0.215)		STAD - Stomach adenocarcinoma(171;0.0134)			cggggcAGCAACCGCCGCCGC	0.741																																					p.Q88Q		Atlas-SNP	.											.,4	FZD1	64	.	3	Insertion - In frame(3)	breast(2)|liver(1)	c.A264G						.						10.0	11.0	11.0					7																	90894459		2176	4257	6433	SO:0001819	synonymous_variant	8321	exon1			GCAGCAACCGCCG	AB017363	CCDS5620.1	7q21	2014-01-29	2014-01-29		ENSG00000157240	ENSG00000157240		"""GPCR / Class F : Frizzled receptors"""	4038	protein-coding gene	gene with protein product	"""Wnt receptor"", ""frizzled, Drosophila, homolog of, 1"""	603408	"""frizzled (Drosophila) homolog 1"", ""frizzled homolog 1 (Drosophila)"", ""frizzled 1, seven transmembrane spanning receptor"", ""frizzled family receptor 1"""			9813155	Standard	NM_003505		Approved	DKFZp564G072	uc003ula.3	Q9UP38	OTTHUMG00000023046	ENST00000287934.2:c.264A>G	chr7.hg19:g.90894459A>G		6.0	1.0		19.0	2.0	NM_003505	A4D1E8|O94815|Q549T8	Silent	SNP	ENST00000287934.2	hg19	CCDS5620.1																																																																																			.	.		0.741	FZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059367.2	NM_003505	
KRIT1	889	hgsc.bcm.edu	37	7	91851228	91851228	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:91851228T>C	ENST00000340022.2	-	14	2569	c.1551A>G	c.(1549-1551)gaA>gaG	p.E517E	KRIT1_ENST00000394503.2_Silent_p.E469E|KRIT1_ENST00000412043.2_Silent_p.E517E|KRIT1_ENST00000394505.2_Silent_p.E517E|KRIT1_ENST00000394507.1_Silent_p.E517E	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	517	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			GTTTTTCAACTTCCAAGGGAA	0.373																																					p.E517E		Atlas-SNP	.											.	KRIT1	66	.	0			c.A1551G						.						64.0	63.0	63.0					7																	91851228		2203	4300	6503	SO:0001819	synonymous_variant	889	exon15			TTCAACTTCCAAG	AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1551A>G	chr7.hg19:g.91851228T>C		50.0	0.0		73.0	4.0	NM_194456	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Silent	SNP	ENST00000340022.2	hg19	CCDS5624.1																																																																																			.	.		0.373	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253910.1		
ANKIB1	54467	hgsc.bcm.edu	37	7	92028083	92028083	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:92028083T>C	ENST00000265742.3	+	20	3466	c.3090T>C	c.(3088-3090)agT>agC	p.S1030S		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	1030							zinc ion binding (GO:0008270)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			CCAGTGTCAGTGAAGGTAGAG	0.488																																					p.S1030S		Atlas-SNP	.											.	ANKIB1	92	.	0			c.T3090C						.						54.0	54.0	54.0					7																	92028083		1916	4130	6046	SO:0001819	synonymous_variant	54467	exon20			TGTCAGTGAAGGT	AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.3090T>C	chr7.hg19:g.92028083T>C		103.0	0.0		129.0	51.0	NM_019004	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Silent	SNP	ENST00000265742.3	hg19	CCDS47639.1																																																																																			.	.		0.488	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342018.1		
DLX6	1750	hgsc.bcm.edu	37	7	96635385	96635385	+	Splice_Site	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:96635385G>A	ENST00000007660.5	+	1	95		c.e1+1		DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000437541.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6_ENST00000518156.2_Silent_p.Q32Q|DLX6_ENST00000555308.1_5'Flank	NM_005222.3	NP_005213.3	P56179	DLX6_HUMAN	distal-less homeobox 6						anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					agcagcagcagcaacagcagc	0.657																																					p.Q32Q		Atlas-SNP	.											DLX6,right_lower_lobe,carcinoma,0,1	DLX6	37	.	0			c.G96A						.						5.0	7.0	6.0					7																	96635385		1971	3959	5930	SO:0001630	splice_region_variant	1750	exon1			GCAGCAGCAACAG		CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000007660.5:c.95+1G>A	chr7.hg19:g.96635385G>A		14.0	0.0		28.0	3.0	NM_005222	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	ENST00000007660.5	hg19																																																																																				.	.		0.657	DLX6-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_005222	Intron
AP4M1	9179	hgsc.bcm.edu	37	7	99704091	99704091	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:99704091A>G	ENST00000359593.4	+	14	1249	c.1091A>G	c.(1090-1092)gAc>gGc	p.D364G	AP4M1_ENST00000421755.1_Missense_Mutation_p.D364G|AP4M1_ENST00000429084.1_Missense_Mutation_p.D371G|AP4M1_ENST00000422582.1_Missense_Mutation_p.D236G	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	364	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTTCGCTGGGACCTGCCTCGG	0.622																																					p.D364G	Pancreas(174;1182 2812 29595 49511)	Atlas-SNP	.											.	AP4M1	39	.	0			c.A1091G						.						44.0	48.0	46.0					7																	99704091		2203	4299	6502	SO:0001583	missense	9179	exon14			GCTGGGACCTGCC	Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.1091A>G	chr7.hg19:g.99704091A>G	ENSP00000352603:p.Asp364Gly	77.0	0.0		77.0	4.0	NM_004722	D6W5U1|Q8WV65|Q9UHK9	Missense_Mutation	SNP	ENST00000359593.4	hg19	CCDS5685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.83|10.83	1.460580|1.460580	0.26248|0.26248	.|.	.|.	ENSG00000221838|ENSG00000221838	ENST00000438383;ENST00000429084;ENST00000359593;ENST00000421755;ENST00000422582;ENST00000450807|ENST00000445295	T;T;T;T;T;T|.	0.19806|.	2.12;2.12;2.12;2.12;2.12;2.12|.	4.81|4.81	4.81|4.81	0.61882|0.61882	Clathrin adaptor, mu subunit, C-terminal (3);|.	0.376195|.	0.31415|.	N|.	0.007691|.	T|T	0.34978|0.34978	0.0916|0.0916	N|N	0.05078|0.05078	-0.115|-0.115	0.40804|0.40804	D|D	0.983369|0.983369	B;B;B|.	0.13594|.	0.008;0.007;0.002|.	B;B;B|.	0.25291|.	0.059;0.025;0.025|.	T|T	0.27706|0.27706	-1.0066|-1.0066	10|5	0.72032|.	D|.	0.01|.	-11.5438|-11.5438	12.3578|12.3578	0.55186|0.55186	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	316;371;364|.	B4DKN7;C9JC87;O00189|.	.;.;AP4M1_HUMAN|.	G|A	296;371;364;364;236;116|90	ENSP00000401613:D296G;ENSP00000403663:D371G;ENSP00000352603:D364G;ENSP00000412185:D364G;ENSP00000406676:D236G;ENSP00000391585:D116G|.	ENSP00000352603:D364G|.	D|T	+|+	2|1	0|0	AP4M1|AP4M1	99542027|99542027	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	2.834000|2.834000	0.48167|0.48167	2.023000|2.023000	0.59567|0.59567	0.459000|0.459000	0.35465|0.35465	GAC|ACC	.	.		0.622	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336772.4	NM_004722	
FBXO24	26261	hgsc.bcm.edu	37	7	100187324	100187324	+	Intron	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:100187324A>G	ENST00000241071.6	+	2	361				FBXO24_ENST00000465843.1_Intron|PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000360609.2_Intron|FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000427939.2_Missense_Mutation_p.S21G|FBXO24_ENST00000468962.1_Intron	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24						protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					GGAGGGCAGGAGCAGGGAGGG	0.657																																					p.S21G		Atlas-SNP	.											.	FBXO24	125	.	0			c.A61G						.						44.0	48.0	47.0					7																	100187324		692	1591	2283	SO:0001627	intron_variant	26261	exon1			GGCAGGAGCAGGG	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.40-276A>G	chr7.hg19:g.100187324A>G		118.0	0.0		130.0	6.0	NM_012172	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	hg19	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	A	11.49	1.655255	0.29425	.	.	ENSG00000106336	ENST00000427939	T	0.15372	2.43	3.59	3.59	0.41128	.	.	.	.	.	T	0.14270	0.0345	.	.	.	0.80722	D	1	B	0.20261	0.043	B	0.14578	0.011	T	0.05632	-1.0873	8	0.87932	D	0	.	8.8159	0.34996	1.0:0.0:0.0:0.0	.	21	B4DX91	.	G	21	ENSP00000416558:S21G	ENSP00000416558:S21G	S	+	1	0	FBXO24	100025260	1.000000	0.71417	1.000000	0.80357	0.337000	0.28794	1.084000	0.30828	1.668000	0.50843	0.392000	0.25879	AGC	.	.		0.657	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
KMT2E	55904	hgsc.bcm.edu	37	7	104746372	104746372	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:104746372C>T	ENST00000311117.3	+	19	3063	c.2518C>T	c.(2518-2520)Caa>Taa	p.Q840*	KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_Nonsense_Mutation_p.Q840*|KMT2E_ENST00000334877.4_Nonsense_Mutation_p.Q840*|CTB-152G17.6_ENST00000607968.1_RNA	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	840					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TTCACCCTGTCAAGAAAGATC	0.348																																					p.Q840X		Atlas-SNP	.											.	MLL5	173	.	0			c.C2518T						.						89.0	96.0	93.0					7																	104746372		2203	4300	6503	SO:0001587	stop_gained	55904	exon18			CCCTGTCAAGAAA	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.2518C>T	chr7.hg19:g.104746372C>T	ENSP00000312379:p.Gln840*	154.0	0.0		152.0	24.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Nonsense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	C	42	9.739784	0.99252	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745	.	.	.	5.81	5.81	0.92471	.	0.319059	0.29846	N	0.011058	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	20.0804	0.97772	0.0:1.0:0.0:0.0	.	.	.	.	X	840;840;840;760;840	.	ENSP00000257745:Q840X	Q	+	1	0	MLL5	104533608	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.335000	0.65929	2.738000	0.93877	0.655000	0.94253	CAA	.	.		0.348	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
DUS4L	11062	hgsc.bcm.edu	37	7	107216859	107216859	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:107216859A>G	ENST00000265720.3	+	7	890	c.528A>G	c.(526-528)gaA>gaG	p.E176E	DUS4L_ENST00000402620.1_Silent_p.E55E	NM_001270419.1|NM_181581.2	NP_001257348.1|NP_853559.1	O95620	DUS4L_HUMAN	dihydrouridine synthase 4-like (S. cerevisiae)	176							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8						AAAAGGCTGAAGCAACAGGAG	0.348																																					p.E176E		Atlas-SNP	.											.	DUS4L	27	.	0			c.A528G						.						82.0	76.0	78.0					7																	107216859		2203	4300	6503	SO:0001819	synonymous_variant	11062	exon7			GGCTGAAGCAACA	U62767	CCDS5745.1	7q22-q31	2007-12-04			ENSG00000105865	ENSG00000105865			21517	protein-coding gene	gene with protein product	"""protein similar to E.coli yhdg and R. capsulatus nifR3"""						Standard	NM_181581		Approved	PP35, DUS4	uc031syv.1	O95620	OTTHUMG00000154763	ENST00000265720.3:c.528A>G	chr7.hg19:g.107216859A>G		69.0	0.0		98.0	4.0	NM_001270419	B4DLX0|Q2NKK1	Silent	SNP	ENST00000265720.3	hg19	CCDS5745.1																																																																																			.	.		0.348	DUS4L-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336967.2	NM_181581	
NRCAM	4897	hgsc.bcm.edu	37	7	107807498	107807498	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:107807498C>T	ENST00000425651.2	-	27	3333	c.3334G>A	c.(3334-3336)Gaa>Aaa	p.E1112K	NRCAM_ENST00000379022.4_Missense_Mutation_p.E1112K|NRCAM_ENST00000413765.2_Intron|NRCAM_ENST00000379028.3_Missense_Mutation_p.E1112K|NRCAM_ENST00000379024.4_Intron|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	1112	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTTACAATTTCTTTTCTCCAT	0.383																																					p.E1112K		Atlas-SNP	.											.	NRCAM	267	.	0			c.G3334A						.						77.0	77.0	77.0					7																	107807498		1871	4099	5970	SO:0001583	missense	4897	exon27			CAATTTCTTTTCT		CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.3334G>A	chr7.hg19:g.107807498C>T	ENSP00000401244:p.Glu1112Lys	95.0	0.0		77.0	4.0	NM_001037132	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Missense_Mutation	SNP	ENST00000425651.2	hg19	CCDS47686.1	.	.	.	.	.	.	.	.	.	.	C	16.33	3.091947	0.55968	.	.	ENSG00000091129	ENST00000379032;ENST00000379028;ENST00000425651;ENST00000379022	T;T;T	0.56776	0.44;0.44;0.44	5.67	4.79	0.61399	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.149927	0.64402	N	0.000014	T	0.44201	0.1282	L	0.34521	1.04	0.80722	D	1	B	0.06786	0.001	B	0.13407	0.009	T	0.32508	-0.9904	10	0.48119	T	0.1	.	15.2425	0.73482	0.0:0.9322:0.0:0.0678	.	1112	Q92823	NRCAM_HUMAN	K	1112	ENSP00000368314:E1112K;ENSP00000401244:E1112K;ENSP00000368308:E1112K	ENSP00000368308:E1112K	E	-	1	0	NRCAM	107594734	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.249000	0.65427	1.532000	0.49169	0.643000	0.83706	GAA	.	.		0.383	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337942.2	NM_001037132	
KLHDC10	23008	hgsc.bcm.edu	37	7	129762020	129762020	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:129762020T>C	ENST00000335420.5	+	5	891	c.757T>C	c.(757-759)Tcc>Ccc	p.S253P		NM_014997.3	NP_055812.1	Q6PID8	KLD10_HUMAN	kelch domain containing 10	253						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|liver(2)|lung(10)|prostate(1)	17						AAACAACCTATCCTGTGATCT	0.408																																					p.S253P		Atlas-SNP	.											.	KLHDC10	36	.	0			c.T757C						.						150.0	119.0	130.0					7																	129762020		2203	4300	6503	SO:0001583	missense	23008	exon5			AACCTATCCTGTG		CCDS5815.1	7q32.2	2008-08-20			ENSG00000128607	ENSG00000128607			22194	protein-coding gene	gene with protein product	"""scruin like at the midline homolog (Drosophila)"""	615152					Standard	NM_014997		Approved	KIAA0265, slim	uc003vpj.2	Q6PID8	OTTHUMG00000157654	ENST00000335420.5:c.757T>C	chr7.hg19:g.129762020T>C	ENSP00000334140:p.Ser253Pro	87.0	0.0		80.0	4.0	NM_014997	Q86Y99|Q92554	Missense_Mutation	SNP	ENST00000335420.5	hg19	CCDS5815.1	.	.	.	.	.	.	.	.	.	.	T	9.802	1.180775	0.21787	.	.	ENSG00000128607	ENST00000335420;ENST00000468226	T;T	0.11277	2.79;2.79	5.47	4.33	0.51752	Galactose oxidase, beta-propeller (1);	0.161589	0.56097	D	0.000025	T	0.03348	0.0097	N	0.01209	-0.955	0.41995	D	0.990864	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.0;0.001	T	0.42865	-0.9426	10	0.26408	T	0.33	-9.9164	7.5016	0.27522	0.0:0.1601:0.0:0.8399	.	102;110;253	Q96G43;Q6PID8-2;Q6PID8	.;.;KLD10_HUMAN	P	253;110	ENSP00000334140:S253P;ENSP00000420034:S110P	ENSP00000334140:S253P	S	+	1	0	KLHDC10	129549256	0.998000	0.40836	0.986000	0.45419	0.333000	0.28666	3.650000	0.54424	2.064000	0.61679	0.533000	0.62120	TCC	.	.		0.408	KLHDC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349347.2		
TMEM209	84928	hgsc.bcm.edu	37	7	129818251	129818251	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:129818251T>C	ENST00000397622.2	-	10	1359	c.1237A>G	c.(1237-1239)Agg>Ggg	p.R413G	TMEM209_ENST00000462753.1_Missense_Mutation_p.R412G|RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000473456.1_Intron|TMEM209_ENST00000336804.8_Intron	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	413						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					CCTTTGATCCTTTCAAACAAG	0.333																																					p.R413G		Atlas-SNP	.											.	TMEM209	31	.	0			c.A1237G						.						48.0	44.0	45.0					7																	129818251		1806	4068	5874	SO:0001583	missense	84928	exon10			TGATCCTTTCAAA		CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.1237A>G	chr7.hg19:g.129818251T>C	ENSP00000380747:p.Arg413Gly	60.0	0.0		54.0	4.0	NM_032842	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	ENST00000397622.2	hg19	CCDS47712.1	.	.	.	.	.	.	.	.	.	.	T	19.71	3.878794	0.72294	.	.	ENSG00000146842	ENST00000397622;ENST00000462753	T;T	0.68765	-0.35;-0.35	5.78	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.82056	0.4954	M	0.85630	2.765	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.83686	0.0174	10	0.87932	D	0	-22.8922	11.1495	0.48451	0.0:0.0:0.2951:0.7049	.	413	Q96SK2	TM209_HUMAN	G	413;412	ENSP00000380747:R413G;ENSP00000419697:R412G	ENSP00000380747:R413G	R	-	1	2	TMEM209	129605487	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.923000	0.48868	0.976000	0.38417	0.477000	0.44152	AGG	.	.		0.333	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000349339.1	NM_032842	
AGAP3	116988	hgsc.bcm.edu	37	7	150825737	150825737	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr7:150825737A>G	ENST00000463381.1	+	10	1104	c.608A>G	c.(607-609)gAc>gGc	p.D203G	AGAP3_ENST00000397238.2_Missense_Mutation_p.D431G	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	395	Small GTPase-like.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						ACGCTCTGTGACAACGGGCTG	0.572																																					p.D431G		Atlas-SNP	.											.	AGAP3	121	.	0			c.A1292G						.						66.0	72.0	70.0					7																	150825737		2030	4174	6204	SO:0001583	missense	116988	exon10			TCTGTGACAACGG	AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.608A>G	chr7.hg19:g.150825737A>G	ENSP00000418016:p.Asp203Gly	61.0	0.0		75.0	4.0	NM_031946	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	ENST00000463381.1	hg19		.	.	.	.	.	.	.	.	.	.	A	23.3	4.405484	0.83230	.	.	ENSG00000133612	ENST00000463381;ENST00000397238;ENST00000335355	T;T	0.79141	-1.24;-1.24	5.26	5.26	0.73747	.	0.138177	0.47852	D	0.000210	D	0.86756	0.6009	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.995;1.0	D;D	0.79784	0.946;0.993	D	0.88217	0.2894	10	0.72032	D	0.01	.	14.3791	0.66900	1.0:0.0:0.0:0.0	.	431;203	Q96P47-4;B3KNZ8	.;.	G	203;431;395	ENSP00000418016:D203G;ENSP00000380413:D431G	ENSP00000334157:D395G	D	+	2	0	AGAP3	150456670	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.490000	0.60319	1.996000	0.58369	0.533000	0.62120	GAC	.	.		0.572	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000351909.2	NM_031946	
PPP3CC	5533	hgsc.bcm.edu	37	8	22333119	22333119	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:22333119A>G	ENST00000240139.5	+	3	681	c.354A>G	c.(352-354)agA>agG	p.R118R	PPP3CC_ENST00000518852.1_Silent_p.R118R|PPP3CC_ENST00000289963.8_Silent_p.R118R|PPP3CC_ENST00000397775.3_Silent_p.R118R	NM_005605.4	NP_005596.2	P48454	PP2BC_HUMAN	protein phosphatase 3, catalytic subunit, gamma isozyme	118					apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(55;0.104)		BRCA - Breast invasive adenocarcinoma(99;0.00756)|Colorectal(74;0.0238)|COAD - Colon adenocarcinoma(73;0.0835)		ATGTGGACAGAGGCTATTTCA	0.343																																					p.R118R		Atlas-SNP	.											.	PPP3CC	39	.	0			c.A354G						.						99.0	94.0	95.0					8																	22333119		2202	4300	6502	SO:0001819	synonymous_variant	5533	exon3			GGACAGAGGCTAT		CCDS34859.1, CCDS59094.1, CCDS59093.1	8p21.3	2010-03-17	2010-03-05		ENSG00000120910	ENSG00000120910	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9316	protein-coding gene	gene with protein product	"""calcineurin A gamma"", ""protein phosphatase 2B, catalytic subunit, gamma isoform"""	114107	"""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform (calcineurin A gamma)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, gamma isoform"""			1339277	Standard	NM_005605		Approved	CALNA3, PP2Bgamma	uc011kzi.2	P48454	OTTHUMG00000163802	ENST00000240139.5:c.354A>G	chr8.hg19:g.22333119A>G		90.0	0.0		85.0	4.0	NM_001243974	B4DRT5|Q9BSS6|Q9H4M5	Silent	SNP	ENST00000240139.5	hg19	CCDS34859.1																																																																																			.	.		0.343	PPP3CC-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000375652.1	NM_005605	
GPR124	25960	hgsc.bcm.edu	37	8	37672476	37672476	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:37672476T>C	ENST00000412232.2	+	2	342	c.329T>C	c.(328-330)cTg>cCg	p.L110P	GPR124_ENST00000315215.7_Missense_Mutation_p.L110P	NM_032777.9	NP_116166.9	Q96PE1	GP124_HUMAN	G protein-coupled receptor 124	110					central nervous system development (GO:0007417)|endothelial cell migration (GO:0043542)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuropeptide signaling pathway (GO:0007218)|positive regulation of endothelial cell migration (GO:0010595)|regulation of angiogenesis (GO:0045765)|regulation of chemotaxis (GO:0050920)|regulation of establishment of blood-brain barrier (GO:0090210)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(16)|ovary(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	37			BRCA - Breast invasive adenocarcinoma(5;2.75e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)			CTGTCACTGCTGGAGAAGCTG	0.597																																					p.L110P		Atlas-SNP	.											.	GPR124	85	.	0			c.T329C						.						107.0	100.0	102.0					8																	37672476		2203	4300	6503	SO:0001583	missense	25960	exon2			CACTGCTGGAGAA	AB040964	CCDS6097.2	8p11.22	2014-08-08			ENSG00000020181	ENSG00000020181		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17849	protein-coding gene	gene with protein product	"""tumor endothelial marker 5"""	606823				11559528, 12565841	Standard	NM_032777		Approved	TEM5, DKFZp434C211, DKFZp434J0911, KIAA1531, FLJ14390	uc003xkj.3	Q96PE1	OTTHUMG00000156182	ENST00000412232.2:c.329T>C	chr8.hg19:g.37672476T>C	ENSP00000406367:p.Leu110Pro	117.0	0.0		98.0	4.0	NM_032777	A6H8W3|D3DSW4|Q8N3R1|Q8TEM3|Q96KB2|Q9P1Z7|Q9UFY4	Missense_Mutation	SNP	ENST00000412232.2	hg19	CCDS6097.2	.	.	.	.	.	.	.	.	.	.	T	18.75	3.691058	0.68271	.	.	ENSG00000020181	ENST00000428068;ENST00000416514;ENST00000315215;ENST00000412232	T;T;T	0.81330	-1.48;-1.48;-1.48	5.68	5.68	0.88126	.	0.000000	0.64402	D	0.000015	D	0.94032	0.8088	H	0.99600	4.65	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.71870	0.975;0.966	D	0.96070	0.9045	10	0.87932	D	0	-10.7013	13.2865	0.60245	0.0:0.0:0.0:1.0	.	110;110	Q96PE1-2;Q96PE1	.;GP124_HUMAN	P	68;103;110;110	ENSP00000400860:L68P;ENSP00000323508:L110P;ENSP00000406367:L110P	ENSP00000323508:L110P	L	+	2	0	GPR124	37791634	1.000000	0.71417	1.000000	0.80357	0.771000	0.43674	4.207000	0.58480	2.156000	0.67533	0.459000	0.35465	CTG	.	.		0.597	GPR124-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343331.2		
AGPAT6	137964	hgsc.bcm.edu	37	8	41472557	41472557	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:41472557T>C	ENST00000396987.3	+	10	1970	c.1043T>C	c.(1042-1044)gTt>gCt	p.V348A	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	348					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			GTTTACCCTGTTGCTATCAAG	0.458																																					p.V348A		Atlas-SNP	.											.	AGPAT6	32	.	0			c.T1043C						.						85.0	79.0	81.0					8																	41472557		2203	4300	6503	SO:0001583	missense	137964	exon10			ACCCTGTTGCTAT	AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.1043T>C	chr8.hg19:g.41472557T>C	ENSP00000380184:p.Val348Ala	124.0	0.0		90.0	5.0	NM_178819	Q86V89	Missense_Mutation	SNP	ENST00000396987.3	hg19	CCDS6117.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.947797	0.92593	.	.	ENSG00000158669	ENST00000396987	D	0.96011	-3.88	5.03	5.03	0.67393	Phospholipid/glycerol acyltransferase (2);	0.000000	0.85682	D	0.000000	D	0.97158	0.9071	M	0.84082	2.675	0.80722	D	1	P	0.45902	0.868	P	0.57283	0.817	D	0.97454	1.0030	10	0.56958	D	0.05	.	14.0909	0.64990	0.0:0.0:0.0:1.0	.	348	Q86UL3	GPAT4_HUMAN	A	348	ENSP00000380184:V348A	ENSP00000380184:V348A	V	+	2	0	AGPAT6	41591714	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.868000	0.87116	2.120000	0.65058	0.533000	0.62120	GTT	.	.		0.458	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377158.1	NM_178819	
KAT6A	7994	hgsc.bcm.edu	37	8	41791551	41791551	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:41791551T>C	ENST00000396930.3	-	18	4730	c.4187A>G	c.(4186-4188)cAc>cGc	p.H1396R	KAT6A_ENST00000265713.2_Missense_Mutation_p.H1396R|KAT6A_ENST00000406337.1_Missense_Mutation_p.H1396R	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	1396					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										GTCTTCTTCGTGGTCGTCCTC	0.498																																					p.H1396R		Atlas-SNP	.											.	.	.	.	0			c.A4187G						.						122.0	110.0	114.0					8																	41791551		2203	4300	6503	SO:0001583	missense	7994	exon18			TCTTCGTGGTCGT	U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.4187A>G	chr8.hg19:g.41791551T>C	ENSP00000380136:p.His1396Arg	125.0	0.0		98.0	4.0	NM_001099412	Q76L81	Missense_Mutation	SNP	ENST00000396930.3	hg19	CCDS6124.1	.	.	.	.	.	.	.	.	.	.	T	9.002	0.980344	0.18812	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930	T;T;T	0.59224	0.28;0.28;0.28	5.97	2.44	0.29823	.	0.426282	0.25267	N	0.031920	T	0.33381	0.0861	N	0.19112	0.55	0.38446	D	0.946846	B	0.12630	0.006	B	0.16289	0.015	T	0.11299	-1.0593	10	0.07644	T	0.81	-11.7636	6.6275	0.22839	0.0:0.1964:0.1343:0.6693	.	1396	Q92794	KAT6A_HUMAN	R	1396	ENSP00000265713:H1396R;ENSP00000385888:H1396R;ENSP00000380136:H1396R	ENSP00000265713:H1396R	H	-	2	0	KAT6A	41910708	0.960000	0.32886	0.997000	0.53966	0.799000	0.45148	1.378000	0.34328	0.527000	0.28560	0.533000	0.62120	CAC	.	.		0.498	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318163.1	NM_006766	
PLAT	5327	hgsc.bcm.edu	37	8	42045063	42045063	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:42045063T>C	ENST00000220809.4	-	6	648	c.392A>G	c.(391-393)cAg>cGg	p.Q131R	PLAT_ENST00000519510.1_Intron|PLAT_ENST00000429089.2_Missense_Mutation_p.Q131R|PLAT_ENST00000270189.6_Missense_Mutation_p.Q131R|PLAT_ENST00000429710.2_Intron|PLAT_ENST00000352041.3_Missense_Mutation_p.Q85R|PLAT_ENST00000524009.1_Intron	NM_000930.3	NP_000921.1	P00750	TPA_HUMAN	plasminogen activator, tissue	131	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein modification process (GO:0006464)|fibrinolysis (GO:0042730)|negative regulation of proteolysis (GO:0045861)|plasminogen activation (GO:0031639)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of ovulation (GO:0060279)|proteolysis (GO:0006508)|regulation of synaptic plasticity (GO:0048167)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|smooth muscle cell migration (GO:0014909)|synaptic transmission, glutamatergic (GO:0035249)	apical part of cell (GO:0045177)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|secretory granule (GO:0030141)|synapse (GO:0045202)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(10)|skin(1)|soft_tissue(1)|urinary_tract(1)	27	all_cancers(6;3.84e-26)|all_epithelial(6;9.61e-28)|all_lung(13;7.2e-13)|Lung NSC(13;1.18e-11)|Ovarian(28;0.00438)|Prostate(17;0.0119)|Colorectal(14;0.0468)|Lung SC(25;0.211)	all_lung(54;0.000378)|Lung NSC(58;0.00145)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	BRCA - Breast invasive adenocarcinoma(8;5.23e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00135)|Colorectal(10;0.00165)|Lung(22;0.00467)|COAD - Colon adenocarcinoma(11;0.0171)|LUSC - Lung squamous cell carcinoma(45;0.024)		Aminocaproic Acid(DB00513)|Ibuprofen(DB01050)|Iloprost(DB01088)|Urokinase(DB00013)	GCTGATGCCCTGGTCCTCGTA	0.642																																					p.Q131R		Atlas-SNP	.											.	PLAT	62	.	0			c.A392G						.						44.0	37.0	40.0					8																	42045063		2203	4300	6503	SO:0001583	missense	5327	exon6			ATGCCCTGGTCCT		CCDS6126.1, CCDS6127.1	8p11.21	2012-10-02			ENSG00000104368	ENSG00000104368			9051	protein-coding gene	gene with protein product		173370					Standard	NM_033011		Approved		uc003xos.2	P00750	OTTHUMG00000164072	ENST00000220809.4:c.392A>G	chr8.hg19:g.42045063T>C	ENSP00000220809:p.Gln131Arg	69.0	0.0		73.0	4.0	NM_000930	A8K022|B2R8E8|Q15103|Q503B0|Q6PJA5|Q7Z7N2|Q86YK8|Q9BU99|Q9BZW1	Missense_Mutation	SNP	ENST00000220809.4	hg19	CCDS6126.1	.	.	.	.	.	.	.	.	.	.	T	7.377	0.627944	0.14257	.	.	ENSG00000104368	ENST00000270189;ENST00000429089;ENST00000220809;ENST00000352041;ENST00000520523;ENST00000521694	T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12	5.95	-1.74	0.08056	Kringle (4);Kringle-like fold (1);	1.089850	0.06732	N	0.776814	T	0.28962	0.0719	N	0.11255	0.115	0.09310	N	0.999995	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.003	T	0.16335	-1.0406	10	0.11794	T	0.64	.	1.9809	0.03426	0.3448:0.0706:0.1863:0.3984	.	131;85;131	B8ZX62;P00750-3;P00750	.;.;TPA_HUMAN	R	131;131;131;85;131;131	ENSP00000270189:Q131R;ENSP00000392045:Q131R;ENSP00000220809:Q131R;ENSP00000270188:Q85R;ENSP00000428797:Q131R;ENSP00000429801:Q131R	ENSP00000220809:Q131R	Q	-	2	0	PLAT	42164220	0.000000	0.05858	0.543000	0.28128	0.249000	0.25844	-0.092000	0.11129	0.099000	0.17552	0.533000	0.62120	CAG	.	.		0.642	PLAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377100.1	NM_000930	
HGSNAT	138050	hgsc.bcm.edu	37	8	43047567	43047567	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:43047567T>C	ENST00000458501.2	+	13	1455	c.1455T>C	c.(1453-1455)tcT>tcC	p.S485S	HGSNAT_ENST00000379644.4_Silent_p.S457S|HGSNAT_ENST00000297798.7_Silent_p.S189S|HGSNAT_ENST00000521576.1_Silent_p.S174S			Q68CP4	HGNAT_HUMAN	heparan-alpha-glucosaminide N-acetyltransferase	485					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lysosomal transport (GO:0007041)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	heparan-alpha-glucosaminide N-acetyltransferase activity (GO:0015019)|transferase activity, transferring acyl groups (GO:0016746)			cervix(1)|endometrium(2)|large_intestine(4)|lung(6)	13	Prostate(17;0.0119)|Ovarian(28;0.0172)|Lung SC(25;0.184)	all_cancers(86;0.000223)|all_epithelial(80;1.61e-07)|all_lung(54;0.00021)|Lung NSC(58;0.000778)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0777)|LUSC - Lung squamous cell carcinoma(45;0.17)			AGCACCCATCTTCTGCTGTGA	0.498																																					p.S457S		Atlas-SNP	.											.	HGSNAT	85	.	0			c.T1371C						.						62.0	59.0	60.0					8																	43047567		1983	4158	6141	SO:0001819	synonymous_variant	138050	exon13			CCCATCTTCTGCT		CCDS47852.1	8p11.1	2011-11-16	2006-09-05	2006-08-16	ENSG00000165102	ENSG00000165102	2.3.1.78		26527	protein-coding gene	gene with protein product		610453	"""transmembrane protein 76"""	TMEM76		17033958, 16960811	Standard	NM_152419		Approved	FLJ32731, HGNAT	uc003xpx.4	Q68CP4	OTTHUMG00000164102	ENST00000458501.2:c.1455T>C	chr8.hg19:g.43047567T>C		70.0	0.0		88.0	4.0	NM_152419	B4E2V0	Silent	SNP	ENST00000458501.2	hg19		.	.	.	.	.	.	.	.	.	.	T	5.170	0.217015	0.09810	.	.	ENSG00000165102	ENST00000524016	.	.	.	5.23	-6.48	0.01896	.	.	.	.	.	T	0.46833	0.1413	.	.	.	0.40583	D	0.981413	.	.	.	.	.	.	T	0.48222	-0.9054	4	.	.	.	-10.3472	6.8837	0.24187	0.2236:0.4955:0.0:0.2809	.	.	.	.	L	159	.	.	F	+	1	0	HGSNAT	43166724	0.850000	0.29656	0.010000	0.14722	0.001000	0.01503	-0.163000	0.09997	-1.636000	0.01533	-1.303000	0.01326	TTC	.	.		0.498	HGSNAT-202	KNOWN	basic	protein_coding	protein_coding		XM_372038	
RP1	6101	hgsc.bcm.edu	37	8	55542178	55542178	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:55542178T>C	ENST00000220676.1	+	4	5884	c.5736T>C	c.(5734-5736)gcT>gcC	p.A1912A		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1912					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AACTGTATGCTCTTTGTGGTC	0.388																																					p.A1912A	Colon(91;1014 1389 7634 14542 40420)	Atlas-SNP	.											.	RP1	429	.	0			c.T5736C						.						93.0	92.0	93.0					8																	55542178		2203	4300	6503	SO:0001819	synonymous_variant	6101	exon4			GTATGCTCTTTGT	AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.5736T>C	chr8.hg19:g.55542178T>C		77.0	0.0		58.0	4.0	NM_006269		Silent	SNP	ENST00000220676.1	hg19	CCDS6160.1																																																																																			.	.		0.388	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378532.2	NM_006269	
CHD7	55636	hgsc.bcm.edu	37	8	61757511	61757511	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:61757511C>G	ENST00000423902.2	+	22	5418	c.4939C>G	c.(4939-4941)Ctg>Gtg	p.L1647V	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1647					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			CAGAACCATCCTGGTGTACTG	0.483																																					p.L1647V		Atlas-SNP	.											.	CHD7	534	.	0			c.C4939G						.						114.0	113.0	113.0					8																	61757511		1965	4162	6127	SO:0001583	missense	55636	exon22			ACCATCCTGGTGT	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4939C>G	chr8.hg19:g.61757511C>G	ENSP00000392028:p.Leu1647Val	78.0	0.0		99.0	5.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	hg19	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	C	17.06	3.293511	0.60086	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	D	0.87334	-2.24	5.63	4.75	0.60458	.	0.000000	0.64402	D	0.000004	D	0.93530	0.7935	M	0.88906	2.99	0.80722	D	1	D	0.54964	0.969	P	0.60541	0.876	D	0.94686	0.7870	10	0.87932	D	0	-14.2895	15.1709	0.72872	0.0:0.9312:0.0:0.0688	.	1647	Q9P2D1	CHD7_HUMAN	V	1647	ENSP00000392028:L1647V	ENSP00000307304:L1647V	L	+	1	2	CHD7	61920065	1.000000	0.71417	0.996000	0.52242	0.535000	0.34838	2.073000	0.41519	1.487000	0.48415	0.655000	0.94253	CTG	.	.		0.483	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
PDE7A	5150	hgsc.bcm.edu	37	8	66636575	66636575	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:66636575T>C	ENST00000401827.3	-	11	1520	c.1077A>G	c.(1075-1077)aaA>aaG	p.K359K	PDE7A_ENST00000396642.3_Silent_p.K359K|PDE7A_ENST00000379419.4_Silent_p.K333K|PDE7A_ENST00000518667.1_5'Flank	NM_001242318.2	NP_001229247.1	Q13946	PDE7A_HUMAN	phosphodiesterase 7A	359	Catalytic. {ECO:0000250}.				cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			large_intestine(5)|lung(3)|stomach(1)|urinary_tract(1)	10			Epithelial(68;0.0509)|BRCA - Breast invasive adenocarcinoma(89;0.111)|all cancers(69;0.168)|OV - Ovarian serous cystadenocarcinoma(28;0.238)		Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	TATCAGCACATTTCAAAGCCA	0.363																																					p.K359K		Atlas-SNP	.											.	PDE7A	78	.	0			c.A1077G						.						118.0	108.0	112.0					8																	66636575		2203	4300	6503	SO:0001819	synonymous_variant	5150	exon11			AGCACATTTCAAA	L12052	CCDS34901.1, CCDS56538.1	8q13	2008-03-18				ENSG00000205268	3.1.4.17	"""Phosphodiesterases"""	8791	protein-coding gene	gene with protein product		171885				8389765, 9521885	Standard	NM_001242318		Approved	HCP1	uc003xvq.3	Q13946		ENST00000401827.3:c.1077A>G	chr8.hg19:g.66636575T>C		73.0	0.0		58.0	4.0	NM_001242318	A0AVH6|A8K436|A8K9G5|O15380|Q96T72	Silent	SNP	ENST00000401827.3	hg19	CCDS56538.1																																																																																			.	.		0.363	PDE7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378905.1		
PREX2	80243	hgsc.bcm.edu	37	8	69002857	69002857	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:69002857T>C	ENST00000288368.4	+	20	2434	c.2157T>C	c.(2155-2157)atT>atC	p.I719I	RP11-403D15.2_ENST00000526901.1_RNA|PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	719	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						GACAGTGCATTATCAAGGTGA	0.433																																					p.I719I		Atlas-SNP	.											.	PREX2	614	.	0			c.T2157C						.						114.0	102.0	106.0					8																	69002857		2203	4300	6503	SO:0001819	synonymous_variant	80243	exon20			GTGCATTATCAAG	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2157T>C	chr8.hg19:g.69002857T>C		116.0	0.0		94.0	4.0	NM_025170	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Silent	SNP	ENST00000288368.4	hg19	CCDS6201.1																																																																																			.	.		0.433	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
PI15	51050	hgsc.bcm.edu	37	8	75737542	75737542	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:75737542A>G	ENST00000260113.2	+	2	237	c.58A>G	c.(58-60)Agt>Ggt	p.S20G	RP11-758M4.4_ENST00000523860.1_RNA|RP11-758M4.4_ENST00000518128.1_RNA|PI15_ENST00000523773.1_Missense_Mutation_p.S20G	NM_015886.3	NP_056970.1	O43692	PI15_HUMAN	peptidase inhibitor 15	20						extracellular vesicular exosome (GO:0070062)	peptidase inhibitor activity (GO:0030414)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|pancreas(1)|skin(1)	30	Breast(64;0.137)		BRCA - Breast invasive adenocarcinoma(89;0.104)|Epithelial(68;0.118)			CTGTGAAGCAAGTACCGTCGT	0.468																																					p.S20G		Atlas-SNP	.											.	PI15	73	.	0			c.A58G						.						219.0	213.0	215.0					8																	75737542		2203	4300	6503	SO:0001583	missense	51050	exon2			GAAGCAAGTACCG	D45027	CCDS6218.1	8q13.3	2005-08-17	2005-08-17		ENSG00000137558	ENSG00000137558			8946	protein-coding gene	gene with protein product		607076	"""protease inhibitor 15"""			8882727, 9473672	Standard	XM_005251255		Approved	P25TI	uc003yal.3	O43692	OTTHUMG00000164528	ENST00000260113.2:c.58A>G	chr8.hg19:g.75737542A>G	ENSP00000260113:p.Ser20Gly	131.0	0.0		120.0	5.0	NM_015886	Q68CY1	Missense_Mutation	SNP	ENST00000260113.2	hg19	CCDS6218.1	.	.	.	.	.	.	.	.	.	.	A	9.589	1.125683	0.20959	.	.	ENSG00000137558	ENST00000260113;ENST00000523773	T;T	0.09630	2.96;2.96	4.77	3.59	0.41128	.	0.238443	0.41938	D	0.000786	T	0.08935	0.0221	L	0.52573	1.65	0.34216	D	0.67487	B	0.19817	0.039	B	0.16289	0.015	T	0.18241	-1.0343	10	0.13108	T	0.6	.	7.0667	0.25156	0.6969:0.1598:0.0:0.1432	.	20	O43692	PI15_HUMAN	G	20	ENSP00000260113:S20G;ENSP00000428567:S20G	ENSP00000260113:S20G	S	+	1	0	PI15	75900097	1.000000	0.71417	0.578000	0.28575	0.974000	0.67602	4.447000	0.60020	0.946000	0.37632	0.459000	0.35465	AGT	.	.		0.468	PI15-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379115.1	NM_015886	
KLF10	7071	hgsc.bcm.edu	37	8	103664250	103664250	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:103664250A>G	ENST00000285407.6	-	3	610	c.310T>C	c.(310-312)Tct>Cct	p.S104P	KLF10_ENST00000395884.3_Missense_Mutation_p.S93P	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	104					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			GACACTTGAGAGGGTTCAAAG	0.398											OREG0018913	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S104P	Esophageal Squamous(16;495 519 2144 16528 44005)	Atlas-SNP	.											.	KLF10	44	.	0			c.T310C						.						58.0	63.0	61.0					8																	103664250		2202	4300	6502	SO:0001583	missense	7071	exon3			CTTGAGAGGGTTC	U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.310T>C	chr8.hg19:g.103664250A>G	ENSP00000285407:p.Ser104Pro	80.0	0.0	1375	87.0	4.0	NM_005655	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	ENST00000285407.6	hg19	CCDS6294.1	.	.	.	.	.	.	.	.	.	.	A	16.90	3.250118	0.59212	.	.	ENSG00000155090	ENST00000285407;ENST00000395884	T;T	0.19250	2.16;2.23	6.02	4.87	0.63330	.	0.073459	0.64402	D	0.000017	T	0.30603	0.0770	M	0.64997	1.995	0.39380	D	0.966241	P;P	0.51791	0.948;0.948	P;P	0.51487	0.671;0.671	T	0.11372	-1.0590	10	0.87932	D	0	.	7.9059	0.29761	0.7938:0.1377:0.0685:0.0	.	104;93	Q13118;O75411	KLF10_HUMAN;.	P	104;93	ENSP00000285407:S104P;ENSP00000379222:S93P	ENSP00000285407:S104P	S	-	1	0	KLF10	103733426	1.000000	0.71417	0.989000	0.46669	0.992000	0.81027	3.741000	0.55090	1.116000	0.41820	0.533000	0.62120	TCT	.	.		0.398	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379967.1		
RAD21	5885	hgsc.bcm.edu	37	8	117870613	117870613	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:117870613A>G	ENST00000297338.2	-	5	746	c.459T>C	c.(457-459)agT>agC	p.S153S	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	153					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					CTTGTAAAATACTGATGTTCC	0.333																																					p.S153S		Atlas-SNP	.											.	RAD21	95	.	0			c.T459C						.						115.0	115.0	115.0					8																	117870613		2203	4300	6503	SO:0001819	synonymous_variant	5885	exon5			TAAAATACTGATG	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.459T>C	chr8.hg19:g.117870613A>G		67.0	0.0		77.0	4.0	NM_006265	A8K0E0|Q15001|Q99568	Silent	SNP	ENST00000297338.2	hg19	CCDS6321.1																																																																																			.	.		0.333	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
RAD21	5885	hgsc.bcm.edu	37	8	117870655	117870655	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:117870655T>C	ENST00000297338.2	-	5	704	c.417A>G	c.(415-417)agA>agG	p.R139R	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	139					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TCTCTTCCACTCTACTCTGAT	0.318																																					p.R139R		Atlas-SNP	.											.	RAD21	95	.	0			c.A417G						.						133.0	131.0	132.0					8																	117870655		2203	4300	6503	SO:0001819	synonymous_variant	5885	exon5			TTCCACTCTACTC	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.417A>G	chr8.hg19:g.117870655T>C		76.0	0.0		96.0	4.0	NM_006265	A8K0E0|Q15001|Q99568	Silent	SNP	ENST00000297338.2	hg19	CCDS6321.1																																																																																			.	.		0.318	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
RAD21	5885	hgsc.bcm.edu	37	8	117870690	117870690	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:117870690C>A	ENST00000297338.2	-	5	669	c.382G>T	c.(382-384)Gat>Tat	p.D128Y	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	128					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TGGGCCACATCGATGTCACTT	0.318																																					p.D128Y		Atlas-SNP	.											.	RAD21	95	.	0			c.G382T						.						120.0	116.0	117.0					8																	117870690		2203	4300	6503	SO:0001583	missense	5885	exon5			CCACATCGATGTC	BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.382G>T	chr8.hg19:g.117870690C>A	ENSP00000297338:p.Asp128Tyr	56.0	0.0		82.0	4.0	NM_006265	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	ENST00000297338.2	hg19	CCDS6321.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.844976	0.91197	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485	T;T;T	0.59772	0.24;1.32;1.32	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.79197	0.4405	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.75830	-0.3179	10	0.26408	T	0.33	-0.1517	19.9542	0.97213	0.0:1.0:0.0:0.0	.	128	O60216	RAD21_HUMAN	Y	128	ENSP00000297338:D128Y;ENSP00000429342:D128Y;ENSP00000427923:D128Y	ENSP00000297338:D128Y	D	-	1	0	RAD21	117939871	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.728000	0.93425	0.650000	0.86243	GAT	.	.		0.318	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381184.1	NM_006265	
TAF2	6873	hgsc.bcm.edu	37	8	120810035	120810035	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:120810035A>G	ENST00000378164.2	-	7	1142	c.844T>C	c.(844-846)Tca>Cca	p.S282P		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	282					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGAAGGTATGATGTGGTATGT	0.338																																					p.S282P		Atlas-SNP	.											.	TAF2	204	.	0			c.T844C						.						89.0	87.0	87.0					8																	120810035		2203	4299	6502	SO:0001583	missense	6873	exon7			GGTATGATGTGGT	AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.844T>C	chr8.hg19:g.120810035A>G	ENSP00000367406:p.Ser282Pro	91.0	0.0		95.0	4.0	NM_003184	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	ENST00000378164.2	hg19	CCDS34937.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.212616	0.79240	.	.	ENSG00000064313	ENST00000378164	T	0.02837	4.14	6.07	6.07	0.98685	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.065598	0.64402	D	0.000006	T	0.06508	0.0167	L	0.49126	1.545	0.58432	D	0.999996	P	0.45428	0.858	P	0.49387	0.609	T	0.47222	-0.9134	10	0.30854	T	0.27	-25.6241	12.4822	0.55850	0.8607:0.1393:0.0:0.0	.	282	Q6P1X5	TAF2_HUMAN	P	282	ENSP00000367406:S282P	ENSP00000367406:S282P	S	-	1	0	TAF2	120879216	1.000000	0.71417	0.897000	0.35233	0.989000	0.77384	7.269000	0.78482	2.326000	0.78906	0.533000	0.62120	TCA	.	.		0.338	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381436.1	NM_003184	
DSCC1	79075	hgsc.bcm.edu	37	8	120850618	120850618	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:120850618T>C	ENST00000313655.4	-	8	1168	c.954A>G	c.(952-954)agA>agG	p.R318R		NM_024094.2	NP_076999.2	Q9BVC3	DCC1_HUMAN	DNA replication and sister chromatid cohesion 1	318					DNA replication (GO:0006260)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)	chromatin (GO:0000785)|chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			NS(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|pancreas(1)	9	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			TGATTTCTGGTCTCGAGTGTC	0.368																																					p.R318R		Atlas-SNP	.											.	DSCC1	40	.	0			c.A954G						.						108.0	109.0	109.0					8																	120850618		2203	4300	6503	SO:0001819	synonymous_variant	79075	exon8			TTCTGGTCTCGAG		CCDS6330.1	8q24.12	2013-05-24	2013-05-24		ENSG00000136982	ENSG00000136982			24453	protein-coding gene	gene with protein product	"""defective in sister chromatid cohesion homolog 1 (S. cerevisiae)"""	613203	"""defective in sister chromatid cohesion 1 homolog (S. cerevisiae)"""			12766176, 20826785	Standard	NM_024094		Approved	DCC1, hDCC1, MGC5528	uc003yov.3	Q9BVC3	OTTHUMG00000165010	ENST00000313655.4:c.954A>G	chr8.hg19:g.120850618T>C		118.0	0.0		137.0	6.0	NM_024094	Q969N5	Silent	SNP	ENST00000313655.4	hg19	CCDS6330.1																																																																																			.	.		0.368	DSCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381443.1	NM_024094	
HHLA1	10086	hgsc.bcm.edu	37	8	133116394	133116394	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:133116394C>T	ENST00000414222.1	-	2	99	c.100G>A	c.(100-102)Gcc>Acc	p.A34T	HHLA1_ENST00000434736.2_Missense_Mutation_p.A34T	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	34						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						TCTTTCTTGGCTTCTCCTTTG	0.383																																					p.A34T		Atlas-SNP	.											.	HHLA1	35	.	0			c.G100A						.						257.0	222.0	232.0					8																	133116394		692	1591	2283	SO:0001583	missense	10086	exon2			TCTTGGCTTCTCC	AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.100G>A	chr8.hg19:g.133116394C>T	ENSP00000388322:p.Ala34Thr	81.0	0.0		95.0	4.0	NM_001145095		Missense_Mutation	SNP	ENST00000414222.1	hg19		.	.	.	.	.	.	.	.	.	.	C	8.684	0.905818	0.17760	.	.	ENSG00000132297	ENST00000414222;ENST00000434736	.	.	.	4.86	-2.7	0.06004	.	.	.	.	.	T	0.17408	0.0418	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.21724	-1.0237	8	0.62326	D	0.03	.	3.494	0.07648	0.3021:0.2427:0.0:0.4552	.	34	C9JL84	HHLA1_HUMAN	T	34	.	ENSP00000388322:A34T	A	-	1	0	HHLA1	133185576	0.004000	0.15560	0.100000	0.21137	0.416000	0.31233	-1.004000	0.03678	-0.293000	0.08986	-0.137000	0.14449	GCC	.	.		0.383	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XR_017860	
PPP1R16A	84988	hgsc.bcm.edu	37	8	145726669	145726669	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr8:145726669C>T	ENST00000292539.4	+	10	2112	c.1195C>T	c.(1195-1197)Ccc>Tcc	p.P399S	PPP1R16A_ENST00000435887.1_Missense_Mutation_p.P399S|CTD-2517M22.14_ENST00000532766.1_RNA|CTD-2517M14.5_ENST00000569326.1_RNA|GPT_ENST00000394955.2_5'Flank|GPT_ENST00000528431.1_5'Flank			Q96I34	PP16A_HUMAN	protein phosphatase 1, regulatory subunit 16A	399						plasma membrane (GO:0005886)				NS(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			CAGGCCGCCGCCCCCGGAGGT	0.736																																					p.P399S		Atlas-SNP	.											.	PPP1R16A	25	.	0			c.C1195T						.						9.0	12.0	11.0					8																	145726669		2134	4173	6307	SO:0001583	missense	84988	exon9			CCGCCGCCCCCGG		CCDS6429.1	8q24.3	2013-01-10	2011-10-04		ENSG00000160972	ENSG00000160972		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14941	protein-coding gene	gene with protein product		609172	"""protein phosphatase 1, regulatory (inhibitor) subunit 16A"""			11948623	Standard	NM_032902		Approved	MGC14333, MYPT3	uc003zdf.3	Q96I34	OTTHUMG00000165173	ENST00000292539.4:c.1195C>T	chr8.hg19:g.145726669C>T	ENSP00000292539:p.Pro399Ser	1.0	0.0		7.0	7.0	NM_032902	D3DWM5	Missense_Mutation	SNP	ENST00000292539.4	hg19	CCDS6429.1	.	.	.	.	.	.	.	.	.	.	C	15.57	2.872668	0.51695	.	.	ENSG00000160972	ENST00000292539;ENST00000435887	T;T	0.70282	-0.47;-0.47	4.72	0.134	0.14771	.	0.480552	0.19810	N	0.105544	T	0.51449	0.1675	L	0.56769	1.78	0.09310	N	1	B	0.31435	0.323	B	0.24006	0.05	T	0.33701	-0.9858	10	0.07644	T	0.81	.	2.4722	0.04566	0.1267:0.4131:0.2754:0.1848	.	399	Q96I34	PP16A_HUMAN	S	399	ENSP00000292539:P399S;ENSP00000391126:P399S	ENSP00000292539:P399S	P	+	1	0	PPP1R16A	145697477	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	-0.049000	0.11924	0.053000	0.16036	0.462000	0.41574	CCC	.	.		0.736	PPP1R16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382459.1	NM_032902	
SMARCA2	6595	hgsc.bcm.edu	37	9	2029231	2029231	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:2029231T>C	ENST00000382203.1	+	2	418	c.209T>C	c.(208-210)aTg>aCg	p.M70T	SMARCA2_ENST00000382194.1_Missense_Mutation_p.M70T|SMARCA2_ENST00000349721.2_Missense_Mutation_p.M70T|SMARCA2_ENST00000357248.2_Missense_Mutation_p.M70T			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2	70					aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CAGGAAGGCATGCATCAAATG	0.498																																					p.M70T		Atlas-SNP	.											.	SMARCA2	313	.	0			c.T209C						.						40.0	33.0	35.0					9																	2029231		2203	4300	6503	SO:0001583	missense	6595	exon2			AAGGCATGCATCA	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.209T>C	chr9.hg19:g.2029231T>C	ENSP00000371638:p.Met70Thr	103.0	0.0		73.0	4.0	NM_139045	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Missense_Mutation	SNP	ENST00000382203.1	hg19	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	T	15.18	2.755525	0.49362	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000450198;ENST00000439732;ENST00000382203;ENST00000382194	D;D;T;D;D	0.88046	-2.33;-2.31;0.58;-2.33;-2.31	5.61	5.61	0.85477	.	0.151372	0.56097	D	0.000024	D	0.83562	0.5281	L	0.43923	1.385	0.80722	D	1	B;B	0.20988	0.05;0.004	B;B	0.17979	0.02;0.006	T	0.79948	-0.1588	10	0.48119	T	0.1	-10.7341	15.7983	0.78428	0.0:0.0:0.0:1.0	.	70;70	P51531-2;P51531	.;SMCA2_HUMAN	T	70	ENSP00000265773:M70T;ENSP00000349788:M70T;ENSP00000392081:M70T;ENSP00000371638:M70T;ENSP00000371629:M70T	ENSP00000265773:M70T	M	+	2	0	SMARCA2	2019231	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.302000	0.72788	2.125000	0.65367	0.455000	0.32223	ATG	.	.		0.498	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	
ADAMTSL1	92949	hgsc.bcm.edu	37	9	18636002	18636002	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:18636002T>C	ENST00000380548.4	+	6	1002	c.663T>C	c.(661-663)ggT>ggC	p.G221G	ADAMTSL1_ENST00000327883.7_Silent_p.G221G|ADAMTSL1_ENST00000276935.6_Silent_p.G221G|ADAMTSL1_ENST00000380566.4_Silent_p.G221G	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	221						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		TCTTAAAAGGTCCTGATCACT	0.348																																					p.G221G		Atlas-SNP	.											.	ADAMTSL1	306	.	0			c.T663C						.						213.0	200.0	204.0					9																	18636002		2203	4300	6503	SO:0001819	synonymous_variant	92949	exon6			AAAAGGTCCTGAT	AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.663T>C	chr9.hg19:g.18636002T>C		163.0	0.0		98.0	4.0	NM_052866	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	ENST00000380548.4	hg19	CCDS47954.1																																																																																			.	.		0.348	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401206.1		
NFX1	4799	hgsc.bcm.edu	37	9	33351736	33351736	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:33351736T>C	ENST00000379540.3	+	16	2665	c.2603T>C	c.(2602-2604)aTg>aCg	p.M868T	NFX1_ENST00000379521.4_Missense_Mutation_p.M868T|Y_RNA_ENST00000363674.1_RNA	NM_002504.4	NP_002495.2	Q12986	NFX1_HUMAN	nuclear transcription factor, X-box binding 1	868					inflammatory response (GO:0006954)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25			LUSC - Lung squamous cell carcinoma(29;0.00506)	GBM - Glioblastoma multiforme(74;0.224)		CACCCGTGTATGGCACCCTGC	0.552																																					p.M868T		Atlas-SNP	.											.	NFX1	85	.	0			c.T2603C						.						74.0	71.0	72.0					9																	33351736		2203	4300	6503	SO:0001583	missense	4799	exon16			CGTGTATGGCACC	U19759	CCDS6538.1, CCDS6539.1, CCDS6540.1	9p12	2013-12-13			ENSG00000086102	ENSG00000086102			7803	protein-coding gene	gene with protein product		603255				7964459, 2511169	Standard	NM_002504		Approved	NFX2, MGC20369, Tex42, TEG-42	uc003zsq.3	Q12986	OTTHUMG00000019772	ENST00000379540.3:c.2603T>C	chr9.hg19:g.33351736T>C	ENSP00000368856:p.Met868Thr	54.0	0.0		54.0	4.0	NM_147133	A8K6H8|Q5VXW6|Q96EL5|Q9BXI1	Missense_Mutation	SNP	ENST00000379540.3	hg19	CCDS6538.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983493	0.35036	.	.	ENSG00000086102	ENST00000379540;ENST00000379521;ENST00000263220	T;T	0.38240	1.15;1.15	5.88	4.68	0.58851	Zinc finger, NF-X1-type (1);	0.337134	0.39146	N	0.001448	T	0.19087	0.0458	N	0.12831	0.26	0.80722	D	1	B;P	0.40476	0.003;0.718	B;B	0.38880	0.01;0.284	T	0.05305	-1.0893	10	0.12766	T	0.61	.	10.9663	0.47414	0.0:0.0:0.1564:0.8436	.	868;868	Q12986;Q12986-2	NFX1_HUMAN;.	T	868;868;65	ENSP00000368856:M868T;ENSP00000368836:M868T	ENSP00000263220:M65T	M	+	2	0	NFX1	33341736	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	1.795000	0.38784	2.246000	0.74042	0.533000	0.62120	ATG	.	.		0.552	NFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052069.1		
TLN1	7094	hgsc.bcm.edu	37	9	35733445	35733445	+	5'Flank	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:35733445A>G	ENST00000314888.9	-	0	0				CREB3_ENST00000353704.2_Missense_Mutation_p.E133G|CREB3_ENST00000486056.1_3'UTR|TLN1_ENST00000540444.1_5'Flank	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGGAGAAGGAGGGGCTTATT	0.463																																					p.E133G		Atlas-SNP	.											.	CREB3	24	.	0			c.A398G						.						101.0	91.0	95.0					9																	35733445		2203	4300	6503	SO:0001631	upstream_gene_variant	10488	exon4			AGAAGGAGGGGCT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874		chr9.hg19:g.35733445A>G	Exception_encountered	125.0	0.0		84.0	4.0	NM_006368	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	A	31	5.083431	0.94050	.	.	ENSG00000107175	ENST00000353704	D	0.83075	-1.68	4.88	4.88	0.63580	Eukaryotic transcription factor, Skn-1-like, DNA-binding (1);	0.054574	0.64402	D	0.000001	D	0.90157	0.6924	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.995	D	0.91360	0.5111	10	0.87932	D	0	.	13.6285	0.62181	1.0:0.0:0.0:0.0	.	157;133	O43889;O43889-2	CREB3_HUMAN;.	G	133	ENSP00000342136:E133G	ENSP00000342136:E133G	E	+	2	0	CREB3	35723445	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.928000	0.63447	1.970000	0.57323	0.528000	0.53228	GAG	.	.		0.463	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
SMC5	23137	hgsc.bcm.edu	37	9	72967130	72967130	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:72967130T>C	ENST00000361138.5	+	25	3247	c.3189T>C	c.(3187-3189)tcT>tcC	p.S1063S	SMC5_ENST00000471372.1_3'UTR	NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	1063					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						TTCCTTATTCTGAAAAGATGA	0.378																																					p.S1063S		Atlas-SNP	.											.	SMC5	96	.	0			c.T3189C						.						84.0	87.0	86.0					9																	72967130		2203	4300	6503	SO:0001819	synonymous_variant	23137	exon25			TTATTCTGAAAAG	AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.3189T>C	chr9.hg19:g.72967130T>C		102.0	0.0		80.0	4.0	NM_015110	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	ENST00000361138.5	hg19	CCDS6632.1																																																																																			.	.		0.378	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052603.1	NM_015110	
C9orf41	138199	hgsc.bcm.edu	37	9	77614715	77614715	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:77614715A>G	ENST00000376834.3	-	4	814	c.662T>C	c.(661-663)cTa>cCa	p.L221P	C9orf41_ENST00000376837.3_Intron	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	221										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						AGCATAACCTAGCATAGCTAT	0.358																																					p.L221P		Atlas-SNP	.											.	C9orf41	57	.	0			c.T662C						.						99.0	98.0	98.0					9																	77614715		2203	4300	6503	SO:0001583	missense	138199	exon4			TAACCTAGCATAG	AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.662T>C	chr9.hg19:g.77614715A>G	ENSP00000366030:p.Leu221Pro	43.0	0.0		24.0	4.0	NM_152420	Q7Z383|Q8N7C5	Missense_Mutation	SNP	ENST00000376834.3	hg19	CCDS6649.1	.	.	.	.	.	.	.	.	.	.	A	18.14	3.557523	0.65425	.	.	ENSG00000156017	ENST00000376834;ENST00000451153	T;T	0.04502	3.61;3.61	6.07	6.07	0.98685	N2227-like (1);	0.067331	0.64402	D	0.000009	T	0.23926	0.0579	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.01725	-1.1287	10	0.38643	T	0.18	-8.7332	11.6865	0.51490	0.868:0.0:0.0:0.132	.	221	Q8N4J0	CI041_HUMAN	P	221;160	ENSP00000366030:L221P;ENSP00000396353:L160P	ENSP00000366030:L221P	L	-	2	0	C9orf41	76804535	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.840000	0.75369	2.326000	0.78906	0.533000	0.62120	CTA	.	.		0.358	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052703.1	NM_152420	
PCSK5	5125	hgsc.bcm.edu	37	9	78947423	78947423	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:78947423A>G	ENST00000545128.1	+	33	5102	c.4564A>G	c.(4564-4566)Agc>Ggc	p.S1522G		NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	1522	CRM (Cys-rich motif).				anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						CCACTGCCACAGCTCTTGCAG	0.562																																					p.S1522G		Atlas-SNP	.											.	PCSK5	329	.	0			c.A4564G						.						67.0	59.0	61.0					9																	78947423		876	1991	2867	SO:0001583	missense	5125	exon33			TGCCACAGCTCTT		CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.4564A>G	chr9.hg19:g.78947423A>G	ENSP00000446280:p.Ser1522Gly	141.0	0.0		98.0	4.0	NM_001190482	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	ENST00000545128.1	hg19	CCDS55320.1	.	.	.	.	.	.	.	.	.	.	A	3.979	-0.006823	0.07773	.	.	ENSG00000099139	ENST00000545128;ENST00000376754;ENST00000424854	T;T	0.64438	-0.1;-0.1	5.54	4.37	0.52481	.	0.374944	0.31392	N	0.007723	T	0.70378	0.3217	M	0.83774	2.66	0.29317	N	0.86761	.	.	.	.	.	.	T	0.65429	-0.6170	8	0.23891	T	0.37	-14.5227	11.0006	0.47602	0.8437:0.1563:0.0:0.0	.	.	.	.	G	1522;1252;1222	ENSP00000446280:S1522G;ENSP00000411654:S1222G	ENSP00000365945:S1252G	S	+	1	0	PCSK5	78137243	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	2.943000	0.49026	0.902000	0.36520	0.533000	0.62120	AGC	.	.		0.562	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
VPS13A	23230	hgsc.bcm.edu	37	9	79986002	79986002	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:79986002C>T	ENST00000360280.3	+	67	9274	c.9014C>T	c.(9013-9015)gCg>gTg	p.A3005V	VPS13A_ENST00000376634.4_Missense_Mutation_p.A3005V|VPS13A_ENST00000357409.5_Missense_Mutation_p.A3005V|VPS13A_ENST00000376636.3_Missense_Mutation_p.A2966V	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	3005					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TTAGTAGGAGCGGTAGCAAGG	0.408																																					p.A3005V		Atlas-SNP	.											VPS13A_ENST00000376634,NS,carcinoma,0,3	VPS13A	735	.	0			c.C9014T						.						103.0	97.0	99.0					9																	79986002		2203	4300	6503	SO:0001583	missense	23230	exon67			TAGGAGCGGTAGC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.9014C>T	chr9.hg19:g.79986002C>T	ENSP00000353422:p.Ala3005Val	105.0	0.0		92.0	4.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	hg19	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	C	16.28	3.077693	0.55753	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.41758	1.16;0.99;1.08;1.12	5.77	5.77	0.91146	Autophagy-related, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46619	0.1402	N	0.10809	0.05	0.80722	D	1	P;D;D;D	0.69078	0.568;0.997;0.985;0.994	B;D;P;P	0.69824	0.23;0.966;0.614;0.765	T	0.43925	-0.9361	9	.	.	.	.	19.9576	0.97228	0.0:1.0:0.0:0.0	.	2966;3005;3005;3005	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	V	3005;2966;3005;3005	ENSP00000365821:A3005V;ENSP00000365823:A2966V;ENSP00000353422:A3005V;ENSP00000349985:A3005V	.	A	+	2	0	VPS13A	79175822	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	4.088000	0.57678	2.885000	0.99019	0.655000	0.94253	GCG	.	.		0.408	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
IARS	3376	hgsc.bcm.edu	37	9	95051645	95051645	+	Silent	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:95051645C>T	ENST00000375643.3	-	2	323	c.57G>A	c.(55-57)ttG>ttA	p.L19L	IARS_ENST00000443024.2_Silent_p.L19L|IARS_ENST00000375629.3_5'UTR|IARS_ENST00000447699.2_5'UTR	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	19					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TCCAAAACTCCAAGATTTTCT	0.299																																					p.L19L		Atlas-SNP	.											.	IARS	74	.	0			c.G57A						.						46.0	46.0	46.0					9																	95051645		2199	4294	6493	SO:0001819	synonymous_variant	3376	exon2			AAACTCCAAGATT	AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.57G>A	chr9.hg19:g.95051645C>T		115.0	0.0		58.0	4.0	NM_013417	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Silent	SNP	ENST00000375643.3	hg19	CCDS6694.1																																																																																			.	.		0.299	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053059.2	NM_002161	
IPPK	64768	hgsc.bcm.edu	37	9	95411768	95411768	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:95411768T>C	ENST00000287996.3	-	5	657	c.381A>G	c.(379-381)gcA>gcG	p.A127A		NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	127					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						GCCGGTGCTCTGCAAAGCGGT	0.502																																					p.A127A		Atlas-SNP	.											.	IPPK	34	.	0			c.A381G						.						154.0	119.0	131.0					9																	95411768		2203	4300	6503	SO:0001819	synonymous_variant	64768	exon5			GTGCTCTGCAAAG	AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.381A>G	chr9.hg19:g.95411768T>C		118.0	0.0		92.0	4.0	NM_022755	Q5T9F7|Q9H7V8	Silent	SNP	ENST00000287996.3	hg19	CCDS6699.1																																																																																			.	.		0.502	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053101.1	NM_022755	
C9orf3	84909	hgsc.bcm.edu	37	9	97535345	97535345	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:97535345C>T	ENST00000375315.2	+	2	859	c.859C>T	c.(859-861)Cca>Tca	p.P287S	C9orf3_ENST00000277198.2_Missense_Mutation_p.P287S|C9orf3_ENST00000297979.5_Missense_Mutation_p.P287S	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	287					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		ATGCCAGGAGCCACCCGTTGC	0.478																																					p.P287S		Atlas-SNP	.											.	C9orf3	100	.	0			c.C859T						.						136.0	128.0	130.0					9																	97535345		2203	4300	6503	SO:0001583	missense	84909	exon3			CAGGAGCCACCCG	AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.859C>T	chr9.hg19:g.97535345C>T	ENSP00000364464:p.Pro287Ser	188.0	0.0		97.0	4.0	NM_001193331	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	ENST00000375315.2	hg19	CCDS55328.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311883	0.81358	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000424143;ENST00000428313	T;T;T;T;T	0.03920	3.76;3.76;3.76;3.76;3.76	5.09	5.09	0.68999	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.12902	0.0313	L	0.34521	1.04	0.80722	D	1	D;D;D;D	0.89917	1.0;0.992;1.0;1.0	D;D;D;D	0.97110	0.997;0.956;1.0;0.988	T	0.35919	-0.9769	10	0.14252	T	0.57	-7.173	18.6869	0.91568	0.0:1.0:0.0:0.0	.	287;287;287;287	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	S	287;287;287;110;69	ENSP00000277198:P287S;ENSP00000297979:P287S;ENSP00000364464:P287S;ENSP00000402171:P110S;ENSP00000401854:P69S	ENSP00000277198:P287S	P	+	1	0	C9orf3	96575166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.204000	0.77872	2.644000	0.89710	0.585000	0.79938	CCA	.	.		0.478	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_032823	
HSD17B3	3293	hgsc.bcm.edu	37	9	99006632	99006632	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:99006632T>C	ENST00000375263.3	-	9	698	c.651A>G	c.(649-651)aaA>aaG	p.K217K	HSD17B3_ENST00000464104.1_5'UTR|HSD17B3_ENST00000375262.2_Silent_p.K217K|RP11-240L7.4_ENST00000448857.1_RNA	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	217					androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				CTTCTTTTGCTTTATATTCCT	0.552																																					p.K217K		Atlas-SNP	.											.	HSD17B3	32	.	0			c.A651G						.						232.0	196.0	208.0					9																	99006632		2203	4300	6503	SO:0001819	synonymous_variant	3293	exon9			TTTTGCTTTATAT		CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.651A>G	chr9.hg19:g.99006632T>C		104.0	0.0		75.0	4.0	NM_000197	Q5U0Q6	Silent	SNP	ENST00000375263.3	hg19	CCDS6716.1																																																																																			.	.		0.552	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053259.1	NM_000197	
OR2K2	26248	hgsc.bcm.edu	37	9	114089950	114089950	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:114089950A>G	ENST00000374428.1	-	1	850	c.851T>C	c.(850-852)cTc>cCc	p.L284P	OR2K2_ENST00000302681.1_Missense_Mutation_p.L255P			Q8NGT1	OR2K2_HUMAN	olfactory receptor, family 2, subfamily K, member 2	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|skin(2)	20						GTACATAGAGAGGGCAGCCCC	0.423																																					p.L255P		Atlas-SNP	.											.	OR2K2	77	.	0			c.T764C						.						116.0	115.0	115.0					9																	114089950		2203	4300	6503	SO:0001583	missense	26248	exon1			ATAGAGAGGGCAG	X64977	CCDS6778.1	9q31.3	2012-08-09			ENSG00000171133	ENSG00000171133		"""GPCR / Class A : Olfactory receptors"""	8264	protein-coding gene	gene with protein product				OR2AR1P		1370859, 17010214	Standard	NM_205859		Approved	HTPCRH06, HSHTPCRH06	uc011lwp.2	Q8NGT1	OTTHUMG00000020488	ENST00000374428.1:c.851T>C	chr9.hg19:g.114089950A>G	ENSP00000363550:p.Leu284Pro	101.0	0.0		61.0	4.0	NM_205859	Q2TA61|Q5VYK4|Q6IFI5	Missense_Mutation	SNP	ENST00000374428.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.97	1.502956	0.26949	.	.	ENSG00000171133	ENST00000302681;ENST00000374428	T;T	0.47528	0.84;0.84	4.55	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35936	U	0.002900	T	0.72145	0.3424	M	0.93462	3.42	0.22531	N	0.999015	D	0.89917	1.0	D	0.97110	1.0	T	0.67106	-0.5754	10	0.87932	D	0	.	6.9177	0.24369	0.8983:0.0:0.1017:0.0	.	284	Q8NGT1	OR2K2_HUMAN	P	255;284	ENSP00000305055:L255P;ENSP00000363550:L284P	ENSP00000305055:L255P	L	-	2	0	OR2K2	113129771	0.000000	0.05858	0.188000	0.23233	0.440000	0.31957	0.816000	0.27267	2.047000	0.60756	0.482000	0.46254	CTC	.	.		0.423	OR2K2-201	KNOWN	basic	protein_coding	protein_coding		NM_205859	
DNAJC25	548645	hgsc.bcm.edu	37	9	114411855	114411855	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:114411855A>G	ENST00000313525.3	+	3	668	c.612A>G	c.(610-612)aaA>aaG	p.K204K	DNAJC25-GNG10_ENST00000374294.3_Intron|DNAJC25_ENST00000556107.1_Intron	NM_001015882.2	NP_001015882.2	Q9H1X3	DJC25_HUMAN	DnaJ (Hsp40) homolog, subfamily C , member 25	204						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(1)|skin(4)	8						CCAAAGAAAAAGGCAAAAACA	0.403																																					p.K204K		Atlas-SNP	.											.	DNAJC25	20	.	0			c.A612G						.						42.0	41.0	41.0					9																	114411855		1840	4090	5930	SO:0001819	synonymous_variant	548645	exon3			AGAAAAAGGCAAA		CCDS43862.1	9q31.3	2011-09-02			ENSG00000059769	ENSG00000059769		"""Heat shock proteins / DNAJ (HSP40)"""	34187	protein-coding gene	gene with protein product							Standard	NM_001015882		Approved	bA16L21.2.1	uc004bfl.3	Q9H1X3	OTTHUMG00000020491	ENST00000313525.3:c.612A>G	chr9.hg19:g.114411855A>G		118.0	0.0		81.0	4.0	NM_001015882	Q5QTD8|Q96BN9	Silent	SNP	ENST00000313525.3	hg19	CCDS43862.1																																																																																			.	.		0.403	DNAJC25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000156218.3	NM_001015882	
SLC46A2	57864	hgsc.bcm.edu	37	9	115652239	115652239	+	Silent	SNP	G	G	A	rs577863419		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:115652239G>A	ENST00000374228.4	-	1	954	c.723C>T	c.(721-723)ccC>ccT	p.P241P		NM_033051.3	NP_149040.3	Q9BY10	TSCOT_HUMAN	solute carrier family 46, member 2	241					negative regulation of T cell apoptotic process (GO:0070233)|regulation of T cell differentiation (GO:0045580)|T cell homeostasis (GO:0043029)|thymus development (GO:0048538)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|pancreas(1)|skin(1)	18						TATCCACGGCGGGGAGCTCCT	0.602													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18617	0.0		0.0	False		,,,				2504	0.0				p.P241P		Atlas-SNP	.											.	SLC46A2	30	.	0			c.C723T						.						70.0	63.0	65.0					9																	115652239		2203	4300	6503	SO:0001819	synonymous_variant	57864	exon1			CACGGCGGGGAGC	AF242557	CCDS6786.1	9q32	2013-05-22	2007-03-29	2007-03-29	ENSG00000119457	ENSG00000119457		"""Solute carriers"""	16055	protein-coding gene	gene with protein product		608956	"""thymic stromal co-transporter"""	TSCOT		10978518, 12826694	Standard	NM_033051		Approved	Ly110	uc004bgk.3	Q9BY10	OTTHUMG00000020513	ENST00000374228.4:c.723C>T	chr9.hg19:g.115652239G>A		92.0	0.0		70.0	51.0	NM_033051	B1ALK1|Q86VT0|Q96NE2	Silent	SNP	ENST00000374228.4	hg19	CCDS6786.1																																																																																			.	.		0.602	SLC46A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053702.1	NM_033051	
RGS3	5998	hgsc.bcm.edu	37	9	116358041	116358041	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:116358041A>G	ENST00000374140.2	+	25	3616	c.3407A>G	c.(3406-3408)aAg>aGg	p.K1136R	RGS3_ENST00000342620.5_Missense_Mutation_p.K106R|RGS3_ENST00000462403.1_Missense_Mutation_p.K249R|RGS3_ENST00000394646.3_Missense_Mutation_p.K529R|RGS3_ENST00000374134.3_Missense_Mutation_p.K457R|RGS3_ENST00000350696.5_Missense_Mutation_p.K1136R|RGS3_ENST00000462143.1_Missense_Mutation_p.K457R|RGS3_ENST00000343817.5_Missense_Mutation_p.K855R	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	1136	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CAGGCATGCAAGGAGGTAGGA	0.577																																					p.K1136R		Atlas-SNP	.											.	RGS3	251	.	0			c.A3407G						.						147.0	119.0	129.0					9																	116358041		2203	4300	6503	SO:0001583	missense	5998	exon25			CATGCAAGGAGGT	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.3407A>G	chr9.hg19:g.116358041A>G	ENSP00000363255:p.Lys1136Arg	93.0	0.0		77.0	4.0	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	hg19	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.022065	0.54576	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000343817;ENST00000394646;ENST00000474719;ENST00000462143;ENST00000342620;ENST00000374134;ENST00000462403	T;T;T;T;T;T;T;T	0.01963	4.53;4.53;4.53;4.53;4.53;4.53;4.53;4.53	5.46	5.46	0.80206	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.64402	D	0.000001	T	0.05777	0.0151	N	0.20530	0.585	0.58432	D	0.999999	B;B;P;D;D;P	0.89917	0.029;0.132;0.93;1.0;1.0;0.943	B;B;P;D;D;P	0.85130	0.064;0.222;0.753;0.995;0.997;0.84	T	0.61715	-0.7006	10	0.28530	T	0.3	.	14.7768	0.69736	1.0:0.0:0.0:0.0	.	529;249;1032;855;1026;1136	B3KUB2;Q5VZ06;P49796-6;P49796-4;B3KWG8;P49796	.;.;.;.;.;RGS3_HUMAN	R	1136;1136;855;529;304;457;106;457;249	ENSP00000363255:K1136R;ENSP00000259406:K1136R;ENSP00000340284:K855R;ENSP00000378141:K529R;ENSP00000420356:K457R;ENSP00000343359:K106R;ENSP00000363249:K457R;ENSP00000436168:K249R	ENSP00000343359:K106R	K	+	2	0	RGS3	115397862	1.000000	0.71417	1.000000	0.80357	0.649000	0.38597	9.142000	0.94618	2.073000	0.62155	0.374000	0.22700	AAG	.	.		0.577	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
ASTN2	23245	hgsc.bcm.edu	37	9	119976991	119976991	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:119976991G>C	ENST00000313400.4	-	3	761	c.661C>G	c.(661-663)Ctg>Gtg	p.L221V	ASTN2_ENST00000361209.2_Missense_Mutation_p.L221V|ASTN2_ENST00000373996.3_Missense_Mutation_p.L221V|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	221					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGAACACCAGCAGCAGCAGC	0.602																																					p.L221V		Atlas-SNP	.											ASTN2,right_upper_lobe,carcinoma,+2,1	ASTN2	307	.	0			c.C661G						.						34.0	35.0	35.0					9																	119976991		2203	4300	6503	SO:0001583	missense	23245	exon3			ACACCAGCAGCAG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.661C>G	chr9.hg19:g.119976991G>C	ENSP00000314038:p.Leu221Val	72.0	0.0		42.0	2.0	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	hg19		.	.	.	.	.	.	.	.	.	.	G	19.87	3.907561	0.72868	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.14022	2.62;2.62;2.54	5.41	4.5	0.54988	.	0.000000	0.56097	D	0.000023	T	0.23249	0.0562	L	0.27053	0.805	0.47476	D	0.999432	D;D;P	0.69078	0.971;0.997;0.946	P;D;P	0.72625	0.835;0.978;0.808	T	0.01982	-1.1235	9	.	.	.	-12.1738	14.2439	0.65975	0.0739:0.0:0.9261:0.0	.	221;221;221	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	221	ENSP00000314038:L221V;ENSP00000363108:L221V;ENSP00000354504:L221V	.	L	-	1	2	ASTN2	119016812	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.130000	0.57964	1.250000	0.43966	0.655000	0.94253	CTG	.	.		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
CNTRL	11064	hgsc.bcm.edu	37	9	123937427	123937427	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:123937427A>G	ENST00000373855.1	+	43	7139	c.6879A>G	c.(6877-6879)gcA>gcG	p.A2293A	CNTRL_ENST00000238341.5_Silent_p.A2293A|CNTRL_ENST00000373850.1_Silent_p.A1741A|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	2293	Sufficient for interaction with HOOK2.				cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GCACCTCTGCAGATTCAGCGT	0.463																																					p.A2293A		Atlas-SNP	.											.	CNTRL	161	.	0			c.A6879G						.						117.0	108.0	111.0					9																	123937427		2203	4300	6503	SO:0001819	synonymous_variant	11064	exon41			CTCTGCAGATTCA	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.6879A>G	chr9.hg19:g.123937427A>G		109.0	0.0		79.0	4.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	ENST00000373855.1	hg19	CCDS35118.1																																																																																			.	.		0.463	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
RC3H2	54542	hgsc.bcm.edu	37	9	125613389	125613389	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:125613389T>C	ENST00000373670.1	-	19	3951	c.3351A>G	c.(3349-3351)aaA>aaG	p.K1117K	RC3H2_ENST00000357244.2_Silent_p.K1117K			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	1117					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						CTAAACTCTGTTTCTTCTGCT	0.388																																					p.K1117K		Atlas-SNP	.											.	RC3H2	150	.	0			c.A3351G						.						215.0	207.0	210.0					9																	125613389		1952	4149	6101	SO:0001819	synonymous_variant	54542	exon20			ACTCTGTTTCTTC	AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.3351A>G	chr9.hg19:g.125613389T>C		147.0	0.0		77.0	5.0	NM_001100588	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	ENST00000373670.1	hg19	CCDS43874.1	.	.	.	.	.	.	.	.	.	.	T	9.320	1.057854	0.19987	.	.	ENSG00000056586	ENST00000454740	.	.	.	5.89	3.58	0.41010	.	.	.	.	.	T	0.58308	0.2113	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51741	-0.8667	4	.	.	.	-27.7648	8.4184	0.32685	0.0:0.1514:0.0:0.8486	.	.	.	.	S	176	.	.	N	-	2	0	RC3H2	124653210	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.517000	0.45529	0.502000	0.28037	0.533000	0.62120	AAC	.	.		0.388	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053966.1	NM_018835	
ENG	2022	hgsc.bcm.edu	37	9	130588025	130588025	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:130588025G>A	ENST00000373203.4	-	5	1038	c.638C>T	c.(637-639)gCc>gTc	p.A213V	ENG_ENST00000480266.1_5'Flank|ENG_ENST00000344849.3_Missense_Mutation_p.A213V	NM_000118.2|NM_001114753.1|NM_001278138.1	NP_000109.1|NP_001108225.1|NP_001265067.1	P17813	EGLN_HUMAN	endoglin	213	Required for interaction with EGL.				artery morphogenesis (GO:0048844)|BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in endocardial cushion formation (GO:0003273)|cell motility (GO:0048870)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|chronological cell aging (GO:0001300)|detection of hypoxia (GO:0070483)|extracellular matrix constituent secretion (GO:0070278)|extracellular matrix disassembly (GO:0022617)|heart looping (GO:0001947)|intracellular signal transduction (GO:0035556)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|patterning of blood vessels (GO:0001569)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of gene expression (GO:0010628)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of systemic arterial blood pressure (GO:0003084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell adhesion (GO:0030155)|regulation of cell proliferation (GO:0042127)|regulation of phosphorylation (GO:0042325)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to corticosteroid (GO:0031960)|response to hypoxia (GO:0001666)|response to statin (GO:0036273)|response to transforming growth factor beta (GO:0071559)|smooth muscle tissue development (GO:0048745)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|wound healing (GO:0042060)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endothelial microparticle (GO:0072563)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	activin binding (GO:0048185)|galactose binding (GO:0005534)|glycosaminoglycan binding (GO:0005539)|protein homodimerization activity (GO:0042803)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane signaling receptor activity (GO:0004888)|type I transforming growth factor beta receptor binding (GO:0034713)|type II transforming growth factor beta receptor binding (GO:0005114)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	17						CTTGTGGCCGGCCACGCCTTC	0.697									Juvenile Polyposis;Hereditary Hemorrhagic Telangiectasia																												p.A213V		Atlas-SNP	.											.	ENG	44	.	0			c.C638T						.						10.0	12.0	11.0					9																	130588025		2172	4246	6418	SO:0001583	missense	2022	exon5	Familial Cancer Database	incl.: Juvenile Polyposis of the Stomach;HHT, Rendu-Osler-Weber disease, incl.: Pulmonary arteriovenous malformations, hypertrophic osteoarthropathy and juvenile polyposis,	TGGCCGGCCACGC	AF035753	CCDS6880.1, CCDS48029.1, CCDS75906.1	9q34.11	2014-09-17	2008-09-04		ENSG00000106991	ENSG00000106991		"""CD molecules"""	3349	protein-coding gene	gene with protein product		131195	"""Osler-Rendu-Weber syndrome 1"""	ORW1, ORW		8404038, 10548503	Standard	NM_001278138		Approved	END, HHT1, CD105	uc031tfe.1	P17813	OTTHUMG00000020723	ENST00000373203.4:c.638C>T	chr9.hg19:g.130588025G>A	ENSP00000362299:p.Ala213Val	26.0	0.0		24.0	4.0	NM_001114753	Q14248|Q14926|Q5T9C0	Missense_Mutation	SNP	ENST00000373203.4	hg19	CCDS48029.1	.	.	.	.	.	.	.	.	.	.	G	12.06	1.824379	0.32237	.	.	ENSG00000106991	ENST00000373203;ENST00000344849;ENST00000545345;ENST00000546301	T;T	0.43688	0.94;1.53	3.87	3.87	0.44632	.	1.021630	0.07794	N	0.955460	T	0.36524	0.0970	L	0.47716	1.5	0.09310	N	1	P;P	0.35077	0.483;0.483	B;B	0.30943	0.122;0.122	T	0.13602	-1.0503	10	0.31617	T	0.26	-1.9289	11.6549	0.51313	0.0:0.0:1.0:0.0	.	213;213	Q5T9B9;P17813	.;EGLN_HUMAN	V	213;213;213;31	ENSP00000362299:A213V;ENSP00000341917:A213V	ENSP00000341917:A213V	A	-	2	0	ENG	129627846	0.272000	0.24172	0.433000	0.26760	0.479000	0.33129	2.844000	0.48246	2.468000	0.83385	0.549000	0.68633	GCC	.	.		0.697	ENG-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054313.1		
PKN3	29941	hgsc.bcm.edu	37	9	131469012	131469012	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:131469012T>C	ENST00000291906.4	+	4	825	c.432T>C	c.(430-432)gcT>gcC	p.A144A		NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	144					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						TCCTGGCAGCTGCCCAGCAGA	0.657																																					p.A144A		Atlas-SNP	.											.	PKN3	62	.	0			c.T432C						.						10.0	12.0	11.0					9																	131469012		2191	4280	6471	SO:0001819	synonymous_variant	29941	exon4			GGCAGCTGCCCAG	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.432T>C	chr9.hg19:g.131469012T>C		57.0	0.0		54.0	5.0	NM_013355	Q9UM03	Silent	SNP	ENST00000291906.4	hg19	CCDS6908.1																																																																																			.	.		0.657	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
ADAMTS13	11093	hgsc.bcm.edu	37	9	136304502	136304502	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr9:136304502T>C	ENST00000371929.3	+	15	2165	c.1721T>C	c.(1720-1722)cTg>cCg	p.L574P	ADAMTS13_ENST00000356589.2_Missense_Mutation_p.L543P|ADAMTS13_ENST00000485925.1_3'UTR|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.L574P|ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.L246P	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	574	Spacer.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		GTCACATTTCTGACAGTTACC	0.507																																					p.L574P		Atlas-SNP	.											.	ADAMTS13	113	.	0			c.T1721C						.						159.0	135.0	143.0					9																	136304502		2203	4300	6503	SO:0001583	missense	11093	exon15			CATTTCTGACAGT	AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1721T>C	chr9.hg19:g.136304502T>C	ENSP00000360997:p.Leu574Pro	123.0	0.0		78.0	4.0	NM_139027	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	ENST00000371929.3	hg19	CCDS6970.1	.	.	.	.	.	.	.	.	.	.	T	14.35	2.510677	0.44660	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.70749	-0.5;-0.51;-0.48;-0.05	5.13	5.13	0.70059	.	.	.	.	.	D	0.84915	0.5578	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	D	0.87145	0.2205	9	0.62326	D	0.03	.	13.7749	0.63048	0.0:0.0:0.0:1.0	.	574;543;574;246	Q76LX8;Q76LX8-3;Q76LX8-2;Q9UGQ1	ATS13_HUMAN;.;.;.	P	574;574;543;246	ENSP00000360997:L574P;ENSP00000347927:L574P;ENSP00000348997:L543P;ENSP00000444504:L246P	ENSP00000347927:L574P	L	+	2	0	ADAMTS13	135294323	1.000000	0.71417	0.948000	0.38648	0.130000	0.20726	6.680000	0.74518	1.928000	0.55862	0.379000	0.24179	CTG	.	.		0.507	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000054920.1	NM_139025	
GATA3	2625	hgsc.bcm.edu	37	10	8115947	8115947	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:8115947A>G	ENST00000346208.3	+	6	1748	c.1293A>G	c.(1291-1293)ggA>ggG	p.G431G	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Silent_p.G432G			P23771	GATA3_HUMAN	GATA binding protein 3	431					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P433fs*>13(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TGTCCTTTGGACCACACCACC	0.637			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.G432G		Atlas-SNP	.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3	182	.	1	Insertion - Frameshift(1)	breast(1)	c.A1296G						.						91.0	76.0	81.0					10																	8115947		2203	4300	6503	SO:0001819	synonymous_variant	2625	exon6			CTTTGGACCACAC	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1293A>G	chr10.hg19:g.8115947A>G		69.0	0.0		104.0	6.0	NM_001002295	Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	hg19	CCDS7083.1																																																																																			.	.		0.637	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
PHYH	5264	hgsc.bcm.edu	37	10	13333891	13333891	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:13333891A>G	ENST00000263038.4	-	5	494	c.436T>C	c.(436-438)Ttc>Ctc	p.F146L	PHYH_ENST00000396920.3_Missense_Mutation_p.F127L|PHYH_ENST00000396913.2_Missense_Mutation_p.F46L	NM_006214.3	NP_006205.1	O14832	PAHX_HUMAN	phytanoyl-CoA 2-hydroxylase	146					cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|isoprenoid metabolic process (GO:0006720)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|electron carrier activity (GO:0009055)|L-ascorbic acid binding (GO:0031418)|metal ion binding (GO:0046872)|phytanoyl-CoA dioxygenase activity (GO:0048244)			NS(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)	25		Ovarian(717;0.0448)			Antihemophilic Factor(DB00025)|Vitamin C(DB00126)	GGTCCAGTGAAGCACTCCACA	0.338																																					p.F146L		Atlas-SNP	.											.	PHYH	50	.	0			c.T436C						.						95.0	91.0	93.0					10																	13333891		2203	4300	6503	SO:0001583	missense	5264	exon5			CAGTGAAGCACTC		CCDS7097.1, CCDS41489.1	10p13	2010-04-27	2006-01-09		ENSG00000107537	ENSG00000107537	1.14.11.18		8940	protein-coding gene	gene with protein product	"""Refsum disease"", ""phytanoyl-CoA dioxygenase"""	602026	"""phytanoyl-CoA hydroxylase (Refsum disease)"", ""phytanoyl-CoA hydroxylase"""			9326939	Standard	XM_005252469		Approved	PAHX, RD, PHYH1	uc001imf.3	O14832	OTTHUMG00000017693	ENST00000263038.4:c.436T>C	chr10.hg19:g.13333891A>G	ENSP00000263038:p.Phe146Leu	44.0	0.0		63.0	4.0	NM_006214	A8MTS8|B1ALH5	Missense_Mutation	SNP	ENST00000263038.4	hg19	CCDS7097.1	.	.	.	.	.	.	.	.	.	.	A	17.16	3.319038	0.60524	.	.	ENSG00000107537	ENST00000396913;ENST00000263038;ENST00000396920;ENST00000453759;ENST00000479604	D;D;D;D;D	0.85955	-2.05;-2.05;-2.05;-2.05;-2.05	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.88097	0.6345	L	0.53561	1.675	0.80722	D	1	B;B	0.31581	0.175;0.329	B;P	0.51297	0.162;0.665	D	0.84332	0.0522	10	0.23891	T	0.37	-27.393	11.3912	0.49815	0.8647:0.0:0.0:0.1353	.	127;146	B1ALH6;O14832	.;PAHX_HUMAN	L	46;146;127;46;146	ENSP00000380121:F46L;ENSP00000263038:F146L;ENSP00000380126:F127L;ENSP00000412525:F46L;ENSP00000420117:F146L	ENSP00000263038:F146L	F	-	1	0	PHYH	13373897	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.182000	0.77689	2.145000	0.66743	0.533000	0.62120	TTC	.	.		0.338	PHYH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046845.2		
SKIDA1	387640	hgsc.bcm.edu	37	10	21806681	21806681	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:21806681T>C	ENST00000449193.2	-	4	2323	c.71A>G	c.(70-72)aAg>aGg	p.K24R	SKIDA1_ENST00000444772.3_Missense_Mutation_p.K24R|SKIDA1_ENST00000487107.1_5'Flank	NM_207371.3	NP_997254.3	Q1XH10	SKDA1_HUMAN	SKI/DACH domain containing 1	24						nucleus (GO:0005634)											AAACATTTGCTTCCCTTTAAT	0.507																																					p.K24R		Atlas-SNP	.											.	.	.	.	0			c.A71G						.						51.0	52.0	52.0					10																	21806681		2001	4162	6163	SO:0001583	missense	387640	exon4			ATTTGCTTCCCTT	AK131456	CCDS44363.1	10p12.31	2012-06-13	2012-06-13	2012-06-13	ENSG00000180592	ENSG00000180592			32697	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 140"""	C10orf140			Standard	NM_207371		Approved	FLJ45187	uc021pnx.1	Q1XH10	OTTHUMG00000017797	ENST00000449193.2:c.71A>G	chr10.hg19:g.21806681T>C	ENSP00000410041:p.Lys24Arg	90.0	0.0		148.0	6.0	NM_207371	B1ANA5|Q6ZMX4|Q8N3C3	Missense_Mutation	SNP	ENST00000449193.2	hg19	CCDS44363.1	.	.	.	.	.	.	.	.	.	.	T	13.80	2.346497	0.41599	.	.	ENSG00000180592	ENST00000449193;ENST00000444772	D;D	0.82344	-1.6;-1.6	4.9	4.9	0.64082	DNA binding domain, putative (1);Transforming protein Ski (2);	0.135854	0.49916	D	0.000139	D	0.84270	0.5435	N	0.19112	0.55	0.39975	D	0.974847	D;D	0.76494	0.995;0.999	D;D	0.74674	0.926;0.984	D	0.87308	0.2310	10	0.66056	D	0.02	.	14.5119	0.67794	0.0:0.0:0.0:1.0	.	24;24	Q1XH10;E9PAX1	DLN1_HUMAN;.	R	24	ENSP00000410041:K24R;ENSP00000442432:K24R	ENSP00000442432:K24R	K	-	2	0	C10orf140	21846687	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.929000	0.63455	1.834000	0.53371	0.254000	0.18369	AAG	.	.		0.507	SKIDA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286950.2	NM_207371	
PCDH15	65217	hgsc.bcm.edu	37	10	55945028	55945028	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:55945028T>C	ENST00000320301.6	-	12	1700	c.1306A>G	c.(1306-1308)Aca>Gca	p.T436A	PCDH15_ENST00000437009.1_Splice_Site_p.T436A|PCDH15_ENST00000395438.1_Splice_Site_p.T436A|PCDH15_ENST00000395446.1_Splice_Site_p.T436A|PCDH15_ENST00000395430.1_Splice_Site_p.T436A|PCDH15_ENST00000373965.2_Splice_Site_p.T443A|PCDH15_ENST00000395432.2_Splice_Site_p.T399A|PCDH15_ENST00000373955.1_Splice_Site_p.T436A|PCDH15_ENST00000395445.1_Splice_Site_p.T443A|PCDH15_ENST00000409834.1_Splice_Site_p.T47A|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395433.1_Splice_Site_p.T414A|PCDH15_ENST00000361849.3_Splice_Site_p.T436A|PCDH15_ENST00000414778.1_Splice_Site_p.T441A|PCDH15_ENST00000373957.3_Splice_Site_p.T414A|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	436	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				GGGTCTTTTGTCTTTGAAAAA	0.358										HNSCC(58;0.16)																											p.T441A		Atlas-SNP	.											PCDH15_ENST00000417177,colon,carcinoma,0,4	PCDH15	1715	.	0			c.A1321G						.						101.0	99.0	100.0					10																	55945028		2203	4300	6503	SO:0001630	splice_region_variant	65217	exon13			CTTTTGTCTTTGA	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.1306-1A>G	chr10.hg19:g.55945028T>C		130.0	0.0		72.0	3.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	hg19	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940979	0.52972	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000409834;ENST00000395445;ENST00000395446;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.60424	0.19;0.75;0.75;0.78;0.19;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75;0.75	5.29	5.29	0.74685	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.72661	0.3488	M	0.63843	1.955	0.45648	D	0.998579	D;D;D;P;D;D;D;D;D;D;D;D;P;D;D	0.76494	0.997;0.999;0.985;0.592;0.996;0.999;0.997;0.992;0.982;0.993;0.999;0.992;0.815;0.994;0.999	D;D;D;P;D;D;D;D;P;P;D;D;P;P;D	0.76575	0.981;0.988;0.959;0.672;0.973;0.988;0.981;0.962;0.898;0.898;0.988;0.962;0.674;0.897;0.988	T	0.74748	-0.3560	9	0.56958	D	0.05	.	14.4908	0.67649	0.0:0.0:0.0:1.0	.	414;436;436;441;436;399;436;436;443;443;436;441;436;414;436	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	A	443;441;436;436;47;443;436;399;436;414;414;436;436;441;436;436	ENSP00000363076:T443A;ENSP00000410304:T441A;ENSP00000378826:T436A;ENSP00000386693:T47A;ENSP00000378832:T443A;ENSP00000378833:T436A;ENSP00000378820:T399A;ENSP00000354950:T436A;ENSP00000378821:T414A;ENSP00000363068:T414A;ENSP00000322604:T436A;ENSP00000378818:T436A;ENSP00000412628:T436A;ENSP00000363066:T436A	ENSP00000322604:T436A	T	-	1	0	PCDH15	55615034	1.000000	0.71417	0.998000	0.56505	0.828000	0.46876	5.664000	0.68045	2.131000	0.65755	0.482000	0.46254	ACA	.	.		0.358	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	Missense_Mutation
PCDH15	65217	hgsc.bcm.edu	37	10	56288150	56288150	+	Intron	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:56288150T>C	ENST00000320301.6	-	3	486				PCDH15_ENST00000437009.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000395430.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395432.2_Intron|PCDH15_ENST00000373955.1_Intron|RP11-257I14.1_ENST00000422842.1_RNA|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395433.1_Intron|PCDH15_ENST00000361849.3_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395442.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15						equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CATCTTACCCTCATATTGCCA	0.318										HNSCC(58;0.16)																											p.E35G		Atlas-SNP	.											.	PCDH15	1715	.	0			c.A104G						.						142.0	133.0	136.0					10																	56288150		1567	3580	5147	SO:0001627	intron_variant	65217	exon3			TTACCCTCATATT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.92-513A>G	chr10.hg19:g.56288150T>C		91.0	0.0		73.0	4.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	ENST00000320301.6	hg19	CCDS7248.1																																																																																			.	.		0.318	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
CCDC6	8030	hgsc.bcm.edu	37	10	61612353	61612353	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:61612353T>C	ENST00000263102.6	-	2	642	c.411A>G	c.(409-411)gaA>gaG	p.E137E		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	137	5 X 29 AA tandem repeats.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GGAATTCTTCTTCTTTCTCAT	0.373			T	RET	NSCLC																																p.E137E		Atlas-SNP	.		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	.	CCDC6	44	.	0			c.A411G						.						118.0	122.0	120.0					10																	61612353		2203	4300	6503	SO:0001819	synonymous_variant	8030	exon2			TTCTTCTTCTTTC	S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.411A>G	chr10.hg19:g.61612353T>C		128.0	0.0		84.0	4.0	NM_005436	Q15250|Q6GSG7	Silent	SNP	ENST00000263102.6	hg19	CCDS7257.1																																																																																			.	.		0.373	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048176.2	NM_005436	
ANK3	288	hgsc.bcm.edu	37	10	61843261	61843261	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:61843261A>G	ENST00000280772.2	-	33	4380	c.4189T>C	c.(4189-4191)Ttt>Ctt	p.F1397L	ANK3_ENST00000373827.2_Missense_Mutation_p.F1391L|Y_RNA_ENST00000365320.1_RNA|ANK3_ENST00000503366.1_Missense_Mutation_p.F1398L|ANK3_ENST00000355288.2_Missense_Mutation_p.F531L	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	1397	UPA domain. {ECO:0000250}.				axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						TTGATGGAAAATGGCAGTCTA	0.289																																					p.F1398L		Atlas-SNP	.											.	ANK3	703	.	0			c.T4192C						.						44.0	47.0	46.0					10																	61843261		2202	4294	6496	SO:0001583	missense	288	exon34			TGGAAAATGGCAG	U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.4189T>C	chr10.hg19:g.61843261A>G	ENSP00000280772:p.Phe1397Leu	88.0	0.0		59.0	4.0	NM_001204404	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	ENST00000280772.2	hg19	CCDS7258.1	.	.	.	.	.	.	.	.	.	.	A	15.75	2.924684	0.52653	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817;ENST00000395293;ENST00000395304;ENST00000544789	T;T;T;T	0.23147	1.92;1.92;1.92;1.92	5.9	5.9	0.94986	.	0.000000	0.40222	N	0.001149	T	0.41604	0.1166	L	0.55103	1.725	0.80722	D	1	B;D;B;D;B;P	0.69078	0.001;0.989;0.007;0.997;0.024;0.956	B;D;B;D;B;D	0.72338	0.004;0.977;0.011;0.97;0.029;0.931	T	0.26849	-1.0091	10	0.02654	T	1	.	16.3322	0.83039	1.0:0.0:0.0:0.0	.	1398;531;1391;1397;632;531	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2	.;.;.;ANK3_HUMAN;.;.	L	1397;1391;531;531;1398;1377;632;1032;1032;530	ENSP00000280772:F1397L;ENSP00000362933:F1391L;ENSP00000347436:F531L;ENSP00000425236:F1398L	ENSP00000280772:F1397L	F	-	1	0	ANK3	61513267	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.511000	0.81718	2.251000	0.74343	0.528000	0.53228	TTT	.	.		0.289	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048201.4	NM_020987	
CCAR1	55749	hgsc.bcm.edu	37	10	70515291	70515291	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:70515291A>G	ENST00000265872.6	+	13	1742	c.1623A>G	c.(1621-1623)caA>caG	p.Q541Q	SNORD98_ENST00000408255.1_RNA|CCAR1_ENST00000483264.1_3'UTR|CCAR1_ENST00000543719.1_Silent_p.Q526Q|CCAR1_ENST00000535016.1_Silent_p.Q526Q	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	541					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						TGTGCACACAATGGTAAGTAC	0.398																																					p.Q541Q		Atlas-SNP	.											.	CCAR1	118	.	0			c.A1623G						.						191.0	184.0	187.0					10																	70515291		2203	4300	6503	SO:0001819	synonymous_variant	55749	exon13			CACACAATGGTAA	AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.1623A>G	chr10.hg19:g.70515291A>G		160.0	0.0		95.0	4.0	NM_018237	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Silent	SNP	ENST00000265872.6	hg19	CCDS7282.1																																																																																			.	.		0.398	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048356.2	NM_018237	
STOX1	219736	hgsc.bcm.edu	37	10	70641820	70641820	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:70641820A>G	ENST00000298596.6	+	2	500	c.417A>G	c.(415-417)gtA>gtG	p.V139V	STOX1_ENST00000421961.2_Silent_p.V29V|STOX1_ENST00000399169.4_Silent_p.V139V|STOX1_ENST00000399162.2_Silent_p.V139V|STOX1_ENST00000399165.4_Silent_p.V139V	NM_152709.4	NP_689922.3	Q6ZVD7	STOX1_HUMAN	storkhead box 1	139						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(2)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|prostate(1)|skin(3)	28						CTCAGATTGTAGTAACGCAGG	0.363																																					p.V139V		Atlas-SNP	.											.	STOX1	75	.	0			c.A417G						.						161.0	144.0	149.0					10																	70641820		1850	4093	5943	SO:0001819	synonymous_variant	219736	exon2			GATTGTAGTAACG	AK057891	CCDS41535.1, CCDS44416.1, CCDS44417.1	10q22.1	2005-11-29	2005-04-04	2005-04-04	ENSG00000165730	ENSG00000165730			23508	protein-coding gene	gene with protein product		609397	"""chromosome 10 open reading frame 24"""	C10orf24			Standard	NM_152709		Approved	FLJ25162	uc001joq.3	Q6ZVD7	OTTHUMG00000018367	ENST00000298596.6:c.417A>G	chr10.hg19:g.70641820A>G		161.0	0.0		85.0	4.0	NM_001130160	A2A3Q9|A5D6Y7|B0QZA4|B0QZA5|B0QZA6|Q4F8Q6|Q5I946|Q5I947|Q5I948|Q5VX38|Q5VX39|Q6ZRY3|Q96LR3|Q96LS0	Silent	SNP	ENST00000298596.6	hg19	CCDS41535.1																																																																																			.	.		0.363	STOX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276849.3	NM_152709	
HKDC1	80201	hgsc.bcm.edu	37	10	71025391	71025391	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:71025391T>C	ENST00000354624.5	+	17	2556	c.2423T>C	c.(2422-2424)cTg>cCg	p.L808P	RP11-227H15.5_ENST00000413220.1_RNA	NM_025130.3	NP_079406	Q2TB90	HKDC1_HUMAN	hexokinase domain containing 1	808	Hexokinase type-2 2.				carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)	cytosol (GO:0005829)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|mannokinase activity (GO:0019158)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						CAGCTGGGCCTGGACAGCACG	0.667																																					p.L808P		Atlas-SNP	.											.	HKDC1	98	.	0			c.T2423C						.						66.0	63.0	64.0					10																	71025391		2203	4299	6502	SO:0001583	missense	80201	exon17			TGGGCCTGGACAG		CCDS7288.1	10q22.1	2006-10-24			ENSG00000156510	ENSG00000156510			23302	protein-coding gene	gene with protein product						12477932	Standard	NM_025130		Approved	FLJ37767, FLJ22761	uc001jpf.4	Q2TB90	OTTHUMG00000018371	ENST00000354624.5:c.2423T>C	chr10.hg19:g.71025391T>C	ENSP00000346643:p.Leu808Pro	76.0	0.0		88.0	27.0	NM_025130	B5MDN9|Q2TB91|Q5VTC7|Q7Z373|Q8WU37|Q96EH2|Q9H5Y9	Missense_Mutation	SNP	ENST00000354624.5	hg19	CCDS7288.1	.	.	.	.	.	.	.	.	.	.	T	23.6	4.438870	0.83885	.	.	ENSG00000156510	ENST00000354624	D	0.97455	-4.39	4.76	4.76	0.60689	Hexokinase, C-terminal (1);	0.000000	0.64402	D	0.000001	D	0.98960	0.9646	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99395	1.0926	10	0.87932	D	0	-13.8423	14.7247	0.69336	0.0:0.0:0.0:1.0	.	808	Q2TB90	HKDC1_HUMAN	P	808	ENSP00000346643:L808P	ENSP00000346643:L808P	L	+	2	0	HKDC1	70695397	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.868000	0.87116	2.121000	0.65114	0.460000	0.39030	CTG	.	.		0.667	HKDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048389.1	NM_025130	
PALD1	27143	hgsc.bcm.edu	37	10	72292498	72292498	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:72292498A>G	ENST00000263563.6	+	6	1023	c.755A>G	c.(754-756)gAg>gGg	p.E252G		NM_014431.2	NP_055246.2	Q9ULE6	PALD_HUMAN	phosphatase domain containing, paladin 1	252						cytosol (GO:0005829)											GTGACGGAGGAGGTGTACAAG	0.622																																					p.E252G		Atlas-SNP	.											.	.	.	.	0			c.A755G						.						182.0	155.0	164.0					10																	72292498		2203	4300	6503	SO:0001583	missense	27143	exon6			CGGAGGAGGTGTA	AB033100	CCDS31215.1	10q22.2	2012-07-17	2012-07-17	2012-07-17	ENSG00000107719	ENSG00000107719			23530	protein-coding gene	gene with protein product		614656	"""paladin"", ""KIAA1274"""	PALD, KIAA1274			Standard	NM_014431		Approved		uc001jrd.4	Q9ULE6	OTTHUMG00000018411	ENST00000263563.6:c.755A>G	chr10.hg19:g.72292498A>G	ENSP00000263563:p.Glu252Gly	94.0	0.0		79.0	4.0	NM_014431	B2RMS1|B9EGC6|Q5JTK7|Q5JTK8	Missense_Mutation	SNP	ENST00000263563.6	hg19	CCDS31215.1	.	.	.	.	.	.	.	.	.	.	A	15.59	2.877638	0.51801	.	.	ENSG00000107719	ENST00000263563;ENST00000373214	T	0.35789	1.29	5.34	4.21	0.49690	.	0.048651	0.85682	N	0.000000	T	0.47673	0.1458	M	0.86178	2.8	0.80722	D	1	P	0.36633	0.562	B	0.41412	0.356	T	0.53005	-0.8499	10	0.87932	D	0	-23.5125	11.0369	0.47806	0.9261:0.0:0.0739:0.0	.	252	Q9ULE6	PALD_HUMAN	G	252	ENSP00000263563:E252G	ENSP00000263563:E252G	E	+	2	0	KIAA1274	71962504	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	7.291000	0.78721	0.977000	0.38444	0.459000	0.35465	GAG	.	.		0.622	PALD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048515.2	NM_014431	
KAT6B	23522	hgsc.bcm.edu	37	10	76735857	76735857	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:76735857T>C	ENST00000287239.4	+	8	2251	c.1762T>C	c.(1762-1764)Ttt>Ctt	p.F588L	KAT6B_ENST00000372711.1_Intron|KAT6B_ENST00000372714.1_Intron|KAT6B_ENST00000372725.1_Intron|KAT6B_ENST00000372724.1_Intron	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	588	Negatively regulates HAT activity.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AGCCCACTTCTTTGGCAAAAG	0.443																																					p.F588L		Atlas-SNP	.											.	.	.	.	0			c.T1762C						.						88.0	86.0	86.0					10																	76735857		2203	4300	6503	SO:0001583	missense	23522	exon8			CACTTCTTTGGCA	AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.1762T>C	chr10.hg19:g.76735857T>C	ENSP00000287239:p.Phe588Leu	86.0	0.0		64.0	4.0	NM_012330	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Missense_Mutation	SNP	ENST00000287239.4	hg19	CCDS7345.1	.	.	.	.	.	.	.	.	.	.	T	8.894	0.954625	0.18431	.	.	ENSG00000156650	ENST00000287239	T	0.75367	-0.93	6.08	6.08	0.98989	.	0.305290	0.23682	N	0.045608	T	0.55433	0.1920	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.53287	-0.8460	9	.	.	.	-9.6649	15.214	0.73250	0.0:0.0:0.0:1.0	.	588	Q8WYB5	KAT6B_HUMAN	L	588	ENSP00000287239:F588L	.	F	+	1	0	KAT6B	76405863	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.426000	0.52778	2.330000	0.79161	0.533000	0.62120	TTT	.	.		0.443	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048771.1	NM_012330	
KCNMA1	3778	hgsc.bcm.edu	37	10	78669796	78669796	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:78669796T>C	ENST00000286628.8	-	25	3074	c.3075A>G	c.(3073-3075)gaA>gaG	p.E1025E	RP11-443A13.5_ENST00000458661.2_RNA|KCNMA1_ENST00000372443.1_Silent_p.E994E|KCNMA1_ENST00000406533.3_Silent_p.E1029E|KCNMA1_ENST00000404771.3_Silent_p.E1025E|RP11-443A13.5_ENST00000426234.1_RNA|KCNMA1_ENST00000354353.5_Silent_p.E1028E|RP11-443A13.5_ENST00000600782.1_RNA|KCNMA1_ENST00000286627.5_Silent_p.E967E|KCNMA1_ENST00000372440.1_Silent_p.E967E|KCNMA1_ENST00000404857.1_Silent_p.E1008E	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	1025					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)	p.E967E(1)		breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	TGAGGTACAGTTCTGTATCAG	0.473																																					p.E1025E		Atlas-SNP	.											KCNMA1_ENST00000406533,bladder,carcinoma,-2,1	KCNMA1	370	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.A3075G						.						169.0	124.0	139.0					10																	78669796		2203	4300	6503	SO:0001819	synonymous_variant	3778	exon25			GTACAGTTCTGTA	U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.3075A>G	chr10.hg19:g.78669796T>C		61.0	0.0		39.0	4.0	NM_001161352	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Silent	SNP	ENST00000286628.8	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.367|9.367	1.069505|1.069505	0.20147|0.20147	.|.	.|.	ENSG00000156113|ENSG00000156113	ENST00000372403|ENST00000372421;ENST00000434208	.|.	.|.	.|.	5.97|5.97	3.63|3.63	0.41609|0.41609	.|.	.|.	.|.	.|.	.|.	T|T	0.58366|0.58366	0.2117|0.2117	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.51841|0.51841	-0.8654|-0.8654	4|4	.|.	.|.	.|.	-13.6099|-13.6099	8.4362|8.4362	0.32789|0.32789	0.0:0.2154:0.0:0.7846|0.0:0.2154:0.0:0.7846	.|.	.|.	.|.	.|.	S|A	918|956;675	.|.	.|.	N|T	-|-	2|1	0|0	KCNMA1|KCNMA1	78339802|78339802	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.918000|0.918000	0.54935|0.54935	1.620000|1.620000	0.36976|0.36976	0.505000|0.505000	0.28104|0.28104	0.533000|0.533000	0.62120|0.62120	AAC|ACT	.	.		0.473	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000048885.3	NM_002247	
KIF20B	9585	hgsc.bcm.edu	37	10	91484863	91484863	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:91484863A>G	ENST00000371728.3	+	15	2014	c.1949A>G	c.(1948-1950)gAc>gGc	p.D650G	KIF20B_ENST00000416354.1_Missense_Mutation_p.D650G|KIF20B_ENST00000260753.4_Missense_Mutation_p.D650G|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Missense_Mutation_p.D650G	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	650					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GGTAAATGTGACACTCGAGAA	0.368																																					p.D650G		Atlas-SNP	.											.	KIF20B	191	.	0			c.A1949G						.						133.0	130.0	131.0					10																	91484863		2203	4300	6503	SO:0001583	missense	9585	exon15			AATGTGACACTCG	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.1949A>G	chr10.hg19:g.91484863A>G	ENSP00000360793:p.Asp650Gly	104.0	0.0		74.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	A	9.689	1.151343	0.21371	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.18174	2.23;2.23;2.23;2.23	5.49	3.2	0.36748	.	0.251074	0.28166	N	0.016359	T	0.11750	0.0286	L	0.60455	1.87	0.09310	N	1	P;B	0.39665	0.682;0.004	B;B	0.30401	0.115;0.006	T	0.18681	-1.0329	10	0.22706	T	0.39	-2.1015	4.6081	0.12387	0.5526:0.276:0.1714:0.0	.	650;650	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	G	650	ENSP00000260753:D650G;ENSP00000411545:D650G;ENSP00000377830:D650G;ENSP00000360793:D650G	ENSP00000260753:D650G	D	+	2	0	KIF20B	91474843	0.894000	0.30519	0.636000	0.29352	0.711000	0.40976	1.835000	0.39181	0.906000	0.36621	-0.250000	0.11733	GAC	.	.		0.368	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
IDE	3416	hgsc.bcm.edu	37	10	94268589	94268589	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:94268589A>G	ENST00000265986.6	-	7	1012	c.956T>C	c.(955-957)aTa>aCa	p.I319T		NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	319					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	AAGGTCAGGTATGGGAAATGT	0.368																																					p.I319T		Atlas-SNP	.											.	IDE	77	.	0			c.T956C						.						152.0	153.0	153.0					10																	94268589		2203	4300	6503	SO:0001583	missense	3416	exon7			TCAGGTATGGGAA	M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.956T>C	chr10.hg19:g.94268589A>G	ENSP00000265986:p.Ile319Thr	105.0	0.0		85.0	4.0	NM_004969	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	ENST00000265986.6	hg19	CCDS7421.1	.	.	.	.	.	.	.	.	.	.	A	17.47	3.396905	0.62177	.	.	ENSG00000119912	ENST00000265986	T	0.06933	3.24	5.28	5.28	0.74379	Peptidase M16, C-terminal (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.000000	0.85682	D	0.000000	T	0.23766	0.0575	L	0.46885	1.475	0.80722	D	1	P	0.37233	0.588	P	0.62089	0.898	T	0.01192	-1.1423	10	0.34782	T	0.22	-16.0308	15.5041	0.75725	1.0:0.0:0.0:0.0	.	319	P14735	IDE_HUMAN	T	319	ENSP00000265986:I319T	ENSP00000265986:I319T	I	-	2	0	IDE	94258569	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	2.131000	0.65755	0.455000	0.32223	ATA	.	.		0.368	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049393.1	NM_004969	
MYOF	26509	hgsc.bcm.edu	37	10	95109578	95109578	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:95109578A>G	ENST00000359263.4	-	36	4069	c.4070T>C	c.(4069-4071)cTc>cCc	p.L1357P	MYOF_ENST00000371501.4_Missense_Mutation_p.L1357P|MYOF_ENST00000371502.4_Missense_Mutation_p.L1357P|MYOF_ENST00000358334.5_Missense_Mutation_p.L1344P	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1357					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTTCATGAAGAGAACAGAACT	0.443																																					p.L1357P		Atlas-SNP	.											.	MYOF	177	.	0			c.T4070C						.						103.0	102.0	102.0					10																	95109578		1910	4127	6037	SO:0001583	missense	26509	exon36			ATGAAGAGAACAG	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4070T>C	chr10.hg19:g.95109578A>G	ENSP00000352208:p.Leu1357Pro	147.0	0.0		83.0	4.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	hg19	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.268520	0.80469	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32	5.53	5.53	0.82687	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.85435	0.5696	M	0.90977	3.165	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.88899	0.3351	10	0.87932	D	0	-16.8222	15.6595	0.77174	1.0:0.0:0.0:0.0	.	1344;1357	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	P	1344;1357;1357;1357	ENSP00000351094:L1344P;ENSP00000352208:L1357P;ENSP00000360556:L1357P;ENSP00000360557:L1357P	ENSP00000351094:L1344P	L	-	2	0	MYOF	95099568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.273000	0.95719	2.102000	0.63906	0.459000	0.35465	CTC	.	.		0.443	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
R3HCC1L	27291	hgsc.bcm.edu	37	10	99991351	99991351	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:99991351T>C	ENST00000298999.3	+	6	2171	c.1868T>C	c.(1867-1869)cTc>cCc	p.L623P	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.L623P|R3HCC1L_ENST00000370586.2_Missense_Mutation_p.L29P|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.L39P	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	637							nucleotide binding (GO:0000166)										GATATTGACCTCAGTGATTGT	0.398																																					p.L637P		Atlas-SNP	.											.	R3HCC1L	3	.	0			c.T1910C						.						127.0	119.0	122.0					10																	99991351		2203	4300	6503	SO:0001583	missense	27291	exon7			TTGACCTCAGTGA	AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.1868T>C	chr10.hg19:g.99991351T>C	ENSP00000298999:p.Leu623Pro	124.0	0.0		75.0	5.0	NM_001256619	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	ENST00000298999.3	hg19	CCDS31267.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341703	0.81911	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.34275	1.37;1.37;1.37;1.37	5.83	5.83	0.93111	.	0.065933	0.64402	D	0.000014	T	0.61375	0.2342	M	0.77820	2.39	0.80722	D	1	P;D;P	0.89917	0.937;1.0;0.708	P;D;B	0.80764	0.735;0.994;0.383	T	0.63625	-0.6595	9	.	.	.	-5.5482	15.1559	0.72743	0.0:0.0:0.0:1.0	.	29;637;623	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	P	623;623;29;39;30	ENSP00000359616:L623P;ENSP00000298999:L623P;ENSP00000359618:L29P;ENSP00000314018:L39P	.	L	+	2	0	C10orf28	99981341	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.328000	0.72915	2.214000	0.71695	0.533000	0.62120	CTC	.	.		0.398	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049764.1	NM_014472	
CFAP58	159686	hgsc.bcm.edu	37	10	106128250	106128250	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:106128250A>G	ENST00000369704.3	+	6	996	c.862A>G	c.(862-864)Aat>Gat	p.N288D	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		288						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		TCAGCAAGAGAATGAACAGCA	0.438																																					p.N288D		Atlas-SNP	.											.	CCDC147	137	.	0			c.A862G						.						118.0	106.0	110.0					10																	106128250		2203	4300	6503	SO:0001583	missense	159686	exon6			CAAGAGAATGAAC																												ENST00000369704.3:c.862A>G	chr10.hg19:g.106128250A>G	ENSP00000358718:p.Asn288Asp	80.0	0.0		73.0	4.0	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	hg19	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710926	0.30322	.	.	ENSG00000120051	ENST00000369704	T	0.33438	1.41	6.17	6.17	0.99709	.	0.284681	0.44285	D	0.000468	T	0.34077	0.0885	L	0.51422	1.61	0.80722	D	1	B	0.33583	0.418	B	0.35655	0.207	T	0.06698	-1.0812	10	0.49607	T	0.09	-28.6057	16.8222	0.85835	1.0:0.0:0.0:0.0	.	288	Q5T655	CC147_HUMAN	D	288	ENSP00000358718:N288D	ENSP00000358718:N288D	N	+	1	0	CCDC147	106118240	1.000000	0.71417	0.998000	0.56505	0.468000	0.32798	4.953000	0.63624	2.371000	0.80710	0.533000	0.62120	AAT	.	.		0.438	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
CFAP58	159686	hgsc.bcm.edu	37	10	106160619	106160619	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:106160619A>G	ENST00000369704.3	+	13	2131	c.1997A>G	c.(1996-1998)aAg>aGg	p.K666R	snoU13_ENST00000458914.1_RNA	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		666						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		CGCCGGGAAAAGGGGATTCTT	0.478																																					p.K666R		Atlas-SNP	.											.	CCDC147	137	.	0			c.A1997G						.						73.0	79.0	77.0					10																	106160619		2203	4300	6503	SO:0001583	missense	159686	exon13			GGGAAAAGGGGAT																												ENST00000369704.3:c.1997A>G	chr10.hg19:g.106160619A>G	ENSP00000358718:p.Lys666Arg	80.0	0.0		87.0	4.0	NM_001008723	D3DRA6|Q8NA27	Missense_Mutation	SNP	ENST00000369704.3	hg19	CCDS31282.1	.	.	.	.	.	.	.	.	.	.	A	14.13	2.444759	0.43429	.	.	ENSG00000120051	ENST00000369704	T	0.52754	0.65	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.37732	0.1014	L	0.38175	1.15	0.80722	D	1	B	0.30709	0.291	B	0.29267	0.1	T	0.19095	-1.0316	10	0.10902	T	0.67	-33.0534	16.2813	0.82687	1.0:0.0:0.0:0.0	.	666	Q5T655	CC147_HUMAN	R	666	ENSP00000358718:K666R	ENSP00000358718:K666R	K	+	2	0	CCDC147	106150609	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.244000	0.73946	0.533000	0.62120	AAG	.	.		0.478	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050216.1		
SHOC2	8036	hgsc.bcm.edu	37	10	112771425	112771425	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:112771425T>C	ENST00000369452.4	+	9	1943	c.1598T>C	c.(1597-1599)cTt>cCt	p.L533P	SHOC2_ENST00000265277.5_Missense_Mutation_p.L487P|SHOC2_ENST00000489390.1_3'UTR	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	533					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		CTGCATAGCCTTCCCTTTGAG	0.413																																					p.L533P		Atlas-SNP	.											.	SHOC2	49	.	0			c.T1598C						.						124.0	121.0	122.0					10																	112771425		2203	4300	6503	SO:0001583	missense	8036	exon9			ATAGCCTTCCCTT	AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.1598T>C	chr10.hg19:g.112771425T>C	ENSP00000358464:p.Leu533Pro	99.0	0.0		82.0	4.0	NM_007373	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	ENST00000369452.4	hg19	CCDS7568.1	.	.	.	.	.	.	.	.	.	.	T	25.9	4.686051	0.88639	.	.	ENSG00000108061	ENST00000265277;ENST00000369452;ENST00000451838	T;T;D	0.86432	1.34;1.34;-2.12	5.42	5.42	0.78866	.	0.056560	0.64402	N	0.000001	D	0.96380	0.8819	H	0.98738	4.315	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.97110	0.991;1.0	D	0.98152	1.0442	10	0.87932	D	0	.	15.4447	0.75220	0.0:0.0:0.0:1.0	.	487;533	Q9UQ13-2;Q9UQ13	.;SHOC2_HUMAN	P	487;533;323	ENSP00000265277:L487P;ENSP00000358464:L533P;ENSP00000408275:L323P	ENSP00000265277:L487P	L	+	2	0	SHOC2	112761415	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.988000	0.88194	2.040000	0.60383	0.533000	0.62120	CTT	.	.		0.413	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050355.1	NM_007373	
EDRF1	26098	hgsc.bcm.edu	37	10	127431772	127431772	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:127431772A>G	ENST00000356792.4	+	18	2749	c.2517A>G	c.(2515-2517)agA>agG	p.R839R	RP11-383C5.7_ENST00000449436.1_RNA|C10orf137_ENST00000337623.3_Silent_p.R805R|RP11-383C5.7_ENST00000600784.1_RNA|RP11-383C5.7_ENST00000593871.1_RNA|RP11-383C5.7_ENST00000602030.1_RNA|RP11-383C5.7_ENST00000594025.1_RNA	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN		839					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TATTAAAGAGAATGGGTAACA	0.358																																					p.R839R		Atlas-SNP	.											.	C10orf137	153	.	0			c.A2517G						.						120.0	120.0	120.0					10																	127431772		2203	4300	6503	SO:0001819	synonymous_variant	26098	exon18			AAAGAGAATGGGT																												ENST00000356792.4:c.2517A>G	chr10.hg19:g.127431772A>G		99.0	0.0		84.0	4.0	NM_001202438	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Silent	SNP	ENST00000356792.4	hg19	CCDS55733.1																																																																																			.	.		0.358	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388539.1		
CFAP46	54777	hgsc.bcm.edu	37	10	134732917	134732917	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:134732917A>G	ENST00000368586.5	-	15	1860	c.1760T>C	c.(1759-1761)gTg>gCg	p.V587A	TTC40_ENST00000368582.2_Missense_Mutation_p.V587A	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TTTCCGGGCCACTTTGGCCAG	0.552																																					p.V587A		Atlas-SNP	.											.	TTC40	100	.	0			c.T1760C						.																																			SO:0001583	missense	54777	exon15			CGGGCCACTTTGG																												ENST00000368586.5:c.1760T>C	chr10.hg19:g.134732917A>G	ENSP00000357575:p.Val587Ala	105.0	0.0		77.0	4.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	A	12.87	2.068152	0.36470	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.47869	2.8;0.83	3.94	3.94	0.45596	.	0.270691	0.30219	N	0.010122	T	0.45236	0.1332	.	.	.	0.23959	N	0.996344	.	.	.	.	.	.	T	0.38929	-0.9638	7	0.52906	T	0.07	-19.8815	7.3956	0.26934	0.8947:0.0:0.1052:0.0	.	.	.	.	A	587	ENSP00000357575:V587A;ENSP00000357571:V587A	ENSP00000357571:V587A	V	-	2	0	C10orf93	134582907	0.999000	0.42202	0.986000	0.45419	0.116000	0.19942	2.853000	0.48317	1.666000	0.50821	0.260000	0.18958	GTG	.	.		0.552	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
OR52B4	143496	hgsc.bcm.edu	37	11	4389188	4389188	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:4389188T>C	ENST00000408920.2	-	1	428	c.338A>G	c.(337-339)gAg>gGg	p.E113G		NM_001005161.3	NP_001005161.2	Q8NGK2	O52B4_HUMAN	olfactory receptor, family 52, subfamily B, member 4	113					cognition (GO:0050890)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(15)|skin(2)	31		Medulloblastoma(188;0.0075)|Breast(177;0.0249)|all_neural(188;0.0577)		Epithelial(150;1.57e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0826)|LUSC - Lung squamous cell carcinoma(625;0.19)		GATCCCTGACTCAGAGATGAA	0.473																																					p.E113G		Atlas-SNP	.											.	OR52B4	56	.	0			c.A338G						.						96.0	98.0	97.0					11																	4389188		2114	4244	6358	SO:0001583	missense	143496	exon1			CCTGACTCAGAGA	AB065792	CCDS41609.1	11p15.4	2012-08-09			ENSG00000221996	ENSG00000221996		"""GPCR / Class A : Olfactory receptors"""	15209	protein-coding gene	gene with protein product							Standard	NM_001005161		Approved		uc010qye.2	Q8NGK2	OTTHUMG00000154222	ENST00000408920.2:c.338A>G	chr11.hg19:g.4389188T>C	ENSP00000386160:p.Glu113Gly	101.0	0.0		83.0	4.0	NM_001005161	A6NP68|Q6IFK6	Missense_Mutation	SNP	ENST00000408920.2	hg19	CCDS41609.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273614	0.59649	.	.	ENSG00000221996	ENST00000408920	T	0.00388	7.59	5.28	5.28	0.74379	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000016	T	0.01558	0.0050	H	0.95679	3.705	0.38208	D	0.940391	D	0.76494	0.999	D	0.69307	0.963	T	0.30707	-0.9969	10	0.87932	D	0	.	14.1695	0.65500	0.0:0.0:0.0:1.0	.	113	Q8NGK2	O52B4_HUMAN	G	113	ENSP00000386160:E113G	ENSP00000386160:E113G	E	-	2	0	OR52B4	4345764	0.998000	0.40836	1.000000	0.80357	0.363000	0.29612	2.257000	0.43240	2.220000	0.72140	0.528000	0.53228	GAG	.	.		0.473	OR52B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334449.3	NM_001005161	
USH1C	10083	hgsc.bcm.edu	37	11	17522671	17522671	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:17522671T>C	ENST00000318024.4	-	18	1515	c.1407A>G	c.(1405-1407)gaA>gaG	p.E469E	USH1C_ENST00000527720.1_Silent_p.E438E|USH1C_ENST00000005226.7_Silent_p.E769E|USH1C_ENST00000527020.1_Silent_p.E450E|USH1C_ENST00000529563.1_5'UTR	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	469	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CCACACCGCCTTCCAGGGCCA	0.602																																					p.E769E		Atlas-SNP	.											.	USH1C	157	.	0			c.A2307G						.						65.0	55.0	58.0					11																	17522671		2200	4293	6493	SO:0001819	synonymous_variant	10083	exon23			ACCGCCTTCCAGG	AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1407A>G	chr11.hg19:g.17522671T>C		86.0	0.0		79.0	4.0	NM_153676	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Silent	SNP	ENST00000318024.4	hg19	CCDS31438.1																																																																																			.	.		0.602	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000389146.1	NM_005709	
NELL1	4745	hgsc.bcm.edu	37	11	20940817	20940817	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:20940817T>C	ENST00000357134.5	+	7	848	c.696T>C	c.(694-696)gaT>gaC	p.D232D	NELL1_ENST00000325319.5_Silent_p.D175D|NELL1_ENST00000298925.5_Silent_p.D260D|NELL1_ENST00000532434.1_Silent_p.D232D	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)	232					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						CCTGCAGTGATTTCTTAAGCC	0.303																																					p.D232D		Atlas-SNP	.											.	NELL1	179	.	0			c.T696C						.						109.0	106.0	107.0					11																	20940817		2203	4299	6502	SO:0001819	synonymous_variant	4745	exon7			CAGTGATTTCTTA	AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.696T>C	chr11.hg19:g.20940817T>C		117.0	0.0		97.0	5.0	NM_006157	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	Silent	SNP	ENST00000357134.5	hg19	CCDS7855.1																																																																																			.	.		0.303	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387588.1	NM_006157	
SLC5A12	159963	hgsc.bcm.edu	37	11	26708028	26708028	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:26708028A>G	ENST00000396005.3	-	10	1526	c.1217T>C	c.(1216-1218)gTg>gCg	p.V406A		NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	406					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						CGTTACCTGCACAACACCTCC	0.433																																					p.V406A		Atlas-SNP	.											.	SLC5A12	134	.	0			c.T1217C						.						104.0	106.0	106.0					11																	26708028		2009	4175	6184	SO:0001583	missense	159963	exon10			ACCTGCACAACAC	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.1217T>C	chr11.hg19:g.26708028A>G	ENSP00000379326:p.Val406Ala	82.0	0.0		76.0	4.0	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	A	12.11	1.838775	0.32513	.	.	ENSG00000148942	ENST00000396005	D	0.87334	-2.24	5.55	5.55	0.83447	.	0.331495	0.22064	U	0.065127	D	0.87083	0.6089	L	0.58302	1.8	0.80722	D	1	B	0.29270	0.24	B	0.36092	0.217	D	0.86308	0.1684	10	0.66056	D	0.02	.	14.6556	0.68831	1.0:0.0:0.0:0.0	.	406	Q1EHB4	SC5AC_HUMAN	A	406	ENSP00000379326:V406A	ENSP00000379326:V406A	V	-	2	0	SLC5A12	26664604	0.392000	0.25229	0.003000	0.11579	0.088000	0.18126	5.230000	0.65321	2.099000	0.63709	0.482000	0.46254	GTG	.	.		0.433	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
PRDM11	56981	hgsc.bcm.edu	37	11	45203337	45203337	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:45203337A>G	ENST00000530656.1	+	2	122	c.122A>G	c.(121-123)gAg>gGg	p.E41G	PRDM11_ENST00000424263.2_Missense_Mutation_p.E7G|PRDM11_ENST00000263765.4_Missense_Mutation_p.E41G			Q9NQV5	PRD11_HUMAN	PR domain containing 11	41							methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						AACATGAAGGAGTGCTTGGCC	0.602																																					p.E7G	NSCLC(118;1511 1736 6472 36603 43224)	Atlas-SNP	.											.	PRDM11	53	.	0			c.A20G						.						109.0	96.0	101.0					11																	45203337		2203	4299	6502	SO:0001583	missense	56981	exon2			TGAAGGAGTGCTT	AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.122A>G	chr11.hg19:g.45203337A>G	ENSP00000435976:p.Glu41Gly	27.0	0.0		33.0	4.0	NM_001256695	Q8N9F1	Missense_Mutation	SNP	ENST00000530656.1	hg19		.	.	.	.	.	.	.	.	.	.	A	15.40	2.821512	0.50633	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.28	4.09	0.47781	.	0.179711	0.38605	N	0.001627	T	0.30634	0.0771	N	0.14661	0.345	0.32351	N	0.558416	B	0.33171	0.4	B	0.30855	0.121	T	0.50355	-0.8838	10	0.87932	D	0	-23.3036	12.7893	0.57523	0.8541:0.1458:0.0:0.0	.	41	Q9NQV5	PRD11_HUMAN	G	41;41;7;7	ENSP00000263765:E41G;ENSP00000435976:E41G;ENSP00000431898:E7G;ENSP00000394314:E7G	ENSP00000263765:E41G	E	+	2	0	PRDM11	45159913	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.024000	0.57218	2.001000	0.58596	0.402000	0.26972	GAG	.	.		0.602	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000389928.1	NM_020229	
CELF1	10658	hgsc.bcm.edu	37	11	47510436	47510436	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:47510436T>C	ENST00000358597.3	-	1	130	c.131A>G	c.(130-132)gAa>gGa	p.E44G	CELF1_ENST00000532048.1_Missense_Mutation_p.E71G|AC090559.1_ENST00000578625.1_RNA|CELF1_ENST00000310513.5_Missense_Mutation_p.E44G|CELF1_ENST00000361904.3_Missense_Mutation_p.E44G|CELF1_ENST00000531165.1_Missense_Mutation_p.E71G|CELF1_ENST00000395292.2_Missense_Mutation_p.E44G|CELF1_ENST00000395290.2_Missense_Mutation_p.E44G			Q92879	CELF1_HUMAN	CUGBP, Elav-like family member 1	44	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of translation (GO:0017148)|positive regulation of multicellular organism growth (GO:0040018)|regulation of RNA splicing (GO:0043484)|RNA interference (GO:0016246)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation repressor activity, nucleic acid binding (GO:0000900)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(2)	18						GACGTTGATTTCATACACAGC	0.468																																					p.E71G	Pancreas(163;1949 1966 9906 43218 43785)	Atlas-SNP	.											.	CELF1	43	.	0			c.A212G						.						164.0	166.0	165.0					11																	47510436		2201	4298	6499	SO:0001583	missense	10658	exon4			TTGATTTCATACA	U63289	CCDS7938.1, CCDS7939.1, CCDS31482.1, CCDS53622.1, CCDS53623.1	11p11	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	2549	protein-coding gene	gene with protein product	"""CUG RNA-binding protein"", ""nuclear polyadenylated RNA-binding protein, 50-kD"", ""bruno-like 2"", ""embryo deadenylation element binding protein"""	601074	"""CUG triplet repeat, RNA-binding protein 1"", ""CUG triplet repeat, RNA binding protein 1"""	CUGBP1		8948631, 9371827	Standard	NM_006560		Approved	CUG-BP, hNab50, BRUNOL2, NAB50, CUGBP, NAPOR, EDEN-BP	uc001nfl.3	Q92879		ENST00000358597.3:c.131A>G	chr11.hg19:g.47510436T>C	ENSP00000351409:p.Glu44Gly	87.0	0.0		85.0	4.0	NM_001172639	B4E2U5|D3DQS0|F8W940|Q4LE52|Q9NP83|Q9NR06	Missense_Mutation	SNP	ENST00000358597.3	hg19	CCDS31482.1	.	.	.	.	.	.	.	.	.	.	T	31	5.091145	0.94149	.	.	ENSG00000149187	ENST00000395290;ENST00000358597;ENST00000395292;ENST00000310513;ENST00000361904;ENST00000531165;ENST00000532048;ENST00000530151;ENST00000528434;ENST00000525841;ENST00000543178;ENST00000535982;ENST00000526419	T;T;T;T;T;T;T;T;T;T;T;T;T	0.75154	-0.91;1.22;1.22;1.22;1.22;1.22;1.22;-0.91;1.22;-0.91;-0.91;1.22;1.22	5.69	5.69	0.88448	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	D	0.83589	0.5287	L	0.61387	1.9	0.80722	D	1	D;D;P;P;D;P	0.71674	0.998;0.958;0.921;0.921;0.958;0.936	D;P;B;B;P;B	0.64687	0.928;0.726;0.31;0.182;0.726;0.345	D	0.85463	0.1168	10	0.87932	D	0	-12.2654	15.9416	0.79758	0.0:0.0:0.0:1.0	.	44;71;71;44;44;44	F8W940;G5EA30;Q92879-4;Q92879-2;Q92879-3;Q92879	.;.;.;.;.;CELF1_HUMAN	G	44;44;44;44;44;71;71;44;71;44;44;71;44	ENSP00000378705:E44G;ENSP00000351409:E44G;ENSP00000378706:E44G;ENSP00000308386:E44G;ENSP00000354639:E44G;ENSP00000436864:E71G;ENSP00000435926:E71G;ENSP00000433986:E44G;ENSP00000435320:E71G;ENSP00000436191:E44G;ENSP00000444825:E44G;ENSP00000438044:E71G;ENSP00000435423:E44G	ENSP00000308386:E44G	E	-	2	0	CELF1	47467012	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.036000	0.88901	2.170000	0.68504	0.459000	0.35465	GAA	.	.		0.468	CELF1-024	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000398352.1	NM_006560	
OSBP	5007	hgsc.bcm.edu	37	11	59347665	59347665	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:59347665A>G	ENST00000263847.1	-	11	2339	c.1860T>C	c.(1858-1860)tcT>tcC	p.S620S		NM_002556.2	NP_002547.1	P22059	OSBP1_HUMAN	oxysterol binding protein	620					lipid transport (GO:0006869)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	oxysterol binding (GO:0008142)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		all_epithelial(135;0.000236)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		CTACATCCCGAGAGAAGTAGC	0.338																																					p.S620S		Atlas-SNP	.											.	OSBP	57	.	0			c.T1860C						.						84.0	84.0	84.0					11																	59347665		2201	4295	6496	SO:0001819	synonymous_variant	5007	exon11			ATCCCGAGAGAAG	AF185696	CCDS7974.1	11q12-q13	2013-01-10			ENSG00000110048	ENSG00000110048		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	8503	protein-coding gene	gene with protein product		167040					Standard	NM_002556		Approved	OSBP1	uc001noc.1	P22059	OTTHUMG00000167422	ENST00000263847.1:c.1860T>C	chr11.hg19:g.59347665A>G		57.0	0.0		44.0	4.0	NM_002556	Q6P524	Silent	SNP	ENST00000263847.1	hg19	CCDS7974.1																																																																																			.	.		0.338	OSBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394555.1		
MS4A14	84689	hgsc.bcm.edu	37	11	60184403	60184403	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:60184403G>A	ENST00000300187.6	+	5	2239	c.1962G>A	c.(1960-1962)tgG>tgA	p.W654*	MS4A14_ENST00000531783.1_Nonsense_Mutation_p.W687*|MS4A14_ENST00000531787.1_Nonsense_Mutation_p.W542*|MS4A14_ENST00000395005.2_Nonsense_Mutation_p.W637*	NM_032597.4	NP_115986.3	Q96JA4	M4A14_HUMAN	membrane-spanning 4-domains, subfamily A, member 14	654	Gln-rich.					integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(9)|lung(31)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	62						ACCAATTCTGGCAATTCCACA	0.463																																					p.W687X		Atlas-SNP	.											.	MS4A14	120	.	0			c.G2061A						.						83.0	86.0	85.0					11																	60184403		2203	4300	6503	SO:0001587	stop_gained	84689	exon6			ATTCTGGCAATTC	AY584610	CCDS31569.1, CCDS41652.1, CCDS58136.1, CCDS73295.1	11q12.2	2008-04-10	2008-04-10	2008-04-10		ENSG00000166928			30706	protein-coding gene	gene with protein product			"""membrane-spanning 4-domains, subfamily A, member 16"""	MS4A16			Standard	NM_032597		Approved	NYD-SP21, FLJ32856, DKFZp434H092	uc031qbd.1	Q96JA4		ENST00000300187.6:c.1962G>A	chr11.hg19:g.60184403G>A	ENSP00000300187:p.Trp654*	102.0	0.0		90.0	17.0	NM_001261828	E9PJE3|Q2TVT5|Q3B7W3|Q86XH8|Q9NTC2	Nonsense_Mutation	SNP	ENST00000300187.6	hg19	CCDS31569.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.116769	0.77323	.	.	ENSG00000166928	ENST00000531787;ENST00000300187;ENST00000395005;ENST00000531783	.	.	.	3.78	0.219	0.15274	.	7.817370	0.00166	N	0.000002	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	.	6.0394	0.19726	0.1041:0.0:0.5168:0.3791	.	.	.	.	X	542;654;637;687	.	ENSP00000300187:W654X	W	+	3	0	MS4A14	59940979	0.015000	0.18098	0.000000	0.03702	0.018000	0.09664	-0.108000	0.10857	-0.093000	0.12396	0.650000	0.86243	TGG	.	.		0.463	MS4A14-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395383.2		
AHNAK	79026	hgsc.bcm.edu	37	11	62286551	62286551	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:62286551A>G	ENST00000378024.4	-	5	15612	c.15338T>C	c.(15337-15339)cTg>cCg	p.L5113P	AHNAK_ENST00000525875.1_5'Flank|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	5113					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTCACCCTCCAGTTTGGGGCT	0.473																																					p.L5113P		Atlas-SNP	.											.	AHNAK	532	.	0			c.T15338C						.						69.0	73.0	72.0					11																	62286551		2202	4299	6501	SO:0001583	missense	79026	exon5			CCCTCCAGTTTGG	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.15338T>C	chr11.hg19:g.62286551A>G	ENSP00000367263:p.Leu5113Pro	127.0	0.0		96.0	4.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	A	12.56	1.973824	0.34848	.	.	ENSG00000124942	ENST00000378024	T	0.00922	5.54	4.88	4.88	0.63580	.	0.859367	0.09745	N	0.761381	T	0.04998	0.0134	M	0.70903	2.155	0.39622	D	0.970046	D	0.58970	0.984	D	0.64506	0.926	T	0.51188	-0.8737	10	0.34782	T	0.22	-0.5009	14.4566	0.67420	1.0:0.0:0.0:0.0	.	5113	Q09666	AHNK_HUMAN	P	5113	ENSP00000367263:L5113P	ENSP00000367263:L5113P	L	-	2	0	AHNAK	62043127	0.421000	0.25465	0.615000	0.29064	0.571000	0.35966	4.269000	0.58890	1.958000	0.56883	0.443000	0.29094	CTG	.	.		0.473	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
INTS5	80789	hgsc.bcm.edu	37	11	62417403	62417403	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:62417403A>G	ENST00000330574.2	-	2	201	c.149T>C	c.(148-150)cTc>cCc	p.L50P	RP11-831H9.11_ENST00000528405.1_3'UTR	NM_030628.1	NP_085131.1	Q6P9B9	INT5_HUMAN	integrator complex subunit 5	50					snRNA processing (GO:0016180)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				breast(1)|endometrium(4)|large_intestine(6)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	36						CCGGGCTGAGAGTTGGTGGCC	0.537																																					p.L50P		Atlas-SNP	.											.	INTS5	81	.	0			c.T149C						.						76.0	84.0	81.0					11																	62417403		2202	4299	6501	SO:0001583	missense	80789	exon2			GCTGAGAGTTGGT	AK123587	CCDS8027.1	11q12.3	2006-04-26	2006-03-15	2006-03-15	ENSG00000185085	ENSG00000185085			29352	protein-coding gene	gene with protein product		611349	"""KIAA1698"""	KIAA1698		16239144	Standard	NM_030628		Approved	INT5	uc001nud.3	Q6P9B9	OTTHUMG00000167605	ENST00000330574.2:c.149T>C	chr11.hg19:g.62417403A>G	ENSP00000327889:p.Leu50Pro	95.0	0.0		93.0	4.0	NM_030628	Q8N6W5|Q9C0G5	Missense_Mutation	SNP	ENST00000330574.2	hg19	CCDS8027.1	.	.	.	.	.	.	.	.	.	.	A	19.39	3.818182	0.71028	.	.	ENSG00000185085	ENST00000330574	.	.	.	5.17	5.17	0.71159	.	0.000000	0.64402	D	0.000001	T	0.74898	0.3777	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.77202	-0.2674	9	0.66056	D	0.02	.	12.9592	0.58447	1.0:0.0:0.0:0.0	.	50	Q6P9B9	INT5_HUMAN	P	50	.	ENSP00000327889:L50P	L	-	2	0	INTS5	62173979	1.000000	0.71417	0.998000	0.56505	0.815000	0.46073	8.723000	0.91458	1.946000	0.56461	0.459000	0.35465	CTC	.	.		0.537	INTS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395327.1	NM_030628	
SF1	7536	hgsc.bcm.edu	37	11	64534515	64534515	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:64534515G>A	ENST00000377390.3	-	12	1776	c.1439C>T	c.(1438-1440)cCg>cTg	p.P480L	SF1_ENST00000377394.3_Silent_p.A481A|SF1_ENST00000334944.5_Missense_Mutation_p.P480L|SF1_ENST00000377387.1_Missense_Mutation_p.P605L|SF1_ENST00000422298.2_Missense_Mutation_p.P365L|SF1_ENST00000227503.9_Missense_Mutation_p.P480L|SF1_ENST00000489544.1_5'Flank|SF1_ENST00000433274.2_Missense_Mutation_p.P454L	NM_004630.3	NP_004621.2	Q15637	SF01_HUMAN	splicing factor 1	480	Pro-rich.				Leydig cell differentiation (GO:0033327)|male sex determination (GO:0030238)|mRNA 3'-splice site recognition (GO:0000389)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of smooth muscle cell proliferation (GO:0048662)|regulation of steroid biosynthetic process (GO:0050810)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribosome (GO:0005840)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(12)|ovary(2)|skin(2)	31						CGGCGGCGGCGGCGGCATCAT	0.692																																					p.P605L		Atlas-SNP	.											.	SF1	124	.	0			c.C1814T						.						18.0	23.0	22.0					11																	64534515		2197	4285	6482	SO:0001583	missense	7536	exon12			GGCGGCGGCGGCA	D26120	CCDS8080.1, CCDS8081.1, CCDS31599.1, CCDS44642.1, CCDS44642.2, CCDS53660.1, CCDS53661.1	11q13	2014-09-17	2001-12-19	2002-01-11	ENSG00000168066	ENSG00000168066		"""Zinc fingers, CCHC domain containing"""	12950	protein-coding gene	gene with protein product		601516	"""zinc finger protein 162"""	ZNF162		7912130, 9573336	Standard	NM_201997		Approved	ZFM1, ZCCHC25	uc001oaz.2	Q15637	OTTHUMG00000066833	ENST00000377390.3:c.1439C>T	chr11.hg19:g.64534515G>A	ENSP00000366607:p.Pro480Leu	61.0	0.0		74.0	14.0	NM_001178030	B7Z1Q1|C9JJE2|Q14818|Q14819|Q15913|Q8IY00|Q92744|Q92745|Q969H7|Q9BW01|Q9UEI0	Missense_Mutation	SNP	ENST00000377390.3	hg19	CCDS31599.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.54|13.54	2.266620|2.266620	0.40095|0.40095	.|.	.|.	ENSG00000168066|ENSG00000168066	ENST00000377387;ENST00000377390;ENST00000227503;ENST00000334944;ENST00000422298;ENST00000443908;ENST00000433274|ENST00000413725	T;T;T;T;T;T;T|.	0.51817|.	0.75;0.76;0.76;0.74;0.69;0.85;0.77|.	4.54|4.54	4.54|4.54	0.55810|0.55810	.|.	0.311799|.	0.33895|.	N|.	0.004451|.	T|T	0.70954|0.70954	0.3283|0.3283	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;0.999;0.999;0.999;1.0|.	D;D;D;D;D|.	0.79108|.	0.913;0.96;0.982;0.992;0.992|.	T|T	0.70263|0.70263	-0.4920|-0.4920	9|4	0.66056|.	D|.	0.02|.	.|.	15.5846|15.5846	0.76473|0.76473	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	365;480;480;480;605|.	B4DX42;Q15637-4;Q15637;Q15637-2;Q15637-5|.	.;.;SF01_HUMAN;.;.|.	L|C	605;480;480;480;365;132;454|50	ENSP00000366604:P605L;ENSP00000366607:P480L;ENSP00000227503:P480L;ENSP00000334414:P480L;ENSP00000413084:P365L;ENSP00000391198:P132L;ENSP00000396793:P454L|.	ENSP00000227503:P480L|.	P|R	-|-	2|1	0|0	SF1|SF1	64291091|64291091	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.898000|0.898000	0.52572|0.52572	6.317000|6.317000	0.72862|0.72862	2.466000|2.466000	0.83321|0.83321	0.561000|0.561000	0.74099|0.74099	CCG|CGC	.	.		0.692	SF1-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000143242.1	NM_004630	
PACS1	55690	hgsc.bcm.edu	37	11	66006669	66006669	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:66006669T>C	ENST00000320580.4	+	21	2383	c.2350T>C	c.(2350-2352)Tcc>Ccc	p.S784P	PACS1_ENST00000529757.1_Missense_Mutation_p.S320P|PACS1_ENST00000524815.1_5'Flank	NM_018026.3	NP_060496.2	Q6VY07	PACS1_HUMAN	phosphofurin acidic cluster sorting protein 1	784					protein targeting to Golgi (GO:0000042)|protein targeting to plasma membrane (GO:0072661)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	COPI-coated vesicle (GO:0030137)|cytosol (GO:0005829)	ion channel binding (GO:0044325)		RBM14/PACS1(2)	breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(8)|ovary(6)|skin(2)|urinary_tract(1)	37						ATCACCACCCTCCAGCTCGGG	0.632																																					p.S784P		Atlas-SNP	.											.	PACS1	71	.	0			c.T2350C						.						122.0	105.0	110.0					11																	66006669		2200	4295	6495	SO:0001583	missense	55690	exon21			CCACCCTCCAGCT	AB033001	CCDS8129.1	11q13.1-q13.2	2008-02-05			ENSG00000175115	ENSG00000175115			30032	protein-coding gene	gene with protein product		607492				12855553, 14608369	Standard	NM_018026		Approved	FLJ10209, KIAA1175	uc001oha.2	Q6VY07	OTTHUMG00000166889	ENST00000320580.4:c.2350T>C	chr11.hg19:g.66006669T>C	ENSP00000316454:p.Ser784Pro	88.0	0.0		95.0	5.0	NM_018026	Q6PJY6|Q6PKB6|Q7Z590|Q7Z5W4|Q8N8K6|Q96MW0|Q9NW92|Q9ULP5	Missense_Mutation	SNP	ENST00000320580.4	hg19	CCDS8129.1	.	.	.	.	.	.	.	.	.	.	T	20.6	4.018890	0.75275	.	.	ENSG00000175115	ENST00000320580;ENST00000529757	T;T	0.47528	0.84;0.84	4.94	4.94	0.65067	.	0.127785	0.52532	D	0.000070	T	0.57359	0.2048	L	0.49350	1.555	0.80722	D	1	D	0.65815	0.995	P	0.58820	0.846	T	0.56432	-0.7980	10	0.39692	T	0.17	-23.7671	13.9082	0.63850	0.0:0.0:0.0:1.0	.	784	Q6VY07	PACS1_HUMAN	P	784;320	ENSP00000316454:S784P;ENSP00000432858:S320P	ENSP00000316454:S784P	S	+	1	0	PACS1	65763245	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	3.683000	0.54663	1.993000	0.58246	0.454000	0.30748	TCC	.	.		0.632	PACS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391690.2	NM_018026	
SPTBN2	6712	hgsc.bcm.edu	37	11	66472881	66472881	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:66472881G>C	ENST00000533211.1	-	15	2197	c.1866C>G	c.(1864-1866)agC>agG	p.S622R	SPTBN2_ENST00000529997.1_Missense_Mutation_p.S622R|SPTBN2_ENST00000309996.2_Missense_Mutation_p.S622R			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	622					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						GTGCCTCATAGCTCTGCTCTA	0.642																																					p.S622R		Atlas-SNP	.											.	SPTBN2	188	.	0			c.C1866G						.						30.0	34.0	33.0					11																	66472881		2194	4279	6473	SO:0001583	missense	6712	exon14			CTCATAGCTCTGC	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.1866C>G	chr11.hg19:g.66472881G>C	ENSP00000432568:p.Ser622Arg	96.0	0.0		118.0	73.0	NM_006946	O14872|O14873	Missense_Mutation	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	G	7.848	0.723341	0.15439	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	T;T;T	0.43294	0.95;0.95;0.95	4.45	4.45	0.53987	.	0.119815	0.64402	D	0.000019	T	0.17874	0.0429	N	0.01473	-0.845	0.40405	D	0.979692	B	0.18013	0.025	B	0.15052	0.012	T	0.11567	-1.0582	10	0.14252	T	0.57	.	16.002	0.80301	0.0:0.0:1.0:0.0	.	622	O15020	SPTN2_HUMAN	R	622	ENSP00000432568:S622R;ENSP00000311489:S622R;ENSP00000433593:S622R	ENSP00000311489:S622R	S	-	3	2	SPTBN2	66229457	1.000000	0.71417	1.000000	0.80357	0.105000	0.19272	3.886000	0.56190	2.294000	0.77228	0.491000	0.48974	AGC	.	.		0.642	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	
TENM4	26011	hgsc.bcm.edu	37	11	78467981	78467981	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:78467981A>G	ENST00000278550.7	-	19	3087	c.2625T>C	c.(2623-2625)ccT>ccC	p.P875P	RP11-673F18.1_ENST00000526741.1_RNA	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	875					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGATGTCCAGAGGGTTAGGGG	0.592																																					p.P875P		Atlas-SNP	.											.	.	.	.	0			c.T2625C						.						70.0	76.0	74.0					11																	78467981		2165	4264	6429	SO:0001819	synonymous_variant	26011	exon19			GTCCAGAGGGTTA	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2625T>C	chr11.hg19:g.78467981A>G		100.0	0.0		98.0	4.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	ENST00000278550.7	hg19	CCDS44688.1																																																																																			.	.		0.592	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
CCDC90B	60492	hgsc.bcm.edu	37	11	82984887	82984887	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:82984887T>C	ENST00000529689.1	-	6	923	c.489A>G	c.(487-489)agA>agG	p.R163R	CCDC90B_ENST00000455220.2_Silent_p.R154R|CCDC90B_ENST00000529611.1_Silent_p.R62R|CCDC90B_ENST00000525503.1_Silent_p.R62R|CCDC90B_ENST00000529073.1_Intron			Q9GZT6	CC90B_HUMAN	coiled-coil domain containing 90B	163						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)	10		Acute lymphoblastic leukemia(157;0.103)				TATTATCTGCTCTGATTCGAC	0.284																																					p.R163R		Atlas-SNP	.											.	CCDC90B	20	.	0			c.A489G						.						77.0	73.0	75.0					11																	82984887		2198	4296	6494	SO:0001819	synonymous_variant	60492	exon6			ATCTGCTCTGATT	BC048795	CCDS8266.1, CCDS66190.1, CCDS66191.1	11q14.1	2006-10-23			ENSG00000137500	ENSG00000137500			28108	protein-coding gene	gene with protein product						11230166	Standard	XM_005274154		Approved	MDS025, MDS011	uc001pae.3	Q9GZT6	OTTHUMG00000167078	ENST00000529689.1:c.489A>G	chr11.hg19:g.82984887T>C		137.0	0.0		93.0	4.0	NM_021825	A8K8I4|B3KP87|B4E3L2|Q3B781|Q9GZU6	Silent	SNP	ENST00000529689.1	hg19	CCDS8266.1																																																																																			.	.		0.284	CCDC90B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392940.2	NM_021825	
SYTL2	54843	hgsc.bcm.edu	37	11	85420461	85420461	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:85420461T>C	ENST00000528231.1	-	12	2190	c.1913A>G	c.(1912-1914)tAt>tGt	p.Y638C	SYTL2_ENST00000525702.1_Missense_Mutation_p.Y80C|SYTL2_ENST00000529581.1_Missense_Mutation_p.Y80C|SYTL2_ENST00000389960.4_Missense_Mutation_p.Y614C|SYTL2_ENST00000527523.1_Missense_Mutation_p.Y606C|SYTL2_ENST00000533892.1_Missense_Mutation_p.Y40C|SYTL2_ENST00000525423.1_Missense_Mutation_p.Y960C|SYTL2_ENST00000354566.3_Missense_Mutation_p.Y976C|SYTL2_ENST00000524452.1_Missense_Mutation_p.Y614C|SYTL2_ENST00000316356.4_Missense_Mutation_p.Y639C|SYTL2_ENST00000359152.5_Missense_Mutation_p.Y1484C|SYTL2_ENST00000389958.3_Missense_Mutation_p.Y69C	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	638	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGACTCCACATATTCAATTGC	0.408																																					p.Y976C		Atlas-SNP	.											.	SYTL2	231	.	0			c.A2927G						.						126.0	120.0	122.0					11																	85420461		2203	4299	6502	SO:0001583	missense	54843	exon7			TCCACATATTCAA	AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1913A>G	chr11.hg19:g.85420461T>C	ENSP00000431701:p.Tyr638Cys	97.0	0.0		92.0	4.0	NM_206927	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	ENST00000528231.1	hg19	CCDS53688.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.508725	0.85282	.	.	ENSG00000137501	ENST00000389960;ENST00000359152;ENST00000354566;ENST00000316356;ENST00000525702;ENST00000525423;ENST00000529581;ENST00000389958;ENST00000530351;ENST00000528231;ENST00000533892;ENST00000527523;ENST00000524452;ENST00000527794;ENST00000529534;ENST00000534414;ENST00000526999	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71	5.99	5.99	0.97316	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.50820	0.1638	H	0.94698	3.57	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	T	0.65175	-0.6232	9	.	.	.	-15.6856	16.4943	0.84223	0.0:0.0:0.0:1.0	.	606;614;638;639;456;936;960;976;69;40	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15;Q9HCH5-11;Q9HCH5-7;Q9HCH5-8;Q9HCH5-9;Q9HCH5-4	.;.;SYTL2_HUMAN;.;.;.;.;.;.;.	C	614;1484;976;639;80;960;80;69;355;638;40;606;614;40;80;133;80	ENSP00000374610:Y614C;ENSP00000352065:Y1484C;ENSP00000346576:Y976C;ENSP00000318803:Y639C;ENSP00000432996:Y80C;ENSP00000432694:Y960C;ENSP00000435855:Y80C;ENSP00000374608:Y69C;ENSP00000435009:Y355C;ENSP00000431701:Y638C;ENSP00000432144:Y40C;ENSP00000434010:Y606C;ENSP00000435238:Y614C;ENSP00000437005:Y40C;ENSP00000432137:Y80C;ENSP00000434111:Y80C	.	Y	-	2	0	SYTL2	85098109	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.040000	0.89188	2.291000	0.77112	0.533000	0.62120	TAT	.	.		0.408	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000392192.1	NM_206927	
KDM4D	55693	hgsc.bcm.edu	37	11	94731384	94731384	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:94731384T>C	ENST00000335080.5	+	3	1680	c.848T>C	c.(847-849)tTc>tCc	p.F283S	KDM4D_ENST00000536741.1_Missense_Mutation_p.F283S	NM_018039.2	NP_060509.2	Q6B0I6	KDM4D_HUMAN	lysine (K)-specific demethylase 4D	283	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	blood microparticle (GO:0072562)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(2)|liver(2)|lung(16)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						CATGCTGGCTTCAACCATGGT	0.512																																					p.F283S		Atlas-SNP	.											.	KDM4D	58	.	0			c.T848C						.						67.0	71.0	70.0					11																	94731384		2201	4298	6499	SO:0001583	missense	55693	exon3			CTGGCTTCAACCA	AK001113	CCDS8302.1	11q21	2012-03-28	2009-04-06	2009-04-06	ENSG00000186280	ENSG00000186280		"""Chromatin-modifying enzymes / K-demethylases"""	25498	protein-coding gene	gene with protein product		609766	"""jumonji domain containing 2D"""	JMJD2D		15138608	Standard	NM_018039		Approved	FLJ10251	uc001pfe.3	Q6B0I6	OTTHUMG00000167838	ENST00000335080.5:c.848T>C	chr11.hg19:g.94731384T>C	ENSP00000334181:p.Phe283Ser	107.0	0.0		85.0	5.0	NM_018039	B3KPC4|Q0VF39|Q9NT41|Q9NW76	Missense_Mutation	SNP	ENST00000335080.5	hg19	CCDS8302.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945705	0.53079	.	.	ENSG00000186280	ENST00000335080	T	0.74632	-0.86	3.73	3.73	0.42828	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.64402	U	0.000001	D	0.89248	0.6661	H	0.96365	3.81	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.91411	0.5151	10	0.87932	D	0	-19.0431	11.0593	0.47938	0.0:0.0:0.0:1.0	.	283	Q6B0I6	KDM4D_HUMAN	S	283	ENSP00000334181:F283S	ENSP00000334181:F283S	F	+	2	0	KDM4D	94371032	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	7.564000	0.82326	1.937000	0.56155	0.379000	0.24179	TTC	.	.		0.512	KDM4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396558.2	NM_018039	
MMP10	4319	hgsc.bcm.edu	37	11	102641564	102641564	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:102641564A>G	ENST00000279441.4	-	10	1427	c.1391T>C	c.(1390-1392)gTg>gCg	p.V464A		NM_002425.2	NP_002416.1	P09238	MMP10_HUMAN	matrix metallopeptidase 10 (stromelysin 2)	464					collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|regulation of cell migration (GO:0030334)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(4)|liver(2)|lung(6)	22	all_epithelial(12;0.00961)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0303)|Lung(13;0.0828)|all cancers(10;0.116)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0145)	Marimastat(DB00786)	TATGTGTGTCACCATCCTGGC	0.353																																					p.V464A		Atlas-SNP	.											.	MMP10	44	.	0			c.T1391C						.						129.0	112.0	118.0					11																	102641564		2203	4299	6502	SO:0001583	missense	4319	exon10			TGTGTCACCATCC	X07820	CCDS8321.1	11q22.3	2008-02-05	2005-08-08		ENSG00000166670	ENSG00000166670	3.4.24.22		7156	protein-coding gene	gene with protein product		185260	"""matrix metalloproteinase 10 (stromelysin 2)"""	STMY2			Standard	NM_002425		Approved		uc001phg.2	P09238	OTTHUMG00000168083	ENST00000279441.4:c.1391T>C	chr11.hg19:g.102641564A>G	ENSP00000279441:p.Val464Ala	88.0	0.0		96.0	4.0	NM_002425	B2R9X9|Q53HH9	Missense_Mutation	SNP	ENST00000279441.4	hg19	CCDS8321.1	.	.	.	.	.	.	.	.	.	.	A	13.28	2.188904	0.38707	.	.	ENSG00000166670	ENST00000279441	T	0.02579	4.24	3.96	3.96	0.45880	Hemopexin/matrixin (2);	0.000000	0.33401	U	0.004956	T	0.17323	0.0416	M	0.88377	2.95	0.20196	N	0.999925	D	0.89917	1.0	D	0.87578	0.998	T	0.02417	-1.1162	10	0.87932	D	0	.	12.4759	0.55814	1.0:0.0:0.0:0.0	.	464	P09238	MMP10_HUMAN	A	464	ENSP00000279441:V464A	ENSP00000279441:V464A	V	-	2	0	MMP10	102146774	0.418000	0.25440	0.637000	0.29366	0.006000	0.05464	5.560000	0.67332	1.766000	0.52107	0.533000	0.62120	GTG	.	.		0.353	MMP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398014.1		
DDI1	414301	hgsc.bcm.edu	37	11	103908147	103908147	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:103908147T>C	ENST00000302259.3	+	1	840	c.597T>C	c.(595-597)cgT>cgC	p.R199R	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	199							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		AGAGGCTTCGTCTCTACACAG	0.512																																					p.R199R		Atlas-SNP	.											DDI1_ENST00000302259,colon,carcinoma,+2,2	DDI1	222	.	0			c.T597C						.						63.0	70.0	67.0					11																	103908147		2202	4299	6501	SO:0001819	synonymous_variant	414301	exon1			GCTTCGTCTCTAC		CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.597T>C	chr11.hg19:g.103908147T>C		68.0	0.0		64.0	3.0	NM_001001711	Q7Z4U6|Q8WTS3	Silent	SNP	ENST00000302259.3	hg19	CCDS31660.1																																																																																			.	.		0.512	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387326.1	NM_001001711	
ATM	472	hgsc.bcm.edu	37	11	108138031	108138031	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:108138031G>C	ENST00000452508.2	+	18	2789	c.2600G>C	c.(2599-2601)aGt>aCt	p.S867T	AP001925.1_ENST00000596081.1_5'Flank|ATM_ENST00000278616.4_Missense_Mutation_p.S867T			Q13315	ATM_HUMAN	ATM serine/threonine kinase	867					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGTAGTGTTAGTGATGCAAAC	0.353			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.S867T		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.G2600C						.						109.0	102.0	104.0					11																	108138031		2201	4298	6499	SO:0001583	missense	472	exon17	Familial Cancer Database	AT, Louis-Bar syndrome	GTGTTAGTGATGC	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2600G>C	chr11.hg19:g.108138031G>C	ENSP00000388058:p.Ser867Thr	124.0	0.0		68.0	31.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	G	3.064	-0.192659	0.06259	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.71934	-0.61;-0.61;-0.61	4.89	-2.89	0.05665	Armadillo-type fold (1);	0.765648	0.13145	N	0.410333	T	0.46405	0.1391	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20739	-1.0266	10	0.38643	T	0.18	.	2.0851	0.03644	0.3268:0.2348:0.3338:0.1046	.	867	Q13315	ATM_HUMAN	T	867	ENSP00000435747:S867T;ENSP00000278616:S867T;ENSP00000388058:S867T	ENSP00000278616:S867T	S	+	2	0	ATM	107643241	0.005000	0.15991	0.007000	0.13788	0.003000	0.03518	-0.306000	0.08178	-0.400000	0.07656	-0.469000	0.05056	AGT	.	.		0.353	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
DSCAML1	57453	hgsc.bcm.edu	37	11	117376187	117376187	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:117376187G>A	ENST00000321322.6	-	9	2225	c.2224C>T	c.(2224-2226)Cgc>Tgc	p.R742C	DSCAML1_ENST00000527706.1_Missense_Mutation_p.R472C	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	682	Ig-like C2-type 8.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		ATGAGCTGGCGCTCCCGGCTC	0.602																																					p.R742C		Atlas-SNP	.											DSCAML1,NS,carcinoma,0,1	DSCAML1	286	.	0			c.C2224T						.						81.0	79.0	80.0					11																	117376187		2201	4296	6497	SO:0001583	missense	57453	exon9			GCTGGCGCTCCCG		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2224C>T	chr11.hg19:g.117376187G>A	ENSP00000315465:p.Arg742Cys	74.0	0.0		98.0	4.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	G	16.05	3.013066	0.54468	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.66460	-0.21;-0.21	4.91	3.96	0.45880	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.58524	0.2128	N	0.02539	-0.55	0.80722	D	1	D	0.76494	0.999	D	0.67725	0.953	T	0.68432	-0.5410	9	0.56958	D	0.05	.	12.2131	0.54391	0.0:0.0:0.69:0.31	.	682	Q8TD84	DSCL1_HUMAN	C	472;742;449	ENSP00000434335:R472C;ENSP00000315465:R742C	ENSP00000315465:R742C	R	-	1	0	DSCAML1	116881397	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	3.256000	0.51492	1.213000	0.43380	0.491000	0.48974	CGC	.	.		0.602	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
NCAPD3	23310	hgsc.bcm.edu	37	11	134072727	134072727	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr11:134072727T>C	ENST00000534548.2	-	13	1663	c.1599A>G	c.(1597-1599)gaA>gaG	p.E533E		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	533					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ATCCAACTGTTTCACCACTGC	0.388																																					p.E533E		Atlas-SNP	.											.	NCAPD3	141	.	0			c.A1599G						.						162.0	151.0	155.0					11																	134072727		2201	4297	6498	SO:0001819	synonymous_variant	23310	exon13			AACTGTTTCACCA	AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.1599A>G	chr11.hg19:g.134072727T>C		142.0	0.0		97.0	4.0	NM_015261	A6NFS2|Q4KMQ9	Silent	SNP	ENST00000534548.2	hg19	CCDS31723.1																																																																																			.	.		0.388	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393575.2	NM_015261	
TEAD4	7004	hgsc.bcm.edu	37	12	3128294	3128294	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:3128294T>C	ENST00000397122.2	+	6	439	c.154T>C	c.(154-156)Tct>Cct	p.S52P	TEAD4_ENST00000359864.2_Missense_Mutation_p.S181P|TEAD4_ENST00000358409.2_Missense_Mutation_p.S138P	NM_201443.2	NP_958851.1	Q15561	TEAD4_HUMAN	TEA domain family member 4	181					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			GAAGCCTTTCTCTCAGCAAAC	0.657																																					p.S181P		Atlas-SNP	.											.	TEAD4	45	.	0			c.T541C						.						105.0	87.0	93.0					12																	3128294		2203	4300	6503	SO:0001583	missense	7004	exon8			CCTTTCTCTCAGC	X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000397122.2:c.154T>C	chr12.hg19:g.3128294T>C	ENSP00000380311:p.Ser52Pro	120.0	0.0		93.0	4.0	NM_003213	H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Missense_Mutation	SNP	ENST00000397122.2	hg19	CCDS41737.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.89|12.89	2.072748|2.072748	0.36566|0.36566	.|.	.|.	ENSG00000197905|ENSG00000197905	ENST00000544666|ENST00000358409;ENST00000359864;ENST00000397122	.|T;T;T	.|0.31247	.|1.5;1.5;1.5	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	.|0.065251	.|0.64402	.|D	.|0.000006	T|T	0.33818|0.33818	0.0876|0.0876	L|L	0.51422|0.51422	1.61|1.61	0.49798|0.49798	D|D	0.999824|0.999824	.|P	.|0.35242	.|0.492	.|P	.|0.44732	.|0.459	T|T	0.18335|0.18335	-1.0340|-1.0340	5|10	.|0.46703	.|T	.|0.11	-14.8685|-14.8685	6.854|6.854	0.24030|0.24030	0.1481:0.0:0.1539:0.698|0.1481:0.0:0.1539:0.698	.|.	.|181	.|Q15561	.|TEAD4_HUMAN	P|P	103|138;181;52	.|ENSP00000351184:S138P;ENSP00000352926:S181P;ENSP00000380311:S52P	.|ENSP00000351184:S138P	L|S	+|+	2|1	0|0	TEAD4|TEAD4	2998555|2998555	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	2.763000|2.763000	0.47605|0.47605	1.876000|1.876000	0.54355|0.54355	0.459000|0.459000	0.35465|0.35465	CTC|TCT	.	.		0.657	TEAD4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398477.1	NM_003213	
PZP	5858	hgsc.bcm.edu	37	12	9334596	9334596	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:9334596T>C	ENST00000261336.2	-	14	1692	c.1664A>G	c.(1663-1665)gAg>gGg	p.E555G	PZP_ENST00000381997.2_Missense_Mutation_p.E424G	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	555					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.S420_E426delSEKFEIE(1)|p.S551_E557delSEKFEIE(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						GTTTTCAATCTCAAATTTTTC	0.388																																					p.E555G	Melanoma(125;1402 1695 4685 34487 38571)	Atlas-SNP	.											.	PZP	422	.	2	Deletion - In frame(2)	prostate(2)	c.A1664G						.						55.0	57.0	57.0					12																	9334596		2203	4300	6503	SO:0001583	missense	5858	exon14			TCAATCTCAAATT	X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.1664A>G	chr12.hg19:g.9334596T>C	ENSP00000261336:p.Glu555Gly	132.0	0.0		123.0	6.0	NM_002864	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	ENST00000261336.2	hg19	CCDS8600.1	.	.	.	.	.	.	.	.	.	.	T	11.04	1.522000	0.27211	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.64438	-0.1;-0.1	3.94	2.68	0.31781	Alpha-2-macroglobulin, N-terminal 2 (1);	0.302961	0.26207	U	0.025715	T	0.68979	0.3060	M	0.86805	2.84	0.09310	N	1	P;P	0.45768	0.866;0.866	P;P	0.48598	0.583;0.507	T	0.62859	-0.6765	10	0.54805	T	0.06	.	7.6612	0.28404	0.0:0.0:0.2127:0.7873	.	424;555	P20742-2;P20742	.;PZP_HUMAN	G	555;424	ENSP00000261336:E555G;ENSP00000371427:E424G	ENSP00000261336:E555G	E	-	2	0	PZP	9225863	0.302000	0.24454	0.109000	0.21407	0.020000	0.10135	3.846000	0.55888	1.580000	0.49851	0.383000	0.25322	GAG	.	.		0.388	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337624.1	NM_002864	
EPS8	2059	hgsc.bcm.edu	37	12	15774278	15774278	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:15774278T>C	ENST00000281172.5	-	21	2878	c.2442A>G	c.(2440-2442)gaA>gaG	p.E814E	EPS8_ENST00000543612.1_Silent_p.E814E|EPS8_ENST00000543523.1_Silent_p.E814E|EPS8_ENST00000542903.1_Silent_p.E554E|EPS8_ENST00000540613.1_Silent_p.E554E	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	814	Effector region. {ECO:0000250}.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CATCAAAAGATTCCACTCCTG	0.378																																					p.E814E		Atlas-SNP	.											.	EPS8	70	.	0			c.A2442G						.						91.0	84.0	87.0					12																	15774278		2202	4300	6502	SO:0001819	synonymous_variant	2059	exon21			AAAAGATTCCACT	U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.2442A>G	chr12.hg19:g.15774278T>C		64.0	0.0		67.0	6.0	NM_004447	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Silent	SNP	ENST00000281172.5	hg19	CCDS31753.1																																																																																			.	.		0.378	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401093.1		
SLCO1B1	10599	hgsc.bcm.edu	37	12	21392086	21392086	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:21392086T>C	ENST00000256958.2	+	15	2135	c.2039T>C	c.(2038-2040)gTc>gCc	p.V680A		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	680					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	AAACATTTTGTCCCTTCTGCT	0.348																																					p.V680A		Atlas-SNP	.											.	SLCO1B1	151	.	0			c.T2039C						.						64.0	71.0	69.0					12																	21392086		2203	4300	6503	SO:0001583	missense	10599	exon15			ATTTTGTCCCTTC		CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.2039T>C	chr12.hg19:g.21392086T>C	ENSP00000256958:p.Val680Ala	67.0	0.0		70.0	4.0	NM_006446	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	ENST00000256958.2	hg19	CCDS8685.1	.	.	.	.	.	.	.	.	.	.	T	4.563	0.104523	0.08731	.	.	ENSG00000134538	ENST00000256958	T	0.37584	1.19	2.81	1.65	0.23941	.	15.110800	0.00397	N	0.000042	T	0.32102	0.0818	L	0.58101	1.795	0.09310	N	1	B	0.20780	0.048	B	0.16289	0.015	T	0.13098	-1.0522	10	0.08837	T	0.75	.	4.577	0.12238	0.0:0.1577:0.0:0.8423	.	680	Q9Y6L6	SO1B1_HUMAN	A	680	ENSP00000256958:V680A	ENSP00000256958:V680A	V	+	2	0	SLCO1B1	21283353	0.000000	0.05858	0.001000	0.08648	0.096000	0.18686	0.006000	0.13152	0.482000	0.27582	0.260000	0.18958	GTC	.	.		0.348	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402070.1	NM_006446	
SLCO1A2	6579	hgsc.bcm.edu	37	12	21453353	21453353	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:21453353T>C	ENST00000307378.6	-	9	1559	c.839A>G	c.(838-840)gAc>gGc	p.D280G	SLCO1A2_ENST00000390670.3_Missense_Mutation_p.D278G|SLCO1A2_ENST00000452078.1_Missense_Mutation_p.D280G|SLCO1A2_ENST00000537524.1_Missense_Mutation_p.D148G|SLCO1A2_ENST00000458504.1_Missense_Mutation_p.D148G	NM_134431.3	NP_602307.1	P46721	SO1A2_HUMAN	solute carrier organic anion transporter family, member 1A2	280					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(2)|endometrium(2)|kidney(4)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(6)|upper_aerodigestive_tract(1)	48					Aminohippurate(DB00345)|Atorvastatin(DB01076)|Bumetanide(DB00887)|Chlorambucil(DB00291)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Enalapril(DB00584)|Erythromycin(DB00199)|Estradiol(DB00783)|Estriol(DB04573)|Estrone(DB00655)|Fexofenadine(DB00950)|Glyburide(DB01016)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Indinavir(DB00224)|Indomethacin(DB00328)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Mirabegron(DB08893)|Naloxone(DB01183)|Naproxen(DB00788)|Nelfinavir(DB00220)|Ouabain(DB01092)|Pravastatin(DB00175)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rocuronium(DB00728)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Simvastatin(DB00641)|Spironolactone(DB00421)|Sumatriptan(DB00669)|Tauroursodeoxycholic acid(DB08834)|Testosterone(DB00624)|Tolbutamide(DB01124)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)	TTTAATGATGTCAGCATTAGT	0.343																																					p.D280G		Atlas-SNP	.											.	SLCO1A2	107	.	0			c.A839G						.						102.0	100.0	101.0					12																	21453353		2203	4300	6503	SO:0001583	missense	6579	exon9			ATGATGTCAGCAT		CCDS8686.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000084453	ENSG00000084453		"""Solute carriers"""	10956	protein-coding gene	gene with protein product		602883	"""solute carrier family 21 (organic anion transporter), member 3"""	SLC21A3		9007731	Standard	NM_134431		Approved	OATP, OATP1A2, OATP-A	uc001rer.3	P46721	OTTHUMG00000156259	ENST00000307378.6:c.839A>G	chr12.hg19:g.21453353T>C	ENSP00000305974:p.Asp280Gly	64.0	0.0		44.0	4.0	NM_134431	Q9UGP7|Q9UL38	Missense_Mutation	SNP	ENST00000307378.6	hg19	CCDS8686.1	.	.	.	.	.	.	.	.	.	.	T	13.41	2.229734	0.39399	.	.	ENSG00000084453	ENST00000307378;ENST00000452078;ENST00000458504;ENST00000537524;ENST00000390670	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.55	3.14	0.36123	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.575101	0.19124	N	0.122094	T	0.48390	0.1497	L	0.52573	1.65	0.09310	N	0.999999	B;B;B	0.13594	0.003;0.008;0.001	B;B;B	0.13407	0.009;0.009;0.008	T	0.34254	-0.9836	10	0.26408	T	0.33	.	10.3709	0.44053	0.0:0.1365:0.0:0.8635	.	260;278;280	Q8IV69;P46721-2;P46721	.;.;SO1A2_HUMAN	G	280;280;148;148;278	ENSP00000305974:D280G;ENSP00000393973:D280G;ENSP00000394854:D148G;ENSP00000439401:D148G;ENSP00000375088:D278G	ENSP00000305974:D280G	D	-	2	0	SLCO1A2	21344620	0.951000	0.32395	0.023000	0.16930	0.385000	0.30292	2.318000	0.43779	0.924000	0.37069	0.460000	0.39030	GAC	.	.		0.343	SLCO1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343648.3	NM_021094	
ITPR2	3709	hgsc.bcm.edu	37	12	26568256	26568256	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:26568256T>C	ENST00000381340.3	-	51	7702	c.7286A>G	c.(7285-7287)aAa>aGa	p.K2429R	RP11-513G19.1_ENST00000535324.1_RNA	NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	2429					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGTTCGGTTTTTCAGCCTATC	0.398																																					p.K2429R		Atlas-SNP	.											.	ITPR2	270	.	0			c.A7286G						.						105.0	100.0	102.0					12																	26568256		1853	4091	5944	SO:0001583	missense	3709	exon51			CGGTTTTTCAGCC	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.7286A>G	chr12.hg19:g.26568256T>C	ENSP00000370744:p.Lys2429Arg	87.0	0.0		100.0	4.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447444	0.43429	.	.	ENSG00000123104	ENST00000381340	D	0.91686	-2.89	5.08	2.6	0.31112	Ion transport (1);	0.128225	0.53938	D	0.000046	D	0.85008	0.5599	N	0.08118	0	0.80722	D	1	P	0.41624	0.757	P	0.50617	0.646	T	0.78663	-0.2116	10	0.16896	T	0.51	.	7.8866	0.29653	0.0:0.0721:0.1374:0.7905	.	2429	Q14571	ITPR2_HUMAN	R	2429	ENSP00000370744:K2429R	ENSP00000370744:K2429R	K	-	2	0	ITPR2	26459523	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.813000	0.48002	0.961000	0.38030	0.482000	0.46254	AAA	.	.		0.398	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
BICD1	636	hgsc.bcm.edu	37	12	32369322	32369322	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:32369322A>G	ENST00000281474.5	+	2	458	c.355A>G	c.(355-357)Agc>Ggc	p.S119G	BICD1_ENST00000548411.1_Missense_Mutation_p.S119G	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	119					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			GCTGAAACAGAGCCGGGCTGT	0.502																																					p.S119G		Atlas-SNP	.											.	BICD1	89	.	0			c.A355G						.						102.0	94.0	97.0					12																	32369322		2203	4300	6503	SO:0001583	missense	636	exon2			AAACAGAGCCGGG	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.355A>G	chr12.hg19:g.32369322A>G	ENSP00000281474:p.Ser119Gly	127.0	0.0		116.0	5.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.347499	0.82022	.	.	ENSG00000151746	ENST00000548411;ENST00000281474	T;T	0.30714	1.52;1.52	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	M	0.65975	2.015	0.80722	D	1	B;B	0.31655	0.058;0.334	B;B	0.34038	0.055;0.174	T	0.12142	-1.0559	10	0.35671	T	0.21	.	15.9745	0.80049	1.0:0.0:0.0:0.0	.	119;119	F8W113;Q96G01	.;BICD1_HUMAN	G	119	ENSP00000446793:S119G;ENSP00000281474:S119G	ENSP00000281474:S119G	S	+	1	0	BICD1	32260589	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.310000	0.78947	2.168000	0.68352	0.533000	0.62120	AGC	.	.		0.502	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
BICD1	636	hgsc.bcm.edu	37	12	32520657	32520657	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:32520657A>G	ENST00000281474.5	+	9	2921	c.2818A>G	c.(2818-2820)Agg>Ggg	p.R940G	BICD1_ENST00000548411.1_3'UTR	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	940					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ACTAGCCGGGAGGCAAGACTG	0.512																																					p.R940G		Atlas-SNP	.											.	BICD1	89	.	0			c.A2818G						.						122.0	105.0	111.0					12																	32520657		2203	4300	6503	SO:0001583	missense	636	exon9			GCCGGGAGGCAAG	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2818A>G	chr12.hg19:g.32520657A>G	ENSP00000281474:p.Arg940Gly	60.0	0.0		73.0	4.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	ENST00000281474.5	hg19	CCDS8726.1	.	.	.	.	.	.	.	.	.	.	A	12.17	1.857288	0.32791	.	.	ENSG00000151746	ENST00000281474	T	0.46063	0.88	5.25	4.1	0.47936	.	0.132974	0.34676	N	0.003777	T	0.18045	0.0433	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06250	-1.0837	10	0.11794	T	0.64	.	5.2631	0.15584	0.6824:0.1511:0.1665:0.0	.	940	Q96G01	BICD1_HUMAN	G	940	ENSP00000281474:R940G	ENSP00000281474:R940G	R	+	1	2	BICD1	32411924	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.404000	0.52623	0.830000	0.34757	0.482000	0.46254	AGG	.	.		0.512	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
RACGAP1	29127	hgsc.bcm.edu	37	12	50384062	50384062	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:50384062T>C	ENST00000427314.2	-	19	2111	c.1888A>G	c.(1888-1890)Atg>Gtg	p.M630V	RACGAP1_ENST00000551016.1_Missense_Mutation_p.M630V|RACGAP1_ENST00000434422.1_Missense_Mutation_p.M630V|RACGAP1_ENST00000454520.2_Missense_Mutation_p.M630V|RACGAP1_ENST00000548961.1_Intron|RACGAP1_ENST00000312377.5_Missense_Mutation_p.M630V|RACGAP1_ENST00000547905.1_Missense_Mutation_p.M630V	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						CACTTGAGCATTGGAGAAGCA	0.418																																					p.M630V		Atlas-SNP	.											.	RACGAP1	36	.	0			c.A1888G						.						131.0	116.0	121.0					12																	50384062		2203	4300	6503	SO:0001583	missense	29127	exon19			TGAGCATTGGAGA		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.1888A>G	chr12.hg19:g.50384062T>C	ENSP00000404190:p.Met630Val	83.0	0.0		75.0	5.0	NM_013277		Missense_Mutation	SNP	ENST00000427314.2	hg19	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	t	9.144	1.014630	0.19355	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905	T;T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87;1.87	4.69	0.658	0.17855	.	0.798245	0.12112	N	0.498426	T	0.17195	0.0413	L	0.44542	1.39	0.18873	N	0.999988	B	0.02656	0.0	B	0.01281	0.0	T	0.27536	-1.0071	10	0.34782	T	0.22	-0.931	2.2851	0.04124	0.3809:0.0725:0.1246:0.422	.	630	Q9H0H5	RGAP1_HUMAN	V	630	ENSP00000404190:M630V;ENSP00000309871:M630V;ENSP00000413241:M630V;ENSP00000404808:M630V;ENSP00000449374:M630V;ENSP00000449370:M630V	ENSP00000309871:M630V	M	-	1	0	RACGAP1	48670329	0.254000	0.23992	0.983000	0.44433	0.912000	0.54170	0.312000	0.19397	-0.073000	0.12842	-0.364000	0.07487	ATG	.	.		0.418	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
OR10A7	121364	hgsc.bcm.edu	37	12	55614885	55614885	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:55614885C>A	ENST00000326258.1	+	1	77	c.77C>A	c.(76-78)tCc>tAc	p.S26Y		NM_001005280.1	NP_001005280.1	Q8NGE5	O10A7_HUMAN	olfactory receptor, family 10, subfamily A, member 7	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|lung(11)|ovary(4)|prostate(2)|skin(3)	24						ATGCAAGTTTCCCTCTTTATT	0.383																																					p.S26Y		Atlas-SNP	.											.	OR10A7	53	.	0			c.C77A						.						221.0	227.0	225.0					12																	55614885		2203	4300	6503	SO:0001583	missense	121364	exon1			AAGTTTCCCTCTT	BK004327	CCDS31815.1	12q13.13	2012-08-09				ENSG00000179919		"""GPCR / Class A : Olfactory receptors"""	15329	protein-coding gene	gene with protein product							Standard	NM_001005280		Approved		uc010spf.2	Q8NGE5	OTTHUMG00000169860	ENST00000326258.1:c.77C>A	chr12.hg19:g.55614885C>A	ENSP00000326718:p.Ser26Tyr	263.0	1.0		176.0	82.0	NM_001005280	Q6IFD5|Q96R19	Missense_Mutation	SNP	ENST00000326258.1	hg19	CCDS31815.1	.	.	.	.	.	.	.	.	.	.	c	7.565	0.665485	0.14710	.	.	ENSG00000179919	ENST00000326258	T	0.00433	7.43	2.91	2.01	0.26516	.	0.396182	0.18651	N	0.134993	T	0.00241	0.0007	N	0.22421	0.69	0.09310	N	1	B	0.11235	0.004	B	0.12156	0.007	T	0.38520	-0.9657	10	0.38643	T	0.18	.	6.4416	0.21853	0.0:0.6947:0.0:0.3053	.	26	Q8NGE5	O10A7_HUMAN	Y	26	ENSP00000326718:S26Y	ENSP00000326718:S26Y	S	+	2	0	OR10A7	53901152	0.000000	0.05858	0.079000	0.20413	0.961000	0.63080	-0.565000	0.05929	0.797000	0.33971	0.637000	0.83480	TCC	.	.		0.383	OR10A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406308.1		
MARS	4141	hgsc.bcm.edu	37	12	57905511	57905511	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:57905511A>G	ENST00000262027.5	+	12	1533	c.1399A>G	c.(1399-1401)Agg>Ggg	p.R467G	RN7SL312P_ENST00000582079.1_RNA|MARS_ENST00000447721.2_3'UTR|RNU6-594P_ENST00000517056.1_RNA|MARS_ENST00000315473.5_Missense_Mutation_p.R233G	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	467					gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	GTGGTTGGGGAGGACATTGCC	0.507																																					p.R467G		Atlas-SNP	.											.	MARS	84	.	0			c.A1399G						.						133.0	113.0	119.0					12																	57905511		2203	4300	6503	SO:0001583	missense	4141	exon12			TTGGGGAGGACAT	X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.1399A>G	chr12.hg19:g.57905511A>G	ENSP00000262027:p.Arg467Gly	101.0	0.0		124.0	5.0	NM_004990	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	ENST00000262027.5	hg19	CCDS8942.1	.	.	.	.	.	.	.	.	.	.	A	14.46	2.540758	0.45280	.	.	ENSG00000166986	ENST00000262027;ENST00000315473	T;T	0.44482	1.5;0.92	5.1	5.1	0.69264	Aminoacyl-tRNA synthetase, class I (M) (1);Rossmann-like alpha/beta/alpha sandwich fold (1);	0.145183	0.64402	D	0.000011	T	0.20047	0.0482	N	0.02973	-0.45	0.29710	N	0.839494	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.09058	-1.0692	10	0.42905	T	0.14	-10.2481	10.7769	0.46354	0.8411:0.1589:0.0:0.0	.	233;340;467	A6NC17;B4E0E9;P56192	.;.;SYMC_HUMAN	G	467;233	ENSP00000262027:R467G;ENSP00000314653:R233G	ENSP00000262027:R467G	R	+	1	2	MARS	56191778	0.997000	0.39634	0.933000	0.37362	0.970000	0.65996	2.242000	0.43106	2.053000	0.61076	0.402000	0.26972	AGG	.	.		0.507	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407014.1	NM_004990	
LRIG3	121227	hgsc.bcm.edu	37	12	59274407	59274407	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:59274407T>C	ENST00000320743.3	-	13	2043	c.1757A>G	c.(1756-1758)cAc>cGc	p.H586R	LRIG3_ENST00000379141.4_Missense_Mutation_p.H526R	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	586	Ig-like C2-type 1.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			TGAACCAAAGTGATTGGAGAT	0.448			T	ROS1	NSCLC																																p.H586R		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.A1757G						.						72.0	67.0	69.0					12																	59274407		2203	4300	6503	SO:0001583	missense	121227	exon13			CCAAAGTGATTGG	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1757A>G	chr12.hg19:g.59274407T>C	ENSP00000326759:p.His586Arg	135.0	0.0		119.0	5.0	NM_153377	Q6UXL7|Q8NC72	Missense_Mutation	SNP	ENST00000320743.3	hg19	CCDS8960.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.073961	0.76415	.	.	ENSG00000139263	ENST00000379141;ENST00000320743	T;T	0.65549	-0.16;-0.16	6.04	6.04	0.98038	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.39083	N	0.001467	T	0.70649	0.3248	L	0.37507	1.11	0.58432	D	0.999998	P;D	0.64830	0.881;0.994	P;D	0.68353	0.874;0.957	T	0.68454	-0.5404	9	.	.	.	.	16.5763	0.84648	0.0:0.0:0.0:1.0	.	526;586	Q6UXM1-2;Q6UXM1	.;LRIG3_HUMAN	R	526;586	ENSP00000368436:H526R;ENSP00000326759:H586R	.	H	-	2	0	LRIG3	57560674	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.075000	0.71261	2.317000	0.78254	0.459000	0.35465	CAC	.	.		0.448	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
LRIG3	121227	hgsc.bcm.edu	37	12	59276667	59276667	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:59276667T>C	ENST00000320743.3	-	12	1750	c.1464A>G	c.(1462-1464)ccA>ccG	p.P488P	LRIG3_ENST00000379141.4_Silent_p.P428P	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	488	LRRCT.				otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.P488P(1)	LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CAAAGCCATCTGGGCTAACAG	0.413			T	ROS1	NSCLC																																p.P488P		Atlas-SNP	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	LRIG3,NS,carcinoma,0,1	LRIG3	120	.	1	Substitution - coding silent(1)	kidney(1)	c.A1464G						.						90.0	84.0	86.0					12																	59276667		2203	4300	6503	SO:0001819	synonymous_variant	121227	exon12			GCCATCTGGGCTA	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.1464A>G	chr12.hg19:g.59276667T>C		69.0	0.0		72.0	3.0	NM_153377	Q6UXL7|Q8NC72	Silent	SNP	ENST00000320743.3	hg19	CCDS8960.1																																																																																			.	.		0.413	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
TMBIM4	51643	hgsc.bcm.edu	37	12	66531841	66531841	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:66531841A>G	ENST00000358230.3	-	7	736	c.616T>C	c.(616-618)Tca>Cca	p.S206P	TMBIM4_ENST00000542724.1_Missense_Mutation_p.S175P|TMBIM4_ENST00000398033.4_3'UTR|TMBIM4_ENST00000539652.1_3'UTR|TMBIM4_ENST00000556010.1_3'UTR|TMBIM4_ENST00000286424.7_Missense_Mutation_p.S253P|TMBIM4_ENST00000544599.1_Missense_Mutation_p.S29P	NM_016056.2	NP_057140.2	Q9HC24	LFG4_HUMAN	transmembrane BAX inhibitor motif containing 4	206					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|regulation of calcium-mediated signaling (GO:0050848)	Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|ovary(1)|prostate(2)	9				GBM - Glioblastoma multiforme(28;0.0745)		TCTTCAGGTGACAGTTTATGC	0.413																																					p.S206P		Atlas-SNP	.											.	TMBIM4	47	.	0			c.T616C						.						123.0	120.0	121.0					12																	66531841		1946	4151	6097	SO:0001583	missense	51643	exon7			CAGGTGACAGTTT	AF113127	CCDS41805.1, CCDS61187.1, CCDS73493.1	12q14.3	2014-05-09			ENSG00000155957	ENSG00000155957			24257	protein-coding gene	gene with protein product						11042152, 10810093	Standard	NM_001282609		Approved	CGI-119, S1R, ZPRO, LFG4, GAAP	uc001stc.3	Q9HC24	OTTHUMG00000168973	ENST00000358230.3:c.616T>C	chr12.hg19:g.66531841A>G	ENSP00000350965:p.Ser206Pro	114.0	0.0		81.0	4.0	NM_016056	Q542Z6|Q9UHY5|Q9Y3C2	Missense_Mutation	SNP	ENST00000358230.3	hg19	CCDS41805.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.928131	0.92389	.	.	ENSG00000155957	ENST00000358230;ENST00000544599;ENST00000286424;ENST00000539043;ENST00000539427;ENST00000542724	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.70245	0.3202	M	0.87097	2.86	0.80722	D	1	P;D;D	0.89917	0.746;1.0;1.0	P;D;D	0.97110	0.561;1.0;1.0	T	0.74515	-0.3640	9	.	.	.	-11.1003	16.8222	0.85835	1.0:0.0:0.0:0.0	.	253;175;206	G3XAA5;G3V1M2;Q9HC24	.;.;TMBI4_HUMAN	P	206;29;253;206;251;175	ENSP00000350965:S206P;ENSP00000444639:S29P;ENSP00000286424:S253P;ENSP00000441291:S175P	.	S	-	1	0	TMBIM4	64818108	1.000000	0.71417	0.943000	0.38184	0.988000	0.76386	8.222000	0.89777	2.371000	0.80710	0.533000	0.62120	TCA	.	.		0.413	TMBIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401832.2	NM_016056	
CPSF6	11052	hgsc.bcm.edu	37	12	69644987	69644987	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:69644987C>T	ENST00000435070.2	+	2	249	c.139C>T	c.(139-141)Cca>Tca	p.P47S	CPSF6_ENST00000456847.3_Missense_Mutation_p.P47S|CPSF6_ENST00000266679.8_Missense_Mutation_p.P47S|CPSF6_ENST00000551516.1_Intron|CPSF6_ENST00000550987.1_3'UTR	NM_007007.2	NP_008938.2	Q16630	CPSF6_HUMAN	cleavage and polyadenylation specific factor 6, 68kDa	47					mRNA polyadenylation (GO:0006378)|mRNA processing (GO:0006397)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleus (GO:0005634)|paraspeckles (GO:0042382)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(7)|lung(8)	16	all_epithelial(5;2.47e-36)|Lung NSC(4;1.1e-32)|all_lung(4;6.26e-31)|Breast(13;1.59e-06)|Esophageal squamous(21;0.187)		Epithelial(6;4.89e-17)|BRCA - Breast invasive adenocarcinoma(5;8.5e-10)|Lung(24;6.04e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.171)|Kidney(9;0.241)			TGGAGATGCCCCAGAAGACCG	0.423																																					p.P47S		Atlas-SNP	.											.	CPSF6	96	.	0			c.C139T						.						87.0	76.0	80.0					12																	69644987		2203	4300	6503	SO:0001583	missense	11052	exon2			GATGCCCCAGAAG	X67336	CCDS8988.1, CCDS73494.1	12q15	2013-06-18	2002-08-29			ENSG00000111605		"""RNA binding motif (RRM) containing"""	13871	protein-coding gene	gene with protein product	"""cleavage factor Im complex 68 kDa subunit"""	604979	"""cleavage and polyadenylation specific factor 6, 68kD subunit"""			9659921, 17267687	Standard	NM_007007		Approved	CFIM, HPBRII-4, HPBRII-7, CFIM68	uc001sut.4	Q16630		ENST00000435070.2:c.139C>T	chr12.hg19:g.69644987C>T	ENSP00000391774:p.Pro47Ser	89.0	0.0		69.0	4.0	NM_007007	A8K7K9|Q53ES1|Q9BSJ7|Q9BW18	Missense_Mutation	SNP	ENST00000435070.2	hg19	CCDS8988.1	.	.	.	.	.	.	.	.	.	.	C	22.8	4.334606	0.81801	.	.	ENSG00000111605	ENST00000435070;ENST00000456847;ENST00000266679	.	.	.	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.49440	0.1557	L	0.38531	1.155	0.80722	D	1	P;B	0.38167	0.621;0.244	B;B	0.36845	0.234;0.18	T	0.47018	-0.9149	8	.	.	.	-5.016	18.5948	0.91226	0.0:1.0:0.0:0.0	.	47;47	Q16630-2;Q16630	.;CPSF6_HUMAN	S	47	.	.	P	+	1	0	CPSF6	67931254	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.440000	0.80464	2.558000	0.86282	0.563000	0.77884	CCA	.	.		0.423	CPSF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403609.1	NM_007007	
CNOT2	4848	hgsc.bcm.edu	37	12	70724192	70724192	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:70724192C>A	ENST00000418359.3	+	7	963	c.512C>A	c.(511-513)cCa>cAa	p.P171Q	CNOT2_ENST00000548230.1_3'UTR|CNOT2_ENST00000229195.3_Missense_Mutation_p.P171Q	NM_001199302.1	NP_001186231.1	Q9NZN8	CNOT2_HUMAN	CCR4-NOT transcription complex, subunit 2	171					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription corepressor binding (GO:0001226)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|pancreas(2)|urinary_tract(1)	20	Renal(347;0.236)		GBM - Glioblastoma multiforme(1;4.77e-09)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00243)|STAD - Stomach adenocarcinoma(21;0.0118)			AGAAGCTCGCCAAGCATAATA	0.443																																					p.P171Q		Atlas-SNP	.											.	CNOT2	53	.	0			c.C512A						.						147.0	138.0	141.0					12																	70724192		2203	4300	6503	SO:0001583	missense	4848	exon7			GCTCGCCAAGCAT	AF180473	CCDS31857.1	12q15	2008-05-14				ENSG00000111596			7878	protein-coding gene	gene with protein product		604909		NOT2		10637334	Standard	NM_014515		Approved	CDC36, NOT2H	uc001svv.3	Q9NZN8		ENST00000418359.3:c.512C>A	chr12.hg19:g.70724192C>A	ENSP00000412091:p.Pro171Gln	199.0	0.0		126.0	70.0	NM_001199302	Q9H3E0|Q9NSX5|Q9NWR6|Q9P028	Missense_Mutation	SNP	ENST00000418359.3	hg19	CCDS31857.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630056	0.67015	.	.	ENSG00000111596	ENST00000552231;ENST00000229195;ENST00000418359;ENST00000550641;ENST00000548159;ENST00000549750;ENST00000551043;ENST00000551873;ENST00000550194	T;T;T;T	0.44083	0.93;0.93;0.94;0.93	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.54679	0.1873	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.39418	-0.9615	10	0.21014	T	0.42	-5.4664	19.8769	0.96880	0.0:1.0:0.0:0.0	.	171	Q9NZN8	CNOT2_HUMAN	Q	171;171;171;151;162;171;171;86;171	ENSP00000229195:P171Q;ENSP00000412091:P171Q;ENSP00000449659:P162Q;ENSP00000449260:P171Q	ENSP00000229195:P171Q	P	+	2	0	CNOT2	69010459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.767000	0.95098	0.557000	0.71058	CCA	.	.		0.443	CNOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404260.1		
NAV3	89795	hgsc.bcm.edu	37	12	78388596	78388596	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:78388596T>C	ENST00000397909.2	+	6	858	c.685T>C	c.(685-687)Tat>Cat	p.Y229H	NAV3_ENST00000228327.6_Missense_Mutation_p.Y229H|NAV3_ENST00000536525.2_Missense_Mutation_p.Y229H|NAV3_ENST00000266692.7_Missense_Mutation_p.Y229H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	229						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						GGCAGCCAGATATGCAACTCA	0.338										HNSCC(70;0.22)																											p.Y229H		Atlas-SNP	.											.	NAV3	506	.	0			c.T685C						.						134.0	126.0	128.0					12																	78388596		1829	4106	5935	SO:0001583	missense	89795	exon6			GCCAGATATGCAA	AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.685T>C	chr12.hg19:g.78388596T>C	ENSP00000381007:p.Tyr229His	89.0	0.0		56.0	4.0	NM_014903	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	ENST00000397909.2	hg19		.	.	.	.	.	.	.	.	.	.	T	15.81	2.943815	0.53079	.	.	ENSG00000067798	ENST00000549464;ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692	T;T;T;T;T	0.41065	1.01;1.01;1.01;1.01;1.01	5.95	5.95	0.96441	.	0.465406	0.15758	U	0.246047	T	0.49338	0.1551	N	0.19112	0.55	0.80722	D	1	P;D	0.89917	0.664;1.0	B;D	0.85130	0.347;0.997	T	0.33523	-0.9865	10	0.15952	T	0.53	-16.1262	16.4237	0.83790	0.0:0.0:0.0:1.0	.	229;229	Q8IVL0;Q8IVL0-2	NAV3_HUMAN;.	H	229	ENSP00000446628:Y229H;ENSP00000446132:Y229H;ENSP00000381007:Y229H;ENSP00000228327:Y229H;ENSP00000266692:Y229H	ENSP00000228327:Y229H	Y	+	1	0	NAV3	76912727	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.347000	0.65998	2.279000	0.76181	0.533000	0.62120	TAT	.	.		0.338	NAV3-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000406812.1	NM_001024383	
PPP1R12A	4659	hgsc.bcm.edu	37	12	80191131	80191131	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:80191131T>C	ENST00000450142.2	-	16	2402	c.2136A>G	c.(2134-2136)ggA>ggG	p.G712G	PPP1R12A_ENST00000261207.5_Silent_p.G712G|PPP1R12A_ENST00000437004.2_Silent_p.G712G|PPP1R12A_ENST00000546369.1_Silent_p.G625G|PPP1R12A_ENST00000550107.1_Silent_p.G656G	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	712	Interaction with ROCK2.				centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						AACGACTTCTTCCTATTGTTT	0.343																																					p.G712G		Atlas-SNP	.											.	PPP1R12A	76	.	0			c.A2136G						.						82.0	68.0	72.0					12																	80191131		1826	4083	5909	SO:0001819	synonymous_variant	4659	exon16			ACTTCTTCCTATT	D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.2136A>G	chr12.hg19:g.80191131T>C		97.0	0.0		69.0	4.0	NM_002480	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Silent	SNP	ENST00000450142.2	hg19	CCDS44947.1	.	.	.	.	.	.	.	.	.	.	T	9.648	1.140698	0.21205	.	.	ENSG00000058272	ENST00000553081	.	.	.	5.31	4.16	0.48862	.	.	.	.	.	T	0.47021	0.1423	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40664	-0.9551	4	.	.	.	.	3.2024	0.06653	0.1379:0.0752:0.1435:0.6435	.	.	.	.	G	304	.	.	E	-	2	0	PPP1R12A	78715262	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.393000	0.44442	0.850000	0.35239	0.482000	0.46254	GAA	.	.		0.343	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407254.2	NM_002480	
VEZT	55591	hgsc.bcm.edu	37	12	95650962	95650962	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:95650962A>G	ENST00000436874.1	+	3	310	c.205A>G	c.(205-207)Agt>Ggt	p.S69G	VEZT_ENST00000356859.4_3'UTR|VEZT_ENST00000261219.6_Missense_Mutation_p.S21G	NM_017599.3	NP_060069.3	Q9HBM0	VEZA_HUMAN	vezatin, adherens junctions transmembrane protein	69					chordate embryonic development (GO:0043009)|single organismal cell-cell adhesion (GO:0016337)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|stereocilia ankle link complex (GO:0002142)				endometrium(2)|kidney(3)|large_intestine(1)|lung(14)|ovary(2)|upper_aerodigestive_tract(1)	23						AACCATCAAAAGTTGGATTTT	0.348																																					p.S69G		Atlas-SNP	.											.	VEZT	106	.	0			c.A205G						.						97.0	92.0	94.0					12																	95650962		1825	4073	5898	SO:0001583	missense	55591	exon3			ATCAAAAGTTGGA	AF216644	CCDS44954.1	12q22	2011-02-15			ENSG00000028203	ENSG00000028203			18258	protein-coding gene	gene with protein product						11080149, 16199027, 21156161	Standard	NM_017599		Approved	DKFZP761C241	uc001tdz.2	Q9HBM0	OTTHUMG00000170182	ENST00000436874.1:c.205A>G	chr12.hg19:g.95650962A>G	ENSP00000410083:p.Ser69Gly	75.0	0.0		42.0	4.0	NM_017599	Q6P1Q3|Q9H2F4|Q9H2U5|Q9NT70|Q9NVW0|Q9UF91	Missense_Mutation	SNP	ENST00000436874.1	hg19	CCDS44954.1	.	.	.	.	.	.	.	.	.	.	A	16.65	3.181072	0.57800	.	.	ENSG00000028203	ENST00000436874;ENST00000261219;ENST00000551472;ENST00000552821;ENST00000551311;ENST00000397792;ENST00000397796	T;T;T;T	0.46819	2.41;2.44;0.86;2.44	5.58	5.58	0.84498	.	0.322723	0.41294	D	0.000917	T	0.41328	0.1154	L	0.38175	1.15	0.36491	D	0.868436	B;B;B;B	0.30686	0.24;0.191;0.29;0.191	B;B;B;B	0.29785	0.067;0.049;0.107;0.03	T	0.51036	-0.8756	10	0.54805	T	0.06	-23.309	15.7537	0.78009	1.0:0.0:0.0:0.0	.	69;69;21;21	C9J154;Q9HBM0;F8W8C2;F2Z3A6	.;VEZA_HUMAN;.;.	G	69;21;88;60;21;21;69	ENSP00000410083:S69G;ENSP00000261219:S21G;ENSP00000449701:S88G;ENSP00000380894:S21G	ENSP00000261219:S21G	S	+	1	0	VEZT	94175093	1.000000	0.71417	0.997000	0.53966	0.836000	0.47400	6.326000	0.72905	2.126000	0.65437	0.383000	0.25322	AGT	.	.		0.348	VEZT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407804.2	NM_017599	
IKBIP	121457	hgsc.bcm.edu	37	12	99007913	99007913	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:99007913A>G	ENST00000342502.2	-	3	914	c.503T>C	c.(502-504)gTt>gCt	p.V168A	IKBIP_ENST00000420861.1_Missense_Mutation_p.V62A|IKBIP_ENST00000393042.3_3'UTR	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein	168					response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						CTTGAGACCAACATCTTTTGC	0.353																																					p.V168A		Atlas-SNP	.											.	IKBIP	46	.	0			c.T503C						.						100.0	91.0	94.0					12																	99007913		2203	4300	6503	SO:0001583	missense	121457	exon3			AGACCAACATCTT	AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.503T>C	chr12.hg19:g.99007913A>G	ENSP00000343471:p.Val168Ala	101.0	0.0		79.0	4.0	NM_201612	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	ENST00000342502.2	hg19	CCDS9067.1	.	.	.	.	.	.	.	.	.	.	A	15.02	2.708374	0.48517	.	.	ENSG00000166130	ENST00000342502;ENST00000420861	T;T	0.55588	0.66;0.51	5.48	5.48	0.80851	.	.	.	.	.	T	0.50103	0.1596	L	0.61218	1.895	0.09310	N	1	P	0.42692	0.787	B	0.34536	0.185	T	0.54364	-0.8305	9	0.66056	D	0.02	.	15.5806	0.76432	1.0:0.0:0.0:0.0	.	168	Q70UQ0	IKIP_HUMAN	A	168;62	ENSP00000343471:V168A;ENSP00000398023:V62A	ENSP00000343471:V168A	V	-	2	0	IKBIP	97532044	0.540000	0.26410	0.819000	0.32651	0.992000	0.81027	6.709000	0.74665	2.084000	0.62774	0.533000	0.62120	GTT	.	.		0.353	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
BCL7A	605	hgsc.bcm.edu	37	12	122492735	122492735	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:122492735A>G	ENST00000261822.4	+	5	670	c.464A>G	c.(463-465)cAg>cGg	p.Q155R	BCL7A_ENST00000538010.1_Missense_Mutation_p.Q155R	NM_001024808.1	NP_001019979.1	Q4VC05	BCL7A_HUMAN	B-cell CLL/lymphoma 7A	155					negative regulation of transcription, DNA-templated (GO:0045892)					haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	18	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000202)|Epithelial(86;0.000386)|BRCA - Breast invasive adenocarcinoma(302;0.231)		CAGAATTCACAGTCCTCGATG	0.537			T	MYC	BNHL						OREG0022214	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q155R	GBM(17;197 467 16477 23242 44349)	Atlas-SNP	.		Dom	yes		12	12q24.1	605	B-cell CLL/lymphoma 7A		L	.	BCL7A	31	.	0			c.A464G						.						129.0	136.0	134.0					12																	122492735		2203	4300	6503	SO:0001583	missense	605	exon5			ATTCACAGTCCTC	X89984	CCDS9226.1, CCDS53841.1	12q24.1	2008-07-03			ENSG00000110987	ENSG00000110987			1004	protein-coding gene	gene with protein product		601406		BCL7		8605326, 9931421	Standard	NM_020993		Approved		uc001ubo.3	Q4VC05	OTTHUMG00000168951	ENST00000261822.4:c.464A>G	chr12.hg19:g.122492735A>G	ENSP00000261822:p.Gln155Arg	68.0	0.0	1519	75.0	4.0	NM_020993	B4DJN6|B7ZB21|Q13843|Q14CT7	Missense_Mutation	SNP	ENST00000261822.4	hg19	CCDS53841.1	.	.	.	.	.	.	.	.	.	.	A	12.23	1.875805	0.33162	.	.	ENSG00000110987	ENST00000538010;ENST00000261822	T;T	0.46451	0.87;0.9	6.07	4.91	0.64330	.	0.171731	0.52532	D	0.000080	T	0.30039	0.0752	N	0.19112	0.55	0.43342	D	0.995396	P;P	0.41848	0.651;0.763	B;B	0.42282	0.115;0.382	T	0.03095	-1.1073	10	0.18276	T	0.48	.	12.6969	0.57010	0.8763:0.0:0.0:0.1236	.	155;155	Q4VC05;Q4VC05-2	BCL7A_HUMAN;.	R	155	ENSP00000445868:Q155R;ENSP00000261822:Q155R	ENSP00000261822:Q155R	Q	+	2	0	BCL7A	120977118	1.000000	0.71417	0.976000	0.42696	0.819000	0.46315	4.651000	0.61447	1.093000	0.41377	-0.333000	0.08304	CAG	.	.		0.537	BCL7A-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000401712.1		
TMEM132C	92293	hgsc.bcm.edu	37	12	129189690	129189690	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:129189690A>G	ENST00000435159.2	+	9	2177	c.2177A>G	c.(2176-2178)gAc>gGc	p.D726G	TMEM132C_ENST00000537538.1_Missense_Mutation_p.D111G|TMEM132C_ENST00000315208.8_Missense_Mutation_p.D342G	NM_001136103.2	NP_001129575.2	Q8N3T6	T132C_HUMAN	transmembrane protein 132C	726						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|lung(2)|prostate(2)|skin(1)	13						ACGCCCCTGGACATCTACGAC	0.622																																					p.D726G		Atlas-SNP	.											.	TMEM132C	142	.	0			c.A2177G						.						61.0	61.0	61.0					12																	129189690		692	1591	2283	SO:0001583	missense	92293	exon9			CCCTGGACATCTA	AK126715		12q24.32	2014-06-13				ENSG00000181234			25436	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 152"""						Standard	NM_001136103		Approved	DKFZp761O2018, PPP1R152	uc021rgn.1	Q8N3T6		ENST00000435159.2:c.2177A>G	chr12.hg19:g.129189690A>G	ENSP00000410852:p.Asp726Gly	49.0	0.0		45.0	4.0	NM_001136103	Q69YX8	Missense_Mutation	SNP	ENST00000435159.2	hg19		.	.	.	.	.	.	.	.	.	.	A	21.8	4.199651	0.79015	.	.	ENSG00000181234	ENST00000435159;ENST00000315208;ENST00000537538	T;T;T	0.13307	2.6;2.6;2.6	4.84	4.84	0.62591	.	0.000000	0.64402	D	0.000010	T	0.41743	0.1172	M	0.84683	2.71	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.46512	-0.9186	10	0.59425	D	0.04	.	14.4293	0.67238	1.0:0.0:0.0:0.0	.	726	Q8N3T6	T132C_HUMAN	G	726;342;111	ENSP00000410852:D726G;ENSP00000324458:D342G;ENSP00000438477:D111G	ENSP00000324458:D342G	D	+	2	0	TMEM132C	127755643	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.002000	0.93572	1.810000	0.52873	0.533000	0.62120	GAC	.	.		0.622	TMEM132C-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		XM_044062	
RAN	5901	hgsc.bcm.edu	37	12	131359255	131359255	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr12:131359255T>C	ENST00000543796.1	+	5	670	c.412T>C	c.(412-414)Ttc>Ctc	p.F138L	RAN_ENST00000392369.2_Missense_Mutation_p.F138L|RAN_ENST00000254675.3_Missense_Mutation_p.F50L|RAN_ENST00000392367.3_Missense_Mutation_p.F155L|RAN_ENST00000541630.1_Missense_Mutation_p.F50L			P62826	RAN_HUMAN	RAN, member RAS oncogene family	138					actin cytoskeleton organization (GO:0030036)|androgen receptor signaling pathway (GO:0030521)|cellular protein complex localization (GO:0034629)|DNA metabolic process (GO:0006259)|gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription, DNA-templated (GO:0045893)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(2)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	Lung NSC(355;7.46e-07)|all_epithelial(31;7.36e-06)		OV - Ovarian serous cystadenocarcinoma(86;9.18e-49)|Epithelial(86;1.42e-45)|all cancers(50;6.28e-40)		ATCCATTGTCTTCCACCGAAA	0.393																																					p.F138L		Atlas-SNP	.											.	RAN	18	.	0			c.T412C						.						88.0	79.0	82.0					12																	131359255		2203	4300	6503	SO:0001583	missense	5901	exon5			ATTGTCTTCCACC	M31469	CCDS9271.1, CCDS73546.1	12q24.33	2014-05-09			ENSG00000132341	ENSG00000132341			9846	protein-coding gene	gene with protein product		601179				8421051	Standard	XM_005253592		Approved	ARA24, TC4, Gsp1	uc001uir.3	P62826	OTTHUMG00000134328	ENST00000543796.1:c.412T>C	chr12.hg19:g.131359255T>C	ENSP00000446215:p.Phe138Leu	114.0	0.0		95.0	4.0	NM_006325	A8K3Z8|P17080|P28746|P28747|Q6IPB2|Q86V08|Q8NI90|Q9CSP3|Q9CWI7|Q9CZA2|Q9UDJ5|Q9UEU9	Missense_Mutation	SNP	ENST00000543796.1	hg19	CCDS9271.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.809451	0.70797	.	.	ENSG00000132341	ENST00000543796;ENST00000448750;ENST00000541630;ENST00000392369;ENST00000254675;ENST00000535090;ENST00000392367	T;T;T;T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.84;-0.84;-0.84;-0.84	3.94	3.94	0.45596	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.68118	0.2966	L	0.52266	1.64	0.80722	D	1	P;P	0.46277	0.875;0.875	B;B	0.40565	0.333;0.333	T	0.73341	-0.4013	10	0.87932	D	0	-11.6413	12.2939	0.54833	0.0:0.0:0.0:1.0	.	138;138	A8K3Z8;P62826	.;RAN_HUMAN	L	138;156;50;138;50;134;155	ENSP00000446215:F138L;ENSP00000396127:F156L;ENSP00000441210:F50L;ENSP00000376176:F138L;ENSP00000254675:F50L;ENSP00000444042:F134L;ENSP00000376174:F155L	ENSP00000254675:F50L	F	+	1	0	RAN	129925208	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.590000	0.82653	1.554000	0.49487	0.460000	0.39030	TTC	.	.		0.393	RAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259441.2	NM_006325	
SACS	26278	hgsc.bcm.edu	37	13	23915617	23915617	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:23915617T>C	ENST00000382292.3	-	9	2671	c.2398A>G	c.(2398-2400)Atg>Gtg	p.M800V	SACS_ENST00000382298.3_Missense_Mutation_p.M800V|SACS_ENST00000402364.1_Missense_Mutation_p.M50V			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	800					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)	p.M653L(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		ATAAGTGGCATCTCATCAAAT	0.358																																					p.M800V		Atlas-SNP	.											SACS,colon,carcinoma,0,1	SACS	871	.	1	Substitution - Missense(1)	large_intestine(1)	c.A2398G						.						79.0	79.0	79.0					13																	23915617		2203	4300	6503	SO:0001583	missense	26278	exon10			GTGGCATCTCATC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.2398A>G	chr13.hg19:g.23915617T>C	ENSP00000371729:p.Met800Val	50.0	0.0		35.0	2.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.65|12.65	2.002593|2.002593	0.35320|0.35320	.|.	.|.	ENSG00000151835|ENSG00000151835	ENST00000455470|ENST00000382292;ENST00000402364;ENST00000382298	.|D;D;D	.|0.86627	.|-2.04;-2.15;-2.04	6.05|6.05	4.85|4.85	0.62838|0.62838	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83317|0.83317	0.5228|0.5228	L|L	0.46741|0.46741	1.465|1.465	0.36329|0.36329	D|D	0.858766|0.858766	.|P;B	.|0.49783	.|0.928;0.053	.|B;B	.|0.44108	.|0.441;0.02	D|D	0.84155|0.84155	0.0425|0.0425	5|10	.|0.35671	.|T	.|0.21	.|.	10.5988|10.5988	0.45354|0.45354	0.2571:0.0:0.0:0.7429|0.2571:0.0:0.0:0.7429	.|.	.|699;800	.|B2REB1;Q9NZJ4	.|.;SACS_HUMAN	G|V	699|800;50;800	.|ENSP00000371729:M800V;ENSP00000385844:M50V;ENSP00000371735:M800V	.|ENSP00000371729:M800V	D|M	-|-	2|1	0|0	SACS|SACS	22813617|22813617	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	4.618000|4.618000	0.61211|0.61211	1.089000|1.089000	0.41292|0.41292	-0.341000|-0.341000	0.08007|0.08007	GAT|ATG	.	.		0.358	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
RNF17	56163	hgsc.bcm.edu	37	13	25399863	25399863	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:25399863G>A	ENST00000255324.5	+	16	2250	c.2198G>A	c.(2197-2199)tGt>tAt	p.C733Y	RNF17_ENST00000381921.1_Missense_Mutation_p.C733Y	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	733	Tudor 1. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		GATCAAGCCTGTGTAGCTAAA	0.368																																					p.C733Y		Atlas-SNP	.											.	RNF17	259	.	0			c.G2198A						.						105.0	101.0	103.0					13																	25399863		2203	4300	6503	SO:0001583	missense	56163	exon16			AAGCCTGTGTAGC	AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2198G>A	chr13.hg19:g.25399863G>A	ENSP00000255324:p.Cys733Tyr	87.0	0.0		45.0	4.0	NM_001184993	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	ENST00000255324.5	hg19	CCDS9308.2	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095649	0.56075	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120	T;T;T	0.16743	2.32;2.32;2.32	4.69	4.69	0.59074	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.269718	0.36703	N	0.002453	T	0.42720	0.1215	M	0.77820	2.39	0.80722	D	1	D;P	0.76494	0.999;0.843	D;P	0.87578	0.998;0.682	T	0.32640	-0.9899	10	0.45353	T	0.12	.	14.9002	0.70672	0.0:0.0:1.0:0.0	.	733;733	B7Z7S1;Q9BXT8	.;RNF17_HUMAN	Y	733;733;592;57	ENSP00000255324:C733Y;ENSP00000371346:C733Y;ENSP00000388892:C57Y	ENSP00000255324:C733Y	C	+	2	0	RNF17	24297863	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	5.781000	0.68964	2.312000	0.78011	0.491000	0.48974	TGT	.	.		0.368	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044217.1	NM_031994	
FRY	10129	hgsc.bcm.edu	37	13	32698997	32698997	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:32698997T>C	ENST00000380250.3	+	7	1197	c.701T>C	c.(700-702)gTg>gCg	p.V234A		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	234						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GTCATTGGAGTGTTGGCACAA	0.468																																					p.V234A		Atlas-SNP	.											.	FRY	312	.	0			c.T701C						.						134.0	132.0	133.0					13																	32698997		1969	4160	6129	SO:0001583	missense	10129	exon7			TTGGAGTGTTGGC	AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.701T>C	chr13.hg19:g.32698997T>C	ENSP00000369600:p.Val234Ala	92.0	0.0		87.0	4.0	NM_023037	Q9Y3N6	Missense_Mutation	SNP	ENST00000380250.3	hg19	CCDS41875.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.9|25.9	4.684629|4.684629	0.88639|0.88639	.|.	.|.	ENSG00000073910|ENSG00000073910	ENST00000267067|ENST00000380250	.|T	.|0.25414	.|1.8	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.46776|0.46776	0.1410|0.1410	M|M	0.74546|0.74546	2.27|2.27	0.80722|0.80722	D|D	1|1	.|P	.|0.45283	.|0.855	.|P	.|0.56916	.|0.809	T|T	0.34030|0.34030	-0.9845|-0.9845	6|10	0.87932|0.30854	D|T	0|0.27	.|.	15.5243|15.5243	0.75890|0.75890	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|234	.|Q5TBA9	.|FRY_HUMAN	R|A	161|234	.|ENSP00000369600:V234A	ENSP00000267067:C161R|ENSP00000369600:V234A	C|V	+|+	1|2	0|0	FRY|FRY	31596997|31596997	1.000000|1.000000	0.71417|0.71417	0.924000|0.924000	0.36721|0.36721	0.991000|0.991000	0.79684|0.79684	8.040000|8.040000	0.89188|0.89188	2.081000|2.081000	0.62600|0.62600	0.459000|0.459000	0.35465|0.35465	TGT|GTG	.	.		0.468	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044405.1	NM_023037	
NBEA	26960	hgsc.bcm.edu	37	13	35758164	35758164	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:35758164C>A	ENST00000400445.3	+	30	5417	c.4883C>A	c.(4882-4884)gCc>gAc	p.A1628D	NBEA_ENST00000379939.2_Missense_Mutation_p.A1625D|NBEA_ENST00000310336.4_Missense_Mutation_p.A1628D|NBEA_ENST00000540320.1_Missense_Mutation_p.A1628D	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1628					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GGATTCCTTGCCAAGTTAATT	0.403																																					p.A1628D		Atlas-SNP	.											.	NBEA	340	.	0			c.C4883A						.						115.0	104.0	107.0					13																	35758164		1881	4118	5999	SO:0001583	missense	26960	exon30			TCCTTGCCAAGTT	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4883C>A	chr13.hg19:g.35758164C>A	ENSP00000383295:p.Ala1628Asp	149.0	0.0		126.0	73.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Missense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	C	15.89	2.966615	0.53507	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336	T;T;T;T	0.51071	0.72;0.72;0.72;0.72	5.82	5.82	0.92795	.	0.153376	0.46442	D	0.000282	T	0.48021	0.1477	N	0.08118	0	0.80722	D	1	D	0.71674	0.998	D	0.73708	0.981	T	0.44314	-0.9336	10	0.14656	T	0.56	.	18.2756	0.90081	0.0:1.0:0.0:0.0	.	1625	Q5T321	.	D	1628;1628;1625;1628	ENSP00000440951:A1628D;ENSP00000383295:A1628D;ENSP00000369271:A1625D;ENSP00000308534:A1628D	ENSP00000308534:A1628D	A	+	2	0	NBEA	34656164	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.770000	0.62309	2.753000	0.94483	0.467000	0.42956	GCC	.	.		0.403	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
NAA16	79612	hgsc.bcm.edu	37	13	41891035	41891035	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:41891035T>C	ENST00000379406.3	+	2	432	c.108T>C	c.(106-108)atT>atC	p.I36I	NAA16_ENST00000403412.3_Silent_p.I36I|NAA16_ENST00000379367.3_Silent_p.I36I	NM_024561.4	NP_078837.3	Q6N069	NAA16_HUMAN	N(alpha)-acetyltransferase 16, NatA auxiliary subunit	36					N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ribosome binding (GO:0043022)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|urinary_tract(2)	31						GCAAGATGATTCTGTCGAACC	0.323																																					p.I36I		Atlas-SNP	.											.	NAA16	74	.	0			c.T108C						.						110.0	114.0	113.0					13																	41891035		2203	4300	6503	SO:0001819	synonymous_variant	79612	exon2			GATGATTCTGTCG	AL833341	CCDS9379.1, CCDS45044.1	13q14.11	2013-01-10	2010-01-14	2010-01-14	ENSG00000172766	ENSG00000172766		"""N(alpha)-acetyltransferase subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	26164	protein-coding gene	gene with protein product			"""NMDA receptor regulated 1-like"""	NARG1L		11483580, 19660095	Standard	NM_024561		Approved	FLJ22054, MGC40612, PRO2435	uc001uyf.2	Q6N069	OTTHUMG00000016791	ENST00000379406.3:c.108T>C	chr13.hg19:g.41891035T>C		86.0	0.0		81.0	4.0	NM_001110798	B0QZ59|Q5VSP9|Q6P2D5|Q8N5J3|Q8N870	Silent	SNP	ENST00000379406.3	hg19	CCDS9379.1																																																																																			.	.		0.323	NAA16-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044672.2	NM_018527	
AKAP11	11215	hgsc.bcm.edu	37	13	42875524	42875524	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:42875524A>G	ENST00000025301.2	+	8	2817	c.2642A>G	c.(2641-2643)cAt>cGt	p.H881R		NM_016248.3	NP_057332.1	Q9UKA4	AKA11_HUMAN	A kinase (PRKA) anchor protein 11	881					intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein kinase A binding (GO:0051018)|protein phosphatase 1 binding (GO:0008157)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(10)|liver(1)|lung(22)|ovary(1)|skin(3)|stomach(2)	56		Lung NSC(96;1.86e-05)|Prostate(109;0.0165)|Lung SC(185;0.0262)|Breast(139;0.0707)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;0.000365)|GBM - Glioblastoma multiforme(144;0.00116)|BRCA - Breast invasive adenocarcinoma(63;0.19)		GCAGTGGTGCATACGATAGTA	0.313																																					p.H881R		Atlas-SNP	.											.	AKAP11	146	.	0			c.A2642G						.						30.0	29.0	30.0					13																	42875524		2199	4299	6498	SO:0001583	missense	11215	exon8			TGGTGCATACGAT	AB014529	CCDS9383.1	13q	2012-04-17			ENSG00000023516	ENSG00000023516		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	369	protein-coding gene	gene with protein product	"""AKAP 220"", ""A-kinase anchoring protein, 220kDa"", ""protein kinase A anchoring protein 11"", ""protein phosphatase 1, regulatory subunit 44"""	604696				9734811, 8621616	Standard	NM_016248		Approved	KIAA0629, AKAP220, PRKA11, FLJ11304, DKFZp781I12161, PPP1R44	uc001uys.2	Q9UKA4	OTTHUMG00000016805	ENST00000025301.2:c.2642A>G	chr13.hg19:g.42875524A>G	ENSP00000025301:p.His881Arg	93.0	0.0		116.0	5.0	NM_016248	O75124|Q9NUK7	Missense_Mutation	SNP	ENST00000025301.2	hg19	CCDS9383.1	.	.	.	.	.	.	.	.	.	.	A	8.513	0.867015	0.17250	.	.	ENSG00000023516	ENST00000025301	T	0.14266	2.52	6.03	3.61	0.41365	.	0.266662	0.33290	N	0.005078	T	0.14313	0.0346	L	0.57536	1.79	0.34657	D	0.722294	B	0.11235	0.004	B	0.12156	0.007	T	0.10291	-1.0636	10	0.28530	T	0.3	.	10.3825	0.44121	0.8684:0.0:0.1316:0.0	.	881	Q9UKA4	AKA11_HUMAN	R	881	ENSP00000025301:H881R	ENSP00000025301:H881R	H	+	2	0	AKAP11	41773524	1.000000	0.71417	0.668000	0.29813	0.242000	0.25591	5.557000	0.67313	0.528000	0.28580	0.533000	0.62120	CAT	.	.		0.313	AKAP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044700.2	NM_016248	
NALCN	259232	hgsc.bcm.edu	37	13	101890168	101890168	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr13:101890168C>T	ENST00000251127.6	-	12	1453	c.1372G>A	c.(1372-1374)Gta>Ata	p.V458I	NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376196.3_Missense_Mutation_p.V458I	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	458					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GTTCCAATTACGAGTAGTAGT	0.318																																					p.V458I		Atlas-SNP	.											NALCN,NS,carcinoma,0,1	NALCN	431	.	0			c.G1372A						.						167.0	179.0	175.0					13																	101890168		2203	4300	6503	SO:0001583	missense	259232	exon12			CAATTACGAGTAG	AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.1372G>A	chr13.hg19:g.101890168C>T	ENSP00000251127:p.Val458Ile	75.0	0.0		41.0	2.0	NM_052867	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	ENST00000251127.6	hg19	CCDS9498.1	.	.	.	.	.	.	.	.	.	.	C	14.01	2.408356	0.42715	.	.	ENSG00000102452	ENST00000251127;ENST00000376196	D;D	0.98762	-5.12;-5.12	5.24	5.24	0.73138	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95711	0.8605	L	0.31526	0.94	0.80722	D	1	P;P;P	0.45827	0.78;0.867;0.78	B;B;B	0.32393	0.145;0.142;0.145	D	0.95607	0.8668	10	0.39692	T	0.17	.	19.1638	0.93546	0.0:1.0:0.0:0.0	.	458;458;458	F2Z323;B3KSZ6;Q8IZF0	.;.;NALCN_HUMAN	I	458	ENSP00000251127:V458I;ENSP00000365367:V458I	ENSP00000251127:V458I	V	-	1	0	NALCN	100688169	1.000000	0.71417	0.090000	0.20809	0.358000	0.29455	7.441000	0.80485	2.593000	0.87608	0.491000	0.48974	GTA	.	.		0.318	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045663.2	NM_052867	
TPPP2	122664	hgsc.bcm.edu	37	14	21500171	21500171	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:21500171A>G	ENST00000321760.6	+	4	596	c.448A>G	c.(448-450)Act>Gct	p.T150A	AL161668.5_ENST00000533984.1_lincRNA|RP11-998D10.1_ENST00000531638.1_5'Flank|TPPP2_ENST00000530140.2_Missense_Mutation_p.T150A|NDRG2_ENST00000403829.3_Intron	NM_173846.4	NP_776245.2	P59282	TPPP2_HUMAN	tubulin polymerization-promoting protein family member 2	150						cytoplasm (GO:0005737)				endometrium(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	9	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.0191)		GGAAGAGATGACTGACAACAC	0.547																																					p.T150A		Atlas-SNP	.											TPPP2,NS,carcinoma,0,1	TPPP2	22	.	0			c.A448G						.						212.0	159.0	177.0					14																	21500171		2203	4300	6503	SO:0001583	missense	122664	exon4			GAGATGACTGACA	AY072034	CCDS9566.1	14q11.2	2014-01-21	2007-05-02	2007-05-02	ENSG00000179636	ENSG00000179636			19293	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 8"""	C14orf8		15590652, 17105200	Standard	NM_173846		Approved	p25beta, p18, CT152	uc001vzh.3	P59282	OTTHUMG00000029642	ENST00000321760.6:c.448A>G	chr14.hg19:g.21500171A>G	ENSP00000317595:p.Thr150Ala	96.0	0.0		63.0	3.0	NM_173846	Q2VYF3	Missense_Mutation	SNP	ENST00000321760.6	hg19	CCDS9566.1	.	.	.	.	.	.	.	.	.	.	A	0.059	-1.227811	0.01518	.	.	ENSG00000179636	ENST00000321760;ENST00000530140	T;T	0.41400	1.0;1.0	4.71	3.48	0.39840	.	0.250070	0.40222	N	0.001148	T	0.19287	0.0463	N	0.11789	0.175	0.09310	N	1	B	0.33777	0.425	B	0.34931	0.192	T	0.11891	-1.0569	10	0.13108	T	0.6	-3.9563	4.5232	0.11969	0.701:0.1986:0.1004:0.0	.	150	P59282	TPPP2_HUMAN	A	150	ENSP00000317595:T150A;ENSP00000435356:T150A	ENSP00000317595:T150A	T	+	1	0	TPPP2	20570011	0.000000	0.05858	0.137000	0.22149	0.014000	0.08584	0.173000	0.16724	2.098000	0.63641	0.533000	0.62120	ACT	.	.		0.547	TPPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000073914.3	NM_173846	
PSME1	5720	hgsc.bcm.edu	37	14	24607958	24607958	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:24607958A>G	ENST00000206451.6	+	11	788	c.683A>G	c.(682-684)gAc>gGc	p.D228G	PSME1_ENST00000382708.3_3'UTR|RP11-468E2.5_ENST00000558478.1_lincRNA|PSME1_ENST00000561435.1_Missense_Mutation_p.T231A|EMC9_ENST00000558200.1_5'Flank|PSME1_ENST00000559123.1_Missense_Mutation_p.D69G	NM_001281528.1|NM_006263.2	NP_001268457.1|NP_006254.1	Q06323	PSME1_HUMAN	proteasome (prosome, macropain) activator subunit 1 (PA28 alpha)	228					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(265;0.00831)		GTGTTATATGACATCATCCTG	0.512																																					p.D228G		Atlas-SNP	.											.	PSME1	18	.	0			c.A683G						.						76.0	76.0	76.0					14																	24607958		2203	4300	6503	SO:0001583	missense	5720	exon11			TATATGACATCAT		CCDS9612.1, CCDS41930.1, CCDS61415.1	14q11.2	2008-08-29			ENSG00000092010	ENSG00000092010		"""Proteasome (prosome, macropain) subunits"""	9568	protein-coding gene	gene with protein product		600654				8269930	Standard	NM_006263		Approved	IFI5111, PA28alpha	uc001wmh.3	Q06323	OTTHUMG00000028795	ENST00000206451.6:c.683A>G	chr14.hg19:g.24607958A>G	ENSP00000206451:p.Asp228Gly	83.0	0.0		69.0	4.0	NM_006263	A6NJG9|H0YNE3|Q6IBM2|Q9UEF4	Missense_Mutation	SNP	ENST00000206451.6	hg19	CCDS9612.1	.	.	.	.	.	.	.	.	.	.	a	17.60	3.429557	0.62844	.	.	ENSG00000092010	ENST00000206451	T	0.58652	0.32	5.18	4.04	0.47022	Proteasome activator pa28, REG beta subunit (2);	.	.	.	.	T	0.73055	0.3538	M	0.77313	2.365	0.26512	N	0.974589	D	0.89917	1.0	D	0.97110	1.0	T	0.62950	-0.6745	9	0.66056	D	0.02	.	7.3739	0.26817	0.9035:0.0:0.0965:0.0	.	228	Q06323	PSME1_HUMAN	G	228	ENSP00000206451:D228G	ENSP00000206451:D228G	D	+	2	0	PSME1	23677798	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.063000	0.76714	0.994000	0.38892	0.533000	0.62120	GAC	.	.		0.512	PSME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071910.2	NM_006263	
RNF31	55072	hgsc.bcm.edu	37	14	24618770	24618770	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:24618770C>T	ENST00000324103.6	+	6	1107	c.787C>T	c.(787-789)Cag>Tag	p.Q263*	RNF31_ENST00000382687.3_Nonsense_Mutation_p.Q112*|PSME2_ENST00000560410.1_5'Flank|RP11-468E2.4_ENST00000558468.1_5'Flank|PSME2_ENST00000471700.2_5'Flank|RNF31_ENST00000559275.1_Nonsense_Mutation_p.Q112*|PSME2_ENST00000216802.5_5'Flank	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	263	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		TGGGGTCCTGCAGGGTACCCA	0.562																																					p.Q263X		Atlas-SNP	.											RNF31,NS,carcinoma,-2,1	RNF31	95	.	0			c.C787T						.						66.0	67.0	66.0					14																	24618770		1953	4137	6090	SO:0001587	stop_gained	55072	exon6			GTCCTGCAGGGTA	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.787C>T	chr14.hg19:g.24618770C>T	ENSP00000315112:p.Gln263*	66.0	0.0		43.0	2.0	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Nonsense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.846219	0.91277	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	.	.	.	5.53	4.64	0.57946	.	1.201630	0.05956	N	0.639731	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	-6.8187	11.8256	0.52265	0.1752:0.8248:0.0:0.0	.	.	.	.	X	263;112	.	ENSP00000315112:Q263X	Q	+	1	0	RNF31	23688610	0.288000	0.24324	0.003000	0.11579	0.009000	0.06853	4.360000	0.59455	1.318000	0.45170	-0.169000	0.13324	CAG	.	.		0.562	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
KIAA0391	9692	hgsc.bcm.edu	37	14	35593210	35593210	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:35593210A>G	ENST00000557565.1	+	2	1140	c.759A>G	c.(757-759)ggA>ggG	p.G253G	KIAA0391_ENST00000603544.1_Silent_p.G253G|KIAA0391_ENST00000604948.1_Silent_p.G158G|KIAA0391_ENST00000534898.4_Silent_p.G253G|KIAA0391_ENST00000250377.7_Silent_p.G158G|KIAA0391_ENST00000321130.10_Silent_p.G253G|PPP2R3C_ENST00000261475.5_5'Flank|PPP2R3C_ENST00000555644.1_5'Flank|KIAA0391_ENST00000605870.1_Intron|KIAA0391_ENST00000603588.1_Intron	NM_001282234.1	NP_001269163.1	O15091	MRRP3_HUMAN	KIAA0391	253					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)				central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	14	Breast(36;0.0545)|Hepatocellular(127;0.158)|Prostate(35;0.184)		Lung(238;2.93e-05)|LUAD - Lung adenocarcinoma(48;3.86e-05)|Epithelial(34;0.0114)|all cancers(34;0.0277)	GBM - Glioblastoma multiforme(112;0.0593)		GTATCCAGGGAGCTCTCCTTC	0.358																																					p.G253G		Atlas-SNP	.											.	KIAA0391	35	.	0			c.A759G						.						49.0	48.0	48.0					14																	35593210		2203	4300	6503	SO:0001819	synonymous_variant	9692	exon2			CCAGGGAGCTCTC	AB002389	CCDS32063.1, CCDS58312.1, CCDS58313.1, CCDS58314.1	14q13.2	2013-06-18			ENSG00000100890	ENSG00000100890			19958	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 3"", ""proteinaceous RNase P"""	609947				9205841, 18984158	Standard	NM_001256678		Approved	MRPP3, PRORP	uc001wsy.2	O15091		ENST00000557565.1:c.759A>G	chr14.hg19:g.35593210A>G		95.0	0.0		68.0	4.0	NM_014672	B4DXD9|B4E0S8|B4E211|C4AM93|D3DS99|D3DSA1|Q86SZ4|Q86YB5|Q8N5L5	Silent	SNP	ENST00000557565.1	hg19	CCDS32063.1																																																																																			.	.		0.358	KIAA0391-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000411280.1	NM_014672	
ATG14	22863	hgsc.bcm.edu	37	14	55836380	55836380	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:55836380G>T	ENST00000247178.5	-	10	1471	c.1436C>A	c.(1435-1437)gCc>gAc	p.A479D		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	479	BATS. {ECO:0000250}.				autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						GGTCACCGAGGCTGCTGCAGA	0.542																																					p.A479D		Atlas-SNP	.											.	ATG14	36	.	0			c.C1436A						.						135.0	130.0	132.0					14																	55836380		2203	4300	6503	SO:0001583	missense	22863	exon10			ACCGAGGCTGCTG	AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.1436C>A	chr14.hg19:g.55836380G>T	ENSP00000247178:p.Ala479Asp	115.0	0.0		93.0	4.0	NM_014924	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Missense_Mutation	SNP	ENST00000247178.5	hg19	CCDS32087.1	.	.	.	.	.	.	.	.	.	.	G	33	5.270069	0.95429	.	.	ENSG00000126775	ENST00000247178	T	0.39592	1.07	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	L	0.46157	1.445	0.80722	D	1	D	0.54047	0.964	P	0.51101	0.659	T	0.53143	-0.8480	10	0.72032	D	0.01	-16.8052	18.7624	0.91858	0.0:0.0:1.0:0.0	.	479	Q6ZNE5	BAKOR_HUMAN	D	479	ENSP00000247178:A479D	ENSP00000247178:A479D	A	-	2	0	ATG14	54906133	1.000000	0.71417	0.992000	0.48379	0.984000	0.73092	7.334000	0.79224	2.649000	0.89929	0.555000	0.69702	GCC	.	.		0.542	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416992.1	NM_014924	
RTN1	6252	hgsc.bcm.edu	37	14	60070638	60070638	+	Splice_Site	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:60070638A>G	ENST00000267484.5	-	6	2449	c.2114T>C	c.(2113-2115)tTt>tCt	p.F705S	RTN1_ENST00000342503.4_Splice_Site_p.F137S|RTN1_ENST00000557422.1_5'UTR|RTN1_ENST00000395090.1_Splice_Site_p.F122S	NM_021136.2	NP_066959.1	Q16799	RTN1_HUMAN	reticulon 1	705	Reticulon. {ECO:0000255|PROSITE- ProRule:PRU00170}.				neuron differentiation (GO:0030182)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(30)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(108;0.0968)		CAGGACTGCAAACTGAAGAAC	0.438																																					p.F705S		Atlas-SNP	.											.	RTN1	139	.	0			c.T2114C						.						155.0	135.0	142.0					14																	60070638		2203	4300	6503	SO:0001630	splice_region_variant	6252	exon6			ACTGCAAACTGAA	L10333	CCDS9740.1, CCDS9741.1	14q21-q22	2008-08-29			ENSG00000139970	ENSG00000139970			10467	protein-coding gene	gene with protein product		600865	"""neuroendocrine-specific protein"""	NSP		8275708	Standard	NM_206852		Approved		uc001xen.1	Q16799	OTTHUMG00000028947	ENST00000267484.5:c.2113-1T>C	chr14.hg19:g.60070638A>G		41.0	0.0		43.0	4.0	NM_021136	Q16800|Q16801|Q5BKZ4|Q9BQ59	Missense_Mutation	SNP	ENST00000267484.5	hg19	CCDS9740.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.809775	0.90707	.	.	ENSG00000139970	ENST00000432103;ENST00000267484;ENST00000395090;ENST00000342503;ENST00000433623	T;T;T	0.48201	0.82;0.82;0.82	5.32	5.32	0.75619	.	0.044542	0.85682	D	0.000000	T	0.75287	0.3829	M	0.92459	3.31	0.80722	D	1	D;D;D	0.67145	0.996;0.968;0.985	D;D;D	0.71656	0.974;0.95;0.956	T	0.82426	-0.0463	10	0.87932	D	0	.	15.6363	0.76958	1.0:0.0:0.0:0.0	.	122;705;137	A8MT72;Q16799;Q16799-3	.;RTN1_HUMAN;.	S	285;705;122;137;631	ENSP00000267484:F705S;ENSP00000378525:F122S;ENSP00000340716:F137S	ENSP00000267484:F705S	F	-	2	0	RTN1	59140391	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.287000	0.95975	2.165000	0.68154	0.369000	0.22263	TTT	.	.		0.438	RTN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000072278.2		Missense_Mutation
SYNE2	23224	hgsc.bcm.edu	37	14	64519805	64519805	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:64519805T>C	ENST00000344113.4	+	48	9386	c.9174T>C	c.(9172-9174)atT>atC	p.I3058I	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.I3091I|SYNE2_ENST00000358025.3_Silent_p.I3058I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	3058					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TGAGAGCTATTGATTTGCAAA	0.348																																					p.I3058I		Atlas-SNP	.											.	SYNE2	577	.	0			c.T9174C						.						54.0	54.0	54.0					14																	64519805		1824	4074	5898	SO:0001819	synonymous_variant	23224	exon48			AGCTATTGATTTG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.9174T>C	chr14.hg19:g.64519805T>C		146.0	0.0		84.0	4.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.348	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ZBTB1	22890	hgsc.bcm.edu	37	14	64989571	64989571	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:64989571G>T	ENST00000554015.1	+	4	1780	c.1349G>T	c.(1348-1350)tGt>tTt	p.C450F	RP11-973N13.4_ENST00000554918.1_RNA|ZBTB1_ENST00000394712.2_Missense_Mutation_p.C450F|ZBTB1_ENST00000358738.3_Missense_Mutation_p.C450F			Q9Y2K1	ZBTB1_HUMAN	zinc finger and BTB domain containing 1	450					B cell differentiation (GO:0030183)|innate immune response (GO:0045087)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of pro-T cell differentiation (GO:2000176)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated immunity (GO:0002711)|protein homooligomerization (GO:0051260)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(1)	13		all_lung(585;0.000567)|Myeloproliferative disorder(585;0.0255)|all_neural(303;0.0294)		UCEC - Uterine corpus endometrioid carcinoma (185;0.0182)|all cancers(60;3.78e-43)|OV - Ovarian serous cystadenocarcinoma(108;1.22e-20)|BRCA - Breast invasive adenocarcinoma(234;6.75e-06)|KIRC - Kidney renal clear cell carcinoma(182;0.00269)|STAD - Stomach adenocarcinoma(64;0.012)		ATCTGTGCATGTGGTAAATGT	0.438																																					p.C450F		Atlas-SNP	.											.	ZBTB1	93	.	0			c.G1349T						.						107.0	105.0	106.0					14																	64989571		2203	4300	6503	SO:0001583	missense	22890	exon2			GTGCATGTGGTAA	AB023214	CCDS32097.1, CCDS45126.1	14q23.3	2013-01-09			ENSG00000126804	ENSG00000126804		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20259	protein-coding gene	gene with protein product						10231032	Standard	NM_014950		Approved	KIAA0997, ZNF909	uc010aqg.3	Q9Y2K1		ENST00000554015.1:c.1349G>T	chr14.hg19:g.64989571G>T	ENSP00000451000:p.Cys450Phe	88.0	0.0		62.0	44.0	NM_014950	A8K6S8|Q86SW8	Missense_Mutation	SNP	ENST00000554015.1	hg19	CCDS45126.1	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458707	0.63401	.	.	ENSG00000126804	ENST00000554015;ENST00000358738;ENST00000394712	T;T;T	0.18016	2.24;2.43;2.24	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000001	T	0.31231	0.0790	L	0.29908	0.895	0.80722	D	1	D;P	0.58268	0.982;0.948	P;P	0.60473	0.875;0.603	T	0.00961	-1.1499	10	0.87932	D	0	-18.564	20.5568	0.99304	0.0:0.0:1.0:0.0	.	450;450	Q9Y2K1-2;Q9Y2K1	.;ZBTB1_HUMAN	F	450	ENSP00000451000:C450F;ENSP00000351587:C450F;ENSP00000378201:C450F	ENSP00000351587:C450F	C	+	2	0	ZBTB1	64059324	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.861000	0.98227	0.655000	0.94253	TGT	.	.		0.438	ZBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411912.1		
ZFYVE26	23503	hgsc.bcm.edu	37	14	68248209	68248209	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:68248209A>G	ENST00000347230.4	-	22	4548	c.4410T>C	c.(4408-4410)gaT>gaC	p.D1470D	ZFYVE26_ENST00000555452.1_Silent_p.D1470D	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1470					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		TCAGAGATGCATCCTTCACGG	0.522																																					p.D1470D		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.T4410C						.						111.0	107.0	108.0					14																	68248209		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon22			AGATGCATCCTTC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.4410T>C	chr14.hg19:g.68248209A>G		68.0	0.0		49.0	4.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	hg19	CCDS9788.1																																																																																			.	.		0.522	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
RGS6	9628	hgsc.bcm.edu	37	14	72945005	72945005	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:72945005A>G	ENST00000553530.1	+	12	1029	c.822A>G	c.(820-822)agA>agG	p.R274R	RGS6_ENST00000556437.1_Silent_p.R274R|RGS6_ENST00000343854.6_Silent_p.R274R|RGS6_ENST00000406236.4_Silent_p.R274R|RGS6_ENST00000402788.2_Silent_p.R274R|RGS6_ENST00000407322.4_Silent_p.R274R|RGS6_ENST00000555571.1_Silent_p.R274R|RGS6_ENST00000554782.1_Silent_p.R135R|RGS6_ENST00000404301.2_Silent_p.R274R|RGS6_ENST00000434263.2_Silent_p.R205R|RGS6_ENST00000355512.6_Silent_p.R274R|RGS6_ENST00000553525.1_Silent_p.R274R	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	274	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		AGATCGACAGACATTGTTTGA	0.338																																					p.R274R	Ovarian(143;1926 2468 21071 48641)	Atlas-SNP	.											.	RGS6	92	.	0			c.A822G						.						128.0	125.0	126.0					14																	72945005		2203	4299	6502	SO:0001819	synonymous_variant	9628	exon12			CGACAGACATTGT	AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.822A>G	chr14.hg19:g.72945005A>G		95.0	0.0		61.0	4.0	NM_001204424	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Silent	SNP	ENST00000553530.1	hg19	CCDS9808.1																																																																																			.	.		0.338	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000413033.2		
ZC3H14	79882	hgsc.bcm.edu	37	14	89039002	89039002	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:89039002T>C	ENST00000251038.5	+	6	737	c.512T>C	c.(511-513)gTg>gCg	p.V171A	ZC3H14_ENST00000555755.1_Missense_Mutation_p.V171A|ZC3H14_ENST00000336693.4_Missense_Mutation_p.V137A|ZC3H14_ENST00000359301.3_Missense_Mutation_p.V137A|ZC3H14_ENST00000556945.1_Missense_Mutation_p.V171A|ZC3H14_ENST00000393514.5_Missense_Mutation_p.V171A|ZC3H14_ENST00000302216.8_Missense_Mutation_p.V171A|ZC3H14_ENST00000557607.1_Missense_Mutation_p.V16A	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	171						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						TCTGAAGATGTGATTGATATT	0.418																																					p.V171A		Atlas-SNP	.											.	ZC3H14	71	.	0			c.T512C						.						129.0	128.0	128.0					14																	89039002		2203	4300	6503	SO:0001583	missense	79882	exon6			AAGATGTGATTGA	AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.512T>C	chr14.hg19:g.89039002T>C	ENSP00000251038:p.Val171Ala	131.0	0.0		90.0	4.0	NM_001160104	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	ENST00000251038.5	hg19	CCDS32133.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.4|22.4	4.286972|4.286972	0.80803|0.80803	.|.	.|.	ENSG00000100722|ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000557607;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693|ENST00000556000	.|.	.|.	.|.	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	0.057386|.	0.64402|.	N|.	0.000001|.	T|.	0.73265|.	0.3565|.	M|M	0.66939|0.66939	2.045|2.045	0.49915|0.49915	D|D	0.999839|0.999839	P;D;B;P;D;P|.	0.71674|.	0.577;0.998;0.3;0.493;0.998;0.493|.	B;D;B;B;D;B|.	0.77557|.	0.269;0.99;0.197;0.338;0.99;0.232|.	T|.	0.72606|.	-0.4242|.	9|.	0.39692|.	T|.	0.17|.	-3.8199|-3.8199	16.1838|16.1838	0.81934|0.81934	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	171;152;171;171;171;171|.	G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7|.	.;.;.;.;.;ZC3HE_HUMAN|.	A|R	171;171;171;137;171;152;171;158;16;137;171;171;137|87	.|.	ENSP00000251038:V171A|.	V|X	+|+	2|1	0|0	ZC3H14|ZC3H14	88108755|88108755	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	6.575000|6.575000	0.74018|0.74018	2.225000|2.225000	0.72522|0.72522	0.533000|0.533000	0.62120|0.62120	GTG|TGA	.	.		0.418	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000410387.1	NM_024824	
CCDC88C	440193	hgsc.bcm.edu	37	14	91770230	91770230	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:91770230G>A	ENST00000389857.6	-	20	3536	c.3450C>T	c.(3448-3450)aaC>aaT	p.N1150N		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1150					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCAGGCTTTCGTTCTCCGTCT	0.657																																					p.N1150N		Atlas-SNP	.											.	CCDC88C	192	.	0			c.C3450T						.						72.0	80.0	78.0					14																	91770230		2159	4255	6414	SO:0001819	synonymous_variant	440193	exon20			GCTTTCGTTCTCC		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3450C>T	chr14.hg19:g.91770230G>A		104.0	0.0		76.0	5.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Silent	SNP	ENST00000389857.6	hg19	CCDS45151.1																																																																																			.	.		0.657	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
SLC24A4	123041	hgsc.bcm.edu	37	14	92790275	92790275	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:92790275G>A	ENST00000532405.1	+	1	327	c.101G>A	c.(100-102)tGc>tAc	p.C34Y	SLC24A4_ENST00000531433.1_Missense_Mutation_p.C34Y|SLC24A4_ENST00000351924.5_Missense_Mutation_p.C17Y|SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000298877.1_Missense_Mutation_p.C17Y			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4	34					amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		GCCCTGGTGTGCTGTGCGTCC	0.697																																					p.C34Y	NSCLC(10;315 435 10383 28450 38798)	Atlas-SNP	.											.	SLC24A4	112	.	0			c.G101A						.						49.0	49.0	49.0					14																	92790275		2203	4300	6503	SO:0001583	missense	123041	exon2			TGGTGTGCTGTGC	AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.101G>A	chr14.hg19:g.92790275G>A	ENSP00000431840:p.Cys34Tyr	79.0	0.0		90.0	15.0	NM_153647	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	Missense_Mutation	SNP	ENST00000532405.1	hg19	CCDS9903.2	.	.	.	.	.	.	.	.	.	.	G	8.678	0.904495	0.17760	.	.	ENSG00000140090	ENST00000531433;ENST00000532405;ENST00000298877;ENST00000351924	T;T;T;T	0.66815	0.18;0.18;-0.22;-0.23	4.61	4.61	0.57282	.	0.203246	0.46145	D	0.000309	T	0.46249	0.1383	N	0.08118	0	0.39520	D	0.968499	B;B	0.20988	0.05;0.022	B;B	0.23275	0.037;0.045	T	0.43180	-0.9407	10	0.22706	T	0.39	.	14.379	0.66900	0.0:0.0:1.0:0.0	.	34;34	Q8NFF2-3;Q8NFF2	.;NCKX4_HUMAN	Y	34;34;17;17	ENSP00000433302:C34Y;ENSP00000431840:C34Y;ENSP00000298877:C17Y;ENSP00000337789:C17Y	ENSP00000298877:C17Y	C	+	2	0	SLC24A4	91860028	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.422000	0.52749	2.120000	0.65058	0.462000	0.41574	TGC	.	.		0.697	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000395240.1	NM_153646	
UNC79	57578	hgsc.bcm.edu	37	14	94007149	94007149	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr14:94007149T>C	ENST00000393151.2	+	13	1496	c.1496T>C	c.(1495-1497)cTg>cCg	p.L499P	UNC79_ENST00000555664.1_Missense_Mutation_p.L499P|UNC79_ENST00000553484.1_Missense_Mutation_p.L499P|UNC79_ENST00000256339.4_Missense_Mutation_p.L322P			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	499					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GATCAGAGGCTGCTCAGTCAA	0.428																																					p.L322P		Atlas-SNP	.											.	UNC79	366	.	0			c.T965C						.						88.0	91.0	90.0					14																	94007149		2203	4300	6503	SO:0001583	missense	57578	exon13			AGAGGCTGCTCAG	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1496T>C	chr14.hg19:g.94007149T>C	ENSP00000376858:p.Leu499Pro	91.0	0.0		75.0	4.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	T	23.3	4.403283	0.83230	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000003	T	0.47619	0.1455	L	0.54323	1.7	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.83275	0.996;0.994	T	0.45891	-0.9230	10	0.72032	D	0.01	-11.1342	15.7948	0.78401	0.0:0.0:0.0:1.0	.	499;499	C9JQL1;Q9P2D8	.;UNC79_HUMAN	P	322;499;499;499;499	ENSP00000256339:L322P;ENSP00000450868:L499P;ENSP00000451360:L499P;ENSP00000376858:L499P	ENSP00000256339:L322P	L	+	2	0	KIAA1409	93076902	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.040000	0.89188	2.128000	0.65567	0.528000	0.53228	CTG	.	.		0.428	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
EHD4	30844	hgsc.bcm.edu	37	15	42245961	42245961	+	Splice_Site	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:42245961C>A	ENST00000220325.4	-	2	497		c.e2+1			NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4						cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		CTGGTCCTTACCGATTCAGGA	0.453																																					.		Atlas-SNP	.											.	EHD4	46	.	0			c.413+1G>T						.						95.0	98.0	97.0					15																	42245961		2203	4299	6502	SO:0001630	splice_region_variant	30844	exon3			TCCTTACCGATTC	AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.413+1G>T	chr15.hg19:g.42245961C>A		77.0	0.0		66.0	36.0	NM_139265	Q9HAR1|Q9NZN2	Splice_Site	SNP	ENST00000220325.4	hg19	CCDS10081.1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.964340	0.92791	.	.	ENSG00000103966	ENST00000220325	.	.	.	5.93	5.93	0.95920	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3539	0.98825	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EHD4	40033253	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.487000	0.81328	2.826000	0.97356	0.655000	0.94253	.	.	.		0.453	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252737.2	NM_139265	Intron
CEP152	22995	hgsc.bcm.edu	37	15	49060502	49060502	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:49060502T>C	ENST00000380950.2	-	15	2119	c.1932A>G	c.(1930-1932)aaA>aaG	p.K644K	CEP152_ENST00000399334.3_Silent_p.K644K|CEP152_ENST00000325747.5_Silent_p.K551K|CEP152_ENST00000559398.1_5'Flank	NM_001194998.1|NM_014985.3	NP_001181927.1|NP_055800.2	O94986	CE152_HUMAN	centrosomal protein 152kDa	644					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|de novo centriole assembly (GO:0098535)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|deuterosome (GO:0098536)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(16)|lung(30)|ovary(1)|prostate(2)|skin(2)	63		all_lung(180;0.0428)		all cancers(107;1.08e-07)|GBM - Glioblastoma multiforme(94;2.32e-06)		TATTTCTCAGTTTTCCTTCAG	0.289																																					p.K644K		Atlas-SNP	.											.	CEP152	145	.	0			c.A1932G						.						169.0	153.0	158.0					15																	49060502		1826	4075	5901	SO:0001819	synonymous_variant	22995	exon15			TCTCAGTTTTCCT	AB020719	CCDS42033.1, CCDS58361.1	15q21.1	2014-02-20							29298	protein-coding gene	gene with protein product	"""asterless"""	613529	"""microcephaly, primary autosomal recessive 4"""	MCPH4		14654843, 21131973	Standard	NM_014985		Approved	KIAA0912, SCKL5	uc001zwz.3	O94986		ENST00000380950.2:c.1932A>G	chr15.hg19:g.49060502T>C		100.0	0.0		83.0	4.0	NM_014985	E7ER66|Q17RV1|Q6NTA0	Silent	SNP	ENST00000380950.2	hg19	CCDS58361.1																																																																																			.	.		0.289	CEP152-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417365.1	NM_014985	
FAM81A	145773	hgsc.bcm.edu	37	15	59801108	59801108	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:59801108G>A	ENST00000288228.5	+	6	777	c.590G>A	c.(589-591)aGc>aAc	p.S197N		NM_152450.2	NP_689663.2	Q8TBF8	FA81A_HUMAN	family with sequence similarity 81, member A	197										endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10						TCAGAGCAGAGCACCAAACTG	0.353																																					p.S197N		Atlas-SNP	.											.	FAM81A	31	.	0			c.G590A						.						79.0	73.0	75.0					15																	59801108		1824	4081	5905	SO:0001583	missense	145773	exon6			AGCAGAGCACCAA		CCDS45269.1	15q22.2	2012-10-02			ENSG00000157470	ENSG00000157470			28379	protein-coding gene	gene with protein product							Standard	NM_152450		Approved	MGC26690	uc002agc.2	Q8TBF8	OTTHUMG00000171915	ENST00000288228.5:c.590G>A	chr15.hg19:g.59801108G>A	ENSP00000288228:p.Ser197Asn	583.0	0.0		567.0	149.0	NM_152450		Missense_Mutation	SNP	ENST00000288228.5	hg19	CCDS45269.1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208478	0.39003	.	.	ENSG00000157470	ENST00000288228	T	0.30182	1.54	5.73	5.73	0.89815	.	0.160367	0.49916	D	0.000121	T	0.28001	0.0690	L	0.33485	1.01	0.30256	N	0.793619	P	0.50528	0.936	P	0.47673	0.554	T	0.13818	-1.0495	10	0.30854	T	0.27	-11.2995	10.196	0.43054	0.0939:0.0:0.9061:0.0	.	197	Q8TBF8	FA81A_HUMAN	N	197	ENSP00000288228:S197N	ENSP00000288228:S197N	S	+	2	0	FAM81A	57588400	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.383000	0.59600	2.714000	0.92807	0.561000	0.74099	AGC	.	.		0.353	FAM81A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415876.1	NM_152450	
CLN6	54982	hgsc.bcm.edu	37	15	68500609	68500609	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:68500609T>C	ENST00000249806.5	-	7	962	c.805A>G	c.(805-807)Acc>Gcc	p.T269A	RP11-315D16.2_ENST00000562767.1_Intron|CALML4_ENST00000395465.3_5'Flank|CALML4_ENST00000540479.1_5'Flank|CLN6_ENST00000418702.2_Missense_Mutation_p.T140A|CLN6_ENST00000565471.1_Missense_Mutation_p.T116A|CALML4_ENST00000448060.2_5'Flank|CALML4_ENST00000467889.1_5'Flank|CLN6_ENST00000538696.1_Missense_Mutation_p.T301A|CLN6_ENST00000566347.1_Missense_Mutation_p.T206A	NM_017882.2	NP_060352.1	Q9NWW5	CLN6_HUMAN	ceroid-lipofuscinosis, neuronal 6, late infantile, variant	269					cell death (GO:0008219)|cellular macromolecule catabolic process (GO:0044265)|cholesterol metabolic process (GO:0008203)|ganglioside metabolic process (GO:0001573)|glycosaminoglycan metabolic process (GO:0030203)|locomotion involved in locomotory behavior (GO:0031987)|lysosomal lumen acidification (GO:0007042)|positive regulation of proteolysis (GO:0045862)|protein catabolic process (GO:0030163)|visual perception (GO:0007601)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						AGCAAGAGGGTCAGTGCGAAG	0.602																																					p.T269A		Atlas-SNP	.											.	CLN6	16	.	0			c.A805G						.						124.0	117.0	119.0					15																	68500609		2200	4298	6498	SO:0001583	missense	54982	exon7			AGAGGGTCAGTGC	AK000568	CCDS10227.1	15q23	2014-09-17			ENSG00000128973	ENSG00000128973			2077	protein-coding gene	gene with protein product		606725				9097964, 11727201	Standard	NM_017882		Approved	FLJ20561, HsT18960, nclf	uc002arf.3	Q9NWW5	OTTHUMG00000133286	ENST00000249806.5:c.805A>G	chr15.hg19:g.68500609T>C	ENSP00000249806:p.Thr269Ala	121.0	0.0		113.0	6.0	NM_017882	A8K560|B4DDH6|Q6IAB1|Q96SR0	Missense_Mutation	SNP	ENST00000249806.5	hg19	CCDS10227.1	.	.	.	.	.	.	.	.	.	.	T	11.64	1.699536	0.30142	.	.	ENSG00000128973	ENST00000249806;ENST00000418702;ENST00000538696	D;D;D	0.94793	-3.52;-3.52;-3.52	5.34	1.76	0.24704	.	0.171254	0.51477	N	0.000095	D	0.89368	0.6695	L	0.43152	1.355	0.47374	D	0.999405	B;B;B	0.19583	0.037;0.003;0.012	B;B;B	0.19148	0.024;0.007;0.017	T	0.80690	-0.1270	10	0.22109	T	0.4	-33.318	8.9728	0.35917	0.0:0.2163:0.0:0.7837	.	301;140;269	B4DDH6;E7ESV1;Q9NWW5	.;.;CLN6_HUMAN	A	269;140;301	ENSP00000249806:T269A;ENSP00000393826:T140A;ENSP00000445770:T301A	ENSP00000249806:T269A	T	-	1	0	CLN6	66287663	0.745000	0.28261	0.974000	0.42286	0.353000	0.29299	0.896000	0.28377	0.371000	0.24564	0.379000	0.24179	ACC	.	.		0.602	CLN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257066.1	NM_017882	
PAQR5	54852	hgsc.bcm.edu	37	15	69672244	69672244	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:69672244T>C	ENST00000340965.3	+	4	742	c.74T>C	c.(73-75)cTg>cCg	p.L25P	PAQR5_ENST00000561153.1_Missense_Mutation_p.L25P|PAQR5_ENST00000395407.2_Missense_Mutation_p.L25P|PAQR5_ENST00000561027.1_3'UTR	NM_001104554.1	NP_001098024.1	Q9NXK6	MPRG_HUMAN	progestin and adipoQ receptor family member V	25					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)|steroid binding (GO:0005496)			endometrium(3)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|skin(1)	11						CAAGGCATCCTGTTCGGCTAC	0.537																																					p.L25P		Atlas-SNP	.											.	PAQR5	35	.	0			c.T74C						.						266.0	240.0	249.0					15																	69672244		2200	4298	6498	SO:0001583	missense	54852	exon4			GCATCCTGTTCGG		CCDS10232.1	15q22.31	2012-08-10			ENSG00000137819	ENSG00000137819			29645	protein-coding gene	gene with protein product	"""membrane progestin receptor gamma"""	607781				12574519	Standard	NM_001104554		Approved	FLJ20190, MPRG	uc002arz.2	Q9NXK6	OTTHUMG00000133322	ENST00000340965.3:c.74T>C	chr15.hg19:g.69672244T>C	ENSP00000343877:p.Leu25Pro	80.0	0.0		90.0	4.0	NM_001104554	Q8IXU2	Missense_Mutation	SNP	ENST00000340965.3	hg19	CCDS10232.1	.	.	.	.	.	.	.	.	.	.	T	26.3	4.723899	0.89298	.	.	ENSG00000137819	ENST00000395407;ENST00000340965	T;T	0.29917	1.55;1.55	5.68	5.68	0.88126	.	0.052632	0.64402	D	0.000001	T	0.49029	0.1533	M	0.66939	2.045	0.80722	D	1	D	0.60160	0.987	P	0.58266	0.836	T	0.50906	-0.8772	10	0.62326	D	0.03	0.0445	13.865	0.63583	0.0:0.0:0.0:1.0	.	25	Q9NXK6	MPRG_HUMAN	P	25	ENSP00000378803:L25P;ENSP00000343877:L25P	ENSP00000343877:L25P	L	+	2	0	PAQR5	67459298	1.000000	0.71417	1.000000	0.80357	0.798000	0.45092	7.625000	0.83145	2.152000	0.67230	0.533000	0.62120	CTG	.	.		0.537	PAQR5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416671.1	NM_017705	
RCCD1	91433	hgsc.bcm.edu	37	15	91500890	91500890	+	Missense_Mutation	SNP	A	A	G	rs75741610		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:91500890A>G	ENST00000394258.2	+	4	816	c.614A>G	c.(613-615)gAg>gGg	p.E205G	RCCD1_ENST00000556618.1_Missense_Mutation_p.E205G|RCCD1_ENST00000555155.1_Missense_Mutation_p.E205G|RCCD1_ENST00000556774.1_Intron|AC068831.6_ENST00000553321.1_RNA	NM_001017919.1|NM_033544.2	NP_001017919.1|NP_291022.2	A6NED2	RCCD1_HUMAN	RCC1 domain containing 1	205						cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|kidney(1)|large_intestine(2)	4	Lung NSC(78;0.0987)|all_lung(78;0.175)		Lung(145;0.189)			CGGCTGTTGGAGGCGTTGCAG	0.617																																					p.E205G		Atlas-SNP	.											.	RCCD1	9	.	0			c.A614G						.						86.0	83.0	84.0					15																	91500890		2198	4298	6496	SO:0001583	missense	91433	exon4			TGTTGGAGGCGTT		CCDS32333.1	15q26.1	2005-10-21	2005-10-21			ENSG00000166965			30457	protein-coding gene	gene with protein product						12477932	Standard	XM_006720763		Approved	MGC14386	uc002bqk.3	A6NED2		ENST00000394258.2:c.614A>G	chr15.hg19:g.91500890A>G	ENSP00000377801:p.Glu205Gly	99.0	0.0		121.0	10.0	NM_001017919	B2RTP9|Q29RX6	Missense_Mutation	SNP	ENST00000394258.2	hg19	CCDS32333.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.334691	0.81801	.	.	ENSG00000166965	ENST00000394258;ENST00000555155;ENST00000556618	T;T;T	0.80214	-1.35;-1.35;-1.35	3.59	3.59	0.41128	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.84866	0.5567	L	0.49455	1.56	0.80722	D	1	D;D	0.67145	0.995;0.996	D;D	0.67382	0.919;0.951	D	0.85723	0.1326	10	0.62326	D	0.03	.	12.1904	0.54268	1.0:0.0:0.0:0.0	.	205;205	G3V2I3;A6NED2	.;RCCD1_HUMAN	G	205	ENSP00000377801:E205G;ENSP00000450678:E205G;ENSP00000451963:E205G	ENSP00000377801:E205G	E	+	2	0	RCCD1	89301894	1.000000	0.71417	0.996000	0.52242	0.741000	0.42261	6.470000	0.73558	1.426000	0.47256	0.397000	0.26171	GAG	.	.		0.617	RCCD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000414748.1	NM_033544	
CHD2	1106	hgsc.bcm.edu	37	15	93489406	93489406	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:93489406G>C	ENST00000394196.4	+	12	2405	c.1337G>C	c.(1336-1338)aGt>aCt	p.S446T	CHD2_ENST00000557381.1_Missense_Mutation_p.S446T|CHD2_ENST00000536619.1_Missense_Mutation_p.S459T|CHD2_ENST00000420239.2_Missense_Mutation_p.S446T	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	446	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			AGCTTCCACAGTAGGAACAAC	0.413																																					p.S446T		Atlas-SNP	.											.	CHD2	280	.	0			c.G1337C						.						81.0	82.0	82.0					15																	93489406		2197	4298	6495	SO:0001583	missense	1106	exon12			TCCACAGTAGGAA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1337G>C	chr15.hg19:g.93489406G>C	ENSP00000377747:p.Ser446Thr	276.0	1.0		186.0	68.0	NM_001042572	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	hg19	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	G	12.29	1.893022	0.33442	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000420239;ENST00000536619	T;T;T;T	0.73681	-0.77;-0.77;-0.77;-0.77	5.57	3.33	0.38152	Chromo domain (1);Chromo domain-like (1);Chromo domain/shadow (2);	0.467569	0.15445	U	0.261968	T	0.58119	0.2100	N	0.14661	0.345	0.28055	N	0.933226	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.11329	0.006;0.001;0.001	T	0.55995	-0.8052	10	0.54805	T	0.06	-7.073	11.5016	0.50441	0.2318:0.0:0.7682:0.0	.	459;446;446	B7Z3I4;O14647;O14647-2	.;CHD2_HUMAN;.	T	446;446;446;459	ENSP00000377747:S446T;ENSP00000451366:S446T;ENSP00000406581:S446T;ENSP00000443618:S459T	ENSP00000377747:S446T	S	+	2	0	CHD2	91290410	0.967000	0.33354	0.998000	0.56505	0.983000	0.72400	0.759000	0.26461	1.498000	0.48600	0.655000	0.94253	AGT	.	.		0.413	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
CHD2	1106	hgsc.bcm.edu	37	15	93489423	93489423	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr15:93489423A>G	ENST00000394196.4	+	12	2422	c.1354A>G	c.(1354-1356)Acc>Gcc	p.T452A	CHD2_ENST00000557381.1_Missense_Mutation_p.T452A|CHD2_ENST00000536619.1_Missense_Mutation_p.T465A|CHD2_ENST00000420239.2_Missense_Mutation_p.T452A	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	452	Chromo 2. {ECO:0000255|PROSITE- ProRule:PRU00053}.				cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CAACTCAAAAACCATCCCAAC	0.428																																					p.T452A		Atlas-SNP	.											.	CHD2	280	.	0			c.A1354G						.						74.0	76.0	75.0					15																	93489423		2197	4298	6495	SO:0001583	missense	1106	exon12			TCAAAAACCATCC	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.1354A>G	chr15.hg19:g.93489423A>G	ENSP00000377747:p.Thr452Ala	288.0	0.0		199.0	76.0	NM_001042572	C6G482|Q96IP5	Missense_Mutation	SNP	ENST00000394196.4	hg19	CCDS10374.2	.	.	.	.	.	.	.	.	.	.	A	17.84	3.487357	0.63962	.	.	ENSG00000173575	ENST00000394196;ENST00000557381;ENST00000420239;ENST00000536619	D;D;T;T	0.93133	-3.17;-3.17;0.86;0.85	5.57	5.57	0.84162	Chromo domain/shadow (1);	0.000000	0.35096	U	0.003459	D	0.91399	0.7286	L	0.53729	1.69	0.53688	D	0.999978	B;B;P	0.35139	0.047;0.002;0.486	B;B;B	0.35550	0.065;0.035;0.205	D	0.90425	0.4420	10	0.37606	T	0.19	-30.4941	16.0216	0.80499	1.0:0.0:0.0:0.0	.	465;452;452	B7Z3I4;O14647;O14647-2	.;CHD2_HUMAN;.	A	452;452;452;465	ENSP00000377747:T452A;ENSP00000451366:T452A;ENSP00000406581:T452A;ENSP00000443618:T465A	ENSP00000377747:T452A	T	+	1	0	CHD2	91290427	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.088000	0.76901	2.242000	0.73789	0.533000	0.62120	ACC	.	.		0.428	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
MRPS34	65993	hgsc.bcm.edu	37	16	1822511	1822511	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:1822511T>C	ENST00000397375.2	-	3	403	c.368A>G	c.(367-369)aAg>aGg	p.K123R	EME2_ENST00000307394.7_5'Flank|NME3_ENST00000219302.3_5'Flank|MRPS34_ENST00000177742.3_Missense_Mutation_p.K130R|EME2_ENST00000568449.1_5'Flank|NME3_ENST00000563498.1_5'Flank	NM_023936.1	NP_076425.1	P82930	RT34_HUMAN	mitochondrial ribosomal protein S34	123						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|skin(2)	3						GCTCTCAGTCTTCCCTGATGA	0.627																																					p.K123R		Atlas-SNP	.											MRPS34,bladder,carcinoma,0,1	MRPS34	7	.	0			c.A368G						.						68.0	73.0	71.0					16																	1822511		2197	4300	6497	SO:0001583	missense	65993	exon3			TCAGTCTTCCCTG	BC001182	CCDS10444.1, CCDS73805.1	16p13.3	2012-09-13			ENSG00000074071	ENSG00000074071		"""Mitochondrial ribosomal proteins / small subunits"""	16618	protein-coding gene	gene with protein product		611994					Standard	NM_023936		Approved	MRP-S12, MGC2616	uc002cmo.3	P82930	OTTHUMG00000128636	ENST00000397375.2:c.368A>G	chr16.hg19:g.1822511T>C	ENSP00000380531:p.Lys123Arg	89.0	0.0		65.0	3.0	NM_023936	Q9BVI7	Missense_Mutation	SNP	ENST00000397375.2	hg19	CCDS10444.1	.	.	.	.	.	.	.	.	.	.	T	13.78	2.339933	0.41398	.	.	ENSG00000074071	ENST00000397375;ENST00000177742	T;T	0.53640	0.61;0.61	4.02	0.499	0.16914	.	0.231983	0.40908	N	0.000986	T	0.26521	0.0648	N	0.17872	0.535	0.41738	D	0.98959	B;B	0.11235	0.004;0.003	B;B	0.12156	0.007;0.007	T	0.05599	-1.0875	10	0.21014	T	0.42	-5.5931	7.5514	0.27800	0.0:0.265:0.0:0.735	.	130;123	C9JJ19;P82930	.;RT34_HUMAN	R	123;130	ENSP00000380531:K123R;ENSP00000177742:K130R	ENSP00000177742:K130R	K	-	2	0	MRPS34	1762512	1.000000	0.71417	0.003000	0.11579	0.056000	0.15407	3.873000	0.56093	-0.104000	0.12154	0.459000	0.35465	AAG	.	.		0.627	MRPS34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250506.1	NM_023936	
SHISA9	729993	hgsc.bcm.edu	37	16	13002438	13002438	+	Intron	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:13002438A>G	ENST00000424107.3	+	1	1008				SHISA9_ENST00000482916.1_3'UTR|SHISA9_ENST00000558318.1_Nonstop_Mutation_p.*263W|SHISA9_ENST00000423335.2_Nonstop_Mutation_p.*222W|SHISA9_ENST00000558583.1_Intron			B4DS77	SHSA9_HUMAN	shisa family member 9						regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						GGACAGTCTGAGTGCACGGAT	0.522																																					p.X222W		Atlas-SNP	.											.	SHISA9	33	.	0			c.A666G						.						99.0	80.0	86.0					16																	13002438		692	1591	2283	SO:0001627	intron_variant	729993	exon2			AGTCTGAGTGCAC		CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.563+5954A>G	chr16.hg19:g.13002438A>G		84.0	0.0		96.0	4.0	NM_001145205	C9J314|C9JCE9	Missense_Mutation	SNP	ENST00000424107.3	hg19	CCDS45417.2	.	.	.	.	.	.	.	.	.	.	A	3.790	-0.043910	0.07452	.	.	ENSG00000237515	ENST00000423335	.	.	.	3.48	1.06	0.20224	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.0145	0.06055	0.6692:0.0:0.1196:0.2112	.	.	.	.	W	263	.	.	X	+	3	0	SHISA9	12909939	0.000000	0.05858	0.008000	0.14137	0.007000	0.05969	-0.063000	0.11655	0.171000	0.19730	0.482000	0.46254	TGA	.	.		0.522	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334564.5	NM_001145204	
SPN	6693	hgsc.bcm.edu	37	16	29675097	29675097	+	Silent	SNP	C	C	T	rs556201400		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:29675097C>T	ENST00000360121.3	+	2	140	c.48C>T	c.(46-48)gaC>gaT	p.D16D	SPN_ENST00000395389.2_Silent_p.D16D	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0	Ala-rich.				anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						TAAGCCCAGACGCTCTGGGGA	0.587													t|||	1	0.000199681	0.0	0.0014	5008	,	,		17775	0.0		0.0	False		,,,				2504	0.0				p.D16D		Atlas-SNP	.											.	SPN	44	.	0			c.C48T						.						117.0	127.0	124.0					16																	29675097		2197	4300	6497	SO:0001819	synonymous_variant	6693	exon2			CCCAGACGCTCTG	J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.48C>T	chr16.hg19:g.29675097C>T		105.0	0.0		100.0	4.0	NM_001030288	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Silent	SNP	ENST00000360121.3	hg19	CCDS10650.1																																																																																			.	.		0.587	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215001.2		
VPS35	55737	hgsc.bcm.edu	37	16	46708512	46708512	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:46708512A>G	ENST00000299138.7	-	9	1033	c.975T>C	c.(973-975)ttT>ttC	p.F325F	VPS35_ENST00000568642.1_5'UTR	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	325					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				AAAATATATCAAAAAGTTTAA	0.343																																					p.F325F		Atlas-SNP	.											.	VPS35	49	.	0			c.T975C						.						38.0	38.0	38.0					16																	46708512		2203	4300	6503	SO:0001819	synonymous_variant	55737	exon9			TATATCAAAAAGT	AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.975T>C	chr16.hg19:g.46708512A>G		100.0	0.0		77.0	4.0	NM_018206	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Silent	SNP	ENST00000299138.7	hg19	CCDS10721.1																																																																																			.	.		0.343	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255742.3		
HEATR3	55027	hgsc.bcm.edu	37	16	50136189	50136189	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:50136189T>C	ENST00000299192.7	+	14	1954	c.1763T>C	c.(1762-1764)cTt>cCt	p.L588P	RP11-429P3.5_ENST00000566770.1_RNA|HEATR3_ENST00000285767.4_Missense_Mutation_p.L502P	NM_182922.2	NP_891552.1	Q7Z4Q2	HEAT3_HUMAN	HEAT repeat containing 3	588										cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	28						TGCTTTCTGCTTGAAGTTACC	0.423																																					p.L588P		Atlas-SNP	.											.	HEATR3	59	.	0			c.T1763C						.						200.0	172.0	182.0					16																	50136189		2198	4300	6498	SO:0001583	missense	55027	exon14			TTCTGCTTGAAGT	BC018730	CCDS10739.1	16q12.1	2008-02-05			ENSG00000155393	ENSG00000155393			26087	protein-coding gene	gene with protein product		614951				12477932	Standard	XM_005256013		Approved	FLJ20718	uc002efw.3	Q7Z4Q2	OTTHUMG00000133174	ENST00000299192.7:c.1763T>C	chr16.hg19:g.50136189T>C	ENSP00000299192:p.Leu588Pro	100.0	0.0		79.0	4.0	NM_182922	A8K1N4|Q8N525|Q8WV56|Q96CC9|Q9NWN7	Missense_Mutation	SNP	ENST00000299192.7	hg19	CCDS10739.1	.	.	.	.	.	.	.	.	.	.	T	18.89	3.719032	0.68844	.	.	ENSG00000155393	ENST00000285767;ENST00000299192	T;T	0.69926	-0.44;-0.44	5.49	5.49	0.81192	Armadillo-type fold (1);	0.057544	0.64402	D	0.000001	T	0.80226	0.4584	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.73380	0.98;0.909	T	0.82299	-0.0526	10	0.72032	D	0.01	.	15.8841	0.79226	0.0:0.0:0.0:1.0	.	502;588	B7WNW7;Q7Z4Q2	.;HEAT3_HUMAN	P	502;588	ENSP00000285767:L502P;ENSP00000299192:L588P	ENSP00000285767:L502P	L	+	2	0	HEATR3	48693690	1.000000	0.71417	0.967000	0.41034	0.734000	0.41952	5.319000	0.65835	2.215000	0.71742	0.528000	0.53228	CTT	.	.		0.423	HEATR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256880.2	NM_182922	
RBL2	5934	hgsc.bcm.edu	37	16	53513864	53513864	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:53513864A>G	ENST00000262133.6	+	19	2979	c.2842A>G	c.(2842-2844)Agc>Ggc	p.S948G	RBL2_ENST00000544545.1_Intron|RBL2_ENST00000379935.4_3'UTR	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	948	Domain B.|Pocket; binds E1A.				chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGATAGCAGAAGCCATCAGAA	0.353																																					p.S948G		Atlas-SNP	.											.	RBL2	115	.	0			c.A2842G						.						69.0	72.0	71.0					16																	53513864		2198	4300	6498	SO:0001583	missense	5934	exon19			AGCAGAAGCCATC	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.2842A>G	chr16.hg19:g.53513864A>G	ENSP00000262133:p.Ser948Gly	141.0	0.0		98.0	4.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	A	12.81	2.048109	0.36085	.	.	ENSG00000103479	ENST00000262133;ENST00000379935	D	0.90197	-2.63	5.59	5.59	0.84812	Retinoblastoma-associated protein, B-box (1);Cyclin-like (1);	0.148202	0.64402	D	0.000012	D	0.84800	0.5552	L	0.34521	1.04	0.80722	D	1	P;B	0.39424	0.673;0.126	B;B	0.37550	0.253;0.096	D	0.84786	0.0776	10	0.46703	T	0.11	-15.5902	10.8547	0.46792	0.8421:0.1579:0.0:0.0	.	658;948	E9PG04;Q08999	.;RBL2_HUMAN	G	948;658	ENSP00000262133:S948G	ENSP00000262133:S948G	S	+	1	0	RBL2	52071365	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.954000	0.56708	2.126000	0.65437	0.528000	0.53228	AGC	.	.		0.353	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
CENPT	80152	hgsc.bcm.edu	37	16	67859617	67859617	+	IGR	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr16:67859617A>G	ENST00000562787.1	-	0	2345				TSNAXIP1_ENST00000388833.3_Missense_Mutation_p.T234A|TSNAXIP1_ENST00000561639.1_Missense_Mutation_p.T288A|TSNAXIP1_ENST00000415766.3_Missense_Mutation_p.T219A	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T						chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		TCTTAAGATGACCCGGCAAGA	0.582																																					p.T234A		Atlas-SNP	.											.	TSNAXIP1	66	.	0			c.A700G						.						109.0	115.0	113.0					16																	67859617		2065	4218	6283	SO:0001628	intergenic_variant	55815	exon8			AAGATGACCCGGC	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3			chr16.hg19:g.67859617A>G		74.0	0.0		80.0	4.0	NM_018430	Q96I29|Q96IC6|Q96NK9|Q9H901	Missense_Mutation	SNP	ENST00000562787.1	hg19	CCDS42182.1	.	.	.	.	.	.	.	.	.	.	A	1.325	-0.598275	0.03744	.	.	ENSG00000102904	ENST00000415766;ENST00000388833;ENST00000431934	.	.	.	5.8	-5.82	0.02333	.	0.903009	0.09563	N	0.785321	T	0.16428	0.0395	N	0.02213	-0.635	0.26558	N	0.973781	B;B;B;B	0.06786	0.001;0.001;0.0;0.0	B;B;B;B	0.08055	0.003;0.002;0.001;0.002	T	0.44467	-0.9326	9	0.02654	T	1	-0.017	19.6123	0.95613	0.1619:0.0:0.8381:0.0	.	219;288;24;234	E7ENJ7;B4DXD0;B4DY78;Q2TAA8	.;.;.;TXIP1_HUMAN	A	219;234;24	.	ENSP00000373485:T234A	T	+	1	0	TSNAXIP1	66417118	0.269000	0.24143	0.298000	0.25002	0.761000	0.43186	-0.162000	0.10012	-1.067000	0.03160	-0.912000	0.02778	ACC	.	.		0.582	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
ABR	29	hgsc.bcm.edu	37	17	975915	975915	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:975915A>G	ENST00000302538.5	-	8	979	c.833T>C	c.(832-834)cTg>cCg	p.L278P	ABR_ENST00000544583.2_Missense_Mutation_p.L232P|ABR_ENST00000291107.2_Missense_Mutation_p.L241P|ABR_ENST00000574437.1_Missense_Mutation_p.L232P|ABR_ENST00000536794.2_Missense_Mutation_p.L60P	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	278	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GATGCTGGACAGGAAGTTCTG	0.657																																					p.L278P	Esophageal Squamous(197;2016 2115 4129 29033 46447)	Atlas-SNP	.											.	ABR	119	.	0			c.T833C						.						111.0	87.0	95.0					17																	975915		2203	4300	6503	SO:0001583	missense	29	exon8			CTGGACAGGAAGT	L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.833T>C	chr17.hg19:g.975915A>G	ENSP00000303909:p.Leu278Pro	153.0	0.0		121.0	5.0	NM_021962	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	ENST00000302538.5	hg19	CCDS10999.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.984029	0.93044	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794;ENST00000382259	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.88	5.88	0.94601	Dbl homology (DH) domain (5);	0.060841	0.64402	D	0.000002	T	0.80909	0.4714	M	0.83012	2.62	0.80722	D	1	D;D;D;D	0.89917	0.995;0.995;0.999;1.0	D;D;D;D	0.91635	0.934;0.976;0.992;0.999	D	0.83833	0.0253	10	0.87932	D	0	.	15.4693	0.75429	1.0:0.0:0.0:0.0	.	60;162;241;278	B7Z683;Q6ZT60;Q12979-2;Q12979	.;.;.;ABR_HUMAN	P	278;232;241;60;162	ENSP00000303909:L278P;ENSP00000442048:L232P;ENSP00000291107:L241P;ENSP00000437429:L60P	ENSP00000291107:L241P	L	-	2	0	ABR	922665	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.257000	0.95545	2.227000	0.72691	0.528000	0.53228	CTG	.	.		0.657	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206675.4		
PRPF8	10594	hgsc.bcm.edu	37	17	1585147	1585147	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:1585147A>G	ENST00000572621.1	-	4	885	c.620T>C	c.(619-621)tTc>tCc	p.F207S	PRPF8_ENST00000304992.6_Missense_Mutation_p.F207S			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	207					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		GTGGTCATAGAACCAGTCCAA	0.547																																					p.F207S		Atlas-SNP	.											.	PRPF8	169	.	0			c.T620C						.						92.0	99.0	96.0					17																	1585147		2203	4300	6503	SO:0001583	missense	10594	exon5			TCATAGAACCAGT	AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.620T>C	chr17.hg19:g.1585147A>G	ENSP00000460348:p.Phe207Ser	127.0	0.0		89.0	4.0	NM_006445	O14547|O75965	Missense_Mutation	SNP	ENST00000572621.1	hg19	CCDS11010.1	.	.	.	.	.	.	.	.	.	.	A	19.51	3.840408	0.71488	.	.	ENSG00000174231	ENST00000304992	T	0.51325	0.71	5.7	5.7	0.88788	Pre-mRNA-processing-splicing factor 8 (2);	0.052615	0.85682	D	0.000000	T	0.71854	0.3389	M	0.89095	3.005	0.80722	D	1	P	0.45569	0.861	P	0.58820	0.846	T	0.77509	-0.2561	10	0.87932	D	0	.	15.9682	0.79991	1.0:0.0:0.0:0.0	.	207	Q6P2Q9	PRP8_HUMAN	S	207	ENSP00000304350:F207S	ENSP00000304350:F207S	F	-	2	0	PRPF8	1531897	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.307000	0.96226	2.176000	0.68965	0.454000	0.30748	TTC	.	.		0.547	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438412.2		
ZNF232	7775	hgsc.bcm.edu	37	17	5009459	5009459	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:5009459T>C	ENST00000250076.3	-	5	1649	c.995A>G	c.(994-996)aAg>aGg	p.K332R	ZNF232_ENST00000575898.1_Missense_Mutation_p.K323R|ZNF232_ENST00000575538.1_5'Flank|ZNF232_ENST00000416429.2_3'UTR	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	305					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GTCACTACACTTATAGGGTTT	0.413																																					p.K332R		Atlas-SNP	.											ZNF232,NS,carcinoma,0,1	ZNF232	42	.	0			c.A995G						.						108.0	111.0	110.0					17																	5009459		2203	4300	6503	SO:0001583	missense	7775	exon5			CTACACTTATAGG	AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.995A>G	chr17.hg19:g.5009459T>C	ENSP00000250076:p.Lys332Arg	44.0	0.0		24.0	2.0	NM_014519		Missense_Mutation	SNP	ENST00000250076.3	hg19	CCDS11068.1	.	.	.	.	.	.	.	.	.	.	T	10.06	1.245936	0.22796	.	.	ENSG00000167840	ENST00000250076	T	0.35973	1.28	2.99	0.766	0.18476	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.494253	0.15116	N	0.279675	T	0.20618	0.0496	L	0.31371	0.925	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.001	T	0.15093	-1.0449	10	0.34782	T	0.22	.	3.0462	0.06154	0.0:0.2573:0.2274:0.5153	.	305;296	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	R	332	ENSP00000250076:K332R	ENSP00000250076:K332R	K	-	2	0	ZNF232	4950183	0.000000	0.05858	0.041000	0.18516	0.997000	0.91878	-0.645000	0.05409	0.111000	0.17947	0.533000	0.62120	AAG	.	.		0.413	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216915.1	NM_014519	
SCIMP	388325	hgsc.bcm.edu	37	17	5124625	5124625	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:5124625T>C	ENST00000574081.1	-	3	270	c.166A>G	c.(166-168)Aag>Gag	p.K56E	SCIMP_ENST00000574297.1_Missense_Mutation_p.K56E|SCIMP_ENST00000571800.1_Missense_Mutation_p.K49E|RP11-333E1.1_ENST00000573772.1_RNA|RP11-333E1.1_ENST00000575601.1_RNA|SCIMP_ENST00000399600.4_Missense_Mutation_p.K49E|RP11-333E1.1_ENST00000571689.1_RNA	NM_001271842.1|NM_207103.3	NP_001258771.1|NP_996986.1	Q6UWF3	SCIMP_HUMAN	SLP adaptor and CSK interacting membrane protein	56					positive regulation of ERK1 and ERK2 cascade (GO:0070374)	immunological synapse (GO:0001772)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|membrane (GO:0016020)|tetraspanin-enriched microdomain (GO:0097197)|uropod membrane (GO:0031259)											TTCAGGGGCTTGGCAATTTCC	0.398																																					p.K56E		Atlas-SNP	.											.	.	.	.	0			c.A166G						.						210.0	192.0	198.0					17																	5124625		1854	4095	5949	SO:0001583	missense	388325	exon3			GGGGCTTGGCAAT	AY358809	CCDS42242.1, CCDS62044.1	17p13.2	2011-11-24	2011-11-23	2011-11-23	ENSG00000161929	ENSG00000161929			33504	protein-coding gene	gene with protein product	"""SLP65/SLP76, Csk-interacting membrane protein"""	614406	"""chromosome 17 open reading frame 87"""	C17orf87		21930792	Standard	NM_207103		Approved	DTFT5783, UNQ5783, FLJ32580, MGC163426, MGC163428	uc002gbh.3	Q6UWF3	OTTHUMG00000132914	ENST00000574081.1:c.166A>G	chr17.hg19:g.5124625T>C	ENSP00000461269:p.Lys56Glu	116.0	0.0		99.0	4.0	NM_207103	A6XGL4|B4DLK1|Q96MD0	Missense_Mutation	SNP	ENST00000574081.1	hg19	CCDS42242.1	.	.	.	.	.	.	.	.	.	.	t	17.81	3.479880	0.63849	.	.	ENSG00000161929	ENST00000399600;ENST00000399592	.	.	.	4.58	4.58	0.56647	.	0.548812	0.17726	N	0.164061	T	0.47358	0.1441	M	0.61703	1.905	0.09310	N	1	P;P;P	0.50528	0.728;0.936;0.728	B;P;B	0.48425	0.297;0.577;0.297	T	0.46205	-0.9208	9	0.66056	D	0.02	-5.4106	10.6338	0.45551	0.0:0.0:0.0:1.0	.	49;49;56	A6XGL4;Q6UWF3-2;Q6UWF3	.;.;CQ087_HUMAN	E	56;45	.	ENSP00000382501:K45E	K	-	1	0	C17orf87	5065349	0.238000	0.23825	0.008000	0.14137	0.330000	0.28571	3.289000	0.51747	2.285000	0.76669	0.529000	0.55759	AAG	.	.		0.398	SCIMP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256425.2	NM_207103	
TP53	7157	hgsc.bcm.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,right_lower_lobe,carcinoma,-2,1	TP53	33396	.	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	chr17.hg19:g.7577534C>A	ENSP00000269305:p.Arg249Ser	191.0	0.0		123.0	91.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NCOR1	9611	hgsc.bcm.edu	37	17	15973762	15973762	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:15973762A>G	ENST00000268712.3	-	31	4487	c.4230T>C	c.(4228-4230)ccT>ccC	p.P1410P	NCOR1_ENST00000395857.3_5'UTR|NCOR1_ENST00000395851.1_Silent_p.P1426P	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	1410	Interaction with ETO.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ATAGTTTGCTAGGCCCCGTGA	0.448																																					p.P1426P		Atlas-SNP	.											.	NCOR1	240	.	0			c.T4278C						.						174.0	167.0	169.0					17																	15973762		2203	4300	6503	SO:0001819	synonymous_variant	9611	exon30			TTTGCTAGGCCCC	AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.4230T>C	chr17.hg19:g.15973762A>G		143.0	0.0		85.0	4.0	NM_001190440	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	ENST00000268712.3	hg19	CCDS11175.1																																																																																			.	.		0.448	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131751.5	NM_006311	
KIAA0100	9703	hgsc.bcm.edu	37	17	26946934	26946934	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:26946934G>A	ENST00000528896.2	-	30	5538	c.5464C>T	c.(5464-5466)Cgg>Tgg	p.R1822W	SPAG5-AS1_ENST00000424210.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.R1679W|KIAA0100_ENST00000579924.2_5'Flank|KIAA0100_ENST00000389003.3_Missense_Mutation_p.R1679W|SPAG5-AS1_ENST00000414744.1_RNA	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	1822						extracellular region (GO:0005576)		p.R1822W(1)		breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					ACATGCTGCCGCACAGCCTCC	0.493																																					p.R1822W		Atlas-SNP	.											KIAA0100,colon,carcinoma,0,1	KIAA0100	175	.	1	Substitution - Missense(1)	large_intestine(1)	c.C5464T						.						99.0	91.0	94.0					17																	26946934		2203	4300	6503	SO:0001583	missense	9703	exon30			GCTGCCGCACAGC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.5464C>T	chr17.hg19:g.26946934G>A	ENSP00000436773:p.Arg1822Trp	69.0	0.0		82.0	4.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	G	17.99	3.522641	0.64747	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.55413	0.52;0.52	5.53	3.24	0.37175	FMP27,  C-terminal (1);	0.051185	0.64402	D	0.000001	T	0.71929	0.3398	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.77117	-0.2706	10	0.72032	D	0.01	.	13.3585	0.60642	0.0:0.0:0.5836:0.4164	.	1822	Q14667	K0100_HUMAN	W	1822;1792;1822;1679	ENSP00000436773:R1822W;ENSP00000446443:R1679W	ENSP00000005905:R1822W	R	-	1	2	KIAA0100	23971061	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.408000	0.34668	1.435000	0.47434	0.655000	0.94253	CGG	.	.		0.493	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
RFFL	117584	hgsc.bcm.edu	37	17	33339090	33339090	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:33339090T>C	ENST00000315249.7	-	7	1211	c.989A>G	c.(988-990)gAg>gGg	p.E330G	RFFL_ENST00000584655.1_Missense_Mutation_p.E294G|RFFL_ENST00000413582.2_Missense_Mutation_p.E322G|RFFL_ENST00000394597.2_Missense_Mutation_p.E330G|RFFL_ENST00000378516.2_Missense_Mutation_p.E322G|RFFL_ENST00000447669.2_Missense_Mutation_p.E330G|RFFL_ENST00000415395.2_Missense_Mutation_p.E330G|RP5-837J1.2_ENST00000578488.1_RNA|RFFL_ENST00000268850.7_Missense_Mutation_p.E294G|RAD51L3-RFFL_ENST00000593039.1_Missense_Mutation_p.E239G					ring finger and FYVE-like domain containing E3 ubiquitin protein ligase											kidney(1)|large_intestine(2)|lung(3)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0227)		GTGGCCACACTCCAGAAGAAC	0.527																																					p.E330G		Atlas-SNP	.											.	RFFL	27	.	0			c.A989G						.						145.0	109.0	121.0					17																	33339090		2203	4300	6503	SO:0001583	missense	117584	exon7			CCACACTCCAGAA	AF434816	CCDS11286.1	17q12	2012-02-23	2012-02-23		ENSG00000092871	ENSG00000092871		"""RING-type (C3HC4) zinc fingers"""	24821	protein-coding gene	gene with protein product		609735	"""ring finger and FYVE-like domain containing"""			15229288	Standard	NR_037713		Approved	rififylin, fring, RNF189, RNF34L	uc002hin.1	Q8WZ73	OTTHUMG00000132933	ENST00000315249.7:c.989A>G	chr17.hg19:g.33339090T>C	ENSP00000326170:p.Glu330Gly	114.0	0.0		119.0	5.0	NM_001017368		Missense_Mutation	SNP	ENST00000315249.7	hg19	CCDS11286.1	.	.	.	.	.	.	.	.	.	.	T	32	5.157861	0.94686	.	.	ENSG00000092871	ENST00000315249;ENST00000394597;ENST00000378516;ENST00000268850	T;T;T;T	0.79033	-1.23;-1.23;-1.23;-1.23	5.65	5.65	0.86999	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);	0.000000	0.85682	D	0.000000	T	0.82144	0.4973	L	0.28649	0.875	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.994;1.0;0.994	D	0.84323	0.0517	10	0.87932	D	0	-25.117	15.2098	0.73214	0.0:0.0:0.0:1.0	.	294;330;322	Q8WZ73-3;Q8WZ73;Q8WZ73-2	.;RFFL_HUMAN;.	G	330;330;322;294	ENSP00000326170:E330G;ENSP00000378096:E330G;ENSP00000367777:E322G;ENSP00000268850:E294G	ENSP00000268850:E294G	E	-	2	0	RFFL	30363203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.527	RFFL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256460.2	NM_057178	
NLE1	54475	hgsc.bcm.edu	37	17	33460235	33460235	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:33460235T>C	ENST00000442241.4	-	12	1439	c.1400A>G	c.(1399-1401)gAt>gGt	p.D467G	NLE1_ENST00000586869.1_Missense_Mutation_p.D175G|NLE1_ENST00000360831.5_Missense_Mutation_p.D425G	NM_001014445.1|NM_018096.3	NP_001014445.1|NP_060566.2	Q9NVX2	NLE1_HUMAN	notchless homolog 1 (Drosophila)	467					hematopoietic stem cell homeostasis (GO:0061484)|inner cell mass cell differentiation (GO:0001826)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001268)|negative regulation of mitotic cell cycle (GO:0045930)|Notch signaling pathway (GO:0007219)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|ribosomal large subunit biogenesis (GO:0042273)	nucleolus (GO:0005730)|nucleus (GO:0005634)				NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	22		Ovarian(249;0.17)				TCTCTGGCCATCTGGACTCCA	0.592																																					p.D467G		Atlas-SNP	.											.	NLE1	42	.	0			c.A1400G						.						200.0	145.0	163.0					17																	33460235		2203	4300	6503	SO:0001583	missense	54475	exon12			TGGCCATCTGGAC		CCDS11291.1, CCDS45647.1	17q12	2013-01-10		2005-08-09	ENSG00000073536	ENSG00000073536		"""WD repeat domain containing"""	19889	protein-coding gene	gene with protein product	"""Notchless gene homolog, (Drosophila)"""						Standard	XM_005257989		Approved	FLJ10458	uc002hiy.1	Q9NVX2	OTTHUMG00000132928	ENST00000442241.4:c.1400A>G	chr17.hg19:g.33460235T>C	ENSP00000413572:p.Asp467Gly	106.0	0.0		97.0	4.0	NM_018096	O60868|Q59GJ8|Q9BU54	Missense_Mutation	SNP	ENST00000442241.4	hg19	CCDS11291.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.6|25.6	4.652398|4.652398	0.88056|0.88056	.|.	.|.	ENSG00000073536|ENSG00000073536	ENST00000442241;ENST00000360831;ENST00000537697|ENST00000436188	T|.	0.63255|.	-0.03|.	5.41|5.41	5.41|5.41	0.78517|0.78517	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);|.	0.092597|.	0.64402|.	D|.	0.000001|.	T|T	0.59542|0.59542	0.2201|0.2201	L|L	0.42632|0.42632	1.34|1.34	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.56697|0.56697	-0.7936|-0.7936	10|5	0.87932|.	D|.	0|.	-13.9533|-13.9533	13.4332|13.4332	0.61068|0.61068	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	467|.	Q9NVX2|.	NLE1_HUMAN|.	G|V	467;175;443|286	ENSP00000413572:D467G|.	ENSP00000354075:D175G|.	D|M	-|-	2|1	0|0	NLE1|NLE1	30484348|30484348	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.087000|7.087000	0.76893|0.76893	2.261000|2.261000	0.74972|0.74972	0.460000|0.460000	0.39030|0.39030	GAT|ATG	.	.		0.592	NLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256441.2	NM_018096	
ACACA	31	hgsc.bcm.edu	37	17	35598870	35598870	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:35598870T>C	ENST00000394406.2	-	23	3110	c.2920A>G	c.(2920-2922)Agg>Ggg	p.R974G	ACACA_ENST00000360679.3_Splice_Site_p.R916G|ACACA_ENST00000335166.5_Splice_Site_p.R896G|ACACA_ENST00000353139.5_Splice_Site_p.R1011G	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	974					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	AGTTACTACCTCTGTACCAGC	0.408																																					p.R1011G	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-SNP	.											.	ACACA	395	.	0			c.A3031G						.						115.0	101.0	106.0					17																	35598870		2203	4300	6503	SO:0001630	splice_region_variant	31	exon23			ACTACCTCTGTAC	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.2921+1A>G	chr17.hg19:g.35598870T>C		135.0	0.0		87.0	4.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Missense_Mutation	SNP	ENST00000394406.2	hg19	CCDS11317.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.877936	0.51801	.	.	ENSG00000132142	ENST00000353139;ENST00000360679;ENST00000394406;ENST00000452074;ENST00000335166	T;T;T;T	0.50548	0.74;0.74;0.74;0.74	4.89	4.89	0.63831	Acetyl-CoA carboxylase, central domain (1);	0.141252	0.64402	D	0.000005	T	0.67627	0.2913	M	0.88640	2.97	0.80722	D	1	P;B;B	0.34815	0.47;0.014;0.011	P;B;B	0.49012	0.598;0.033;0.019	T	0.72551	-0.4259	10	0.59425	D	0.04	-6.8596	13.8335	0.63395	0.0:0.0:0.0:1.0	.	1011;974;916	Q13085-4;Q13085;Q13085-2	.;ACACA_HUMAN;.	G	1011;916;974;998;896	ENSP00000344789:R1011G;ENSP00000353898:R916G;ENSP00000377928:R974G;ENSP00000335323:R896G	ENSP00000335323:R896G	R	-	1	2	ACACA	32672983	1.000000	0.71417	1.000000	0.80357	0.574000	0.36063	6.161000	0.71868	2.049000	0.60858	0.482000	0.46254	AGG	.	.		0.408	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	Missense_Mutation
MED1	5469	hgsc.bcm.edu	37	17	37566928	37566928	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:37566928C>T	ENST00000394287.3	-	17	1751	c.1546G>A	c.(1546-1548)Gaa>Aaa	p.E516K	MED1_ENST00000300651.6_Missense_Mutation_p.E516K			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TGAATGGTTTCAGCTTTCCTC	0.483										HNSCC(31;0.082)																											p.E516K	Pancreas(21;279 768 2492 4877 24026)	Atlas-SNP	.											.	MED1	123	.	0			c.G1546A						.						88.0	81.0	83.0					17																	37566928		2203	4300	6503	SO:0001583	missense	5469	exon17			TGGTTTCAGCTTT	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1546G>A	chr17.hg19:g.37566928C>T	ENSP00000377828:p.Glu516Lys	181.0	0.0		130.0	6.0	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	ENST00000394287.3	hg19		.	.	.	.	.	.	.	.	.	.	C	16.47	3.131115	0.56828	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	T;T	0.56103	0.48;0.48	5.8	5.8	0.92144	.	.	.	.	.	T	0.46112	0.1376	N	0.22421	0.69	0.80722	D	1	P;B	0.34546	0.456;0.42	B;B	0.36808	0.233;0.09	T	0.45056	-0.9287	9	0.54805	T	0.06	-14.153	20.0505	0.97625	0.0:1.0:0.0:0.0	.	516;516	Q15648;Q15648-3	MED1_HUMAN;.	K	516	ENSP00000377828:E516K;ENSP00000300651:E516K	ENSP00000300651:E516K	E	-	1	0	MED1	34820454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.739000	0.93911	0.561000	0.74099	GAA	.	.		0.483	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000256944.1	NM_004774	
PSMD3	5709	hgsc.bcm.edu	37	17	38140566	38140566	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:38140566A>G	ENST00000264639.4	+	2	414	c.240A>G	c.(238-240)aaA>aaG	p.K80K	PSMD3_ENST00000541736.1_Intron	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	80					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					AGCACGTGAAACAGCTAGAGA	0.512																																					p.K80K	Ovarian(186;531 2051 6385 19668 48409)	Atlas-SNP	.											.	PSMD3	56	.	0			c.A240G						.						59.0	56.0	57.0					17																	38140566		2203	4300	6503	SO:0001819	synonymous_variant	5709	exon2			CGTGAAACAGCTA	D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.240A>G	chr17.hg19:g.38140566A>G		99.0	0.0		99.0	4.0	NM_002809	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Silent	SNP	ENST00000264639.4	hg19	CCDS11356.1																																																																																			.	.		0.512	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257018.1	NM_002809	
KLHL11	55175	hgsc.bcm.edu	37	17	40010298	40010298	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:40010298G>A	ENST00000319121.3	-	2	1881	c.1821C>T	c.(1819-1821)taC>taT	p.Y607Y	RP11-156E6.1_ENST00000560400.1_RNA	NM_018143.1	NP_060613.1	Q9NVR0	KLH11_HUMAN	kelch-like family member 11	607										NS(2)|breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17		Breast(137;0.00156)				CATCATCTTTGTAATAGCAAA	0.428																																					p.Y607Y		Atlas-SNP	.											.	KLHL11	44	.	0			c.C1821T						.						93.0	93.0	93.0					17																	40010298		2203	4300	6503	SO:0001819	synonymous_variant	55175	exon2			ATCTTTGTAATAG		CCDS11411.1	17q21	2013-01-30	2013-01-30		ENSG00000178502	ENSG00000178502		"""Kelch-like"", ""BTB/POZ domain containing"""	19008	protein-coding gene	gene with protein product			"""kelch-like 11 (Drosophila)"""				Standard	NM_018143		Approved	FLJ10572	uc002hyf.1	Q9NVR0	OTTHUMG00000133506	ENST00000319121.3:c.1821C>T	chr17.hg19:g.40010298G>A		119.0	0.0		81.0	4.0	NM_018143		Silent	SNP	ENST00000319121.3	hg19	CCDS11411.1																																																																																			.	.		0.428	KLHL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257464.2	NM_018143	
HDAC5	10014	hgsc.bcm.edu	37	17	42168677	42168677	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:42168677A>G	ENST00000393622.2	-	11	1679	c.1348T>C	c.(1348-1350)Ttg>Ctg	p.L450L	HDAC5_ENST00000225983.6_Silent_p.L451L|HDAC5_ENST00000336057.5_Silent_p.L450L|HDAC5_ENST00000586802.1_Silent_p.L450L	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	450					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		TGCTCCAGCAACAGCACATGC	0.632																																					p.L451L		Atlas-SNP	.											.	HDAC5	67	.	0			c.T1351C						.						25.0	24.0	24.0					17																	42168677		2203	4298	6501	SO:0001819	synonymous_variant	10014	exon11			CCAGCAACAGCAC	AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1348T>C	chr17.hg19:g.42168677A>G		75.0	0.0		109.0	5.0	NM_001015053	C9JFV9|O60340|O60528|Q96DY4	Silent	SNP	ENST00000393622.2	hg19	CCDS45696.1																																																																																			.	.		0.632	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457686.1	NM_001015053	
UBTF	7343	hgsc.bcm.edu	37	17	42284734	42284734	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:42284734T>C	ENST00000302904.4	-	21	2663	c.2171A>G	c.(2170-2172)aAt>aGt	p.N724S	CTB-175E5.7_ENST00000586560.1_RNA|UBTF_ENST00000529383.1_Splice_Site_p.N724S|UBTF_ENST00000436088.1_Splice_Site_p.N724S|UBTF_ENST00000343638.5_Splice_Site_p.N687S|UBTF_ENST00000527034.1_Splice_Site_p.M686V|UBTF_ENST00000533177.1_Splice_Site_p.N687S|UBTF_ENST00000393606.3_Splice_Site_p.N687S|UBTF_ENST00000526094.1_Splice_Site_p.N687S			P17480	UBF1_HUMAN	upstream binding transcription factor, RNA polymerase I	724	Asp/Glu/Ser-rich (acidic).				chromatin silencing at rDNA (GO:0000183)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|regulation of transcription from RNA polymerase I promoter (GO:0006356)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|large_intestine(9)|lung(10)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.114)		atcCTCTTCATTCTGGGGGGT	0.612																																					p.N724S		Atlas-SNP	.											.	UBTF	65	.	0			c.A2171G						.						123.0	80.0	94.0					17																	42284734		2203	4300	6503	SO:0001630	splice_region_variant	7343	exon21			TCTTCATTCTGGG	BC042297	CCDS11480.1, CCDS42346.1	17q21.31	2014-03-25			ENSG00000108312	ENSG00000108312			12511	protein-coding gene	gene with protein product		600673				9126496	Standard	NM_001076683		Approved	UBF, NOR-90, UBF1, UBF2	uc010czs.3	P17480	OTTHUMG00000167585	ENST00000302904.4:c.2170-1A>G	chr17.hg19:g.42284734T>C		121.0	0.0		104.0	5.0	NM_014233	A8K6R8	Missense_Mutation	SNP	ENST00000302904.4	hg19	CCDS11480.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.343|9.343	1.063501|1.063501	0.20067|0.20067	.|.	.|.	ENSG00000108312|ENSG00000108312	ENST00000527034|ENST00000343638;ENST00000302904;ENST00000533177;ENST00000436088;ENST00000393606;ENST00000526094;ENST00000529383	D|D;D;D;D;D;D;D	0.98192|0.97924	-4.78|-4.61;-3.86;-4.61;-3.86;-4.61;-4.61;-3.86	4.95|4.95	3.87|3.87	0.44632|0.44632	.|.	.|0.653608	.|0.14315	.|N	.|0.327400	D|D	0.92854|0.92854	0.7727|0.7727	N|N	0.19112|0.19112	0.55|0.55	0.29230|0.29230	N|N	0.873351|0.873351	.|B;B	.|0.06786	.|0.001;0.0	.|B;B	.|0.04013	.|0.001;0.0	D|D	0.85436|0.85436	0.1152|0.1152	7|10	0.87932|0.14252	D|T	0|0.57	-13.223|-13.223	9.0709|9.0709	0.36491|0.36491	0.0:0.0844:0.0:0.9156|0.0:0.0844:0.0:0.9156	.|.	.|687;724	.|P17480-2;P17480	.|.;UBF1_HUMAN	V|S	686|687;724;687;724;687;687;724	ENSP00000431539:M686V|ENSP00000345297:N687S;ENSP00000302640:N724S;ENSP00000437180:N687S;ENSP00000390669:N724S;ENSP00000377231:N687S;ENSP00000432925:N687S;ENSP00000435708:N724S	ENSP00000431539:M686V|ENSP00000302640:N724S	M|N	-|-	1|2	0|0	UBTF|UBTF	39640260|39640260	0.999000|0.999000	0.42202|0.42202	0.983000|0.983000	0.44433|0.44433	0.925000|0.925000	0.55904|0.55904	3.444000|3.444000	0.52914|0.52914	1.035000|1.035000	0.39972|0.39972	0.459000|0.459000	0.35465|0.35465	ATG|AAT	.	.		0.612	UBTF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395205.1	NM_014233	Missense_Mutation
WNT9B	7484	hgsc.bcm.edu	37	17	44953863	44953863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:44953863G>T	ENST00000290015.2	+	4	906	c.853G>T	c.(853-855)Gag>Tag	p.E285*	WNT9B_ENST00000393461.2_Nonsense_Mutation_p.E285*	NM_003396.1	NP_003387.1	O14905	WNT9B_HUMAN	wingless-type MMTV integration site family, member 9B	285					branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|cellular response to retinoic acid (GO:0071300)|cellular response to starvation (GO:0009267)|collecting duct development (GO:0072044)|cornea development in camera-type eye (GO:0061303)|embryonic cranial skeleton morphogenesis (GO:0048701)|establishment of planar polarity involved in nephron morphogenesis (GO:0072046)|in utero embryonic development (GO:0001701)|kidney rudiment formation (GO:0072003)|male genitalia development (GO:0030539)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesonephric duct formation (GO:0072181)|metanephric tubule formation (GO:0072174)|multicellular organismal development (GO:0007275)|neuron differentiation (GO:0030182)|palate development (GO:0060021)|positive regulation of catalytic activity (GO:0043085)|regulation of asymmetric cell division (GO:0009786)|regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003339)|regulation of protein phosphorylation (GO:0001932)|regulation of tube size (GO:0035150)|response to retinoic acid (GO:0032526)|uterus morphogenesis (GO:0061038)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			large_intestine(2)|lung(8)	10			BRCA - Breast invasive adenocarcinoma(9;0.0257)			GGTGTACATGGAGGACTCACC	0.677																																					p.E285X		Atlas-SNP	.											.	WNT9B	37	.	0			c.G853T						.						46.0	50.0	48.0					17																	44953863		2201	4293	6494	SO:0001587	stop_gained	7484	exon4			TACATGGAGGACT	AF028703	CCDS11506.1	17q21	2008-01-07	2003-03-11	2003-03-14		ENSG00000158955		"""Wingless-type MMTV integration sites"""	12779	protein-coding gene	gene with protein product		602864	"""wingless-type MMTV integration site family, member 15"""	WNT15		9441749, 11713592	Standard	NM_003396		Approved	WNT14B	uc002ikw.1	O14905		ENST00000290015.2:c.853G>T	chr17.hg19:g.44953863G>T	ENSP00000290015:p.Glu285*	145.0	0.0		137.0	76.0	NM_003396	Q6UXT4|Q96Q09	Nonsense_Mutation	SNP	ENST00000290015.2	hg19	CCDS11506.1	.	.	.	.	.	.	.	.	.	.	G	32	5.162681	0.94727	.	.	ENSG00000158955	ENST00000376843;ENST00000393461;ENST00000290015	.	.	.	4.69	4.69	0.59074	.	0.051938	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.8129	0.88622	0.0:0.0:1.0:0.0	.	.	.	.	X	279;285;285	.	ENSP00000290015:E285X	E	+	1	0	WNT9B	42308862	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.653000	0.98506	2.434000	0.82447	0.561000	0.74099	GAG	.	.		0.677	WNT9B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440433.1	NM_003396	
IGF2BP1	10642	hgsc.bcm.edu	37	17	47103022	47103022	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:47103022A>G	ENST00000290341.3	+	3	613	c.279A>G	c.(277-279)cgA>cgG	p.R93R	IGF2BP1_ENST00000431824.2_Silent_p.R93R|IGF2BP1_ENST00000515586.1_3'UTR	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1	93	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCCAGCTCCGATGGGAAGTAA	0.478																																					p.R93R	Esophageal Squamous(198;1041 2123 8248 37119 38268)	Atlas-SNP	.											.	IGF2BP1	80	.	0			c.A279G						.						35.0	34.0	35.0					17																	47103022		2203	4300	6503	SO:0001819	synonymous_variant	10642	exon3			GCTCCGATGGGAA	AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.279A>G	chr17.hg19:g.47103022A>G		100.0	0.0		99.0	4.0	NM_001160423	C9JT33	Silent	SNP	ENST00000290341.3	hg19	CCDS11543.1																																																																																			.	.		0.478	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364046.1	NM_006546	
KAT7	11143	hgsc.bcm.edu	37	17	47874270	47874270	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:47874270G>T	ENST00000259021.4	+	3	602	c.322G>T	c.(322-324)Gtt>Ttt	p.V108F	KAT7_ENST00000503935.2_5'UTR|KAT7_ENST00000509773.1_Missense_Mutation_p.V108F|KAT7_ENST00000424009.2_Missense_Mutation_p.V108F|KAT7_ENST00000510819.1_Intron|KAT7_ENST00000435742.2_5'UTR|KAT7_ENST00000454930.2_Intron	NM_007067.4	NP_008998.1	O95251	KAT7_HUMAN	K(lysine) acetyltransferase 7	108					chromatin organization (GO:0006325)|DNA replication (GO:0006260)|histone H3 acetylation (GO:0043966)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGAGCAAGTGGTTGATTTTTC	0.483																																					p.V108F		Atlas-SNP	.											.	.	.	.	0			c.G322T						.						132.0	134.0	133.0					17																	47874270		2203	4300	6503	SO:0001583	missense	11143	exon3			CAAGTGGTTGATT	AF074606	CCDS11554.1, CCDS56035.1, CCDS56036.1, CCDS56037.1, CCDS56038.1	17q21.32	2013-01-10	2011-07-21	2011-07-21	ENSG00000136504	ENSG00000136504	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17016	protein-coding gene	gene with protein product	"""histone acetyltransferase binding to ORC1"""	609880	"""MYST histone acetyltransferase 2"""	MYST2		10438470, 10930412	Standard	NM_001199155		Approved	HBOA, HBO1, ZC2HC7	uc002ipm.3	O95251	OTTHUMG00000161770	ENST00000259021.4:c.322G>T	chr17.hg19:g.47874270G>T	ENSP00000259021:p.Val108Phe	146.0	0.0		121.0	99.0	NM_007067	B3KN74|B4DF85|B4DFB4|B4DFE0|B4DGY4|E7ER15|G5E9K7	Missense_Mutation	SNP	ENST00000259021.4	hg19	CCDS11554.1	.	.	.	.	.	.	.	.	.	.	G	19.00	3.741140	0.69304	.	.	ENSG00000136504	ENST00000259021;ENST00000509773;ENST00000424009	.	.	.	5.93	5.93	0.95920	.	0.136549	0.49305	D	0.000152	T	0.73202	0.3557	L	0.36672	1.1	0.80722	D	1	D;B;D	0.64830	0.99;0.054;0.994	D;B;D	0.73380	0.954;0.022;0.98	T	0.72037	-0.4411	9	0.51188	T	0.08	-12.3404	19.9388	0.97151	0.0:0.0:1.0:0.0	.	108;108;108	B4DFB4;O95251;G5E9K7	.;KAT7_HUMAN;.	F	108	.	ENSP00000259021:V108F	V	+	1	0	KAT7	45229269	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.836000	0.86788	2.815000	0.96918	0.561000	0.74099	GTT	.	.		0.483	KAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366032.1	NM_007067	
TEX2	55852	hgsc.bcm.edu	37	17	62290595	62290595	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:62290595A>G	ENST00000583097.1	-	2	1155	c.983T>C	c.(982-984)cTc>cCc	p.L328P	TEX2_ENST00000258991.3_Missense_Mutation_p.L328P|TEX2_ENST00000584379.1_Missense_Mutation_p.L328P			Q8IWB9	TEX2_HUMAN	testis expressed 2	328					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		CAGATTGGAGAGTTCTGAAGC	0.458																																					p.L328P		Atlas-SNP	.											.	TEX2	89	.	0			c.T983C						.						72.0	68.0	70.0					17																	62290595		2203	4300	6503	SO:0001583	missense	55852	exon2			TTGGAGAGTTCTG	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.983T>C	chr17.hg19:g.62290595A>G	ENSP00000462665:p.Leu328Pro	88.0	0.0		100.0	4.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.18	1.564080	0.27915	.	.	ENSG00000136478	ENST00000258991	T	0.62639	0.01	6.03	6.03	0.97812	.	0.058903	0.64402	D	0.000001	T	0.76962	0.4061	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.99	T	0.78597	-0.2142	10	0.72032	D	0.01	-16.796	16.5582	0.84512	1.0:0.0:0.0:0.0	.	328;328	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	P	328	ENSP00000258991:L328P	ENSP00000258991:L328P	L	-	2	0	TEX2	59644327	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.050000	0.76620	2.308000	0.77769	0.533000	0.62120	CTC	.	.		0.458	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
ABCA9	10350	hgsc.bcm.edu	37	17	67041411	67041411	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:67041411T>C	ENST00000340001.4	-	4	582	c.371A>G	c.(370-372)gAc>gGc	p.D124G	ABCA9_ENST00000453985.2_Missense_Mutation_p.D124G|ABCA9_ENST00000370732.2_Missense_Mutation_p.D124G|ABCA9_ENST00000495634.1_Missense_Mutation_p.D124G	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	124					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TCTCACTGCGTCTATTGAATA	0.398																																					p.D124G		Atlas-SNP	.											.	ABCA9	192	.	0			c.A371G						.						145.0	138.0	141.0					17																	67041411		2203	4300	6503	SO:0001583	missense	10350	exon4			ACTGCGTCTATTG	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.371A>G	chr17.hg19:g.67041411T>C	ENSP00000342216:p.Asp124Gly	103.0	0.0		87.0	4.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	hg19	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	T	3.031	-0.199645	0.06219	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732;ENST00000453749	D;D	0.88741	-2.42;-2.42	3.83	3.83	0.44106	.	0.158806	0.28683	U	0.014491	D	0.84032	0.5383	L	0.53249	1.67	0.25963	N	0.982592	B;B	0.13145	0.007;0.001	B;B	0.17098	0.017;0.012	T	0.70439	-0.4871	10	0.24483	T	0.36	.	9.2771	0.37705	0.0:0.0:0.0:1.0	.	124;124	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	G	124;107;124;119	ENSP00000342216:D124G;ENSP00000359767:D124G	ENSP00000342216:D124G	D	-	2	0	ABCA9	64553006	0.083000	0.21467	0.813000	0.32504	0.002000	0.02628	2.223000	0.42936	1.964000	0.57103	0.482000	0.46254	GAC	.	.		0.398	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
GPR142	350383	hgsc.bcm.edu	37	17	72368628	72368628	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:72368628A>G	ENST00000335666.4	+	4	1326	c.1278A>G	c.(1276-1278)cgA>cgG	p.R426R		NM_181790.1	NP_861455.1	Q7Z601	GP142_HUMAN	G protein-coupled receptor 142	426						cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(21)|ovary(2)|prostate(1)|skin(4)	35						CCACTGTCCGACAGGTCATCC	0.617																																					p.R426R		Atlas-SNP	.											.	GPR142	74	.	0			c.A1278G						.						72.0	63.0	66.0					17																	72368628		2203	4300	6503	SO:0001819	synonymous_variant	350383	exon4			TGTCCGACAGGTC	AY255622	CCDS11698.1	17q25.2	2012-08-21				ENSG00000257008		"""GPCR / Class A : Orphans"""	20088	protein-coding gene	gene with protein product		609046				14623098	Standard	NM_181790		Approved	PGR2	uc010wqy.2	Q7Z601		ENST00000335666.4:c.1278A>G	chr17.hg19:g.72368628A>G		91.0	0.0		99.0	5.0	NM_181790	A4CYJ8|Q86SL3	Silent	SNP	ENST00000335666.4	hg19	CCDS11698.1																																																																																			.	.		0.617	GPR142-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442545.1	NM_181790	
ITGB4	3691	hgsc.bcm.edu	37	17	73751906	73751906	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:73751906T>C	ENST00000200181.3	+	35	4870	c.4683T>C	c.(4681-4683)agT>agC	p.S1561S	ITGB4_ENST00000579662.1_Silent_p.S1491S|ITGB4_ENST00000449880.2_Silent_p.S1544S|ITGB4_ENST00000450894.3_Silent_p.S1491S|ITGB4_ENST00000339591.3_Silent_p.S1544S|GALK1_ENST00000225614.2_Intron	NM_000213.3	NP_000204.3	P16144	ITB4_HUMAN	integrin, beta 4	1561	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				amelogenesis (GO:0097186)|autophagy (GO:0006914)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell motility (GO:0048870)|cell-matrix adhesion (GO:0007160)|digestive tract development (GO:0048565)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|mesodermal cell differentiation (GO:0048333)|nail development (GO:0035878)|renal system development (GO:0072001)|response to wounding (GO:0009611)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|hemidesmosome (GO:0030056)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor binding (GO:0001664)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(1)|lung(25)|skin(1)|urinary_tract(1)	43	all_cancers(13;1.5e-07)		all cancers(21;8.32e-07)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			AGGGCTACAGTGTGGAGTACC	0.682																																					p.S1561S		Atlas-SNP	.											.	ITGB4	165	.	0			c.T4683C						.						23.0	25.0	24.0					17																	73751906		2203	4298	6501	SO:0001819	synonymous_variant	3691	exon35			CTACAGTGTGGAG		CCDS11727.1, CCDS32736.1, CCDS58599.1	17q25.1	2013-09-19			ENSG00000132470	ENSG00000132470		"""CD molecules"", ""Integrins"", ""Fibronectin type III domain containing"""	6158	protein-coding gene	gene with protein product		147557				2070796	Standard	XM_005257309		Approved	CD104	uc002jpg.3	P16144	OTTHUMG00000179814	ENST00000200181.3:c.4683T>C	chr17.hg19:g.73751906T>C		63.0	0.0		112.0	5.0	NM_000213	A0AVL6|O14690|O14691|O15339|O15340|O15341|Q0VF97|Q9UIQ4	Silent	SNP	ENST00000200181.3	hg19	CCDS11727.1																																																																																			.	.		0.682	ITGB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000448334.1		
DNAH17	8632	hgsc.bcm.edu	37	17	76503588	76503588	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:76503588C>G	ENST00000585328.1	-	28	4651	c.4527G>C	c.(4525-4527)caG>caC	p.Q1509H	DNAH17_ENST00000389840.5_Missense_Mutation_p.Q1508H	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1508	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCCCCGGGAGCTGGGTGCGGA	0.597																																					p.Q1512H		Atlas-SNP	.											.	DNAH17	347	.	0			c.G4536C						.						45.0	51.0	49.0					17																	76503588		2078	4244	6322	SO:0001583	missense	8632	exon28			CGGGAGCTGGGTG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4527G>C	chr17.hg19:g.76503588C>G	ENSP00000465516:p.Gln1509His	129.0	0.0		151.0	30.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	C	19.19	3.779539	0.70107	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.64260	-0.09	4.97	3.78	0.43462	Dynein heavy chain, domain-2 (1);	.	.	.	.	D	0.86556	0.5961	H	0.98918	4.37	0.40204	D	0.977548	D	0.89917	1.0	D	0.91635	0.999	D	0.91547	0.5254	9	0.87932	D	0	.	13.2232	0.59901	0.0:0.859:0.0:0.141	.	1508	Q9UFH2	DYH17_HUMAN	H	1509;1508	ENSP00000374490:Q1508H	ENSP00000300671:Q1509H	Q	-	3	2	DNAH17	74015183	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.195000	0.51013	2.276000	0.75962	0.563000	0.77884	CAG	.	.		0.597	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
C17orf70	80233	hgsc.bcm.edu	37	17	79517603	79517603	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr17:79517603T>C	ENST00000327787.8	-	3	963	c.917A>G	c.(916-918)gAt>gGt	p.D306G	C17orf70_ENST00000425898.2_5'Flank|C17orf70_ENST00000537152.1_Missense_Mutation_p.D155G			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	306					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			ACAGTGCACATCCTCGTCAGG	0.602																																					p.D306G		Atlas-SNP	.											.	C17orf70	79	.	0			c.A917G						.						52.0	53.0	52.0					17																	79517603		2202	4300	6502	SO:0001583	missense	80233	exon3			TGCACATCCTCGT	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.917A>G	chr17.hg19:g.79517603T>C	ENSP00000333283:p.Asp306Gly	116.0	0.0		118.0	5.0	NM_025161	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	ENST00000327787.8	hg19	CCDS32765.2	.	.	.	.	.	.	.	.	.	.	T	13.61	2.289544	0.40494	.	.	ENSG00000185504	ENST00000327787;ENST00000537152;ENST00000541246;ENST00000544302	T;T	0.33865	1.4;1.39	3.91	2.82	0.32997	.	0.475716	0.22063	N	0.065154	T	0.37625	0.1010	L	0.57536	1.79	0.09310	N	1	P	0.45957	0.869	P	0.47827	0.558	T	0.12889	-1.0530	10	0.28530	T	0.3	.	8.1149	0.30937	0.0:0.1009:0.0:0.8991	.	306	Q0VG06	FP100_HUMAN	G	306;155;155;155	ENSP00000333283:D306G;ENSP00000440151:D155G	ENSP00000333283:D306G	D	-	2	0	C17orf70	77128045	0.005000	0.15991	0.001000	0.08648	0.904000	0.53231	1.298000	0.33412	0.553000	0.29044	0.460000	0.39030	GAT	.	.		0.602	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
NDC80	10403	hgsc.bcm.edu	37	18	2578079	2578079	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:2578079T>C	ENST00000261597.4	+	5	597	c.415T>C	c.(415-417)Tca>Cca	p.S139P		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	139	Interaction with RB1.|Interaction with the N-terminus of CDCA1.|Nuclear localization.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						CCTGTGCCCCTCATACGAACT	0.383																																					p.S139P		Atlas-SNP	.											NDC80,colon,carcinoma,0,1	NDC80	62	.	0			c.T415C						.						140.0	131.0	134.0					18																	2578079		2203	4300	6503	SO:0001583	missense	10403	exon5			TGCCCCTCATACG	AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.415T>C	chr18.hg19:g.2578079T>C	ENSP00000261597:p.Ser139Pro	148.0	0.0		102.0	7.0	NM_006101	Q6PJX2	Missense_Mutation	SNP	ENST00000261597.4	hg19	CCDS11827.1	.	.	.	.	.	.	.	.	.	.	T	15.22	2.769882	0.49680	.	.	ENSG00000080986	ENST00000261597;ENST00000543946	T	0.47528	0.84	5.8	5.8	0.92144	.	0.169262	0.52532	D	0.000062	T	0.57315	0.2045	M	0.73962	2.25	0.33405	D	0.577903	D	0.61697	0.99	P	0.52881	0.712	T	0.70506	-0.4853	10	0.36615	T	0.2	-7.8095	10.4429	0.44477	0.2522:0.0:0.0:0.7478	.	139	O14777	NDC80_HUMAN	P	139	ENSP00000261597:S139P	ENSP00000261597:S139P	S	+	1	0	NDC80	2568079	0.999000	0.42202	0.862000	0.33874	0.532000	0.34746	2.820000	0.48057	2.216000	0.71823	0.533000	0.62120	TCA	.	.		0.383	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254327.1	NM_006101	
SPIRE1	56907	hgsc.bcm.edu	37	18	12453092	12453092	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:12453092A>G	ENST00000409402.4	-	14	2089	c.1822T>C	c.(1822-1824)Tct>Cct	p.S608P	SPIRE1_ENST00000453447.2_Missense_Mutation_p.S474P|SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000383356.2_Missense_Mutation_p.S435P|SPIRE1_ENST00000410092.3_Missense_Mutation_p.S594P|SPIRE1_ENST00000309836.5_Missense_Mutation_p.S397P	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						CAGGTATAAGACCAAGTGAAG	0.323																																					p.S608P		Atlas-SNP	.											.	SPIRE1	120	.	0			c.T1822C						.						61.0	63.0	62.0					18																	12453092		2203	4300	6503	SO:0001583	missense	56907	exon14			TATAAGACCAAGT	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1822T>C	chr18.hg19:g.12453092A>G	ENSP00000387266:p.Ser608Pro	111.0	0.0		59.0	4.0	NM_001128626		Missense_Mutation	SNP	ENST00000409402.4	hg19	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.532550	0.45073	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06	5.95	4.8	0.61643	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.69744	0.3145	N	0.19112	0.55	0.58432	D	0.999999	B;B;B	0.32717	0.144;0.381;0.298	B;B;B	0.43155	0.156;0.23;0.41	T	0.64188	-0.6466	10	0.23302	T	0.38	-11.4703	11.9386	0.52888	0.9324:0.0:0.0676:0.0	.	594;397;608	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	P	474;608;594;397;435	ENSP00000407050:S474P;ENSP00000387266:S608P;ENSP00000387226:S594P;ENSP00000309661:S397P;ENSP00000372847:S435P	ENSP00000309661:S397P	S	-	1	0	SPIRE1	12443092	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.654000	0.91092	1.076000	0.40961	0.528000	0.53228	TCT	.	.		0.323	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818	
CEP192	55125	hgsc.bcm.edu	37	18	13103589	13103589	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:13103589T>C	ENST00000325971.8	+	37	6756		c.e37+2		CEP192_ENST00000430049.2_Splice_Site|CEP192_ENST00000506447.1_Splice_Site|CEP192_ENST00000540847.2_Splice_Site			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa						centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TATGTCAAGGTCAGTCATGAC	0.383																																					.		Atlas-SNP	.											CEP192_ENST00000506447,NS,neuroblastoma,0,2	CEP192	340	.	0			c.6951+2T>C						.						156.0	131.0	139.0					18																	13103589		2203	4300	6503	SO:0001630	splice_region_variant	55125	exon39			TCAAGGTCAGTCA	AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5163+2T>C	chr18.hg19:g.13103589T>C		89.0	0.0		69.0	4.0	NM_032142	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Splice_Site	SNP	ENST00000325971.8	hg19		.	.	.	.	.	.	.	.	.	.	T	16.56	3.156149	0.57259	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	.	.	.	5.88	5.88	0.94601	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.261	0.73621	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	CEP192	13093589	1.000000	0.71417	1.000000	0.80357	0.661000	0.39034	5.760000	0.68793	2.244000	0.73946	0.528000	0.53228	.	.	.		0.383	CEP192-201	KNOWN	basic	protein_coding	protein_coding		NM_032142	Intron
ELP2	55250	hgsc.bcm.edu	37	18	33709907	33709907	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:33709907C>T	ENST00000358232.6	+	1	74	c.11C>T	c.(10-12)cCc>cTc	p.P4L	ELP2_ENST00000542824.1_Missense_Mutation_p.P4L|SLC39A6_ENST00000440549.2_5'Flank|ELP2_ENST00000423854.2_Missense_Mutation_p.P4L|ELP2_ENST00000442325.2_Missense_Mutation_p.P4L|ELP2_ENST00000350494.6_Missense_Mutation_p.P4L|SLC39A6_ENST00000590986.1_5'Flank|SLC39A6_ENST00000269187.5_5'Flank|ELP2_ENST00000351393.6_Missense_Mutation_p.P4L	NM_018255.2	NP_060725.1	Q6IA86	ELP2_HUMAN	elongator acetyltransferase complex subunit 2	4					chromatin organization (GO:0006325)|regulation of JAK-STAT cascade (GO:0046425)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)				NS(1)|breast(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|urinary_tract(2)	30						ATGGTGGCACCCGTGCTGGAG	0.617																																					p.P4L		Atlas-SNP	.											ELP2_ENST00000350494,NS,carcinoma,0,2	ELP2	70	.	0			c.C11T						.						75.0	69.0	71.0					18																	33709907		2203	4300	6503	SO:0001583	missense	55250	exon1			TGGCACCCGTGCT	AK001741	CCDS11918.1, CCDS56065.1, CCDS56066.1, CCDS56067.1, CCDS56068.1, CCDS56069.1	18q12.1	2013-01-10	2012-08-08	2007-04-20	ENSG00000134759	ENSG00000134759		"""Elongator acetyltransferase complex subunits"", ""WD repeat domain containing"""	18248	protein-coding gene	gene with protein product			"""signal transducer and activator of transcription 3 interacting protein 1"", ""elongation protein 2 homolog (S. cerevisiae)"""	STATIP1		11714725, 10954736	Standard	NM_001242875		Approved	FLJ10879, StIP	uc002kzk.2	Q6IA86	OTTHUMG00000132589	ENST00000358232.6:c.11C>T	chr18.hg19:g.33709907C>T	ENSP00000350967:p.Pro4Leu	112.0	0.0		97.0	4.0	NM_001242879	A8KAI6|B4DTG0|B4DXP0|E7EP23|E9PCX0|Q53GZ0|Q687Y8|Q8N5C2|Q96GV4|Q96PI7|Q9H9N0|Q9NV81	Missense_Mutation	SNP	ENST00000358232.6	hg19	CCDS11918.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527182	0.85706	.	.	ENSG00000134759	ENST00000358232;ENST00000351393;ENST00000442325;ENST00000423854;ENST00000350494;ENST00000542824	T;T;T;T;T;T	0.59638	0.25;0.41;0.72;0.88;0.48;0.4	5.61	5.61	0.85477	.	0.279476	0.41097	D	0.000943	T	0.57388	0.2050	L	0.36672	1.1	0.21473	N	0.999674	P;P;P;P;P;P	0.45283	0.763;0.855;0.565;0.8;0.532;0.698	P;P;B;P;P;B	0.49999	0.548;0.548;0.33;0.628;0.506;0.424	T	0.51911	-0.8645	10	0.28530	T	0.3	-1.0655	15.1309	0.72523	0.0:1.0:0.0:0.0	.	4;4;4;4;4;4	B4DTG0;E7EP23;E9PCX0;Q6IA86-2;Q6IA86-3;Q6IA86	.;.;.;.;.;ELP2_HUMAN	L	4	ENSP00000350967:P4L;ENSP00000257191:P4L;ENSP00000414851:P4L;ENSP00000391202:P4L;ENSP00000316051:P4L;ENSP00000443800:P4L	ENSP00000316051:P4L	P	+	2	0	ELP2	31963905	0.001000	0.12720	0.006000	0.13384	0.631000	0.37964	1.318000	0.33643	2.645000	0.89757	0.585000	0.79938	CCC	.	.		0.617	ELP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255800.2	NM_018255	
MOCOS	55034	hgsc.bcm.edu	37	18	33775247	33775247	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:33775247C>A	ENST00000261326.5	+	2	191	c.170C>A	c.(169-171)gCc>gAc	p.A57D		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CATGCAGGTGCCACCTTGTTC	0.393																																					p.A57D		Atlas-SNP	.											MOCOS,NS,carcinoma,0,1	MOCOS	84	.	0			c.C170A						.						150.0	152.0	151.0					18																	33775247		2203	4300	6503	SO:0001583	missense	55034	exon2			CAGGTGCCACCTT	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.170C>A	chr18.hg19:g.33775247C>A	ENSP00000261326:p.Ala57Asp	76.0	0.0		34.0	2.0	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	hg19	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935348	0.92458	.	.	ENSG00000075643	ENST00000261326	D	0.87029	-2.2	5.41	5.41	0.78517	Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.127935	0.51477	D	0.000099	D	0.93429	0.7904	M	0.87827	2.91	0.40700	D	0.982472	D	0.57571	0.98	P	0.62885	0.908	D	0.94542	0.7746	10	0.72032	D	0.01	-16.3106	14.718	0.69284	0.0:1.0:0.0:0.0	.	57	Q96EN8	MOCOS_HUMAN	D	57	ENSP00000261326:A57D	ENSP00000261326:A57D	A	+	2	0	MOCOS	32029245	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.645000	0.67909	2.538000	0.85594	0.563000	0.77884	GCC	.	.		0.393	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
SETBP1	26040	hgsc.bcm.edu	37	18	42533197	42533197	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:42533197A>G	ENST00000282030.5	+	4	4188	c.3892A>G	c.(3892-3894)Agt>Ggt	p.S1298G		NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	1298						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CGTGAGTGGGAGTAAAAGGAG	0.507									Schinzel-Giedion syndrome																												p.S1298G		Atlas-SNP	.											.	SETBP1	577	.	0			c.A3892G						.						143.0	131.0	135.0					18																	42533197		2203	4300	6503	SO:0001583	missense	26040	exon4	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	AGTGGGAGTAAAA	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.3892A>G	chr18.hg19:g.42533197A>G	ENSP00000282030:p.Ser1298Gly	82.0	0.0		54.0	4.0	NM_015559	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	hg19	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	A	15.26	2.779574	0.49891	.	.	ENSG00000152217	ENST00000282030	T	0.69685	-0.42	6.17	5.02	0.67125	.	0.161329	0.56097	D	0.000036	T	0.49762	0.1576	N	0.24115	0.695	0.29490	N	0.855677	B	0.10296	0.003	B	0.11329	0.006	T	0.40459	-0.9562	10	0.17832	T	0.49	.	11.0663	0.47976	0.9305:0.0:0.0695:0.0	.	1298	Q9Y6X0	SETBP_HUMAN	G	1298	ENSP00000282030:S1298G	ENSP00000282030:S1298G	S	+	1	0	SETBP1	40787195	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.748000	0.55142	1.159000	0.42565	0.533000	0.62120	AGT	.	.		0.507	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
TCEB3B	51224	hgsc.bcm.edu	37	18	44560140	44560140	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:44560140T>C	ENST00000332567.4	-	1	1848	c.1496A>G	c.(1495-1497)gAg>gGg	p.E499G	KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	499					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						AGCAGCTTCCTCCCGGAACTT	0.602																																					p.E499G		Atlas-SNP	.											.	TCEB3B	141	.	0			c.A1496G						.						67.0	77.0	73.0					18																	44560140		2203	4300	6503	SO:0001583	missense	51224	exon1			GCTTCCTCCCGGA	BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.1496A>G	chr18.hg19:g.44560140T>C	ENSP00000331302:p.Glu499Gly	169.0	0.0		113.0	5.0	NM_016427	Q9P2V9	Missense_Mutation	SNP	ENST00000332567.4	hg19	CCDS11932.1	.	.	.	.	.	.	.	.	.	.	T	11.63	1.695036	0.30052	.	.	ENSG00000206181	ENST00000332567	T	0.11821	2.74	1.87	1.87	0.25490	.	0.710197	0.12250	N	0.485692	T	0.19805	0.0476	M	0.65975	2.015	0.22940	N	0.998531	P	0.45715	0.865	P	0.48524	0.58	T	0.08680	-1.0710	10	0.46703	T	0.11	-21.5747	5.7908	0.18359	0.0:0.0:0.0:1.0	.	499	Q8IYF1	ELOA2_HUMAN	G	499	ENSP00000331302:E499G	ENSP00000331302:E499G	E	-	2	0	TCEB3B	42814138	0.068000	0.21057	0.041000	0.18516	0.004000	0.04260	0.918000	0.28678	1.133000	0.42147	0.496000	0.49642	GAG	.	.		0.602	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255900.1	NM_016427	
ALPK2	115701	hgsc.bcm.edu	37	18	56246468	56246468	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr18:56246468T>C	ENST00000361673.3	-	4	1753	c.1540A>G	c.(1540-1542)Acg>Gcg	p.T514A	ALPK2_ENST00000587399.1_5'Flank	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	514						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TCAGCTGCCGTCTCCCAACAC	0.512											OREG0025011	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T514A		Atlas-SNP	.											ALPK2_ENST00000361673,colon,carcinoma,0,2	ALPK2	487	.	0			c.A1540G						.						202.0	202.0	202.0					18																	56246468		2203	4300	6503	SO:0001583	missense	115701	exon4			CTGCCGTCTCCCA	AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.1540A>G	chr18.hg19:g.56246468T>C	ENSP00000354991:p.Thr514Ala	115.0	0.0	1014	66.0	3.0	NM_052947	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	ENST00000361673.3	hg19	CCDS11966.2	.	.	.	.	.	.	.	.	.	.	T	9.814	1.184031	0.21870	.	.	ENSG00000198796	ENST00000361673	T	0.41758	0.99	5.58	1.82	0.25136	.	1.941730	0.02824	N	0.125923	T	0.29458	0.0734	N	0.22421	0.69	0.09310	N	1	B	0.13594	0.008	B	0.08055	0.003	T	0.13045	-1.0524	10	0.27082	T	0.32	-0.2389	5.0466	0.14487	0.0:0.1566:0.295:0.5485	.	514	Q86TB3	ALPK2_HUMAN	A	514	ENSP00000354991:T514A	ENSP00000354991:T514A	T	-	1	0	ALPK2	54397448	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.796000	0.26986	0.364000	0.24374	-0.290000	0.09829	ACG	.	.		0.512	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256126.1	NM_052947	
HMHA1	23526	hgsc.bcm.edu	37	19	1074826	1074826	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:1074826A>G	ENST00000313093.2	+	10	1364	c.1133A>G	c.(1132-1134)gAg>gGg	p.E378G	HMHA1_ENST00000536472.1_Missense_Mutation_p.E218G|HMHA1_ENST00000590577.1_5'Flank|HMHA1_ENST00000586866.1_Missense_Mutation_p.E382G|HMHA1_ENST00000590214.1_Missense_Mutation_p.E405G|HMHA1_ENST00000539243.2_Missense_Mutation_p.E394G|HMHA1_ENST00000543365.1_Missense_Mutation_p.E261G	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	378					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTTGAACACGAGAAGCGCAGG	0.766																																					p.E394G		Atlas-SNP	.											.	HMHA1	78	.	0			c.A1181G						.						7.0	9.0	8.0					19																	1074826		2106	4169	6275	SO:0001583	missense	23526	exon10			AACACGAGAAGCG	D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.1133A>G	chr19.hg19:g.1074826A>G	ENSP00000316772:p.Glu378Gly	38.0	0.0		73.0	4.0	NM_001258328	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	ENST00000313093.2	hg19	CCDS32863.1	.	.	.	.	.	.	.	.	.	.	A	29.3	4.996526	0.93167	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000544746;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.49139	0.79;0.79;0.79;0.79	4.45	4.45	0.53987	.	0.000000	0.85682	D	0.000000	T	0.69033	0.3066	M	0.84326	2.69	0.58432	D	0.999996	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.74203	-0.3741	10	0.87932	D	0	-37.3036	11.7632	0.51916	1.0:0.0:0.0:0.0	.	218;394;261;378	F5H4A3;F6QP70;F5H1R4;Q92619	.;.;.;HMHA1_HUMAN	G	394;378;378;218;372;261	ENSP00000439601:E394G;ENSP00000316772:E378G;ENSP00000445109:E218G;ENSP00000438979:E261G	ENSP00000316772:E378G	E	+	2	0	HMHA1	1025826	1.000000	0.71417	0.999000	0.59377	0.912000	0.54170	5.468000	0.66743	1.778000	0.52293	0.459000	0.35465	GAG	.	.		0.766	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458026.1		
MUM1	84939	hgsc.bcm.edu	37	19	1360617	1360617	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:1360617T>C	ENST00000415183.3	+	4	726	c.700T>C	c.(700-702)Tcc>Ccc	p.S234P	MUM1_ENST00000591806.1_Missense_Mutation_p.S234P|MUM1_ENST00000311401.5_Missense_Mutation_p.S165P|MUM1_ENST00000344663.3_Missense_Mutation_p.S234P			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	233					chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAATGGATCTTCCCTTTCAGA	0.572																																					p.S234P		Atlas-SNP	.											.	MUM1	54	.	0			c.T700C						.						70.0	68.0	69.0					19																	1360617		2203	4300	6503	SO:0001583	missense	84939	exon5			GGATCTTCCCTTT	AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.700T>C	chr19.hg19:g.1360617T>C	ENSP00000394925:p.Ser234Pro	80.0	0.0		88.0	4.0	NM_032853	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	ENST00000415183.3	hg19		.	.	.	.	.	.	.	.	.	.	T	10.59	1.391501	0.25118	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183;ENST00000542512	T;T;T	0.25085	1.85;1.85;1.82	4.36	-1.95	0.07548	.	0.552015	0.16587	N	0.207953	T	0.11750	0.0286	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.15473	0.001;0.003;0.01;0.013	B;B;B;B	0.16722	0.003;0.003;0.016;0.014	T	0.15150	-1.0447	10	0.59425	D	0.04	.	1.4347	0.02341	0.1343:0.2134:0.3723:0.28	.	234;234;165;233	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	P	234;165;234;163	ENSP00000345789:S234P;ENSP00000309135:S165P;ENSP00000394925:S234P	ENSP00000309135:S165P	S	+	1	0	MUM1	1311617	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-1.168000	0.03123	-0.513000	0.06496	-0.440000	0.05779	TCC	.	.		0.572	MUM1-016	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000449510.1	NM_032853	
ARHGEF18	23370	hgsc.bcm.edu	37	19	7533871	7533871	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:7533871T>C	ENST00000359920.6	+	17	3330	c.3077T>C	c.(3076-3078)gTg>gCg	p.V1026A	CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.C984R|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.V868A	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	1026					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				AAGAGCGATGTGCCCATCCAG	0.697																																					p.V1026A		Atlas-SNP	.											.	ARHGEF18	129	.	0			c.T3077C						.						20.0	19.0	19.0					19																	7533871		2180	4285	6465	SO:0001583	missense	23370	exon17			GCGATGTGCCCAT	AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.3077T>C	chr19.hg19:g.7533871T>C	ENSP00000352995:p.Val1026Ala	46.0	0.0		69.0	4.0	NM_001130955	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	ENST00000359920.6	hg19	CCDS45946.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.294159	0.81025	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.61392	0.11;0.11	5.11	5.11	0.69529	.	0.000000	0.45361	D	0.000368	T	0.71239	0.3316	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.68519	-0.5387	10	0.22706	T	0.39	-36.1186	12.8551	0.57880	0.0:0.0:0.0:1.0	.	868;1026	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	A	868;1026	ENSP00000319200:V868A;ENSP00000352995:V1026A	ENSP00000319200:V868A	V	+	2	0	ARHGEF18	7439871	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.423000	0.80229	1.934000	0.56057	0.460000	0.39030	GTG	.	.		0.697	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000436340.1	NM_015318	
KRI1	65095	hgsc.bcm.edu	37	19	10671691	10671691	+	Silent	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:10671691G>C	ENST00000312962.6	-	8	688	c.669C>G	c.(667-669)tcC>tcG	p.S223S	KRI1_ENST00000537964.1_5'UTR|KRI1_ENST00000361821.5_Silent_p.S219S	NM_023008.3	NP_075384.3	Q8N9T8	KRI1_HUMAN	KRI1 homolog (S. cerevisiae)	217	Glu-rich.					nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	26			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			GTTCCTTCAGGGAATCTGGGT	0.547																																					p.S223S		Atlas-SNP	.											.	KRI1	65	.	0			c.C669G						.						113.0	85.0	95.0					19																	10671691		2203	4300	6503	SO:0001819	synonymous_variant	65095	exon8			CTTCAGGGAATCT		CCDS12242.1	19p13.2	2008-02-05			ENSG00000129347	ENSG00000129347			25769	protein-coding gene	gene with protein product						12878157	Standard	NM_023008		Approved	FLJ12949	uc002moy.1	Q8N9T8	OTTHUMG00000150343	ENST00000312962.6:c.669C>G	chr19.hg19:g.10671691G>C		93.0	0.0		110.0	26.0	NM_023008	Q2M1R5|Q2M1R7|Q7L5J7|Q96G92|Q9BU50|Q9H6I1|Q9H978	Silent	SNP	ENST00000312962.6	hg19	CCDS12242.1	.	.	.	.	.	.	.	.	.	.	G	6.238	0.412061	0.11812	.	.	ENSG00000129347	ENST00000543682	.	.	.	4.56	-0.338	0.12651	.	.	.	.	.	T	0.21307	0.0513	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24657	-1.0154	4	.	.	.	-4.1918	2.6004	0.04865	0.1608:0.2642:0.4397:0.1353	.	.	.	.	R	161	.	.	P	-	2	0	KRI1	10532691	0.000000	0.05858	0.038000	0.18304	0.203000	0.24098	-0.275000	0.08525	0.156000	0.19299	-0.360000	0.07572	CCC	.	.		0.547	KRI1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317705.1	NM_023008	
C19orf57	79173	hgsc.bcm.edu	37	19	14000257	14000257	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:14000257T>C	ENST00000586783.1	-	5	1411	c.1412A>G	c.(1411-1413)gAg>gGg	p.E471G	C19orf57_ENST00000346736.2_Missense_Mutation_p.E471G|C19orf57_ENST00000454313.1_Missense_Mutation_p.E471G|C19orf57_ENST00000591586.1_Intron			Q0VDD7	CS057_HUMAN	chromosome 19 open reading frame 57	471					multicellular organismal development (GO:0007275)					breast(2)|kidney(1)|lung(3)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;2e-21)			ACGGAACCCCTCGAGGTCTCG	0.602																																					p.E471G		Atlas-SNP	.											.	C19orf57	34	.	0			c.A1412G						.						64.0	67.0	66.0					19																	14000257		2203	4300	6503	SO:0001583	missense	79173	exon6			AACCCCTCGAGGT	BC012945	CCDS12299.1	19p13.12	2012-10-26			ENSG00000132016	ENSG00000132016			28153	protein-coding gene	gene with protein product						8228263	Standard	NM_024323		Approved	MGC11271	uc002mxl.1	Q0VDD7	OTTHUMG00000181851	ENST00000586783.1:c.1412A>G	chr19.hg19:g.14000257T>C	ENSP00000465822:p.Glu471Gly	78.0	0.0		91.0	4.0	NM_024323	Q13411|Q8N825|Q96D63|Q9BU49	Missense_Mutation	SNP	ENST00000586783.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.16	2.750544	0.49257	.	.	ENSG00000132016	ENST00000454313;ENST00000346736	T;T	0.47177	0.85;0.85	4.69	-2.65	0.06095	.	2.277220	0.01710	N	0.027661	T	0.34366	0.0895	L	0.29908	0.895	0.09310	N	1	B;B	0.17465	0.022;0.022	B;B	0.17979	0.02;0.02	T	0.11060	-1.0603	10	0.33141	T	0.24	0.9965	5.5723	0.17204	0.1543:0.4594:0.0:0.3863	.	471;471	Q0VDD7-2;Q0VDD7	.;CS057_HUMAN	G	471	ENSP00000404382:E471G;ENSP00000254336:E471G	ENSP00000254336:E471G	E	-	2	0	C19orf57	13861257	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.568000	0.05909	-0.779000	0.04560	0.519000	0.50382	GAG	.	.		0.602	C19orf57-003	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000457947.1	NM_024323	
ZNF253	56242	hgsc.bcm.edu	37	19	20003478	20003478	+	Silent	SNP	T	T	C	rs377662376		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:20003478T>C	ENST00000589717.1	+	4	1514	c.1422T>C	c.(1420-1422)caT>caC	p.H474H	ZNF253_ENST00000355650.4_Silent_p.H398H|AC011477.1_ENST00000578823.1_RNA|CTC-559E9.8_ENST00000585571.1_RNA	NM_021047.2	NP_066385.2	O75346	ZN253_HUMAN	zinc finger protein 253	474					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AGAAAATTCATATTGAACGAA	0.333																																					p.H474H		Atlas-SNP	.											.	ZNF253	99	.	0			c.T1422C						.						64.0	73.0	70.0					19																	20003478		2071	4236	6307	SO:0001819	synonymous_variant	56242	exon4			AATTCATATTGAA	AF038951	CCDS42532.1	19p12	2014-02-12	2003-12-17		ENSG00000256771	ENSG00000256771		"""Zinc fingers, C2H2-type"", ""-"""	13497	protein-coding gene	gene with protein product		606954	"""zinc finger protein 411"""	ZNF411		10585455	Standard	NM_021047		Approved	BMZF-1, FLJ90391	uc002noj.3	O75346	OTTHUMG00000182369	ENST00000589717.1:c.1422T>C	chr19.hg19:g.20003478T>C		59.0	0.0		57.0	4.0	NM_021047	A4FVA7|Q0P6G3|Q6P0L2|Q8NCA3|Q8NCF9	Silent	SNP	ENST00000589717.1	hg19	CCDS42532.1																																																																																			.	.		0.333	ZNF253-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460802.1	NM_021047	
ZNF208	7757	hgsc.bcm.edu	37	19	22155053	22155053	+	Missense_Mutation	SNP	C	C	A	rs373937489		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:22155053C>A	ENST00000397126.4	-	4	2931	c.2783G>T	c.(2782-2784)tGg>tTg	p.W928L	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	928					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				GACTGACAACCAGCTGAAGGC	0.393																																					p.W928L		Atlas-SNP	.											.	ZNF208	817	.	0			c.G2783T						.						52.0	54.0	53.0					19																	22155053		2053	4210	6263	SO:0001583	missense	7757	exon4			GACAACCAGCTGA	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.2783G>T	chr19.hg19:g.22155053C>A	ENSP00000380315:p.Trp928Leu	101.0	0.0		68.0	13.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	hg19	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	C	1.440	-0.567797	0.03910	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.06142	3.34	3.07	-6.14	0.02111	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04679	0.0127	.	.	.	0.09310	N	1	P	0.50066	0.931	P	0.51833	0.681	T	0.15407	-1.0438	8	0.11182	T	0.66	.	1.2557	0.01991	0.1471:0.2899:0.1456:0.4173	.	828	O43345	ZN208_HUMAN	L	928;828	ENSP00000380315:W928L	ENSP00000380315:W928L	W	-	2	0	ZNF208	21946893	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.300000	0.02751	-1.180000	0.02734	-0.385000	0.06624	TGG	.	.		0.393	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
GRAMD1A	57655	hgsc.bcm.edu	37	19	35514222	35514222	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:35514222T>C	ENST00000317991.5	+	18	2128	c.1936T>C	c.(1936-1938)Tgg>Cgg	p.W646R	GRAMD1A_ENST00000599564.1_Missense_Mutation_p.W729R|GRAMD1A_ENST00000504615.2_Missense_Mutation_p.W408R|CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000411896.2_Missense_Mutation_p.W635R	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	646						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CTTTGAGTCCTGGCACAGCCT	0.642																																					p.W646R		Atlas-SNP	.											.	GRAMD1A	39	.	0			c.T1936C						.						203.0	207.0	206.0					19																	35514222		1981	4156	6137	SO:0001583	missense	57655	exon18			GAGTCCTGGCACA	AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.1936T>C	chr19.hg19:g.35514222T>C	ENSP00000441032:p.Trp646Arg	119.0	0.0		96.0	4.0	NM_020895	A6NKY7|Q8NC77|Q9P1Z5	Missense_Mutation	SNP	ENST00000317991.5	hg19	CCDS42546.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041309	0.75732	.	.	ENSG00000089351	ENST00000453966;ENST00000504615;ENST00000317991;ENST00000411896	T;T;T	0.49432	0.78;1.82;1.8	4.76	4.76	0.60689	.	0.078084	0.56097	D	0.000029	T	0.60818	0.2298	L	0.49778	1.585	0.49687	D	0.999816	D;D;D;D	0.89917	0.998;0.995;1.0;0.998	D;P;D;D	0.91635	0.974;0.897;0.999;0.974	T	0.60105	-0.7328	10	0.42905	T	0.14	.	12.3323	0.55046	0.0:0.0:0.0:1.0	.	642;646;408;635	Q96CP6-3;Q96CP6;B3KQF7;Q96CP6-2	.;GRM1A_HUMAN;.;.	R	728;408;646;635	ENSP00000423728:W408R;ENSP00000441032:W646R;ENSP00000439267:W635R	ENSP00000441032:W646R	W	+	1	0	GRAMD1A	40206062	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.511000	0.73733	2.013000	0.59113	0.473000	0.43528	TGG	.	.		0.642	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000461557.1	NM_020895	
PROSER3	148137	hgsc.bcm.edu	37	19	36258938	36258938	+	Splice_Site	SNP	G	G	A	rs398034467|rs5827939		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:36258938G>A	ENST00000396908.4	+	9	1264	c.1191G>A	c.(1189-1191)caG>caA	p.Q397Q	C19orf55_ENST00000544099.1_Silent_p.Q397Q|AC002398.13_ENST00000589397.1_RNA	NM_001039887.2	NP_001034976.2	Q2NL68	PRSR3_HUMAN		398										cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|prostate(1)	15	all_lung(56;2.87e-07)|Lung NSC(56;4.32e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCTTGCCCAGGGCCGCCCTG	0.731																																					.		Atlas-SNP	.											.,11	C19orf55	39	.	0			c.1190+1G>A						.						1.0	1.0	1.0					19																	36258938		567	1236	1803	SO:0001630	splice_region_variant	148137	exon9			TGCCCAGGGCCGC																												ENST00000396908.4:c.1191+1G>A	chr19.hg19:g.36258938G>A		6.0	0.0		9.0	2.0	NM_001039887	Q8NDI3|Q8WWC8|Q96NL4	Splice_Site	SNP	ENST00000396908.4	hg19																																																																																				.	.		0.731	C19orf55-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			Silent
KIRREL2	84063	hgsc.bcm.edu	37	19	36353409	36353409	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:36353409G>A	ENST00000360202.5	+	12	1723	c.1525G>A	c.(1525-1527)Gtg>Atg	p.V509M	KIRREL2_ENST00000262625.7_Missense_Mutation_p.V509M|KIRREL2_ENST00000592409.1_Intron|KIRREL2_ENST00000347900.6_Missense_Mutation_p.V459M|NPHS1_ENST00000591817.1_Intron	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	509					cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCTGCCCACTGTGCGGATAGT	0.622																																					p.V509M		Atlas-SNP	.											.	KIRREL2	170	.	0			c.G1525A						.						116.0	118.0	117.0					19																	36353409		2203	4300	6503	SO:0001583	missense	84063	exon12			CCCACTGTGCGGA	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1525G>A	chr19.hg19:g.36353409G>A	ENSP00000353331:p.Val509Met	50.0	0.0		74.0	4.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	G	10.78	1.447449	0.25987	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.68331	-0.32;-0.08;-0.3	4.37	0.797	0.18654	.	0.213928	0.23351	N	0.049124	T	0.58694	0.2140	M	0.61703	1.905	0.31070	N	0.713108	B;B;B;B	0.27765	0.061;0.062;0.188;0.17	B;B;B;B	0.30572	0.066;0.055;0.083;0.117	T	0.57888	-0.7733	10	0.52906	T	0.07	-5.2741	6.1253	0.20176	0.105:0.3683:0.5267:0.0	.	489;509;459;509	Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;KIRR2_HUMAN;.;.	M	509;459;509;489	ENSP00000262625:V509M;ENSP00000345067:V459M;ENSP00000353331:V509M	ENSP00000262625:V509M	V	+	1	0	KIRREL2	41045249	0.719000	0.27986	0.988000	0.46212	0.686000	0.39977	0.484000	0.22308	0.087000	0.17167	0.491000	0.48974	GTG	.	.		0.622	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
ZNF345	25850	hgsc.bcm.edu	37	19	37368330	37368330	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:37368330A>G	ENST00000529555.1	+	2	1386	c.598A>G	c.(598-600)Aaa>Gaa	p.K200E	ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000589046.1_Missense_Mutation_p.K200E|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000420450.1_Missense_Mutation_p.K200E			Q14585	ZN345_HUMAN	zinc finger protein 345	200					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CACAGGTGAGAAACCTTATGA	0.418																																					p.K200E		Atlas-SNP	.											.	ZNF345	68	.	0			c.A598G						.						67.0	65.0	66.0					19																	37368330		2203	4300	6503	SO:0001583	missense	25850	exon4			GGTGAGAAACCTT	X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.598A>G	chr19.hg19:g.37368330A>G	ENSP00000431202:p.Lys200Glu	61.0	0.0		76.0	4.0	NM_001242476		Missense_Mutation	SNP	ENST00000529555.1	hg19	CCDS12497.1	.	.	.	.	.	.	.	.	.	.	A	19.82	3.898255	0.72639	.	.	ENSG00000251247	ENST00000420450;ENST00000529555	T;T	0.27104	1.69;1.69	3.86	3.86	0.44501	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.48390	0.1497	M	0.75085	2.285	0.30349	N	0.784943	D	0.89917	1.0	D	0.72075	0.976	T	0.49351	-0.8949	8	.	.	.	.	10.9193	0.47154	1.0:0.0:0.0:0.0	.	200	Q14585	ZN345_HUMAN	E	200	ENSP00000431216:K200E;ENSP00000431202:K200E	.	K	+	1	0	ZNF345	42060170	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.095000	0.64529	1.731000	0.51592	0.459000	0.35465	AAA	.	.		0.418	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388258.1		
WDR87	83889	hgsc.bcm.edu	37	19	38383676	38383676	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:38383676C>G	ENST00000303868.5	-	4	2774	c.2550G>C	c.(2548-2550)atG>atC	p.M850I	WDR87_ENST00000447313.2_Missense_Mutation_p.M889I	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	850										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TGGAAAGTCTCATTTCTAGGA	0.398																																					p.M850I		Atlas-SNP	.											.	WDR87	191	.	0			c.G2550C						.						149.0	117.0	127.0					19																	38383676		692	1591	2283	SO:0001583	missense	83889	exon4			AAGTCTCATTTCT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.2550G>C	chr19.hg19:g.38383676C>G	ENSP00000368025:p.Met850Ile	123.0	0.0		124.0	7.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	C	2.080	-0.410868	0.04799	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.09538	2.97;2.97	5.1	-0.999	0.10208	.	1.399710	0.04479	N	0.377488	T	0.08846	0.0219	L	0.36672	1.1	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.09377	0.004;0.004	T	0.38156	-0.9674	10	0.30854	T	0.27	2.6908	4.8338	0.13454	0.0:0.4559:0.1557:0.3884	.	850;889	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	I	889;850	ENSP00000405012:M889I;ENSP00000368025:M850I	ENSP00000368025:M850I	M	-	3	0	WDR87	43075516	0.004000	0.15560	0.039000	0.18376	0.271000	0.26615	-0.369000	0.07533	-0.025000	0.13918	0.643000	0.83706	ATG	.	.		0.398	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
AXL	558	hgsc.bcm.edu	37	19	41762508	41762508	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:41762508A>G	ENST00000301178.4	+	18	2378	c.2188A>G	c.(2188-2190)Agc>Ggc	p.S730G	AXL_ENST00000359092.3_Missense_Mutation_p.S721G|AXL_ENST00000593513.1_Missense_Mutation_p.S462G	NM_001278599.1|NM_021913.3	NP_001265528.1|NP_068713	P30530	UFO_HUMAN	AXL receptor tyrosine kinase	730	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to extracellular stimulus (GO:0031668)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to interferon-alpha (GO:0035457)|cellular response to lipopolysaccharide (GO:0071222)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|erythrocyte homeostasis (GO:0034101)|forebrain cell migration (GO:0021885)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|natural killer cell differentiation (GO:0001779)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of tumor necrosis factor production (GO:0032720)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of protein kinase B signaling (GO:0051897)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|phosphatidylserine binding (GO:0001786)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)	48						CACCAGCAAGAGCGATGTGGT	0.567																																					p.S730G		Atlas-SNP	.											.	AXL	126	.	0			c.A2188G						.						168.0	118.0	135.0					19																	41762508		2203	4300	6503	SO:0001583	missense	558	exon18			AGCAAGAGCGATG	M76125	CCDS12574.1, CCDS12575.1, CCDS62677.1	19q13.1	2013-02-11				ENSG00000167601	2.7.10.1	"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	905	protein-coding gene	gene with protein product		109135				1656220	Standard	NM_021913		Approved	UFO, JTK11	uc010ehj.3	P30530		ENST00000301178.4:c.2188A>G	chr19.hg19:g.41762508A>G	ENSP00000301178:p.Ser730Gly	112.0	0.0		122.0	5.0	NM_021913	Q8N5L2|Q9UD27	Missense_Mutation	SNP	ENST00000301178.4	hg19	CCDS12575.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.773466	0.69992	.	.	ENSG00000167601	ENST00000301178;ENST00000359092	D;D	0.89196	-2.48;-2.48	4.49	4.49	0.54785	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94640	0.8272	M	0.88842	2.985	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.71184	0.966;0.972	D	0.95436	0.8521	10	0.87932	D	0	-10.0188	13.1778	0.59637	1.0:0.0:0.0:0.0	.	721;730	P30530-2;P30530	.;UFO_HUMAN	G	730;721	ENSP00000301178:S730G;ENSP00000351995:S721G	ENSP00000301178:S730G	S	+	1	0	AXL	46454348	1.000000	0.71417	0.993000	0.49108	0.447000	0.32167	8.989000	0.93506	2.004000	0.58718	0.482000	0.46254	AGC	.	.		0.567	AXL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463323.2		
CCDC8	83987	hgsc.bcm.edu	37	19	46915065	46915065	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:46915065G>C	ENST00000307522.3	-	1	1776	c.1003C>G	c.(1003-1005)Cag>Gag	p.Q335E		NM_032040.4	NP_114429.2	Q9H0W5	CCDC8_HUMAN	coiled-coil domain containing 8	335					microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(262;4.66e-05)|all cancers(93;0.000582)|Epithelial(262;0.00428)|GBM - Glioblastoma multiforme(486;0.0421)		TCTTCCCTCTGATTATCTGCA	0.602																																					p.Q335E		Atlas-SNP	.											.	CCDC8	56	.	0			c.C1003G						.						94.0	100.0	98.0					19																	46915065		2203	4300	6503	SO:0001583	missense	83987	exon1			CCCTCTGATTATC	BC025243	CCDS12685.1	19q13.33	2012-04-17			ENSG00000169515	ENSG00000169515		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25367	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 20"""	614145				11230166	Standard	NM_032040		Approved	DKFZp564K0322, 3M3, PPP1R20	uc002pep.3	Q9H0W5	OTTHUMG00000162348	ENST00000307522.3:c.1003C>G	chr19.hg19:g.46915065G>C	ENSP00000303158:p.Gln335Glu	205.0	0.0		160.0	20.0	NM_032040	Q8TB26	Missense_Mutation	SNP	ENST00000307522.3	hg19	CCDS12685.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.69|12.69	2.013964|2.013964	0.35511|0.35511	.|.	.|.	ENSG00000169515|ENSG00000169515	ENST00000540252|ENST00000307522	.|T	.|0.13196	.|2.61	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.495473	.|0.15037	.|N	.|0.284089	T|T	0.18800|0.18800	0.0451|0.0451	M|M	0.65498|0.65498	2.005|2.005	0.09310|0.09310	N|N	1|1	.|P	.|0.50819	.|0.939	.|B	.|0.42851	.|0.4	T|T	0.15521|0.15521	-1.0434|-1.0434	6|10	0.35671|0.25751	T|T	0.21|0.34	-2.9829|-2.9829	15.0527|15.0527	0.71888|0.71888	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|335	.|Q9H0W5	.|CCDC8_HUMAN	M|E	181|335	.|ENSP00000303158:Q335E	ENSP00000441180:I181M|ENSP00000303158:Q335E	I|Q	-|-	3|1	3|0	CCDC8|CCDC8	51606905|51606905	0.004000|0.004000	0.15560|0.15560	0.140000|0.140000	0.22221|0.22221	0.039000|0.039000	0.13416|0.13416	1.446000|1.446000	0.35090|0.35090	2.317000|2.317000	0.78254|0.78254	0.561000|0.561000	0.74099|0.74099	ATC|CAG	.	.		0.602	CCDC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368598.1	NM_032040	
PRKD2	25865	hgsc.bcm.edu	37	19	47207810	47207810	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47207810C>G	ENST00000291281.4	-	4	833	c.608G>C	c.(607-609)aGt>aCt	p.S203T	PRKD2_ENST00000601806.1_Missense_Mutation_p.S46T|PRKD2_ENST00000595515.1_Missense_Mutation_p.S203T|PRKD2_ENST00000600194.1_Missense_Mutation_p.S46T|PRKD2_ENST00000433867.1_Missense_Mutation_p.S203T			Q9BZL6	KPCD2_HUMAN	protein kinase D2	203					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CGAGTGGCCACTGGCCAGAGA	0.662											OREG0025578	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S203T		Atlas-SNP	.											.	PRKD2	94	.	0			c.G608C						.						36.0	40.0	39.0					19																	47207810		2203	4300	6503	SO:0001583	missense	25865	exon4			TGGCCACTGGCCA	AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.608G>C	chr19.hg19:g.47207810C>G	ENSP00000291281:p.Ser203Thr	106.0	0.0	945	100.0	26.0	NM_016457	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	ENST00000291281.4	hg19	CCDS12689.1	.	.	.	.	.	.	.	.	.	.	C	9.805	1.181466	0.21787	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.66280	-0.2;-0.2	5.26	5.26	0.73747	.	0.122405	0.51477	D	0.000092	T	0.48077	0.1480	L	0.36672	1.1	0.42933	D	0.994321	B;B	0.31931	0.024;0.347	B;B	0.30716	0.027;0.119	T	0.41963	-0.9479	10	0.12103	T	0.63	-21.2032	11.8621	0.52471	0.0:0.9147:0.0:0.0853	.	203;203	E7ER94;Q9BZL6	.;KPCD2_HUMAN	T	203	ENSP00000291281:S203T;ENSP00000393978:S203T	ENSP00000291281:S203T	S	-	2	0	PRKD2	51899650	0.999000	0.42202	1.000000	0.80357	0.302000	0.27658	2.251000	0.43187	2.447000	0.82792	0.313000	0.20887	AGT	.	.		0.662	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466591.1	NM_016457	
ARHGAP35	2909	hgsc.bcm.edu	37	19	47424967	47424967	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47424967T>C	ENST00000404338.3	+	1	3035	c.3035T>C	c.(3034-3036)cTc>cCc	p.L1012P		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1012					axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CATTCTAAGCTCTCTATGGAA	0.438																																					p.L1012P		Atlas-SNP	.											.	.	.	.	0			c.T3035C						.						73.0	69.0	71.0					19																	47424967		1893	4132	6025	SO:0001583	missense	2909	exon1			CTAAGCTCTCTAT	M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3035T>C	chr19.hg19:g.47424967T>C	ENSP00000385720:p.Leu1012Pro	113.0	0.0		123.0	5.0	NM_004491	A7E2A4|Q14452|Q9C0E1	Missense_Mutation	SNP	ENST00000404338.3	hg19	CCDS46127.1	.	.	.	.	.	.	.	.	.	.	T	15.02	2.709991	0.48517	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	T	0.08546	3.08	5.76	5.76	0.90799	.	0.233903	0.44097	D	0.000491	T	0.11879	0.0289	N	0.22421	0.69	0.58432	D	0.999996	D	0.54047	0.964	P	0.52066	0.689	T	0.07481	-1.0770	10	0.44086	T	0.13	-16.5649	15.0486	0.71846	0.0:0.0:0.0:1.0	.	1012	Q9NRY4-2	.	P	1012	ENSP00000385720:L1012P	ENSP00000324820:L1012P	L	+	2	0	ARHGAP35	52116807	0.949000	0.32298	0.982000	0.44146	0.919000	0.55068	2.300000	0.43620	2.200000	0.70718	0.533000	0.62120	CTC	.	.		0.438	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466652.1	NM_004491	
C5AR2	27202	hgsc.bcm.edu	37	19	47844736	47844736	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:47844736C>A	ENST00000595464.1	+	2	898	c.680C>A	c.(679-681)gCa>gAa	p.A227E	C5AR2_ENST00000600626.1_Missense_Mutation_p.A227E|C5AR2_ENST00000257267.2_Missense_Mutation_p.A227E	NM_001271749.1	NP_001258678.1	Q9P296	C5AR2_HUMAN	complement component 5a receptor 2	227					chemotaxis (GO:0006935)|inflammatory response (GO:0006954)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of tumor necrosis factor production (GO:0032720)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of interleukin-8 secretion (GO:2000482)	apical part of cell (GO:0045177)|basal plasma membrane (GO:0009925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)										CTGTGCTGGGCAGCCCGACGC	0.667																																					p.A227E		Atlas-SNP	.											.	.	.	.	0			c.C680A						.						28.0	36.0	34.0					19																	47844736		2179	4260	6439	SO:0001583	missense	27202	exon2			GCTGGGCAGCCCG	AB038237	CCDS12699.1	19q13.33	2013-01-28	2013-01-28	2013-01-28		ENSG00000134830		"""GPCR / Class A : Complement component receptors"""	4527	protein-coding gene	gene with protein product		609949	"""G protein-coupled receptor 77"""	GPR77		11165367	Standard	NM_018485		Approved	C5L2	uc010ela.1	Q9P296		ENST00000595464.1:c.680C>A	chr19.hg19:g.47844736C>A	ENSP00000472620:p.Ala227Glu	27.0	0.0		38.0	16.0	NM_001271750	B2RA09	Missense_Mutation	SNP	ENST00000595464.1	hg19	CCDS12699.1	.	.	.	.	.	.	.	.	.	.	C	15.69	2.909012	0.52439	.	.	ENSG00000134830	ENST00000257267	T	0.38560	1.13	4.11	-6.76	0.01732	GPCR, rhodopsin-like superfamily (1);	0.952150	0.08746	U	0.899814	T	0.40347	0.1113	M	0.62723	1.935	0.09310	N	1	D	0.54601	0.967	P	0.58266	0.836	T	0.41556	-0.9502	10	0.12430	T	0.62	.	0.5786	0.00708	0.2218:0.1518:0.245:0.3814	.	227	Q9P296	C5ARL_HUMAN	E	227	ENSP00000257267:A227E	ENSP00000257267:A227E	A	+	2	0	GPR77	52536576	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-1.026000	0.03596	-0.867000	0.04063	0.313000	0.20887	GCA	.	.		0.667	C5AR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466926.1	NM_018485	
TBC1D17	79735	hgsc.bcm.edu	37	19	50381446	50381446	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:50381446A>G	ENST00000221543.5	+	2	367	c.68A>G	c.(67-69)aAg>aGg	p.K23R	AKT1S1_ENST00000391832.3_5'Flank|AKT1S1_ENST00000482622.1_5'UTR|TBC1D17_ENST00000598789.1_3'UTR|AKT1S1_ENST00000391833.1_5'Flank|AKT1S1_ENST00000391834.2_5'Flank|AKT1S1_ENST00000391831.1_5'Flank|TBC1D17_ENST00000535102.2_Intron|AKT1S1_ENST00000344175.5_5'Flank|AKT1S1_ENST00000391835.1_5'Flank	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	23					autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		AGCGCTAAGAAGTATCAGGAC	0.642																																					p.K23R		Atlas-SNP	.											.	TBC1D17	39	.	0			c.A68G						.						45.0	38.0	41.0					19																	50381446		2195	4288	6483	SO:0001583	missense	79735	exon2			CTAAGAAGTATCA	AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.68A>G	chr19.hg19:g.50381446A>G	ENSP00000221543:p.Lys23Arg	77.0	0.0		89.0	4.0	NM_024682	B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	ENST00000221543.5	hg19	CCDS12785.1	.	.	.	.	.	.	.	.	.	.	A	14.69	2.610046	0.46527	.	.	ENSG00000104946	ENST00000221543	T	0.34859	1.34	5.72	2.16	0.27623	Domain of unknown function DUF3548 (1);	0.060857	0.64402	D	0.000004	T	0.14442	0.0349	N	0.05383	-0.06	0.80722	D	1	B	0.10296	0.003	B	0.17979	0.02	T	0.06625	-1.0816	10	0.19590	T	0.45	-37.0567	3.5835	0.07962	0.5379:0.1918:0.2703:0.0	.	23	Q9HA65	TBC17_HUMAN	R	23	ENSP00000221543:K23R	ENSP00000221543:K23R	K	+	2	0	TBC1D17	55073258	0.999000	0.42202	1.000000	0.80357	0.975000	0.68041	1.270000	0.33086	0.985000	0.38656	0.459000	0.35465	AAG	.	.		0.642	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466404.1	NM_024682	
SIGLEC7	27036	hgsc.bcm.edu	37	19	51649119	51649119	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:51649119A>G	ENST00000317643.6	+	4	837	c.768A>G	c.(766-768)acA>acG	p.T256T	SIGLEC7_ENST00000305628.7_Silent_p.T163T|SIGLEC7_ENST00000600577.1_Intron	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	256	Ig-like C2-type 2.				cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CAGCATCCACAGCTCTGGGGA	0.512																																					p.T256T		Atlas-SNP	.											.	SIGLEC7	74	.	0			c.A768G						.						154.0	153.0	153.0					19																	51649119		2203	4300	6503	SO:0001819	synonymous_variant	27036	exon4			ATCCACAGCTCTG	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.768A>G	chr19.hg19:g.51649119A>G		72.0	0.0		61.0	4.0	NM_014385	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	hg19	CCDS12826.1																																																																																			.	.		0.512	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
ZNF836	162962	hgsc.bcm.edu	37	19	52658668	52658668	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:52658668G>A	ENST00000322146.8	-	5	2789	c.2268C>T	c.(2266-2268)ggC>ggT	p.G756G	CTC-471J1.8_ENST00000594362.1_RNA|ZNF836_ENST00000597252.1_Silent_p.G756G	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	756					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TAAAGACCTGGCCACATTCAA	0.423																																					p.G756G		Atlas-SNP	.											.	ZNF836	158	.	0			c.C2268T						.						86.0	91.0	90.0					19																	52658668		2182	4286	6468	SO:0001819	synonymous_variant	162962	exon5			GACCTGGCCACAT	BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.2268C>T	chr19.hg19:g.52658668G>A		96.0	0.0		64.0	4.0	NM_001102657		Silent	SNP	ENST00000322146.8	hg19	CCDS46162.1																																																																																			.	.		0.423	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462456.1	NM_001102657	
ZNF534	147658	hgsc.bcm.edu	37	19	52938454	52938454	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:52938454T>C	ENST00000332323.6	+	3	363	c.302T>C	c.(301-303)gTg>gCg	p.V101A	ZNF534_ENST00000432303.2_Intron|ZNF534_ENST00000301085.4_Missense_Mutation_p.V88A|ZNF534_ENST00000433050.1_Missense_Mutation_p.V88A	NM_001143939.1	NP_001137411.1	Q76KX8	ZN534_HUMAN	zinc finger protein 534	101					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|lung(1)|prostate(1)|skin(1)	4						ATCAAAGGTGTGAACACAGGT	0.478																																					p.V101A		Atlas-SNP	.											.	ZNF534	105	.	0			c.T302C						.						77.0	66.0	69.0					19																	52938454		1568	3582	5150	SO:0001583	missense	147658	exon3			AAGGTGTGAACAC	AK058073	CCDS46165.1, CCDS46166.1	19q13.41	2013-01-08	2004-02-06	2004-02-11	ENSG00000198633	ENSG00000198633		"""Zinc fingers, C2H2-type"", ""-"""	26337	protein-coding gene	gene with protein product			"""KRAB domain only 3"""	KRBO3			Standard	NM_001143938		Approved	FLJ25344	uc002pzk.3	Q76KX8	OTTHUMG00000156493	ENST00000332323.6:c.302T>C	chr19.hg19:g.52938454T>C	ENSP00000327538:p.Val101Ala	108.0	0.0		92.0	4.0	NM_001143939	Q76KX9	Missense_Mutation	SNP	ENST00000332323.6	hg19	CCDS46165.1	.	.	.	.	.	.	.	.	.	.	T	5.044	0.193778	0.09599	.	.	ENSG00000198633	ENST00000301085;ENST00000332323;ENST00000433050;ENST00000391790	T;T;T	0.07567	5.62;3.18;3.2	1.67	-1.98	0.07480	.	.	.	.	.	T	0.06462	0.0166	L	0.42744	1.35	0.09310	N	1	P;P;B	0.38767	0.504;0.646;0.138	B;B;B	0.35770	0.057;0.21;0.082	T	0.31110	-0.9955	9	0.45353	T	0.12	.	5.4986	0.16817	0.0:0.0:0.602:0.398	.	88;101;88	Q76KX8-2;Q76KX8;Q1T7F5	.;ZN534_HUMAN;.	A	88;101;88;100	ENSP00000301085:V88A;ENSP00000327538:V101A;ENSP00000391358:V88A	ENSP00000301085:V88A	V	+	2	0	ZNF534	57630266	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	-0.251000	0.08818	-0.145000	0.11294	0.338000	0.21704	GTG	.	.		0.478	ZNF534-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460877.1	NM_182512	
CACNG8	59283	hgsc.bcm.edu	37	19	54485412	54485412	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:54485412A>G	ENST00000270458.2	+	4	690	c.587A>G	c.(586-588)aAg>aGg	p.K196R	MIR935_ENST00000401179.1_RNA	NM_031895.5	NP_114101	Q8WXS5	CCG8_HUMAN	calcium channel, voltage-dependent, gamma subunit 8	196					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			kidney(1)|large_intestine(3)|lung(8)|urinary_tract(1)	13	all_cancers(19;0.0385)|all_epithelial(19;0.0207)|all_lung(19;0.145)|Lung NSC(19;0.168)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.162)		GACGAGGAGAAGAAAAACCAC	0.627																																					p.K196R		Atlas-SNP	.											.	CACNG8	29	.	0			c.A587G						.						53.0	43.0	46.0					19																	54485412		2202	4299	6501	SO:0001583	missense	59283	exon4			AGGAGAAGAAAAA	AF288388	CCDS33104.1	19q13.4	2008-05-02			ENSG00000142408	ENSG00000142408		"""Calcium channel subunits"""	13628	protein-coding gene	gene with protein product		606900				11170751	Standard	NM_031895		Approved		uc002qcs.2	Q8WXS5	OTTHUMG00000064908	ENST00000270458.2:c.587A>G	chr19.hg19:g.54485412A>G	ENSP00000270458:p.Lys196Arg	82.0	0.0		106.0	5.0	NM_031895	Q9BXT0|Q9BY23	Missense_Mutation	SNP	ENST00000270458.2	hg19	CCDS33104.1	.	.	.	.	.	.	.	.	.	.	.	21.1	4.104143	0.76983	.	.	ENSG00000142408	ENST00000270458	T	0.50001	0.76	2.28	2.28	0.28536	.	0.000000	0.64402	U	0.000005	T	0.52629	0.1746	M	0.83953	2.67	0.31060	N	0.714201	P	0.44816	0.844	P	0.45610	0.487	T	0.67597	-0.5630	9	0.62326	D	0.03	-27.083	8.1583	0.31183	1.0:0.0:0.0:0.0	.	196	Q8WXS5	CCG8_HUMAN	R	196	ENSP00000270458:K196R	ENSP00000270458:K196R	K	+	2	0	CACNG8	59177224	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.417000	0.73337	1.066000	0.40716	0.241000	0.17934	AAG	.	.		0.627	CACNG8-001	KNOWN	non_ATG_start|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139361.3		
ZNF17	7565	hgsc.bcm.edu	37	19	57932584	57932584	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:57932584T>C	ENST00000601808.1	+	3	1937	c.1724T>C	c.(1723-1725)gTt>gCt	p.V575A	ZNF17_ENST00000307658.7_Missense_Mutation_p.V577A|AC004076.7_ENST00000597410.1_Intron	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	575					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		CACCAAAAAGTTCACACTAGG	0.408																																					p.V575A	Melanoma(149;1637 1853 29914 42869 44988)	Atlas-SNP	.											.	ZNF17	49	.	0			c.T1724C						.						51.0	51.0	51.0					19																	57932584		2020	4211	6231	SO:0001583	missense	7565	exon3			AAAAAGTTCACAC	X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.1724T>C	chr19.hg19:g.57932584T>C	ENSP00000471905:p.Val575Ala	100.0	0.0		79.0	4.0	NM_006959	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	ENST00000601808.1	hg19	CCDS42636.1	.	.	.	.	.	.	.	.	.	.	T	14.94	2.685649	0.47991	.	.	ENSG00000186272	ENST00000307658	.	.	.	2.45	1.37	0.22104	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.47377	0.1442	L	0.38531	1.155	0.09310	N	1	D;B	0.71674	0.998;0.129	D;B	0.67103	0.949;0.048	T	0.28138	-1.0053	8	0.87932	D	0	.	5.7423	0.18100	0.0:0.2658:0.0:0.7342	.	577;575	P17021-2;P17021	.;ZNF17_HUMAN	A	575	.	ENSP00000302455:V575A	V	+	2	0	ZNF17	62624396	0.001000	0.12720	0.011000	0.14972	0.697000	0.40408	1.101000	0.31037	0.166000	0.19597	0.383000	0.25322	GTT	.	.		0.408	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466384.1	NM_006959	
ZNF549	256051	hgsc.bcm.edu	37	19	58048846	58048846	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr19:58048846A>G	ENST00000376233.3	+	4	655	c.474A>G	c.(472-474)aaA>aaG	p.K158K	ZNF550_ENST00000601415.1_Intron|ZNF549_ENST00000602149.1_Intron|ZNF549_ENST00000240719.3_Silent_p.K145K|ZNF549_ENST00000594943.1_Intron	NM_001199295.1	NP_001186224	Q6P9A3	ZN549_HUMAN	zinc finger protein 549	158					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	21		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		GTGGAGAGAAACACATCAGAA	0.458																																					p.K158K		Atlas-SNP	.											.	ZNF549	118	.	0			c.A474G						.						79.0	72.0	74.0					19																	58048846		2203	4300	6503	SO:0001819	synonymous_variant	256051	exon4			AGAGAAACACATC	AK092236	CCDS12952.1, CCDS56106.1	19q13.43	2013-01-08				ENSG00000121406		"""Zinc fingers, C2H2-type"", ""-"""	26632	protein-coding gene	gene with protein product						12477932	Standard	NM_153263		Approved	FLJ34917	uc002qpb.2	Q6P9A3		ENST00000376233.3:c.474A>G	chr19.hg19:g.58048846A>G		117.0	0.0		100.0	5.0	NM_001199295	B3KV91|O43336|Q8NAR4	Silent	SNP	ENST00000376233.3	hg19	CCDS56106.1																																																																																			.	.		0.458	ZNF549-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466780.1	NM_153263	
UBOX5	22888	hgsc.bcm.edu	37	20	3102976	3102976	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:3102976G>A	ENST00000217173.2	-	3	780	c.309C>T	c.(307-309)ggC>ggT	p.G103G	UBOX5_ENST00000348031.2_Silent_p.G103G|UBOX5-AS1_ENST00000446537.1_RNA	NM_001267584.1|NM_014948.3	NP_001254513.1|NP_055763.1			U-box domain containing 5											endometrium(1)|kidney(2)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	20						GCTCAGCTGGGCCCAGGGTCC	0.557																																					p.G103G		Atlas-SNP	.											.	UBOX5	47	.	0			c.C309T						.						59.0	59.0	59.0					20																	3102976		2203	4300	6503	SO:0001819	synonymous_variant	22888	exon3			AGCTGGGCCCAGG	AB020667	CCDS13046.1, CCDS13047.1	20p13	2013-01-28			ENSG00000185019	ENSG00000185019		"""RING-type (C3HC4) zinc fingers"", ""U-box domain containing"""	17777	protein-coding gene	gene with protein product						11274149	Standard	NM_014948		Approved	UIP5, KIAA0860, Ubce7ip5, RNF37	uc002whw.4	O94941	OTTHUMG00000031731	ENST00000217173.2:c.309C>T	chr20.hg19:g.3102976G>A		114.0	0.0		102.0	47.0	NM_014948		Silent	SNP	ENST00000217173.2	hg19	CCDS13046.1																																																																																			.	.		0.557	UBOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077706.2	NM_014948	
OVOL2	58495	hgsc.bcm.edu	37	20	18022310	18022310	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:18022310C>G	ENST00000278780.6	-	3	621	c.379G>C	c.(379-381)Ggc>Cgc	p.G127R	OVOL2_ENST00000483661.1_5'UTR	NM_021220.2	NP_067043.2	Q9BRP0	OVOL2_HUMAN	ovo-like zinc finger 2	127					angiogenesis (GO:0001525)|dorsal/ventral pattern formation (GO:0009953)|embryonic digestive tract morphogenesis (GO:0048557)|endocardium formation (GO:0060214)|heart looping (GO:0001947)|heart trabecula formation (GO:0060347)|labyrinthine layer blood vessel development (GO:0060716)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neural fold formation (GO:0001842)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of keratinocyte proliferation (GO:0010837)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)	6						AGACGGAAGCCCTTGCCACAC	0.617																																					p.G127R		Atlas-SNP	.											.	OVOL2	18	.	0			c.G379C						.						120.0	80.0	93.0					20																	18022310		2203	4300	6503	SO:0001583	missense	58495	exon3			GGAAGCCCTTGCC	AK022284	CCDS13132.1	20p11.23	2013-10-17	2013-10-17	2005-05-31	ENSG00000125850	ENSG00000125850		"""Zinc fingers, C2H2-type"""	15804	protein-coding gene	gene with protein product			"""zinc finger protein 339"", ""ovo-like 2 (Drosophila)"""	ZNF339			Standard	NM_021220		Approved	bA504H3.3, HOVO2	uc002wqi.1	Q9BRP0	OTTHUMG00000031960	ENST00000278780.6:c.379G>C	chr20.hg19:g.18022310C>G	ENSP00000278780:p.Gly127Arg	157.0	0.0		142.0	6.0	NM_021220	Q5T8B4|Q9BX22|Q9HA54|Q9Y4M0	Missense_Mutation	SNP	ENST00000278780.6	hg19	CCDS13132.1	.	.	.	.	.	.	.	.	.	.	C	16.51	3.142366	0.57044	.	.	ENSG00000125850	ENST00000278780	T	0.75938	-0.98	5.57	0.66	0.17868	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.706306	0.14785	N	0.298588	T	0.61627	0.2362	L	0.27053	0.805	0.30601	N	0.760484	P	0.41366	0.747	B	0.43508	0.422	T	0.60712	-0.7209	10	0.72032	D	0.01	-13.263	6.295	0.21081	0.2774:0.6108:0.0:0.1117	.	127	Q9BRP0	OVOL2_HUMAN	R	127	ENSP00000278780:G127R	ENSP00000278780:G127R	G	-	1	0	OVOL2	17970310	0.292000	0.24362	0.990000	0.47175	0.998000	0.95712	0.629000	0.24538	-0.132000	0.11557	0.655000	0.94253	GGC	.	.		0.617	OVOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078148.5	NM_021220	
NINL	22981	hgsc.bcm.edu	37	20	25442240	25442240	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:25442240A>G	ENST00000278886.6	-	21	3687	c.3614T>C	c.(3613-3615)cTt>cCt	p.L1205P	NINL_ENST00000422516.1_Missense_Mutation_p.L856P|NINL_ENST00000464285.1_5'Flank	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1205					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						CAGGCATTCAAGTTCAACTCT	0.443																																					p.L1205P		Atlas-SNP	.											.	NINL	148	.	0			c.T3614C						.						174.0	148.0	157.0					20																	25442240		2203	4300	6503	SO:0001583	missense	22981	exon21			CATTCAAGTTCAA		CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3614T>C	chr20.hg19:g.25442240A>G	ENSP00000278886:p.Leu1205Pro	98.0	0.0		94.0	4.0	NM_025176	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	ENST00000278886.6	hg19	CCDS33452.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.538279	0.45176	.	.	ENSG00000101004	ENST00000278886;ENST00000422516	T;T	0.38722	3.29;1.12	4.81	3.71	0.42584	.	0.092912	0.43919	D	0.000502	T	0.55970	0.1954	L	0.58101	1.795	0.41456	D	0.988018	B;D	0.89917	0.087;1.0	B;D	0.80764	0.063;0.994	T	0.56739	-0.7929	10	0.72032	D	0.01	-3.3487	8.2593	0.31775	0.9077:0.0:0.0923:0.0	.	856;1205	Q9Y2I6-2;Q9Y2I6	.;NINL_HUMAN	P	1205;856	ENSP00000278886:L1205P;ENSP00000410431:L856P	ENSP00000278886:L1205P	L	-	2	0	NINL	25390240	0.993000	0.37304	0.939000	0.37840	0.509000	0.34042	2.534000	0.45676	0.865000	0.35603	0.454000	0.30748	CTT	.	.		0.443	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078445.3	NM_025176	
ASXL1	171023	hgsc.bcm.edu	37	20	31021502	31021502	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:31021502T>C	ENST00000375687.4	+	12	1925	c.1501T>C	c.(1501-1503)Tct>Cct	p.S501P	ASXL1_ENST00000306058.5_Missense_Mutation_p.S496P	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	501	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						GGCACGTGCCTCTGCATCTCC	0.567			"""F, N, Mis"""		"""MDS, CMML"""																																p.S501P		Atlas-SNP	.		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	.	ASXL1	1114	.	0			c.T1501C						.						121.0	125.0	124.0					20																	31021502		2203	4300	6503	SO:0001583	missense	171023	exon11			CGTGCCTCTGCAT	AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1501T>C	chr20.hg19:g.31021502T>C	ENSP00000364839:p.Ser501Pro	97.0	0.0		138.0	6.0	NM_015338	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	ENST00000375687.4	hg19	CCDS13201.1	.	.	.	.	.	.	.	.	.	.	T	11.77	1.739158	0.30774	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.15603	2.41;2.41	4.38	4.38	0.52667	.	0.120886	0.64402	D	0.000020	T	0.13628	0.0330	L	0.45137	1.4	0.35903	D	0.830526	B;P	0.35714	0.068;0.517	B;B	0.40636	0.01;0.335	T	0.19289	-1.0310	10	0.24483	T	0.36	-8.7631	1.9683	0.03400	0.1476:0.0888:0.2485:0.5151	.	496;501	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	P	501;501;501;440;496	ENSP00000364839:S501P;ENSP00000305119:S496P	ENSP00000305119:S496P	S	+	1	0	ASXL1	30485163	1.000000	0.71417	0.953000	0.39169	0.097000	0.18754	1.587000	0.36622	2.198000	0.70561	0.533000	0.62120	TCT	.	.		0.567	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078624.2	NM_015338	
SPINT3	10816	hgsc.bcm.edu	37	20	44144183	44144183	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:44144183T>C	ENST00000217428.6	-	1	81	c.66A>G	c.(64-66)gaA>gaG	p.E22E		NM_006652.1	NP_006643.1	P49223	SPIT3_HUMAN	serine peptidase inhibitor, Kunitz type, 3	22						extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)	1						CTCGTGCTAGTTCTGATCGAA	0.562																																					p.E22E		Atlas-SNP	.											.	SPINT3	12	.	0			c.A66G						.						86.0	74.0	77.0					20																	44144183		692	1591	2283	SO:0001819	synonymous_variant	10816	exon1			TGCTAGTTCTGAT	X77166	CCDS46608.1	20q12-q13.2	2012-08-20	2005-08-17		ENSG00000101446	ENSG00000101446			11248	protein-coding gene	gene with protein product		613941	"""serine protease inhibitor, Kunitz type, 3"""			21988899	Standard	NM_006652		Approved	HKIB9	uc010ghg.1	P49223	OTTHUMG00000032585	ENST00000217428.6:c.66A>G	chr20.hg19:g.44144183T>C		100.0	0.0		107.0	5.0	NM_006652	A6NCQ6|Q6UDR8|Q96KK2	Silent	SNP	ENST00000217428.6	hg19	CCDS46608.1																																																																																			.	.		0.562	SPINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079464.5	NM_006652	
ZNF335	63925	hgsc.bcm.edu	37	20	44586259	44586259	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:44586259C>G	ENST00000322927.2	-	17	2508	c.2408G>C	c.(2407-2409)aGt>aCt	p.S803T	ZNF335_ENST00000426788.1_Missense_Mutation_p.S648T	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	803					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CCGCTGAGCACTCATGTTCAG	0.617																																					p.S803T		Atlas-SNP	.											.	ZNF335	115	.	0			c.G2408C						.						62.0	55.0	58.0					20																	44586259		2203	4300	6503	SO:0001583	missense	63925	exon17			TGAGCACTCATGT	AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.2408G>C	chr20.hg19:g.44586259C>G	ENSP00000325326:p.Ser803Thr	89.0	0.0		93.0	4.0	NM_022095	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	ENST00000322927.2	hg19	CCDS13389.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.738862	0.89573	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.21191	2.2;2.02	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.34571	0.0902	L	0.34521	1.04	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.78314	0.991;0.98	T	0.01238	-1.1409	10	0.27785	T	0.31	-13.011	16.1908	0.81987	0.0:1.0:0.0:0.0	.	648;803	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	T	803;580;648	ENSP00000325326:S803T;ENSP00000397098:S648T	ENSP00000243961:S580T	S	-	2	0	ZNF335	44019666	1.000000	0.71417	0.964000	0.40570	0.972000	0.66771	6.548000	0.73896	2.735000	0.93741	0.563000	0.77884	AGT	.	.		0.617	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079553.1	NM_022095	
SPATA2	9825	hgsc.bcm.edu	37	20	48524814	48524814	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:48524814T>C	ENST00000422556.1	-	2	563	c.214A>G	c.(214-216)Agc>Ggc	p.S72G	SPATA2_ENST00000289431.5_Missense_Mutation_p.S72G|SPATA2_ENST00000543716.1_Intron	NM_001135773.1	NP_001129245.1	Q9UM82	SPAT2_HUMAN	spermatogenesis associated 2	72					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)	20	Hepatocellular(150;0.133)		BRCA - Breast invasive adenocarcinoma(9;4.03e-06)			CGCAAGGAGCTCTCCACCACC	0.607																																					p.S72G		Atlas-SNP	.											.	SPATA2	36	.	0			c.A214G						.						82.0	70.0	74.0					20																	48524814		2203	4300	6503	SO:0001583	missense	9825	exon2			AGGAGCTCTCCAC	AB018300	CCDS13422.1	20q13.13	2014-06-13			ENSG00000158480	ENSG00000158480			14681	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 145"""	607662					Standard	NM_001135773		Approved	KIAA0757, PD1, tamo, PPP1R145	uc002xuw.3	Q9UM82	OTTHUMG00000032704	ENST00000422556.1:c.214A>G	chr20.hg19:g.48524814T>C	ENSP00000416799:p.Ser72Gly	73.0	0.0		116.0	5.0	NM_006038	E1P626|O94857	Missense_Mutation	SNP	ENST00000422556.1	hg19	CCDS13422.1	.	.	.	.	.	.	.	.	.	.	T	15.11	2.736872	0.49045	.	.	ENSG00000158480	ENST00000289431;ENST00000422556	T;T	0.72051	-0.62;-0.62	4.38	2.04	0.26737	.	0.050219	0.85682	D	0.000000	T	0.57755	0.2075	L	0.44542	1.39	0.80722	D	1	B	0.30605	0.287	B	0.24394	0.053	T	0.50259	-0.8849	10	0.31617	T	0.26	-4.8772	11.3129	0.49375	0.0:0.0:0.3102:0.6898	.	72	Q9UM82	SPAT2_HUMAN	G	72	ENSP00000289431:S72G;ENSP00000416799:S72G	ENSP00000289431:S72G	S	-	1	0	SPATA2	47958221	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.068000	0.50018	0.292000	0.22492	0.533000	0.62120	AGC	.	.		0.607	SPATA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079658.1	NM_006038	
FAM65C	140876	hgsc.bcm.edu	37	20	49214133	49214133	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:49214133C>A	ENST00000327979.2	-	14	2173	c.1762G>T	c.(1762-1764)Ggc>Tgc	p.G588C	FAM65C_ENST00000535356.1_Missense_Mutation_p.G592C|FAM65C_ENST00000045083.2_Missense_Mutation_p.G588C			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	588										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CCCTGGGAGCCCCCAAACAGG	0.652																																					p.G588C		Atlas-SNP	.											.	FAM65C	87	.	0			c.G1762T						.						53.0	47.0	49.0					20																	49214133		2201	4300	6501	SO:0001583	missense	140876	exon14			GGGAGCCCCCAAA	AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.1762G>T	chr20.hg19:g.49214133C>A	ENSP00000332663:p.Gly588Cys	109.0	0.0		140.0	18.0	NM_080829	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	ENST00000327979.2	hg19	CCDS13431.2	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339966	0.41398	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.15372	2.43;2.43;2.43	4.6	3.39	0.38822	.	0.087335	0.85682	D	0.000000	T	0.30696	0.0773	M	0.68317	2.08	0.47737	D	0.999507	D;D	0.76494	0.998;0.999	D;D	0.65443	0.927;0.935	T	0.05954	-1.0854	10	0.72032	D	0.01	-35.1959	4.0709	0.09882	0.0:0.6553:0.0:0.3447	.	592;588	F5H0X2;Q96MK2	.;FA65C_HUMAN	C	588;588;592	ENSP00000332663:G588C;ENSP00000045083:G588C;ENSP00000439802:G592C	ENSP00000045083:G588C	G	-	1	0	FAM65C	48647540	1.000000	0.71417	1.000000	0.80357	0.165000	0.22458	1.676000	0.37565	2.256000	0.74724	0.561000	0.74099	GGC	.	.		0.652	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257962.1		
SYCP2	10388	hgsc.bcm.edu	37	20	58442784	58442784	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:58442784T>C	ENST00000357552.3	-	39	4332	c.4107A>G	c.(4105-4107)gaA>gaG	p.E1369E	SYCP2_ENST00000371001.2_Silent_p.E1369E			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1369					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TTCTCTTAAATTCTGAATTGA	0.328																																					p.E1369E		Atlas-SNP	.											.	SYCP2	204	.	0			c.A4107G						.						52.0	55.0	54.0					20																	58442784		2203	4295	6498	SO:0001819	synonymous_variant	10388	exon38			CTTAAATTCTGAA	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.4107A>G	chr20.hg19:g.58442784T>C		111.0	0.0		100.0	4.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Silent	SNP	ENST00000357552.3	hg19	CCDS13482.1																																																																																			.	.		0.328	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
CDH4	1002	hgsc.bcm.edu	37	20	60318825	60318825	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr20:60318825T>C	ENST00000360469.5	+	3	464	c.376T>C	c.(376-378)Tcc>Ccc	p.S126P	RP11-429E11.2_ENST00000447909.1_RNA|CDH4_ENST00000543233.1_Missense_Mutation_p.S52P|RP11-429E11.2_ENST00000442888.1_RNA	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	126					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			CCAGACCTCGTCCCCGCACTC	0.642																																					p.S126P		Atlas-SNP	.											.	CDH4	172	.	0			c.T376C						.						51.0	41.0	45.0					20																	60318825		2198	4300	6498	SO:0001583	missense	1002	exon3			ACCTCGTCCCCGC	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.376T>C	chr20.hg19:g.60318825T>C	ENSP00000353656:p.Ser126Pro	77.0	0.0		97.0	4.0	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	hg19	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	T	3.595	-0.082855	0.07141	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.56776	0.44;0.45	5.0	1.22	0.21188	Cadherin-like (1);	1.747780	0.03392	N	0.202093	T	0.31263	0.0791	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13926	-1.0491	9	.	.	.	.	5.3668	0.16117	0.0:0.2406:0.2983:0.4611	.	126	P55283	CADH4_HUMAN	P	126;34;52	ENSP00000353656:S126P;ENSP00000443301:S52P	.	S	+	1	0	CDH4	59752220	0.000000	0.05858	0.001000	0.08648	0.150000	0.21749	0.133000	0.15912	-0.035000	0.13691	0.402000	0.26972	TCC	.	.		0.642	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
KCNJ6	3763	hgsc.bcm.edu	37	21	38997717	38997717	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:38997717A>G	ENST00000609713.1	-	4	1605	c.1016T>C	c.(1015-1017)gTc>gCc	p.V339A	KCNJ6_ENST00000288309.6_Missense_Mutation_p.V339A	NM_002240.3	NP_002231.1	P48051	KCNJ6_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 6	339					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	G-protein activated inward rectifier potassium channel activity (GO:0015467)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	22					Halothane(DB01159)	CAGGGTCAGGACAGGTGTGAA	0.537																																					p.V339A	Pancreas(48;379 1118 2936 19024 28214)	Atlas-SNP	.											.	KCNJ6	58	.	0			c.T1016C						.						91.0	98.0	95.0					21																	38997717		2048	4216	6264	SO:0001583	missense	3763	exon4			GTCAGGACAGGTG	U24660	CCDS42927.1	21q22.1	2011-07-05			ENSG00000157542	ENSG00000157542		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6267	protein-coding gene	gene with protein product		600877		KCNJ7		7796919, 16382105	Standard	NM_002240		Approved	Kir3.2, GIRK2, KATP2, BIR1, hiGIRK2	uc002ywo.3	P48051	OTTHUMG00000086667	ENST00000609713.1:c.1016T>C	chr21.hg19:g.38997717A>G	ENSP00000477437:p.Val339Ala	114.0	0.0		80.0	4.0	NM_002240	Q3MJ74|Q53WW6	Missense_Mutation	SNP	ENST00000609713.1	hg19	CCDS42927.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.761425	0.89932	.	.	ENSG00000157542	ENST00000400482;ENST00000288309	D;D	0.95412	-3.7;-3.7	5.88	5.88	0.94601	Immunoglobulin E-set (1);Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);Potassium channel, inwardly rectifying, Kir, cytoplasmic (1);	0.052029	0.85682	D	0.000000	D	0.97611	0.9217	M	0.80847	2.515	0.80722	D	1	D	0.64830	0.994	D	0.70227	0.968	D	0.98314	1.0525	10	0.87932	D	0	.	16.3009	0.82811	1.0:0.0:0.0:0.0	.	339	P48051	IRK6_HUMAN	A	339	ENSP00000383330:V339A;ENSP00000288309:V339A	ENSP00000288309:V339A	V	-	2	0	KCNJ6	37919587	1.000000	0.71417	0.993000	0.49108	0.918000	0.54935	8.962000	0.93254	2.246000	0.74042	0.533000	0.62120	GTC	.	.		0.537	KCNJ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194828.2	NM_002240	
BRWD1	54014	hgsc.bcm.edu	37	21	40590495	40590495	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:40590495A>G	ENST00000333229.2	-	30	3801	c.3474T>C	c.(3472-3474)ggT>ggC	p.G1158G	BRWD1_ENST00000342449.3_Silent_p.G1158G|BRWD1-IT1_ENST00000435608.1_RNA|BRWD1_ENST00000380800.3_Silent_p.G1158G	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1158					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TTGATTTCTGACCCCATTCAC	0.328																																					p.G1158G	Melanoma(170;988 1986 4794 16843 39731)	Atlas-SNP	.											.	BRWD1	325	.	0			c.T3474C						.						136.0	121.0	126.0					21																	40590495		2203	4300	6503	SO:0001819	synonymous_variant	54014	exon30			TTTCTGACCCCAT	AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3474T>C	chr21.hg19:g.40590495A>G		92.0	0.0		86.0	5.0	NM_018963	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	ENST00000333229.2	hg19	CCDS13662.1	.	.	.	.	.	.	.	.	.	.	A	9.000	0.979959	0.18812	.	.	ENSG00000185658	ENST00000424441	.	.	.	5.36	-3.9	0.04181	.	.	.	.	.	T	0.37732	0.1014	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.36768	-0.9734	4	.	.	.	-8.878	1.3199	0.02114	0.2806:0.1085:0.3337:0.2773	.	.	.	.	P	144	.	.	S	-	1	0	BRWD1	39512365	0.000000	0.05858	0.989000	0.46669	0.996000	0.88848	-1.778000	0.01778	-0.539000	0.06273	0.460000	0.39030	TCA	.	.		0.328	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141398.3	NM_033656	
LCA5L	150082	hgsc.bcm.edu	37	21	40782216	40782216	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:40782216A>G	ENST00000358268.2	-	8	1666	c.1138T>C	c.(1138-1140)Tca>Cca	p.S380P	LCA5L_ENST00000288350.3_Missense_Mutation_p.S380P|LCA5L_ENST00000380671.2_Missense_Mutation_p.S380P|LCA5L_ENST00000495240.1_5'UTR|WRB_ENST00000541890.1_Intron			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	380										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				GGAACATCTGATTTTTGGGTT	0.368																																					p.S380P		Atlas-SNP	.											.	LCA5L	57	.	0			c.T1138C						.						232.0	223.0	226.0					21																	40782216		2203	4300	6503	SO:0001583	missense	150082	exon8			CATCTGATTTTTG	AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.1138T>C	chr21.hg19:g.40782216A>G	ENSP00000351008:p.Ser380Pro	135.0	0.0		100.0	4.0	NM_152505	D3DSI0|Q3ZCT0	Missense_Mutation	SNP	ENST00000358268.2	hg19	CCDS13665.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.624322	0.66901	.	.	ENSG00000157578	ENST00000288350;ENST00000380671;ENST00000358268	T;T;T	0.57436	0.4;0.4;0.4	4.97	3.66	0.41972	.	0.156285	0.40302	N	0.001139	T	0.62368	0.2422	M	0.63843	1.955	0.34886	D	0.745045	D	0.76494	0.999	D	0.64776	0.929	T	0.71328	-0.4626	10	0.56958	D	0.05	-12.843	6.9073	0.24315	0.7421:0.0:0.0:0.2579	.	380	O95447	LCA5L_HUMAN	P	380	ENSP00000288350:S380P;ENSP00000370046:S380P;ENSP00000351008:S380P	ENSP00000288350:S380P	S	-	1	0	LCA5L	39704086	0.995000	0.38212	0.998000	0.56505	0.958000	0.62258	2.318000	0.43779	1.997000	0.58415	0.533000	0.62120	TCA	.	.		0.368	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141807.2	NM_152505	
UBASH3A	53347	hgsc.bcm.edu	37	21	43829672	43829672	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr21:43829672A>G	ENST00000319294.6	+	3	340	c.309A>G	c.(307-309)agA>agG	p.R103R	UBASH3A_ENST00000450356.1_Silent_p.R103R|UBASH3A_ENST00000291535.6_Silent_p.R103R|UBASH3A_ENST00000398367.1_Silent_p.R103R	NM_018961.3	NP_061834.1	P57075	UBS3A_HUMAN	ubiquitin associated and SH3 domain containing A	103					negative regulation of T cell receptor signaling pathway (GO:0050860)|regulation of cytokine production (GO:0001817)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.R103R(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(9)|lung(12)|ovary(3)	28						CAAAGAACAGAGCTCATGAGG	0.537																																					p.R103R		Atlas-SNP	.											UBASH3A,NS,carcinoma,0,1	UBASH3A	72	.	1	Substitution - coding silent(1)	lung(1)	c.A309G						.						136.0	119.0	125.0					21																	43829672		2203	4300	6503	SO:0001819	synonymous_variant	53347	exon3			GAACAGAGCTCAT	AJ277750	CCDS13687.1, CCDS33566.1, CCDS58791.1	21q22.3	2010-04-28	2010-04-28		ENSG00000160185	ENSG00000160185			12462	protein-coding gene	gene with protein product		605736				11281453	Standard	NM_018961		Approved	STS-2, TULA, CLIP4	uc002zbf.3	P57075	OTTHUMG00000086805	ENST00000319294.6:c.309A>G	chr21.hg19:g.43829672A>G		77.0	0.0		41.0	2.0	NM_018961	G5E9E4|Q6HA34|Q6HA35|Q6ISI6|Q6ISK3|Q6ISS9	Silent	SNP	ENST00000319294.6	hg19	CCDS13687.1																																																																																			.	.		0.537	UBASH3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195382.1	NM_001001895	
MRPL40	64976	hgsc.bcm.edu	37	22	19422404	19422404	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:19422404T>C	ENST00000333130.3	+	3	936	c.283T>C	c.(283-285)Ttg>Ctg	p.L95L	HIRA_ENST00000541063.1_Intron|HIRA_ENST00000546308.1_Intron|MRPL40_ENST00000443660.1_3'UTR	NM_003776.2	NP_003767.2	Q9NQ50	RM40_HUMAN	mitochondrial ribosomal protein L40	95					anatomical structure morphogenesis (GO:0009653)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					TCTAAAGTTCTTGGATAAAGC	0.413																																					p.L95L		Atlas-SNP	.											.	MRPL40	13	.	0			c.T283C						.						74.0	79.0	78.0					22																	19422404		2203	4300	6503	SO:0001819	synonymous_variant	64976	exon3			AAGTTCTTGGATA	AB051624	CCDS13760.1	22q11.2	2012-09-13	2002-11-13		ENSG00000185608	ENSG00000185608		"""Mitochondrial ribosomal proteins / large subunits"""	14491	protein-coding gene	gene with protein product		605089	"""nuclear localization signal deleted in velocardiofacial syndrome"""	NLVCF		9790763, 11543634	Standard	NM_003776		Approved	MRP-L22	uc002zpg.3	Q9NQ50	OTTHUMG00000150136	ENST00000333130.3:c.283T>C	chr22.hg19:g.19422404T>C		62.0	0.0		54.0	4.0	NM_003776	B3KVZ7|O95134	Silent	SNP	ENST00000333130.3	hg19	CCDS13760.1																																																																																			.	.		0.413	MRPL40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316491.2	NM_003776	
SGSM1	129049	hgsc.bcm.edu	37	22	25263061	25263061	+	Splice_Site	SNP	G	G	A	rs375323027		TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:25263061G>A	ENST00000400359.4	+	10	935	c.928G>A	c.(928-930)Gtc>Atc	p.V310I	SGSM1_ENST00000400358.4_Splice_Site_p.V310I	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	310	Required for interaction with RAP family members.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						CGCTTCCAGCGTCTACTGGGA	0.617																																					p.V310I		Atlas-SNP	.											.	SGSM1	150	.	0			c.G928A						.	G	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	0,4152		0,0,2076	39.0	43.0	42.0		928,928,928,928	3.2	1.0	22		42	1,8449		0,1,4224	no	missense-near-splice,missense-near-splice,missense-near-splice,missense-near-splice	SGSM1	NM_001039948.2,NM_001098497.1,NM_001098498.1,NM_133454.2	29,29,29,29	0,1,6300	AA,AG,GG		0.0118,0.0,0.0079	probably-damaging,probably-damaging,probably-damaging,probably-damaging	310/1149,310/1094,310/1033,310/1088	25263061	1,12601	2076	4225	6301	SO:0001630	splice_region_variant	129049	exon10			TCCAGCGTCTACT	AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.927-1G>A	chr22.hg19:g.25263061G>A		86.0	0.0		116.0	8.0	NM_001098497	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	ENST00000400359.4	hg19	CCDS46674.1	.	.	.	.	.	.	.	.	.	.	G	16.00	2.999133	0.54147	0.0	1.18E-4	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.31769	1.48;1.48	4.19	3.17	0.36434	.	0.301547	0.35772	N	0.002981	T	0.31295	0.0792	N	0.25485	0.75	0.80722	D	1	D;D;P;D	0.67145	0.996;0.963;0.865;0.984	P;B;P;P	0.56514	0.8;0.435;0.488;0.557	T	0.01998	-1.1232	10	0.21540	T	0.41	-5.2056	11.3382	0.49516	0.0896:0.0:0.9104:0.0	.	310;426;443;310	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	I	426;310;310	ENSP00000383211:V310I;ENSP00000383212:V310I	ENSP00000383211:V310I	V	+	1	0	SGSM1	23593061	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.453000	0.80700	0.913000	0.36797	0.555000	0.69702	GTC	.	.		0.617	SGSM1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320282.1	XM_059318	Missense_Mutation
MYH9	4627	hgsc.bcm.edu	37	22	36696312	36696312	+	Splice_Site	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:36696312T>C	ENST00000216181.5	-	23	3069		c.e23-2			NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle						actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CTCAAGCTCCTGCCGGGGGCC	0.617			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																												.		Atlas-SNP	.		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	.	MYH9	225	.	0			c.2839-2A>G						.						47.0	48.0	47.0					22																	36696312		2203	4300	6503	SO:0001630	splice_region_variant	4627	exon24	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA	AGCTCCTGCCGGG		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2839-2A>G	chr22.hg19:g.36696312T>C		52.0	0.0		60.0	4.0	NM_002473	A8K6E4|O60805|Q60FE2|Q86T83	Splice_Site	SNP	ENST00000216181.5	hg19	CCDS13927.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.911790	0.72983	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	.	.	.	5.16	5.16	0.70880	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2996	0.73936	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MYH9	35026258	1.000000	0.71417	0.883000	0.34634	0.822000	0.46500	8.002000	0.88514	2.073000	0.62155	0.533000	0.62120	.	.	.		0.617	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000259110.3	NM_002473	Intron
SMC1B	27127	hgsc.bcm.edu	37	22	45802675	45802675	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr22:45802675T>C	ENST00000357450.4	-	3	369	c.370A>G	c.(370-372)Ata>Gta	p.I124V	SMC1B_ENST00000404354.3_Missense_Mutation_p.I124V	NM_148674.3	NP_683515.3	Q8NDV3	SMC1B_HUMAN	structural maintenance of chromosomes 1B	124					meiotic nuclear division (GO:0007126)|sister chromatid cohesion (GO:0007062)	chromosome, centromeric region (GO:0000775)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(15)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	37		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)		ATTATGCCTATCTTTTCCAAC	0.299																																					p.I124V		Atlas-SNP	.											.	SMC1B	215	.	0			c.A370G						.						82.0	78.0	79.0					22																	45802675		1816	4068	5884	SO:0001583	missense	27127	exon3			TGCCTATCTTTTC	AJ504806	CCDS43027.1, CCDS74876.1	22q13	2006-07-06	2006-07-06	2006-07-06	ENSG00000077935	ENSG00000077935		"""Structural maintenance of chromosomes proteins"""	11112	protein-coding gene	gene with protein product		608685	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 2 (yeast)"""	SMC1L2		10591208, 11564881	Standard	XM_005261566		Approved	bK268H5	uc003bgc.3	Q8NDV3	OTTHUMG00000151334	ENST00000357450.4:c.370A>G	chr22.hg19:g.45802675T>C	ENSP00000350036:p.Ile124Val	83.0	0.0		95.0	4.0	NM_148674	A0AV46|B0QY23|B0QY24|Q5TIC3|Q6ZUF9|Q9Y3G5	Missense_Mutation	SNP	ENST00000357450.4	hg19	CCDS43027.1	.	.	.	.	.	.	.	.	.	.	T	16.66	3.183854	0.57800	.	.	ENSG00000077935	ENST00000357450;ENST00000404354	T;T	0.10099	2.91;3.27	5.89	5.89	0.94794	.	0.000000	0.64402	D	0.000003	T	0.17619	0.0423	L	0.49126	1.545	0.53688	D	0.999973	P;P	0.36183	0.542;0.485	B;P	0.45794	0.279;0.493	T	0.06162	-1.0842	10	0.17369	T	0.5	.	15.4934	0.75629	0.0:0.0:0.0:1.0	.	124;124	Q8NDV3-2;Q8NDV3-3	.;.	V	124	ENSP00000350036:I124V;ENSP00000385902:I124V	ENSP00000350036:I124V	I	-	1	0	SMC1B	44181339	0.877000	0.30153	1.000000	0.80357	0.973000	0.67179	0.618000	0.24373	2.254000	0.74563	0.459000	0.35465	ATA	.	.		0.299	SMC1B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322256.2	NM_148674	
STS	412	hgsc.bcm.edu	37	X	7177588	7177588	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:7177588C>T	ENST00000217961.4	+	5	816	c.596C>T	c.(595-597)aCc>aTc	p.T199I		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	199					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	ACCCTCCTTACCCTTGCTGCA	0.567									Ichthyosis																												p.T199I		Atlas-SNP	.											.	STS	64	.	0			c.C596T						.						104.0	71.0	82.0					X																	7177588		2203	4299	6502	SO:0001583	missense	412	exon5	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCCTTACCCTTGC	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.596C>T	chrX.hg19:g.7177588C>T	ENSP00000217961:p.Thr199Ile	101.0	0.0		99.0	4.0	NM_000351	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	hg19	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.933832	0.52866	.	.	ENSG00000101846	ENST00000217961	D	0.93859	-3.3	3.96	3.09	0.35607	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.357664	0.27846	N	0.017615	D	0.96349	0.8809	M	0.88775	2.98	0.09310	N	1	D	0.63880	0.993	D	0.67548	0.952	D	0.90790	0.4686	10	0.72032	D	0.01	.	9.99	0.41865	0.0:0.8947:0.0:0.1053	.	199	P08842	STS_HUMAN	I	199	ENSP00000217961:T199I	ENSP00000217961:T199I	T	+	2	0	STS	7187588	0.915000	0.31059	0.002000	0.10522	0.004000	0.04260	6.507000	0.73717	0.528000	0.28580	0.544000	0.68410	ACC	.	.		0.567	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
FANCB	2187	hgsc.bcm.edu	37	X	14868753	14868753	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:14868753A>G	ENST00000324138.3	-	6	1523	c.1370T>C	c.(1369-1371)gTc>gCc	p.V457A	FANCB_ENST00000398334.1_Missense_Mutation_p.V457A	NM_152633.2	NP_689846.1	Q8NB91	FANCB_HUMAN	Fanconi anemia, complementation group B	457					DNA repair (GO:0006281)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24	Hepatocellular(33;0.183)					TAAGATATGGACAGAATTTTC	0.318								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.V457A		Atlas-SNP	.											.	FANCB	78	.	0			c.T1370C						.						93.0	75.0	81.0					X																	14868753		2203	4300	6503	SO:0001583	missense	2187	exon6	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	ATATGGACAGAAT	AK091383	CCDS14161.1	Xp22.2	2014-09-17			ENSG00000181544	ENSG00000181544		"""Fanconi anemia, complementation groups"""	3583	protein-coding gene	gene with protein product		300515				9382107, 15502827	Standard	NM_152633		Approved	FAB, FLJ34064, FAAP95	uc004cwh.1	Q8NB91	OTTHUMG00000021168	ENST00000324138.3:c.1370T>C	chrX.hg19:g.14868753A>G	ENSP00000326819:p.Val457Ala	70.0	0.0		81.0	4.0	NM_152633	B2RMZ4|Q7Z2U2|Q86XG1	Missense_Mutation	SNP	ENST00000324138.3	hg19	CCDS14161.1	.	.	.	.	.	.	.	.	.	.	a	8.024	0.760374	0.15914	.	.	ENSG00000181544	ENST00000324138;ENST00000398334;ENST00000452869	.	.	.	5.85	-1.27	0.09347	.	0.780233	0.12465	N	0.466481	T	0.37019	0.0988	L	0.56769	1.78	0.09310	N	1	B	0.14438	0.01	B	0.14578	0.011	T	0.27971	-1.0058	9	0.25751	T	0.34	0.0345	6.1971	0.20555	0.4505:0.0:0.4208:0.1286	.	457	Q8NB91	FANCB_HUMAN	A	457	.	ENSP00000326819:V457A	V	-	2	0	FANCB	14778674	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	0.235000	0.17948	-0.218000	0.10018	0.433000	0.28618	GTC	.	.		0.318	FANCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055835.1	NM_152633	
CA5B	11238	hgsc.bcm.edu	37	X	15768152	15768152	+	Silent	SNP	G	G	A			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:15768152G>A	ENST00000318636.3	+	2	142	c.6G>A	c.(4-6)gtG>gtA	p.V2V	CA5B_ENST00000380313.1_3'UTR|CA5B_ENST00000454127.2_Silent_p.V2V	NM_007220.3	NP_009151.1	Q8WTZ4	CA5BL_HUMAN	carbonic anhydrase VB, mitochondrial	0						mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(3)|prostate(1)|stomach(2)	9	Hepatocellular(33;0.183)					TAAAGATGGTGGTGATGAACA	0.483																																					p.V2V		Atlas-SNP	.											.	CA5B	23	.	0			c.G6A						.						118.0	111.0	113.0					X																	15768152		2203	4300	6503	SO:0001819	synonymous_variant	11238	exon2			GATGGTGGTGATG	AB021660	CCDS14171.1	Xp22.1	2008-08-13			ENSG00000169239	ENSG00000169239		"""Carbonic anhydrases"""	1378	protein-coding gene	gene with protein product		300230				10409679	Standard	XM_005274442		Approved		uc004cxe.3	Q9Y2D0	OTTHUMG00000021183	ENST00000318636.3:c.6G>A	chrX.hg19:g.15768152G>A		65.0	0.0		85.0	4.0	NM_007220	A6NEZ4	Silent	SNP	ENST00000318636.3	hg19	CCDS14171.1																																																																																			.	.		0.483	CA5B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354933.1	NM_007220	
PDHA1	5160	hgsc.bcm.edu	37	X	19368150	19368150	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:19368150A>G	ENST00000422285.2	+	3	318	c.213A>G	c.(211-213)gtA>gtG	p.V71V	PDHA1_ENST00000545074.1_Silent_p.V71V|PDHA1_ENST00000540249.1_Silent_p.V71V|PDHA1_ENST00000379805.3_Silent_p.V71V|PDHA1_ENST00000379806.5_Silent_p.V109V			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	71					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					TGCAGACTGTACGCCGAATGG	0.483																																					p.V109V		Atlas-SNP	.											.	PDHA1	85	.	0			c.A327G						.						245.0	192.0	210.0					X																	19368150		2203	4300	6503	SO:0001819	synonymous_variant	5160	exon4			GACTGTACGCCGA		CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.213A>G	chrX.hg19:g.19368150A>G		114.0	0.0		114.0	5.0	NM_001173454	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Silent	SNP	ENST00000422285.2	hg19	CCDS14192.1																																																																																			.	.		0.483	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055977.1		
PTCHD1	139411	hgsc.bcm.edu	37	X	23411680	23411680	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:23411680T>C	ENST00000379361.4	+	3	2905	c.2045T>C	c.(2044-2046)tTc>tCc	p.F682S		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	682					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						TTCATCGTCTTCAATCCGTCC	0.493																																					p.F682S		Atlas-SNP	.											.	PTCHD1	213	.	0			c.T2045C						.						91.0	82.0	85.0					X																	23411680		2203	4300	6503	SO:0001583	missense	139411	exon3			TCGTCTTCAATCC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.2045T>C	chrX.hg19:g.23411680T>C	ENSP00000368666:p.Phe682Ser	90.0	0.0		80.0	4.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	hg19	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	T	17.03	3.283986	0.59867	.	.	ENSG00000165186	ENST00000379361	D	0.91011	-2.77	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.93667	0.7977	L	0.57536	1.79	0.58432	D	0.999998	D	0.60160	0.987	D	0.67725	0.953	D	0.94194	0.7444	10	0.72032	D	0.01	.	14.3778	0.66889	0.0:0.0:0.0:1.0	.	682	Q96NR3	PTHD1_HUMAN	S	682	ENSP00000368666:F682S	ENSP00000368666:F682S	F	+	2	0	PTCHD1	23321601	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.694000	0.84235	1.775000	0.52247	0.430000	0.28490	TTC	.	.		0.493	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
SYTL5	94122	hgsc.bcm.edu	37	X	37913595	37913595	+	Silent	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:37913595T>C	ENST00000357972.5	+	3	795	c.249T>C	c.(247-249)gcT>gcC	p.A83A	SYTL5_ENST00000297875.2_Silent_p.A83A|SYTL5_ENST00000456733.2_Silent_p.A83A|TM4SF2_ENST00000465127.1_Intron			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	83	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						CTTGTCAGGCTTGCTCACTGA	0.507																																					p.A83A		Atlas-SNP	.											.	SYTL5	72	.	0			c.T249C						.						94.0	81.0	85.0					X																	37913595		2202	4300	6502	SO:0001819	synonymous_variant	94122	exon2			TCAGGCTTGCTCA		CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.249T>C	chrX.hg19:g.37913595T>C		45.0	0.0		67.0	4.0	NM_001163334	A2RRF2	Silent	SNP	ENST00000357972.5	hg19	CCDS14244.1																																																																																			.	.		0.507	SYTL5-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080883.1	NM_138780	
SHROOM4	57477	hgsc.bcm.edu	37	X	50351123	50351123	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:50351123T>C	ENST00000289292.7	-	6	3302	c.3019A>G	c.(3019-3021)Aac>Gac	p.N1007D	SHROOM4_ENST00000460112.3_Missense_Mutation_p.N891D|SHROOM4_ENST00000376020.2_Missense_Mutation_p.N1007D			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1007					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					AGTGCTGGGTTCTCAAGGCAA	0.433																																					p.N1007D		Atlas-SNP	.											.	SHROOM4	171	.	0			c.A3019G						.						51.0	48.0	49.0					X																	50351123		2203	4300	6503	SO:0001583	missense	57477	exon6			CTGGGTTCTCAAG	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3019A>G	chrX.hg19:g.50351123T>C	ENSP00000289292:p.Asn1007Asp	102.0	0.0		99.0	5.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	hg19	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	T	15.98	2.991725	0.54041	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	T;T;T	0.19250	2.58;2.58;2.16	5.51	5.51	0.81932	.	0.217639	0.36815	N	0.002395	T	0.34629	0.0904	L	0.34521	1.04	0.39593	D	0.969615	D	0.76494	0.999	D	0.78314	0.991	T	0.19877	-1.0292	10	0.87932	D	0	.	12.4646	0.55751	0.0:0.0:0.0:1.0	.	1007	Q9ULL8	SHRM4_HUMAN	D	1007;1007;891	ENSP00000289292:N1007D;ENSP00000365188:N1007D;ENSP00000421450:N891D	ENSP00000289292:N1007D	N	-	1	0	SHROOM4	50367863	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	4.916000	0.63362	1.849000	0.53698	0.486000	0.48141	AAC	.	.		0.433	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
TSPYL2	64061	hgsc.bcm.edu	37	X	53115034	53115034	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:53115034T>C	ENST00000375442.4	+	6	1592	c.1460T>C	c.(1459-1461)gTc>gCc	p.V487A		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	487	Asn-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						CACAATGAGGTCCCcaacaac	0.478																																					p.V487A		Atlas-SNP	.											.	TSPYL2	53	.	0			c.T1460C						.						229.0	170.0	190.0					X																	53115034		2203	4300	6503	SO:0001583	missense	64061	exon6			ATGAGGTCCCCAA	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1460T>C	chrX.hg19:g.53115034T>C	ENSP00000364591:p.Val487Ala	87.0	0.0		101.0	5.0	NM_022117	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	hg19	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	T	0.005	-2.160611	0.00321	.	.	ENSG00000184205	ENST00000375442	T	0.19669	2.13	2.63	-5.25	0.02781	.	1.286020	0.05786	U	0.609421	T	0.07908	0.0198	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28267	-1.0049	10	0.13470	T	0.59	-3.1879	3.6647	0.08252	0.2125:0.5025:0.1553:0.1297	.	127;487	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	A	487	ENSP00000364591:V487A	ENSP00000364591:V487A	V	+	2	0	TSPYL2	53131759	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.511000	0.02260	-2.595000	0.00454	-0.832000	0.03076	GTC	.	.		0.478	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
RPS6KA6	27330	hgsc.bcm.edu	37	X	83389804	83389804	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:83389804T>C	ENST00000262752.2	-	8	639	c.632A>G	c.(631-633)cAt>cGt	p.H211R	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.H211R	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	211	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TAATTTGATATGTCCTATTTC	0.229																																					p.H211R		Atlas-SNP	.											.	RPS6KA6	116	.	0			c.A632G						.						33.0	33.0	33.0					X																	83389804		2177	4237	6414	SO:0001583	missense	27330	exon8			TTGATATGTCCTA	AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.632A>G	chrX.hg19:g.83389804T>C	ENSP00000262752:p.His211Arg	58.0	0.0		52.0	4.0	NM_014496	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	ENST00000262752.2	hg19	CCDS14451.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.507262	0.64410	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.64618	-0.11;-0.11	4.4	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.052055	0.85682	D	0.000000	T	0.62672	0.2447	L	0.52011	1.625	0.80722	D	1	P;P	0.38827	0.649;0.649	P;P	0.44422	0.449;0.449	T	0.67043	-0.5770	10	0.87932	D	0	.	13.0112	0.58731	0.0:0.0:0.0:1.0	.	211;211	B7ZL90;Q9UK32	.;KS6A6_HUMAN	R	211	ENSP00000262752:H211R;ENSP00000440830:H211R	ENSP00000262752:H211R	H	-	2	0	RPS6KA6	83276460	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.331000	0.79192	1.437000	0.47472	0.425000	0.28330	CAT	.	.		0.229	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057372.1	NM_014496	
GPRASP2	114928	hgsc.bcm.edu	37	X	101970641	101970641	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:101970641T>C	ENST00000535209.1	+	4	1675	c.844T>C	c.(844-846)Tct>Cct	p.S282P	GPRASP2_ENST00000332262.5_Missense_Mutation_p.S282P|GPRASP2_ENST00000543253.1_Missense_Mutation_p.S282P			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	282						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGATTCCTGGTCTGGATCTGA	0.512																																					p.S282P		Atlas-SNP	.											.	GPRASP2	89	.	0			c.T844C						.						111.0	110.0	110.0					X																	101970641		2203	4300	6503	SO:0001583	missense	114928	exon4			TCCTGGTCTGGAT	AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.844T>C	chrX.hg19:g.101970641T>C	ENSP00000437394:p.Ser282Pro	95.0	0.0		100.0	4.0	NM_138437	D3DXA0|Q8NAB4	Missense_Mutation	SNP	ENST00000535209.1	hg19	CCDS14501.1	.	.	.	.	.	.	.	.	.	.	T	7.665	0.685835	0.14973	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.19105	2.17;2.17;2.17	4.1	4.1	0.47936	.	0.000000	0.45867	D	0.000323	T	0.20981	0.0505	L	0.52126	1.63	0.35730	D	0.817837	P	0.43094	0.799	P	0.46172	0.506	T	0.16247	-1.0409	10	0.25106	T	0.35	-15.3059	5.3771	0.16172	0.0:0.1241:0.0:0.8759	.	282	Q96D09	GASP2_HUMAN	P	282	ENSP00000437872:S282P;ENSP00000437394:S282P;ENSP00000339057:S282P	ENSP00000339057:S282P	S	+	1	0	GPRASP2	101857297	0.998000	0.40836	0.983000	0.44433	0.024000	0.10985	0.290000	0.18975	1.830000	0.53286	0.486000	0.48141	TCT	.	.		0.512	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057626.2	NM_138437	
TMEM164	84187	hgsc.bcm.edu	37	X	109247199	109247199	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:109247199A>G	ENST00000372073.1	+	2	533	c.197A>G	c.(196-198)gAg>gGg	p.E66G	TMEM164_ENST00000288381.4_Missense_Mutation_p.E66G|TMEM164_ENST00000372068.2_Missense_Mutation_p.E66G|TMEM164_ENST00000372072.3_Intron			Q5U3C3	TM164_HUMAN	transmembrane protein 164	66						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|large_intestine(5)|lung(6)|skin(1)	14						CAGACGAAGGAGGACGGTAGG	0.627																																					p.E66G		Atlas-SNP	.											.	TMEM164	59	.	0			c.A197G						.						64.0	60.0	61.0					X																	109247199		2203	4300	6503	SO:0001583	missense	84187	exon2			CGAAGGAGGACGG	AK094127	CCDS14550.2, CCDS55475.1	Xq22.3	2008-02-05			ENSG00000157600	ENSG00000157600			26217	protein-coding gene	gene with protein product						12477932	Standard	NM_032227		Approved	FLJ22679, RP13-360B22.2	uc004eom.3	Q5U3C3	OTTHUMG00000022192	ENST00000372073.1:c.197A>G	chrX.hg19:g.109247199A>G	ENSP00000361143:p.Glu66Gly	114.0	0.0		120.0	5.0	NM_032227	B3KSQ8|F5H2P2	Missense_Mutation	SNP	ENST00000372073.1	hg19	CCDS14550.2	.	.	.	.	.	.	.	.	.	.	a	8.567	0.879169	0.17395	.	.	ENSG00000157600	ENST00000372073;ENST00000372068;ENST00000288381;ENST00000501872	T;T;T	0.48201	0.85;0.85;0.82	4.32	4.32	0.51571	.	0.617074	0.16464	N	0.213279	T	0.30572	0.0769	L	0.29908	0.895	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.14727	-1.0462	10	0.26408	T	0.33	-6.4129	4.3317	0.11066	0.5128:0.16:0.0:0.3272	.	66;66	Q9H617;Q5U3C3	.;TM164_HUMAN	G	66	ENSP00000361143:E66G;ENSP00000361138:E66G;ENSP00000288381:E66G	ENSP00000288381:E66G	E	+	2	0	TMEM164	109133855	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.061000	0.64319	1.591000	0.50007	0.414000	0.27820	GAG	.	.		0.627	TMEM164-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057898.1	NM_032227	
PAK3	5063	hgsc.bcm.edu	37	X	110439078	110439078	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:110439078A>T	ENST00000372010.1	+	16	1606	c.1164A>T	c.(1162-1164)caA>caT	p.Q388H	PAK3_ENST00000262836.4_Missense_Mutation_p.Q388H|PAK3_ENST00000417227.1_Missense_Mutation_p.Q394H|PAK3_ENST00000425146.1_Missense_Mutation_p.Q373H|PAK3_ENST00000360648.4_Missense_Mutation_p.Q409H|PAK3_ENST00000372007.5_Missense_Mutation_p.Q373H|PAK3_ENST00000446737.1_Missense_Mutation_p.Q373H|PAK3_ENST00000519681.1_Missense_Mutation_p.Q394H|PAK3_ENST00000518291.1_Missense_Mutation_p.Q409H			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	388	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						AGTGCCTGCAAGCTTTGGATT	0.318										TSP Lung(19;0.15)																											p.Q409H		Atlas-SNP	.											.	PAK3	179	.	0			c.A1227T						.						106.0	103.0	104.0					X																	110439078		2203	4300	6503	SO:0001583	missense	5063	exon13			CCTGCAAGCTTTG	AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.1164A>T	chrX.hg19:g.110439078A>T	ENSP00000361080:p.Gln388His	46.0	0.0		58.0	49.0	NM_001128168	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	ENST00000372010.1	hg19	CCDS48153.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.472376	0.63737	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.15	3.96	0.45880	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.69433	0.3110	L	0.35723	1.085	0.80722	D	1	D;P;D;P;D	0.58268	0.978;0.901;0.982;0.901;0.982	P;P;P;P;P	0.62491	0.843;0.56;0.903;0.69;0.903	T	0.70332	-0.4901	10	0.51188	T	0.08	.	10.6458	0.45619	0.9195:0.0:0.0805:0.0	.	394;409;388;373;388	O75914-4;O75914-3;O75914;O75914-2;B1GX77	.;.;PAK3_HUMAN;.;.	H	373;373;388;394;373;409;409;394;388	ENSP00000410853:Q373H;ENSP00000401982:Q373H;ENSP00000361080:Q388H;ENSP00000429113:Q394H;ENSP00000361077:Q373H;ENSP00000428921:Q409H;ENSP00000353864:Q409H;ENSP00000389172:Q394H;ENSP00000262836:Q388H	ENSP00000262836:Q388H	Q	+	3	2	PAK3	110325734	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.052000	0.57420	1.823000	0.53134	0.486000	0.48141	CAA	.	.		0.318	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057918.1	NM_002578	
GRIA3	2892	hgsc.bcm.edu	37	X	122551504	122551504	+	Silent	SNP	A	A	G			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:122551504A>G	ENST00000371251.1	+	11	1804	c.1752A>G	c.(1750-1752)gaA>gaG	p.E584E	GRIA3_ENST00000541091.1_Silent_p.E568E|GRIA3_ENST00000264357.5_Silent_p.E584E|GRIA3_ENST00000542149.1_Silent_p.E584E|GRIA3_ENST00000371256.5_Silent_p.E584E			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	584					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GGCACTTGGAAGACAACAATG	0.423																																					p.E584E		Atlas-SNP	.											.	GRIA3	386	.	0			c.A1752G						.						256.0	230.0	239.0					X																	122551504		2203	4300	6503	SO:0001819	synonymous_variant	2892	exon11			CTTGGAAGACAAC	U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1752A>G	chrX.hg19:g.122551504A>G		103.0	0.0		97.0	4.0	NM_000828	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	ENST00000371251.1	hg19	CCDS14604.1																																																																																			.	.		0.423	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058854.1	NM_000828	
ARHGAP36	158763	hgsc.bcm.edu	37	X	130222734	130222734	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:130222734C>T	ENST00000276211.5	+	12	1964	c.1619C>T	c.(1618-1620)aCt>aTt	p.T540I	ARHGAP36_ENST00000370921.1_Missense_Mutation_p.T404I|ARHGAP36_ENST00000370922.1_Missense_Mutation_p.T528I	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	540					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						GAGGCCAAAACTGGCGTCAGC	0.542																																					p.T540I		Atlas-SNP	.											.	ARHGAP36	171	.	0			c.C1619T						.						85.0	79.0	81.0					X																	130222734		2203	4300	6503	SO:0001583	missense	158763	exon12			CCAAAACTGGCGT		CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.1619C>T	chrX.hg19:g.130222734C>T	ENSP00000276211:p.Thr540Ile	79.0	0.0		88.0	4.0	NM_144967	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Missense_Mutation	SNP	ENST00000276211.5	hg19	CCDS14628.1	.	.	.	.	.	.	.	.	.	.	C	10.16	1.273071	0.23221	.	.	ENSG00000147256	ENST00000276211;ENST00000370922;ENST00000412432;ENST00000370921	T;T;T;T	0.11604	2.76;2.78;2.78;2.77	4.31	3.43	0.39272	.	0.489143	0.17402	N	0.175495	T	0.05823	0.0152	N	0.08118	0	0.26772	N	0.969788	P;P;P	0.40431	0.717;0.717;0.594	B;B;B	0.40066	0.318;0.318;0.169	T	0.24225	-1.0166	10	0.40728	T	0.16	.	7.499	0.27507	0.0:0.8806:0.0:0.1194	.	509;528;540	Q6ZRI8-2;Q6ZRI8-4;Q6ZRI8	.;.;RHG36_HUMAN	I	540;528;509;404	ENSP00000276211:T540I;ENSP00000359960:T528I;ENSP00000408515:T509I;ENSP00000359959:T404I	ENSP00000276211:T540I	T	+	2	0	ARHGAP36	130050415	1.000000	0.71417	0.994000	0.49952	0.611000	0.37282	1.699000	0.37804	1.133000	0.42147	0.600000	0.82982	ACT	.	.		0.542	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355073.1	NM_144967	
RPL10	6134	hgsc.bcm.edu	37	X	153629200	153629200	+	3'UTR	SNP	T	T	C			TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chrX:153629200T>C	ENST00000369817.2	+	0	1226				RPL10_ENST00000406022.2_3'UTR|RPL10_ENST00000424325.2_3'UTR|SNORA70_ENST00000384436.1_RNA			P27635	RL10_HUMAN	ribosomal protein L10						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCATGAGGGCTTCCAATGTGC	0.522																																					p.F163L		Atlas-SNP	.											.	RPL10	22	.	0			c.T487C						.						10.0	11.0	11.0					X																	153629200		2129	4151	6280	SO:0001624	3_prime_UTR_variant	6134	exon6			GAGGGCTTCCAAT	AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.*5T>C	chrX.hg19:g.153629200T>C		82.0	0.0		100.0	5.0	NM_001256577	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Missense_Mutation	SNP	ENST00000369817.2	hg19	CCDS14746.1	.	.	.	.	.	.	.	.	.	.	T	13.76	2.334356	0.41297	.	.	ENSG00000147403	ENST00000458500	.	.	.	4.28	-0.582	0.11709	.	.	.	.	.	T	0.26011	0.0634	.	.	.	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.19976	-1.0289	7	0.44086	T	0.13	.	4.2354	0.10623	0.1824:0.4763:0.0:0.3412	.	163	A6QRI9	.	L	163	.	ENSP00000395025:F163L	F	+	1	0	RPL10	153282394	0.006000	0.16342	0.003000	0.11579	0.186000	0.23388	-0.226000	0.09139	-0.093000	0.12396	0.486000	0.48141	TTC	.	.		0.522	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000127774.5	NM_006013	
LATS1	9113	hgsc.bcm.edu	37	6	150001056	150001058	+	In_Frame_Del	DEL	AGA	AGA	-	rs56382749	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	AGA	AGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr6:150001056_150001058delAGA	ENST00000543571.1	-	5	3093_3095	c.2546_2548delTCT	c.(2545-2550)ctctgc>cgc	p.849_850LC>R	LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_In_Frame_Del_p.849_850LC>R	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		AAGCCAGTGCAGAGGCCAAAGTC	0.3																																					p.849_850del		Atlas-Indel,Pindel	.											.	LATS1	241	.	0			c.2547_2549del						.																																			SO:0001651	inframe_deletion	9113	exon5			.	AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.2546_2548delTCT	chr6.hg19:g.150001056_150001058delAGA	ENSP00000437550:p.Leu849_Cys850delinsArg	208.0	0.0		150.0	116.0	NM_004690		In_Frame_Del	DEL	ENST00000543571.1	hg19	CCDS34551.1																																																																																			.	.		0.300	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043923.4	NM_004690	
OPN4	94233	hgsc.bcm.edu	37	10	88421086	88421086	+	Frame_Shift_Del	DEL	C	C	-	rs192913605	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:88421086delC	ENST00000241891.5	+	7	1181	c.1014delC	c.(1012-1014)atcfs	p.I338fs	OPN4_ENST00000372071.2_Frame_Shift_Del_p.I349fs	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	338					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CAGCCGTCATCGCCAAGGCCT	0.587																																					p.I349fs		Atlas-INDEL	.											.	OPN4	61	.	0			c.1046delT						.						256.0	178.0	205.0					10																	88421086		2203	4300	6503	SO:0001589	frameshift_variant	94233	exon8			.	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1014delC	chr10.hg19:g.88421086delC	ENSP00000241891:p.Ile338fs	111.0	0.0		93.0	34.0	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Frame_Shift_Del	DEL	ENST00000241891.5	hg19	CCDS7376.1																																																																																			.	.		0.587	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
TRAK1	22906	hgsc.bcm.edu	37	3	42234621	42234660	+	Frame_Shift_Del	DEL	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	-	rs201576814	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	AAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr3:42234621_42234660delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	ENST00000327628.5	+	8	1224_1263	c.824_863delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	c.(823-864)gaagatgctgcccgccagcaagaggagatcacacacctgctafs	p.EDAARQQEEITHLL275fs	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000449246.1_Frame_Shift_Del_p.EDAARQQEEITHLL201fs|TRAK1_ENST00000396175.1_Frame_Shift_Del_p.EDAARQQEEITHLL217fs|TRAK1_ENST00000341421.3_Frame_Shift_Del_p.EDAARQQEEITHLL217fs	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	275	HAP1 N-terminal.				endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						AAGAAGACGGAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCTATCGCAAATA	0.475																																					p.275_288del	GBM(44;195 884 22595 31865 41850)	Pindel	.											.	TRAK1	188	.	0			c.823_862del						.																																			SO:0001589	frameshift_variant	22906	exon8			.		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.824_863delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	chr3.hg19:g.42234621_42234660delAAGATGCTGCCCGCCAGCAAGAGGAGATCACACACCTGCT	ENSP00000328998:p.Glu275fs	162.0	0.0		84.0	12.0	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Frame_Shift_Del	DEL	ENST00000327628.5	hg19	CCDS43072.1																																																																																			.	.		0.475	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
OPN4	94233	hgsc.bcm.edu	37	10	88421086	88421087	+	Frame_Shift_Del	DEL	CG	CG	-	rs192913605	byFrequency	TCGA-CC-A3MB-01A-11D-A20W-10	TCGA-CC-A3MB-10A-01D-A20W-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b81ffdd9-b1d2-409e-abbb-27eb123acb69	73e746f4-36ea-4aec-8af3-a825b5917e67	g.chr10:88421086_88421087delCG	ENST00000241891.5	+	7	1181_1182	c.1014_1015delCG	c.(1012-1017)atcgccfs	p.A339fs	OPN4_ENST00000372071.2_Frame_Shift_Del_p.A350fs	NM_033282.3	NP_150598.1	Q9UHM6	OPN4_HUMAN	opsin 4	339					phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|rhodopsin mediated signaling pathway (GO:0016056)|rhythmic process (GO:0048511)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	11-cis retinal binding (GO:0005502)|G-protein coupled photoreceptor activity (GO:0008020)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(5)|ovary(3)	18						CAGCCGTCATCGCCAAGGCCTC	0.589																																					p.349_349del		Pindel	.											.	OPN4	61	.	0			c.1046_1047del						.																																			SO:0001589	frameshift_variant	94233	exon8			.	AF147788	CCDS7376.1, CCDS31237.1	10q22	2012-08-08	2008-04-16		ENSG00000122375	ENSG00000122375		"""GPCR / Class A : Opsin receptors"""	14449	protein-coding gene	gene with protein product	"""melanopsin"""	606665	"""opsin 4 (melanopsin)"""			10632589	Standard	NM_001030015		Approved	MOP, melanopsin	uc001kdp.3	Q9UHM6	OTTHUMG00000018654	ENST00000241891.5:c.1014_1015delCG	chr10.hg19:g.88421086_88421087delCG	ENSP00000241891:p.Ala339fs	112.0	0.0		96.0	24.0	NM_001030015	B7ZLB3|Q14D01|Q2PP22|Q8NGQ9	Frame_Shift_Del	DEL	ENST00000241891.5	hg19	CCDS7376.1																																																																																			.	.		0.589	OPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049158.2	NM_033282	
