#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MTOR	2475	hgsc.bcm.edu	37	1	11298100	11298100	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:11298100C>G	ENST00000361445.4	-	13	2084	c.2008G>C	c.(2008-2010)Gac>Cac	p.D670H		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	670					cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	TAGCGAATGTCAGGGTCTGCA	0.552																																					p.D670H		Atlas-SNP	.											.	MTOR	327	.	0			c.G2008C						.						55.0	49.0	51.0					1																	11298100		2203	4300	6503	SO:0001583	missense	2475	exon13			GAATGTCAGGGTC	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.2008G>C	chr1.hg19:g.11298100C>G	ENSP00000354558:p.Asp670His	161.0	0.0		160.0	50.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	ENST00000361445.4	hg19	CCDS127.1	.	.	.	.	.	.	.	.	.	.	C	27.6	4.842137	0.91197	.	.	ENSG00000198793	ENST00000361445;ENST00000539766	T	0.32988	1.43	5.83	5.83	0.93111	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45074	0.1324	M	0.62209	1.925	0.80722	D	1	P	0.50617	0.937	P	0.49276	0.605	T	0.33727	-0.9857	10	0.56958	D	0.05	-4.7663	20.115	0.97926	0.0:1.0:0.0:0.0	.	670	P42345	MTOR_HUMAN	H	670	ENSP00000354558:D670H	ENSP00000354558:D670H	D	-	1	0	MTOR	11220687	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	7.456000	0.80751	2.761000	0.94854	0.650000	0.86243	GAC	.	.		0.552	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
PLEKHM2	23207	hgsc.bcm.edu	37	1	16060357	16060357	+	Silent	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:16060357C>T	ENST00000375799.3	+	20	3215	c.2988C>T	c.(2986-2988)agC>agT	p.S996S	RP11-288I21.1_ENST00000453804.1_RNA|PLEKHM2_ENST00000375793.2_Silent_p.S976S|PLEKHM2_ENST00000477849.1_3'UTR|SLC25A34_ENST00000294454.5_5'Flank	NM_015164.2	NP_055979.2	Q8IWE5	PKHM2_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 2	996					Golgi organization (GO:0007030)	cytoplasm (GO:0005737)	kinesin binding (GO:0019894)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000259)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00057)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ATGCCTTGAGCCTCATCCACA	0.647																																					p.S996S		Atlas-SNP	.											.	PLEKHM2	94	.	0			c.C2988T						.						60.0	70.0	67.0					1																	16060357		2082	4203	6285	SO:0001819	synonymous_variant	23207	exon20			CTTGAGCCTCATC	AB020649	CCDS44063.1	1p36.13	2013-01-10			ENSG00000116786	ENSG00000116786		"""Pleckstrin homology (PH) domain containing"""	29131	protein-coding gene	gene with protein product		609613				10048485	Standard	NM_015164		Approved	KIAA0842	uc010obo.2	Q8IWE5	OTTHUMG00000003062	ENST00000375799.3:c.2988C>T	chr1.hg19:g.16060357C>T		265.0	0.0		182.0	50.0	NM_015164	O94928|Q5VT65|Q6NUH9|Q7L8G1|Q8IVT7|Q8N2T4|Q96AY0|Q9NTF7	Silent	SNP	ENST00000375799.3	hg19	CCDS44063.1																																																																																			.	.		0.647	PLEKHM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008463.1	NM_015164	
KIRREL	55243	hgsc.bcm.edu	37	1	158059547	158059547	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:158059547T>C	ENST00000359209.6	+	10	1278	c.1211T>C	c.(1210-1212)gTg>gCg	p.V404A	KIRREL_ENST00000360089.4_Missense_Mutation_p.V240A|KIRREL_ENST00000368173.3_Missense_Mutation_p.V420A|KIRREL_ENST00000392272.2_Missense_Mutation_p.V301A|KIRREL_ENST00000368172.1_Missense_Mutation_p.V218A|KIRREL_ENST00000416935.2_Missense_Mutation_p.V304A			Q96J84	KIRR1_HUMAN	kin of IRRE like (Drosophila)	404	Ig-like C2-type 5.				excretion (GO:0007588)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of actin filament polymerization (GO:0030838)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|dendritic shaft (GO:0043198)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	myosin binding (GO:0017022)			NS(1)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|prostate(5)|skin(3)|stomach(1)	38	all_hematologic(112;0.0378)					CAGTATGCTGTGAGGGGTGAC	0.602																																					p.V404A		Atlas-SNP	.											.	KIRREL	346	.	0			c.T1211C						.						148.0	132.0	137.0					1																	158059547		2203	4300	6503	SO:0001583	missense	55243	exon10			ATGCTGTGAGGGG	AK001707	CCDS1172.2, CCDS72952.1	1q21-q25	2013-01-29			ENSG00000183853	ENSG00000183853		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15734	protein-coding gene	gene with protein product	"""nephrin-like protein 1"""	607428				12424224	Standard	NM_001286349		Approved	NEPH1	uc001frn.4	Q96J84	OTTHUMG00000022438	ENST00000359209.6:c.1211T>C	chr1.hg19:g.158059547T>C	ENSP00000352138:p.Val404Ala	187.0	0.0		228.0	43.0	NM_018240	Q5W0F8|Q5XKC6|Q7Z696|Q7Z7N8|Q8TB15|Q9H9N1|Q9NVA5	Missense_Mutation	SNP	ENST00000359209.6	hg19	CCDS1172.2	.	.	.	.	.	.	.	.	.	.	T	12.66	2.003914	0.35320	.	.	ENSG00000183853	ENST00000360089;ENST00000368173;ENST00000392272;ENST00000359209;ENST00000416935;ENST00000368172	T;T;T;T;T;T	0.03004	4.08;4.08;4.08;4.08;4.08;4.08	5.28	5.28	0.74379	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.775469	0.10417	N	0.677174	T	0.00998	0.0033	N	0.16368	0.405	0.50171	D	0.999853	B;B;B;B	0.11235	0.0;0.004;0.0;0.003	B;B;B;B	0.13407	0.005;0.009;0.002;0.007	T	0.49418	-0.8942	10	0.16420	T	0.52	-8.7755	7.8514	0.29457	0.0:0.0934:0.0:0.9066	.	304;240;218;404	B4DN67;Q5W0F9;Q5W0G0;Q96J84	.;.;.;KIRR1_HUMAN	A	240;420;301;404;304;218	ENSP00000353202:V240A;ENSP00000357155:V420A;ENSP00000376098:V301A;ENSP00000352138:V404A;ENSP00000389674:V304A;ENSP00000357154:V218A	ENSP00000352138:V404A	V	+	2	0	KIRREL	156326171	0.884000	0.30299	0.645000	0.29479	0.521000	0.34408	2.182000	0.42556	1.992000	0.58205	0.377000	0.23210	GTG	.	.		0.602	KIRREL-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000058342.3	NM_018240	
CACNA1E	777	hgsc.bcm.edu	37	1	181767459	181767459	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:181767459C>T	ENST00000367573.2	+	48	6431	c.6431C>T	c.(6430-6432)cCc>cTc	p.P2144L	CACNA1E_ENST00000367567.4_Missense_Mutation_p.P1708L|CACNA1E_ENST00000360108.3_Missense_Mutation_p.P2125L|CACNA1E_ENST00000367570.1_Missense_Mutation_p.P2101L|CACNA1E_ENST00000357570.5_Missense_Mutation_p.P2095L|CACNA1E_ENST00000358338.5_Missense_Mutation_p.P2033L|CACNA1E_ENST00000526775.1_Missense_Mutation_p.P2082L	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2144					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGCTCCATCCCCTCTGTCTCT	0.567																																					p.P2144L		Atlas-SNP	.											.	CACNA1E	778	.	0			c.C6431T						.						125.0	135.0	131.0					1																	181767459		2024	4178	6202	SO:0001583	missense	777	exon48			CCATCCCCTCTGT	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6431C>T	chr1.hg19:g.181767459C>T	ENSP00000356545:p.Pro2144Leu	24.0	0.0		34.0	6.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	12.42	1.932592	0.34096	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96136	-3.85;-3.84;-3.8;-3.84;-3.92;-3.8;-3.8	5.59	4.68	0.58851	.	0.421997	0.27659	N	0.018397	D	0.92838	0.7722	N	0.19112	0.55	0.58432	D	0.999997	D;B	0.56035	0.974;0.002	P;B	0.56343	0.796;0.003	D	0.89826	0.3992	10	0.05525	T	0.97	.	14.2396	0.65948	0.0:0.9277:0.0:0.0723	.	2082;2101	Q15878-2;Q15878-3	.;.	L	2101;2082;2095;2033;1708;2125;2144	ENSP00000356542:P2101L;ENSP00000434814:P2082L;ENSP00000350183:P2095L;ENSP00000351101:P2033L;ENSP00000356539:P1708L;ENSP00000353222:P2125L;ENSP00000356545:P2144L	ENSP00000350183:P2095L	P	+	2	0	CACNA1E	180034082	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.560000	0.53763	1.358000	0.45922	0.563000	0.77884	CCC	.	.		0.567	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
HMCN1	83872	hgsc.bcm.edu	37	1	185992215	185992215	+	Silent	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:185992215T>C	ENST00000271588.4	+	36	5908	c.5679T>C	c.(5677-5679)gcT>gcC	p.A1893A	HMCN1_ENST00000367492.2_Silent_p.A1893A	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	1893	Ig-like C2-type 16.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						TGGAAGATGCTGGCAGATACA	0.413																																					p.A1893A		Atlas-SNP	.											.	HMCN1	797	.	0			c.T5679C						.						127.0	124.0	125.0					1																	185992215		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon36			AGATGCTGGCAGA	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.5679T>C	chr1.hg19:g.185992215T>C		142.0	0.0		150.0	28.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.413	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
SERTAD4	56256	hgsc.bcm.edu	37	1	210412936	210412936	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:210412936A>T	ENST00000367012.3	+	3	504	c.274A>T	c.(274-276)Agc>Tgc	p.S92C	SERTAD4_ENST00000490620.1_3'UTR	NM_019605.3	NP_062551.1	Q9NUC0	SRTD4_HUMAN	SERTA domain containing 4	92						nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(81;0.0237)|all cancers(67;0.127)		CCCACCACTCAGCAGCTGTAG	0.338																																					p.S92C		Atlas-SNP	.											.	SERTAD4	53	.	0			c.A274T						.						77.0	85.0	82.0					1																	210412936		2203	4300	6503	SO:0001583	missense	56256	exon3			CCACTCAGCAGCT	BC012083	CCDS1494.1	1q32.1-q41	2008-02-05			ENSG00000082497	ENSG00000082497			25236	protein-coding gene	gene with protein product						12477932	Standard	NM_019605		Approved	DJ667H12.2	uc001hhy.3	Q9NUC0	OTTHUMG00000036391	ENST00000367012.3:c.274A>T	chr1.hg19:g.210412936A>T	ENSP00000355979:p.Ser92Cys	140.0	0.0		186.0	65.0	NM_019605	B2RD32	Missense_Mutation	SNP	ENST00000367012.3	hg19	CCDS1494.1	.	.	.	.	.	.	.	.	.	.	a	14.43	2.534486	0.45073	.	.	ENSG00000082497	ENST00000367012	.	.	.	6.16	5.04	0.67666	.	0.193616	0.51477	D	0.000099	T	0.40094	0.1103	N	0.17082	0.46	0.31297	N	0.688734	D	0.63046	0.992	P	0.54401	0.751	T	0.50118	-0.8865	9	0.72032	D	0.01	-24.4619	12.0816	0.53673	0.9336:0.0:0.0664:0.0	.	92	Q9NUC0	SRTD4_HUMAN	C	92	.	ENSP00000355979:S92C	S	+	1	0	SERTAD4	208479559	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.314000	0.43743	1.158000	0.42547	0.529000	0.55759	AGC	.	.		0.338	SERTAD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088577.1	NM_019605	
DISP1	84976	hgsc.bcm.edu	37	1	223176572	223176572	+	Silent	SNP	C	C	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr1:223176572C>A	ENST00000284476.6	+	8	1997	c.1833C>A	c.(1831-1833)acC>acA	p.T611T		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	611	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TGTTCGTCACCAGTTTTACCA	0.448																																					p.T611T		Atlas-SNP	.											.	DISP1	145	.	0			c.C1833A						.						144.0	133.0	137.0					1																	223176572		2203	4300	6503	SO:0001819	synonymous_variant	84976	exon10			CGTCACCAGTTTT	AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.1833C>A	chr1.hg19:g.223176572C>A		150.0	0.0		177.0	14.0	NM_032890	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Silent	SNP	ENST00000284476.6	hg19	CCDS1536.1																																																																																			.	.		0.448	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092512.1	NM_032890	
PLB1	151056	hgsc.bcm.edu	37	2	28761221	28761221	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr2:28761221G>A	ENST00000327757.5	+	10	635	c.591G>A	c.(589-591)atG>atA	p.M197I	PLB1_ENST00000422425.2_Missense_Mutation_p.M208I	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	197	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					ATGAGCTGATGGGGGTGCTGG	0.662																																					p.M208I		Atlas-SNP	.											.	PLB1	255	.	0			c.G624A						.						43.0	41.0	42.0					2																	28761221		2203	4300	6503	SO:0001583	missense	151056	exon10			GCTGATGGGGGTG		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.591G>A	chr2.hg19:g.28761221G>A	ENSP00000330442:p.Met197Ile	42.0	0.0		33.0	13.0	NM_001170585	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	hg19	CCDS33168.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.589|8.589	0.884032|0.884032	0.17467|0.17467	.|.	.|.	ENSG00000163803|ENSG00000163803	ENST00000416713;ENST00000327757;ENST00000422425|ENST00000404858	T;T;T|.	0.21932|.	1.98;2.82;2.83|.	5.0|5.0	-9.99|-9.99	0.00435|0.00435	.|.	1.745490|.	0.03019|.	N|.	0.150533|.	T|.	0.11110|.	0.0271|.	N|N	0.04508|0.04508	-0.205|-0.205	0.09310|0.09310	N|N	1|1	B;B|.	0.09022|.	0.002;0.0|.	B;B|.	0.08055|.	0.003;0.0|.	T|.	0.10132|.	-1.0643|.	10|.	0.19147|.	T|.	0.46|.	-0.5139|-0.5139	4.4555|4.4555	0.11642|0.11642	0.2273:0.2661:0.4257:0.0809|0.2273:0.2661:0.4257:0.0809	.|.	208;197|.	Q6P1J6-3;Q6P1J6|.	.;PLB1_HUMAN|.	I|X	152;197;208|207	ENSP00000407076:M152I;ENSP00000330442:M197I;ENSP00000416440:M208I|.	ENSP00000330442:M197I|.	M|W	+|+	3|2	0|0	PLB1|PLB1	28614725|28614725	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.191000|0.191000	0.23601|0.23601	-6.157000|-6.157000	0.00078|0.00078	-4.322000|-4.322000	0.00056|0.00056	0.491000|0.491000	0.48974|0.48974	ATG|TGG	.	.		0.662	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
MBD5	55777	hgsc.bcm.edu	37	2	149226010	149226010	+	Silent	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr2:149226010T>C	ENST00000407073.1	+	9	1495	c.498T>C	c.(496-498)aaT>aaC	p.N166N	MBD5_ENST00000404807.1_Silent_p.N166N	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	166					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		AATGTAAGAATCCTTTCAAGT	0.423																																					p.N166N		Atlas-SNP	.											.	MBD5	164	.	0			c.T498C						.						62.0	60.0	60.0					2																	149226010		2203	4300	6503	SO:0001819	synonymous_variant	55777	exon9			TAAGAATCCTTTC	AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.498T>C	chr2.hg19:g.149226010T>C		105.0	0.0		131.0	9.0	NM_018328	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Silent	SNP	ENST00000407073.1	hg19	CCDS33302.1																																																																																			.	.		0.423	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318111.2		
DNAH7	56171	hgsc.bcm.edu	37	2	196759699	196759699	+	Splice_Site	SNP	C	C	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr2:196759699C>A	ENST00000312428.6	-	30	4997		c.e30+1			NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7						cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AATATACTTGCCTTTTCACAT	0.313																																					.		Atlas-SNP	.											.	DNAH7	512	.	0			c.4896+1G>T						.						57.0	53.0	54.0					2																	196759699		1836	4072	5908	SO:0001630	splice_region_variant	56171	exon31			TACTTGCCTTTTC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.4896+1G>T	chr2.hg19:g.196759699C>A		195.0	0.0		205.0	46.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Splice_Site	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	C	19.16	3.773716	0.69992	.	.	ENSG00000118997	ENST00000312428	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9814	0.92756	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAH7	196467944	1.000000	0.71417	0.978000	0.43139	0.875000	0.50365	3.111000	0.50360	2.826000	0.97356	0.655000	0.94253	.	.	.		0.313	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	Intron
UNC80	285175	hgsc.bcm.edu	37	2	210680056	210680056	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr2:210680056C>A	ENST00000439458.1	+	9	1356	c.1276C>A	c.(1276-1278)Ctg>Atg	p.L426M	UNC80_ENST00000272845.6_Missense_Mutation_p.L426M	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	426					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ACTGACCAATCTGCGTAGATC	0.388																																					p.L426M		Atlas-SNP	.											.	UNC80	280	.	0			c.C1276A						.						145.0	114.0	123.0					2																	210680056		692	1591	2283	SO:0001583	missense	285175	exon9			ACCAATCTGCGTA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1276C>A	chr2.hg19:g.210680056C>A	ENSP00000391088:p.Leu426Met	50.0	0.0		91.0	12.0	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	C	17.85	3.489202	0.64074	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.37752	1.18;1.18	5.21	1.13	0.20643	.	.	.	.	.	T	0.38532	0.1044	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	D	0.65010	0.931	T	0.08848	-1.0702	9	0.40728	T	0.16	.	9.9167	0.41439	0.0:0.6133:0.0:0.3867	.	426	Q8N2C7	UNC80_HUMAN	M	426	ENSP00000391088:L426M;ENSP00000272845:L426M	ENSP00000272845:L426M	L	+	1	2	UNC80	210388301	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	2.040000	0.41203	0.356000	0.24157	0.585000	0.79938	CTG	.	.		0.388	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
SLC25A38	54977	hgsc.bcm.edu	37	3	39433444	39433444	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr3:39433444T>G	ENST00000273158.4	+	5	934	c.557T>G	c.(556-558)cTt>cGt	p.L186R		NM_017875.2	NP_060345.2			solute carrier family 25, member 38											breast(1)|endometrium(1)|large_intestine(1)|lung(6)|skin(1)|stomach(1)	11				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		GCAACTCTCCTTCGAGATGCG	0.502																																					p.L186R		Atlas-SNP	.											.	SLC25A38	25	.	0			c.T557G						.						89.0	91.0	90.0					3																	39433444		2203	4300	6503	SO:0001583	missense	54977	exon5			CTCTCCTTCGAGA	BC013194	CCDS2685.1	3p22.1	2013-05-22			ENSG00000144659	ENSG00000144659		"""Solute carriers"""	26054	protein-coding gene	gene with protein product		610819				16949250	Standard	NM_017875		Approved	FLJ20551	uc003cjo.2	Q96DW6	OTTHUMG00000131289	ENST00000273158.4:c.557T>G	chr3.hg19:g.39433444T>G	ENSP00000273158:p.Leu186Arg	156.0	0.0		184.0	31.0	NM_017875		Missense_Mutation	SNP	ENST00000273158.4	hg19	CCDS2685.1	.	.	.	.	.	.	.	.	.	.	t	21.6	4.171309	0.78452	.	.	ENSG00000144659	ENST00000273158	D	0.81821	-1.54	4.89	4.89	0.63831	Mitochondrial carrier domain (2);	0.062472	0.64402	D	0.000003	D	0.93028	0.7781	H	0.98111	4.15	0.58432	D	0.999998	D	0.89917	1.0	D	0.77004	0.989	D	0.94775	0.7948	10	0.62326	D	0.03	-17.5579	12.7386	0.57239	0.0:0.0:0.0:1.0	.	186	Q96DW6	S2538_HUMAN	R	186	ENSP00000273158:L186R	ENSP00000273158:L186R	L	+	2	0	SLC25A38	39408448	1.000000	0.71417	0.814000	0.32528	0.993000	0.82548	5.929000	0.70096	1.950000	0.56595	0.455000	0.32223	CTT	.	.		0.502	SLC25A38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254057.3	NM_017875	
CFAP44	55779	hgsc.bcm.edu	37	3	113092280	113092280	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr3:113092280G>A	ENST00000295868.2	-	18	2584	c.2422C>T	c.(2422-2424)Ccc>Tcc	p.P808S	WDR52_ENST00000393845.2_Missense_Mutation_p.P808S	NM_018338.3	NP_060808.2														breast(2)|central_nervous_system(3)|endometrium(3)|kidney(5)|large_intestine(7)|lung(26)|prostate(1)|urinary_tract(2)	49						GTTTGGATGGGATTGTCCTCT	0.368																																					p.P808S		Atlas-SNP	.											.	WDR52	151	.	0			c.C2422T						.						149.0	140.0	143.0					3																	113092280		2203	4300	6503	SO:0001583	missense	55779	exon18			GGATGGGATTGTC																												ENST00000295868.2:c.2422C>T	chr3.hg19:g.113092280G>A	ENSP00000295868:p.Pro808Ser	99.0	0.0		89.0	9.0	NM_001164496		Missense_Mutation	SNP	ENST00000295868.2	hg19	CCDS2972.1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010923	0.54361	.	.	ENSG00000206530	ENST00000393845;ENST00000295868	T;T	0.17528	2.27;2.27	5.39	4.51	0.55191	WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.26557	0.0649	L	0.34521	1.04	0.80722	D	1	D	0.71674	0.998	P	0.58820	0.846	T	0.02075	-1.1218	9	0.66056	D	0.02	.	13.865	0.63583	0.0:0.0:0.8471:0.1529	.	808	Q96MT7	WDR52_HUMAN	S	808	ENSP00000377428:P808S;ENSP00000295868:P808S	ENSP00000295868:P808S	P	-	1	0	WDR52	114574970	1.000000	0.71417	0.987000	0.45799	0.329000	0.28539	5.696000	0.68287	1.403000	0.46800	0.655000	0.94253	CCC	.	.		0.368	WDR52-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354128.3		
MRPL3	11222	hgsc.bcm.edu	37	3	131208896	131208896	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr3:131208896C>T	ENST00000264995.3	-	5	644	c.497G>A	c.(496-498)cGg>cAg	p.R166Q	MRPL3_ENST00000506946.1_5'UTR|MRPL3_ENST00000425847.2_Missense_Mutation_p.R193Q	NM_007208.3	NP_009139.1	P09001	RM03_HUMAN	mitochondrial ribosomal protein L3	166					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TCCAAGTTCCCGGTAAAATTC	0.363																																					p.R166Q		Atlas-SNP	.											MRPL3,right_upper_lobe,carcinoma,0,1	MRPL3	32	.	0			c.G497A						.						65.0	64.0	64.0					3																	131208896		2203	4300	6503	SO:0001583	missense	11222	exon5			AGTTCCCGGTAAA	X06323	CCDS3071.1	3q21-q23	2012-09-13			ENSG00000114686	ENSG00000114686		"""Mitochondrial ribosomal proteins / large subunits"""	10379	protein-coding gene	gene with protein product		607118		RPML3		2891103	Standard	NM_007208		Approved	MRL3	uc003eoh.3	P09001	OTTHUMG00000159607	ENST00000264995.3:c.497G>A	chr3.hg19:g.131208896C>T	ENSP00000264995:p.Arg166Gln	42.0	0.0		64.0	12.0	NM_007208	Q6IBT2	Missense_Mutation	SNP	ENST00000264995.3	hg19	CCDS3071.1	.	.	.	.	.	.	.	.	.	.	C	13.21	2.167846	0.38315	.	.	ENSG00000114686	ENST00000264995;ENST00000425847;ENST00000507669;ENST00000512877	T;T;T;T	0.42513	2.13;2.13;2.13;0.97	5.31	-0.531	0.11894	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.446138	0.24691	N	0.036387	T	0.28732	0.0712	L	0.31845	0.965	0.40319	D	0.978802	B;B	0.17667	0.012;0.023	B;B	0.17979	0.02;0.012	T	0.09796	-1.0658	10	0.23302	T	0.38	-0.0849	12.5056	0.55979	0.0:0.7842:0.0:0.2158	.	193;166	E7ETU7;P09001	.;RM03_HUMAN	Q	166;193;61;133	ENSP00000264995:R166Q;ENSP00000398536:R193Q;ENSP00000422419:R61Q;ENSP00000422035:R133Q	ENSP00000264995:R166Q	R	-	2	0	MRPL3	132691586	0.823000	0.29233	0.987000	0.45799	0.926000	0.56050	-0.104000	0.10923	-0.405000	0.07599	0.462000	0.41574	CGG	.	.		0.363	MRPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356471.3	NM_007208	
EPHA5	2044	hgsc.bcm.edu	37	4	66467871	66467871	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr4:66467871G>A	ENST00000273854.3	-	3	998	c.398C>T	c.(397-399)aCc>aTc	p.T133I	EPHA5_ENST00000432638.2_Missense_Mutation_p.T133I|EPHA5_ENST00000354839.4_Missense_Mutation_p.T133I|EPHA5_ENST00000511294.1_Missense_Mutation_p.T133I	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	133	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						GTCCCGCAGGGTAAATTTGAG	0.428										TSP Lung(17;0.13)																											p.T133I		Atlas-SNP	.											.	EPHA5	315	.	0			c.C398T						.						82.0	86.0	85.0					4																	66467871		2203	4300	6503	SO:0001583	missense	2044	exon3			CGCAGGGTAAATT	L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.398C>T	chr4.hg19:g.66467871G>A	ENSP00000273854:p.Thr133Ile	43.0	0.0		41.0	7.0	NM_004439	Q7Z3F2	Missense_Mutation	SNP	ENST00000273854.3	hg19	CCDS3513.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117328	0.77323	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.12672	2.66;2.66;2.66;2.66	5.67	5.67	0.87782	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.64402	D	0.000005	T	0.45637	0.1352	M	0.86097	2.795	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.97110	1.0;0.992;0.999;0.996	T	0.48410	-0.9038	10	0.87932	D	0	.	19.7625	0.96325	0.0:0.0:1.0:0.0	.	133;133;133;133	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	I	133	ENSP00000273854:T133I;ENSP00000389208:T133I;ENSP00000346899:T133I;ENSP00000427638:T133I	ENSP00000273854:T133I	T	-	2	0	EPHA5	66150466	1.000000	0.71417	0.996000	0.52242	0.791000	0.44710	9.869000	0.99810	2.677000	0.91161	0.650000	0.86243	ACC	.	.		0.428	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251388.2	NM_004439	
ATOH1	474	hgsc.bcm.edu	37	4	94750441	94750441	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr4:94750441G>T	ENST00000306011.3	+	1	400	c.364G>T	c.(364-366)Gtg>Ttg	p.V122L		NM_005172.1	NP_005163.1	Q92858	ATOH1_HUMAN	atonal homolog 1 (Drosophila)	122					auditory receptor cell fate determination (GO:0042668)|auditory receptor cell fate specification (GO:0042667)|axon guidance (GO:0007411)|central nervous system development (GO:0007417)|cerebral cortex development (GO:0021987)|inner ear morphogenesis (GO:0042472)|negative regulation of apoptotic process (GO:0043066)|neuron migration (GO:0001764)|positive regulation of auditory receptor cell differentiation (GO:0045609)|positive regulation of neuron differentiation (GO:0045666)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;3.57e-07)		CCCCGGGCCGGTGAAAGTGCG	0.692																																					p.V122L		Atlas-SNP	.											.	ATOH1	40	.	0			c.G364T						.						21.0	31.0	27.0					4																	94750441		2202	4299	6501	SO:0001583	missense	474	exon1			GGGCCGGTGAAAG	U61148	CCDS3638.1	4q22	2013-05-21			ENSG00000172238	ENSG00000172238		"""Basic helix-loop-helix proteins"""	797	protein-coding gene	gene with protein product		601461				8872459	Standard	NM_005172		Approved	HATH1, MATH-1, Math1, bHLHa14	uc003hta.1	Q92858	OTTHUMG00000130972	ENST00000306011.3:c.364G>T	chr4.hg19:g.94750441G>T	ENSP00000302216:p.Val122Leu	132.0	0.0		110.0	12.0	NM_005172	Q14CT9	Missense_Mutation	SNP	ENST00000306011.3	hg19	CCDS3638.1	.	.	.	.	.	.	.	.	.	.	G	3.285	-0.146188	0.06627	.	.	ENSG00000172238	ENST00000306011	D	0.97328	-4.34	4.2	3.33	0.38152	.	0.281352	0.30473	N	0.009548	D	0.89808	0.6822	N	0.14661	0.345	0.26559	N	0.973771	B	0.09022	0.002	B	0.04013	0.001	T	0.77135	-0.2699	10	0.09843	T	0.71	-16.6657	6.6623	0.23020	0.2122:0.0:0.7878:0.0	.	122	Q92858	ATOH1_HUMAN	L	122	ENSP00000302216:V122L	ENSP00000302216:V122L	V	+	1	0	ATOH1	94969464	0.976000	0.34144	0.770000	0.31555	0.111000	0.19643	2.238000	0.43070	2.161000	0.67846	0.549000	0.68633	GTG	.	.		0.692	ATOH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253585.1	NM_005172	
ANKRD34B	340120	hgsc.bcm.edu	37	5	79855469	79855469	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr5:79855469A>G	ENST00000338682.3	-	5	1042	c.370T>C	c.(370-372)Tat>Cat	p.Y124H		NM_001004441.2	NP_001004441.2	A5PLL1	AN34B_HUMAN	ankyrin repeat domain 34B	124						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	28		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;2.17e-46)|Epithelial(54;5.64e-41)|all cancers(79;3.24e-36)		TTTATAGCATAAACAAGAGCT	0.443																																					p.Y124H		Atlas-SNP	.											.	ANKRD34B	61	.	0			c.T370C						.						125.0	127.0	126.0					5																	79855469		2203	4300	6503	SO:0001583	missense	340120	exon5			TAGCATAAACAAG		CCDS34194.1	5q14.1	2014-08-12			ENSG00000189127	ENSG00000189127		"""Ankyrin repeat domain containing"""	33736	protein-coding gene	gene with protein product							Standard	NM_001004441		Approved	DP58	uc003kgw.3	A5PLL1	OTTHUMG00000162541	ENST00000338682.3:c.370T>C	chr5.hg19:g.79855469A>G	ENSP00000339802:p.Tyr124His	145.0	0.0		128.0	33.0	NM_001004441	B2RPH1|Q68D79	Missense_Mutation	SNP	ENST00000338682.3	hg19	CCDS34194.1	.	.	.	.	.	.	.	.	.	.	A	13.18	2.159369	0.38119	.	.	ENSG00000189127	ENST00000338682	T	0.35605	1.3	6.03	4.88	0.63580	Ankyrin repeat-containing domain (3);	0.000000	0.64402	U	0.000002	T	0.35913	0.0948	L	0.48877	1.53	0.58432	D	0.999992	P	0.48350	0.909	P	0.47015	0.534	T	0.05716	-1.0868	10	0.25106	T	0.35	-8.9732	10.9227	0.47174	0.9268:0.0:0.0732:0.0	.	124	A5PLL1	AN34B_HUMAN	H	124	ENSP00000339802:Y124H	ENSP00000339802:Y124H	Y	-	1	0	ANKRD34B	79891225	1.000000	0.71417	0.844000	0.33320	0.856000	0.48823	6.231000	0.72307	1.109000	0.41680	0.533000	0.62120	TAT	.	.		0.443	ANKRD34B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369475.1	NM_001004441	
TRIM36	55521	hgsc.bcm.edu	37	5	114462308	114462308	+	Silent	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr5:114462308C>T	ENST00000282369.3	-	10	2200	c.2079G>A	c.(2077-2079)gtG>gtA	p.V693V	TRIM36_ENST00000513154.1_Silent_p.V681V|TRIM36_ENST00000514154.1_Silent_p.V538V	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	693	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		GTGAACAGTCCACTTGGCGTT	0.408																																					p.V693V		Atlas-SNP	.											.	TRIM36	126	.	0			c.G2079A						.						112.0	100.0	104.0					5																	114462308		2202	4300	6502	SO:0001819	synonymous_variant	55521	exon10			ACAGTCCACTTGG	AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.2079G>A	chr5.hg19:g.114462308C>T		120.0	0.0		129.0	31.0	NM_018700	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Silent	SNP	ENST00000282369.3	hg19	CCDS4115.1																																																																																			.	.		0.408	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250854.2	NM_018700	
REEP2	51308	hgsc.bcm.edu	37	5	137780443	137780443	+	Splice_Site	SNP	G	G	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr5:137780443G>C	ENST00000254901.5	+	5	426	c.304G>C	c.(304-306)Gag>Cag	p.E102Q	REEP2_ENST00000378339.2_Splice_Site_p.E102Q|REEP2_ENST00000506158.1_Splice_Site_p.E64Q	NM_016606.2	NP_057690.2	Q9BRK0	REEP2_HUMAN	receptor accessory protein 2	102					cell death (GO:0008219)|endoplasmic reticulum tubular network organization (GO:0071786)|protein transport into membrane raft (GO:0032596)|regulation of intracellular transport (GO:0032386)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			AATCCCATAGGAGATCGACGA	0.622																																					p.E102Q		Atlas-SNP	.											.	REEP2	21	.	0			c.G304C						.						72.0	59.0	64.0					5																	137780443		2203	4300	6503	SO:0001630	splice_region_variant	51308	exon5			CCATAGGAGATCG	AK056193	CCDS4205.1, CCDS64259.1	5q31	2014-03-12	2006-02-07	2006-02-07	ENSG00000132563	ENSG00000132563		"""Receptor accessory proteins"""	17975	protein-coding gene	gene with protein product		609347	"""chromosome 5 open reading frame 19"""	C5orf19		16271481, 15550249, 24388663	Standard	NM_016606		Approved	SGC32445, SPG72	uc003lda.4	Q9BRK0	OTTHUMG00000129205	ENST00000254901.5:c.304-1G>C	chr5.hg19:g.137780443G>C		121.0	0.0		109.0	24.0	NM_016606	Q53EM8|Q9NYF2	Missense_Mutation	SNP	ENST00000254901.5	hg19	CCDS4205.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.38|18.38	3.612242|3.612242	0.66672|0.66672	.|.	.|.	ENSG00000132563|ENSG00000132563	ENST00000378339;ENST00000254901;ENST00000506158|ENST00000512126	D;D;D|.	0.89415|.	-2.51;-2.49;-1.68|.	5.13|5.13	5.13|5.13	0.70059|0.70059	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.78097|0.78097	0.4230|0.4230	M|M	0.81614|0.81614	2.55|2.55	0.80722|0.80722	D|D	1|1	P;D|.	0.56968|.	0.94;0.978|.	P;P|.	0.60949|.	0.77;0.881|.	T|T	0.79045|0.79045	-0.1964|-0.1964	9|5	.|.	.|.	.|.	-4.6113|-4.6113	17.4888|17.4888	0.87696|0.87696	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	102;102|.	A8K3D2;Q9BRK0|.	.;REEP2_HUMAN|.	Q|S	102;102;64|139	ENSP00000367590:E102Q;ENSP00000254901:E102Q;ENSP00000422530:E64Q|.	.|.	E|R	+|+	1|3	0|2	REEP2|REEP2	137808342|137808342	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.047000|0.047000	0.14425|0.14425	9.527000|9.527000	0.98044|0.98044	2.674000|2.674000	0.91012|0.91012	0.655000|0.655000	0.94253|0.94253	GAG|AGG	.	.		0.622	REEP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251284.1	NM_016606	Missense_Mutation
EDN1	1906	hgsc.bcm.edu	37	6	12294540	12294540	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr6:12294540A>G	ENST00000379375.5	+	4	703	c.436A>G	c.(436-438)Aaa>Gaa	p.K146E		NM_001168319.1|NM_001955.4	NP_001161791.1|NP_001946.3	P05305	EDN1_HUMAN	endothelin 1	146					artery smooth muscle contraction (GO:0014824)|body fluid secretion (GO:0007589)|calcium-mediated signaling (GO:0019722)|cartilage development (GO:0051216)|cell growth (GO:0016049)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|dorsal/ventral pattern formation (GO:0009953)|epithelial fluid transport (GO:0042045)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose transport (GO:0015758)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|inositol phosphate-mediated signaling (GO:0048016)|leukocyte activation (GO:0045321)|maternal process involved in parturition (GO:0060137)|membrane depolarization (GO:0051899)|middle ear morphogenesis (GO:0042474)|multicellular organismal aging (GO:0010259)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of hormone secretion (GO:0046888)|negative regulation of nitric-oxide synthase biosynthetic process (GO:0051771)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell development (GO:0014032)|nitric oxide transport (GO:0030185)|patterning of blood vessels (GO:0001569)|peptide hormone secretion (GO:0030072)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase D-activating G-protein coupled receptor signaling pathway (GO:0031583)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell size (GO:0045793)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of odontogenesis (GO:0042482)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of urine volume (GO:0035810)|prostaglandin biosynthetic process (GO:0001516)|protein kinase C deactivation (GO:0042313)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|respiratory gaseous exchange (GO:0007585)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to nicotine (GO:0035094)|response to testosterone (GO:0033574)|rhythmic excitation (GO:0043179)|sensory perception of pain (GO:0019233)|superoxide anion generation (GO:0042554)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|endothelin A receptor binding (GO:0031707)|endothelin B receptor binding (GO:0031708)|hormone activity (GO:0005179)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	13	all_cancers(95;0.241)|Breast(50;0.0266)|Ovarian(93;0.12)	all_hematologic(90;0.117)				TAAGAAAGGAAAAGACTGTTC	0.363																																					p.K146E		Atlas-SNP	.											.	EDN1	23	.	0			c.A436G						.						98.0	98.0	98.0					6																	12294540		2203	4300	6503	SO:0001583	missense	1906	exon4			AAAGGAAAAGACT	S56805	CCDS4522.1	6p24.1	2014-03-19			ENSG00000078401	ENSG00000078401		"""Endogenous ligands"""	3176	protein-coding gene	gene with protein product		131240					Standard	NM_001168319		Approved	ET1	uc003nae.4	P05305	OTTHUMG00000014266	ENST00000379375.5:c.436A>G	chr6.hg19:g.12294540A>G	ENSP00000368683:p.Lys146Glu	419.0	0.0		396.0	117.0	NM_001955	Q96DA1	Missense_Mutation	SNP	ENST00000379375.5	hg19	CCDS4522.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488697	0.26686	.	.	ENSG00000078401	ENST00000379375	D	0.84660	-1.88	5.85	4.7	0.59300	.	0.487586	0.24354	N	0.039247	T	0.71550	0.3353	M	0.66506	2.035	0.23036	N	0.998396	B;B	0.21381	0.055;0.055	B;B	0.15052	0.012;0.012	T	0.63216	-0.6687	10	0.37606	T	0.19	-4.084	9.4862	0.38931	0.8688:0.0:0.1312:0.0	.	146;146	Q6FH53;P05305	.;EDN1_HUMAN	E	146	ENSP00000368683:K146E	ENSP00000368683:K146E	K	+	1	0	EDN1	12402526	0.873000	0.30073	0.997000	0.53966	0.108000	0.19459	2.343000	0.44001	2.238000	0.73509	0.533000	0.62120	AAA	.	.		0.363	EDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039872.1	NM_001955	
DNAH8	1769	hgsc.bcm.edu	37	6	38891940	38891940	+	Splice_Site	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr6:38891940T>C	ENST00000359357.3	+	71	10565		c.e71+2		DNAH8_ENST00000449981.2_Splice_Site|RP1-207H1.3_ENST00000416948.1_RNA|DNAH8_ENST00000441566.1_Splice_Site|RP1-207H1.3_ENST00000418399.1_RNA			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						CCTCCAACTGTAAGTTTTACT	0.383																																					.		Atlas-SNP	.											.	DNAH8	1239	.	0			c.10962+2T>C						.						74.0	83.0	80.0					6																	38891940		2202	4300	6502	SO:0001630	splice_region_variant	1769	exon73			CAACTGTAAGTTT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.10311+2T>C	chr6.hg19:g.38891940T>C		44.0	0.0		44.0	17.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Splice_Site	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	T	20.7	4.027496	0.75390	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8524	0.70306	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH8	38999918	1.000000	0.71417	0.986000	0.45419	0.870000	0.49936	6.896000	0.75665	2.244000	0.73946	0.533000	0.62120	.	.	.		0.383	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	Intron
DST	667	hgsc.bcm.edu	37	6	56391319	56391319	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr6:56391319A>C	ENST00000361203.3	-	64	17016	c.17009T>G	c.(17008-17010)cTt>cGt	p.L5670R	DST_ENST00000370754.5_Missense_Mutation_p.L5959R|DST_ENST00000340834.4_5'UTR|DST_ENST00000446842.2_Missense_Mutation_p.L5455R|DST_ENST00000244364.6_Missense_Mutation_p.L3367R|DST_ENST00000312431.6_3'UTR|DST_ENST00000421834.2_Missense_Mutation_p.L3693R|DST_ENST00000370769.4_Missense_Mutation_p.L5781R|DST_ENST00000370788.2_Missense_Mutation_p.L3584R			Q03001	DYST_HUMAN	dystonin	5674					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			CACTTCATTAAGGGAGTCCAG	0.423																																					p.L3367R		Atlas-SNP	.											.	DST	1427	.	0			c.T10100G						.						252.0	232.0	238.0					6																	56391319		1940	4160	6100	SO:0001583	missense	667	exon50			TCATTAAGGGAGT	M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.17009T>G	chr6.hg19:g.56391319A>C	ENSP00000354508:p.Leu5670Arg	110.0	0.0		108.0	33.0	NM_015548	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	ENST00000361203.3	hg19		.	.	.	.	.	.	.	.	.	.	A	18.06	3.539840	0.65085	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82	5.73	5.73	0.89815	.	0.000000	0.47455	D	0.000235	T	0.64638	0.2616	M	0.79123	2.44	0.37156	D	0.902364	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.998;0.997	D;D;D;P;D	0.91635	0.998;0.995;0.999;0.844;0.947	T	0.70425	-0.4875	9	0.87932	D	0	.	16.3197	0.82945	1.0:0.0:0.0:0.0	.	3693;5781;5959;5779;3367	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	R	3367;5959;5781;3693;5455;3584;5670	ENSP00000244364:L3367R;ENSP00000359790:L5959R;ENSP00000359805:L5781R;ENSP00000400883:L3693R;ENSP00000393645:L5455R;ENSP00000359824:L3584R;ENSP00000354508:L5670R	ENSP00000244364:L3367R	L	-	2	0	DST	56499278	1.000000	0.71417	0.953000	0.39169	0.869000	0.49853	9.287000	0.95975	2.302000	0.77476	0.533000	0.62120	CTT	.	.		0.423	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000041021.3	NM_001723	
GLCCI1	113263	hgsc.bcm.edu	37	7	8125841	8125841	+	Silent	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr7:8125841G>A	ENST00000223145.5	+	8	1874	c.1317G>A	c.(1315-1317)tcG>tcA	p.S439S		NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	439						cytoplasm (GO:0005737)		p.S439S(1)		endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		AGCCTATCTCGGCCCCTCTCT	0.388																																					p.S439S		Atlas-SNP	.											GLCCI1,right_upper_lobe,carcinoma,0,1	GLCCI1	50	.	1	Substitution - coding silent(1)	lung(1)	c.G1317A						.						105.0	118.0	114.0					7																	8125841		2203	4300	6503	SO:0001819	synonymous_variant	113263	exon8			TATCTCGGCCCCT	BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.1317G>A	chr7.hg19:g.8125841G>A		27.0	0.0		35.0	3.0	NM_138426	A4D103|Q96FD0	Silent	SNP	ENST00000223145.5	hg19	CCDS34601.1																																																																																			.	.		0.388	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324672.1	NM_138426	
POU6F2	11281	hgsc.bcm.edu	37	7	39379463	39379463	+	Missense_Mutation	SNP	C	C	A	rs150071017	byFrequency	TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr7:39379463C>A	ENST00000403058.1	+	6	888	c.734C>A	c.(733-735)gCg>gAg	p.A245E	POU6F2_ENST00000559001.1_Missense_Mutation_p.A237E|POU6F2_ENST00000518318.2_Missense_Mutation_p.A245E|POU6F2_ENST00000517348.1_3'UTR	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	245	Gln-rich.|Pro-rich.				central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						ctgcaacaggcgcctcagccc	0.667																																					p.A245E		Atlas-SNP	.											.	POU6F2	117	.	0			c.C734A						.						88.0	95.0	93.0					7																	39379463		2203	4295	6498	SO:0001583	missense	11281	exon6			AACAGGCGCCTCA	U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.734C>A	chr7.hg19:g.39379463C>A	ENSP00000384004:p.Ala245Glu	59.0	0.0		75.0	14.0	NM_007252	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Missense_Mutation	SNP	ENST00000403058.1	hg19	CCDS34620.2	.	.	.	.	.	.	.	.	.	.	C	6.081	0.383302	0.11524	.	.	ENSG00000106536	ENST00000403058;ENST00000518318	T;D	0.84873	1.07;-1.91	2.03	2.03	0.26663	.	.	.	.	.	T	0.67739	0.2925	N	0.14661	0.345	0.09310	N	1	B;B	0.28880	0.226;0.015	B;B	0.18871	0.023;0.002	T	0.55101	-0.8193	9	0.26408	T	0.33	.	5.8656	0.18773	0.3125:0.6874:0.0:0.0	.	245;245	P78424-2;P78424	.;PO6F2_HUMAN	E	245	ENSP00000384004:A245E;ENSP00000430514:A245E	ENSP00000384004:A245E	A	+	2	0	POU6F2	39345988	0.009000	0.17119	0.054000	0.19295	0.510000	0.34073	0.122000	0.15687	1.426000	0.47256	0.557000	0.71058	GCG	.	C|0.994;T|0.006		0.667	POU6F2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000320146.3	NM_007252	
PKD1L1	168507	hgsc.bcm.edu	37	7	47886599	47886599	+	Silent	SNP	A	A	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr7:47886599A>C	ENST00000289672.2	-	32	5081	c.5031T>G	c.(5029-5031)gcT>gcG	p.A1677A		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	1677					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						TCACTGCCTTAGCTAAATATC	0.393																																					p.A1677A		Atlas-SNP	.											.	PKD1L1	328	.	0			c.T5031G						.						103.0	98.0	100.0					7																	47886599		2203	4300	6503	SO:0001819	synonymous_variant	168507	exon32			TGCCTTAGCTAAA	AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.5031T>G	chr7.hg19:g.47886599A>C		193.0	0.0		181.0	52.0	NM_138295	Q6UWK1	Silent	SNP	ENST00000289672.2	hg19	CCDS34633.1																																																																																			.	.		0.393	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340974.1	NM_138295	
ALDH1B1	219	hgsc.bcm.edu	37	9	38396047	38396047	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr9:38396047G>T	ENST00000377698.3	+	2	455	c.302G>T	c.(301-303)cGg>cTg	p.R101L		NM_000692.4	NP_000683.3	P30837	AL1B1_HUMAN	aldehyde dehydrogenase 1 family, member B1	101					carbohydrate metabolic process (GO:0005975)|ethanol catabolic process (GO:0006068)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)			NS(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(2)|urinary_tract(2)	32				GBM - Glioblastoma multiforme(29;0.043)|Lung(182;0.115)		GCCTCTGAGCGGGGCCGGCTG	0.642																																					p.R101L		Atlas-SNP	.											.	ALDH1B1	50	.	0			c.G302T						.						70.0	79.0	76.0					9																	38396047		2203	4300	6503	SO:0001583	missense	219	exon2			CTGAGCGGGGCCG	M63967	CCDS6615.1	9p13	2008-02-05			ENSG00000137124	ENSG00000137124	1.2.1.3	"""Aldehyde dehydrogenases"""	407	protein-coding gene	gene with protein product		100670		ALDH5		2061311	Standard	NM_000692		Approved	ALDHX	uc004aay.3	P30837	OTTHUMG00000019938	ENST00000377698.3:c.302G>T	chr9.hg19:g.38396047G>T	ENSP00000366927:p.Arg101Leu	79.0	0.0		90.0	28.0	NM_000692	B2R8F0|Q8WX76|Q9BV45	Missense_Mutation	SNP	ENST00000377698.3	hg19	CCDS6615.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.929275	0.73327	.	.	ENSG00000137124	ENST00000377698	D	0.88277	-2.36	5.28	2.46	0.29980	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.56097	D	0.000033	D	0.96021	0.8704	H	0.99368	4.535	0.46078	D	0.998859	D	0.54397	0.966	P	0.60789	0.879	D	0.94294	0.7531	10	0.87932	D	0	.	8.8734	0.35330	0.248:0.0:0.7519:0.0	.	101	P30837	AL1B1_HUMAN	L	101	ENSP00000366927:R101L	ENSP00000366927:R101L	R	+	2	0	ALDH1B1	38386047	0.990000	0.36364	0.996000	0.52242	0.998000	0.95712	5.978000	0.70501	0.242000	0.21303	0.655000	0.94253	CGG	.	.		0.642	ALDH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052492.1		
TRPM3	80036	hgsc.bcm.edu	37	9	73426150	73426150	+	Silent	SNP	C	C	A	rs200079844	byFrequency	TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr9:73426150C>A	ENST00000396292.4	-	5	524	c.525G>T	c.(523-525)ccG>ccT	p.P175P	TRPM3_ENST00000408909.2_Intron|TRPM3_ENST00000396283.1_Silent_p.P175P|TRPM3_ENST00000357533.2_Intron|MIR204_ENST00000385200.1_RNA|TRPM3_ENST00000361823.5_Intron|TRPM3_ENST00000377110.3_Intron|TRPM3_ENST00000377101.1_Intron|TRPM3_ENST00000377105.1_Intron|TRPM3_ENST00000396285.1_Intron|TRPM3_ENST00000423814.3_Silent_p.P330P|TRPM3_ENST00000360823.2_Silent_p.P175P|TRPM3_ENST00000377106.1_Silent_p.P175P|TRPM3_ENST00000358082.3_Silent_p.P175P|TRPM3_ENST00000396280.5_Intron|TRPM3_ENST00000377111.2_Intron			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	328					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GAGAGAAAAACGGCAGGCATC	0.338																																					p.P175P		Atlas-SNP	.											TRPM3,colon,carcinoma,0,2	TRPM3	700	.	0			c.G525T						.						60.0	64.0	63.0					9																	73426150		2203	4300	6503	SO:0001819	synonymous_variant	80036	exon7			GAAAAACGGCAGG	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000396292.4:c.525G>T	chr9.hg19:g.73426150C>A		122.0	0.0		144.0	30.0	NM_001007470	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000396292.4	hg19	CCDS6635.1																																																																																			.	C|1.000;T|0.000		0.338	TRPM3-011	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000214161.2	NM_206945	
SVEP1	79987	hgsc.bcm.edu	37	9	113137703	113137703	+	Silent	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr9:113137703C>T	ENST00000401783.2	-	46	10881	c.10545G>A	c.(10543-10545)gtG>gtA	p.V3515V	SVEP1_ENST00000374469.1_Silent_p.V3492V|SVEP1_ENST00000297826.5_Silent_p.V1441V	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	3515	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						GGTAAGGGGCCACACAGCGAC	0.498																																					p.V3515V		Atlas-SNP	.											.	SVEP1	326	.	0			c.G10545A						.						32.0	32.0	32.0					9																	113137703		1861	4050	5911	SO:0001819	synonymous_variant	79987	exon46			AGGGGCCACACAG	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.10545G>A	chr9.hg19:g.113137703C>T		180.0	0.0		173.0	28.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Silent	SNP	ENST00000401783.2	hg19	CCDS48004.1																																																																																			.	.		0.498	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
COL13A1	1305	hgsc.bcm.edu	37	10	71700763	71700763	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr10:71700763G>A	ENST00000398978.3	+	34	2357	c.1865G>A	c.(1864-1866)gGc>gAc	p.G622D	COL13A1_ENST00000398972.3_Missense_Mutation_p.G608D|COL13A1_ENST00000354547.3_Missense_Mutation_p.G600D|COL13A1_ENST00000356340.3_Missense_Mutation_p.G622D|COL13A1_ENST00000398968.3_Missense_Mutation_p.G603D|COL13A1_ENST00000398971.3_Missense_Mutation_p.G607D|COL13A1_ENST00000398966.3_Missense_Mutation_p.G600D|COL13A1_ENST00000398973.3_Intron|COL13A1_ENST00000520133.1_Intron|COL13A1_ENST00000520267.1_Missense_Mutation_p.G550D|COL13A1_ENST00000357811.3_Intron|COL13A1_ENST00000522165.1_Intron|COL13A1_ENST00000398969.3_Missense_Mutation_p.G550D|COL13A1_ENST00000398964.3_Missense_Mutation_p.G593D|COL13A1_ENST00000398974.3_Missense_Mutation_p.G610D|COL13A1_ENST00000517713.1_Intron	NM_001130103.1	NP_001123575.1			collagen, type XIII, alpha 1											endometrium(5)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	28						GGTTTGGACGGCAGGCCTGGG	0.577																																					p.G622D		Atlas-SNP	.											.	COL13A1	133	.	0			c.G1865A						.						202.0	224.0	216.0					10																	71700763		2036	4176	6212	SO:0001583	missense	1305	exon34			TGGACGGCAGGCC	AJ293624	CCDS44419.1, CCDS44423.1, CCDS44424.1, CCDS44425.1, CCDS44427.1, CCDS44428.1, CCDS44423.2, CCDS44424.2, CCDS44425.2, CCDS44427.2, CCDS44428.2	10q22	2013-01-16			ENSG00000197467	ENSG00000197467		"""Collagens"""	2190	protein-coding gene	gene with protein product		120350					Standard	NM_001130103		Approved		uc001jql.3	Q5TAT6	OTTHUMG00000018394	ENST00000398978.3:c.1865G>A	chr10.hg19:g.71700763G>A	ENSP00000381949:p.Gly622Asp	86.0	0.0		73.0	21.0	NM_001130103		Missense_Mutation	SNP	ENST00000398978.3	hg19	CCDS44419.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.16|17.16	3.319267|3.319267	0.60524|0.60524	.|.	.|.	ENSG00000197467|ENSG00000197467	ENST00000398975|ENST00000398974;ENST00000398971;ENST00000398968;ENST00000398966;ENST00000398964;ENST00000398969;ENST00000356340;ENST00000398972;ENST00000398978;ENST00000354547;ENST00000520267	.|D;D;D;D;D;D;D;D;D;D;D	.|0.99619	.|-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28;-6.28	4.9|4.9	4.9|4.9	0.64082|0.64082	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	D|D	0.99825|0.99825	0.9922|0.9922	H|H	0.98351|0.98351	4.21|4.21	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D;D;D;D;D;D	.|0.97110	.|0.998;1.0;1.0;1.0;1.0;0.972;1.0;0.999;1.0;1.0;1.0	D|D	0.96515|0.96515	0.9381|0.9381	5|10	.|0.87932	.|D	.|0	-4.8829|-4.8829	18.095|18.095	0.89487|0.89487	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|550;622;608;600;603;608;610;607;600;593;622	.|B9EGD2;Q5TAT6;Q5TAT6-6;E7ES55;E7ES51;E7ES47;E7ES46;E7ES49;Q5TAT6-2;E7ES56;G5E987	.|.;CODA1_HUMAN;.;.;.;.;.;.;.;.;.	T|D	152|610;607;603;600;593;550;622;608;622;600;550	.|ENSP00000381946:G610D;ENSP00000381943:G607D;ENSP00000381940:G603D;ENSP00000381938:G600D;ENSP00000381936:G593D;ENSP00000381941:G550D;ENSP00000348695:G622D;ENSP00000381944:G608D;ENSP00000381949:G622D;ENSP00000346553:G600D;ENSP00000428057:G550D	.|ENSP00000346553:G600D	A|G	+|+	1|2	0|0	COL13A1|COL13A1	71370769|71370769	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	1.000000|1.000000	0.99986|0.99986	7.662000|7.662000	0.83803|0.83803	2.259000|2.259000	0.74868|0.74868	0.655000|0.655000	0.94253|0.94253	GCA|GGC	.	.		0.577	COL13A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048468.1	NM_005203	
TDRD1	56165	hgsc.bcm.edu	37	10	115987675	115987675	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr10:115987675T>C	ENST00000369280.1	+	23	3642	c.3182T>C	c.(3181-3183)aTg>aCg	p.M1061T	TDRD1_ENST00000369282.1_Missense_Mutation_p.M1061T|TDRD1_ENST00000251864.2_Missense_Mutation_p.M1137T|TDRD1_ENST00000369281.2_Missense_Mutation_p.M1023T|TDRD1_ENST00000422662.1_Missense_Mutation_p.M665T			Q9BXT4	TDRD1_HUMAN	tudor domain containing 1	1061					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ cell development (GO:0007281)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)	metal ion binding (GO:0046872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(5)	48		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0343)|all cancers(201;0.0754)		TTAGAAAAGATGTATAGGATG	0.313																																					p.M1137T		Atlas-SNP	.											.	TDRD1	126	.	0			c.T3410C						.						118.0	111.0	113.0					10																	115987675		2202	4300	6502	SO:0001583	missense	56165	exon24			AAAAGATGTATAG	AF285606	CCDS7588.1	10q26.11	2013-01-23			ENSG00000095627	ENSG00000095627		"""Tudor domain containing"""	11712	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.1"""	605796				11279525	Standard	NM_198795		Approved	CT41.1	uc001lbg.1	Q9BXT4	OTTHUMG00000019083	ENST00000369280.1:c.3182T>C	chr10.hg19:g.115987675T>C	ENSP00000358286:p.Met1061Thr	51.0	0.0		42.0	10.0	NM_198795	A6NEN3|A6NMN2|B3KVI4|B4E2L5|D3DRC2|Q4G0Y8|Q6P518|Q9H7B3	Missense_Mutation	SNP	ENST00000369280.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.712	0.912326	0.17907	.	.	ENSG00000095627	ENST00000369282;ENST00000251864;ENST00000369281;ENST00000422662;ENST00000369280	T;T;T;T;T	0.16196	3.12;3.2;2.36;2.58;3.13	6.02	-7.26	0.01466	.	1.226810	0.05785	N	0.609334	T	0.05364	0.0142	N	0.01705	-0.755	0.09310	N	1	P;B;B;B;B	0.35033	0.481;0.0;0.0;0.0;0.0	B;B;B;B;B	0.36092	0.217;0.0;0.0;0.0;0.0	T	0.31138	-0.9954	10	0.13853	T	0.58	6.1833	8.5995	0.33736	0.0871:0.1746:0.0858:0.6524	.	665;1137;1023;1137;1023	Q9BXT4-4;Q9BXT4;B7WPM2;Q9BXT4-3;Q9BXT4-2	.;TDRD1_HUMAN;.;.;.	T	1061;1137;1023;665;1061	ENSP00000358288:M1061T;ENSP00000251864:M1137T;ENSP00000358287:M1023T;ENSP00000402794:M665T;ENSP00000358286:M1061T	ENSP00000251864:M1137T	M	+	2	0	TDRD1	115977665	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-4.115000	0.00292	-1.773000	0.01290	-0.924000	0.02725	ATG	.	.		0.313	TDRD1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000050457.2		
MUC5B	727897	hgsc.bcm.edu	37	11	1262923	1262923	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr11:1262923G>A	ENST00000529681.1	+	31	4871	c.4813G>A	c.(4813-4815)Gga>Aga	p.G1605R	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.G1608R	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	1605	7 X Cys-rich subdomain repeats.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCACTGCAGGGGACGTGCCAC	0.647																																					p.G1605R		Atlas-SNP	.											.	MUC5B	473	.	0			c.G4813A						.						20.0	27.0	24.0					11																	1262923		2113	4210	6323	SO:0001583	missense	727897	exon31			TGCAGGGGACGTG	U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.4813G>A	chr11.hg19:g.1262923G>A	ENSP00000436812:p.Gly1605Arg	132.0	0.0		102.0	24.0	NM_002458	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	ENST00000529681.1	hg19	CCDS44515.2	.	.	.	.	.	.	.	.	.	.	g	10.66	1.412011	0.25465	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21734	1.99;2.13	3.82	-6.16	0.02098	.	.	.	.	.	T	0.09512	0.0234	N	0.19112	0.55	0.09310	N	1	B;B	0.28233	0.204;0.204	B;B	0.27076	0.076;0.071	T	0.31081	-0.9956	9	0.87932	D	0	.	1.1342	0.01752	0.3639:0.2632:0.2396:0.1332	.	2298;1608	A7Y9J9;E9PBJ0	.;.	R	1605;1608;1606;1675	ENSP00000436812:G1605R;ENSP00000415793:G1608R	ENSP00000343037:G1606R	G	+	1	0	MUC5B	1219499	0.000000	0.05858	0.000000	0.03702	0.145000	0.21501	-1.050000	0.03510	-1.390000	0.02087	0.306000	0.20318	GGA	.	.		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000390041.2	XM_001126093	
PPP1CA	5499	hgsc.bcm.edu	37	11	67166225	67166225	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr11:67166225T>C	ENST00000376745.4	-	6	998	c.850A>G	c.(850-852)Agt>Ggt	p.S284G	PPP1CA_ENST00000358239.4_Missense_Mutation_p.S240G|PPP1CA_ENST00000312989.7_Missense_Mutation_p.S295G|PPP1CA_ENST00000532446.1_5'UTR	NM_001008709.1|NM_002708.3	NP_001008709.1|NP_002699.1	P62136	PP1A_HUMAN	protein phosphatase 1, catalytic subunit, alpha isozyme	284					branching morphogenesis of an epithelial tube (GO:0048754)|cell cycle (GO:0007049)|cell division (GO:0051301)|circadian regulation of gene expression (GO:0032922)|entrainment of circadian clock by photoperiod (GO:0043153)|glycogen metabolic process (GO:0005977)|lung development (GO:0030324)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein dephosphorylation (GO:0006470)|regulation of circadian rhythm (GO:0042752)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)|triglyceride catabolic process (GO:0019433)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|MLL5-L complex (GO:0070688)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein phosphatase type 1 complex (GO:0000164)|PTW/PP1 phosphatase complex (GO:0072357)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)|ribonucleoprotein complex binding (GO:0043021)			breast(1)|lung(2)|pancreas(1)|urinary_tract(3)	7			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			TCGTCCACACTCATCATGGCG	0.567																																					p.S295G		Atlas-SNP	.											.	PPP1CA	83	.	0			c.A883G						.						101.0	92.0	95.0					11																	67166225		2200	4295	6495	SO:0001583	missense	5499	exon6			CCACACTCATCAT		CCDS8160.1, CCDS8161.1, CCDS31618.1	11q13	2013-01-18	2010-03-05			ENSG00000172531	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9281	protein-coding gene	gene with protein product		176875	"""protein phosphatase 1, catalytic subunit, alpha isoform"""	PPP1A			Standard	NM_002708		Approved	PP1A, PP-1A, PP1alpha	uc001oku.1	P62136		ENST00000376745.4:c.850A>G	chr11.hg19:g.67166225T>C	ENSP00000365936:p.Ser284Gly	104.0	0.0		76.0	5.0	NM_001008709	A6NNR3|B2R908|P08129|P20653|P22802|Q07161	Missense_Mutation	SNP	ENST00000376745.4	hg19	CCDS8160.1	.	.	.	.	.	.	.	.	.	.	T	15.99	2.995146	0.54147	.	.	ENSG00000172531	ENST00000312989;ENST00000451458;ENST00000376745;ENST00000358239;ENST00000527663	T;T;T;T	0.05649	3.41;3.41;3.41;3.41	5.62	5.62	0.85841	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (1);	0.000000	0.85682	D	0.000000	T	0.14013	0.0339	M	0.78637	2.42	0.80722	D	1	B;B;B;B;B;B	0.26483	0.092;0.092;0.15;0.032;0.003;0.011	B;B;B;B;B;B	0.32533	0.032;0.032;0.147;0.023;0.008;0.018	T	0.00970	-1.1496	10	0.66056	D	0.02	-15.1124	14.8196	0.70062	0.0:0.0:0.0:1.0	.	381;381;284;240;295;293	B3KXM2;E9PDP1;P62136;A6NNR3;Q07161;F8W0W8	.;.;PP1A_HUMAN;.;.;.	G	295;381;284;240;249	ENSP00000326031:S295G;ENSP00000365936:S284G;ENSP00000350974:S240G;ENSP00000431146:S249G	ENSP00000326031:S295G	S	-	1	0	PPP1CA	66922801	1.000000	0.71417	0.998000	0.56505	0.590000	0.36582	8.020000	0.88740	2.140000	0.66376	0.460000	0.39030	AGT	.	.		0.567	PPP1CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395487.1	NM_002708	
UBASH3B	84959	hgsc.bcm.edu	37	11	122647740	122647740	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr11:122647740C>T	ENST00000284273.5	+	3	599	c.224C>T	c.(223-225)tCc>tTc	p.S75F		NM_032873.4	NP_116262.2	Q8TF42	UBS3B_HUMAN	ubiquitin associated and SH3 domain containing B	75	UBA. {ECO:0000255|PROSITE- ProRule:PRU00212}.				negative regulation of platelet aggregation (GO:0090331)|negative regulation of protein kinase activity (GO:0006469)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(11)|prostate(1)|skin(2)|stomach(2)	26		Breast(109;0.00254)|Medulloblastoma(222;0.00877)|Lung NSC(97;0.0183)|all_lung(97;0.0186)|all_neural(223;0.0381)|all_hematologic(192;0.104)		BRCA - Breast invasive adenocarcinoma(274;1.37e-05)|OV - Ovarian serous cystadenocarcinoma(99;0.0463)		AGGTTATTCTCCCATGTCGGT	0.547																																					p.S75F		Atlas-SNP	.											.	UBASH3B	73	.	0			c.C224T						.						81.0	70.0	74.0					11																	122647740		2202	4299	6501	SO:0001583	missense	84959	exon3			TATTCTCCCATGT	AB075839	CCDS31694.1	11q24.1	2010-04-28	2010-04-28		ENSG00000154127	ENSG00000154127			29884	protein-coding gene	gene with protein product	"""SH3 domain-containing 70 kDa protein, suppressor of T-cell receptor signaling 1, nm23-phosphorylated unknown substrate"""	609201				11853319, 12370296	Standard	NM_032873		Approved	KIAA1959, STS-1	uc001pyi.4	Q8TF42	OTTHUMG00000166025	ENST00000284273.5:c.224C>T	chr11.hg19:g.122647740C>T	ENSP00000284273:p.Ser75Phe	125.0	0.0		96.0	4.0	NM_032873	Q53GT5|Q53GT8|Q8NBV7|Q96IG9|Q96NZ2	Missense_Mutation	SNP	ENST00000284273.5	hg19	CCDS31694.1	.	.	.	.	.	.	.	.	.	.	C	18.03	3.533188	0.64972	.	.	ENSG00000154127	ENST00000284273	T	0.25749	1.78	5.54	5.54	0.83059	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);UBA-like (1);	0.048805	0.85682	D	0.000000	T	0.32852	0.0843	L	0.60904	1.88	0.80722	D	1	B	0.28801	0.223	B	0.32289	0.143	T	0.06734	-1.0810	10	0.48119	T	0.1	-18.496	19.4812	0.95011	0.0:1.0:0.0:0.0	.	75	Q8TF42	UBS3B_HUMAN	F	75	ENSP00000284273:S75F	ENSP00000284273:S75F	S	+	2	0	UBASH3B	122152950	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.711000	0.84669	2.600000	0.87896	0.655000	0.94253	TCC	.	.		0.547	UBASH3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387499.1	NM_032873	
GRAMD1B	57476	hgsc.bcm.edu	37	11	123483491	123483491	+	Silent	SNP	C	C	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr11:123483491C>A	ENST00000529750.1	+	14	1840	c.1513C>A	c.(1513-1515)Cga>Aga	p.R505R	GRAMD1B_ENST00000456860.2_Silent_p.R512R|GRAMD1B_ENST00000450171.2_Silent_p.R196R|GRAMD1B_ENST00000322282.7_Silent_p.R505R	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	505						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		GCTGCGCTATCGAAAACAGCC	0.532																																					p.R505R		Atlas-SNP	.											.	GRAMD1B	122	.	0			c.C1513A						.						44.0	46.0	45.0					11																	123483491		1938	4135	6073	SO:0001819	synonymous_variant	57476	exon14			CGCTATCGAAAAC	AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.1513C>A	chr11.hg19:g.123483491C>A		107.0	0.0		122.0	31.0	NM_020716	Q6UW85|Q9ULL9	Silent	SNP	ENST00000529750.1	hg19	CCDS53720.1																																																																																			.	.		0.532	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387404.2	XM_370660	
PDZRN4	29951	hgsc.bcm.edu	37	12	41966919	41966919	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr12:41966919C>G	ENST00000402685.2	+	10	2346	c.2338C>G	c.(2338-2340)Cag>Gag	p.Q780E	PDZRN4_ENST00000539469.2_Missense_Mutation_p.Q522E|PDZRN4_ENST00000298919.7_Missense_Mutation_p.Q520E	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	780							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GGCAGCCACCCAGTCCTCTTC	0.507																																					p.Q780E		Atlas-SNP	.											.	PDZRN4	346	.	0			c.C2338G						.						105.0	104.0	104.0					12																	41966919		2203	4300	6503	SO:0001583	missense	29951	exon10			GCCACCCAGTCCT	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2338C>G	chr12.hg19:g.41966919C>G	ENSP00000384197:p.Gln780Glu	114.0	0.0		136.0	21.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	C	0.004	-2.251865	0.00268	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.47177	0.85;0.85;0.85	4.72	4.72	0.59763	.	1.575960	0.03275	N	0.185383	T	0.45276	0.1334	L	0.45137	1.4	0.23464	N	0.997621	B;B;B	0.23185	0.081;0.001;0.0	B;B;B	0.18263	0.021;0.004;0.003	T	0.49744	-0.8907	10	0.02654	T	1	-10.3849	18.5778	0.91161	0.0:1.0:0.0:0.0	.	780;520;522	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	E	780;522;520	ENSP00000384197:Q780E;ENSP00000439990:Q522E;ENSP00000298919:Q520E	ENSP00000298919:Q520E	Q	+	1	0	PDZRN4	40253186	0.984000	0.35163	0.035000	0.18076	0.133000	0.20885	4.177000	0.58276	2.565000	0.86533	0.650000	0.86243	CAG	.	.		0.507	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ERBB3	2065	hgsc.bcm.edu	37	12	56478884	56478884	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr12:56478884A>T	ENST00000267101.3	+	3	780	c.340A>T	c.(340-342)Aag>Tag	p.K114*	ERBB3_ENST00000411731.2_Nonsense_Mutation_p.K114*|ERBB3_ENST00000415288.2_Nonsense_Mutation_p.K55*|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	114					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CTACGATGGGAAGTTTGCCAT	0.552																																					p.K114X		Atlas-SNP	.											.	ERBB3	350	.	0			c.A340T						.						208.0	177.0	187.0					12																	56478884		2203	4300	6503	SO:0001587	stop_gained	2065	exon3			GATGGGAAGTTTG	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.340A>T	chr12.hg19:g.56478884A>T	ENSP00000267101:p.Lys114*	128.0	0.0		141.0	16.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Nonsense_Mutation	SNP	ENST00000267101.3	hg19	CCDS31833.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166814	0.78339	.	.	ENSG00000065361	ENST00000549282;ENST00000549061;ENST00000267101;ENST00000394099;ENST00000411731;ENST00000549672;ENST00000415288	.	.	.	5.82	4.65	0.58169	.	0.076168	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1525	0.54057	0.8567:0.1433:0.0:0.0	.	.	.	.	X	114;55;114;114;114;55;55	.	ENSP00000267101:K114X	K	+	1	0	ERBB3	54765151	1.000000	0.71417	1.000000	0.80357	0.712000	0.41017	5.099000	0.64554	0.983000	0.38602	0.533000	0.62120	AAG	.	.		0.552	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
ZFC3H1	196441	hgsc.bcm.edu	37	12	72021636	72021636	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr12:72021636T>A	ENST00000378743.3	-	21	4383	c.4025A>T	c.(4024-4026)aAt>aTt	p.N1342I		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1342					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATCAGTCTCATTTGTAAAGTA	0.358																																					p.N1342I		Atlas-SNP	.											.	ZFC3H1	172	.	0			c.A4025T						.						107.0	97.0	100.0					12																	72021636		1874	4115	5989	SO:0001583	missense	196441	exon21			GTCTCATTTGTAA	AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.4025A>T	chr12.hg19:g.72021636T>A	ENSP00000368017:p.Asn1342Ile	91.0	0.0		76.0	11.0	NM_144982	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Missense_Mutation	SNP	ENST00000378743.3	hg19	CCDS41813.1	.	.	.	.	.	.	.	.	.	.	T	18.19	3.569065	0.65765	.	.	ENSG00000133858	ENST00000378743	T	0.33654	1.4	5.38	3.04	0.35103	.	0.108239	0.64402	D	0.000006	T	0.23649	0.0572	N	0.24115	0.695	0.80722	D	1	B	0.29085	0.232	B	0.29440	0.102	T	0.05500	-1.0881	10	0.66056	D	0.02	.	8.415	0.32666	0.0:0.2522:0.0:0.7478	.	1342	O60293	ZC3H1_HUMAN	I	1342	ENSP00000368017:N1342I	ENSP00000368017:N1342I	N	-	2	0	ZFC3H1	70307903	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.954000	0.40362	0.366000	0.24427	-0.274000	0.10170	AAT	.	.		0.358	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404751.1	NM_144982	
TRPM1	4308	hgsc.bcm.edu	37	15	31318460	31318460	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr15:31318460C>T	ENST00000256552.6	-	27	3658	c.3511G>A	c.(3511-3513)Gac>Aac	p.D1171N	TRPM1_ENST00000397795.2_Missense_Mutation_p.D1149N|TRPM1_ENST00000542188.1_Missense_Mutation_p.D1188N|RP11-348B17.1_ENST00000561299.1_RNA|RP11-348B17.1_ENST00000558755.1_RNA	NM_001252024.1	NP_001238953.1			transient receptor potential cation channel, subfamily M, member 1											NS(2)|breast(3)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(15)|lung(48)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(3)	99		all_lung(180;1.92e-11)		all cancers(64;3.52e-16)|Epithelial(43;1.65e-11)|GBM - Glioblastoma multiforme(186;3.57e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00533)|COAD - Colon adenocarcinoma(236;0.0609)|Lung(196;0.199)		AGCTCCTCGTCGCTAAGGAAG	0.537																																					p.D1188N		Atlas-SNP	.											.	TRPM1	183	.	0			c.G3562A						.						55.0	55.0	55.0					15																	31318460		2064	4207	6271	SO:0001583	missense	4308	exon26			CCTCGTCGCTAAG	AF071787	CCDS10024.2, CCDS58345.1, CCDS58346.1, CCDS58347.1	15q13.3	2014-01-28		2002-01-18	ENSG00000134160	ENSG00000134160		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	7146	protein-coding gene	gene with protein product		603576	"""melastatin 1"""	MLSN1		9806836, 9537257, 16382100	Standard	NM_001252020		Approved	LTRPC1, CSNB1C	uc021sia.1	Q7Z4N2	OTTHUMG00000129267	ENST00000256552.6:c.3511G>A	chr15.hg19:g.31318460C>T	ENSP00000256552:p.Asp1171Asn	43.0	0.0		38.0	5.0	NM_001252020		Missense_Mutation	SNP	ENST00000256552.6	hg19	CCDS58346.1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.206180	0.58343	.	.	ENSG00000134160	ENST00000397795;ENST00000542188;ENST00000256552;ENST00000397793	T;T;T	0.31510	1.49;1.49;1.49	5.5	5.5	0.81552	.	0.751346	0.13163	N	0.408935	T	0.33059	0.0850	L	0.41573	1.285	0.45541	D	0.998497	B;B	0.22003	0.055;0.063	B;B	0.20184	0.028;0.017	T	0.11641	-1.0579	10	0.87932	D	0	-6.1344	19.7537	0.96281	0.0:1.0:0.0:0.0	.	1143;1149	Q7Z4N2-3;Q7Z4N2	.;TRPM1_HUMAN	N	1149;1188;1171;1149	ENSP00000380897:D1149N;ENSP00000437849:D1188N;ENSP00000256552:D1171N	ENSP00000256552:D1171N	D	-	1	0	TRPM1	29105752	1.000000	0.71417	0.984000	0.44739	0.766000	0.43426	4.737000	0.62066	2.736000	0.93811	0.591000	0.81541	GAC	.	.		0.537	TRPM1-004	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417166.2	NM_002420	
FSIP1	161835	hgsc.bcm.edu	37	15	40062634	40062634	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr15:40062634A>G	ENST00000350221.3	-	3	513	c.304T>C	c.(304-306)Tgt>Cgt	p.C102R	RP11-37C7.1_ENST00000558616.1_RNA	NM_152597.4	NP_689810.3	Q8NA03	FSIP1_HUMAN	fibrous sheath interacting protein 1	102										NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	23		all_cancers(109;2.66e-19)|all_epithelial(112;2.66e-16)|Lung NSC(122;1.5e-11)|all_lung(180;4.03e-10)|Melanoma(134;0.0575)|Ovarian(310;0.0827)|Colorectal(260;0.119)		GBM - Glioblastoma multiforme(113;8.22e-06)|BRCA - Breast invasive adenocarcinoma(123;0.142)		CTACCTGAACACTCAGAGATT	0.328																																					p.C102R		Atlas-SNP	.											.	FSIP1	53	.	0			c.T304C						.						165.0	151.0	156.0					15																	40062634		2203	4300	6503	SO:0001583	missense	161835	exon3			CTGAACACTCAGA	BC045191	CCDS10050.1	15q14	2012-11-19			ENSG00000150667	ENSG00000150667			21674	protein-coding gene	gene with protein product		615795				14702039	Standard	NM_152597		Approved	FLJ35989	uc001zki.3	Q8NA03	OTTHUMG00000172456	ENST00000350221.3:c.304T>C	chr15.hg19:g.40062634A>G	ENSP00000280236:p.Cys102Arg	45.0	0.0		42.0	7.0	NM_152597	Q6X2C8|Q86Y89	Missense_Mutation	SNP	ENST00000350221.3	hg19	CCDS10050.1	.	.	.	.	.	.	.	.	.	.	a	4.147	0.025712	0.08054	.	.	ENSG00000150667	ENST00000350221	T	0.21734	1.99	4.38	0.0837	0.14434	.	0.671284	0.14279	N	0.329646	T	0.12390	0.0301	L	0.31294	0.92	0.18873	N	0.999981	B	0.06786	0.001	B	0.09377	0.004	T	0.31194	-0.9952	9	.	.	.	1.6157	6.8569	0.24046	0.5378:0.0:0.4622:0.0	.	102	Q8NA03	FSIP1_HUMAN	R	102	ENSP00000280236:C102R	.	C	-	1	0	FSIP1	37849926	0.004000	0.15560	0.081000	0.20488	0.887000	0.51463	0.314000	0.19432	-0.066000	0.12998	-0.266000	0.10368	TGT	.	.		0.328	FSIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252118.2	NM_152597	
PLA2G4E	123745	hgsc.bcm.edu	37	15	42285005	42285005	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr15:42285005C>T	ENST00000399518.3	-	13	1886	c.1400G>A	c.(1399-1401)aGc>aAc	p.S467N	CTD-2382E5.1_ENST00000499478.2_RNA|PLA2G4E_ENST00000413860.2_Missense_Mutation_p.S438N	NM_001206670.1	NP_001193599.1	Q3MJ16	PA24E_HUMAN	phospholipase A2, group IVE	455	PLA2c. {ECO:0000255|PROSITE- ProRule:PRU00555}.				glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)|stomach(1)	16		all_cancers(109;8.09e-13)|all_epithelial(112;2.03e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.0273)		OV - Ovarian serous cystadenocarcinoma(18;7.61e-18)|GBM - Glioblastoma multiforme(94;3.07e-06)		GCCTTCCTGGCTGCGCTGCCG	0.607																																					p.S467N		Atlas-SNP	.											.	PLA2G4E	60	.	0			c.G1400A						.						48.0	51.0	50.0					15																	42285005		1921	4134	6055	SO:0001583	missense	123745	exon13			TCCTGGCTGCGCT		CCDS55962.1	15q15.1	2008-09-19			ENSG00000188089	ENSG00000188089	3.1.1.4		24791	protein-coding gene	gene with protein product						15866882	Standard	NM_001206670		Approved	FLJ45651	uc021sjp.1	Q3MJ16	OTTHUMG00000130371	ENST00000399518.3:c.1400G>A	chr15.hg19:g.42285005C>T	ENSP00000382434:p.Ser467Asn	114.0	0.0		74.0	7.0	NM_001206670	Q6ZSC0	Missense_Mutation	SNP	ENST00000399518.3	hg19	CCDS55962.1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240352	0.39598	.	.	ENSG00000188089	ENST00000399518;ENST00000413860	T;T	0.11495	2.77;2.77	5.52	4.55	0.56014	Acyl transferase/acyl hydrolase/lysophospholipase (1);Lysophospholipase, catalytic domain (3);	0.546854	0.21451	N	0.074337	T	0.09247	0.0228	L	0.40543	1.245	0.26021	N	0.981864	B;B	0.10296	0.003;0.003	B;B	0.15052	0.012;0.012	T	0.13442	-1.0509	10	0.28530	T	0.3	4.8632	8.9083	0.35537	0.0:0.765:0.153:0.0819	.	438;455	C9JK77;Q3MJ16	.;PA24E_HUMAN	N	467;438	ENSP00000382434:S467N;ENSP00000413897:S438N	ENSP00000382434:S467N	S	-	2	0	PLA2G4E	40072297	0.005000	0.15991	0.993000	0.49108	0.615000	0.37417	0.043000	0.13971	2.586000	0.87340	0.655000	0.94253	AGC	.	.		0.607	PLA2G4E-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252738.2	NM_198442	
ADCY9	115	hgsc.bcm.edu	37	16	4033250	4033250	+	Silent	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr16:4033250G>A	ENST00000294016.3	-	7	3040	c.2502C>T	c.(2500-2502)tcC>tcT	p.S834S		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	834					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						ACACCGCGAGGGACAGCACCT	0.662											OREG0023573	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S834S		Atlas-SNP	.											.	ADCY9	151	.	0			c.C2502T						.						17.0	14.0	15.0					16																	4033250		2120	4136	6256	SO:0001819	synonymous_variant	115	exon7			CGCGAGGGACAGC	AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2502C>T	chr16.hg19:g.4033250G>A		67.0	0.0	615	40.0	13.0	NM_001116	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Silent	SNP	ENST00000294016.3	hg19	CCDS32382.1																																																																																			.	.		0.662	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438076.1		
ZNF267	10308	hgsc.bcm.edu	37	16	31926823	31926823	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr16:31926823G>A	ENST00000300870.10	+	4	1462	c.1253G>A	c.(1252-1254)cGc>cAc	p.R418H		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	418					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R418H(1)		breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						AAAGCCTTTCGCTGTAGTTCA	0.363																																					p.R418H		Atlas-SNP	.											ZNF267,rectum,carcinoma,0,1	ZNF267	94	.	1	Substitution - Missense(1)	large_intestine(1)	c.G1253A						.						43.0	48.0	46.0					16																	31926823		2197	4297	6494	SO:0001583	missense	10308	exon4			CCTTTCGCTGTAG	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1253G>A	chr16.hg19:g.31926823G>A	ENSP00000300870:p.Arg418His	35.0	0.0		34.0	11.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	hg19	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	4.243	0.044049	0.08196	.	.	ENSG00000185947	ENST00000300870	T	0.01005	5.45	0.458	-0.616	0.11583	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00666	0.0022	L	0.35723	1.085	0.09310	N	1	P	0.43542	0.81	B	0.29862	0.108	T	0.50101	-0.8867	9	0.35671	T	0.21	.	3.7552	0.08582	0.6257:0.0:0.3743:0.0	.	418	Q14586	ZN267_HUMAN	H	418	ENSP00000300870:R418H	ENSP00000300870:R418H	R	+	2	0	ZNF267	31834324	0.000000	0.05858	0.026000	0.17262	0.025000	0.11179	-2.107000	0.01337	-0.354000	0.08212	-0.350000	0.07774	CGC	.	.		0.363	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
ACSF3	197322	hgsc.bcm.edu	37	16	89180877	89180877	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr16:89180877A>G	ENST00000317447.4	+	6	1485	c.1108A>G	c.(1108-1110)Act>Gct	p.T370A	ACSF3_ENST00000378345.4_Missense_Mutation_p.T105A|ACSF3_ENST00000406948.3_Missense_Mutation_p.T370A|CTD-2555A7.3_ENST00000562782.1_RNA	NM_001127214.2|NM_001243279.1|NM_001284316.1|NM_174917.3	NP_001120686.1|NP_001230208.1|NP_001271245.1|NP_777577.2	Q4G176	ACSF3_HUMAN	acyl-CoA synthetase family member 3	370					fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|malonate catabolic process (GO:0090410)	mitochondrion (GO:0005739)	acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)|malonyl-CoA synthetase activity (GO:0090409)			central_nervous_system(1)|endometrium(1)|kidney(2)|lung(9)|prostate(1)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(80;0.0281)		GCCCCTGACCACTGCCGTGCG	0.637																																					p.T370A		Atlas-SNP	.											.	ACSF3	40	.	0			c.A1108G						.						86.0	85.0	86.0					16																	89180877		2198	4300	6498	SO:0001583	missense	197322	exon6			CTGACCACTGCCG	AK075499	CCDS10974.1, CCDS73926.1	16q24.3	2013-01-15			ENSG00000176715	ENSG00000176715		"""Acyl-CoA synthetase family"""	27288	protein-coding gene	gene with protein product	"""malonyl-CoA synthetase"""	614245				17762044, 21846720	Standard	XM_005256293		Approved		uc010cig.2	Q4G176	OTTHUMG00000138044	ENST00000317447.4:c.1108A>G	chr16.hg19:g.89180877A>G	ENSP00000320646:p.Thr370Ala	87.0	0.0		53.0	17.0	NM_174917	A8K4J8|C9JQL6|Q6INA0|Q8N2F7	Missense_Mutation	SNP	ENST00000317447.4	hg19	CCDS10974.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	1.223|1.223	-0.626392|-0.626392	0.03610|0.03610	.|.	.|.	ENSG00000176715|ENSG00000176715	ENST00000543676|ENST00000537895;ENST00000317447;ENST00000540697;ENST00000406948;ENST00000378345;ENST00000544543	.|D;T;T;T;T;T	.|0.81996	.|-1.56;1.05;1.05;1.05;1.05;1.05	0.727|0.727	-1.45|-1.45	0.08828|0.08828	.|AMP-dependent synthetase/ligase (1);	.|1.542160	.|0.03558	.|N	.|0.226552	T|T	0.60235|0.60235	0.2253|0.2253	N|N	0.05306|0.05306	-0.075|-0.075	0.09310|0.09310	N|N	1|1	.|B	.|0.02656	.|0.0	.|B	.|0.06405	.|0.002	T|T	0.44436|0.44436	-0.9328|-0.9328	4|9	.|0.12430	.|T	.|0.62	.|.	.|.	.|.	.|.	.|.	.|370	.|Q4G176	.|ACSF3_HUMAN	R|A	117|105;370;105;370;105;105	.|ENSP00000439201:T105A;ENSP00000320646:T370A;ENSP00000445397:T105A;ENSP00000384627:T370A;ENSP00000367596:T105A;ENSP00000442781:T105A	.|ENSP00000320646:T370A	H|T	+|+	2|1	0|0	ACSF3|ACSF3	87708378|87708378	0.057000|0.057000	0.20700|0.20700	0.002000|0.002000	0.10522|0.10522	0.001000|0.001000	0.01503|0.01503	0.209000|0.209000	0.17435|0.17435	-2.115000|-2.115000	0.00831|0.00831	-1.899000|-1.899000	0.00529|0.00529	CAC|ACT	.	.		0.637	ACSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269919.1	NM_174917	
AATK	9625	hgsc.bcm.edu	37	17	79094590	79094590	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr17:79094590C>T	ENST00000326724.4	-	11	3170	c.3146G>A	c.(3145-3147)gGc>gAc	p.G1049D	AATK_ENST00000417379.1_Missense_Mutation_p.G946D	NM_001080395.2	NP_001073864.2	Q6ZMQ8	LMTK1_HUMAN	apoptosis-associated tyrosine kinase	1049					brain development (GO:0007420)|negative regulation of axon extension (GO:0030517)|neuron apoptotic process (GO:0051402)|peptidyl-tyrosine autophosphorylation (GO:0038083)|Rab protein signal transduction (GO:0032482)	axonal growth cone (GO:0044295)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(2)|lung(8)|ovary(3)|prostate(1)|stomach(4)|upper_aerodigestive_tract(1)	21	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			GGGGCCAGAGCCTTGTGCCTC	0.731																																					p.G1049D		Atlas-SNP	.											.	AATK	102	.	0			c.G3146A						.						5.0	6.0	5.0					17																	79094590		1817	4017	5834	SO:0001583	missense	9625	exon11			CCAGAGCCTTGTG	AB014541	CCDS45807.1, CCDS58607.1	17q25.3	2014-06-12			ENSG00000181409	ENSG00000181409			21	protein-coding gene	gene with protein product	"""lemur tyrosine kinase 1"", ""protein phosphatase 1, regulatory subunit 77"""	605276				9734811, 10083745	Standard	NM_001080395		Approved	AATYK, KIAA0641, LMTK1, LMR1, AATYK1, PPP1R77	uc010dia.3	Q6ZMQ8	OTTHUMG00000132717	ENST00000326724.4:c.3146G>A	chr17.hg19:g.79094590C>T	ENSP00000324196:p.Gly1049Asp	47.0	0.0		33.0	5.0	NM_001080395	O75136|Q6ZN31|Q86X28	Missense_Mutation	SNP	ENST00000326724.4	hg19	CCDS45807.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	5.994|5.994	0.367328|0.367328	0.11352|0.11352	.|.	.|.	ENSG00000181409|ENSG00000181409	ENST00000417379|ENST00000326724	.|T	.|0.76448	.|-1.02	4.28|4.28	0.663|0.663	0.17885|0.17885	.|.	.|1.515330	.|0.04128	.|N	.|0.317559	T|T	0.63733|0.63733	0.2536|0.2536	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	1|1	.|B	.|0.09022	.|0.002	.|B	.|0.06405	.|0.002	T|T	0.49360|0.49360	-0.8948|-0.8948	5|10	.|0.34782	.|T	.|0.22	.|.	3.3419|3.3419	0.07122|0.07122	0.1864:0.48:0.0:0.3335|0.1864:0.48:0.0:0.3335	.|.	.|1049	.|Q6ZMQ8	.|LMTK1_HUMAN	T|D	1002|1049	.|ENSP00000324196:G1049D	.|ENSP00000324196:G1049D	A|G	-|-	1|2	0|0	AATK|AATK	76709185|76709185	0.000000|0.000000	0.05858|0.05858	0.027000|0.027000	0.17364|0.17364	0.445000|0.445000	0.32107|0.32107	-1.541000|-1.541000	0.02198|0.02198	0.756000|0.756000	0.33013|0.33013	0.462000|0.462000	0.41574|0.41574	GCT|GGC	.	.		0.731	AATK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256055.1	NM_004920	
ZNF208	7757	hgsc.bcm.edu	37	19	22156012	22156012	+	Silent	SNP	G	G	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr19:22156012G>T	ENST00000397126.4	-	4	1972	c.1824C>A	c.(1822-1824)ccC>ccA	p.P608P	ZNF208_ENST00000599916.1_Intron|ZNF208_ENST00000601773.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	608					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				CACATTTGTAGGGTTTCTCAC	0.363																																					p.P608P		Atlas-SNP	.											.	ZNF208	817	.	0			c.C1824A						.						56.0	59.0	58.0					19																	22156012		2088	4240	6328	SO:0001819	synonymous_variant	7757	exon4			TTTGTAGGGTTTC	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1824C>A	chr19.hg19:g.22156012G>T		30.0	0.0		28.0	5.0	NM_007153		Silent	SNP	ENST00000397126.4	hg19	CCDS54240.1																																																																																			.	.		0.363	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
RHPN2	85415	hgsc.bcm.edu	37	19	33493213	33493213	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr19:33493213C>T	ENST00000254260.3	-	9	1080	c.1045G>A	c.(1045-1047)Gcc>Acc	p.A349T	RHPN2_ENST00000400226.4_Missense_Mutation_p.A198T	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	349	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					TAGTGGTGGGCCTTCACGCAG	0.632																																					p.A349T		Atlas-SNP	.											.	RHPN2	107	.	0			c.G1045A						.						53.0	51.0	52.0					19																	33493213		2203	4300	6503	SO:0001583	missense	85415	exon9			GGTGGGCCTTCAC	AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1045G>A	chr19.hg19:g.33493213C>T	ENSP00000254260:p.Ala349Thr	194.0	0.0		192.0	22.0	NM_033103	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	ENST00000254260.3	hg19	CCDS12427.1	.	.	.	.	.	.	.	.	.	.	C	11.59	1.683979	0.29872	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.18960	2.18;2.18	4.61	2.03	0.26663	BRO1 domain (3);	0.401087	0.29853	N	0.011024	T	0.21881	0.0527	L	0.56199	1.76	0.41435	D	0.987886	B	0.22800	0.075	B	0.23574	0.047	T	0.15723	-1.0427	10	0.49607	T	0.09	-5.0597	13.7833	0.63094	0.3704:0.6296:0.0:0.0	.	349	Q8IUC4	RHPN2_HUMAN	T	349;79;198	ENSP00000254260:A349T;ENSP00000402244:A198T	ENSP00000254260:A349T	A	-	1	0	RHPN2	38185053	1.000000	0.71417	1.000000	0.80357	0.261000	0.26267	1.888000	0.39708	0.992000	0.38840	0.455000	0.32223	GCC	.	.		0.632	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450828.2	NM_033103	
LILRB5	10990	hgsc.bcm.edu	37	19	54756260	54756260	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr19:54756260G>T	ENST00000316219.5	-	11	1649	c.1542C>A	c.(1540-1542)agC>agA	p.S514R	LILRB5_ENST00000345866.6_Missense_Mutation_p.S415R|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000450632.1_Missense_Mutation_p.S506R|LILRB5_ENST00000449561.2_Missense_Mutation_p.S515R	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	514					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CAGCAACTGGGCTGGCCCTGG	0.592																																					p.S515R		Atlas-SNP	.											.	LILRB5	176	.	0			c.C1545A						.						93.0	91.0	92.0					19																	54756260		2203	4300	6503	SO:0001583	missense	10990	exon11			AACTGGGCTGGCC	AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1542C>A	chr19.hg19:g.54756260G>T	ENSP00000320390:p.Ser514Arg	77.0	0.0		55.0	10.0	NM_001081442	Q8N760	Missense_Mutation	SNP	ENST00000316219.5	hg19	CCDS12885.1	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330413	0.24167	.	.	ENSG00000105609	ENST00000316219;ENST00000450632;ENST00000449561;ENST00000345866	T;T;T;T	0.00507	7.0;6.92;7.03;7.02	2.08	-4.16	0.03869	.	.	.	.	.	T	0.00815	0.0027	L	0.57536	1.79	0.09310	N	1	B;D;B;D	0.76494	0.068;0.991;0.007;0.999	B;P;B;D	0.68943	0.022;0.906;0.018;0.961	T	0.36138	-0.9760	9	0.52906	T	0.07	.	0.8149	0.01100	0.2692:0.3422:0.2163:0.1723	.	506;415;515;514	C9JMK7;O75023-2;O75023-3;O75023	.;.;.;LIRB5_HUMAN	R	514;506;515;415	ENSP00000320390:S514R;ENSP00000414225:S506R;ENSP00000406478:S515R;ENSP00000263430:S415R	ENSP00000320390:S514R	S	-	3	2	LILRB5	59448072	0.151000	0.22747	0.000000	0.03702	0.013000	0.08279	-0.133000	0.10451	-1.492000	0.01838	-0.225000	0.12378	AGC	.	.		0.592	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000142877.2		
ZNF551	90233	hgsc.bcm.edu	37	19	58198623	58198623	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr19:58198623G>C	ENST00000282296.5	+	3	1165	c.980G>C	c.(979-981)aGa>aCa	p.R327T	ZNF551_ENST00000356715.4_Missense_Mutation_p.R311T|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron|ZNF551_ENST00000596085.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CACCACCAGAGACGTCACACT	0.418																																					p.R327T		Atlas-SNP	.											.	ZNF551	65	.	0			c.G980C						.						89.0	86.0	87.0					19																	58198623		2203	4300	6503	SO:0001583	missense	90233	exon3			ACCAGAGACGTCA	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.980G>C	chr19.hg19:g.58198623G>C	ENSP00000282296:p.Arg327Thr	77.0	0.0		75.0	23.0	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	hg19	CCDS12959.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.77|13.77	2.335484|2.335484	0.41398|0.41398	.|.	.|.	ENSG00000204519|ENSG00000228006	ENST00000356715;ENST00000282296|ENST00000541705	.|.	.|.	.|.	2.57|2.57	0.227|0.227	0.15359|0.15359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|0.202887	.|0.23021	.|U	.|0.052853	T|T	0.41627|0.41627	0.1167|0.1167	M|M	0.63169|0.63169	1.94|1.94	0.09310|0.09310	N|N	1|1	D|.	0.55385|.	0.971|.	B|.	0.42916|.	0.402|.	T|T	0.29027|0.29027	-1.0025|-1.0025	8|7	0.54805|0.40728	T|T	0.06|0.16	.|.	6.3397|6.3397	0.21316|0.21316	0.116:0.1864:0.6976:0.0|0.116:0.1864:0.6976:0.0	.|.	327|.	Q7Z340|.	ZN551_HUMAN|.	T|C	327;311|261	.|.	ENSP00000282296:R311T|ENSP00000437781:S261C	R|S	+|-	2|2	0|0	ZNF551|AC004017.1	62890435|62890435	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.025000|-0.025000	0.12413|0.12413	0.016000|0.016000	0.14998|0.14998	-0.258000|-0.258000	0.10820|0.10820	AGA|TCT	.	.		0.418	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
PNPLA3	80339	hgsc.bcm.edu	37	22	44328955	44328955	+	Silent	SNP	C	C	T			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr22:44328955C>T	ENST00000216180.3	+	4	857	c.684C>T	c.(682-684)ccC>ccT	p.P228P	PNPLA3_ENST00000423180.2_Silent_p.P224P|PNPLA3_ENST00000478713.1_3'UTR	NM_025225.2	NP_079501.2	Q9NST1	PLPL3_HUMAN	patatin-like phospholipase domain containing 3	228					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride catabolic process (GO:0019433)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	diolein transacylation activity (GO:0051265)|mono-olein transacylation activity (GO:0051264)|phospholipase A2 activity (GO:0004623)|triglyceride lipase activity (GO:0004806)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(3)|prostate(1)|skin(1)|stomach(2)	19		Ovarian(80;0.024)|all_neural(38;0.0416)				CTTTTGTCCCCCCGGATCTCA	0.542																																					p.P228P		Atlas-SNP	.											.	PNPLA3	53	.	0			c.C684T						.						111.0	103.0	106.0					22																	44328955		2203	4300	6503	SO:0001819	synonymous_variant	80339	exon4			TGTCCCCCCGGAT		CCDS14054.1	22q13.31	2014-03-14	2006-05-26	2006-05-26	ENSG00000100344	ENSG00000100344	3.1.1.3	"""Patatin-like phospholipase domain containing"""	18590	protein-coding gene	gene with protein product		609567	"""chromosome 22 open reading frame 20"", ""adiponutrin"""	C22orf20, ADPN		16799181, 19029121	Standard	NM_025225		Approved	dJ796I17.1, FLJ22012, adiponutrin, iPLA2epsilon	uc003bei.1	Q9NST1	OTTHUMG00000150555	ENST00000216180.3:c.684C>T	chr22.hg19:g.44328955C>T		80.0	0.0		121.0	22.0	NM_025225	B0QYI0|B2RCL3|B3KW00|Q6P1A1|Q96CB4	Silent	SNP	ENST00000216180.3	hg19	CCDS14054.1																																																																																			.	.		0.542	PNPLA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318891.1	NM_025225	
UBQLN2	29978	hgsc.bcm.edu	37	X	56590709	56590709	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chrX:56590709C>G	ENST00000338222.5	+	1	684	c.403C>G	c.(403-405)Cct>Gct	p.P135A		NM_013444.3	NP_038472.2	Q9UHD9	UBQL2_HUMAN	ubiquilin 2	135					cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)	21						TAACTCCACACCTATTTCCAC	0.577																																					p.P135A	Esophageal Squamous(104;218 1492 6022 10838 28884)	Atlas-SNP	.											.	UBQLN2	55	.	0			c.C403G						.						38.0	35.0	36.0					X																	56590709		2203	4300	6503	SO:0001583	missense	29978	exon1			TCCACACCTATTT	AF189009	CCDS14374.1	Xp11.21	2014-09-17			ENSG00000188021	ENSG00000188021		"""Ubiquilin family"""	12509	protein-coding gene	gene with protein product	"""NEDD4 binding protein 4"""	300264				10675567	Standard	NM_013444		Approved	Chap1, Dsk2, RIHFB2157, LIC-2, CHAP1/DSK2, PLIC-2, N4BP4, PLIC2	uc004dus.3	Q9UHD9	OTTHUMG00000021669	ENST00000338222.5:c.403C>G	chrX.hg19:g.56590709C>G	ENSP00000345195:p.Pro135Ala	138.0	0.0		127.0	19.0	NM_013444	O94798|Q5D027|Q9H3W6|Q9HAZ4	Missense_Mutation	SNP	ENST00000338222.5	hg19	CCDS14374.1	.	.	.	.	.	.	.	.	.	.	C	0.042	-1.282245	0.01398	.	.	ENSG00000188021	ENST00000338222;ENST00000535171	D	0.82803	-1.65	4.94	2.1	0.27182	.	0.450163	0.22458	N	0.059784	T	0.56396	0.1982	N	0.03608	-0.345	0.31421	N	0.674324	B;B	0.29481	0.245;0.032	B;B	0.27500	0.08;0.008	T	0.51841	-0.8654	10	0.18276	T	0.48	-0.1927	3.859	0.08988	0.0:0.5046:0.1767:0.3187	.	135;135	B4DZF1;Q9UHD9	.;UBQL2_HUMAN	A	135	ENSP00000345195:P135A	ENSP00000345195:P135A	P	+	1	0	UBQLN2	56607434	0.935000	0.31712	0.734000	0.30879	0.177000	0.22998	0.470000	0.22084	0.192000	0.20272	-0.217000	0.12591	CCT	.	.		0.577	UBQLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056891.1	NM_013444	
LONRF3	79836	hgsc.bcm.edu	37	X	118145797	118145797	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chrX:118145797A>G	ENST00000371628.3	+	8	1703	c.1672A>G	c.(1672-1674)Att>Gtt	p.I558V	LONRF3_ENST00000422289.2_Missense_Mutation_p.I302V|LONRF3_ENST00000472173.1_3'UTR|LONRF3_ENST00000304778.7_Missense_Mutation_p.I517V	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	558	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						GAATGTGCCTATTTTCGTGTG	0.433																																					p.I558V		Atlas-SNP	.											.	LONRF3	138	.	0			c.A1672G						.						339.0	255.0	283.0					X																	118145797		2203	4300	6503	SO:0001583	missense	79836	exon8			GTGCCTATTTTCG	AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1672A>G	chrX.hg19:g.118145797A>G	ENSP00000360690:p.Ile558Val	147.0	0.0		103.0	28.0	NM_001031855	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	ENST00000371628.3	hg19	CCDS35374.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	26.1|26.1	4.708470|4.708470	0.89018|0.89018	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	T;T;T;T|.	0.39592|.	1.07;1.07;1.07;1.07|.	6.07|6.07	6.07|6.07	0.98685|0.98685	Peptidase S16, lon N-terminal (1);PUA-like domain (1);|.	0.102234|.	0.64402|.	D|.	0.000017|.	T|T	0.64886|0.64886	0.2639|0.2639	L|L	0.53561|0.53561	1.675|1.675	0.48452|0.48452	D|D	0.999654|0.999654	D;P;D|.	0.71674|.	0.998;0.854;0.988|.	D;P;D|.	0.67725|.	0.951;0.747;0.953|.	T|T	0.62868|0.62868	-0.6763|-0.6763	10|5	0.27785|.	T|.	0.31|.	-16.9782|-16.9782	14.5728|14.5728	0.68224|0.68224	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	302;517;558|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	V|C	517;517;558;302|323	ENSP00000360691:I517V;ENSP00000307732:I517V;ENSP00000360690:I558V;ENSP00000408894:I302V|.	ENSP00000307732:I517V|.	I|Y	+|+	1|2	0|0	LONRF3|LONRF3	118029825|118029825	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	9.339000|9.339000	0.96797|0.96797	2.041000|2.041000	0.60428|0.60428	0.481000|0.481000	0.45027|0.45027	ATT|TAT	.	.		0.433	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355124.2	NM_024778	
PCK1	5105	hgsc.bcm.edu	37	20	56137828	56137828	+	Frame_Shift_Del	DEL	G	G	-	rs530695277		TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr20:56137828delG	ENST00000319441.4	+	4	647	c.483delG	c.(481-483)acgfs	p.T161fs	PCK1_ENST00000543666.1_Intron|PCK1_ENST00000535860.1_Frame_Shift_Del_p.T29fs	NM_002591.3	NP_002582.3	P35558	PCKGC_HUMAN	phosphoenolpyruvate carboxykinase 1 (soluble)	161					carbohydrate metabolic process (GO:0005975)|drug metabolic process (GO:0017144)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process from pyruvate (GO:0046327)|internal protein amino acid acetylation (GO:0006475)|oxaloacetate metabolic process (GO:0006107)|response to activity (GO:0014823)|response to insulin (GO:0032868)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	carboxylic acid binding (GO:0031406)|GDP binding (GO:0019003)|GTP binding (GO:0005525)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoenolpyruvate carboxykinase (GTP) activity (GO:0004613)			endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(19)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	34	Lung NSC(12;0.000764)|all_lung(29;0.00264)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;9.88e-12)|Epithelial(14;3.41e-08)|all cancers(14;2.13e-07)			TCGAGCTGACGGATTCACCCT	0.612																																					p.T161fs		Atlas-Indel,Pindel	.											PCK1,colon,carcinoma,0,1	PCK1	95	.	0			c.482delC						.						73.0	61.0	65.0					20																	56137828		2203	4300	6503	SO:0001589	frameshift_variant	5105	exon4			.		CCDS13460.1	20q13.31	2007-11-06			ENSG00000124253	ENSG00000124253	4.1.1.32		8724	protein-coding gene	gene with protein product		614168				1492743	Standard	NM_002591		Approved	PEPCK-C	uc002xyn.4	P35558	OTTHUMG00000032825	ENST00000319441.4:c.483delG	chr20.hg19:g.56137828delG	ENSP00000319814:p.Thr161fs	136.0	0.0		140.0	29.0	NM_002591	A8K437|B4DT64|Q8TCA3|Q9UJD2	Frame_Shift_Del	DEL	ENST00000319441.4	hg19	CCDS13460.1																																																																																			.	.		0.612	PCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079851.2		
AXIN1	8312	hgsc.bcm.edu	37	16	396352	396352	+	Frame_Shift_Del	DEL	C	C	-			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr16:396352delC	ENST00000262320.3	-	2	1045	c.674delG	c.(673-675)agcfs	p.S226fs	AXIN1_ENST00000481769.1_Intron|AXIN1_ENST00000354866.3_Frame_Shift_Del_p.S226fs	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	226	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TGACCCAGAGCTCTGGTCACT	0.493																																					p.S225fs		Atlas-INDEL	.											.	AXIN1	290	.	0			c.675delC						.						92.0	90.0	91.0					16																	396352		2203	4300	6503	SO:0001589	frameshift_variant	8312	exon2			.	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.674delG	chr16.hg19:g.396352delC	ENSP00000262320:p.Ser226fs	59.0	0.0		56.0	10.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	hg19	CCDS10405.1																																																																																			.	.		0.493	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
WRN	7486	hgsc.bcm.edu	37	8	30941291	30941351	+	Splice_Site	DEL	TTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	TTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	-	rs182813211|rs2737325	byFrequency	TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	TTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	TTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr8:30941291_30941351delTTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	ENST00000298139.5	+	10	1595_1599	c.1346_1350delTTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT	c.(1345-1350)cttaag>c	p.LK449fs		NM_000553.4	NP_000544.2	Q14191	WRN_HUMAN	Werner syndrome, RecQ helicase-like	449	2 X 27 AA tandem repeats of H-L-S-P-N-D- N-E-N-D-T-S-Y-V-I-E-S-D-E-D-L-E-M-E-M-L- K.				aging (GO:0007568)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to starvation (GO:0009267)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA replication (GO:0006260)|DNA synthesis involved in DNA repair (GO:0000731)|double-strand break repair (GO:0006302)|multicellular organismal aging (GO:0010259)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleolus to nucleoplasm transport (GO:0032066)|positive regulation of hydrolase activity (GO:0051345)|regulation of apoptotic process (GO:0042981)|regulation of growth rate (GO:0040009)|replication fork processing (GO:0031297)|replicative cell aging (GO:0001302)|response to oxidative stress (GO:0006979)|response to UV-C (GO:0010225)|telomere maintenance (GO:0000723)	centrosome (GO:0005813)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	3'-5' DNA helicase activity (GO:0043138)|3'-5' exonuclease activity (GO:0008408)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|exonuclease activity (GO:0004527)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|Y-form DNA binding (GO:0000403)			central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(13)|lung(28)|ovary(3)|skin(3)|upper_aerodigestive_tract(3)	60		Breast(100;0.195)		KIRC - Kidney renal clear cell carcinoma(542;0.147)|Kidney(114;0.176)|Colorectal(111;0.192)		ATGGAGATGCTTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATTAAGTAAAATA	0.261			"""Mis, N, F, S"""			"""osteosarcoma, meningioma, others"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Werner syndrome																												p.449_450del	Ovarian(18;161 598 2706 14834 27543)	Pindel	.	yes	Rec		Werner Syndrome	8	8p12-p11.2	7486	Werner syndrome (RECQL2)		"""L, E, M, O"""	.	WRN	116	.	0			c.1345_1350del						.																																			SO:0001630	splice_region_variant	7486	exon10	Familial Cancer Database	WS, Adult Progeria	.		CCDS6082.1	8p12	2014-09-17	2009-03-19		ENSG00000165392	ENSG00000165392			12791	protein-coding gene	gene with protein product		604611	"""Werner syndrome"""			9288107	Standard	NM_000553		Approved	RECQL2, RECQ3	uc003xio.4	Q14191	OTTHUMG00000163894	ENST00000298139.5:c.1350+1TTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT>-	chr8.hg19:g.30941291_30941351delTTAAGGTATGTTTACAATTATAAAAATATTACTTCAAGTTCTTTCCAAAGGACATTTAATT		160.0	0.0		188.0	18.0	NM_000553	A1KYY9	In_Frame_Del	DEL	ENST00000298139.5	hg19	CCDS6082.1																																																																																			.	.		0.261	WRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376248.1		Frame_Shift_Del
AXIN1	8312	hgsc.bcm.edu	37	16	396352	396353	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-CC-A5UC-01A-11D-A28X-10	TCGA-CC-A5UC-10A-01D-A28X-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	14c093b0-daba-46f0-9fee-73efbe76cc2b	0e3769b2-9456-4937-bd2b-27960a8ab40c	g.chr16:396352_396353delCT	ENST00000262320.3	-	2	1044_1045	c.673_674delAG	c.(673-675)agcfs	p.S226fs	AXIN1_ENST00000481769.1_Intron|AXIN1_ENST00000354866.3_Frame_Shift_Del_p.S226fs	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	226	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				TGACCCAGAGCTCTGGTCACTA	0.495																																					p.225_225del		Pindel	.											.	AXIN1	290	.	0			c.674_675del						.																																			SO:0001589	frameshift_variant	8312	exon2			.	AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.673_674delAG	chr16.hg19:g.396354_396355delCT	ENSP00000262320:p.Ser226fs	60.0	0.0		56.0	10.0	NM_003502	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Frame_Shift_Del	DEL	ENST00000262320.3	hg19	CCDS10405.1																																																																																			.	.		0.495	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139441.3		
