#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SCNN1D	6339	hgsc.bcm.edu	37	1	1223365	1223365	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:1223365G>T	ENST00000338555.2	+	9	2262	c.1118G>T	c.(1117-1119)gGc>gTc	p.G373V	SCNN1D_ENST00000379116.5_Missense_Mutation_p.G537V|SCNN1D_ENST00000400928.3_Missense_Mutation_p.G373V|SCNN1D_ENST00000325425.8_Missense_Mutation_p.G439V			P51172	SCNND_HUMAN	sodium channel, non-voltage-gated 1, delta subunit	373					ion transmembrane transport (GO:0034220)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	actin cytoskeleton (GO:0015629)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ligand-gated sodium channel activity (GO:0015280)			lung(6)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;3.01e-35)|OV - Ovarian serous cystadenocarcinoma(86;2.46e-21)|Colorectal(212;0.000157)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00229)|BRCA - Breast invasive adenocarcinoma(365;0.00251)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.034)|Lung(427;0.199)	Amiloride(DB00594)|Triamterene(DB00384)	TGCACCGCCGGCGGGGAAGGC	0.711																																					p.G537V		Atlas-SNP	.											.	SCNN1D	60	.	0			c.G1610T						.						6.0	8.0	7.0					1																	1223365		1996	4043	6039	SO:0001583	missense	6339	exon12			CCGCCGGCGGGGA	U38254	CCDS44037.1, CCDS44037.2	1p36.3-p36.2	2012-02-28	2012-02-28		ENSG00000162572	ENSG00000162572		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10601	protein-coding gene	gene with protein product		601328	"""sodium channel, nonvoltage-gated 1, delta"", ""sodium channel, non-voltage-gated 1, delta"""			8661065	Standard	NM_001130413		Approved	ENaCdelta, dNaCh	uc001adt.1	P51172	OTTHUMG00000002081	ENST00000338555.2:c.1118G>T	chr1.hg19:g.1223365G>T	ENSP00000339504:p.Gly373Val	150.0	0.0		105.0	52.0	NM_001130413	A9Z1X6|B1PS44|Q08AQ3|Q09HT0|Q5T7L3|Q8NA24	Missense_Mutation	SNP	ENST00000338555.2	hg19		.	.	.	.	.	.	.	.	.	.	G	13.85	2.359030	0.41801	.	.	ENSG00000162572	ENST00000379110;ENST00000379116;ENST00000338555;ENST00000325425;ENST00000400928	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	3.48	1.5	0.22942	.	0.449819	0.18883	U	0.128527	T	0.68650	0.3024	M	0.64997	1.995	0.09310	N	0.999997	D;D;D	0.60160	0.971;0.971;0.987	P;P;P	0.61722	0.856;0.893;0.737	T	0.56786	-0.7921	10	0.44086	T	0.13	.	7.8758	0.29592	0.3149:0.0:0.6851:0.0	.	195;373;537	B1AMF2;P51172;A6NNF7	.;SCNND_HUMAN;.	V	404;537;373;439;373	ENSP00000368411:G537V;ENSP00000339504:G373V;ENSP00000321594:G439V;ENSP00000383717:G373V	ENSP00000321594:G439V	G	+	2	0	SCNN1D	1213228	0.005000	0.15991	0.000000	0.03702	0.000000	0.00434	1.731000	0.38135	0.597000	0.29811	-0.671000	0.03813	GGC	.	.		0.711	SCNN1D-001	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000005802.2	NM_002978	
PRDM16	63976	hgsc.bcm.edu	37	1	3328344	3328344	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:3328344T>A	ENST00000270722.5	+	9	1632	c.1583T>A	c.(1582-1584)cTg>cAg	p.L528Q	PRDM16_ENST00000442529.2_Missense_Mutation_p.L528Q|PRDM16_ENST00000511072.1_Missense_Mutation_p.L529Q|PRDM16_ENST00000512462.1_3'UTR|PRDM16_ENST00000441472.2_Missense_Mutation_p.L528Q|PRDM16_ENST00000378391.2_Missense_Mutation_p.L528Q|PRDM16_ENST00000514189.1_Missense_Mutation_p.L529Q|PRDM16_ENST00000378398.3_Missense_Mutation_p.L529Q			Q9HAZ2	PRD16_HUMAN	PR domain containing 16	528	Pro-rich.				brown fat cell differentiation (GO:0050873)|negative regulation of granulocyte differentiation (GO:0030853)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurogenesis (GO:0022008)|palate development (GO:0060021)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cellular respiration (GO:0043457)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(3)	59	all_cancers(77;0.00208)|all_epithelial(69;0.000732)|Ovarian(185;0.0634)|Lung NSC(156;0.109)|all_lung(157;0.111)	all_epithelial(116;2.03e-21)|all_lung(118;7.55e-09)|Lung NSC(185;1.28e-06)|Breast(487;0.000792)|Renal(390;0.00137)|Hepatocellular(190;0.00515)|Myeloproliferative disorder(586;0.0267)|Ovarian(437;0.0365)|Lung SC(97;0.114)|Medulloblastoma(700;0.134)		Epithelial(90;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.99e-20)|GBM - Glioblastoma multiforme(42;3.72e-11)|Colorectal(212;0.000425)|BRCA - Breast invasive adenocarcinoma(365;0.000946)|COAD - Colon adenocarcinoma(227;0.000968)|Kidney(185;0.00155)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0175)|Lung(427;0.137)		CGGCCGCCTCTGCTACCTCCC	0.706			T	EVI1	"""MDS, AML"""																																p.L528Q		Atlas-SNP	.		Dom	yes		1	1p36.23-p33	63976	PR domain containing 16		L	.	PRDM16	147	.	0			c.T1583A						.						63.0	81.0	75.0					1																	3328344		1932	4125	6057	SO:0001583	missense	63976	exon9			CGCCTCTGCTACC	AF294278	CCDS41236.1, CCDS44048.1, CCDS41236.2, CCDS44048.2	1p36.23-p33	2013-01-08			ENSG00000142611	ENSG00000142611		"""Zinc fingers, C2H2-type"""	14000	protein-coding gene	gene with protein product	"""MDS1/EVI1-like"", ""PR-domain zinc finger protein 16"", ""transcription factor MEL1"""	605557				11050005	Standard	NM_199454		Approved	MEL1, PFM13, KIAA1675, MGC166915	uc001akf.3	Q9HAZ2	OTTHUMG00000000581	ENST00000270722.5:c.1583T>A	chr1.hg19:g.3328344T>A	ENSP00000270722:p.Leu528Gln	50.0	0.0		27.0	10.0	NM_022114	A6NHQ8|B1AJP7|B1AJP8|B1AJP9|B1WB48|Q8WYJ9|Q9C0I8	Missense_Mutation	SNP	ENST00000270722.5	hg19	CCDS41236.2	.	.	.	.	.	.	.	.	.	.	T	19.77	3.889585	0.72524	.	.	ENSG00000142611	ENST00000511072;ENST00000378398;ENST00000441472;ENST00000442529;ENST00000378391;ENST00000514189;ENST00000270722;ENST00000512462;ENST00000408992;ENST00000509860	T;T;T;T;T;T;T;T;T	0.09538	2.99;3.03;3.04;3.03;3.03;3.02;3.04;2.97;2.99	5.33	5.33	0.75918	.	0.000000	0.40064	U	0.001198	T	0.34135	0.0887	M	0.75264	2.295	0.48185	D	0.999608	D;D;D;D	0.89917	0.993;1.0;1.0;1.0	P;D;D;D	0.97110	0.77;0.999;1.0;0.999	T	0.09684	-1.0663	10	0.87932	D	0	.	15.3332	0.74231	0.0:0.0:0.0:1.0	.	528;528;528;528	Q9HAZ2;Q9HAZ2-2;F8WEV3;D3YTA5	PRD16_HUMAN;.;.;.	Q	529;529;528;528;528;529;528;344;344;337	ENSP00000426975:L529Q;ENSP00000367651:L529Q;ENSP00000407968:L528Q;ENSP00000405253:L528Q;ENSP00000367643:L528Q;ENSP00000421400:L529Q;ENSP00000270722:L528Q;ENSP00000422504:L344Q;ENSP00000425796:L337Q	ENSP00000270722:L528Q	L	+	2	0	PRDM16	3318204	1.000000	0.71417	0.920000	0.36463	0.995000	0.86356	6.179000	0.71974	2.042000	0.60477	0.491000	0.48974	CTG	.	.		0.706	PRDM16-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000001382.3	NM_022114	
KIF1B	23095	hgsc.bcm.edu	37	1	10384901	10384901	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:10384901A>C	ENST00000377086.1	+	26	2825	c.2623A>C	c.(2623-2625)Act>Cct	p.T875P	KIF1B_ENST00000377081.1_Missense_Mutation_p.T875P|KIF1B_ENST00000263934.6_Missense_Mutation_p.T829P			O60333	KIF1B_HUMAN	kinesin family member 1B	875					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		AACCACTGTGACTGGCAGCGA	0.448																																					p.T829P		Atlas-SNP	.											.	KIF1B	242	.	0			c.A2485C						.						180.0	169.0	173.0					1																	10384901		2203	4300	6503	SO:0001583	missense	23095	exon24			ACTGTGACTGGCA	AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2623A>C	chr1.hg19:g.10384901A>C	ENSP00000366290:p.Thr875Pro	78.0	0.0		83.0	35.0	NM_015074	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	ENST00000377086.1	hg19		.	.	.	.	.	.	.	.	.	.	A	18.81	3.703957	0.68501	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.75938	-0.98;-0.98;-0.98	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.80276	0.4593	L	0.35723	1.085	0.80722	D	1	D;D;D;D;D;D	0.76494	0.99;0.979;0.993;0.992;0.999;0.997	D;P;D;D;D;D	0.78314	0.944;0.906;0.944;0.93;0.958;0.991	T	0.77968	-0.2388	10	0.30078	T	0.28	.	16.2194	0.82247	1.0:0.0:0.0:0.0	.	861;835;875;849;875;829	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	P	875;829;875;875	ENSP00000263934:T829P;ENSP00000366290:T875P;ENSP00000366284:T875P	ENSP00000263934:T829P	T	+	1	0	KIF1B	10307488	1.000000	0.71417	0.997000	0.53966	0.961000	0.63080	9.339000	0.96797	2.234000	0.73211	0.528000	0.53228	ACT	.	.		0.448	KIF1B-001	NOVEL	basic	protein_coding	protein_coding	OTTHUMT00000005102.1		
PLA2G2F	64600	hgsc.bcm.edu	37	1	20474788	20474788	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:20474788T>A	ENST00000375102.3	+	5	632	c.530T>A	c.(529-531)cTc>cAc	p.L177H		NM_022819.3	NP_073730.3	Q9BZM2	PA2GF_HUMAN	phospholipase A2, group IIF	134					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000247)|Lung NSC(340;0.000285)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.13e-05)|BRCA - Breast invasive adenocarcinoma(304;8.01e-05)|Kidney(64;0.00017)|GBM - Glioblastoma multiforme(114;0.000524)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.198)		CGTGGCTTCCTCAATGTCTAC	0.582																																					p.L177H		Atlas-SNP	.											.	PLA2G2F	28	.	0			c.T530A						.						173.0	143.0	153.0					1																	20474788		2203	4300	6503	SO:0001583	missense	64600	exon5			GCTTCCTCAATGT	AL158172	CCDS204.2	1p35	2008-09-19			ENSG00000158786	ENSG00000158786	3.1.1.4		30040	protein-coding gene	gene with protein product						11112443	Standard	NM_022819		Approved		uc009vpp.1	Q9BZM2	OTTHUMG00000002704	ENST00000375102.3:c.530T>A	chr1.hg19:g.20474788T>A	ENSP00000364243:p.Leu177His	310.0	1.0		193.0	81.0	NM_022819	Q5R385|Q8N217|Q9H506	Missense_Mutation	SNP	ENST00000375102.3	hg19	CCDS204.2	.	.	.	.	.	.	.	.	.	.	T	8.916	0.959937	0.18507	.	.	ENSG00000158786	ENST00000375102	D	0.83506	-1.73	5.19	5.19	0.71726	.	0.292816	0.24750	N	0.035913	D	0.87581	0.6213	M	0.69358	2.11	0.29667	N	0.842809	D	0.89917	1.0	D	0.69479	0.964	T	0.81621	-0.0850	10	0.15499	T	0.54	-24.8592	11.431	0.50041	0.0:0.0:0.0:1.0	.	177	Q9BZM2-2	.	H	177	ENSP00000364243:L177H	ENSP00000364243:L177H	L	+	2	0	PLA2G2F	20347375	1.000000	0.71417	0.997000	0.53966	0.019000	0.09904	2.345000	0.44018	1.967000	0.57214	0.460000	0.39030	CTC	.	.		0.582	PLA2G2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007687.1	NM_022819	
ARID1A	8289	hgsc.bcm.edu	37	1	27107029	27107029	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:27107029A>T	ENST00000324856.7	+	20	7011	c.6640A>T	c.(6640-6642)Agc>Tgc	p.S2214C	ARID1A_ENST00000540690.1_Missense_Mutation_p.S542C|ARID1A_ENST00000374152.2_Missense_Mutation_p.S1831C|ARID1A_ENST00000457599.2_Missense_Mutation_p.S1997C	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	2214					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GAGCCAGGCCAGCCTCCTCCA	0.627			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.S2214C		Atlas-SNP	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.A6640T						.						69.0	68.0	69.0					1																	27107029		2203	4300	6503	SO:0001583	missense	8289	exon20			CAGGCCAGCCTCC	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.6640A>T	chr1.hg19:g.27107029A>T	ENSP00000320485:p.Ser2214Cys	124.0	0.0		90.0	38.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Missense_Mutation	SNP	ENST00000324856.7	hg19	CCDS285.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.74|12.74	2.027754|2.027754	0.35797|0.35797	.|.	.|.	ENSG00000117713|ENSG00000117713	ENST00000430799|ENST00000324856;ENST00000457599;ENST00000374152;ENST00000540690	.|T;T;T;T	.|0.36699	.|1.24;1.24;1.24;1.24	4.6|4.6	4.6|4.6	0.57074|0.57074	.|Armadillo-like helical (1);	.|0.183447	.|0.50627	.|D	.|0.000103	T|T	0.50531|0.50531	0.1621|0.1621	M|M	0.63428|0.63428	1.95|1.95	0.34106|0.34106	D|D	0.662488|0.662488	.|D;D;D	.|0.76494	.|0.999;0.999;0.998	.|P;D;P	.|0.68192	.|0.871;0.956;0.891	T|T	0.63620|0.63620	-0.6596|-0.6596	5|10	.|0.52906	.|T	.|0.07	-10.5505|-10.5505	6.9016|6.9016	0.24285|0.24285	0.8215:0.0:0.1785:0.0|0.8215:0.0:0.1785:0.0	.|.	.|1831;2214;1997	.|O14497-3;O14497;O14497-2	.|.;ARI1A_HUMAN;.	L|C	1110|2214;1997;1831;542	.|ENSP00000320485:S2214C;ENSP00000387636:S1997C;ENSP00000363267:S1831C;ENSP00000442437:S542C	.|ENSP00000320485:S2214C	Q|S	+|+	2|1	0|0	ARID1A|ARID1A	26979616|26979616	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	2.502000|2.502000	0.45398|0.45398	2.063000|2.063000	0.61619|0.61619	0.482000|0.482000	0.46254|0.46254	CAG|AGC	.	.		0.627	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
MAP3K6	9064	hgsc.bcm.edu	37	1	27684710	27684710	+	Silent	SNP	C	C	T	rs376956203		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:27684710C>T	ENST00000493901.1	-	22	3116	c.2877G>A	c.(2875-2877)ccG>ccA	p.P959P	MAP3K6_ENST00000374040.3_Silent_p.P951P|MAP3K6_ENST00000357582.2_Silent_p.P959P	NM_004672.3	NP_004663.3	O95382	M3K6_HUMAN	mitogen-activated protein kinase kinase kinase 6	959					activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)			breast(4)|central_nervous_system(2)|lung(3)|ovary(1)	10		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.69e-27)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00132)|KIRC - Kidney renal clear cell carcinoma(1967;0.00163)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		GGCAGCGCTTCGGGGGGCTGG	0.607											OREG0013282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P959P		Atlas-SNP	.											.	MAP3K6	134	.	0			c.G2877A						.	C		1,4405	2.1+/-5.4	0,1,2202	58.0	68.0	64.0		2877	-9.6	0.5	1		64	0,8600		0,0,4300	no	coding-synonymous	MAP3K6	NM_004672.3		0,1,6502	TT,TC,CC		0.0,0.0227,0.0077		959/1289	27684710	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9064	exon21			GCGCTTCGGGGGG	AF100318	CCDS299.1, CCDS72738.1	1p36.11	2011-06-09			ENSG00000142733	ENSG00000142733		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6858	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 2"""	604468				9875215	Standard	XM_005246029		Approved	MAPKKK6, ASK2, MEKK6	uc001bny.1	O95382	OTTHUMG00000004631	ENST00000493901.1:c.2877G>A	chr1.hg19:g.27684710C>T		128.0	0.0	796	96.0	43.0	NM_004672	A2ACE8|A2VDG4|A2VDG5|Q59HF4|Q5SSD4|Q75PK3|Q96B75	Silent	SNP	ENST00000493901.1	hg19	CCDS299.1	.	.	.	.	.	.	.	.	.	.	C	9.550	1.115587	0.20795	2.27E-4	0.0	ENSG00000142733	ENST00000472410	.	.	.	4.82	-9.64	0.00541	.	.	.	.	.	T	0.46560	0.1399	.	.	.	0.50039	D	0.999841	.	.	.	.	.	.	T	0.55768	-0.8089	4	.	.	.	.	8.4087	0.32629	0.0:0.2498:0.4034:0.3468	.	.	.	.	Q	683	.	.	R	-	2	0	MAP3K6	27557297	0.000000	0.05858	0.530000	0.27963	0.964000	0.63967	-4.514000	0.00222	-2.160000	0.00786	-0.143000	0.13931	CGA	.	.		0.607	MAP3K6-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000013469.2	NM_004672	
CSMD2	114784	hgsc.bcm.edu	37	1	34038176	34038176	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:34038176G>A	ENST00000373381.4	-	50	7868	c.7692C>T	c.(7690-7692)ggC>ggT	p.G2564G		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2566	Sushi 15. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				TGGCCTCAGCGCCTGCCTGGA	0.587																																					p.G2566G		Atlas-SNP	.											CSMD2_ENST00000373381,colon,carcinoma,0,2	CSMD2	946	.	0			c.C7698T						.						140.0	118.0	125.0					1																	34038176		2203	4300	6503	SO:0001819	synonymous_variant	114784	exon51			CTCAGCGCCTGCC	AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.7692C>T	chr1.hg19:g.34038176G>A		107.0	0.0		87.0	35.0	NM_052896	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	ENST00000373381.4	hg19																																																																																				.	.		0.587	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_052896	
MTF1	4520	hgsc.bcm.edu	37	1	38287832	38287832	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:38287832T>G	ENST00000373036.4	-	9	1868	c.1728A>C	c.(1726-1728)ttA>ttC	p.L576F		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	576					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				TGGCACCATTTAATATCCATT	0.408																																					p.L576F		Atlas-SNP	.											.	MTF1	67	.	0			c.A1728C						.						151.0	145.0	147.0					1																	38287832		2203	4300	6503	SO:0001583	missense	4520	exon9			ACCATTTAATATC	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1728A>C	chr1.hg19:g.38287832T>G	ENSP00000362127:p.Leu576Phe	233.0	0.0		163.0	78.0	NM_005955	B2RAK6|Q96CB1	Missense_Mutation	SNP	ENST00000373036.4	hg19	CCDS30676.1	.	.	.	.	.	.	.	.	.	.	T	16.99	3.273522	0.59649	.	.	ENSG00000188786	ENST00000373036	T	0.56611	0.45	5.85	-3.48	0.04739	.	0.000000	0.64402	D	0.000001	T	0.60843	0.2300	L	0.58810	1.83	0.39847	D	0.97318	D	0.76494	0.999	D	0.85130	0.997	T	0.62978	-0.6739	10	0.87932	D	0	.	9.4143	0.38512	0.0:0.3386:0.0987:0.5627	.	576	Q14872	MTF1_HUMAN	F	576	ENSP00000362127:L576F	ENSP00000362127:L576F	L	-	3	2	MTF1	38060419	0.975000	0.34042	0.991000	0.47740	0.997000	0.91878	0.006000	0.13152	-0.377000	0.07930	0.459000	0.35465	TTA	.	.		0.408	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
CCDC30	728621	hgsc.bcm.edu	37	1	43055011	43055011	+	Missense_Mutation	SNP	G	G	A	rs145632548		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:43055011G>A	ENST00000340612.4	+	8	1240	c.1240G>A	c.(1240-1242)Gta>Ata	p.V414I	CCDC30_ENST00000342022.4_Missense_Mutation_p.V414I|CCDC30_ENST00000507855.1_Missense_Mutation_p.V203I|CCDC30_ENST00000390640.4_Missense_Mutation_p.V203I|CCDC30_ENST00000428554.2_Missense_Mutation_p.V414I			Q5VVM6	CCD30_HUMAN	coiled-coil domain containing 30	414						extracellular vesicular exosome (GO:0070062)		p.V414I(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	30						ATATCAGAACGTAGATGAGTT	0.368																																					p.V414I		Atlas-SNP	.											CCDC30,NS,carcinoma,0,1	CCDC30	78	.	1	Substitution - Missense(1)	endometrium(1)	c.G1240A						.	G	ILE/VAL	2,4404	4.2+/-10.8	0,2,2201	81.0	81.0	81.0		1240	-3.7	0.0	1	dbSNP_134	81	0,8600		0,0,4300	no	missense	CCDC30	NM_001080850.2	29	0,2,6501	AA,AG,GG		0.0,0.0454,0.0154	benign	414/784	43055011	2,13004	2203	4300	6503	SO:0001583	missense	728621	exon9			CAGAACGTAGATG	AY639646	CCDS30690.1	1p34.2	2009-07-09			ENSG00000186409	ENSG00000186409			26103	protein-coding gene	gene with protein product	"""prefoldin 6-like"""					16710767	Standard	NM_001080850		Approved	FLJ20972, PFD6L, LOC728621	uc009vwk.1	Q5VVM6	OTTHUMG00000007334	ENST00000340612.4:c.1240G>A	chr1.hg19:g.43055011G>A	ENSP00000340378:p.Val414Ile	67.0	0.0		46.0	18.0	NM_001080850	Q14F06|Q5VVM5	Missense_Mutation	SNP	ENST00000340612.4	hg19	CCDS30690.1	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.746155	0.00669	4.54E-4	0.0	ENSG00000186409	ENST00000428554;ENST00000507855;ENST00000340612;ENST00000342022;ENST00000390640	T;T;T;T;T	0.46819	0.86;0.9;0.86;0.86;0.9	5.08	-3.69	0.04450	.	1.492440	0.03555	N	0.226154	T	0.21186	0.0510	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.18741	0.003;0.002;0.03	B;B;B	0.08055	0.003;0.002;0.002	T	0.11792	-1.0573	10	0.21540	T	0.41	.	6.8615	0.24069	0.4497:0.0:0.4358:0.1145	.	414;198;203	Q5VVM6;Q6N081;Q5VVM6-2	CCD30_HUMAN;.;.	I	414;203;414;414;203	ENSP00000397035:V414I;ENSP00000426711:V203I;ENSP00000340378:V414I;ENSP00000339280:V414I;ENSP00000375051:V203I	ENSP00000340378:V414I	V	+	1	0	CCDC30	42827598	0.000000	0.05858	0.005000	0.12908	0.014000	0.08584	-0.827000	0.04424	-1.298000	0.02348	-1.579000	0.00862	GTA	.	G|1.000;A|0.000		0.368	CCDC30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019524.3	NM_025030	
LRIG2	9860	hgsc.bcm.edu	37	1	113655151	113655151	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:113655151G>T	ENST00000361127.5	+	14	2047	c.1849G>T	c.(1849-1851)Gcc>Tcc	p.A617S	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	617	Ig-like C2-type 2.				innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TCGCACTGGTGCCATGGCCAG	0.488																																					p.A617S		Atlas-SNP	.											.	LRIG2	67	.	0			c.G1849T						.						148.0	140.0	142.0					1																	113655151		2203	4300	6503	SO:0001583	missense	9860	exon14			ACTGGTGCCATGG	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.1849G>T	chr1.hg19:g.113655151G>T	ENSP00000355396:p.Ala617Ser	123.0	0.0		79.0	17.0	NM_014813	Q9NSN2	Missense_Mutation	SNP	ENST00000361127.5	hg19	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	G	14.98	2.696152	0.48202	.	.	ENSG00000198799	ENST00000361127	T	0.75477	-0.94	5.45	5.45	0.79879	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.052902	0.85682	D	0.000000	T	0.37100	0.0991	N	0.01624	-0.795	0.41346	D	0.987332	B	0.21753	0.06	B	0.29353	0.101	T	0.42882	-0.9425	10	0.17832	T	0.49	.	19.2881	0.94087	0.0:0.0:1.0:0.0	.	617	O94898	LRIG2_HUMAN	S	617	ENSP00000355396:A617S	ENSP00000355396:A617S	A	+	1	0	LRIG2	113456674	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.091000	0.64505	2.560000	0.86352	0.591000	0.81541	GCC	.	.		0.488	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144854658	144854658	+	Splice_Site	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:144854658T>A	ENST00000369354.3	-	42	7003		c.e42-2		PDE4DIP_ENST00000524974.1_Splice_Site|PDE4DIP_ENST00000369356.4_Splice_Site|PDE4DIP_ENST00000313382.9_Splice_Site|PDE4DIP_ENST00000530740.1_Splice_Site|PDE4DIP_ENST00000369359.4_Splice_Site			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		TGATTCTCCCTGGATAAGAGG	0.468			T	PDGFRB	MPD																																.		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.6814-2A>T						.						206.0	184.0	191.0					1																	144854658		2203	4300	6503	SO:0001630	splice_region_variant	9659	exon43			TCTCCCTGGATAA	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.6814-2A>T	chr1.hg19:g.144854658T>A		126.0	0.0		145.0	9.0	NM_001198834	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Splice_Site	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	.	12.59	1.985123	0.35036	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.	.	.	3.82	3.82	0.43975	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.8488	0.24003	0.2071:0.0:0.0:0.7929	.	.	.	.	.	-1	.	.	.	-	.	.	PDE4DIP	143566015	1.000000	0.71417	0.951000	0.38953	0.219000	0.24729	5.810000	0.69179	1.542000	0.49330	0.363000	0.22086	.	.	.		0.468	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	Intron
NBPF10	100132406	hgsc.bcm.edu	37	1	145367800	145367800	+	Missense_Mutation	SNP	G	G	A	rs201525063		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:145367800G>A	ENST00000342960.5	+	83	10431	c.10396G>A	c.(10396-10398)Gat>Aat	p.D3466N	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	761						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.D3466N(1)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		aggggaagaagaTCAAAACCC	0.428																																					p.D3466N		Atlas-SNP	.											NBPF10,rectum,carcinoma,0,2	NBPF10	221	.	1	Substitution - Missense(1)	endometrium(1)	c.G10396A						.																																			SO:0001583	missense	100132406	exon83			GAAGAAGATCAAA	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10396G>A	chr1.hg19:g.145367800G>A	ENSP00000345684:p.Asp3466Asn	1.0	0.0		6.0	3.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	hg19	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	9.745	1.165911	0.21538	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.09723	2.95	.	.	.	.	.	.	.	.	T	0.11067	0.0270	M	0.85197	2.74	0.09310	N	1	.	.	.	.	.	.	T	0.11891	-1.0569	5	0.59425	D	0.04	.	.	.	.	.	.	.	.	N	586;3466	ENSP00000345684:D3466N	ENSP00000345684:D3466N	D	+	1	0	NBPF10	144079157	0.020000	0.18652	0.199000	0.23439	0.199000	0.23934	0.885000	0.28227	0.162000	0.19483	0.165000	0.16767	GAT	.	.		0.428	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
RNF115	27246	hgsc.bcm.edu	37	1	145688137	145688137	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:145688137A>T	ENST00000369291.5	+	9	1036	c.832A>T	c.(832-834)Act>Tct	p.T278S		NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						TGAGGACTCTACTCGGCAAAG	0.463																																					p.T278S		Atlas-SNP	.											.	RNF115	27	.	0			c.A832T						.						126.0	115.0	119.0					1																	145688137		2203	4300	6503	SO:0001583	missense	27246	exon9			GACTCTACTCGGC	AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.832A>T	chr1.hg19:g.145688137A>T	ENSP00000358297:p.Thr278Ser	166.0	0.0		242.0	61.0	NM_014455		Missense_Mutation	SNP	ENST00000369291.5	hg19	CCDS922.1	.	.	.	.	.	.	.	.	.	.	A	11.35	1.611452	0.28712	.	.	ENSG00000121848	ENST00000369291	T	0.11063	2.81	5.65	5.65	0.86999	Zinc finger, RING/FYVE/PHD-type (1);	0.095666	0.64402	D	0.000001	T	0.02380	0.0073	L	0.27053	0.805	0.34595	D	0.715882	P	0.34864	0.473	B	0.24848	0.056	T	0.33317	-0.9873	10	0.09338	T	0.73	-15.6679	13.8738	0.63638	1.0:0.0:0.0:0.0	.	278	Q9Y4L5	RN115_HUMAN	S	278	ENSP00000358297:T278S	ENSP00000358297:T278S	T	+	1	0	RNF115	144399494	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.984000	0.63838	2.371000	0.80710	0.533000	0.62120	ACT	.	.		0.463	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038554.2	NM_014455	
KPRP	448834	hgsc.bcm.edu	37	1	152732782	152732782	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:152732782T>A	ENST00000606109.1	+	1	746	c.718T>A	c.(718-720)Tat>Aat	p.Y240N	KPRP_ENST00000368773.1_Missense_Mutation_p.Y240N			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	240						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCAGGGCTCCTATGGGAGCTT	0.607																																					p.Y240N		Atlas-SNP	.											.	KPRP	152	.	0			c.T718A						.						66.0	72.0	70.0					1																	152732782		2203	4300	6503	SO:0001583	missense	448834	exon2			GGCTCCTATGGGA	AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.718T>A	chr1.hg19:g.152732782T>A	ENSP00000475216:p.Tyr240Asn	80.0	0.0		146.0	35.0	NM_001025231		Missense_Mutation	SNP	ENST00000606109.1	hg19	CCDS30862.1	.	.	.	.	.	.	.	.	.	.	T	13.16	2.153197	0.38021	.	.	ENSG00000203786	ENST00000368773	T	0.17213	2.29	5.52	3.04	0.35103	.	0.352416	0.20931	N	0.083090	T	0.09069	0.0224	L	0.32530	0.975	0.09310	N	1	P	0.51351	0.944	P	0.53722	0.733	T	0.07673	-1.0760	10	0.72032	D	0.01	-6.5442	5.4458	0.16535	0.0:0.0895:0.1749:0.7356	.	240	Q5T749	KPRP_HUMAN	N	240	ENSP00000357762:Y240N	ENSP00000357762:Y240N	Y	+	1	0	KPRP	150999406	0.003000	0.15002	0.003000	0.11579	0.300000	0.27592	1.321000	0.33678	1.028000	0.39785	-0.290000	0.09829	TAT	.	.		0.607	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034522.2	NM_001025231	
LCE1B	353132	hgsc.bcm.edu	37	1	152785001	152785001	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:152785001C>G	ENST00000360090.3	+	1	555	c.79C>G	c.(79-81)Cct>Gct	p.P27A		NM_178349.1	NP_848126.1	Q5T7P3	LCE1B_HUMAN	late cornified envelope 1B	27	Pro-rich.				keratinization (GO:0031424)					breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|skin(2)	18	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			gtgccTCACCCCTAGATGCCC	0.632																																					p.P27A		Atlas-SNP	.											.	LCE1B	45	.	0			c.C79G						.						98.0	99.0	99.0					1																	152785001		2203	4300	6503	SO:0001583	missense	353132	exon1			CTCACCCCTAGAT	BI670515	CCDS1027.1	1q21.3	2008-02-05	2004-10-11	2004-10-15	ENSG00000196734	ENSG00000196734		"""Late cornified envelopes"""	16611	protein-coding gene	gene with protein product		612604	"""small proline rich-like (epidermal differentiation complex) 2A"""	SPRL2A		11698679	Standard	NM_178349		Approved	LEP2	uc001faq.3	Q5T7P3	OTTHUMG00000014402	ENST00000360090.3:c.79C>G	chr1.hg19:g.152785001C>G	ENSP00000353203:p.Pro27Ala	245.0	1.0		367.0	174.0	NM_178349	A4IF40	Missense_Mutation	SNP	ENST00000360090.3	hg19	CCDS1027.1	.	.	.	.	.	.	.	.	.	.	C	1.808	-0.475384	0.04414	.	.	ENSG00000196734	ENST00000360090;ENST00000439693	T	0.04194	3.68	4.34	4.34	0.51931	.	0.000000	0.36740	N	0.002422	T	0.04679	0.0127	M	0.87180	2.865	0.09310	N	1	P	0.39282	0.666	B	0.35240	0.198	T	0.04840	-1.0923	10	0.87932	D	0	.	12.5252	0.56083	0.0:1.0:0.0:0.0	.	27	Q5T7P3	LCE1B_HUMAN	A	27	ENSP00000353203:P27A	ENSP00000353203:P27A	P	+	1	0	LCE1B	151051625	0.063000	0.20901	0.022000	0.16811	0.003000	0.03518	1.966000	0.40481	2.398000	0.81561	0.650000	0.86243	CCT	.	.		0.632	LCE1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040060.1	NM_178349	
ASH1L	55870	hgsc.bcm.edu	37	1	155449286	155449286	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:155449286T>A	ENST00000368346.3	-	3	4014	c.3375A>T	c.(3373-3375)gcA>gcT	p.A1125A	ASH1L_ENST00000392403.3_Silent_p.A1125A			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	1125					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CAACAAAACCTGCATCACTAC	0.463																																					p.A1125A		Atlas-SNP	.											.	ASH1L	279	.	0			c.A3375T						.						97.0	88.0	91.0					1																	155449286		2203	4300	6503	SO:0001819	synonymous_variant	55870	exon3			AAAACCTGCATCA	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.3375A>T	chr1.hg19:g.155449286T>A		142.0	0.0		186.0	52.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	hg19																																																																																				.	.		0.463	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
HAPLN2	60484	hgsc.bcm.edu	37	1	156594457	156594457	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:156594457T>A	ENST00000255039.1	+	6	1028	c.621T>A	c.(619-621)ccT>ccA	p.P207P	HAPLN2_ENST00000494218.1_3'UTR	NM_021817.2	NP_068589.1	Q9GZV7	HPLN2_HUMAN	hyaluronan and proteoglycan link protein 2	207	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				cell adhesion (GO:0007155)|establishment of blood-nerve barrier (GO:0008065)|extracellular matrix assembly (GO:0085029)	proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			NS(1)|endometrium(2)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	7	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCGCTACCCTGTGCTCACCG	0.731																																					p.P207P		Atlas-SNP	.											.	HAPLN2	20	.	0			c.T621A						.						11.0	13.0	13.0					1																	156594457		2186	4290	6476	SO:0001819	synonymous_variant	60484	exon6			CTACCCTGTGCTC	AB049054	CCDS1148.1	1q23.1	2013-01-11			ENSG00000132702	ENSG00000132702		"""Immunoglobulin superfamily / V-set domain containing"""	17410	protein-coding gene	gene with protein product	"""brain link protein 1"""					11027579, 11873941	Standard	NM_021817		Approved	BRAL1	uc001fpn.1	Q9GZV7	OTTHUMG00000033205	ENST00000255039.1:c.621T>A	chr1.hg19:g.156594457T>A		31.0	0.0		30.0	7.0	NM_021817	Q5T3J0	Silent	SNP	ENST00000255039.1	hg19	CCDS1148.1																																																																																			.	.		0.731	HAPLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081039.1	NM_021817	
CRABP2	1382	hgsc.bcm.edu	37	1	156670823	156670823	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:156670823T>A	ENST00000368222.3	-	2	246	c.92A>T	c.(91-93)aAg>aTg	p.K31M	CRABP2_ENST00000368221.1_Missense_Mutation_p.K31M	NM_001199723.1|NM_001878.3	NP_001186652.1|NP_001869.1	P29373	RABP2_HUMAN	cellular retinoic acid binding protein 2	31					epidermis development (GO:0008544)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(2)|lung(3)|upper_aerodigestive_tract(1)	6	all_hematologic(923;0.088)|Hepatocellular(266;0.158)				Alitretinoin(DB00523)|Tretinoin(DB00755)	CACAGCAATCTTCCTCAGCAT	0.552																																					p.K31M		Atlas-SNP	.											.	CRABP2	13	.	0			c.A92T						.						87.0	75.0	79.0					1																	156670823		2203	4300	6503	SO:0001583	missense	1382	exon3			GCAATCTTCCTCA	BC001109	CCDS1152.1	1q21.3	2013-03-01	2001-11-28		ENSG00000143320	ENSG00000143320		"""Fatty acid binding protein family"""	2339	protein-coding gene	gene with protein product		180231	"""cellular retinoic acid-binding protein 2"""			1654334	Standard	NM_001878		Approved	CRABP-II	uc001fpr.3	P29373	OTTHUMG00000041300	ENST00000368222.3:c.92A>T	chr1.hg19:g.156670823T>A	ENSP00000357205:p.Lys31Met	77.0	0.0		116.0	31.0	NM_001199723	B2R4Z8|D3DVC5|F1T098|Q6ICN6	Missense_Mutation	SNP	ENST00000368222.3	hg19	CCDS1152.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.720299	0.48728	.	.	ENSG00000143320	ENST00000368222;ENST00000368221;ENST00000368220	T;T;T	0.10573	2.86;2.86;2.86	4.44	4.44	0.53790	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.176056	0.49305	D	0.000160	T	0.10294	0.0252	M	0.68728	2.09	0.53688	D	0.999973	B	0.31893	0.345	B	0.40825	0.341	T	0.01553	-1.1326	10	0.87932	D	0	.	11.7023	0.51577	0.0:0.0:0.0:1.0	.	31	P29373	RABP2_HUMAN	M	31	ENSP00000357205:K31M;ENSP00000357204:K31M;ENSP00000357203:K31M	ENSP00000357203:K31M	K	-	2	0	CRABP2	154937447	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	3.536000	0.53582	1.873000	0.54277	0.533000	0.62120	AAG	.	.		0.552	CRABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098966.1	NM_001878	
FCRL1	115350	hgsc.bcm.edu	37	1	157767574	157767574	+	Intron	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:157767574T>A	ENST00000368176.3	-	9	1254				FCRL1_ENST00000489998.1_Intron|FCRL1_ENST00000358292.3_Missense_Mutation_p.Q345L|FCRL1_ENST00000491942.1_Intron	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGAATGCTGTTGTCTGCCATG	0.493																																					p.Q345L	GBM(54;482 1003 11223 30131 35730)	Atlas-SNP	.											.	FCRL1	164	.	0			c.A1034T						.						187.0	165.0	172.0					1																	157767574		692	1591	2283	SO:0001627	intron_variant	115350	exon8			TGCTGTTGTCTGC	BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.1186+83A>T	chr1.hg19:g.157767574T>A		125.0	0.0		202.0	33.0	NM_001159397	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	ENST00000368176.3	hg19	CCDS1170.1	.	.	.	.	.	.	.	.	.	.	T	6.493	0.459209	0.12342	.	.	ENSG00000163534	ENST00000358292	T	0.39997	1.05	3.34	0.348	0.16026	.	.	.	.	.	T	0.09291	0.0229	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.34576	-0.9823	8	0.28530	T	0.3	.	5.5908	0.17299	0.0:0.6105:0.0:0.3895	.	345	Q96LA6-3	.	L	345	ENSP00000351039:Q345L	ENSP00000351039:Q345L	Q	-	2	0	FCRL1	156034198	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.197000	0.03038	0.071000	0.16664	-0.899000	0.02877	CAA	.	.		0.493	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051401.1	NM_052938	
NUF2	83540	hgsc.bcm.edu	37	1	163295880	163295880	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:163295880G>C	ENST00000271452.3	+	2	318	c.39G>C	c.(37-39)gaG>gaC	p.E13D	NUF2_ENST00000367900.3_Missense_Mutation_p.E13D|NUF2_ENST00000524800.1_Missense_Mutation_p.E13D|NUF2_ENST00000490881.1_3'UTR	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	13	Interaction with the N-terminus of NDC80.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					ATGTAGCTGAGATTGTGATTC	0.358																																					p.E13D		Atlas-SNP	.											.	NUF2	138	.	0			c.G39C						.						123.0	125.0	124.0					1																	163295880		2203	4300	6503	SO:0001583	missense	83540	exon2			AGCTGAGATTGTG	BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.39G>C	chr1.hg19:g.163295880G>C	ENSP00000271452:p.Glu13Asp	58.0	0.0		93.0	18.0	NM_145697	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	ENST00000271452.3	hg19	CCDS1245.1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.522069	0.27211	.	.	ENSG00000143228	ENST00000534289;ENST00000450453;ENST00000524800;ENST00000442820;ENST00000367900;ENST00000271452	T;T;T	0.34472	1.36;1.39;1.39	5.84	2.79	0.32731	.	0.272209	0.42548	N	0.000693	T	0.07683	0.0193	N	0.22421	0.69	0.32964	D	0.521419	B;B;B	0.20780	0.026;0.026;0.048	B;B;B	0.20184	0.022;0.022;0.028	T	0.27157	-1.0082	9	0.22109	T	0.4	-14.3809	5.403	0.16306	0.2522:0.1547:0.5931:0.0	.	13;13;13	E9PQC4;Q9BZD4;B1AQT4	.;NUF2_HUMAN;.	D	13	ENSP00000436888:E13D;ENSP00000356875:E13D;ENSP00000271452:E13D	ENSP00000271452:E13D	E	+	3	2	NUF2	161562504	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	0.473000	0.22132	0.402000	0.25451	0.650000	0.86243	GAG	.	.		0.358	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000082812.1	NM_145697	
TEX35	84066	hgsc.bcm.edu	37	1	178490806	178490806	+	Splice_Site	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:178490806G>T	ENST00000367643.3	+	9	663		c.e9-1		TEX35_ENST00000258298.2_Intron|TEX35_ENST00000367641.3_3'UTR|TEX35_ENST00000367639.1_Intron|TEX35_ENST00000367642.3_3'UTR|TEX35_ENST00000319416.2_Intron	NM_001170723.1	NP_001164194.1			testis expressed 35																		TTCCAACCTAGCGCAGCTGCA	0.522																																					.		Atlas-SNP	.											.	TEX35	15	.	0			c.587-1G>T						.						147.0	130.0	135.0					1																	178490806		692	1591	2283	SO:0001630	splice_region_variant	84066	exon9			AACCTAGCGCAGC	AL136694	CCDS1323.1, CCDS53433.1, CCDS53434.1	1q25.2	2014-01-28	2012-06-29	2012-06-29	ENSG00000240021	ENSG00000240021			25366	protein-coding gene	gene with protein product	"""Testis-Specific Conserved gene 24kDa"""		"""chromosome 1 open reading frame 49"""	C1orf49		11230166, 17077512	Standard	NM_032126		Approved	DKFZP564J047, TSC24	uc001glt.2	Q5T0J7	OTTHUMG00000035023	ENST00000367643.3:c.587-1G>T	chr1.hg19:g.178490806G>T		149.0	0.0		189.0	38.0	NM_001170723		Splice_Site	SNP	ENST00000367643.3	hg19	CCDS53433.1	.	.	.	.	.	.	.	.	.	.	G	4.852	0.158294	0.09236	.	.	ENSG00000240021	ENST00000367643	.	.	.	4.46	1.29	0.21616	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.4709	0.11712	0.2088:0.1842:0.607:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C1orf49	176757429	0.002000	0.14202	0.001000	0.08648	0.009000	0.06853	0.417000	0.21214	0.443000	0.26582	-0.247000	0.11927	.	.	.		0.522	TEX35-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098171.1	NM_032126	Intron
KCNT2	343450	hgsc.bcm.edu	37	1	196197434	196197434	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:196197434G>C	ENST00000294725.9	-	28	4243	c.3328C>G	c.(3328-3330)Ctt>Gtt	p.L1110V	KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000609185.1_Missense_Mutation_p.L1043V|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.L1086V|KCNT2_ENST00000367431.4_Missense_Mutation_p.L1044V			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	1110					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CTGTTTGGAAGGTAGGCCAGT	0.363																																					p.L1110V		Atlas-SNP	.											.	KCNT2	243	.	0			c.C3328G						.						70.0	68.0	69.0					1																	196197434		2203	4300	6503	SO:0001583	missense	343450	exon28			TTGGAAGGTAGGC	BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.3328C>G	chr1.hg19:g.196197434G>C	ENSP00000294725:p.Leu1110Val	60.0	0.0		87.0	17.0	NM_198503	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	ENST00000294725.9	hg19	CCDS1384.1	.	.	.	.	.	.	.	.	.	.	G	2.967	-0.213363	0.06140	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.13901	2.56;2.55;2.84	5.71	5.71	0.89125	.	0.118608	0.38663	N	0.001617	T	0.02533	0.0077	N	0.00075	-2.25	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.001;0.002;0.001	T	0.44329	-0.9335	10	0.02654	T	1	-17.3912	14.1206	0.65184	0.0:0.2652:0.7348:0.0	.	1086;1043;1110	Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;KCNT2_HUMAN	V	1086;1044;1110	ENSP00000356403:L1086V;ENSP00000356401:L1044V;ENSP00000294725:L1110V	ENSP00000294725:L1110V	L	-	1	0	KCNT2	194464057	1.000000	0.71417	0.999000	0.59377	0.968000	0.65278	4.398000	0.59697	2.699000	0.92147	0.650000	0.86243	CTT	.	.		0.363	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086418.2	NM_198503	
CACNA1S	779	hgsc.bcm.edu	37	1	201060850	201060850	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:201060850G>A	ENST00000362061.3	-	5	838	c.612C>T	c.(610-612)ctC>ctT	p.L204L	CACNA1S_ENST00000367338.3_Silent_p.L204L	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	204					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TGACCATAAAGAGGACCAGCA	0.552																																					p.L204L		Atlas-SNP	.											.	CACNA1S	249	.	0			c.C612T						.						97.0	80.0	86.0					1																	201060850		2203	4300	6503	SO:0001819	synonymous_variant	779	exon5			CATAAAGAGGACC	L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.612C>T	chr1.hg19:g.201060850G>A		211.0	0.0		220.0	32.0	NM_000069	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	ENST00000362061.3	hg19	CCDS1407.1																																																																																			.	.		0.552	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087049.1	NM_000069	
MFSD4	148808	hgsc.bcm.edu	37	1	205553249	205553249	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:205553249T>A	ENST00000367147.4	+	4	950	c.857T>A	c.(856-858)cTa>cAa	p.L286Q	MFSD4_ENST00000539267.1_Missense_Mutation_p.L286Q|MFSD4_ENST00000536357.1_Missense_Mutation_p.L199Q	NM_181644.4	NP_857595.3	Q8N468	MFSD4_HUMAN	major facilitator superfamily domain containing 4	286					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			CAGTCACACCTAGGTAGGGGC	0.532																																					p.L286Q		Atlas-SNP	.											.	MFSD4	46	.	0			c.T857A						.						52.0	53.0	53.0					1																	205553249		2203	4300	6503	SO:0001583	missense	148808	exon4			CACACCTAGGTAG	BC036549	CCDS1455.1	1q32.1	2008-02-05			ENSG00000174514	ENSG00000174514			25433	protein-coding gene	gene with protein product							Standard	NM_181644		Approved	DKFZp761N1114, FLJ34577, UNQ3064, FLJ25004	uc001hcv.4	Q8N468	OTTHUMG00000037197	ENST00000367147.4:c.857T>A	chr1.hg19:g.205553249T>A	ENSP00000356115:p.Leu286Gln	54.0	0.0		46.0	12.0	NM_181644	B7Z8X3|Q6UY25|Q8NAY0|Q8TCP4	Missense_Mutation	SNP	ENST00000367147.4	hg19	CCDS1455.1	.	.	.	.	.	.	.	.	.	.	T	1.021	-0.684999	0.03328	.	.	ENSG00000174514	ENST00000367147;ENST00000539267;ENST00000536357	T;T;T	0.57273	0.41;0.41;2.02	5.84	1.41	0.22369	Major facilitator superfamily domain, general substrate transporter (1);	0.956968	0.08882	N	0.879917	T	0.19046	0.0457	N	0.01352	-0.895	0.09310	N	0.999998	B;B;B	0.09022	0.002;0.0;0.001	B;B;B	0.08055	0.003;0.003;0.002	T	0.28554	-1.0040	10	0.11794	T	0.64	-4.415	3.9693	0.09446	0.2826:0.5003:0.1374:0.0797	.	231;199;286	B7Z8X0;B7Z8X3;Q8N468	.;.;MFSD4_HUMAN	Q	286;286;199	ENSP00000356115:L286Q;ENSP00000445329:L286Q;ENSP00000440183:L199Q	ENSP00000356115:L286Q	L	+	2	0	MFSD4	203819872	0.027000	0.19231	0.939000	0.37840	0.240000	0.25518	-0.260000	0.08708	0.810000	0.34279	-0.252000	0.11476	CTA	.	.		0.532	MFSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090391.1	NM_181644	
PRSS38	339501	hgsc.bcm.edu	37	1	228003457	228003457	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:228003457T>A	ENST00000366757.3	+	1	64	c.40T>A	c.(40-42)Tct>Act	p.S14T		NM_183062.2	NP_898885.1	A1L453	PRS38_HUMAN	protease, serine, 38	14						extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						ACTCGGGCCCTCTGCCCTGGG	0.667																																					p.S14T		Atlas-SNP	.											.	PRSS38	55	.	0			c.T40A						.						24.0	26.0	26.0					1																	228003457		2203	4299	6502	SO:0001583	missense	339501	exon1			GGGCCCTCTGCCC		CCDS1563.1	1q42.13	2010-05-07			ENSG00000185888	ENSG00000185888		"""Serine peptidases / Serine peptidases"""	29625	protein-coding gene	gene with protein product	"""marapsin 2"""					12838346	Standard	NM_183062		Approved	MPN2	uc001hrh.3	A1L453	OTTHUMG00000037701	ENST00000366757.3:c.40T>A	chr1.hg19:g.228003457T>A	ENSP00000355719:p.Ser14Thr	131.0	0.0		129.0	43.0	NM_183062	Q7RTY6	Missense_Mutation	SNP	ENST00000366757.3	hg19	CCDS1563.1	.	.	.	.	.	.	.	.	.	.	T	2.527	-0.309307	0.05458	.	.	ENSG00000185888	ENST00000366757	D	0.88124	-2.34	1.78	-3.55	0.04639	.	.	.	.	.	T	0.64713	0.2623	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48103	-0.9064	9	0.33940	T	0.23	.	1.8858	0.03237	0.207:0.1495:0.4553:0.1882	.	14	A1L453	PRS38_HUMAN	T	14	ENSP00000355719:S14T	ENSP00000355719:S14T	S	+	1	0	PRSS38	226070080	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.165000	0.09968	-1.825000	0.01207	0.334000	0.21626	TCT	.	.		0.667	PRSS38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091981.1	NM_183062	
OBSCN	84033	hgsc.bcm.edu	37	1	228563447	228563447	+	Missense_Mutation	SNP	G	G	A	rs370427130		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr1:228563447G>A	ENST00000422127.1	+	98	22752	c.22708G>A	c.(22708-22710)Gcg>Acg	p.A7570T	OBSCN_ENST00000570156.2_Missense_Mutation_p.A8527T|OBSCN_ENST00000366707.4_Missense_Mutation_p.A5204T	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7570	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGAGGTGTACGCGGATGGGGT	0.632																																					p.A8527T		Atlas-SNP	.											OBSCN_ENST00000570156,NS,carcinoma,0,2	OBSCN	2142	.	0			c.G25579A						.		THR/ALA	0,4246		0,0,2123	68.0	83.0	78.0		22708	2.5	0.0	1		78	1,8481		0,1,4240	no	missense	OBSCN	NM_001098623.1	58	0,1,6363	AA,AG,GG		0.0118,0.0,0.0079	possibly-damaging	7570/7969	228563447	1,12727	2123	4241	6364	SO:0001583	missense	84033	exon109			GTGTACGCGGATG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.22708G>A	chr1.hg19:g.228563447G>A	ENSP00000409493:p.Ala7570Thr	184.0	0.0		171.0	41.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.07|15.07	2.723815|2.723815	0.48728|0.48728	0.0|0.0	1.18E-4|1.18E-4	ENSG00000154358|ENSG00000154358	ENST00000422127;ENST00000366707|ENST00000441106	T;T|.	0.22539|.	1.95;1.95|.	5.33|5.33	2.45|2.45	0.29901|0.29901	Fibronectin, type III (3);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|T	0.35595|0.35595	0.0937|0.0937	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	B|.	0.13594|.	0.008|.	B|.	0.08055|.	0.003|.	T|T	0.21655|0.21655	-1.0239|-1.0239	9|5	0.16896|.	T|.	0.51|.	.|.	8.8253|8.8253	0.35052|0.35052	0.368:0.0:0.632:0.0|0.368:0.0:0.632:0.0	.|.	7570|.	Q5VST9|.	OBSCN_HUMAN|.	T|H	7570;5204|2186	ENSP00000409493:A7570T;ENSP00000355668:A5204T|.	ENSP00000355668:A5204T|.	A|R	+|+	1|2	0|0	OBSCN|OBSCN	226630070|226630070	0.001000|0.001000	0.12720|0.12720	0.000000|0.000000	0.03702|0.03702	0.030000|0.030000	0.12068|0.12068	1.042000|1.042000	0.30303|0.30303	0.382000|0.382000	0.24878|0.24878	0.506000|0.506000	0.49869|0.49869	GCG|CGC	.	.		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ITSN2	50618	hgsc.bcm.edu	37	2	24438936	24438936	+	Silent	SNP	A	A	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:24438936A>G	ENST00000355123.4	-	32	4415	c.3972T>C	c.(3970-3972)gaT>gaC	p.D1324D	ITSN2_ENST00000361999.3_Silent_p.D1297D|AC009228.1_ENST00000413989.1_RNA|AC009228.1_ENST00000413254.1_RNA|AC009228.1_ENST00000430105.1_RNA	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1324	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTCTTTGAAATCTGTGTCTT	0.512																																					p.D1324D		Atlas-SNP	.											.	ITSN2	224	.	0			c.T3972C						.						75.0	76.0	75.0					2																	24438936		2203	4300	6503	SO:0001819	synonymous_variant	50618	exon32			TTTGAAATCTGTG	AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.3972T>C	chr2.hg19:g.24438936A>G		60.0	0.0		87.0	16.0	NM_006277	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Silent	SNP	ENST00000355123.4	hg19	CCDS1710.2																																																																																			.	.		0.512	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000207620.2	NM_006277	
DTNB	1838	hgsc.bcm.edu	37	2	25705696	25705696	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:25705696T>C	ENST00000406818.3	-	10	1297	c.1048A>G	c.(1048-1050)Atg>Gtg	p.M350V	DTNB_ENST00000545439.1_Missense_Mutation_p.M146V|DTNB_ENST00000288642.8_Missense_Mutation_p.M350V|DTNB_ENST00000407186.1_Missense_Mutation_p.M350V|DTNB_ENST00000405222.1_Missense_Mutation_p.M350V|DTNB_ENST00000407038.3_Missense_Mutation_p.M350V|DTNB_ENST00000404103.3_Missense_Mutation_p.M350V|DTNB_ENST00000496972.2_Missense_Mutation_p.M293V|DTNB_ENST00000407661.3_Missense_Mutation_p.M350V	NM_001256303.1|NM_021907.4	NP_001243232.1|NP_068707.1	O60941	DTNB_HUMAN	dystrobrevin, beta	350						cytoplasm (GO:0005737)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	11	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGAGGACATGTGGCTAACC	0.478																																					p.M350V		Atlas-SNP	.											.	DTNB	43	.	0			c.A1048G						.						95.0	98.0	97.0					2																	25705696		2032	4173	6205	SO:0001583	missense	1838	exon10			AGGACATGTGGCT	AF022728	CCDS46233.1, CCDS46234.1, CCDS46235.1, CCDS46236.1, CCDS46237.1, CCDS58702.1, CCDS74496.1	2p23.2	2008-05-15			ENSG00000138101	ENSG00000138101			3058	protein-coding gene	gene with protein product		602415				9419360	Standard	NM_021907		Approved		uc002rgh.4	O60941	OTTHUMG00000152129	ENST00000406818.3:c.1048A>G	chr2.hg19:g.25705696T>C	ENSP00000384084:p.Met350Val	96.0	0.0		111.0	76.0	NM_021907	B7Z733|F5GZG4|G5E9F6|O43782|O60881|O75538|Q86VR4|Q96AW0|Q9UE14|Q9UE15|Q9UE16	Missense_Mutation	SNP	ENST00000406818.3	hg19	CCDS46237.1	.	.	.	.	.	.	.	.	.	.	T	8.269	0.812967	0.16537	.	.	ENSG00000138101	ENST00000496972;ENST00000406818;ENST00000404103;ENST00000407661;ENST00000407038;ENST00000405222;ENST00000407186;ENST00000288642;ENST00000545439;ENST00000535791	T;T;T;T;T;T;T;T;T	0.39056	2.42;2.41;2.41;2.41;2.38;2.38;2.38;2.42;1.1	5.13	-1.79	0.07932	.	0.497633	0.23902	N	0.043438	T	0.18002	0.0432	N	0.14661	0.345	0.22745	N	0.998784	B;B;B;B;B;B;B;B;B;B;B;B	0.15141	0.003;0.001;0.004;0.001;0.001;0.001;0.001;0.0;0.0;0.012;0.005;0.007	B;B;B;B;B;B;B;B;B;B;B;B	0.16289	0.002;0.004;0.015;0.006;0.003;0.007;0.0;0.001;0.002;0.004;0.004;0.01	T	0.13656	-1.0501	10	0.19590	T	0.45	-2.4242	4.6247	0.12472	0.0:0.2509:0.2991:0.45	.	350;146;293;350;350;293;350;350;350;350;350;350	E7EVB6;B7Z202;F5GZG4;O60941-3;B7Z6A9;B7Z733;E9PEY4;Q96AW0;O60941-2;O60941-4;G5E9F6;O60941	.;.;.;.;.;.;.;.;.;.;.;DTNB_HUMAN	V	293;350;350;350;350;350;350;350;146;203	ENSP00000444463:M293V;ENSP00000384084:M350V;ENSP00000385482:M350V;ENSP00000385193:M350V;ENSP00000384767:M350V;ENSP00000384787:M350V;ENSP00000385784:M350V;ENSP00000288642:M350V;ENSP00000444961:M146V	ENSP00000288642:M350V	M	-	1	0	DTNB	25559200	0.934000	0.31675	0.980000	0.43619	0.999000	0.98932	-0.265000	0.08644	-0.479000	0.06813	0.528000	0.53228	ATG	.	.		0.478	DTNB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325361.1	NM_033147	
ALMS1	7840	hgsc.bcm.edu	37	2	73678026	73678026	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:73678026G>T	ENST00000264448.6	+	8	4480	c.4369G>T	c.(4369-4371)Gct>Tct	p.A1457S	ALMS1_ENST00000409009.1_Missense_Mutation_p.A1415S|ALMS1_ENST00000377715.1_Missense_Mutation_p.A1457S	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	1457	34 X 47 AA approximate tandem repeat.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						AGTTTCAGTTGCTCCTGGACC	0.483																																					p.A1457S		Atlas-SNP	.											.	ALMS1	384	.	0			c.G4369T						.						113.0	113.0	113.0					2																	73678026		1897	4116	6013	SO:0001583	missense	7840	exon8			TCAGTTGCTCCTG	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.4369G>T	chr2.hg19:g.73678026G>T	ENSP00000264448:p.Ala1457Ser	91.0	0.0		124.0	75.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1	.	.	.	.	.	.	.	.	.	.	G	2.651	-0.281998	0.05642	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.16897	3.21;3.21;2.31	4.18	-2.39	0.06602	.	3.675970	0.00757	N	0.001105	T	0.14399	0.0348	L	0.42245	1.32	0.09310	N	1	B;B;B	0.26708	0.157;0.123;0.047	B;B;B	0.26416	0.069;0.022;0.022	T	0.22626	-1.0211	10	0.11485	T	0.65	.	7.8188	0.29276	0.1755:0.5539:0.2706:0.0	.	1457;1415;1457	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	S	1415;1457;1457	ENSP00000386627:A1415S;ENSP00000264448:A1457S;ENSP00000366944:A1457S	ENSP00000264448:A1457S	A	+	1	0	ALMS1	73531534	0.000000	0.05858	0.000000	0.03702	0.035000	0.12851	-1.247000	0.02893	-0.504000	0.06577	-0.274000	0.10170	GCT	.	.		0.483	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SULT1C4	27233	hgsc.bcm.edu	37	2	108999919	108999919	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:108999919A>T	ENST00000272452.2	+	5	894	c.568A>T	c.(568-570)Aaa>Taa	p.K190*	SULT1C4_ENST00000409309.3_Nonsense_Mutation_p.K115*	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	190					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						GTGGGAAGCCAAAGACAAACA	0.468																																					p.K190X		Atlas-SNP	.											.	SULT1C4	41	.	0			c.A568T						.						139.0	117.0	125.0					2																	108999919		2203	4300	6503	SO:0001587	stop_gained	27233	exon5			GAAGCCAAAGACA	AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.568A>T	chr2.hg19:g.108999919A>T	ENSP00000272452:p.Lys190*	82.0	0.0		93.0	55.0	NM_006588	Q069I8|Q08AS5|Q53S63	Nonsense_Mutation	SNP	ENST00000272452.2	hg19	CCDS2077.1	.	.	.	.	.	.	.	.	.	.	A	37	6.179726	0.97352	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	.	.	.	4.76	4.76	0.60689	.	0.109265	0.41294	D	0.000919	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.9031	0.63817	1.0:0.0:0.0:0.0	.	.	.	.	X	190;115	.	ENSP00000272452:K190X	K	+	1	0	SULT1C4	108366351	0.693000	0.27728	0.005000	0.12908	0.853000	0.48598	4.695000	0.61767	2.125000	0.65367	0.496000	0.49642	AAA	.	.		0.468	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253561.1	NM_006588	
NEB	4703	hgsc.bcm.edu	37	2	152539201	152539201	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:152539201T>A	ENST00000172853.10	-	29	3065	c.2918A>T	c.(2917-2919)aAg>aTg	p.K973M	NEB_ENST00000603639.1_Missense_Mutation_p.K973M|NEB_ENST00000604864.1_Missense_Mutation_p.K973M|NEB_ENST00000427231.2_Missense_Mutation_p.K973M|NEB_ENST00000397345.3_Missense_Mutation_p.K973M|NEB_ENST00000409198.1_Missense_Mutation_p.K973M			P20929	NEBU_HUMAN	nebulin	973					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TGAAGCTCGCTTTGCCTTTTC	0.463																																					p.K973M		Atlas-SNP	.											.	NEB	1697	.	0			c.A2918T						.						108.0	108.0	108.0					2																	152539201		2046	4188	6234	SO:0001583	missense	4703	exon29			GCTCGCTTTGCCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.2918A>T	chr2.hg19:g.152539201T>A	ENSP00000172853:p.Lys973Met	77.0	0.0		109.0	31.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	T	21.3	4.127982	0.77549	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.10573	2.86;2.93;2.92;2.86	5.89	5.89	0.94794	.	0.107337	0.64402	D	0.000006	T	0.41096	0.1144	M	0.90650	3.135	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.49624	-0.8920	10	0.87932	D	0	.	15.2948	0.73894	0.0:0.0:0.0:1.0	.	973	P20929	NEBU_HUMAN	M	973	ENSP00000386259:K973M;ENSP00000380505:K973M;ENSP00000416578:K973M;ENSP00000172853:K973M	ENSP00000172853:K973M	K	-	2	0	NEB	152247447	1.000000	0.71417	1.000000	0.80357	0.626000	0.37791	5.018000	0.64054	2.254000	0.74563	0.459000	0.35465	AAG	.	.		0.463	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
IFIH1	64135	hgsc.bcm.edu	37	2	163124064	163124064	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:163124064T>C	ENST00000263642.2	-	15	3218	c.2823A>G	c.(2821-2823)gtA>gtG	p.V941V		NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	941					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						TGTTTTCTCTTACAATGTAAA	0.403																																					p.V941V		Atlas-SNP	.											.	IFIH1	102	.	0			c.A2823G						.						160.0	134.0	143.0					2																	163124064		2203	4300	6503	SO:0001819	synonymous_variant	64135	exon15			TTCTCTTACAATG	AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.2823A>G	chr2.hg19:g.163124064T>C		43.0	0.0		34.0	15.0	NM_022168	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Silent	SNP	ENST00000263642.2	hg19	CCDS2217.1																																																																																			.	.		0.403	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255078.2	NM_022168	
MFSD6	54842	hgsc.bcm.edu	37	2	191301292	191301292	+	Silent	SNP	G	G	A	rs115585862	byFrequency	TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:191301292G>A	ENST00000392328.1	+	3	861	c.537G>A	c.(535-537)ctG>ctA	p.L179L	MFSD6_ENST00000281416.7_Silent_p.L179L	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	179					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TAACTATCCTGCCAACAAATT	0.438																																					p.L179L		Atlas-SNP	.											.	MFSD6	58	.	0			c.G537A						.						92.0	102.0	99.0					2																	191301292		2202	4300	6502	SO:0001819	synonymous_variant	54842	exon3			TATCCTGCCAACA		CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.537G>A	chr2.hg19:g.191301292G>A		86.0	0.0		93.0	32.0	NM_017694	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	ENST00000392328.1	hg19	CCDS2306.1																																																																																			.	G|0.996;T|0.004		0.438	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255931.1		
RFTN2	130132	hgsc.bcm.edu	37	2	198508920	198508920	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:198508920C>T	ENST00000295049.4	-	3	936	c.400G>A	c.(400-402)Gca>Aca	p.A134T		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	134					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						TTTGTTTGTGCCTCAGAAGTT	0.408																																					p.A134T		Atlas-SNP	.											.	RFTN2	68	.	0			c.G400A						.						186.0	175.0	179.0					2																	198508920		2203	4300	6503	SO:0001583	missense	130132	exon3			TTTGTGCCTCAGA	AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.400G>A	chr2.hg19:g.198508920C>T	ENSP00000295049:p.Ala134Thr	104.0	0.0		130.0	73.0	NM_144629	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	ENST00000295049.4	hg19	CCDS2323.1	.	.	.	.	.	.	.	.	.	.	C	7.265	0.605945	0.14002	.	.	ENSG00000162944	ENST00000295049	T	0.28666	1.6	5.39	1.67	0.24075	.	0.647125	0.16704	N	0.202992	T	0.09069	0.0224	N	0.01800	-0.715	0.25336	N	0.98899	B	0.02656	0.0	B	0.04013	0.001	T	0.37526	-0.9702	10	0.05436	T	0.98	-0.7503	8.1483	0.31126	0.0:0.229:0.0:0.771	.	134	Q52LD8	RFTN2_HUMAN	T	134	ENSP00000295049:A134T	ENSP00000295049:A134T	A	-	1	0	RFTN2	198217165	0.055000	0.20627	0.867000	0.34043	0.991000	0.79684	1.735000	0.38176	0.130000	0.18549	-0.312000	0.09012	GCA	.	.		0.408	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256106.2	NM_144629	
ERBB4	2066	hgsc.bcm.edu	37	2	212812232	212812232	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:212812232T>A	ENST00000342788.4	-	3	654	c.344A>T	c.(343-345)tAt>tTt	p.Y115F	ERBB4_ENST00000484474.1_5'UTR|ERBB4_ENST00000402597.1_Missense_Mutation_p.Y115F|ERBB4_ENST00000436443.1_Missense_Mutation_p.Y115F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	115					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	TGCCAAGGCATATCGATCCTC	0.383										TSP Lung(8;0.080)																											p.Y115F		Atlas-SNP	.											.	ERBB4	480	.	0			c.A344T						.						117.0	111.0	113.0					2																	212812232		2203	4300	6503	SO:0001583	missense	2066	exon3			AAGGCATATCGAT	L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.344A>T	chr2.hg19:g.212812232T>A	ENSP00000342235:p.Tyr115Phe	97.0	0.0		94.0	58.0	NM_001042599	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	ENST00000342788.4	hg19	CCDS2394.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.72|12.72	2.021945|2.021945	0.35701|0.35701	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597;ENST00000435846	.|D;D;D;D	.|0.84442	.|-1.85;-1.85;-1.85;-1.85	5.54|5.54	5.54|5.54	0.83059|0.83059	.|EGF receptor, L domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80691|0.80691	0.4671|0.4671	N|N	0.20445|0.20445	0.575|0.575	0.50632|0.50632	D|D	0.999887|0.999887	.|P;B;P;P	.|0.47545	.|0.874;0.078;0.874;0.897	.|P;B;P;P	.|0.51355	.|0.537;0.091;0.537;0.667	T|T	0.77742|0.77742	-0.2474|-0.2474	5|10	.|0.20519	.|T	.|0.43	.|.	12.2419|12.2419	0.54546|0.54546	0.0:0.0:0.1419:0.8581|0.0:0.0:0.1419:0.8581	.|.	.|115;115;115;115	.|Q15303-4;Q15303-2;Q15303-3;Q15303	.|.;.;.;ERBB4_HUMAN	L|F	115|115;115;115;56	.|ENSP00000342235:Y115F;ENSP00000403204:Y115F;ENSP00000385565:Y115F;ENSP00000405564:Y56F	.|ENSP00000342235:Y115F	M|Y	-|-	1|2	0|0	ERBB4|ERBB4	212520477|212520477	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.991000|4.991000	0.63883|0.63883	2.102000|2.102000	0.63906|0.63906	0.455000|0.455000	0.32223|0.32223	ATG|TAT	.	.		0.383	ERBB4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256597.1	NM_001042599	
SEPT2	4735	hgsc.bcm.edu	37	2	242283230	242283230	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr2:242283230A>T	ENST00000391973.2	+	9	1288	c.760A>T	c.(760-762)Aga>Tga	p.R254*	SEPT2_ENST00000407971.1_Nonsense_Mutation_p.R214*|SEPT2_ENST00000360051.3_Nonsense_Mutation_p.R254*|SEPT2_ENST00000402092.2_Nonsense_Mutation_p.R254*|SEPT2_ENST00000391971.2_Nonsense_Mutation_p.R254*|SEPT2_ENST00000401990.1_Nonsense_Mutation_p.R264*	NM_006155.1	NP_006146.1	Q15019	SEPT2_HUMAN	septin 2	254	Septin-type G.				cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|neuron projection development (GO:0031175)|regulation of L-glutamate transport (GO:0002036)|regulation of protein localization (GO:0032880)|smoothened signaling pathway (GO:0007224)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|ciliary membrane (GO:0060170)|ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|exocyst (GO:0000145)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|septin complex (GO:0031105)|synapse (GO:0045202)	enzyme regulator activity (GO:0030234)|GTP binding (GO:0005525)			central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12		all_cancers(19;7.62e-41)|all_epithelial(40;1.71e-18)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00338)|Ovarian(221;0.00556)|Lung NSC(271;0.012)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.24e-34)|all cancers(36;7.15e-32)|OV - Ovarian serous cystadenocarcinoma(60;1.21e-15)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;3.16e-06)|Lung(119;7.81e-05)|LUSC - Lung squamous cell carcinoma(224;0.000742)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0889)		AAAGAAGGTCAGAGGCCGCCT	0.493																																					p.R254X		Atlas-SNP	.											.	SEPT2	33	.	0			c.A760T						.						249.0	254.0	252.0					2																	242283230		2203	4300	6503	SO:0001587	stop_gained	4735	exon10			AAGGTCAGAGGCC	D28540	CCDS2548.1, CCDS63195.1, CCDS74682.1	2q37.3	2013-01-21	2005-01-11	2005-01-12	ENSG00000168385	ENSG00000168385		"""Septins"""	7729	protein-coding gene	gene with protein product		601506	"""neural precursor cell expressed, developmentally down-regulated 5"""	DIFF6, NEDD5		8697812	Standard	XM_005247011		Approved	KIAA0158, hNedd5, Pnutl3	uc002wbd.3	Q15019	OTTHUMG00000133394	ENST00000391973.2:c.760A>T	chr2.hg19:g.242283230A>T	ENSP00000375834:p.Arg254*	123.0	0.0		162.0	44.0	NM_001008491	B4DGE8|Q14132|Q53QU3|Q8IUK9|Q96CB0	Nonsense_Mutation	SNP	ENST00000391973.2	hg19	CCDS2548.1	.	.	.	.	.	.	.	.	.	.	A	38	7.165442	0.98107	.	.	ENSG00000168385	ENST00000391973;ENST00000360051;ENST00000391971;ENST00000401990;ENST00000407971;ENST00000402092;ENST00000391972;ENST00000421717	.	.	.	6.08	-12.0	0.00017	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	28.9819	0.99999	0.1681:0.8319:0.0:0.0	.	.	.	.	X	254;254;254;264;214;254;289;109	.	ENSP00000353157:R254X	R	+	1	2	SEPT2	241931903	0.971000	0.33674	0.814000	0.32528	0.999000	0.98932	0.341000	0.19909	-1.205000	0.02645	0.533000	0.62120	AGA	.	.		0.493	SEPT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323177.3	NM_006155	
CHL1	10752	hgsc.bcm.edu	37	3	383657	383657	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:383657G>T	ENST00000256509.2	+	7	1213	c.571G>T	c.(571-573)Gca>Tca	p.A191S	CHL1_ENST00000397491.2_Missense_Mutation_p.A191S	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Glu-rich.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		TCTATACTTCGCAAACGTGGA	0.378																																					p.A191S		Atlas-SNP	.											.	CHL1	242	.	0			c.G571T						.						91.0	85.0	87.0					3																	383657		2203	4300	6503	SO:0001583	missense	10752	exon5			TACTTCGCAAACG	AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.571G>T	chr3.hg19:g.383657G>T	ENSP00000256509:p.Ala191Ser	229.0	0.0		340.0	174.0	NM_001253388	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	ENST00000256509.2	hg19	CCDS2556.1	.	.	.	.	.	.	.	.	.	.	G	9.659	1.143662	0.21205	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.37411	1.2;1.2	5.43	5.43	0.79202	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.060122	0.64402	D	0.000002	T	0.25717	0.0626	N	0.03891	-0.335	0.47778	D	0.999517	P;P;P	0.46277	0.581;0.581;0.875	B;B;P	0.51974	0.218;0.218;0.686	T	0.05886	-1.0858	10	0.02654	T	1	.	17.7511	0.88434	0.0:0.0:1.0:0.0	.	191;191;191	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	S	191	ENSP00000256509:A191S;ENSP00000380628:A191S	ENSP00000256509:A191S	A	+	1	0	CHL1	358657	1.000000	0.71417	0.968000	0.41197	0.986000	0.74619	6.372000	0.73123	2.696000	0.92011	0.591000	0.81541	GCA	.	.		0.378	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207155.2	NM_006614	
FBLN2	2199	hgsc.bcm.edu	37	3	13670761	13670761	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:13670761T>C	ENST00000295760.7	+	12	2739	c.2670T>C	c.(2668-2670)ttT>ttC	p.F890F	FBLN2_ENST00000404922.3_Silent_p.F937F|FBLN2_ENST00000492059.1_Silent_p.F937F|FBLN2_ENST00000535798.1_Silent_p.F916F	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	890	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			AAGCCGGCTTTCAGCGGGATG	0.647																																					p.F937F		Atlas-SNP	.											.	FBLN2	137	.	0			c.T2811C						.						30.0	35.0	33.0					3																	13670761		2086	4209	6295	SO:0001819	synonymous_variant	2199	exon13			CGGCTTTCAGCGG	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2670T>C	chr3.hg19:g.13670761T>C		112.0	0.0		107.0	60.0	NM_001004019	B7Z9C5|Q8IUI0|Q8IUI1	Silent	SNP	ENST00000295760.7	hg19	CCDS46762.1																																																																																			.	.		0.647	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	A	rs121913416|rs121913400		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:41266101C>A	ENST00000349496.5	+	3	378	c.98C>A	c.(97-99)tCt>tAt	p.S33Y	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33Y|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26Y|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33Y|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33Y	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33Y	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,359	CTNNB1	4904	.	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98A						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>A	chr3.hg19:g.41266101C>A	ENSP00000344456:p.Ser33Tyr	139.0	0.0		145.0	44.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	23.7	4.449496	0.84101	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	Y	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26Y;ENSP00000385604:S33Y;ENSP00000412219:S33Y;ENSP00000379486:S33Y;ENSP00000344456:S33Y;ENSP00000411226:S26Y;ENSP00000379488:S33Y;ENSP00000409302:S33Y;ENSP00000401599:S33Y	ENSP00000344456:S33Y	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
KIF15	56992	hgsc.bcm.edu	37	3	44879894	44879894	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:44879894T>A	ENST00000326047.4	+	27	3448	c.3299T>A	c.(3298-3300)aTt>aAt	p.I1100N	KIF15_ENST00000425755.1_Missense_Mutation_p.I735N	NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15	1100					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		GAAGCCCTGATTCAGGAACTT	0.517																																					p.I1100N		Atlas-SNP	.											.	KIF15	103	.	0			c.T3299A						.						55.0	58.0	57.0					3																	44879894		2203	4300	6503	SO:0001583	missense	56992	exon27			CCCTGATTCAGGA	AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.3299T>A	chr3.hg19:g.44879894T>A	ENSP00000324020:p.Ile1100Asn	155.0	0.0		150.0	86.0	NM_020242	Q17RV9|Q69YL6|Q96JX7|Q9H280	Missense_Mutation	SNP	ENST00000326047.4	hg19	CCDS33744.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.15|19.15	3.771885|3.771885	0.69992|0.69992	.|.	.|.	ENSG00000163808|ENSG00000163808	ENST00000396031|ENST00000326047;ENST00000425755	.|T;T	.|0.57595	.|0.39;0.39	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.000000	.|0.52532	.|D	.|0.000074	T|T	0.60599|0.60599	0.2281|0.2281	L|L	0.29908|0.29908	0.895|0.895	0.54753|0.54753	D|D	0.999987|0.999987	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	T|T	0.62034|0.62034	-0.6939|-0.6939	6|10	0.20519|0.48119	T|T	0.43|0.1	.|.	13.4068|13.4068	0.60917|0.60917	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1100	.|Q9NS87	.|KIF15_HUMAN	E|N	1098|1100;735	.|ENSP00000324020:I1100N;ENSP00000389982:I735N	ENSP00000379348:D1098E|ENSP00000324020:I1100N	D|I	+|+	3|2	2|0	KIF15|KIF15	44854898|44854898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	5.254000|5.254000	0.65457|0.65457	1.983000|1.983000	0.57843|0.57843	0.528000|0.528000	0.53228|0.53228	GAT|ATT	.	.		0.517	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343831.2		
CCR1	1230	hgsc.bcm.edu	37	3	46244963	46244963	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:46244963A>T	ENST00000296140.3	-	2	967	c.842T>A	c.(841-843)cTg>cAg	p.L281Q	CCR3_ENST00000357422.2_Intron	NM_001295.2	NP_001286.1	P32246	CCR1_HUMAN	chemokine (C-C motif) receptor 1	281					calcium ion transport (GO:0006816)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|exocytosis (GO:0006887)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|immune response (GO:0006955)|inflammatory response (GO:0006954)|metabolic process (GO:0008152)|negative regulation of bone mineralization (GO:0030502)|negative regulation of gene expression (GO:0010629)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of osteoclast differentiation (GO:0045672)|response to wounding (GO:0009611)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|C-C chemokine receptor activity (GO:0016493)|chemokine (C-C motif) ligand 5 binding (GO:0071791)|chemokine (C-C motif) ligand 7 binding (GO:0035717)|chemokine receptor activity (GO:0004950)|phosphatidylinositol phospholipase C activity (GO:0004435)			autonomic_ganglia(1)|large_intestine(6)|lung(6)|pancreas(1)|skin(3)	17				BRCA - Breast invasive adenocarcinoma(193;0.00113)|KIRC - Kidney renal clear cell carcinoma(197;0.0172)|Kidney(197;0.0203)		TTGCACAGCCAGGTCCAAATG	0.498																																					p.L281Q		Atlas-SNP	.											.	CCR1	36	.	0			c.T842A						.						64.0	58.0	60.0					3																	46244963		2203	4300	6503	SO:0001583	missense	1230	exon2			ACAGCCAGGTCCA		CCDS2737.1	3p21	2012-08-08			ENSG00000163823	ENSG00000163823		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1602	protein-coding gene	gene with protein product		601159		SCYAR1, CMKBR1		7679328	Standard	NM_001295		Approved	CKR-1, MIP1aR, CD191	uc003cph.1	P32246	OTTHUMG00000133451	ENST00000296140.3:c.842T>A	chr3.hg19:g.46244963A>T	ENSP00000296140:p.Leu281Gln	114.0	0.0		131.0	77.0	NM_001295	Q86VA9	Missense_Mutation	SNP	ENST00000296140.3	hg19	CCDS2737.1	.	.	.	.	.	.	.	.	.	.	A	10.74	1.434353	0.25813	.	.	ENSG00000163823	ENST00000296140	T	0.38887	1.11	5.33	5.33	0.75918	GPCR, rhodopsin-like superfamily (1);	1.332120	0.04950	N	0.460228	T	0.41949	0.1181	N	0.05330	-0.07	0.32229	N	0.574219	D	0.61080	0.989	D	0.73708	0.981	T	0.38112	-0.9676	10	0.15066	T	0.55	.	6.1068	0.20077	0.7682:0.0:0.078:0.1538	.	281	P32246	CCR1_HUMAN	Q	281	ENSP00000296140:L281Q	ENSP00000296140:L281Q	L	-	2	0	CCR1	46219967	0.995000	0.38212	0.997000	0.53966	0.029000	0.11900	4.004000	0.57068	2.145000	0.66743	0.533000	0.62120	CTG	.	.		0.498	CCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257325.2	NM_001295	
P4HTM	54681	hgsc.bcm.edu	37	3	49042389	49042389	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:49042389A>T	ENST00000383729.4	+	6	1354	c.983A>T	c.(982-984)cAc>cTc	p.H328L	WDR6_ENST00000608424.1_5'Flank|WDR6_ENST00000448293.1_5'Flank|WDR6_ENST00000395474.3_5'Flank|WDR6_ENST00000415265.2_5'Flank|P4HTM_ENST00000343546.4_Missense_Mutation_p.H328L	NM_177939.2	NP_808808.1	Q9NXG6	P4HTM_HUMAN	prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)	328	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.					endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)			NS(1)|breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21					Vitamin C(DB00126)	TACCATGCCCACGTGGACAGT	0.612																																					p.H328L		Atlas-SNP	.											.	P4HTM	71	.	0			c.A983T						.						119.0	94.0	103.0					3																	49042389		2203	4300	6503	SO:0001583	missense	54681	exon6			ATGCCCACGTGGA		CCDS2781.2, CCDS43089.1	3p21.31	2009-01-14			ENSG00000178467	ENSG00000178467			28858	protein-coding gene	gene with protein product	"""Prolyl hydroxlase domain-containing 4"", ""hypoxia inducible factor prolyl 4 hydroxylase"""	614584				12163023, 17726031	Standard	XR_245139		Approved	P4H-TM, PHD4, PH4, HIFPH4, FLJ20262, EGLN4, PH-4	uc003cvh.3	Q9NXG6	OTTHUMG00000074057	ENST00000383729.4:c.983A>T	chr3.hg19:g.49042389A>T	ENSP00000373235:p.His328Leu	110.0	0.0		102.0	58.0	NM_177938	Q6PAG6|Q8TCJ9|Q8WV55|Q96F22|Q9BW77	Missense_Mutation	SNP	ENST00000383729.4	hg19	CCDS43089.1	.	.	.	.	.	.	.	.	.	.	A	28.6	4.932321	0.92389	.	.	ENSG00000178467	ENST00000383729;ENST00000343546	D	0.95342	-3.68	5.29	5.29	0.74685	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.107966	0.64402	D	0.000002	D	0.97087	0.9048	H	0.96547	3.84	0.58432	D	0.999999	B;P	0.45672	0.277;0.864	B;P	0.48368	0.202;0.575	D	0.98121	1.0425	10	0.87932	D	0	-17.3852	15.3015	0.73955	1.0:0.0:0.0:0.0	.	328;328	Q9NXG6-3;Q9NXG6	.;P4HTM_HUMAN	L	328	ENSP00000373235:H328L	ENSP00000341422:H328L	H	+	2	0	P4HTM	49017393	1.000000	0.71417	0.982000	0.44146	0.975000	0.68041	8.919000	0.92770	2.017000	0.59298	0.529000	0.55759	CAC	.	.		0.612	P4HTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157211.1	NM_177938	
ITIH4	3700	hgsc.bcm.edu	37	3	52848087	52848087	+	Splice_Site	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:52848087C>A	ENST00000266041.4	-	23	2723	c.2627G>T	c.(2626-2628)gGc>gTc	p.G876V	RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000406595.1_Splice_Site_p.G846V|ITIH4_ENST00000485816.1_Splice_Site_p.G881V|ITIH4_ENST00000346281.5_Splice_Site_p.G860V	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	876					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GTAAAACTGGCCTGAGATACA	0.587																																					p.G876V		Atlas-SNP	.											.	ITIH4	74	.	0			c.G2627T						.						43.0	37.0	39.0					3																	52848087		2203	4300	6503	SO:0001630	splice_region_variant	3700	exon23			AACTGGCCTGAGA	D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2627-1G>T	chr3.hg19:g.52848087C>A		111.0	0.0		99.0	27.0	NM_002218	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	ENST00000266041.4	hg19	CCDS2865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.76|17.76	3.467946|3.467946	0.63625|0.63625	.|.	.|.	ENSG00000055955|ENSG00000055955	ENST00000266041;ENST00000346281;ENST00000485816;ENST00000406595;ENST00000538421|ENST00000441637	T;T;T;T|.	0.32988|.	1.43;1.43;1.43;1.43|.	5.04|5.04	4.1|4.1	0.47936|0.47936	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);|.	0.000000|.	0.56097|.	D|.	0.000022|.	T|T	0.66147|0.66147	0.2760|0.2760	M|M	0.70275|0.70275	2.135|2.135	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.97110|.	1.0;1.0;1.0;0.999|.	T|T	0.64504|0.64504	-0.6392|-0.6392	10|5	0.87932|.	D|.	0|.	.|.	10.2271|10.2271	0.43231|0.43231	0.1975:0.8025:0.0:0.0|0.1975:0.8025:0.0:0.0	.|.	846;881;876;860|.	E9PGN5;B7ZKJ8;Q14624;Q14624-2|.	.;.;ITIH4_HUMAN;.|.	V|C	876;860;881;846;834|664	ENSP00000266041:G876V;ENSP00000340520:G860V;ENSP00000417824:G881V;ENSP00000384425:G846V|.	ENSP00000266041:G876V|.	G|W	-|-	2|3	0|0	ITIH4|ITIH4	52823127|52823127	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.761000|0.761000	0.43186|0.43186	3.763000|3.763000	0.55257|0.55257	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	GGC|TGG	.	.		0.587	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317715.1	NM_002218	Missense_Mutation
B3GALNT1	8706	hgsc.bcm.edu	37	3	160803895	160803895	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:160803895T>A	ENST00000392781.2	-	8	1395	c.648A>T	c.(646-648)agA>agT	p.R216S	B3GALNT1_ENST00000473285.1_Missense_Mutation_p.R216S|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000392780.1_Missense_Mutation_p.R216S|B3GALNT1_ENST00000488170.1_Missense_Mutation_p.R216S|B3GALNT1_ENST00000392779.2_Missense_Mutation_p.R216S|B3GALNT1_ENST00000320474.4_Missense_Mutation_p.R216S	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	216					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			GGTAAAATCCTCTATAGGAAT	0.353																																					p.R216S		Atlas-SNP	.											.	B3GALNT1	34	.	0			c.A648T						.						31.0	32.0	32.0					3																	160803895		2201	4295	6496	SO:0001583	missense	8706	exon8			AAATCCTCTATAG	Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.648A>T	chr3.hg19:g.160803895T>A	ENSP00000376532:p.Arg216Ser	28.0	0.0		26.0	5.0	NM_001038628	D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Missense_Mutation	SNP	ENST00000392781.2	hg19	CCDS3193.1	.	.	.	.	.	.	.	.	.	.	T	17.72	3.459023	0.63401	.	.	ENSG00000169255	ENST00000320474;ENST00000392779;ENST00000392780;ENST00000392781;ENST00000473285;ENST00000488170	D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	5.94	3.59	0.41128	.	0.000000	0.85682	D	0.000000	D	0.90566	0.7043	M	0.85099	2.735	0.40752	D	0.982924	D	0.61697	0.99	P	0.61800	0.894	D	0.89720	0.3918	10	0.87932	D	0	.	8.0452	0.30545	0.0:0.2125:0.0:0.7875	.	216	O75752	B3GL1_HUMAN	S	216	ENSP00000323479:R216S;ENSP00000376530:R216S;ENSP00000376531:R216S;ENSP00000376532:R216S;ENSP00000418226:R216S;ENSP00000420163:R216S	ENSP00000323479:R216S	R	-	3	2	B3GALNT1	162286589	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.192000	0.32150	0.514000	0.28300	0.459000	0.35465	AGA	.	.		0.353	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353125.1	NM_033167	
ZBBX	79740	hgsc.bcm.edu	37	3	166960387	166960387	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:166960387C>T	ENST00000392766.2	-	20	2522	c.2182G>A	c.(2182-2184)Gat>Aat	p.D728N	ZBBX_ENST00000392767.2_Missense_Mutation_p.D728N|ZBBX_ENST00000307529.5_Missense_Mutation_p.D767N|ZBBX_ENST00000455345.2_Missense_Mutation_p.D767N|ZBBX_ENST00000392764.1_Missense_Mutation_p.D699N	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	728						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTGCTGAAATCTGGGAACTCT	0.363																																					p.D767N		Atlas-SNP	.											ZBBX_ENST00000455345,colon,carcinoma,0,2	ZBBX	299	.	0			c.G2299A						.						95.0	93.0	93.0					3																	166960387		1824	4077	5901	SO:0001583	missense	79740	exon21			TGAAATCTGGGAA	AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2182G>A	chr3.hg19:g.166960387C>T	ENSP00000376519:p.Asp728Asn	29.0	0.0		48.0	16.0	NM_001199201	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	ENST00000392766.2	hg19	CCDS3199.2	.	.	.	.	.	.	.	.	.	.	C	7.397	0.632051	0.14322	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6	5.62	4.73	0.59995	.	0.374827	0.21088	N	0.080369	T	0.30070	0.0753	N	0.08118	0	0.09310	N	1	B;B	0.27316	0.175;0.109	B;B	0.26416	0.069;0.019	T	0.11641	-1.0579	10	0.21540	T	0.41	-0.446	10.8196	0.46597	0.0:0.9109:0.0:0.0891	.	767;728	A8MT70-2;A8MT70	.;ZBBX_HUMAN	N	728;728;767;767;699	ENSP00000376519:D728N;ENSP00000376520:D728N;ENSP00000390232:D767N;ENSP00000305065:D767N;ENSP00000376517:D699N	ENSP00000305065:D767N	D	-	1	0	ZBBX	168443081	0.017000	0.18338	0.015000	0.15790	0.005000	0.04900	0.367000	0.20382	2.640000	0.89533	0.591000	0.81541	GAT	.	.		0.363	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000257657.3	NM_024687	
EIF4G1	1981	hgsc.bcm.edu	37	3	184039550	184039550	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:184039550C>G	ENST00000346169.2	+	10	1449	c.1178C>G	c.(1177-1179)cCc>cGc	p.P393R	EIF4G1_ENST00000319274.6_Missense_Mutation_p.P393R|EIF4G1_ENST00000414031.1_Missense_Mutation_p.P353R|EIF4G1_ENST00000441154.1_Missense_Mutation_p.P229R|EIF2B5_ENST00000444495.1_Intron|EIF4G1_ENST00000392537.2_Missense_Mutation_p.P306R|EIF4G1_ENST00000382330.3_Missense_Mutation_p.P400R|EIF4G1_ENST00000342981.4_Missense_Mutation_p.P393R|EIF4G1_ENST00000352767.3_Missense_Mutation_p.P400R|EIF4G1_ENST00000435046.2_Missense_Mutation_p.P197R|EIF4G1_ENST00000434061.2_Missense_Mutation_p.P197R|EIF4G1_ENST00000427845.1_Missense_Mutation_p.P306R|EIF4G1_ENST00000424196.1_Missense_Mutation_p.P400R|EIF4G1_ENST00000411531.1_Missense_Mutation_p.P353R|EIF4G1_ENST00000350481.5_Missense_Mutation_p.P229R	NM_198241.2	NP_937884	Q04637	IF4G1_HUMAN	eukaryotic translation initiation factor 4 gamma, 1	393					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|response to ethanol (GO:0045471)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(5)|large_intestine(14)|lung(41)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	75	all_cancers(143;1.06e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCCCCTGTGCCCATTGCTCCA	0.607																																					p.P400R		Atlas-SNP	.											.	EIF4G1	151	.	0			c.C1199G						.						177.0	192.0	187.0					3																	184039550		2203	4300	6503	SO:0001583	missense	1981	exon11			CTGTGCCCATTGC	D12686	CCDS3259.1, CCDS3260.1, CCDS3261.1, CCDS46970.1, CCDS46970.2, CCDS54687.1, CCDS54688.1	3q27.1	2013-09-19			ENSG00000114867	ENSG00000114867		"""Parkinson disease"""	3296	protein-coding gene	gene with protein product		600495		EIF4G, EIF4F		1429670, 9372926, 21907011	Standard	NM_182917		Approved	p220, PARK18	uc010hxy.3	Q04637	OTTHUMG00000156784	ENST00000346169.2:c.1178C>G	chr3.hg19:g.184039550C>G	ENSP00000316879:p.Pro393Arg	195.0	0.0		155.0	96.0	NM_001194946	D3DNT2|D3DNT4|D3DNT5|E9PFM1|G5E9S1|O43177|O95066|Q5HYG0|Q6ZN21|Q8N102	Missense_Mutation	SNP	ENST00000346169.2	hg19	CCDS3259.1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512773	0.44660	.	.	ENSG00000114867	ENST00000346169;ENST00000414031;ENST00000392537;ENST00000450424;ENST00000421110;ENST00000382330;ENST00000426123;ENST00000350481;ENST00000352767;ENST00000427845;ENST00000342981;ENST00000319274;ENST00000424196;ENST00000411531;ENST00000444861;ENST00000441154;ENST00000434061;ENST00000457456;ENST00000435046	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.32753	4.05;4.04;3.96;2.93;2.93;4.04;3.1;3.87;4.04;3.94;4.03;4.05;4.04;4.03;2.53;3.87;3.86;1.44;3.87	5.07	4.2	0.49525	.	0.511843	0.20969	N	0.082430	T	0.37376	0.1001	N	0.24115	0.695	0.41262	D	0.986781	D;P;D;D	0.71674	0.995;0.769;0.998;0.995	P;B;D;P	0.78314	0.854;0.372;0.991;0.854	T	0.08953	-1.0697	10	0.30078	T	0.28	-6.3191	10.8383	0.46700	0.0:0.9119:0.0:0.0881	.	400;393;393;400	E9PFM1;D3DNT2;Q04637;B2RU10	.;.;IF4G1_HUMAN;.	R	393;353;306;393;400;400;334;229;400;306;393;393;400;353;229;229;197;197;197	ENSP00000316879:P393R;ENSP00000391935:P353R;ENSP00000376320:P306R;ENSP00000391412:P393R;ENSP00000413159:P400R;ENSP00000371767:P400R;ENSP00000403269:P334R;ENSP00000317600:P229R;ENSP00000338020:P400R;ENSP00000407682:P306R;ENSP00000343450:P393R;ENSP00000323737:P393R;ENSP00000416255:P400R;ENSP00000395974:P353R;ENSP00000398145:P229R;ENSP00000399858:P229R;ENSP00000411826:P197R;ENSP00000399969:P197R;ENSP00000404754:P197R	ENSP00000323737:P393R	P	+	2	0	EIF4G1	185522244	.	.	0.746000	0.31095	0.938000	0.57974	.	.	1.499000	0.48617	0.563000	0.77884	CCC	.	.		0.607	EIF4G1-007	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000345733.1	NM_182917	
MUC4	4585	hgsc.bcm.edu	37	3	195513058	195513058	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:195513058A>T	ENST00000463781.3	-	2	5852	c.5393T>A	c.(5392-5394)gTt>gAt	p.V1798D	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.V1798D|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TGCCGAGGAAACGTCGGTGAC	0.592																																					p.V1798D		Atlas-SNP	.											.	MUC4	1505	.	0			c.T5393A						.						72.0	73.0	73.0					3																	195513058		689	1591	2280	SO:0001583	missense	4585	exon2			GAGGAAACGTCGG	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5393T>A	chr3.hg19:g.195513058A>T	ENSP00000417498:p.Val1798Asp	1820.0	1.0		1861.0	369.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1	.	.	.	.	.	.	.	.	.	.	-	5.826	0.336737	0.11013	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.44482	0.99;0.92	.	.	.	.	.	.	.	.	T	0.15349	0.0370	N	0.08118	0	0.09310	N	1	B	0.26876	0.162	B	0.14578	0.011	T	0.14783	-1.0460	7	.	.	.	.	4.0492	0.09786	0.6617:0.0:0.3382:0.0	.	1798	E7ESK3	.	D	1798	ENSP00000417498:V1798D;ENSP00000420243:V1798D	.	V	-	2	0	MUC4	196997453	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-3.208000	0.00557	-1.871000	0.01138	-1.895000	0.00532	GTT	.	.		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
LDB2	9079	hgsc.bcm.edu	37	4	16510279	16510279	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:16510279C>T	ENST00000304523.5	-	7	1093	c.770G>A	c.(769-771)cGg>cAg	p.R257Q	LDB2_ENST00000503178.2_Missense_Mutation_p.R133Q|LDB2_ENST00000441778.2_Missense_Mutation_p.R257Q|LDB2_ENST00000502640.1_Missense_Mutation_p.R257Q|LDB2_ENST00000515064.1_Missense_Mutation_p.R257Q|RP11-446J8.1_ENST00000512370.1_RNA	NM_001290.3	NP_001281.1	O43679	LDB2_HUMAN	LIM domain binding 2	257					epithelial structure maintenance (GO:0010669)|hair follicle development (GO:0001942)|positive regulation of cellular component biogenesis (GO:0044089)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|somatic stem cell maintenance (GO:0035019)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	LIM domain binding (GO:0030274)|transcription cofactor activity (GO:0003712)	p.R257Q(2)		breast(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(23)|urinary_tract(1)	33						CCTTTTTCTCCGTTTGGTTGT	0.478																																					p.R257Q		Atlas-SNP	.											LDB2_ENST00000441778,NS,carcinoma,0,1	LDB2	129	.	2	Substitution - Missense(2)	lung(2)	c.G770A						.						251.0	205.0	221.0					4																	16510279		2203	4300	6503	SO:0001583	missense	9079	exon7			TTTCTCCGTTTGG	AF068651	CCDS3420.1, CCDS47031.1	4p16	2008-08-01			ENSG00000169744	ENSG00000169744			6533	protein-coding gene	gene with protein product		603450				9853615, 9880598, 10861853	Standard	NM_001290		Approved	CLIM1, LDB1	uc003goz.3	O43679	OTTHUMG00000048212	ENST00000304523.5:c.770G>A	chr4.hg19:g.16510279C>T	ENSP00000306772:p.Arg257Gln	97.0	0.0		108.0	52.0	NM_001290	O60619|O75480	Missense_Mutation	SNP	ENST00000304523.5	hg19	CCDS3420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	36|36	5.691075|5.691075	0.96793|0.96793	.|.	.|.	ENSG00000169744|ENSG00000169744	ENST00000507464|ENST00000515064;ENST00000441778;ENST00000304523;ENST00000502640;ENST00000503178	.|T;T;T;T;T	.|0.25250	.|1.81;1.81;1.81;1.81;1.81	5.83|5.83	5.83|5.83	0.93111|0.93111	.|.	.|0.000000	.|0.64402	.|D	.|0.000010	T|T	0.55497|0.55497	0.1924|0.1924	M|M	0.81497|0.81497	2.545|2.545	0.80722|0.80722	D|D	1|1	.|D;D;D;P;D;D;D	.|0.89917	.|0.999;0.994;0.968;0.716;1.0;0.998;1.0	.|D;P;B;B;D;D;D	.|0.83275	.|0.974;0.885;0.269;0.169;0.996;0.99;0.996	T|T	0.51276|0.51276	-0.8726|-0.8726	5|10	.|0.38643	.|T	.|0.18	-17.6274|-17.6274	19.1044|19.1044	0.93287|0.93287	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|133;223;257;257;257;257;233	.|B7Z2D3;B7Z6D0;E9PFI4;G5E9Y7;O43679-2;O43679;O43679-3	.|.;.;.;.;.;LDB2_HUMAN;.	R|Q	178|257;257;257;257;133	.|ENSP00000422552:R257Q;ENSP00000392089:R257Q;ENSP00000306772:R257Q;ENSP00000423963:R257Q;ENSP00000440940:R133Q	.|ENSP00000306772:R257Q	G|R	-|-	1|2	0|0	LDB2|LDB2	16119377|16119377	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	7.818000|7.818000	0.86416|0.86416	2.756000|2.756000	0.94617|0.94617	0.655000|0.655000	0.94253|0.94253	GGA|CGG	.	.		0.478	LDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250321.2		
FRYL	285527	hgsc.bcm.edu	37	4	48529665	48529665	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:48529665T>C	ENST00000503238.1	-	50	7145	c.7146A>G	c.(7144-7146)gtA>gtG	p.V2382V	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000358350.4_Silent_p.V2382V|FRYL_ENST00000537810.1_Silent_p.V2382V			O94915	FRYL_HUMAN	FRY-like	2382					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)					breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TAGAAGAAAATACAACCTGAT	0.408																																					p.V2382V		Atlas-SNP	.											.	FRYL	242	.	0			c.A7146G						.						138.0	129.0	132.0					4																	48529665		1814	4071	5885	SO:0001819	synonymous_variant	285527	exon53			AGAAAATACAACC	AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.7146A>G	chr4.hg19:g.48529665T>C		41.0	0.0		50.0	27.0	NM_015030	O95640|Q8WTZ5|Q9NT40	Silent	SNP	ENST00000503238.1	hg19	CCDS43227.1	.	.	.	.	.	.	.	.	.	.	T	0.351	-0.944630	0.02304	.	.	ENSG00000075539	ENST00000514617	.	.	.	5.53	-2.73	0.05950	.	.	.	.	.	T	0.48040	0.1478	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42749	-0.9433	4	.	.	.	.	5.0552	0.14529	0.2558:0.4279:0.0:0.3163	.	.	.	.	V	1252	.	.	I	-	1	0	FRYL	48224422	0.943000	0.32029	0.988000	0.46212	0.045000	0.14185	0.051000	0.14141	-0.186000	0.10533	-0.441000	0.05720	ATT	.	.		0.408	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369265.2		
KIT	3815	hgsc.bcm.edu	37	4	55593652	55593652	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:55593652C>A	ENST00000288135.5	+	11	1815	c.1718C>A	c.(1717-1719)cCa>cAa	p.P573Q		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	573					actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.Y570_L576del(9)|p.P573L(4)|p.V560_L576del(4)|p.Y553_T574>S(3)|p.V555_P573del(3)|p.I563_L576del(2)|p.Q556_L576del(2)|p.N564_Y578del(2)|p.W557_Q575del(2)|p.N564_L576del(2)|p.I571_L576del(2)|p.Y568_T574del(2)|p.Y568_L576>CV(1)|p.N564_T574del(1)|p.K558_Q575del(1)|p.M552_T574>TESA(1)|p.N567_L576>E(1)|p.E561_P577del(1)|p.I571_N587del(1)|p.V569_L576>G(1)|p.V569_L576del(1)|p.K558_L576>NV(1)|p.V569_Q575del(1)|p.N564_P577del(1)|p.V559_L576del(1)|p.Q556_T574del(1)|p.E562_P573del(1)|p.Q556_P573del(1)|p.N567_P573del(1)|p.Y570_L576delYIDPTQL(1)		NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TACATAGACCCAACACAACTT	0.413		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.P573Q		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	KIT,colon,carcinoma,0,5	KIT	7396	.	55	Deletion - In frame(43)|Complex - deletion inframe(8)|Substitution - Missense(4)	soft_tissue(48)|skin(4)|eye(2)|testis(1)	c.C1718A						.						77.0	76.0	77.0					4																	55593652		2203	4300	6503	SO:0001583	missense	3815	exon11	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TAGACCCAACACA	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1718C>A	chr4.hg19:g.55593652C>A	ENSP00000288135:p.Pro573Gln	91.0	0.0		138.0	77.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	ENST00000288135.5	hg19	CCDS3496.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.875954	0.91664	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.97924	-4.61;-4.61	6.06	6.06	0.98353	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000007	D	0.98792	0.9593	M	0.81341	2.54	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.991	D;D;D	0.77557	0.954;0.99;0.91	D	0.99429	1.0935	10	0.87932	D	0	.	20.613	0.99472	0.0:1.0:0.0:0.0	.	80;569;573	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	Q	573;569	ENSP00000288135:P573Q;ENSP00000390987:P569Q	ENSP00000288135:P573Q	P	+	2	0	KIT	55288409	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.663000	0.83820	2.876000	0.98609	0.655000	0.94253	CCA	.	.		0.413	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
MAPK10	5602	hgsc.bcm.edu	37	4	86989078	86989078	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:86989078T>A	ENST00000359221.3	-	10	1359	c.833A>T	c.(832-834)cAa>cTa	p.Q278L	MAPK10_ENST00000395161.2_Missense_Mutation_p.Q278L|MAPK10_ENST00000395157.3_Missense_Mutation_p.Q133L|MAPK10_ENST00000449047.2_Missense_Mutation_p.Q133L|MAPK10_ENST00000395169.3_Missense_Mutation_p.Q240L|MAPK10_ENST00000361569.2_Missense_Mutation_p.Q278L|MAPK10_ENST00000395166.1_Missense_Mutation_p.Q240L|MAPK10_ENST00000395160.3_Missense_Mutation_p.Q133L			P53779	MK10_HUMAN	mitogen-activated protein kinase 10	278	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		TGTTCCTAGTTGTTCAATTAC	0.418																																					p.Q278L		Atlas-SNP	.											.	MAPK10	106	.	0			c.A833T						.						122.0	112.0	115.0					4																	86989078		2203	4300	6503	SO:0001583	missense	5602	exon10			CCTAGTTGTTCAA	U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.833A>T	chr4.hg19:g.86989078T>A	ENSP00000352157:p.Gln278Leu	100.0	0.0		92.0	67.0	NM_002753	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	Missense_Mutation	SNP	ENST00000359221.3	hg19	CCDS34026.1	.	.	.	.	.	.	.	.	.	.	T	12.89	2.073778	0.36566	.	.	ENSG00000109339	ENST00000395169;ENST00000359221;ENST00000395157;ENST00000361569;ENST00000395166;ENST00000395160;ENST00000449047;ENST00000395161	T;T;T;T;T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12;-0.12	5.28	5.28	0.74379	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.32224	0.0822	N	0.01679	-0.765	0.80722	D	1	B;B;B;B;B	0.16603	0.003;0.018;0.006;0.006;0.003	B;B;B;B;B	0.21360	0.015;0.034;0.01;0.01;0.011	T	0.40384	-0.9566	10	0.02654	T	1	-13.6375	15.5104	0.75776	0.0:0.0:0.0:1.0	.	164;133;240;278;278	B7Z1Z1;Q499Y8;P53779-3;P53779-2;P53779	.;.;.;.;MK10_HUMAN	L	240;278;133;278;240;133;133;278	ENSP00000378598:Q240L;ENSP00000352157:Q278L;ENSP00000378586:Q133L;ENSP00000355297:Q278L;ENSP00000378595:Q240L;ENSP00000378589:Q133L;ENSP00000414469:Q133L;ENSP00000378590:Q278L	ENSP00000352157:Q278L	Q	-	2	0	MAPK10	87208102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.111000	0.64477	0.533000	0.62120	CAA	.	.		0.418	MAPK10-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000361363.2		
NEIL3	55247	hgsc.bcm.edu	37	4	178231110	178231110	+	Start_Codon_SNP	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:178231110G>C	ENST00000264596.3	+	1	121	c.3G>C	c.(1-3)atG>atC	p.M1I		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	1					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		CCACAGAGATGGTGGAAGGAC	0.657								Base excision repair (BER), DNA glycosylases																													p.M1I		Atlas-SNP	.											.	NEIL3	89	.	0			c.G3C						.						31.0	34.0	33.0					4																	178231110		2203	4300	6503	SO:0001582	initiator_codon_variant	55247	exon1			AGAGATGGTGGAA	AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.3G>C	chr4.hg19:g.178231110G>C	ENSP00000264596:p.Met1Ile	273.0	0.0		264.0	15.0	NM_018248	Q2PPJ3|Q8NG51|Q9NV95	Missense_Mutation	SNP	ENST00000264596.3	hg19	CCDS3828.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.490157	0.84962	.	.	ENSG00000109674	ENST00000264596	T	0.27402	1.67	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.55847	0.1946	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.59899	-0.7367	9	0.87932	D	0	-26.9493	13.7254	0.62754	0.0:0.0:1.0:0.0	.	1	Q8TAT5	NEIL3_HUMAN	I	1	ENSP00000264596:M1I	ENSP00000264596:M1I	M	+	3	0	NEIL3	178468104	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	4.555000	0.60767	2.612000	0.88384	0.655000	0.94253	ATG	.	.		0.657	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248	Missense_Mutation
NEIL3	55247	hgsc.bcm.edu	37	4	178256896	178256896	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr4:178256896T>C	ENST00000264596.3	+	3	451	c.333T>C	c.(331-333)taT>taC	p.Y111Y		NM_018248.2	NP_060718	Q8TAT5	NEIL3_HUMAN	nei endonuclease VIII-like 3 (E. coli)	111					base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)	bubble DNA binding (GO:0000405)|damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA binding (GO:0003690)|single-stranded DNA binding (GO:0003697)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29		Breast(14;6.27e-05)|Melanoma(52;0.00102)|Renal(120;0.00988)|Prostate(90;0.00996)|all_hematologic(60;0.014)|all_neural(102;0.164)		all cancers(43;1.96e-23)|Epithelial(43;2.52e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.89e-11)|GBM - Glioblastoma multiforme(59;9.49e-05)|Colorectal(24;0.00013)|COAD - Colon adenocarcinoma(29;0.000696)|STAD - Stomach adenocarcinoma(60;0.00308)|LUSC - Lung squamous cell carcinoma(193;0.0398)|READ - Rectum adenocarcinoma(43;0.191)		AGTATAAATATAAAAATGGAG	0.313								Base excision repair (BER), DNA glycosylases																													p.Y111Y		Atlas-SNP	.											.	NEIL3	89	.	0			c.T333C						.						57.0	63.0	61.0					4																	178256896		2200	4298	6498	SO:0001819	synonymous_variant	55247	exon3			TAAATATAAAAAT	AB079071	CCDS3828.1	4q34	2014-02-18			ENSG00000109674	ENSG00000109674			24573	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 3"""	608934				12713815, 12509226	Standard	NM_018248		Approved	FLJ10858, hFPG2, FPG2, hNEI3, ZGRF3	uc003iut.2	Q8TAT5	OTTHUMG00000160722	ENST00000264596.3:c.333T>C	chr4.hg19:g.178256896T>C		108.0	0.0		91.0	79.0	NM_018248	Q2PPJ3|Q8NG51|Q9NV95	Silent	SNP	ENST00000264596.3	hg19	CCDS3828.1																																																																																			.	.		0.313	NEIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361914.1	NM_018248	
SLC12A7	10723	hgsc.bcm.edu	37	5	1053526	1053526	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:1053526T>C	ENST00000264930.5	-	23	3141	c.3098A>G	c.(3097-3099)gAt>gGt	p.D1033G		NM_006598.2	NP_006589.2	Q9Y666	S12A7_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 7	1033					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	32	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;5.44e-09)		Epithelial(17;0.000497)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00241)|Lung(60;0.165)		Potassium Chloride(DB00761)	CAGCTGCGCATCCTGGGACTT	0.622																																					p.D1033G		Atlas-SNP	.											.	SLC12A7	97	.	0			c.A3098G						.						176.0	138.0	151.0					5																	1053526		2203	4300	6503	SO:0001583	missense	10723	exon23			TGCGCATCCTGGG	AF105365	CCDS34129.1	5p15	2013-07-18	2013-07-18		ENSG00000113504	ENSG00000113504		"""Solute carriers"""	10915	protein-coding gene	gene with protein product		604879				10347194	Standard	NM_006598		Approved	KCC4, DKFZP434F076	uc003jbu.3	Q9Y666	OTTHUMG00000161931	ENST00000264930.5:c.3098A>G	chr5.hg19:g.1053526T>C	ENSP00000264930:p.Asp1033Gly	164.0	0.0		211.0	36.0	NM_006598	A6NDS8|Q4G0F3|Q96I81|Q9H7I3|Q9H7I7|Q9UFW2	Missense_Mutation	SNP	ENST00000264930.5	hg19	CCDS34129.1	.	.	.	.	.	.	.	.	.	.	T	7.233	0.599660	0.13939	.	.	ENSG00000113504	ENST00000264930	T	0.50813	0.73	3.88	2.67	0.31697	.	0.393288	0.24717	N	0.036172	T	0.34308	0.0893	L	0.39020	1.185	0.41687	D	0.989329	B	0.12630	0.006	B	0.12837	0.008	T	0.12811	-1.0533	10	0.52906	T	0.07	.	6.9588	0.24585	0.0:0.1257:0.0:0.8743	.	1033	Q9Y666	S12A7_HUMAN	G	1033	ENSP00000264930:D1033G	ENSP00000264930:D1033G	D	-	2	0	SLC12A7	1106526	0.696000	0.27757	0.628000	0.29241	0.201000	0.24016	1.715000	0.37971	0.468000	0.27243	0.402000	0.26972	GAT	.	.		0.622	SLC12A7-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366446.2	NM_006598	
DNAH5	1767	hgsc.bcm.edu	37	5	13830159	13830159	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:13830159A>T	ENST00000265104.4	-	37	6329	c.6225T>A	c.(6223-6225)ccT>ccA	p.P2075P		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	2075	AAA 1. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					GCCCAAATTCAGGGTTCATAG	0.388									Kartagener syndrome																												p.P2075P		Atlas-SNP	.											.	DNAH5	868	.	0			c.T6225A						.						81.0	79.0	80.0					5																	13830159		2203	4300	6503	SO:0001819	synonymous_variant	1767	exon37	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AAATTCAGGGTTC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.6225T>A	chr5.hg19:g.13830159A>T		163.0	0.0		233.0	44.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	hg19	CCDS3882.1																																																																																			.	.		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
FBXL7	23194	hgsc.bcm.edu	37	5	15928539	15928539	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:15928539A>T	ENST00000504595.1	+	3	1149	c.668A>T	c.(667-669)tAc>tTc	p.Y223F	FBXL7_ENST00000510662.1_Missense_Mutation_p.Y176F|FBXL7_ENST00000329673.7_Missense_Mutation_p.Y211F	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	223					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TCAGGCTGTTACAATATCTCC	0.567																																					p.Y223F		Atlas-SNP	.											.	FBXL7	138	.	0			c.A668T						.						97.0	94.0	95.0					5																	15928539		2049	4193	6242	SO:0001583	missense	23194	exon3			GCTGTTACAATAT	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.668A>T	chr5.hg19:g.15928539A>T	ENSP00000423630:p.Tyr223Phe	153.0	0.0		246.0	53.0	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	hg19	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	A	11.08	1.532215	0.27387	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.02369	4.32;4.32;4.32	5.14	5.14	0.70334	.	0.056384	0.64402	D	0.000001	T	0.02807	0.0084	L	0.38953	1.18	0.53688	D	0.999974	P	0.36086	0.536	B	0.31614	0.133	T	0.56475	-0.7973	10	0.10377	T	0.69	.	14.9504	0.71067	1.0:0.0:0.0:0.0	.	223	Q9UJT9	FBXL7_HUMAN	F	223;176;211	ENSP00000423630:Y223F;ENSP00000425184:Y176F;ENSP00000329632:Y211F	ENSP00000329632:Y211F	Y	+	2	0	FBXL7	15981539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.348000	0.73009	1.944000	0.56390	0.459000	0.35465	TAC	.	.		0.567	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
MYO10	4651	hgsc.bcm.edu	37	5	16704767	16704767	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:16704767T>A	ENST00000513610.1	-	22	2651	c.2197A>T	c.(2197-2199)Aaa>Taa	p.K733*	MYO10_ENST00000427430.2_Nonsense_Mutation_p.K90*|MYO10_ENST00000515803.1_Nonsense_Mutation_p.K72*|MYO10_ENST00000274203.9_Nonsense_Mutation_p.K90*|MYO10_ENST00000512061.1_5'UTR|MYO10_ENST00000505695.1_Nonsense_Mutation_p.K72*	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	733	Myosin motor.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TTCTCCAGTTTCTGTTCCAAG	0.537																																					p.K733X		Atlas-SNP	.											.	MYO10	198	.	0			c.A2197T						.						69.0	72.0	71.0					5																	16704767		2022	4182	6204	SO:0001587	stop_gained	4651	exon22			CCAGTTTCTGTTC	AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.2197A>T	chr5.hg19:g.16704767T>A	ENSP00000421280:p.Lys733*	58.0	0.0		64.0	16.0	NM_012334	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Nonsense_Mutation	SNP	ENST00000513610.1	hg19	CCDS54834.1	.	.	.	.	.	.	.	.	.	.	T	42	9.260413	0.99117	.	.	ENSG00000145555	ENST00000513610;ENST00000515803;ENST00000274203;ENST00000505695;ENST00000427430;ENST00000513882	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5602	0.50772	0.0:0.0:0.1493:0.8507	.	.	.	.	X	733;72;90;72;90;744	.	ENSP00000274203:K90X	K	-	1	0	MYO10	16757767	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	3.363000	0.52321	1.919000	0.55581	0.460000	0.39030	AAA	.	.		0.537	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366167.1	NM_012334	
MAP1B	4131	hgsc.bcm.edu	37	5	71494849	71494849	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:71494849T>C	ENST00000296755.7	+	5	5965	c.5667T>C	c.(5665-5667)taT>taC	p.Y1889Y		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	1889					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATTATGACTATGAGTCTTATG	0.468																																					p.Y1889Y	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.T5667C						.						73.0	77.0	75.0					5																	71494849		2203	4300	6503	SO:0001819	synonymous_variant	4131	exon5			TGACTATGAGTCT	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.5667T>C	chr5.hg19:g.71494849T>C		54.0	0.0		48.0	27.0	NM_005909	A2BDK5	Silent	SNP	ENST00000296755.7	hg19	CCDS4012.1																																																																																			.	.		0.468	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
VCAN	1462	hgsc.bcm.edu	37	5	82834673	82834673	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:82834673G>A	ENST00000265077.3	+	8	6416	c.5851G>A	c.(5851-5853)Gaa>Aaa	p.E1951K	VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000343200.5_Missense_Mutation_p.E964K|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1951	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CATAGCAAAAGAAGAAACGGT	0.443																																					p.E1951K		Atlas-SNP	.											.	VCAN	498	.	0			c.G5851A						.						84.0	81.0	82.0					5																	82834673		2203	4300	6503	SO:0001583	missense	1462	exon8			GCAAAAGAAGAAA	X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5851G>A	chr5.hg19:g.82834673G>A	ENSP00000265077:p.Glu1951Lys	66.0	0.0		56.0	14.0	NM_004385	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	ENST00000265077.3	hg19	CCDS4060.1	.	.	.	.	.	.	.	.	.	.	G	11.55	1.672703	0.29693	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.87103	-2.18;-2.21;2.83	5.81	4.02	0.46733	.	0.507528	0.19438	N	0.114261	T	0.81997	0.4941	M	0.61703	1.905	0.19575	N	0.999964	P;D	0.54397	0.775;0.966	B;B	0.39660	0.306;0.265	T	0.75800	-0.3190	10	0.62326	D	0.03	.	5.3563	0.16063	0.2051:0.161:0.6339:0.0	.	964;1951	P13611-2;P13611	.;CSPG2_HUMAN	K	1951;964;964	ENSP00000265077:E1951K;ENSP00000340062:E964K;ENSP00000426251:E964K	ENSP00000265077:E1951K	E	+	1	0	VCAN	82870429	0.936000	0.31750	0.034000	0.17996	0.036000	0.12997	1.535000	0.36061	0.792000	0.33850	-0.218000	0.12543	GAA	.	.		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254092.3	NM_004385	
GPR98	84059	hgsc.bcm.edu	37	5	89971058	89971058	+	Splice_Site	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:89971058A>T	ENST00000405460.2	+	24	5206		c.e24-1		GPR98_ENST00000450321.2_Splice_Site	NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98						detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGTCTCCACTAGGCTTGCTGC	0.493																																					.		Atlas-SNP	.											.	GPR98	605	.	0			c.5111-2A>T						.						42.0	42.0	42.0					5																	89971058		2045	4208	6253	SO:0001630	splice_region_variant	84059	exon24			TCCACTAGGCTTG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.5111-1A>T	chr5.hg19:g.89971058A>T		82.0	0.0		59.0	23.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Splice_Site	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	13.93	2.382524	0.42207	.	.	ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4972	0.75662	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GPR98	90006814	1.000000	0.71417	0.944000	0.38274	0.162000	0.22319	8.712000	0.91403	2.120000	0.65058	0.533000	0.62120	.	.	.		0.493	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	Intron
TCF7	6932	hgsc.bcm.edu	37	5	133480499	133480499	+	Intron	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:133480499C>T	ENST00000321584.4	+	10	1271				TCF7_ENST00000378560.4_Missense_Mutation_p.P248S|TCF7_ENST00000321603.6_Intron|TCF7_ENST00000395023.1_Intron|TCF7_ENST00000395029.1_Missense_Mutation_p.P363S|TCF7_ENST00000378564.1_Intron|TCF7_ENST00000518915.1_Intron|TCF7_ENST00000432532.2_Missense_Mutation_p.P248S|TCF7_ENST00000342854.5_Intron|TCF7_ENST00000520958.1_Intron			P36402	TCF7_HUMAN	transcription factor 7 (T-cell specific, HMG-box)						alpha-beta T cell differentiation (GO:0046632)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cellular response to interleukin-4 (GO:0071353)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic genitalia morphogenesis (GO:0030538)|embryonic hindgut morphogenesis (GO:0048619)|generation of neurons (GO:0048699)|immune response (GO:0006955)|neural tube development (GO:0021915)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor V(D)J recombination (GO:0033153)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			kidney(2)|large_intestine(7)|lung(2)|skin(1)	12		Breast(839;0.058)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCCTGGCTCGCCTAAGAAATG	0.602																																					p.P248S		Atlas-SNP	.											.	TCF7	81	.	0			c.C742T						.						104.0	105.0	104.0					5																	133480499		2110	4216	6326	SO:0001627	intron_variant	6932	exon9			GGCTCGCCTAAGA	Z47362	CCDS4169.1, CCDS4170.1, CCDS43362.1, CCDS47263.1, CCDS47263.2	5q31	2008-02-05			ENSG00000081059	ENSG00000081059			11639	protein-coding gene	gene with protein product		189908					Standard	NM_003202		Approved	TCF-1	uc003kyt.3	P36402	OTTHUMG00000129124	ENST00000321584.4:c.1076-933C>T	chr5.hg19:g.133480499C>T		218.0	0.0		107.0	38.0	NM_201634	B3KSH3|Q86WR9|Q9UKI4	Missense_Mutation	SNP	ENST00000321584.4	hg19		.	.	.	.	.	.	.	.	.	.	C	19.00	3.742881	0.69418	.	.	ENSG00000081059	ENST00000361590;ENST00000395029;ENST00000378560;ENST00000432532	D;D;D	0.99264	-5.63;-5.59;-5.65	5.97	5.97	0.96955	.	0.150059	0.43260	D	0.000588	D	0.99007	0.9661	L	0.39397	1.21	0.58432	D	0.999996	D	0.89917	1.0	D	0.83275	0.996	D	0.99222	1.0879	10	0.21540	T	0.41	.	20.428	0.99075	0.0:1.0:0.0:0.0	.	363	B7WNT5	.	S	363;363;248;248	ENSP00000378472:P363S;ENSP00000367822:P248S;ENSP00000397946:P248S	ENSP00000354863:P363S	P	+	1	0	TCF7	133508398	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.981000	0.70524	2.837000	0.97791	0.655000	0.94253	CCT	.	.		0.602	TCF7-201	KNOWN	basic	protein_coding	protein_coding		NM_201634	
PITX1	5307	hgsc.bcm.edu	37	5	134364795	134364795	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:134364795G>C	ENST00000265340.7	-	3	1035	c.619C>G	c.(619-621)Ccg>Gcg	p.P207A	PITX1_ENST00000506438.1_Missense_Mutation_p.P207A	NM_002653.4	NP_002644.4	P78337	PITX1_HUMAN	paired-like homeodomain 1	207	Interacts with PIT-1. {ECO:0000250}.				anatomical structure morphogenesis (GO:0009653)|branchiomeric skeletal muscle development (GO:0014707)|cartilage development (GO:0051216)|embryonic hindlimb morphogenesis (GO:0035116)|myoblast fate commitment (GO:0048625)|pituitary gland development (GO:0021983)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)			central_nervous_system(1)|cervix(3)|endometrium(3)|large_intestine(1)|lung(5)|ovary(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)	READ - Rectum adenocarcinoma(2;0.0607)		GACGACAGCGGGCTCATGGAG	0.642																																					p.P207A		Atlas-SNP	.											.	PITX1	31	.	0			c.C619G						.						81.0	81.0	81.0					5																	134364795		2203	4300	6503	SO:0001583	missense	5307	exon3			ACAGCGGGCTCAT	AF009648	CCDS4182.1	5q31.1	2011-06-20	2007-07-12		ENSG00000069011	ENSG00000069011		"""Homeoboxes / PRD class"""	9004	protein-coding gene	gene with protein product		602149	"""paired-like homeodomain transcription factor 1"""	BFT		9337397, 9070926	Standard	NM_002653		Approved	PTX1, POTX	uc010jea.3	P78337	OTTHUMG00000149983	ENST00000265340.7:c.619C>G	chr5.hg19:g.134364795G>C	ENSP00000265340:p.Pro207Ala	193.0	0.0		122.0	46.0	NM_002653	A8K3M0|D3DQB0|O14677|O60425|Q9BTI5	Missense_Mutation	SNP	ENST00000265340.7	hg19	CCDS4182.1	.	.	.	.	.	.	.	.	.	.	G	16.65	3.182016	0.57800	.	.	ENSG00000069011	ENST00000265340;ENST00000506438	D;D	0.92805	-3.11;-3.11	4.39	4.39	0.52855	.	0.000000	0.85682	D	0.000000	D	0.95661	0.8589	M	0.77103	2.36	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.96144	0.9102	10	0.62326	D	0.03	.	15.9519	0.79846	0.0:0.0:1.0:0.0	.	207	P78337	PITX1_HUMAN	A	207	ENSP00000265340:P207A;ENSP00000427542:P207A	ENSP00000265340:P207A	P	-	1	0	PITX1	134392694	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.715000	0.84713	1.991000	0.58162	0.462000	0.41574	CCG	.	.		0.642	PITX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251195.3		
PSD2	84249	hgsc.bcm.edu	37	5	139189340	139189340	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:139189340A>T	ENST00000274710.3	+	2	520	c.315A>T	c.(313-315)gcA>gcT	p.A105A		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	105					neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCGTGCTGGCAGAGGGGGACA	0.602																																					p.A105A		Atlas-SNP	.											.	PSD2	88	.	0			c.A315T						.						81.0	90.0	87.0					5																	139189340		2203	4300	6503	SO:0001819	synonymous_variant	84249	exon2			GCTGGCAGAGGGG	AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.315A>T	chr5.hg19:g.139189340A>T		90.0	0.0		59.0	32.0	NM_032289	D3DQD3|Q8N3J8	Silent	SNP	ENST00000274710.3	hg19	CCDS4216.1																																																																																			.	.		0.602	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251339.1	NM_032289	
ANKHD1	54882	hgsc.bcm.edu	37	5	139909162	139909162	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:139909162A>T	ENST00000360839.2	+	29	6785	c.6631A>T	c.(6631-6633)Aat>Tat	p.N2211Y	ANKHD1_ENST00000297183.6_Missense_Mutation_p.N2211Y|ANKHD1_ENST00000544120.1_Missense_Mutation_p.N594Y|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.N2211Y|SNORD45_ENST00000363181.1_RNA	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	2211						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CACACTTTTCAATCACTTCAG	0.473																																					p.N2211Y		Atlas-SNP	.											.	ANKHD1	233	.	0			c.A6631T						.						155.0	150.0	152.0					5																	139909162		2203	4300	6503	SO:0001583	missense	54882	exon29			CTTTTCAATCACT	AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.6631A>T	chr5.hg19:g.139909162A>T	ENSP00000354085:p.Asn2211Tyr	123.0	0.0		93.0	41.0	NM_017747	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	ENST00000360839.2	hg19	CCDS4225.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.24|16.24	3.068127|3.068127	0.55539|0.55539	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000433049;ENST00000544120;ENST00000532219;ENST00000437495|ENST00000435794;ENST00000432301	T;T;T;T;T;T;T|.	0.69306|.	-0.33;-0.39;1.74;1.74;1.32;-0.39;0.71|.	4.76|4.76	4.76|4.76	0.60689|0.60689	.|.	0.049886|.	0.85682|.	D|.	0.000000|.	T|T	0.68128|0.68128	0.2967|0.2967	L|L	0.53249|0.53249	1.67|1.67	0.58432|0.58432	D|D	0.99999|0.99999	D;D;D;D;D;D|.	0.76494|.	0.999;0.998;0.999;0.998;0.998;0.995|.	D;D;D;D;D;D|.	0.80764|.	0.993;0.988;0.987;0.99;0.994;0.991|.	T|T	0.66889|0.66889	-0.5809|-0.5809	10|5	0.54805|.	T|.	0.06|.	.|.	14.8011|14.8011	0.69916|0.69916	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	594;641;594;2211;2211;2211|.	Q8IWG5;Q9H059;F6WFL0;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;.;ANKH1_HUMAN|.	Y|L	2211;2211;2211;867;733;594;2211;222|701;661	ENSP00000354085:N2211Y;ENSP00000297183:N2211Y;ENSP00000393204:N867Y;ENSP00000390034:N733Y;ENSP00000437687:N594Y;ENSP00000432016:N2211Y;ENSP00000396882:N222Y|.	ENSP00000396882:N222Y|.	N|Q	+|+	1|2	0|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139889346|139889346	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	5.543000|5.543000	0.67225|0.67225	2.154000|2.154000	0.67381|0.67381	0.477000|0.477000	0.44152|0.44152	AAT|CAA	.	.		0.473	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000251672.1	NM_017747	
PCDHAC1	56135	hgsc.bcm.edu	37	5	140308516	140308516	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:140308516A>T	ENST00000253807.2	+	1	2039	c.2039A>T	c.(2038-2040)cAg>cTg	p.Q680L	PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.Q680L|PCDHA13_ENST00000409494.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA11_ENST00000398640.2_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	680					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTCTGCCCAGAACTTGTAT	0.478																																					p.Q680L		Atlas-SNP	.											.	PCDHAC1	141	.	0			c.A2039T						.						133.0	129.0	130.0					5																	140308516		2203	4300	6503	SO:0001583	missense	56135	exon1			CTGCCCAGAACTT	AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.2039A>T	chr5.hg19:g.140308516A>T	ENSP00000253807:p.Gln680Leu	79.0	0.0		52.0	24.0	NM_031882	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	ENST00000253807.2	hg19	CCDS4241.1	.	.	.	.	.	.	.	.	.	.	A	0.160	-1.081800	0.01888	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.43294	0.95;0.98	5.95	-0.666	0.11399	.	.	.	.	.	T	0.12178	0.0296	N	0.03983	-0.305	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.26883	-1.0090	9	0.02654	T	1	.	0.1142	0.00059	0.27:0.1856:0.2463:0.2982	.	680;680	Q9H158;Q9H158-2	PCDC1_HUMAN;.	L	680	ENSP00000386356:Q680L;ENSP00000253807:Q680L	ENSP00000253807:Q680L	Q	+	2	0	PCDHAC1	140288700	0.459000	0.25768	0.997000	0.53966	0.997000	0.91878	1.145000	0.31577	-0.080000	0.12685	0.460000	0.39030	CAG	.	.		0.478	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251798.1	NM_018898	
CSF1R	1436	hgsc.bcm.edu	37	5	149431544	149431544	+	IGR	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:149431544A>T	ENST00000286301.3	-	0	3989				HMGXB3_ENST00000503427.1_Missense_Mutation_p.D1191V|HMGXB3_ENST00000502717.1_Missense_Mutation_p.D1223V	NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor						cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	ATTGCCTTCGACAATGCCACT	0.552																																					p.D1223V		Atlas-SNP	.											.	HMGXB3	31	.	0			c.A3668T						.						135.0	137.0	136.0					5																	149431544		692	1591	2283	SO:0001628	intergenic_variant	22993	exon20			CCTTCGACAATGC	U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050		chr5.hg19:g.149431544A>T		88.0	0.0		68.0	28.0	NM_014983	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Missense_Mutation	SNP	ENST00000286301.3	hg19	CCDS4302.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.204847	0.79127	.	.	ENSG00000113716	ENST00000503427;ENST00000502717	.	.	.	5.97	5.97	0.96955	.	0.181299	0.64402	D	0.000014	T	0.61438	0.2347	L	0.51422	1.61	0.58432	D	0.999999	D	0.57571	0.98	P	0.48454	0.578	T	0.65907	-0.6054	9	0.87932	D	0	-25.5703	16.4504	0.83984	1.0:0.0:0.0:0.0	.	1469	Q12766	HMGX3_HUMAN	V	1191;1223	.	ENSP00000421917:D1223V	D	+	2	0	HMGXB3	149411737	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.095000	0.76952	2.288000	0.76882	0.533000	0.62120	GAC	.	.		0.552	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252329.2	NM_005211	
SLC36A3	285641	hgsc.bcm.edu	37	5	150663626	150663626	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:150663626G>T	ENST00000335230.3	-	8	1364	c.953C>A	c.(952-954)aCc>aAc	p.T318N	SLC36A3_ENST00000377713.3_Missense_Mutation_p.T359N	NM_181774.3	NP_861439.3	Q495N2	S36A3_HUMAN	solute carrier family 36, member 3	318						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	21		Medulloblastoma(196;0.109)|all_hematologic(541;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAGTTGAGGGTGATGCTGGC	0.502																																					p.T359N		Atlas-SNP	.											.	SLC36A3	54	.	0			c.C1076A						.						176.0	149.0	158.0					5																	150663626		2203	4300	6503	SO:0001583	missense	285641	exon9			TTGAGGGTGATGC	AY162215	CCDS4314.1, CCDS47316.1	5q33.1	2013-07-17	2013-07-17		ENSG00000186334	ENSG00000186334		"""Solute carriers"""	19659	protein-coding gene	gene with protein product		608332				12809675	Standard	NM_181774		Approved	PAT3, TRAMD2, tramdorin2	uc003ltw.2	Q495N2	OTTHUMG00000130128	ENST00000335230.3:c.953C>A	chr5.hg19:g.150663626G>T	ENSP00000334750:p.Thr318Asn	145.0	0.0		111.0	49.0	NM_001145017	Q495N3|Q6ZMU7|Q6ZRU4|Q7Z6B4	Missense_Mutation	SNP	ENST00000335230.3	hg19	CCDS4314.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083773	0.76642	.	.	ENSG00000186334	ENST00000335230;ENST00000377713	T;T	0.02682	4.2;4.2	4.2	3.32	0.38043	.	0.160048	0.52532	D	0.000061	T	0.21962	0.0529	H	0.95884	3.735	0.58432	D	0.999994	D;D;D	0.69078	0.996;0.997;0.993	D;D;D	0.73380	0.945;0.98;0.966	T	0.21008	-1.0258	10	0.87932	D	0	.	12.8121	0.57645	0.084:0.0:0.916:0.0	.	359;318;303	Q495N2-3;Q495N2;Q495N2-2	.;S36A3_HUMAN;.	N	318;359	ENSP00000334750:T318N;ENSP00000366942:T359N	ENSP00000334750:T318N	T	-	2	0	SLC36A3	150643819	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.780000	0.62382	2.348000	0.79779	0.655000	0.94253	ACC	.	.		0.502	SLC36A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252436.1	NM_181774	
MGAT1	4245	hgsc.bcm.edu	37	5	180218676	180218676	+	Silent	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr5:180218676C>T	ENST00000446023.2	-	3	2046	c.1296G>A	c.(1294-1296)gcG>gcA	p.A432A	MGAT1_ENST00000427865.2_Silent_p.A432A|MGAT1_ENST00000307826.4_Silent_p.A432A|MGAT1_ENST00000393340.3_Silent_p.A432A|MGAT1_ENST00000333055.3_Silent_p.A432A	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	432					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCAGTGGGGGCGCCAGGTGGA	0.622																																					p.A432A		Atlas-SNP	.											.	MGAT1	48	.	0			c.G1296A						.						39.0	41.0	40.0					5																	180218676		2203	4300	6503	SO:0001819	synonymous_variant	4245	exon3			TGGGGGCGCCAGG	M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.1296G>A	chr5.hg19:g.180218676C>T		282.0	0.0		213.0	96.0	NM_001114617	A8K404|B3KRU8|D3DWR1|Q6IBE3	Silent	SNP	ENST00000446023.2	hg19	CCDS4458.1																																																																																			.	.		0.622	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618	
ABHD16A	7920	hgsc.bcm.edu	37	6	31660873	31660873	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:31660873T>A	ENST00000395952.3	-	7	719	c.557A>T	c.(556-558)gAg>gTg	p.E186V	ABHD16A_ENST00000538874.1_Missense_Mutation_p.S88C|ABHD16A_ENST00000375842.4_5'UTR|ABHD16A_ENST00000440843.2_Missense_Mutation_p.E153V|ABHD16A_ENST00000471644.1_5'Flank|XXbac-BPG32J3.20_ENST00000461287.1_3'UTR	NM_021160.2	NP_066983.1	O95870	ABHGA_HUMAN	abhydrolase domain containing 16A	186						integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10						GTGCAGGGGCTCTGGGCGAAG	0.637																																					p.E186V		Atlas-SNP	.											.	ABHD16A	34	.	0			c.A557T						.						44.0	44.0	44.0					6																	31660873		2203	4300	6503	SO:0001583	missense	7920	exon7			AGGGGCTCTGGGC	AF129756	CCDS4713.1, CCDS54988.1	6p21.3	2013-01-17	2010-12-09	2010-12-09	ENSG00000204427	ENSG00000204427		"""Abhydrolase domain containing"""	13921	protein-coding gene	gene with protein product		142620	"""HLA-B associated transcript 5"""	BAT5		2911734, 2813433	Standard	NM_021160		Approved	NG26, D6S82E	uc003nvy.2	O95870	OTTHUMG00000031177	ENST00000395952.3:c.557A>T	chr6.hg19:g.31660873T>A	ENSP00000379282:p.Glu186Val	80.0	0.0		69.0	53.0	NM_021160	A2BEY3|B7Z4R6|Q5SRR1|Q5SRR2|Q8WYH0|Q9NW33	Missense_Mutation	SNP	ENST00000395952.3	hg19	CCDS4713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.3|26.3	4.723270|4.723270	0.89298|0.89298	.|.	.|.	ENSG00000204427|ENSG00000204427	ENST00000395952;ENST00000440843|ENST00000538874	.|.	.|.	.|.	5.63|5.63	5.63|5.63	0.86233|0.86233	.|.	0.053058|.	0.64402|.	D|.	0.000001|.	T|T	0.56171|0.56171	0.1967|0.1967	L|L	0.49350|0.49350	1.555|1.555	0.32386|0.32386	N|N	0.553967|0.553967	B;P|D	0.48911|0.76494	0.346;0.917|0.999	B;B|D	0.44315|0.65874	0.077;0.446|0.939	T|T	0.62751|0.62751	-0.6788|-0.6788	9|8	0.56958|0.87932	D|D	0.05|0	-22.2172|-22.2172	13.8019|13.8019	0.63206|0.63206	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	153;186|88	B7Z4R6;O95870|B7Z8I9	.;ABHGA_HUMAN|.	V|C	186;153|88	.|.	ENSP00000379282:E186V|ENSP00000442151:S88C	E|S	-|-	2|1	0|0	ABHD16A|ABHD16A	31768852|31768852	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.017000|5.017000	0.64047|0.64047	2.144000|2.144000	0.66660|0.66660	0.459000|0.459000	0.35465|0.35465	GAG|AGC	.	.		0.637	ABHD16A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076342.4		
PSMB9	5698	hgsc.bcm.edu	37	6	32826201	32826201	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:32826201A>T	ENST00000374859.2	+	5	520	c.451A>T	c.(451-453)Agc>Tgc	p.S151C	PSMB9_ENST00000453265.2_Missense_Mutation_p.S107C|PSMB9_ENST00000395330.1_Missense_Mutation_p.S128C	NM_002800.4	NP_002791.1	P28065	PSB9_HUMAN	proteasome (prosome, macropain) subunit, beta type, 9	151					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			large_intestine(4)|lung(4)|skin(1)	9					Carfilzomib(DB08889)	TGGCTCCGGCAGCACCTTTAT	0.527																																					p.S151C		Atlas-SNP	.											.	PSMB9	16	.	0			c.A451T						.						89.0	100.0	96.0					6																	32826201		1508	2708	4216	SO:0001583	missense	5698	exon5			TCCGGCAGCACCT		CCDS4759.1	6p21.3	2013-03-27	2013-03-27		ENSG00000240065	ENSG00000240065		"""Proteasome (prosome, macropain) subunits"""	9546	protein-coding gene	gene with protein product		177045	"""proteasome (prosome, macropain) subunit, beta type, 9 (large multifunctional protease 2)"", ""large multifunctional peptidase 2"""	LMP2		1922385, 1529427	Standard	NM_002800		Approved	RING12, beta1i, PSMB6i	uc003sga.3	P28065	OTTHUMG00000031287	ENST00000374859.2:c.451A>T	chr6.hg19:g.32826201A>T	ENSP00000363993:p.Ser151Cys	94.0	0.0		75.0	31.0	NM_002800	B0V0T1|Q16523|Q5JNW4	Missense_Mutation	SNP	ENST00000374859.2	hg19	CCDS4759.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.443498	0.83993	.	.	ENSG00000240065	ENST00000395330;ENST00000414474;ENST00000374859;ENST00000453265;ENST00000395333	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.63390	0.2507	M	0.90650	3.135	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.72191	-0.4365	10	0.87932	D	0	-0.7704	12.7006	0.57029	1.0:0.0:0.0:0.0	.	107;151	B4DZW2;P28065	.;PSB9_HUMAN	C	128;128;151;107;107	ENSP00000378739:S128C;ENSP00000394363:S128C;ENSP00000363993:S151C;ENSP00000394773:S107C	ENSP00000363993:S151C	S	+	1	0	PSMB9	32934179	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.158000	0.89649	2.155000	0.67459	0.523000	0.50628	AGC	.	.		0.527	PSMB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076624.5	NM_002800	
DEF6	50619	hgsc.bcm.edu	37	6	35280290	35280290	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:35280290A>T	ENST00000316637.5	+	4	640	c.635A>T	c.(634-636)gAg>gTg	p.E212V	DEF6_ENST00000542066.1_Intron	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	212						cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						GTCTACCAGGAGCTCATCCAA	0.632																																					p.E212V		Atlas-SNP	.											.	DEF6	36	.	0			c.A635T						.						35.0	39.0	37.0					6																	35280290		2203	4300	6503	SO:0001583	missense	50619	exon4			ACCAGGAGCTCAT	AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.635A>T	chr6.hg19:g.35280290A>T	ENSP00000319831:p.Glu212Val	167.0	0.0		93.0	76.0	NM_022047	Q86VF4	Missense_Mutation	SNP	ENST00000316637.5	hg19	CCDS4802.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.566612	0.86439	.	.	ENSG00000023892	ENST00000394658;ENST00000316637	T	0.23754	1.89	5.52	4.32	0.51571	.	0.046069	0.85682	D	0.000000	T	0.44138	0.1279	M	0.85945	2.785	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.54330	-0.8310	10	0.87932	D	0	-34.0732	12.7379	0.57236	0.8627:0.1373:0.0:0.0	.	212;212	B2RBP7;Q9H4E7	.;DEFI6_HUMAN	V	175;212	ENSP00000319831:E212V	ENSP00000319831:E212V	E	+	2	0	DEF6	35388268	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.213000	0.95133	0.991000	0.38814	0.533000	0.62120	GAG	.	.		0.632	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040276.1	NM_022047	
NCR2	9436	hgsc.bcm.edu	37	6	41309647	41309647	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:41309647T>C	ENST00000373089.5	+	3	598	c.510T>C	c.(508-510)tcT>tcC	p.S170S	NCR2_ENST00000373083.4_Silent_p.S170S|NCR2_ENST00000373086.3_Silent_p.S170S	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	170					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					AGTCTCCATCTACCATCCCTG	0.642																																					p.S170S		Atlas-SNP	.											.	NCR2	44	.	0			c.T510C						.						103.0	95.0	98.0					6																	41309647		2203	4300	6503	SO:0001819	synonymous_variant	9436	exon3			TCCATCTACCATC	AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.510T>C	chr6.hg19:g.41309647T>C		106.0	0.0		63.0	50.0	NM_004828	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Silent	SNP	ENST00000373089.5	hg19	CCDS4855.1																																																																																			.	.		0.642	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040511.3		
FRK	2444	hgsc.bcm.edu	37	6	116277657	116277657	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:116277657T>A	ENST00000606080.1	-	5	1362	c.916A>T	c.(916-918)Aca>Tca	p.T306S	FRK_ENST00000538210.1_Missense_Mutation_p.T164S	NM_002031.2	NP_002022.1	P42685	FRK_HUMAN	fyn-related Src family tyrosine kinase	306	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell differentiation (GO:0030154)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|skin(1)|urinary_tract(1)	27		all_cancers(87;0.00559)|all_epithelial(87;0.00738)|Colorectal(196;0.0465)		all cancers(137;0.0128)|OV - Ovarian serous cystadenocarcinoma(136;0.0209)|GBM - Glioblastoma multiforme(226;0.0459)|Epithelial(106;0.0625)	Regorafenib(DB08896)	ATCAACTCTGTAATAATATAA	0.353																																					p.T306S		Atlas-SNP	.											.	FRK	78	.	0			c.A916T						.						95.0	102.0	100.0					6																	116277657		2203	4300	6503	SO:0001583	missense	2444	exon5			ACTCTGTAATAAT	U00803	CCDS5103.1	6q21-q22.3	2014-06-25	2014-06-25		ENSG00000111816	ENSG00000111816	2.7.10.1	"""SH2 domain containing"""	3955	protein-coding gene	gene with protein product		606573	"""PTK5 protein tyrosine kinase 5"", ""fyn-related kinase"""	PTK5		7510261	Standard	NM_002031		Approved	RAK, GTK	uc003pwi.1	P42685	OTTHUMG00000015424	ENST00000606080.1:c.916A>T	chr6.hg19:g.116277657T>A	ENSP00000476145:p.Thr306Ser	63.0	0.0		31.0	12.0	NM_002031	B4DY49|Q13128|Q9NTR5	Missense_Mutation	SNP	ENST00000606080.1	hg19	CCDS5103.1	.	.	.	.	.	.	.	.	.	.	T	26.5	4.743712	0.89663	.	.	ENSG00000111816	ENST00000368626;ENST00000538210	T;T	0.35789	1.29;1.29	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000003	T	0.48333	0.1494	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.51919	-0.8644	10	0.72032	D	0.01	.	16.0351	0.80621	0.0:0.0:0.0:1.0	.	306	P42685	FRK_HUMAN	S	306;164	ENSP00000357615:T306S;ENSP00000443075:T164S	ENSP00000357615:T306S	T	-	1	0	FRK	116384350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.186000	0.69663	0.533000	0.62120	ACA	.	.		0.353	FRK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041924.2	NM_002031	
HIVEP2	3097	hgsc.bcm.edu	37	6	143092423	143092423	+	Silent	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:143092423C>A	ENST00000367604.1	-	4	4092	c.3453G>T	c.(3451-3453)ctG>ctT	p.L1151L	HIVEP2_ENST00000012134.2_Silent_p.L1151L|HIVEP2_ENST00000367603.2_Silent_p.L1151L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1151					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GGGCCAGGTGCAGTGGCCCCG	0.587																																					p.L1151L	Esophageal Squamous(107;843 1510 13293 16805 42198)	Atlas-SNP	.											.	HIVEP2	225	.	0			c.G3453T						.						60.0	66.0	64.0					6																	143092423		2014	4195	6209	SO:0001819	synonymous_variant	3097	exon5			CAGGTGCAGTGGC	M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3453G>T	chr6.hg19:g.143092423C>A		88.0	0.0		91.0	35.0	NM_006734	Q02646|Q5THT5|Q9NS05	Silent	SNP	ENST00000367604.1	hg19	CCDS43510.1																																																																																			.	.		0.587	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042495.1		
TIAM2	26230	hgsc.bcm.edu	37	6	155569180	155569180	+	Silent	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:155569180C>T	ENST00000461783.3	+	22	4972	c.3699C>T	c.(3697-3699)ccC>ccT	p.P1233P	TIAM2_ENST00000456877.2_Silent_p.P545P|TIAM2_ENST00000529824.2_Silent_p.P1233P|TIAM2_ENST00000456144.1_Silent_p.P1233P|TIAM2_ENST00000528391.2_Silent_p.P569P|TIAM2_ENST00000367174.2_Silent_p.P609P|TIAM2_ENST00000360366.4_Silent_p.P1257P|TIAM2_ENST00000318981.5_Silent_p.P1233P|TIAM2_ENST00000275246.7_Silent_p.P158P			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	1233	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		CCCGGAACCCCACCAAGCAGC	0.527											OREG0017745	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P1233P		Atlas-SNP	.											.	TIAM2	161	.	0			c.C3699T						.						75.0	74.0	75.0					6																	155569180		2203	4300	6503	SO:0001819	synonymous_variant	26230	exon19			GAACCCCACCAAG		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.3699C>T	chr6.hg19:g.155569180C>T		125.0	0.0	1771	83.0	69.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Silent	SNP	ENST00000461783.3	hg19	CCDS34558.1																																																																																			.	.		0.527	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
CARD11	84433	hgsc.bcm.edu	37	7	2984108	2984108	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:2984108T>A	ENST00000396946.4	-	5	825	c.422A>T	c.(421-423)cAg>cTg	p.Q141L	AC004906.3_ENST00000423194.1_RNA	NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	141					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GGCCTTCATCTGCTGCTGCAG	0.622			Mis		DLBCL																																p.Q141L		Atlas-SNP	.		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	.	CARD11	339	.	0			c.A422T						.						91.0	83.0	86.0					7																	2984108		2203	4300	6503	SO:0001583	missense	84433	exon5			TTCATCTGCTGCT	AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.422A>T	chr7.hg19:g.2984108T>A	ENSP00000380150:p.Gln141Leu	102.0	0.0		79.0	33.0	NM_032415	A4D1Z7|Q2NKN7|Q548H3	Missense_Mutation	SNP	ENST00000396946.4	hg19	CCDS5336.2	.	.	.	.	.	.	.	.	.	.	T	15.23	2.772177	0.49680	.	.	ENSG00000198286	ENST00000396946	T	0.35973	1.28	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.44117	0.1278	L	0.47716	1.5	0.58432	D	0.99999	P	0.45634	0.863	P	0.51582	0.674	T	0.43653	-0.9378	10	0.62326	D	0.03	-32.9619	13.9133	0.63881	0.0:0.0:0.0:1.0	.	141	Q9BXL7	CAR11_HUMAN	L	141	ENSP00000380150:Q141L	ENSP00000380150:Q141L	Q	-	2	0	CARD11	2950634	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	7.477000	0.81069	1.750000	0.51863	0.533000	0.62120	CAG	.	.		0.622	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059344.4	NM_032415	
SDK1	221935	hgsc.bcm.edu	37	7	4188918	4188918	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:4188918T>A	ENST00000404826.2	+	30	4587	c.4448T>A	c.(4447-4449)cTc>cAc	p.L1483H	SDK1_ENST00000389531.3_Missense_Mutation_p.L1483H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1483	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CCCAGAGAGCTCCTGGTGCCC	0.667																																					p.L1483H		Atlas-SNP	.											.	SDK1	361	.	0			c.T4448A						.						22.0	25.0	24.0					7																	4188918		2203	4300	6503	SO:0001583	missense	221935	exon30			GAGAGCTCCTGGT	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4448T>A	chr7.hg19:g.4188918T>A	ENSP00000385899:p.Leu1483His	75.0	0.0		54.0	16.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126943	0.56721	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.59364	0.27;0.27	5.06	5.06	0.68205	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000043	T	0.73079	0.3541	M	0.78456	2.415	0.09310	N	0.999994	D;D	0.89917	0.998;1.0	D;D	0.74674	0.919;0.984	T	0.66642	-0.5872	10	0.72032	D	0.01	.	9.3635	0.38210	0.0:0.0805:0.0:0.9195	.	1483;1483	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	H	1483	ENSP00000385899:L1483H;ENSP00000374182:L1483H	ENSP00000374182:L1483H	L	+	2	0	SDK1	4155444	0.732000	0.28121	0.998000	0.56505	0.935000	0.57460	2.273000	0.43381	1.907000	0.55213	0.460000	0.39030	CTC	.	.		0.667	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
SDK1	221935	hgsc.bcm.edu	37	7	4201422	4201422	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:4201422A>T	ENST00000404826.2	+	32	4873	c.4734A>T	c.(4732-4734)ccA>ccT	p.P1578P	SDK1_ENST00000389531.3_Silent_p.P1578P	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1578					cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		TTTCAGTTCCAGGAGAGCCCC	0.602																																					p.P1578P		Atlas-SNP	.											.	SDK1	361	.	0			c.A4734T						.						112.0	101.0	105.0					7																	4201422		2203	4300	6503	SO:0001819	synonymous_variant	221935	exon32			AGTTCCAGGAGAG	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.4734A>T	chr7.hg19:g.4201422A>T		134.0	0.0		90.0	39.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Silent	SNP	ENST00000404826.2	hg19	CCDS34590.1																																																																																			.	.		0.602	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
ABCB5	340273	hgsc.bcm.edu	37	7	20698148	20698148	+	Missense_Mutation	SNP	G	G	T	rs199505251		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:20698148G>T	ENST00000404938.2	+	14	2208	c.1556G>T	c.(1555-1557)gGg>gTg	p.G519V	ABCB5_ENST00000443026.2_Missense_Mutation_p.G74V|ABCB5_ENST00000406935.1_Missense_Mutation_p.G74V|ABCB5_ENST00000258738.6_Missense_Mutation_p.G74V	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	519	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ACATTGGTAGGGGAAAAAGGA	0.418																																					p.G519V		Atlas-SNP	.											.	ABCB5	357	.	0			c.G1556T						.						89.0	83.0	85.0					7																	20698148		2203	4300	6503	SO:0001583	missense	340273	exon14			TGGTAGGGGAAAA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1556G>T	chr7.hg19:g.20698148G>T	ENSP00000384881:p.Gly519Val	55.0	0.0		25.0	11.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	G	28.0	4.882530	0.91740	.	.	ENSG00000004846	ENST00000404938;ENST00000443026;ENST00000406935;ENST00000258738	D;D;D;D	0.92249	-2.31;-3.0;-3.0;-2.31	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000016	D	0.96883	0.8982	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;1.0;1.0;0.998	D	0.96886	0.9649	10	0.87932	D	0	.	19.5509	0.95319	0.0:0.0:1.0:0.0	.	74;519;74;74	B5MD19;A7BKA4;Q2M3G0;Q2M3G0-2	.;.;ABCB5_HUMAN;.	V	519;74;74;74	ENSP00000384881:G519V;ENSP00000406730:G74V;ENSP00000383899:G74V;ENSP00000258738:G74V	ENSP00000258738:G74V	G	+	2	0	ABCB5	20664673	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	9.618000	0.98365	2.937000	0.99478	0.650000	0.86243	GGG	.	G|0.999;A|0.001		0.418	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	
ABCB5	340273	hgsc.bcm.edu	37	7	20762841	20762841	+	Splice_Site	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:20762841A>T	ENST00000404938.2	+	21	3276	c.2624A>T	c.(2623-2625)aAg>aTg	p.K875M	ABCB5_ENST00000258738.6_Splice_Site_p.K430M	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	875	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						CATGCTGGAAAGGTAAAATGA	0.363																																					p.K875M		Atlas-SNP	.											.	ABCB5	357	.	0			c.A2624T						.						82.0	77.0	78.0					7																	20762841		2203	4300	6503	SO:0001630	splice_region_variant	340273	exon21			CTGGAAAGGTAAA	U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.2625+1A>T	chr7.hg19:g.20762841A>T		77.0	0.0		44.0	6.0	NM_001163941	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	ENST00000404938.2	hg19	CCDS55090.1	.	.	.	.	.	.	.	.	.	.	A	18.42	3.619024	0.66787	.	.	ENSG00000004846	ENST00000404938;ENST00000258738	D;D	0.90620	-2.7;-2.7	4.85	4.85	0.62838	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.64402	D	0.000007	D	0.95430	0.8516	M	0.86805	2.84	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.995;0.999	D	0.95924	0.8933	10	0.87932	D	0	.	12.724	0.57159	1.0:0.0:0.0:0.0	.	875;53;430	A7BKA4;A0ASV4;Q2M3G0	.;.;ABCB5_HUMAN	M	875;430	ENSP00000384881:K875M;ENSP00000258738:K430M	ENSP00000258738:K430M	K	+	2	0	ABCB5	20729366	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.714000	0.68422	2.175000	0.68902	0.533000	0.62120	AAG	.	.		0.363	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000326736.2	NM_178559	Missense_Mutation
TBX20	57057	hgsc.bcm.edu	37	7	35293206	35293206	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:35293206G>T	ENST00000408931.3	-	1	552	c.26C>A	c.(25-27)cCc>cAc	p.P9H		NM_001077653.2|NM_001166220.1	NP_001071121.1|NP_001159692.1	Q9UMR3	TBX20_HUMAN	T-box 20	9					aortic valve morphogenesis (GO:0003180)|atrial septum morphogenesis (GO:0060413)|blood circulation (GO:0008015)|cardiac chamber formation (GO:0003207)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|dorsal/ventral pattern formation (GO:0009953)|embryonic heart tube elongation (GO:0036306)|embryonic heart tube morphogenesis (GO:0003143)|endocardial cushion formation (GO:0003272)|endocardial cushion morphogenesis (GO:0003203)|endoderm formation (GO:0001706)|foramen ovale closure (GO:0035922)|heart looping (GO:0001947)|lateral mesoderm formation (GO:0048370)|muscle contraction (GO:0006936)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron migration (GO:0001764)|outflow tract septum morphogenesis (GO:0003148)|patterning of blood vessels (GO:0001569)|pericardium morphogenesis (GO:0003344)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pulmonary valve formation (GO:0003193)|pulmonary vein morphogenesis (GO:0060577)|tricuspid valve development (GO:0003175)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(9)|prostate(1)|skin(1)|stomach(1)	18						GGAGAGTTGGGGCTTGGGGGA	0.637																																					p.P9H		Atlas-SNP	.											.	TBX20	96	.	0			c.C26A						.						48.0	50.0	50.0					7																	35293206		2203	4300	6503	SO:0001583	missense	57057	exon1			AGTTGGGGCTTGG	AJ237589	CCDS43568.1	7p14.3	2014-09-17			ENSG00000164532	ENSG00000164532		"""T-boxes"""	11598	protein-coding gene	gene with protein product		606061				10936053	Standard	NM_001077653		Approved		uc011kas.2	Q9UMR3	OTTHUMG00000099411	ENST00000408931.3:c.26C>A	chr7.hg19:g.35293206G>T	ENSP00000386170:p.Pro9His	46.0	0.0		29.0	12.0	NM_001077653	A4D1Y6|Q000T4|Q0IJ70|Q0VAS1|Q9Y2N5	Missense_Mutation	SNP	ENST00000408931.3	hg19	CCDS43568.1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.174865	0.78564	.	.	ENSG00000164532	ENST00000408931	D	0.88354	-2.37	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	D	0.91307	0.7259	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.92734	0.6202	10	0.87932	D	0	.	18.0684	0.89398	0.0:0.0:1.0:0.0	.	9	Q9UMR3	TBX20_HUMAN	H	9	ENSP00000386170:P9H	ENSP00000386170:P9H	P	-	2	0	TBX20	35259731	1.000000	0.71417	1.000000	0.80357	0.854000	0.48673	9.414000	0.97362	2.349000	0.79799	0.462000	0.41574	CCC	.	.		0.637	TBX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216870.2	NM_020417	
GLI3	2737	hgsc.bcm.edu	37	7	42088201	42088201	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:42088201A>T	ENST00000395925.3	-	5	652	c.568T>A	c.(568-570)Ttc>Atc	p.F190I	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	190					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						GGAGGGCTGAAGGGAGACTCG	0.567									Pallister-Hall syndrome;Greig Cephalopolysyndactyly																												p.F190I		Atlas-SNP	.											.	GLI3	312	.	0			c.T568A						.						152.0	155.0	154.0					7																	42088201		2203	4300	6503	SO:0001583	missense	2737	exon5	Familial Cancer Database	;	GGCTGAAGGGAGA		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.568T>A	chr7.hg19:g.42088201A>T	ENSP00000379258:p.Phe190Ile	240.0	0.0		167.0	55.0	NM_000168	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	ENST00000395925.3	hg19	CCDS5465.1	.	.	.	.	.	.	.	.	.	.	A	36	5.633993	0.96682	.	.	ENSG00000106571	ENST00000395925	T	0.46063	0.88	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.43100	0.1232	M	0.67397	2.05	0.80722	D	1	P	0.39862	0.692	B	0.34590	0.186	T	0.50734	-0.8793	10	0.72032	D	0.01	.	16.003	0.80308	1.0:0.0:0.0:0.0	.	190	P10071	GLI3_HUMAN	I	190	ENSP00000379258:F190I	ENSP00000379258:F190I	F	-	1	0	GLI3	42054726	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.328000	0.96403	2.247000	0.74100	0.482000	0.46254	TTC	.	.		0.567	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250806.3	NM_000168	
POM121L12	285877	hgsc.bcm.edu	37	7	53103631	53103631	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:53103631G>A	ENST00000408890.4	+	1	283	c.267G>A	c.(265-267)ccG>ccA	p.P89P		NM_182595.3	NP_872401.3	Q8N7R1	P1L12_HUMAN	POM121 transmembrane nucleoporin-like 12	89								p.P89P(1)		endometrium(5)|kidney(1)|large_intestine(5)|lung(44)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	61						CCGCCAAGCCGCAGCGGGTGG	0.697																																					p.P89P		Atlas-SNP	.											POM121L12,NS,carcinoma,0,1	POM121L12	146	.	1	Substitution - coding silent(1)	lung(1)	c.G267A						.						14.0	17.0	16.0					7																	53103631		1855	4063	5918	SO:0001819	synonymous_variant	285877	exon1			CAAGCCGCAGCGG		CCDS43584.1	7p12.1	2012-03-13	2012-03-13		ENSG00000221900	ENSG00000221900			25369	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 12"""				Standard	NM_182595		Approved	DKFZp564N2472	uc003tpz.3	Q8N7R1	OTTHUMG00000155995	ENST00000408890.4:c.267G>A	chr7.hg19:g.53103631G>A		22.0	1.0		29.0	15.0	NM_182595	Q8NDI9	Silent	SNP	ENST00000408890.4	hg19	CCDS43584.1																																																																																			.	.		0.697	POM121L12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342656.1	NM_182595	
ASNS	440	hgsc.bcm.edu	37	7	97484710	97484710	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:97484710T>A	ENST00000394309.3	-	9	1563	c.1092A>T	c.(1090-1092)ggA>ggT	p.G364G	ASNS_ENST00000175506.4_Silent_p.G364G|ASNS_ENST00000394308.3_Silent_p.G364G|ASNS_ENST00000437628.1_Silent_p.G281G|ASNS_ENST00000444334.1_Silent_p.G343G|ASNS_ENST00000455086.1_Silent_p.G281G|ASNS_ENST00000422745.1_Silent_p.G343G	NM_133436.3	NP_597680.2	P08243	ASNS_HUMAN	asparagine synthetase (glutamine-hydrolyzing)	364	Asparagine synthetase.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|asparagine biosynthetic process (GO:0006529)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular protein metabolic process (GO:0044267)|cellular response to glucose starvation (GO:0042149)|cellular response to hormone stimulus (GO:0032870)|endoplasmic reticulum unfolded protein response (GO:0030968)|glutamine metabolic process (GO:0006541)|L-asparagine biosynthetic process (GO:0070981)|liver development (GO:0001889)|negative regulation of apoptotic process (GO:0043066)|positive regulation of mitotic cell cycle (GO:0045931)|response to amino acid (GO:0043200)|response to follicle-stimulating hormone (GO:0032354)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)|ATP binding (GO:0005524)|cofactor binding (GO:0048037)			ovary(1)	1	all_cancers(62;6.64e-09)|all_epithelial(64;1.58e-09)|Esophageal squamous(72;0.00448)|Lung NSC(181;0.0342)|all_lung(186;0.0369)				Adenosine triphosphate(DB00171)|L-Asparagine(DB00174)|L-Aspartic Acid(DB00128)|L-Glutamine(DB00130)	CTGATCCTTCTCCAGAGAAGA	0.343																																					p.G364G	Melanoma(70;6 1280 3108 3799 51123)|GBM(6;275 291 425 9929 27738)	Atlas-SNP	.											.	ASNS	97	.	0			c.A1092T						.						107.0	100.0	103.0					7																	97484710		2203	4300	6503	SO:0001819	synonymous_variant	440	exon9			TCCTTCTCCAGAG	M27396	CCDS5652.1, CCDS55131.1, CCDS55132.1	7q21.3	2012-10-02	2010-05-07		ENSG00000070669	ENSG00000070669	6.3.5.4		753	protein-coding gene	gene with protein product		108370	"""asparagine synthetase"""				Standard	NM_001673		Approved		uc003uov.4	P08243	OTTHUMG00000022892	ENST00000394309.3:c.1092A>T	chr7.hg19:g.97484710T>A		32.0	0.0		45.0	13.0	NM_133436	A4D1I8|B4DXZ1|B7ZAA9|D6W5R3|E9PCI3|E9PCX6|P08184|Q15666|Q549T9|Q96HD0	Silent	SNP	ENST00000394309.3	hg19	CCDS5652.1																																																																																			.	.		0.343	ASNS-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333645.1	NM_001673, NM_183356	
LMOD2	442721	hgsc.bcm.edu	37	7	123302237	123302237	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:123302237T>A	ENST00000458573.2	+	2	754	c.597T>A	c.(595-597)atT>atA	p.I199I	LMOD2_ENST00000456238.2_Intron	NM_207163.1	NP_997046.1	Q6P5Q4	LMOD2_HUMAN	leiomodin 2 (cardiac)	199						cytoskeleton (GO:0005856)											CTACAGTGATTGAGGACGCTT	0.433																																					p.I199I		Atlas-SNP	.											.	LMOD2	62	.	0			c.T597A						.						61.0	60.0	60.0					7																	123302237		2016	4176	6192	SO:0001819	synonymous_variant	442721	exon2			AGTGATTGAGGAC	AC006333	CCDS47693.1	7q31.32	2008-08-08			ENSG00000170807	ENSG00000170807			6648	protein-coding gene	gene with protein product		608006					Standard	NM_207163		Approved		uc003vky.2	Q6P5Q4	OTTHUMG00000157149	ENST00000458573.2:c.597T>A	chr7.hg19:g.123302237T>A		97.0	0.0		85.0	38.0	NM_207163	A4D0W9|A4D0Y2|Q8WVJ8	Silent	SNP	ENST00000458573.2	hg19	CCDS47693.1																																																																																			.	.		0.433	LMOD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348525.1		
LEP	3952	hgsc.bcm.edu	37	7	127894794	127894794	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:127894794T>A	ENST00000308868.4	+	3	533	c.482T>A	c.(481-483)cTg>cAg	p.L161Q		NM_000230.2	NP_000221.1	P41159	LEP_HUMAN	leptin	161					adipose tissue development (GO:0060612)|adult feeding behavior (GO:0008343)|bile acid metabolic process (GO:0008206)|bone mineralization involved in bone maturation (GO:0035630)|cellular response to L-ascorbic acid (GO:0071298)|cellular response to retinoic acid (GO:0071300)|central nervous system neuron development (GO:0021954)|cholesterol metabolic process (GO:0008203)|circadian rhythm (GO:0007623)|eating behavior (GO:0042755)|energy reserve metabolic process (GO:0006112)|fatty acid beta-oxidation (GO:0006635)|female pregnancy (GO:0007565)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glycerol biosynthetic process (GO:0006114)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|leptin-mediated signaling pathway (GO:0033210)|leukocyte tethering or rolling (GO:0050901)|negative regulation of apoptotic process (GO:0043066)|negative regulation of appetite (GO:0032099)|negative regulation of cartilage development (GO:0061037)|negative regulation of glucagon secretion (GO:0070093)|negative regulation of glutamine transport (GO:2000486)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vasoconstriction (GO:0045906)|ovulation from ovarian follicle (GO:0001542)|placenta development (GO:0001890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of developmental growth (GO:0048639)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of ion transport (GO:0043270)|positive regulation of luteinizing hormone secretion (GO:0033686)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of blood pressure (GO:0008217)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis (GO:0006111)|regulation of insulin secretion (GO:0050796)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of lipoprotein lipid oxidation (GO:0060587)|regulation of steroid biosynthetic process (GO:0050810)|response to dietary excess (GO:0002021)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to vitamin E (GO:0033197)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)				endometrium(1)|large_intestine(2)|lung(5)	8						CTGTGGCAGCTGGACCTCAGC	0.592																																					p.L161Q		Atlas-SNP	.											.	LEP	17	.	0			c.T482A						.						21.0	22.0	21.0					7																	127894794		2202	4297	6499	SO:0001583	missense	3952	exon3			GGCAGCTGGACCT		CCDS5800.1	7q31	2008-03-06	2008-03-06		ENSG00000174697	ENSG00000174697			6553	protein-coding gene	gene with protein product		164160	"""leptin (murine obesity homolog)"", ""leptin (obesity homolog, mouse)"""	OBS, OB		1686014, 16932309	Standard	NM_000230		Approved		uc003vml.2	P41159	OTTHUMG00000157564	ENST00000308868.4:c.482T>A	chr7.hg19:g.127894794T>A	ENSP00000312652:p.Leu161Gln	40.0	0.0		25.0	13.0	NM_000230	O15158|Q56A88	Missense_Mutation	SNP	ENST00000308868.4	hg19	CCDS5800.1	.	.	.	.	.	.	.	.	.	.	T	18.48	3.632859	0.67015	.	.	ENSG00000174697	ENST00000308868	T	0.71222	-0.55	5.54	5.54	0.83059	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.000000	0.45606	D	0.000353	D	0.82692	0.5092	M	0.74881	2.28	0.42842	D	0.994059	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85018	0.0910	10	0.87932	D	0	-12.7464	12.0609	0.53562	0.0:0.0:0.0:1.0	.	161;161	A4D0Y8;P41159	.;LEP_HUMAN	Q	161	ENSP00000312652:L161Q	ENSP00000312652:L161Q	L	+	2	0	LEP	127682030	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	4.140000	0.58031	2.108000	0.64289	0.533000	0.62120	CTG	.	.		0.592	LEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349174.1		
CNOT4	4850	hgsc.bcm.edu	37	7	135095305	135095305	+	Nonsense_Mutation	SNP	T	T	A	rs548144515		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:135095305T>A	ENST00000315544.5	-	7	1060	c.781A>T	c.(781-783)Aaa>Taa	p.K261*	CNOT4_ENST00000428680.2_Nonsense_Mutation_p.K261*|CNOT4_ENST00000423368.2_Nonsense_Mutation_p.K261*|CNOT4_ENST00000541284.1_Nonsense_Mutation_p.K261*|CNOT4_ENST00000451834.1_Nonsense_Mutation_p.K261*|CNOT4_ENST00000414802.1_Nonsense_Mutation_p.K261*|CNOT4_ENST00000361528.4_Nonsense_Mutation_p.K261*|CNOT4_ENST00000356162.4_Nonsense_Mutation_p.K261*	NM_001190848.1	NP_001177777.1	O95628	CNOT4_HUMAN	CCR4-NOT transcription complex, subunit 4	261					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|protein autoubiquitination (GO:0051865)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	22						TTCTTATTTTTATCAACTGAA	0.343																																					p.K261X	Ovarian(51;766 1130 5502 35047 50875)	Atlas-SNP	.											.	CNOT4	146	.	0			c.A781T						.						132.0	128.0	129.0					7																	135095305		1838	4083	5921	SO:0001587	stop_gained	4850	exon7			TATTTTTATCAAC	AF180475	CCDS43650.1, CCDS47719.1, CCDS55164.1, CCDS55165.1, CCDS55166.1, CCDS55167.1	7q33	2013-09-19			ENSG00000080802	ENSG00000080802		"""RNA binding motif (RRM) containing"""	7880	protein-coding gene	gene with protein product		604911		NOT4		10637334	Standard	NM_013316		Approved	CLONE243, NOT4H	uc011kpy.2	O95628	OTTHUMG00000155568	ENST00000315544.5:c.781A>T	chr7.hg19:g.135095305T>A	ENSP00000326731:p.Lys261*	78.0	0.0		63.0	30.0	NM_001190850	B7Z6I4|E7ET38|F8VQP3|O95339|O95627|Q8IYM7|Q8NCL0|Q9NPQ1|Q9NZN6	Nonsense_Mutation	SNP	ENST00000315544.5	hg19	CCDS55166.1	.	.	.	.	.	.	.	.	.	.	T	40	8.069415	0.98638	.	.	ENSG00000080802	ENST00000541284;ENST00000451834;ENST00000423368;ENST00000262563;ENST00000361528;ENST00000414802;ENST00000356162;ENST00000428680;ENST00000315544	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.0371	15.644	0.77033	0.0:0.0:0.0:1.0	.	.	.	.	X	261	.	ENSP00000262563:K261X	K	-	1	0	CNOT4	134745845	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.101000	0.63845	0.533000	0.62120	AAA	.	.		0.343	CNOT4-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_013316	
MGAM	8972	hgsc.bcm.edu	37	7	141765270	141765270	+	Splice_Site	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:141765270T>A	ENST00000549489.2	+	38	4713		c.e38+2		MGAM_ENST00000475668.2_Splice_Site	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	CTATCATTGGTGCGTGGGTCC	0.592																																					.		Atlas-SNP	.											.	MGAM	767	.	0			c.4618+2T>A						.						73.0	79.0	77.0					7																	141765270		2033	4185	6218	SO:0001630	splice_region_variant	8972	exon38			CATTGGTGCGTGG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4618+2T>A	chr7.hg19:g.141765270T>A		90.0	0.0		64.0	37.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Splice_Site	SNP	ENST00000549489.2	hg19	CCDS47727.1	.	.	.	.	.	.	.	.	.	.	T	15.60	2.881642	0.51908	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	.	.	.	3.97	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8945	0.52650	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MGAM	141411739	1.000000	0.71417	0.957000	0.39632	0.492000	0.33523	7.896000	0.87350	1.436000	0.47453	0.254000	0.18369	.	.	.		0.592	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		Intron
SSPO	23145	hgsc.bcm.edu	37	7	149529876	149529876	+	RNA	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:149529876A>T	ENST00000378016.2	+	0	15293							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGCAGAGCCAGTGTGACTGC	0.637																																					p.Q5097L		Atlas-SNP	.											.	.	.	.	0			c.A15290T						.						43.0	50.0	48.0					7																	149529876		2057	4206	6263			23145	exon109			AGAGCCAGTGTGA	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149529876A>T		86.0	0.0		40.0	17.0	NM_198455	Q76B61	Missense_Mutation	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.637	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
WDR60	55112	hgsc.bcm.edu	37	7	158672638	158672638	+	Silent	SNP	A	A	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr7:158672638A>G	ENST00000407559.3	+	5	995	c.837A>G	c.(835-837)aaA>aaG	p.K279K		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	279					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		TGGATAGAAAAGAGAAATCGG	0.478																																					p.K279K		Atlas-SNP	.											.	WDR60	94	.	0			c.A837G						.						69.0	73.0	72.0					7																	158672638		1882	4096	5978	SO:0001819	synonymous_variant	55112	exon5			TAGAAAAGAGAAA		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.837A>G	chr7.hg19:g.158672638A>G		213.0	0.0		189.0	72.0	NM_018051	Q9NW58	Silent	SNP	ENST00000407559.3	hg19	CCDS47757.1																																																																																			.	.		0.478	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
LZTS1	11178	hgsc.bcm.edu	37	8	20112615	20112615	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:20112615G>A	ENST00000381569.1	-	2	435	c.78C>T	c.(76-78)cgC>cgT	p.R26R	LZTS1_ENST00000265801.6_Silent_p.R26R|LZTS1_ENST00000522290.1_Silent_p.R26R			Q9Y250	LZTS1_HUMAN	leucine zipper, putative tumor suppressor 1	26					cell cycle (GO:0007049)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of macroautophagy (GO:0016242)|positive regulation of type I interferon production (GO:0032481)|regulation of dendrite morphogenesis (GO:0048814)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|nucleoplasm (GO:0005654)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(16)|ovary(2)|skin(1)|urinary_tract(1)	29				Colorectal(74;0.0511)|COAD - Colon adenocarcinoma(73;0.207)		GGGAGGACTTGCGCAGCTTGT	0.612																																					p.R26R		Atlas-SNP	.											.	LZTS1	72	.	0			c.C78T						.						68.0	70.0	69.0					8																	20112615		2203	4300	6503	SO:0001819	synonymous_variant	11178	exon1			GGACTTGCGCAGC	AF123659	CCDS6015.1	8p22	2012-10-05			ENSG00000061337	ENSG00000061337			13861	protein-coding gene	gene with protein product		606551	"""F37/Esophageal cancer-related gene-coding leucine-zipper motif"""			10097140, 17349584	Standard	NM_021020		Approved	FEZ1	uc003wzr.3	Q9Y250	OTTHUMG00000097027	ENST00000381569.1:c.78C>T	chr8.hg19:g.20112615G>A		99.0	0.0		105.0	27.0	NM_021020	D3DSQ6|Q9Y5V7|Q9Y5V8|Q9Y5V9|Q9Y5W0|Q9Y5W1|Q9Y5W2	Silent	SNP	ENST00000381569.1	hg19	CCDS6015.1																																																																																			.	.		0.612	LZTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214122.1	NM_021020	
C8orf58	541565	hgsc.bcm.edu	37	8	22458397	22458397	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:22458397G>T	ENST00000289989.5	+	2	117	c.43G>T	c.(43-45)Ggg>Tgg	p.G15W	AC037459.4_ENST00000430850.2_Missense_Mutation_p.M122I|C8orf58_ENST00000409586.3_Missense_Mutation_p.G15W|C8orf58_ENST00000453427.2_3'UTR			Q8NAV2	CH058_HUMAN	chromosome 8 open reading frame 58	15										endometrium(1)|lung(1)|ovary(1)|skin(1)	4		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00563)|Colorectal(74;0.0145)|COAD - Colon adenocarcinoma(73;0.0608)		CCATGCAGATGGGGCTGGCGA	0.672																																					p.G15W		Atlas-SNP	.											.	C8orf58	17	.	0			c.G43T						.						18.0	18.0	18.0					8																	22458397		2188	4290	6478	SO:0001583	missense	541565	exon2			GCAGATGGGGCTG	BC012750	CCDS34862.1, CCDS56527.1, CCDS75708.1	8p21.3	2010-08-17			ENSG00000241852	ENSG00000241852			32233	protein-coding gene	gene with protein product							Standard	NM_001013842		Approved	FLJ34715	uc003xce.3	Q8NAV2	OTTHUMG00000154160	ENST00000289989.5:c.43G>T	chr8.hg19:g.22458397G>T	ENSP00000289989:p.Gly15Trp	76.0	0.0		64.0	42.0	NM_001013842	B4DI44	Missense_Mutation	SNP	ENST00000289989.5	hg19	CCDS34862.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	14.33|14.33	2.502875|2.502875	0.44558|0.44558	.|.	.|.	ENSG00000248235;ENSG00000241852;ENSG00000241852|ENSG00000248235	ENST00000450780;ENST00000409586;ENST00000289989|ENST00000430850;ENST00000447849	.|D	.|0.86694	.|-2.16	4.63|4.63	0.416|0.416	0.16416|0.16416	.|.	0.277746|.	0.25768|.	N|.	0.028436|.	D|D	0.84942|0.84942	0.5584|0.5584	M|M	0.70595|0.70595	2.14|2.14	0.30818|0.30818	N|N	0.738143|0.738143	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.999|.	T|T	0.76790|0.76790	-0.2829|-0.2829	9|7	0.87932|0.28530	D|T	0|0.3	-8.0847|-8.0847	3.0475|3.0475	0.06158|0.06158	0.0979:0.3382:0.3903:0.1736|0.0979:0.3382:0.3903:0.1736	.|.	15;15|.	Q8NAV2-2;Q8NAV2|.	.;CH058_HUMAN|.	W|I	84;15;15|122;106	.|ENSP00000428700:M122I	ENSP00000399696:G84W|ENSP00000428700:M122I	G|M	+|+	1|3	0|0	AC037459.4;C8orf58|AC037459.4	22514342|22514342	0.017000|0.017000	0.18338|0.18338	0.342000|0.342000	0.25602|0.25602	0.247000|0.247000	0.25773|0.25773	0.056000|0.056000	0.14256|0.14256	0.077000|0.077000	0.16863|0.16863	0.448000|0.448000	0.29417|0.29417	GGG|ATG	.	.		0.672	C8orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334183.1	NM_001013842	
UNC5D	137970	hgsc.bcm.edu	37	8	35542098	35542098	+	Splice_Site	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:35542098A>T	ENST00000404895.2	+	6	1079		c.e6-1		UNC5D_ENST00000416672.1_Splice_Site|UNC5D_ENST00000287272.2_Intron|UNC5D_ENST00000420357.1_Intron|UNC5D_ENST00000453357.2_Splice_Site	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)						apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		TTTCTCTCTCAGTGAATGGAG	0.532																																					.		Atlas-SNP	.											.	UNC5D	393	.	0			c.752-2A>T						.						88.0	86.0	86.0					8																	35542098		2203	4300	6503	SO:0001630	splice_region_variant	137970	exon6			TCTCTCAGTGAAT	AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.752-1A>T	chr8.hg19:g.35542098A>T		109.0	0.0		85.0	16.0	NM_080872	Q8WYP7	Splice_Site	SNP	ENST00000404895.2	hg19	CCDS6093.2	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110921	0.77210	.	.	ENSG00000156687	ENST00000404895;ENST00000416672;ENST00000453357	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1367	0.72572	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UNC5D	35661640	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	2.039000	0.60335	0.533000	0.62120	.	.	.		0.532	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347586.2		Intron
CHD7	55636	hgsc.bcm.edu	37	8	61765635	61765635	+	Silent	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:61765635C>T	ENST00000423902.2	+	31	6830	c.6351C>T	c.(6349-6351)ctC>ctT	p.L2117L	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2117					adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			ATCACATCCTCAATGACCCTG	0.502																																					p.L2117L		Atlas-SNP	.											.	CHD7	534	.	0			c.C6351T						.						87.0	95.0	92.0					8																	61765635		2044	4183	6227	SO:0001819	synonymous_variant	55636	exon31			CATCCTCAATGAC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6351C>T	chr8.hg19:g.61765635C>T		176.0	0.0		182.0	50.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Silent	SNP	ENST00000423902.2	hg19	CCDS47865.1																																																																																			.	.		0.502	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
TRPS1	7227	hgsc.bcm.edu	37	8	116599393	116599393	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:116599393A>C	ENST00000220888.5	-	4	2655	c.2496T>G	c.(2494-2496)aaT>aaG	p.N832K	TRPS1_ENST00000519076.1_Missense_Mutation_p.N586K|TRPS1_ENST00000395715.3_Missense_Mutation_p.N845K|TRPS1_ENST00000519674.1_Missense_Mutation_p.N832K|TRPS1_ENST00000520276.1_Missense_Mutation_p.N836K			Q9UHF7	TRPS1_HUMAN	trichorhinophalangeal syndrome I	832					chondrocyte differentiation (GO:0002062)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|regulation of chondrocyte differentiation (GO:0032330)|regulation of histone deacetylation (GO:0031063)|skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(58)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	111	all_cancers(13;5.44e-23)|all_epithelial(1;2.14e-27)|Lung NSC(37;2.55e-05)|Ovarian(258;0.0219)		Epithelial(1;9.78e-37)|all cancers(1;3.14e-31)|BRCA - Breast invasive adenocarcinoma(1;2.56e-12)			CGGCCTCCACATTGGGACTAT	0.617									Langer-Giedion syndrome																												p.N845K		Atlas-SNP	.											.	TRPS1	516	.	0			c.T2535G						.						60.0	62.0	62.0					8																	116599393		1879	4108	5987	SO:0001583	missense	7227	exon5	Familial Cancer Database	Trichorhinophalangeal syndrome type 2, TRPS II	CTCCACATTGGGA	AF183810	CCDS6318.2, CCDS64957.1	8q23.3	2014-06-23			ENSG00000104447	ENSG00000104447		"""GATA zinc finger domain containing"", ""Zinc fingers, C2H2-type"""	12340	protein-coding gene	gene with protein product		604386				8530105, 10615131, 10647898	Standard	NM_001282903		Approved	LGCR	uc003yny.3	Q9UHF7	OTTHUMG00000142829	ENST00000220888.5:c.2496T>G	chr8.hg19:g.116599393A>C	ENSP00000220888:p.Asn832Lys	51.0	0.0		117.0	20.0	NM_014112	B4E1Z5|Q08AU2|Q9NWE1|Q9UHH6	Missense_Mutation	SNP	ENST00000220888.5	hg19		.	.	.	.	.	.	.	.	.	.	A	12.33	1.905969	0.33628	.	.	ENSG00000104447	ENST00000395715;ENST00000220888;ENST00000519076;ENST00000520276;ENST00000519674	D;D;D;D;T	0.98362	-4.89;-4.86;-4.84;-4.87;0.89	5.76	-0.777	0.10981	.	0.373808	0.30879	N	0.008691	D	0.95633	0.8580	L	0.27053	0.805	0.39207	D	0.963248	B;P;P	0.46220	0.01;0.801;0.874	B;B;P	0.47402	0.017;0.344;0.546	D	0.92846	0.6293	10	0.56958	D	0.05	.	11.8384	0.52340	0.5558:0.0:0.4442:0.0	.	836;832;845	Q9UHF7-3;Q9UHF7;Q9UHF7-2	.;TRPS1_HUMAN;.	K	845;832;586;836;832	ENSP00000379065:N845K;ENSP00000220888:N832K;ENSP00000428910:N586K;ENSP00000428680:N836K;ENSP00000429174:N832K	ENSP00000220888:N832K	N	-	3	2	TRPS1	116668568	0.003000	0.15002	0.901000	0.35422	0.697000	0.40408	-1.834000	0.01693	-0.082000	0.12640	-0.256000	0.11100	AAT	.	.		0.617	TRPS1-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000286436.3	NM_014112	
LRRC6	23639	hgsc.bcm.edu	37	8	133595953	133595953	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:133595953T>A	ENST00000519595.1	-	11	1312	c.1214A>T	c.(1213-1215)cAa>cTa	p.Q405L	LRRC6_ENST00000518642.1_Missense_Mutation_p.Q402L|LRRC6_ENST00000250173.1_Missense_Mutation_p.Q405L			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	405					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGTATTTGTTTGTTCTCTGCT	0.398																																					p.Q405L		Atlas-SNP	.											.	LRRC6	58	.	0			c.A1214T						.						234.0	198.0	210.0					8																	133595953		2203	4300	6503	SO:0001583	missense	23639	exon11			TTTGTTTGTTCTC	U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.1214A>T	chr8.hg19:g.133595953T>A	ENSP00000429791:p.Gln405Leu	95.0	0.0		289.0	44.0	NM_012472	Q13648|Q4G183	Missense_Mutation	SNP	ENST00000519595.1	hg19		.	.	.	.	.	.	.	.	.	.	T	0.719	-0.784234	0.02907	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T;T	0.54071	0.74;0.89;0.59;0.74	4.57	2.14	0.27477	.	0.982780	0.08353	N	0.959001	T	0.43942	0.1270	L	0.50333	1.59	0.09310	N	1	B	0.22983	0.078	B	0.21546	0.035	T	0.34576	-0.9823	10	0.33940	T	0.23	-1.7026	4.7981	0.13282	0.0:0.0991:0.1902:0.7107	.	405	Q86X45	LRRC6_HUMAN	L	405;145;402;405;405	ENSP00000429791:Q405L;ENSP00000428015:Q145L;ENSP00000428610:Q402L;ENSP00000250173:Q405L	ENSP00000250173:Q405L	Q	-	2	0	LRRC6	133665135	0.014000	0.17966	0.012000	0.15200	0.014000	0.08584	0.106000	0.15354	0.355000	0.24131	0.477000	0.44152	CAA	.	.		0.398	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000379578.1	NM_012472	
PUF60	22827	hgsc.bcm.edu	37	8	144899155	144899155	+	Silent	SNP	G	G	A	rs372944670		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:144899155G>A	ENST00000526683.1	-	11	1860	c.1305C>T	c.(1303-1305)agC>agT	p.S435S	SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000524570.1_5'Flank|SCRIB_ENST00000377533.3_5'Flank|PUF60_ENST00000349157.6_Silent_p.S418S|SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000313352.7_Silent_p.S375S|PUF60_ENST00000527197.1_Silent_p.S389S|PUF60_ENST00000456095.2_Silent_p.S406S|PUF60_ENST00000453551.2_Silent_p.S392S	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	435	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCTCCTGCTCGCTCAGCATCT	0.627																																					p.S435S		Atlas-SNP	.											.	PUF60	26	.	0			c.C1305T						.	G	,,	1,4341		0,1,2170	43.0	40.0	41.0		1176,1254,1305	-8.5	0.9	8		41	0,8538		0,0,4269	no	coding-synonymous,coding-synonymous,coding-synonymous	PUF60	NM_001136033.1,NM_014281.3,NM_078480.1	,,	0,1,6439	AA,AG,GG		0.0,0.023,0.0078	,,	392/517,418/543,435/560	144899155	1,12879	2171	4269	6440	SO:0001819	synonymous_variant	22827	exon11			CTGCTCGCTCAGC	AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.1305C>T	chr8.hg19:g.144899155G>A		111.0	0.0		128.0	10.0	NM_078480	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Silent	SNP	ENST00000526683.1	hg19	CCDS47934.1																																																																																			.	.		0.627	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382222.1	NM_014281	
EPPK1	83481	hgsc.bcm.edu	37	8	144943295	144943295	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:144943295T>A	ENST00000525985.1	-	2	4198	c.4127A>T	c.(4126-4128)cAg>cTg	p.Q1376L				P58107	EPIPL_HUMAN	epiplakin 1	1376						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(2)|lung(30)|ovary(2)|pancreas(1)|prostate(10)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(97;1.42e-10)|all_epithelial(106;1.99e-09)|Lung NSC(106;0.000126)|all_lung(105;0.000354)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;2.88e-40)|all cancers(56;1.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			GGCTGCCGCCTGGGGCAGGTG	0.647																																					p.Q1376L		Atlas-SNP	.											.	EPPK1	199	.	0			c.A4127T						.						15.0	18.0	17.0					8																	144943295		2098	4213	6311	SO:0001583	missense	83481	exon1			GCCGCCTGGGGCA	AB051895	CCDS75800.1	8q24.3	2014-09-17				ENSG00000261150			15577	protein-coding gene	gene with protein product	"""epidermal autoantigen 450K"""	607553				11278896, 15671067	Standard	NM_031308		Approved	EPIPL1	uc003zaa.1	P58107		ENST00000525985.1:c.4127A>T	chr8.hg19:g.144943295T>A	ENSP00000436337:p.Gln1376Leu	51.0	0.0		100.0	41.0	NM_031308	Q76E58|Q9NSU9	Missense_Mutation	SNP	ENST00000525985.1	hg19		.	.	.	.	.	.	.	.	.	.	T	10.99	1.507695	0.27036	.	.	ENSG00000227184	ENST00000525985	T	0.66815	-0.23	4.66	-1.21	0.09524	.	.	.	.	.	T	0.32315	0.0825	N	0.04090	-0.28	0.20196	N	0.999923	B	0.02656	0.0	B	0.06405	0.002	T	0.19418	-1.0306	9	0.08179	T	0.78	.	2.0822	0.03637	0.5618:0.101:0.1171:0.2201	.	1376	E9PPU0	.	L	1376	ENSP00000436337:Q1376L	ENSP00000436337:Q1376L	Q	-	2	0	EPPK1	145015283	0.014000	0.17966	0.490000	0.27465	0.692000	0.40212	2.568000	0.45965	-0.311000	0.08754	0.533000	0.62120	CAG	.	.		0.647	EPPK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382675.1	NM_031308	
SLC39A4	55630	hgsc.bcm.edu	37	8	145640635	145640635	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr8:145640635T>A	ENST00000301305.3	-	3	748	c.643A>T	c.(643-645)Agc>Tgc	p.S215C	SLC39A4_ENST00000531013.1_5'Flank|SLC39A4_ENST00000276833.5_Missense_Mutation_p.S190C	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	215					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			GGGACCTCGCTGCTGTGCTGC	0.687																																					p.S215C		Atlas-SNP	.											.	SLC39A4	54	.	0			c.A643T						.						48.0	49.0	49.0					8																	145640635		2202	4299	6501	SO:0001583	missense	55630	exon3			CCTCGCTGCTGTG	AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.643A>T	chr8.hg19:g.145640635T>A	ENSP00000301305:p.Ser215Cys	161.0	0.0		273.0	34.0	NM_130849	Q7L5S5|Q9H6T8|Q9NXC4	Missense_Mutation	SNP	ENST00000301305.3	hg19	CCDS6424.1	.	.	.	.	.	.	.	.	.	.	T	15.46	2.840512	0.51057	.	.	ENSG00000147804	ENST00000276833;ENST00000301305;ENST00000526658	T;T;T	0.57107	0.42;0.42;0.42	5.3	0.336	0.15958	.	1.006370	0.07985	N	0.986169	T	0.41166	0.1147	L	0.36672	1.1	0.09310	N	1	B;B	0.22480	0.011;0.07	B;B	0.15870	0.008;0.014	T	0.35151	-0.9800	10	0.66056	D	0.02	-4.4124	7.6192	0.28175	0.0:0.4401:0.0:0.5599	.	215;190	Q6P5W5;A6NDY5	S39A4_HUMAN;.	C	190;215;121	ENSP00000276833:S190C;ENSP00000301305:S215C;ENSP00000434512:S121C	ENSP00000276833:S190C	S	-	1	0	SLC39A4	145611443	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.077000	0.11394	-0.151000	0.11176	-0.394000	0.06481	AGC	.	.		0.687	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382688.1		
SLC24A2	25769	hgsc.bcm.edu	37	9	19786418	19786418	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:19786418T>A	ENST00000341998.2	-	1	508	c.447A>T	c.(445-447)ttA>ttT	p.L149F	SLC24A2_ENST00000286344.3_Missense_Mutation_p.L149F	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	149					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		AGACAATGGCTAAGGCTATGA	0.458																																					p.L149F		Atlas-SNP	.											.	SLC24A2	93	.	0			c.A447T						.						89.0	84.0	86.0					9																	19786418		2203	4300	6503	SO:0001583	missense	25769	exon1			AATGGCTAAGGCT	AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.447A>T	chr9.hg19:g.19786418T>A	ENSP00000344801:p.Leu149Phe	31.0	0.0		33.0	27.0	NM_001193288	B7ZLL8|Q9NTN5|Q9NZQ4	Missense_Mutation	SNP	ENST00000341998.2	hg19	CCDS6493.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.407084	0.62399	.	.	ENSG00000155886	ENST00000341998;ENST00000286344	T;T	0.67345	-0.26;-0.26	5.76	5.76	0.90799	Sodium/calcium exchanger membrane region (1);	0.000000	0.85682	D	0.000000	D	0.85588	0.5731	M	0.91717	3.235	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.88768	0.3262	9	.	.	.	.	16.0738	0.80955	0.0:0.0:0.0:1.0	.	149;149	Q9UI40-2;Q9UI40	.;NCKX2_HUMAN	F	149	ENSP00000344801:L149F;ENSP00000286344:L149F	.	L	-	3	2	SLC24A2	19776418	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.692000	0.47018	2.192000	0.70111	0.533000	0.62120	TTA	.	.		0.458	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051866.2	NM_020344	
TLE4	7091	hgsc.bcm.edu	37	9	82333727	82333727	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:82333727T>A	ENST00000376552.2	+	15	2449	c.1431T>A	c.(1429-1431)caT>caA	p.H477Q	TLE4_ENST00000376537.4_Missense_Mutation_p.H509Q|TLE4_ENST00000376534.4_Missense_Mutation_p.H114Q|TLE4_ENST00000265284.6_Missense_Mutation_p.H452Q|TLE4_ENST00000376520.4_Missense_Mutation_p.H509Q|TLE4_ENST00000376544.3_Missense_Mutation_p.H408Q	NM_007005.3	NP_008936.2	Q04727	TLE4_HUMAN	transducin-like enhancer of split 4	477					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(10)|lung(12)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	39						TCCCCCGGCATGCTCGCCAGA	0.602																																					p.H477Q		Atlas-SNP	.											.	TLE4	187	.	0			c.T1431A						.						119.0	110.0	113.0					9																	82333727		2203	4300	6503	SO:0001583	missense	7091	exon15			CCGGCATGCTCGC	M99439	CCDS43837.1, CCDS65069.1, CCDS65070.1, CCDS75851.1	9q21.32	2014-03-07	2014-03-07		ENSG00000106829	ENSG00000106829		"""WD repeat domain containing"""	11840	protein-coding gene	gene with protein product		605132	"""transducin-like enhancer of split 4, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 4 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005252167		Approved	E(spI), ESG, GRG4	uc004alc.3	Q04727	OTTHUMG00000020072	ENST00000376552.2:c.1431T>A	chr9.hg19:g.82333727T>A	ENSP00000365735:p.His477Gln	168.0	0.0		156.0	36.0	NM_007005	F8W6T6|Q3ZCS1|Q5T1Y2|Q6PCB3|Q9BZ07|Q9BZ08|Q9BZ09|Q9NSL3|Q9ULF9	Missense_Mutation	SNP	ENST00000376552.2	hg19	CCDS43837.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.34|12.34	1.908985|1.908985	0.33721|0.33721	.|.	.|.	ENSG00000106829|ENSG00000106829	ENST00000496114|ENST00000376552;ENST00000376544;ENST00000376520;ENST00000376537;ENST00000376534;ENST00000265284	.|T;T;T;T;T;T	.|0.10573	.|2.86;2.86;2.86;2.86;2.86;2.86	5.83|5.83	-1.61|-1.61	0.08399|0.08399	.|WD40 repeat-like-containing domain (1);	.|0.093065	.|0.64402	.|D	.|0.000001	T|T	0.26846|0.26846	0.0657|0.0657	M|M	0.77616|0.77616	2.38|2.38	0.58432|0.58432	D|D	0.999994|0.999994	.|B;D;B;P	.|0.60575	.|0.418;0.988;0.026;0.536	.|B;D;B;B	.|0.71184	.|0.181;0.972;0.113;0.264	T|T	0.02358|0.02358	-1.1171|-1.1171	5|10	.|0.46703	.|T	.|0.11	-22.0444|-22.0444	10.9983|10.9983	0.47589|0.47589	0.0:0.3854:0.0:0.6146|0.0:0.3854:0.0:0.6146	.|.	.|452;408;509;477	.|F8W6T6;Q04727-2;Q04727-3;Q04727	.|.;.;.;TLE4_HUMAN	S|Q	293|477;408;509;509;114;452	.|ENSP00000365735:H477Q;ENSP00000365727:H408Q;ENSP00000365703:H509Q;ENSP00000365720:H509Q;ENSP00000365717:H114Q;ENSP00000265284:H452Q	.|ENSP00000265284:H452Q	C|H	+|+	1|3	0|2	TLE4|TLE4	81523547|81523547	0.006000|0.006000	0.16342|0.16342	0.955000|0.955000	0.39395|0.39395	0.414000|0.414000	0.31173|0.31173	-1.001000|-1.001000	0.03690|0.03690	-0.108000|-0.108000	0.12066|0.12066	-0.959000|-0.959000	0.02639|0.02639	TGC|CAT	.	.		0.602	TLE4-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052792.4	XM_212237	
SPATA31C1	441452	hgsc.bcm.edu	37	9	90535600	90535600	+	RNA	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:90535600G>C	ENST00000602681.1	+	0	1504							P0DKV0	S31C1_HUMAN	SPATA31 subfamily C, member 1						cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											ACTTCCACTGGACACCGTCCC	0.582																																					p.D260H		Atlas-SNP	.											.	.	.	.	0			c.G778C						.						41.0	38.0	39.0					9																	90535600		692	1590	2282			441452	exon4			CCACTGGACACCG	AK093374		9q22.1	2014-03-18	2012-10-12	2012-10-12	ENSG00000230246	ENSG00000230246			27846	other	unknown			"""family with sequence similarity 75, member C1"""	FAM75C1			Standard	NM_001145124		Approved	FLJ36055	uc010mqi.3	P0DKV0	OTTHUMG00000020160		chr9.hg19:g.90535600G>C		167.0	0.0		191.0	50.0	NM_001145124		Missense_Mutation	SNP	ENST00000602681.1	hg19																																																																																				.	.		0.582	SPATA31C1-002	KNOWN	basic	processed_transcript	pseudogene	OTTHUMT00000467313.1	NM_001145124	
TMEM245	23731	hgsc.bcm.edu	37	9	111853343	111853343	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:111853343T>A	ENST00000374586.3	-	5	1040	c.1009A>T	c.(1009-1011)Aga>Tga	p.R337*		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	337						integral component of membrane (GO:0016021)											GGCCTTCGTCTGCCCAGAGTA	0.502																																					p.R337X		Atlas-SNP	.											.	.	.	.	0			c.A1009T						.						100.0	103.0	102.0					9																	111853343		1917	4120	6037	SO:0001587	stop_gained	23731	exon5			TTCGTCTGCCCAG	AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1009A>T	chr9.hg19:g.111853343T>A	ENSP00000363714:p.Arg337*	66.0	0.0		90.0	57.0	NM_032012	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Nonsense_Mutation	SNP	ENST00000374586.3	hg19	CCDS43858.1	.	.	.	.	.	.	.	.	.	.	T	37	6.125630	0.97305	.	.	ENSG00000106771	ENST00000374587;ENST00000374586;ENST00000223608	.	.	.	5.68	4.52	0.55395	.	0.367463	0.29466	N	0.012068	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.1413	13.0146	0.58749	0.0:0.0:0.1347:0.8653	.	.	.	.	X	337	.	ENSP00000223608:R337X	R	-	1	2	C9orf5	110893164	1.000000	0.71417	0.992000	0.48379	0.974000	0.67602	5.505000	0.66981	0.962000	0.38057	0.460000	0.39030	AGA	.	.		0.502	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053587.2	NM_032012	
C9orf84	158401	hgsc.bcm.edu	37	9	114500592	114500592	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:114500592A>T	ENST00000318737.4	-	10	1321	c.1193T>A	c.(1192-1194)aTa>aAa	p.I398K	C9orf84_ENST00000374283.5_Missense_Mutation_p.I462K|C9orf84_ENST00000374287.3_Missense_Mutation_p.I398K|C9orf84_ENST00000394777.4_Missense_Mutation_p.I359K|C9orf84_ENST00000394779.3_Missense_Mutation_p.I359K	NM_173521.3	NP_775792.3	Q5VXU9	CI084_HUMAN	chromosome 9 open reading frame 84	398										breast(1)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(10)|liver(1)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35						AGGCAAAAATATCTCAATTTT	0.284																																					p.I398K		Atlas-SNP	.											.	C9orf84	207	.	0			c.T1193A						.						102.0	99.0	100.0					9																	114500592		2202	4296	6498	SO:0001583	missense	158401	exon10			AAAAATATCTCAA	AL833535	CCDS6781.3, CCDS43863.1	9q32	2012-03-16			ENSG00000165181	ENSG00000165181			26535	protein-coding gene	gene with protein product							Standard	XM_005251738		Approved	FLJ32779	uc004bfr.3	Q5VXU9	OTTHUMG00000020495	ENST00000318737.4:c.1193T>A	chr9.hg19:g.114500592A>T	ENSP00000322108:p.Ile398Lys	43.0	0.0		63.0	29.0	NM_173521	A2A2V3|Q2M1H8|Q96M73	Missense_Mutation	SNP	ENST00000318737.4	hg19	CCDS6781.3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.708|5.708	0.315176|0.315176	0.10789|0.10789	.|.	.|.	ENSG00000165181|ENSG00000165181	ENST00000394779;ENST00000394777;ENST00000374287;ENST00000318737;ENST00000374283|ENST00000394778	T;T;T;T;T|.	0.57436|.	0.67;0.67;0.67;0.67;0.4|.	4.84|4.84	3.63|3.63	0.41609|0.41609	.|.	0.748880|.	0.12282|.	N|.	0.482799|.	T|T	0.29652|0.29652	0.0740|0.0740	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	0.999998|0.999998	B;P;P;B|.	0.36909|.	0.343;0.571;0.573;0.145|.	B;B;B;B|.	0.40228|.	0.225;0.323;0.219;0.063|.	T|T	0.21655|0.21655	-1.0239|-1.0239	10|6	0.35671|0.87932	T|D	0.21|0	0.3369|0.3369	7.0555|7.0555	0.25097|0.25097	0.8899:0.0:0.1101:0.0|0.8899:0.0:0.1101:0.0	.|.	359;462;398;359|.	A6PVK7;Q5VXU9-2;Q5VXU9;A2A2V3|.	.;.;CI084_HUMAN;.|.	K|N	359;359;398;398;462|13	ENSP00000378259:I359K;ENSP00000378257:I359K;ENSP00000363405:I398K;ENSP00000322108:I398K;ENSP00000363401:I462K|.	ENSP00000322108:I398K|ENSP00000378258:Y13N	I|Y	-|-	2|1	0|0	C9orf84|C9orf84	113540413|113540413	0.045000|0.045000	0.20229|0.20229	0.017000|0.017000	0.16124|0.16124	0.048000|0.048000	0.14542|0.14542	1.371000|1.371000	0.34250|0.34250	0.904000|0.904000	0.36572|0.36572	0.477000|0.477000	0.44152|0.44152	ATA|TAT	.	.		0.284	C9orf84-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053656.2	NM_173521	
HDHD3	81932	hgsc.bcm.edu	37	9	116135994	116135994	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:116135994G>A	ENST00000238379.5	-	2	1538	c.641C>T	c.(640-642)cCa>cTa	p.P214L	HDHD3_ENST00000374180.3_Missense_Mutation_p.P214L|HDHD3_ENST00000485934.1_5'Flank	NM_031219.2	NP_112496.1	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain containing 3	214						mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			large_intestine(2)|liver(1)	3						CAGTGCCTGTGGGCCAACCAC	0.587																																					p.P214L		Atlas-SNP	.											.	HDHD3	10	.	0			c.C641T						.						76.0	77.0	77.0					9																	116135994		2203	4300	6503	SO:0001583	missense	81932	exon2			GCCTGTGGGCCAA	AK097067	CCDS6793.1	9q33.1	2006-04-12	2004-08-09	2004-08-12	ENSG00000119431	ENSG00000119431			28171	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 158"""	C9orf158		12477932	Standard	NM_031219		Approved	MGC12904	uc004bhi.1	Q9BSH5	OTTHUMG00000020524	ENST00000238379.5:c.641C>T	chr9.hg19:g.116135994G>A	ENSP00000238379:p.Pro214Leu	90.0	0.0		105.0	64.0	NM_031219	B2RD47	Missense_Mutation	SNP	ENST00000238379.5	hg19	CCDS6793.1	.	.	.	.	.	.	.	.	.	.	G	3.841	-0.033745	0.07543	.	.	ENSG00000119431	ENST00000238379;ENST00000374180	T;T	0.42900	0.96;0.96	5.74	4.85	0.62838	HAD-like domain (2);	0.629853	0.15851	N	0.241518	T	0.24509	0.0594	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.08055	0.003	T	0.12400	-1.0549	10	0.21540	T	0.41	-4.1136	13.8332	0.63393	0.0733:0.0:0.9267:0.0	.	214	Q9BSH5	HDHD3_HUMAN	L	214	ENSP00000238379:P214L;ENSP00000363295:P214L	ENSP00000238379:P214L	P	-	2	0	HDHD3	115175815	0.599000	0.26891	0.004000	0.12327	0.058000	0.15608	4.784000	0.62411	1.438000	0.47492	0.650000	0.86243	CCA	.	.		0.587	HDHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053731.1	NM_031219	
NCS1	23413	hgsc.bcm.edu	37	9	132980139	132980139	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:132980139A>T	ENST00000372398.3	+	3	204	c.118A>T	c.(118-120)Agt>Tgt	p.S40C	NCS1_ENST00000458469.1_Missense_Mutation_p.S22C|NCS1_ENST00000493042.1_3'UTR	NM_014286.3	NP_055101.2	P62166	NCS1_HUMAN	neuronal calcium sensor 1	40	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion transmembrane transport (GO:0070588)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of exocytosis (GO:0045921)|regulation of neuron projection development (GO:0010975)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|voltage-gated calcium channel activity (GO:0005245)			large_intestine(1)|lung(4)|stomach(1)	6						GGACTGCCCCAGTGGGCAGCT	0.552																																					p.S40C	Melanoma(30;182 1162 22581 33240)	Atlas-SNP	.											.	NCS1	18	.	0			c.A118T						.						91.0	94.0	93.0					9																	132980139		2203	4300	6503	SO:0001583	missense	23413	exon3			TGCCCCAGTGGGC	AF186409	CCDS6932.1	9q34.11	2013-01-10	2010-01-27	2010-01-27	ENSG00000107130	ENSG00000107130		"""EF-hand domain containing"""	3953	protein-coding gene	gene with protein product		603315	"""frequenin (Drosophila) homolog"", ""frequenin homolog (Drosophila)"""	FREQ		11092894	Standard	NM_014286		Approved	NCS-1	uc004bzi.2	P62166	OTTHUMG00000020801	ENST00000372398.3:c.118A>T	chr9.hg19:g.132980139A>T	ENSP00000361475:p.Ser40Cys	123.0	0.0		139.0	39.0	NM_014286	E9PAY3|P36610|Q9UK26	Missense_Mutation	SNP	ENST00000372398.3	hg19	CCDS6932.1	.	.	.	.	.	.	.	.	.	.	A	15.21	2.765467	0.49574	.	.	ENSG00000107130	ENST00000372398;ENST00000458469	T;T	0.70282	-0.47;-0.47	4.55	3.41	0.39046	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.76751	0.4031	M	0.83012	2.62	0.58432	D	0.999998	D;D	0.71674	0.998;0.995	P;P	0.51016	0.656;0.574	T	0.77869	-0.2427	10	0.87932	D	0	.	9.1584	0.37007	0.9131:0.0:0.0869:0.0	.	22;40	E9PAY3;P62166	.;NCS1_HUMAN	C	40;22	ENSP00000361475:S40C;ENSP00000404103:S22C	ENSP00000361475:S40C	S	+	1	0	NCS1	132019960	1.000000	0.71417	0.987000	0.45799	0.015000	0.08874	9.107000	0.94261	0.621000	0.30232	-0.379000	0.06801	AGT	.	.		0.552	NCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054637.1	NM_014286	
RAPGEF1	2889	hgsc.bcm.edu	37	9	134525525	134525525	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr9:134525525T>G	ENST00000372189.3	-	3	378	c.255A>C	c.(253-255)caA>caC	p.Q85H	RAPGEF1_ENST00000372190.3_Missense_Mutation_p.Q103H|RAPGEF1_ENST00000372195.1_Missense_Mutation_p.Q102H	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	85					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CCTTCTGCCTTTGAGACCTGG	0.483																																					p.Q103H		Atlas-SNP	.											.	RAPGEF1	126	.	0			c.A309C						.						41.0	41.0	41.0					9																	134525525		1956	4166	6122	SO:0001583	missense	2889	exon3			CTGCCTTTGAGAC	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.255A>C	chr9.hg19:g.134525525T>G	ENSP00000361263:p.Gln85His	95.0	0.0		89.0	67.0	NM_198679	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	hg19	CCDS48047.1	.	.	.	.	.	.	.	.	.	.	T	17.76	3.469334	0.63625	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000372189;ENST00000372190;ENST00000337036;ENST00000357686;ENST00000427994	T;T;T;T	0.37058	1.22;1.22;1.22;1.22	5.91	-0.299	0.12808	.	0.277274	0.33591	N	0.004760	T	0.43722	0.1260	L	0.36672	1.1	0.25666	N	0.98595	D;D;D	0.67145	0.996;0.992;0.995	D;D;D	0.77004	0.986;0.976;0.989	T	0.33343	-0.9872	10	0.54805	T	0.06	.	10.2702	0.43479	0.0:0.5406:0.0:0.4594	.	102;85;103	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	H	85;102;85;103;11;102;103	ENSP00000361269:Q102H;ENSP00000361263:Q85H;ENSP00000361264:Q103H;ENSP00000402174:Q103H	ENSP00000266110:Q85H	Q	-	3	2	RAPGEF1	133515346	0.990000	0.36364	0.998000	0.56505	0.996000	0.88848	-0.007000	0.12810	-0.026000	0.13895	-0.250000	0.11733	CAA	.	.		0.483	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
CUBN	8029	hgsc.bcm.edu	37	10	16877186	16877186	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr10:16877186T>A	ENST00000377833.4	-	64	10254	c.10189A>T	c.(10189-10191)Aga>Tga	p.R3397*		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3397	CUB 26. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TGATAGTCTCTGTTGCAATCT	0.413																																					p.R3397X		Atlas-SNP	.											.	CUBN	515	.	0			c.A10189T						.						116.0	106.0	110.0					10																	16877186		2203	4300	6503	SO:0001587	stop_gained	8029	exon64			AGTCTCTGTTGCA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.10189A>T	chr10.hg19:g.16877186T>A	ENSP00000367064:p.Arg3397*	80.0	0.0		242.0	68.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Nonsense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	51	17.343323	0.99884	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	.	.	.	4.84	2.39	0.29439	.	0.000000	0.45606	D	0.000358	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.6817	0.51461	0.0:0.0:0.301:0.6989	.	.	.	.	X	3397;238	.	ENSP00000367064:R3397X	R	-	1	2	CUBN	16917192	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	1.127000	0.31357	0.896000	0.36366	0.459000	0.35465	AGA	.	.		0.413	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
GPR158	57512	hgsc.bcm.edu	37	10	25701321	25701321	+	Silent	SNP	T	T	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr10:25701321T>G	ENST00000376351.3	+	4	1613	c.1254T>G	c.(1252-1254)ctT>ctG	p.L418L		NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	418					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						ATTTACGACTTGCCATCATCT	0.522																																					p.L418L		Atlas-SNP	.											.	GPR158	255	.	0			c.T1254G						.						257.0	222.0	234.0					10																	25701321		2203	4300	6503	SO:0001819	synonymous_variant	57512	exon4			ACGACTTGCCATC	AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.1254T>G	chr10.hg19:g.25701321T>G		115.0	0.0		296.0	82.0	NM_020752	Q6QR81|Q9ULT3	Silent	SNP	ENST00000376351.3	hg19	CCDS31166.1																																																																																			.	.		0.522	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047248.2	XM_166110	
PTEN	5728	hgsc.bcm.edu	37	10	89712017	89712017	+	Splice_Site	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr10:89712017G>T	ENST00000371953.3	+	6	1991		c.e6+1		PTEN_ENST00000472832.1_Splice_Site	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(5)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GGAACTTGCAGTAAGTGCTTG	0.343		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											.		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,0,4	PTEN	3652	.	50	Whole gene deletion(37)|Deletion - Frameshift(7)|Unknown(5)|Deletion - In frame(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|ovary(3)|endometrium(2)|breast(2)|soft_tissue(1)|urinary_tract(1)|kidney(1)	c.634+1G>T						.						139.0	138.0	138.0					10																	89712017		2203	4300	6503	SO:0001630	splice_region_variant	5728	exon6	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CTTGCAGTAAGTG	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.634+1G>T	chr10.hg19:g.89712017G>T		39.0	0.0		16.0	12.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Splice_Site	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161219	0.78226	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1698	0.98157	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTEN	89701997	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.365000	0.97139	2.777000	0.95525	0.585000	0.79938	.	.	.		0.343	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	Intron
OR51D1	390038	hgsc.bcm.edu	37	11	4661967	4661967	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:4661967T>A	ENST00000357605.2	+	1	1023	c.947T>A	c.(946-948)cTc>cAc	p.L316H	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	316						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		TCAAGGGTCCTCTGTATGTTC	0.463																																					p.L316H		Atlas-SNP	.											.	OR51D1	49	.	0			c.T947A						.						70.0	70.0	70.0					11																	4661967		2201	4298	6499	SO:0001583	missense	390038	exon1			GGGTCCTCTGTAT	AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.947T>A	chr11.hg19:g.4661967T>A	ENSP00000350222:p.Leu316His	67.0	0.0		100.0	25.0	NM_001004751	B9EIK4	Missense_Mutation	SNP	ENST00000357605.2	hg19	CCDS31357.1	.	.	.	.	.	.	.	.	.	.	T	9.552	1.116072	0.20795	.	.	ENSG00000197428	ENST00000357605	T	0.39592	1.07	4.56	2.23	0.28157	.	0.889887	0.09306	N	0.820190	T	0.61060	0.2317	M	0.87038	2.855	0.09310	N	1	D	0.55385	0.971	P	0.56788	0.806	T	0.46789	-0.9166	10	0.62326	D	0.03	.	7.0583	0.25111	0.0:0.1847:0.0:0.8153	.	316	Q8NGF3	O51D1_HUMAN	H	316	ENSP00000350222:L316H	ENSP00000350222:L316H	L	+	2	0	OR51D1	4618543	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.672000	0.25187	0.361000	0.24292	-0.521000	0.04368	CTC	.	.		0.463	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385956.1	NM_001004751	
EIF3F	8665	hgsc.bcm.edu	37	11	8017529	8017529	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:8017529A>T	ENST00000533626.1	+	10	1660	c.1034A>T	c.(1033-1035)cAg>cTg	p.Q345L	EIF3F_ENST00000449102.2_Missense_Mutation_p.Q196L|EIF3F_ENST00000537635.1_Missense_Mutation_p.Q360L|EIF3F_ENST00000309828.4_Missense_Mutation_p.Q345L					eukaryotic translation initiation factor 3, subunit F											endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|skin(1)	13				Epithelial(150;1.44e-07)|BRCA - Breast invasive adenocarcinoma(625;0.189)		AACCTCACACAGTCACAGATT	0.483																																					p.Q345L		Atlas-SNP	.											.	EIF3F	23	.	0			c.A1034T						.						185.0	182.0	183.0					11																	8017529		2201	4296	6497	SO:0001583	missense	8665	exon8			TCACACAGTCACA	U94855, AK093511	CCDS7785.1	11p15.4	2010-03-10	2007-07-27	2007-07-27	ENSG00000175390	ENSG00000175390			3275	protein-coding gene	gene with protein product		603914	"""eukaryotic translation initiation factor 3, subunit 5 epsilon, 47kDa"""	EIF3S5		9341143	Standard	NM_003754		Approved	eIF3-epsilon, eIF3-p47, eIF3f	uc001mfw.3	O00303		ENST00000533626.1:c.1034A>T	chr11.hg19:g.8017529A>T	ENSP00000431800:p.Gln345Leu	57.0	0.0		62.0	16.0	NM_003754		Missense_Mutation	SNP	ENST00000533626.1	hg19	CCDS7785.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.779383	0.90195	.	.	ENSG00000175390	ENST00000533626;ENST00000537635;ENST00000309828;ENST00000538607;ENST00000449102	T;T;T;T	0.44881	1.47;1.47;1.47;0.91	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.54351	0.1853	L	0.53249	1.67	0.80722	D	1	P	0.51653	0.947	P	0.57324	0.818	T	0.57648	-0.7775	10	0.87932	D	0	-11.5192	13.646	0.62281	1.0:0.0:0.0:0.0	.	345	O00303	EIF3F_HUMAN	L	345;360;345;295;196	ENSP00000431800:Q345L;ENSP00000442283:Q360L;ENSP00000310040:Q345L;ENSP00000396929:Q196L	ENSP00000310040:Q345L	Q	+	2	0	EIF3F	7974105	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.139000	0.94554	2.270000	0.75569	0.459000	0.35465	CAG	.	.		0.483	EIF3F-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000385713.2	NM_003754	
LRRC4C	57689	hgsc.bcm.edu	37	11	40137322	40137322	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:40137322A>G	ENST00000278198.2	-	2	2484	c.521T>C	c.(520-522)tTg>tCg	p.L174S	LRRC4C_ENST00000527150.1_Missense_Mutation_p.L174S|LRRC4C_ENST00000528697.1_Missense_Mutation_p.L174S|LRRC4C_ENST00000530763.1_Missense_Mutation_p.L174S			Q9HCJ2	LRC4C_HUMAN	leucine rich repeat containing 4C	174					regulation of axonogenesis (GO:0050770)	cell junction (GO:0030054)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)				NS(2)|central_nervous_system(3)|endometrium(1)|large_intestine(14)|lung(43)|ovary(5)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	86		all_lung(304;0.0575)|Lung NSC(402;0.138)				TAGTCGGCGCAAAGAAGGAAT	0.423																																					p.L174S		Atlas-SNP	.											.	LRRC4C	190	.	0			c.T521C						.						91.0	91.0	91.0					11																	40137322		2203	4300	6503	SO:0001583	missense	57689	exon7			CGGCGCAAAGAAG	AB046800	CCDS31464.1	11p12	2013-01-14				ENSG00000148948		"""Immunoglobulin superfamily / I-set domain containing"""	29317	protein-coding gene	gene with protein product		608817				14595443	Standard	NM_020929		Approved	KIAA1580, NGL-1	uc031pzu.1	Q9HCJ2		ENST00000278198.2:c.521T>C	chr11.hg19:g.40137322A>G	ENSP00000278198:p.Leu174Ser	52.0	0.0		76.0	18.0	NM_001258419	A8K0T1|Q7L0N3	Missense_Mutation	SNP	ENST00000278198.2	hg19	CCDS31464.1	.	.	.	.	.	.	.	.	.	.	A	16.19	3.053096	0.55218	.	.	ENSG00000148948	ENST00000278198;ENST00000527150;ENST00000528697;ENST00000530763	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	5.82	5.82	0.92795	.	0.000000	0.64402	D	0.000001	T	0.77572	0.4150	H	0.99379	4.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87606	0.2500	10	0.87932	D	0	.	15.3632	0.74499	1.0:0.0:0.0:0.0	.	174	Q9HCJ2	LRC4C_HUMAN	S	174	ENSP00000278198:L174S;ENSP00000436976:L174S;ENSP00000437132:L174S;ENSP00000434761:L174S	ENSP00000278198:L174S	L	-	2	0	LRRC4C	40093898	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.287000	0.95975	2.222000	0.72286	0.528000	0.53228	TTG	.	.		0.423	LRRC4C-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389499.1	NM_020929	
OR8K5	219453	hgsc.bcm.edu	37	11	55926911	55926911	+	Nonsense_Mutation	SNP	C	C	A	rs376114385		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:55926911C>A	ENST00000313447.1	-	1	882	c.883G>T	c.(883-885)Gaa>Taa	p.E295*		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	295						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TTCACCTCTTCGTTTCTTAAG	0.303																																					p.E295X		Atlas-SNP	.											.	OR8K5	82	.	0			c.G883T						.						70.0	67.0	68.0					11																	55926911		2201	4296	6497	SO:0001587	stop_gained	219453	exon1			CCTCTTCGTTTCT	BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.883G>T	chr11.hg19:g.55926911C>A	ENSP00000323853:p.Glu295*	81.0	0.0		39.0	13.0	NM_001004058	Q6IFB5	Nonsense_Mutation	SNP	ENST00000313447.1	hg19	CCDS31521.1	.	.	.	.	.	.	.	.	.	.	T	12.07	1.827281	0.32329	.	.	ENSG00000181752	ENST00000313447	.	.	.	3.88	3.88	0.44766	.	0.228496	0.30999	N	0.008446	.	.	.	.	.	.	0.32023	N	0.600555	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1093	0.30905	0.0:0.104:0.0:0.896	.	.	.	.	X	295	.	ENSP00000323853:E295X	E	-	1	0	OR8K5	55683487	0.581000	0.26741	1.000000	0.80357	0.598000	0.36846	1.221000	0.32503	0.651000	0.30788	-0.929000	0.02709	GAA	.	.		0.303	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391543.1	NM_001004058	
OR4D9	390199	hgsc.bcm.edu	37	11	59283045	59283045	+	Silent	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:59283045C>A	ENST00000329328.3	+	1	660	c.660C>A	c.(658-660)gtC>gtA	p.V220V		NM_001004711.1	NP_001004711.1	Q8NGE8	OR4D9_HUMAN	olfactory receptor, family 4, subfamily D, member 9	220						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|prostate(5)|upper_aerodigestive_tract(1)	26						CTTACACGGTCATCTTGATGA	0.498																																					p.V220V		Atlas-SNP	.											.	OR4D9	47	.	0			c.C660A						.						229.0	199.0	209.0					11																	59283045		2201	4295	6496	SO:0001819	synonymous_variant	390199	exon1			CACGGTCATCTTG	AB065861	CCDS31564.1	11q12.1	2012-08-09	2003-12-15		ENSG00000172742	ENSG00000172742		"""GPCR / Class A : Olfactory receptors"""	15178	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily D, member 9 pseudogene"""				Standard	NM_001004711		Approved		uc010rkv.2	Q8NGE8	OTTHUMG00000167343	ENST00000329328.3:c.660C>A	chr11.hg19:g.59283045C>A		94.0	0.0		78.0	36.0	NM_001004711	Q6IFF3	Silent	SNP	ENST00000329328.3	hg19	CCDS31564.1																																																																																			.	.		0.498	OR4D9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394237.1	NM_001004711	
IL18BP	10068	hgsc.bcm.edu	37	11	71712350	71712350	+	Silent	SNP	A	A	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:71712350A>G	ENST00000393703.4	+	4	876	c.339A>G	c.(337-339)cgA>cgG	p.R113R	IL18BP_ENST00000531053.1_Silent_p.R113R|IL18BP_ENST00000393705.4_Silent_p.R113R|IL18BP_ENST00000337131.5_Silent_p.R113R|IL18BP_ENST00000393707.4_Intron|IL18BP_ENST00000260049.5_Silent_p.R113R|IL18BP_ENST00000497194.2_Silent_p.R113R|IL18BP_ENST00000404792.1_Silent_p.R113R	NM_001039660.1	NP_001034749.1	O95998	I18BP_HUMAN	interleukin 18 binding protein	113	Ig-like C2-type.				cellular response to hydrogen peroxide (GO:0070301)|cellular response to tumor necrosis factor (GO:0071356)|extracellular negative regulation of signal transduction (GO:1900116)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	interleukin-18 binding (GO:0042007)|receptor antagonist activity (GO:0048019)			endometrium(2)|kidney(1)|large_intestine(3)|lung(1)	7						TCCCAGGCCGACTGTGGGAGG	0.617																																					p.R113R		Atlas-SNP	.											.	IL18BP	15	.	0			c.A339G						.						42.0	44.0	43.0					11																	71712350		2061	4179	6240	SO:0001819	synonymous_variant	10068	exon4			AGGCCGACTGTGG	AF110798	CCDS8206.2, CCDS44666.1	11q13	2013-01-11			ENSG00000137496	ENSG00000137496		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5987	protein-coding gene	gene with protein product	"""MC51L-53L-54L homolog gene product"""	604113				10023777	Standard	NM_001145055		Approved	IL18BPa	uc001orf.1	O95998	OTTHUMG00000133713	ENST00000393703.4:c.339A>G	chr11.hg19:g.71712350A>G		108.0	0.0		85.0	36.0	NM_001145057	B3KUZ0|B7WPK4|O95993|O96027|Q9NZA9|Q9UBR7	Silent	SNP	ENST00000393703.4	hg19	CCDS8206.2																																																																																			.	.		0.617	IL18BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000258012.2	NM_173042	
ATM	472	hgsc.bcm.edu	37	11	108114838	108114838	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:108114838T>A	ENST00000452508.2	+	7	844	c.655T>A	c.(655-657)Tgt>Agt	p.C219S	ATM_ENST00000278616.4_Missense_Mutation_p.C219S			Q13315	ATM_HUMAN	ATM serine/threonine kinase	219					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	GGCTATTCAGTGTGCGAGGTA	0.328			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																											p.C219S		Atlas-SNP	.	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	.	ATM	1657	.	0			c.T655A						.						86.0	84.0	85.0					11																	108114838		2201	4298	6499	SO:0001583	missense	472	exon6	Familial Cancer Database	AT, Louis-Bar syndrome	ATTCAGTGTGCGA	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.655T>A	chr11.hg19:g.108114838T>A	ENSP00000388058:p.Cys219Ser	54.0	0.0		39.0	14.0	NM_000051	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	ENST00000452508.2	hg19	CCDS31669.1	.	.	.	.	.	.	.	.	.	.	T	4.297	0.054359	0.08291	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.01613	4.73;5.0;5.0	5.42	1.97	0.26223	.	1.397370	0.03926	N	0.284447	T	0.01695	0.0054	L	0.29908	0.895	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.50215	-0.8854	10	0.22109	T	0.4	.	1.0028	0.01481	0.3223:0.0961:0.1672:0.4144	.	219	Q13315	ATM_HUMAN	S	219	ENSP00000435747:C219S;ENSP00000278616:C219S;ENSP00000388058:C219S	ENSP00000278616:C219S	C	+	1	0	ATM	107620048	0.997000	0.39634	0.012000	0.15200	0.505000	0.33919	1.916000	0.39986	0.105000	0.17753	0.533000	0.62120	TGT	.	.		0.328	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389938.1	NM_000051	
KMT2A	4297	hgsc.bcm.edu	37	11	118347664	118347664	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:118347664C>T	ENST00000389506.5	+	4	3301	c.3301C>T	c.(3301-3303)Cga>Tga	p.R1101*	KMT2A_ENST00000354520.4_Nonsense_Mutation_p.R1101*|KMT2A_ENST00000534358.1_Nonsense_Mutation_p.R1101*			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	1101					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										ATGGGAAGAACGAGAAAAGAT	0.458																																					p.R1101X		Atlas-SNP	.											.	MLL	548	.	0			c.C3301T						.						120.0	111.0	114.0					11																	118347664		2200	4296	6496	SO:0001587	stop_gained	4297	exon4			GAAGAACGAGAAA	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.3301C>T	chr11.hg19:g.118347664C>T	ENSP00000374157:p.Arg1101*	151.0	0.0		121.0	44.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Nonsense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	41	8.645073	0.98899	.	.	ENSG00000118058	ENST00000534358;ENST00000531904;ENST00000389506;ENST00000354520;ENST00000359313;ENST00000533790	.	.	.	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.9396	0.70983	0.1429:0.8571:0.0:0.0	.	.	.	.	X	1101;1134;1101;1101;11;179	.	ENSP00000346516:R1101X	R	+	1	2	MLL	117852874	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.577000	0.53885	2.771000	0.95319	0.655000	0.94253	CGA	.	.		0.458	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
CHEK1	1111	hgsc.bcm.edu	37	11	125514071	125514071	+	Nonsense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:125514071A>T	ENST00000534070.1	+	10	1264	c.1009A>T	c.(1009-1011)Aaa>Taa	p.K337*	CHEK1_ENST00000428830.2_Nonsense_Mutation_p.K337*|CHEK1_ENST00000544373.1_Nonsense_Mutation_p.K337*|CHEK1_ENST00000524737.1_Nonsense_Mutation_p.K337*|CHEK1_ENST00000438015.1_Nonsense_Mutation_p.K337*|CHEK1_ENST00000278916.3_Nonsense_Mutation_p.K337*|CHEK1_ENST00000427383.2_Nonsense_Mutation_p.K353*|CHEK1_ENST00000532449.1_3'UTR	NM_001274.5	NP_001265.2	O14757	CHK1_HUMAN	checkpoint kinase 1	337					cellular response to caffeine (GO:0071313)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to mechanical stimulus (GO:0071260)|chromatin-mediated maintenance of transcription (GO:0048096)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of mitosis (GO:0045839)|peptidyl-threonine phosphorylation (GO:0018107)|regulation of cell proliferation (GO:0042127)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of histone H3-K9 acetylation (GO:2000615)|regulation of mitotic centrosome separation (GO:0046602)|regulation of transcription from RNA polymerase II promoter in response to UV-induced DNA damage (GO:0010767)|replicative senescence (GO:0090399)	centrosome (GO:0005813)|chromatin (GO:0000785)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|replication fork (GO:0005657)	ATP binding (GO:0005524)|histone kinase activity (H3-T11 specific) (GO:0035402)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(3)|large_intestine(2)|lung(16)|skin(1)|upper_aerodigestive_tract(1)	26	all_hematologic(175;0.228)	Breast(109;0.0021)|Lung NSC(97;0.0126)|all_lung(97;0.0132)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0748)		ATACATTGATAAATTGGTACA	0.473								Other conserved DNA damage response genes																													p.K337X		Atlas-SNP	.											.	CHEK1	44	.	0			c.A1009T						.						139.0	132.0	135.0					11																	125514071		2201	4299	6500	SO:0001587	stop_gained	1111	exon10			ATTGATAAATTGG	AF016582, BC017575	CCDS8459.1, CCDS58191.1	11q24.2	2011-11-11	2011-11-11		ENSG00000149554	ENSG00000149554			1925	protein-coding gene	gene with protein product		603078	"""CHK1 (checkpoint, S.pombe) homolog"", ""CHK1 checkpoint homolog (S. pombe)"""			9278511, 9382850	Standard	NM_001114121		Approved	CHK1	uc001qcg.4	O14757	OTTHUMG00000165853	ENST00000534070.1:c.1009A>T	chr11.hg19:g.125514071A>T	ENSP00000435371:p.Lys337*	66.0	0.0		77.0	39.0	NM_001244846	A8K934|B4DDD0|B4DSK3|B5BTY6|F5H7S4|H2BI51	Nonsense_Mutation	SNP	ENST00000534070.1	hg19	CCDS8459.1	.	.	.	.	.	.	.	.	.	.	A	45	11.692524	0.99592	.	.	ENSG00000149554	ENST00000438015;ENST00000427383;ENST00000428830;ENST00000544373;ENST00000534070;ENST00000524737;ENST00000278916	.	.	.	5.72	5.72	0.89469	.	0.226724	0.45867	D	0.000334	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	-21.1455	15.0031	0.71489	1.0:0.0:0.0:0.0	.	.	.	.	X	337;353;337;337;337;337;337	.	ENSP00000278916:K337X	K	+	1	0	CHEK1	125019281	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	1.494000	0.35616	2.194000	0.70268	0.533000	0.62120	AAA	.	.		0.473	CHEK1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386714.1	NM_001274	
KLRC4	8302	hgsc.bcm.edu	37	12	10561527	10561527	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:10561527T>A	ENST00000309384.1	-	2	451	c.270A>T	c.(268-270)acA>acT	p.T90T	KLRC4-KLRK1_ENST00000539300.1_Missense_Mutation_p.N82Y	NM_013431.2	NP_038459.1	O43908	NKG2F_HUMAN	killer cell lectin-like receptor subfamily C, member 4	90					cellular defense response (GO:0006968)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)	5						TAAGAACTATTGTTTTTAACA	0.393																																					p.T90T		Atlas-SNP	.											.	KLRC4	23	.	0			c.A270T						.						136.0	139.0	138.0					12																	10561527		2203	4300	6503	SO:0001819	synonymous_variant	8302	exon2			AACTATTGTTTTT	U96846	CCDS8624.1	12p13.2-p12.3	2008-08-05			ENSG00000183542	ENSG00000183542		"""Killer cell lectin-like receptors"""	6377	protein-coding gene	gene with protein product		602893				9598306	Standard	NM_013431		Approved	NKG2-F	uc001qye.3	O43908	OTTHUMG00000168575	ENST00000309384.1:c.270A>T	chr12.hg19:g.10561527T>A		344.0	0.0		317.0	180.0	NM_013431	O60851	Silent	SNP	ENST00000309384.1	hg19	CCDS8624.1																																																																																			.	.		0.393	KLRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400108.1	NM_013431	
NCKAP5L	57701	hgsc.bcm.edu	37	12	50190491	50190491	+	Silent	SNP	A	A	G	rs34210566		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:50190491A>G	ENST00000335999.6	-	8	1353	c.1152T>C	c.(1150-1152)ggT>ggC	p.G384G		NM_001037806.3	NP_001032895.2	Q9HCH0	NCK5L_HUMAN	NCK-associated protein 5-like	380	Pro-rich.									central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(8)|prostate(2)	18						CCTCTGGGGTACCCCCACCCC	0.662																																					p.G384G		Atlas-SNP	.											.	NCKAP5L	142	.	0			c.T1152C						.						21.0	24.0	23.0					12																	50190491		1866	4078	5944	SO:0001819	synonymous_variant	57701	exon8			TGGGGTACCCCCA	AB046822	CCDS41781.2	12q13.12	2009-08-14	2009-08-14	2009-08-14	ENSG00000167566	ENSG00000167566			29321	protein-coding gene	gene with protein product		615104	"""KIAA1602"""	KIAA1602			Standard	NM_001037806		Approved		uc009zlk.2	Q9HCH0	OTTHUMG00000156969	ENST00000335999.6:c.1152T>C	chr12.hg19:g.50190491A>G		43.0	0.0		37.0	8.0	NM_001037806	Q2TB26|Q71RH1|Q8N4W1|Q96HX2	Silent	SNP	ENST00000335999.6	hg19	CCDS41781.2	.	.	.	.	.	.	.	.	.	.	A	3.399	-0.122675	0.06795	.	.	ENSG00000167566	ENST00000433948	.	.	.	4.12	-1.43	0.08884	.	.	.	.	.	T	0.18718	0.0449	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.24977	-1.0145	4	.	.	.	-0.1118	1.0098	0.01495	0.258:0.3226:0.2622:0.1572	.	.	.	.	H	99	.	.	Y	-	1	0	NCKAP5L	48476758	0.000000	0.05858	0.863000	0.33907	0.890000	0.51754	-0.199000	0.09491	0.107000	0.17824	-0.543000	0.04237	TAC	.	.		0.662	NCKAP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346884.2	XM_035497	
SP7	121340	hgsc.bcm.edu	37	12	53723037	53723037	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:53723037A>T	ENST00000536324.2	-	3	472	c.189T>A	c.(187-189)gcT>gcA	p.A63A	SP7_ENST00000303846.3_Silent_p.A63A|SP7_ENST00000537210.2_Silent_p.A45A	NM_001173467.1	NP_001166938.1	Q8TDD2	SP7_HUMAN	Sp7 transcription factor	63					hematopoietic stem cell differentiation (GO:0060218)|osteoblast differentiation (GO:0001649)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(2)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	14						GGGCTGGATAAGCATCCCCCA	0.552																																					p.A63A		Atlas-SNP	.											.	SP7	30	.	0			c.T189A						.						185.0	188.0	187.0					12																	53723037		2046	4182	6228	SO:0001819	synonymous_variant	121340	exon2			TGGATAAGCATCC	AF477981	CCDS44897.1, CCDS73475.1	12q13.13	2013-01-08				ENSG00000170374		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	17321	protein-coding gene	gene with protein product		606633				11792318	Standard	NM_152860		Approved	osterix, OSX	uc001sct.3	Q8TDD2		ENST00000536324.2:c.189T>A	chr12.hg19:g.53723037A>T		67.0	0.0		63.0	24.0	NM_152860	B3KY26|Q3MJ72|Q7Z718	Silent	SNP	ENST00000536324.2	hg19	CCDS44897.1																																																																																			.	.		0.552	SP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406917.1		
CALCOCO1	57658	hgsc.bcm.edu	37	12	54118967	54118967	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:54118967T>A	ENST00000550804.1	-	2	120	c.60A>T	c.(58-60)gtA>gtT	p.V20V	CALCOCO1_ENST00000547885.1_5'UTR|CALCOCO1_ENST00000548263.1_Silent_p.V20V|CALCOCO1_ENST00000430117.2_Silent_p.V20V|CALCOCO1_ENST00000262059.4_Silent_p.V20V			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	20	N-terminal AD (CTNNB1 binding site). {ECO:0000250}.|p300 KIX-binding. {ECO:0000250}.				intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						AGGTCCGGGCTACATTGAGAA	0.527																																					p.V20V		Atlas-SNP	.											.	CALCOCO1	50	.	0			c.A60T						.						190.0	147.0	162.0					12																	54118967		2203	4300	6503	SO:0001819	synonymous_variant	57658	exon2			CCGGGCTACATTG	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.60A>T	chr12.hg19:g.54118967T>A		230.0	0.0		246.0	146.0	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Silent	SNP	ENST00000550804.1	hg19	CCDS8864.1																																																																																			.	.		0.527	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
METTL21B	25895	hgsc.bcm.edu	37	12	58163625	58163625	+	5'Flank	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:58163625C>A	ENST00000300209.8	+	0	0				METTL1_ENST00000548681.1_5'Flank|METTL21B_ENST00000548256.1_5'Flank|METTL21B_ENST00000333012.5_5'Flank|METTL21B_ENST00000551420.1_5'Flank|METTL1_ENST00000257848.7_Intron|CYP27B1_ENST00000228606.4_5'Flank|METTL1_ENST00000324871.7_Missense_Mutation_p.G130V	NM_015433.2	NP_056248.2	Q96AZ1	MT21B_HUMAN	methyltransferase like 21B							cytoplasm (GO:0005737)|intracellular (GO:0005622)	methyltransferase activity (GO:0008168)			endometrium(1)|lung(1)	2						GTTCTGGAAGCCACCTGCAGG	0.577																																					p.G130V		Atlas-SNP	.											.	METTL1	14	.	0			c.G389T						.						67.0	60.0	63.0					12																	58163625		2203	4300	6503	SO:0001631	upstream_gene_variant	4234	exon3			TGGAAGCCACCTG	AL050100, AF455816	CCDS8957.1, CCDS31848.1	12q14.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000123427	ENSG00000123427			24936	protein-coding gene	gene with protein product		615258	"""family with sequence similarity 119, member B"""	FAM119B		12477932	Standard	NM_015433		Approved	DKFZP586D0919	uc001sqg.3	Q96AZ1	OTTHUMG00000170459		chr12.hg19:g.58163625C>A	Exception_encountered	157.0	0.0		135.0	77.0	NM_005371	Q9H749|Q9Y3W2	Missense_Mutation	SNP	ENST00000300209.8	hg19	CCDS8957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.887|9.887	1.203272|1.203272	0.22121|0.22121	.|.	.|.	ENSG00000037897|ENSG00000037897	ENST00000324871|ENST00000548504	T|.	0.57595|.	0.39|.	5.12|5.12	4.21|4.21	0.49690|0.49690	.|.	0.529823|.	0.20871|.	N|.	0.084175|.	T|T	0.38878|0.38878	0.1057|0.1057	L|L	0.49126|0.49126	1.545|1.545	0.09310|0.09310	N|N	0.999997|0.999997	B|.	0.28760|.	0.221|.	B|.	0.32090|.	0.14|.	T|T	0.30822|0.30822	-0.9965|-0.9965	10|5	0.49607|.	T|.	0.09|.	-11.493|-11.493	4.7347|4.7347	0.12982|0.12982	0.1825:0.6479:0.0:0.1695|0.1825:0.6479:0.0:0.1695	.|.	130|.	Q9UBP6|.	TRMB_HUMAN|.	V|C	130|8	ENSP00000314441:G130V|.	ENSP00000314441:G130V|.	G|W	-|-	2|3	0|0	METTL1|METTL1	56449892|56449892	0.994000|0.994000	0.37717|0.37717	0.999000|0.999000	0.59377|0.59377	0.998000|0.998000	0.95712|0.95712	1.290000|1.290000	0.33319|0.33319	1.107000|1.107000	0.41642|0.41642	0.655000|0.655000	0.94253|0.94253	GGC|TGG	.	.		0.577	METTL21B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409268.1	NM_015433	
LGR5	8549	hgsc.bcm.edu	37	12	71960645	71960645	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:71960645A>T	ENST00000266674.5	+	11	1334	c.1023A>T	c.(1021-1023)tcA>tcT	p.S341S	LGR5_ENST00000540815.2_Silent_p.S317S|LGR5_ENST00000536515.1_Silent_p.S269S			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	341					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						CACAGATCTCATCTCTTCCTC	0.398																																					p.S341S		Atlas-SNP	.											.	LGR5	103	.	0			c.A1023T						.						217.0	198.0	205.0					12																	71960645		2203	4300	6503	SO:0001819	synonymous_variant	8549	exon11			GATCTCATCTCTT	AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1023A>T	chr12.hg19:g.71960645A>T		125.0	0.0		176.0	91.0	NM_003667	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	ENST00000266674.5	hg19	CCDS9000.1																																																																																			.	.		0.398	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404744.1	NM_003667	
USP44	84101	hgsc.bcm.edu	37	12	95927304	95927304	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:95927304A>T	ENST00000258499.3	-	2	1017	c.729T>A	c.(727-729)gaT>gaA	p.D243E	USP44_ENST00000393091.2_Missense_Mutation_p.D243E|USP44_ENST00000537435.2_Missense_Mutation_p.D243E|USP44_ENST00000552440.1_Missense_Mutation_p.D243E	NM_001278393.1|NM_032147.2	NP_001265322.1|NP_115523.2	Q9H0E7	UBP44_HUMAN	ubiquitin specific peptidase 44	243					mitotic nuclear division (GO:0007067)|negative regulation of mitotic anaphase-promoting complex activity (GO:0060564)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein deubiquitination (GO:0016579)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|regulation of spindle checkpoint (GO:0090231)	nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(5)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	36						AGAGTACTTTATCTTTTGCTG	0.413																																					p.D243E		Atlas-SNP	.											.	USP44	83	.	0			c.T729A						.						128.0	121.0	123.0					12																	95927304		2203	4300	6503	SO:0001583	missense	84101	exon2			TACTTTATCTTTT	AK027434	CCDS9053.1	12q21.33	2005-08-08	2005-08-08			ENSG00000136014		"""Ubiquitin-specific peptidases"""	20064	protein-coding gene	gene with protein product		610993	"""ubiquitin specific protease 44"""			12838346	Standard	NM_001278393		Approved	FLJ14528	uc001teg.3	Q9H0E7		ENST00000258499.3:c.729T>A	chr12.hg19:g.95927304A>T	ENSP00000258499:p.Asp243Glu	63.0	0.0		72.0	19.0	NM_032147	B2RDW3	Missense_Mutation	SNP	ENST00000258499.3	hg19	CCDS9053.1	.	.	.	.	.	.	.	.	.	.	A	0.003	-2.485665	0.00163	.	.	ENSG00000136014	ENST00000258499;ENST00000393091;ENST00000552440;ENST00000537435	T;T;T;T	0.13778	3.8;3.8;2.56;3.8	4.96	-7.15	0.01521	.	1.368430	0.04103	N	0.313222	T	0.06826	0.0174	L	0.33485	1.01	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.37619	-0.9698	10	0.06099	T	0.92	.	3.4391	0.07457	0.142:0.412:0.2847:0.1613	.	243	Q9H0E7	UBP44_HUMAN	E	243	ENSP00000258499:D243E;ENSP00000376806:D243E;ENSP00000448670:D243E;ENSP00000442629:D243E	ENSP00000258499:D243E	D	-	3	2	USP44	94451435	0.000000	0.05858	0.007000	0.13788	0.023000	0.10783	-1.056000	0.03489	-0.838000	0.04218	-1.765000	0.00666	GAT	.	.		0.413	USP44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408312.1	NM_032147	
HECTD4	283450	hgsc.bcm.edu	37	12	112685903	112685903	+	Missense_Mutation	SNP	T	T	A	rs374617773		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:112685903T>A	ENST00000430131.2	-	26	4095	c.2950A>T	c.(2950-2952)Atg>Ttg	p.M984L	HECTD4_ENST00000550722.1_Missense_Mutation_p.M1260L|HECTD4_ENST00000377560.5_Missense_Mutation_p.M1234L			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	984					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										AAGAAAGGCATGTTGTTCTCC	0.363																																					p.M1272L		Atlas-SNP	.											.	.	.	.	0			c.A3814T						.						96.0	92.0	93.0					12																	112685903		1920	4143	6063	SO:0001583	missense	283450	exon27			AAGGCATGTTGTT	AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2950A>T	chr12.hg19:g.112685903T>A	ENSP00000404379:p.Met984Leu	67.0	0.0		80.0	16.0	NM_001109662	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	ENST00000430131.2	hg19		.	.	.	.	.	.	.	.	.	.	T	12.11	1.840430	0.32513	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.41065	1.02;1.02;1.01	5.79	4.66	0.58398	.	.	.	.	.	T	0.24044	0.0582	N	0.14661	0.345	0.19775	N	0.999958	B	0.06786	0.001	B	0.04013	0.001	T	0.07790	-1.0754	9	0.27082	T	0.32	.	6.9182	0.24371	0.0:0.2102:0.0:0.7898	.	984	Q9Y4D8	K0614_HUMAN	L	1234;984;1260	ENSP00000366783:M1234L;ENSP00000404379:M984L;ENSP00000449784:M1260L	ENSP00000366783:M1234L	M	-	1	0	C12orf51	111170286	0.998000	0.40836	1.000000	0.80357	0.897000	0.52465	0.848000	0.27710	2.223000	0.72356	0.454000	0.30748	ATG	.	.		0.363	HECTD4-202	KNOWN	basic	protein_coding	protein_coding		NM_173813	
CCDC42B	387885	hgsc.bcm.edu	37	12	113587689	113587689	+	Silent	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:113587689C>T	ENST00000335621.6	+	1	27	c.27C>T	c.(25-27)ttC>ttT	p.F9F		NM_001144872.1	NP_001138344.1	A6NFT4	CC42B_HUMAN	coiled-coil domain containing 42B	9																	AGGAATATTTCCGACTGGCTT	0.572																																					p.F9F		Atlas-SNP	.											.	CCDC42B	3	.	0			c.C27T						.						66.0	64.0	65.0					12																	113587689		692	1591	2283	SO:0001819	synonymous_variant	387885	exon1			ATATTTCCGACTG		CCDS44983.1	12q24.13	2014-07-31			ENSG00000186710	ENSG00000186710			37100	protein-coding gene	gene with protein product						23569216	Standard	NM_001144872		Approved	MIA2	uc010sys.2	A6NFT4	OTTHUMG00000169655	ENST00000335621.6:c.27C>T	chr12.hg19:g.113587689C>T		62.0	0.0		82.0	48.0	NM_001144872		Silent	SNP	ENST00000335621.6	hg19	CCDS44983.1																																																																																			.	.		0.572	CCDC42B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405303.1	NM_001144872	
NOS1	4842	hgsc.bcm.edu	37	12	117669901	117669901	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr12:117669901G>C	ENST00000338101.4	-	22	3377	c.3373C>G	c.(3373-3375)Ccg>Gcg	p.P1125A	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.P1091A			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GTGCAGGGCGGGAGGCGGAGC	0.602																																					p.P1125A	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.C3373G						.						68.0	75.0	73.0					12																	117669901		2152	4265	6417	SO:0001583	missense	4842	exon23			AGGGCGGGAGGCG		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3373C>G	chr12.hg19:g.117669901G>C	ENSP00000337459:p.Pro1125Ala	190.0	0.0		158.0	54.0	NM_001204218		Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	18.26	3.584315	0.65992	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.65916	-0.18;-0.18	4.55	4.55	0.56014	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.82006	0.4943	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85985	0.1485	10	0.87932	D	0	-28.2414	17.4925	0.87708	0.0:0.0:1.0:0.0	.	1091	P29475	NOS1_HUMAN	A	986;1091;1091;1125	ENSP00000320758:P1091A;ENSP00000337459:P1125A	ENSP00000320758:P1091A	P	-	1	0	NOS1	116154284	1.000000	0.71417	0.930000	0.37139	0.337000	0.28794	9.657000	0.98554	2.371000	0.80710	0.305000	0.20034	CCG	.	.		0.602	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
PAN3	255967	hgsc.bcm.edu	37	13	28748529	28748529	+	Splice_Site	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:28748529A>T	ENST00000380958.3	+	2	703	c.551A>T	c.(550-552)cAg>cTg	p.Q184L	PAN3_ENST00000399613.1_Splice_Site_p.Q38L	NM_175854.7	NP_787050.6			PAN3 poly(A) specific ribonuclease subunit											endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)	Colorectal(13;0.000334)	all cancers(112;0.0102)|Epithelial(112;0.0803)|GBM - Glioblastoma multiforme(144;0.121)|OV - Ovarian serous cystadenocarcinoma(117;0.13)|Lung(94;0.174)		CCCCTGATGCAGGTATCCTTA	0.378																																					p.Q184L		Atlas-SNP	.											.	PAN3	123	.	0			c.A551T						.						76.0	75.0	75.0					13																	28748529		2203	4300	6503	SO:0001630	splice_region_variant	255967	exon2			TGATGCAGGTATC	AK091307	CCDS9329.1, CCDS9329.2	13q12.2	2014-03-27	2014-03-27		ENSG00000152520	ENSG00000152520			29991	protein-coding gene	gene with protein product			"""PAN3 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""			14583602	Standard	NM_175854		Approved		uc001urz.3	Q58A45	OTTHUMG00000016645	ENST00000380958.3:c.552+1A>T	chr13.hg19:g.28748529A>T		33.0	0.0		29.0	20.0	NM_175854		Missense_Mutation	SNP	ENST00000380958.3	hg19	CCDS9329.2	.	.	.	.	.	.	.	.	.	.	A	27.8	4.862722	0.91511	.	.	ENSG00000152520	ENST00000380958;ENST00000399613	T;T	0.61040	0.14;0.43	5.32	5.32	0.75619	.	0.000000	0.85682	D	0.000000	T	0.65933	0.2739	L	0.29908	0.895	0.80722	D	1	D;P;P	0.63046	0.992;0.908;0.908	D;D;P	0.72982	0.979;0.922;0.888	T	0.70178	-0.4943	10	0.87932	D	0	-7.4408	15.2951	0.73898	1.0:0.0:0.0:0.0	.	184;184;184	Q58A45-4;Q58A45;Q58A45-3	.;PAN3_HUMAN;.	L	184;38	ENSP00000370345:Q184L;ENSP00000382522:Q38L	ENSP00000370345:Q184L	Q	+	2	0	PAN3	27646529	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.842000	0.92136	2.013000	0.59113	0.482000	0.46254	CAG	.	.		0.378	PAN3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044318.4	NM_175854	Missense_Mutation
USPL1	10208	hgsc.bcm.edu	37	13	31232186	31232186	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:31232186G>T	ENST00000255304.4	+	9	2314	c.1972G>T	c.(1972-1974)Gtt>Ttt	p.V658F		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	658					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TCCATCCCAAGTTGTAAATAC	0.353																																					p.V658F	Ovarian(60;318 1180 1554 28110 31601)	Atlas-SNP	.											.	USPL1	82	.	0			c.G1972T						.						77.0	76.0	76.0					13																	31232186		2203	4300	6503	SO:0001583	missense	10208	exon9			TCCCAAGTTGTAA	X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.1972G>T	chr13.hg19:g.31232186G>T	ENSP00000255304:p.Val658Phe	45.0	0.0		72.0	4.0	NM_005800	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	ENST00000255304.4	hg19	CCDS9336.1	.	.	.	.	.	.	.	.	.	.	G	3.048	-0.196008	0.06259	.	.	ENSG00000132952	ENST00000255304	T	0.15372	2.43	4.81	-2.03	0.07365	.	1.172930	0.06112	N	0.667347	T	0.07007	0.0178	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.14023	0.01	T	0.36817	-0.9732	10	0.22109	T	0.4	-0.3871	2.3207	0.04209	0.3403:0.3922:0.1484:0.1191	.	658	Q5W0Q7	USPL1_HUMAN	F	658	ENSP00000255304:V658F	ENSP00000255304:V658F	V	+	1	0	USPL1	30130186	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.010000	0.03656	-0.280000	0.09154	0.655000	0.94253	GTT	.	.		0.353	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044369.1	NM_005800	
N4BP2L2	10443	hgsc.bcm.edu	37	13	33092036	33092036	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:33092036T>C	ENST00000267068.3	-	6	1819	c.1655A>G	c.(1654-1656)cAc>cGc	p.H552R	N4BP2L2_ENST00000504114.1_Missense_Mutation_p.H108R|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.H123R|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.H552R|N4BP2L2_ENST00000357505.6_Missense_Mutation_p.H108R	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	552					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TGTGCTTTTGTGTGATGGTTC	0.408																																					p.H552R		Atlas-SNP	.											.	N4BP2L2	90	.	0			c.A1655G						.						159.0	149.0	153.0					13																	33092036		2203	4300	6503	SO:0001583	missense	10443	exon6			CTTTTGTGTGATG	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.1655A>G	chr13.hg19:g.33092036T>C	ENSP00000267068:p.His552Arg	74.0	0.0		77.0	43.0	NM_014887	A3KME8	Missense_Mutation	SNP	ENST00000267068.3	hg19	CCDS9346.1	.	.	.	.	.	.	.	.	.	.	T	17.17	3.320244	0.60634	.	.	ENSG00000244754	ENST00000504114;ENST00000357505;ENST00000399396;ENST00000446957;ENST00000505213;ENST00000267068	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.59	5.59	0.84812	.	1.200800	0.06311	N	0.702734	T	0.51975	0.1706	L	0.47190	1.495	0.34385	D	0.693499	B;D;B;P	0.58620	0.355;0.983;0.07;0.51	B;P;B;B	0.54544	0.203;0.755;0.024;0.202	T	0.48559	-0.9025	10	0.52906	T	0.07	-0.3805	15.7685	0.78146	0.0:0.0:0.0:1.0	.	108;123;552;552	B4DPY1;Q92802-3;Q92802;Q92802-2	.;.;N42L2_HUMAN;.	R	108;108;123;552;552;552	ENSP00000427477:H108R;ENSP00000350104:H108R;ENSP00000382328:H123R;ENSP00000394239:H552R;ENSP00000423362:H552R;ENSP00000267068:H552R	ENSP00000267068:H552R	H	-	2	0	N4BP2L2	31990036	1.000000	0.71417	0.975000	0.42487	0.963000	0.63663	6.765000	0.74965	2.132000	0.65825	0.528000	0.53228	CAC	.	.		0.408	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887	
NBEA	26960	hgsc.bcm.edu	37	13	35923307	35923307	+	Nonsense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:35923307T>A	ENST00000400445.3	+	37	6500	c.5966T>A	c.(5965-5967)tTg>tAg	p.L1989*	NBEA_ENST00000540320.1_Nonsense_Mutation_p.L1989*|NBEA_ENST00000379939.2_Nonsense_Mutation_p.L1986*|NBEA_ENST00000310336.4_Nonsense_Mutation_p.L1989*	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1989					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GAGTTTATTTTGAACAGACAA	0.338																																					p.L1989X		Atlas-SNP	.											.	NBEA	340	.	0			c.T5966A						.						97.0	94.0	95.0					13																	35923307		1848	4099	5947	SO:0001587	stop_gained	26960	exon37			TTATTTTGAACAG	AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.5966T>A	chr13.hg19:g.35923307T>A	ENSP00000383295:p.Leu1989*	130.0	0.0		102.0	30.0	NM_015678	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Nonsense_Mutation	SNP	ENST00000400445.3	hg19	CCDS45026.1	.	.	.	.	.	.	.	.	.	.	T	51	17.382056	0.99885	.	.	ENSG00000172915	ENST00000540320;ENST00000400445;ENST00000379939;ENST00000310336;ENST00000422518	.	.	.	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.6691	0.77258	0.0:0.0:0.0:1.0	.	.	.	.	X	1989;1989;1986;1989;616	.	ENSP00000308534:L1989X	L	+	2	0	NBEA	34821307	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.503000	0.81632	2.108000	0.64289	0.533000	0.62120	TTG	.	.		0.338	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015678	
MYCBP2	23077	hgsc.bcm.edu	37	13	77763108	77763108	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:77763108G>T	ENST00000544440.2	-	30	4132	c.4115C>A	c.(4114-4116)tCt>tAt	p.S1372Y	MYCBP2_ENST00000407578.2_Missense_Mutation_p.S1410Y|MYCBP2_ENST00000357337.6_Missense_Mutation_p.S1372Y|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCTTGCAAAAGACCTCTTTAA	0.378																																					p.S1410Y		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.C4229A						.						120.0	119.0	119.0					13																	77763108		2203	4300	6503	SO:0001583	missense	23077	exon30			GCAAAAGACCTCT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.4115C>A	chr13.hg19:g.77763108G>T	ENSP00000444596:p.Ser1372Tyr	57.0	0.0		54.0	4.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	G	27.8	4.862122	0.91511	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.29917	1.55;1.55;1.55	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.27866	0.0686	N	0.08118	0	0.58432	D	0.999999	P	0.44090	0.826	P	0.47470	0.548	T	0.19418	-1.0306	10	0.66056	D	0.02	.	19.8965	0.96963	0.0:0.0:1.0:0.0	.	1372	O75592	MYCB2_HUMAN	Y	1372;1410;1372	ENSP00000349892:S1372Y;ENSP00000384288:S1410Y;ENSP00000444596:S1372Y	ENSP00000349892:S1372Y	S	-	2	0	MYCBP2	76661109	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.717000	0.92951	0.655000	0.94253	TCT	.	.		0.378	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
ABCC4	10257	hgsc.bcm.edu	37	13	95822825	95822825	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr13:95822825C>G	ENST00000376887.4	-	14	1899	c.1785G>C	c.(1783-1785)caG>caC	p.Q595H	ABCC4_ENST00000538287.1_3'UTR|ABCC4_ENST00000412704.1_Missense_Mutation_p.Q595H|ABCC4_ENST00000536256.1_Missense_Mutation_p.Q520H|ABCC4_ENST00000431522.1_Missense_Mutation_p.Q595H	NM_005845.3	NP_005836.2	O15439	MRP4_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 4	595	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				blood coagulation (GO:0007596)|oxidation-reduction process (GO:0055114)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of smooth muscle cell proliferation (GO:0048661)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|response to organonitrogen compound (GO:0010243)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	15-hydroxyprostaglandin dehydrogenase (NAD+) activity (GO:0016404)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43	all_neural(89;0.0878)|Medulloblastoma(90;0.163)				Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cefazolin(DB01327)|Celecoxib(DB00482)|Conjugated Estrogens(DB00286)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Flurbiprofen(DB00712)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Lamivudine(DB00709)|Leucovorin(DB00650)|Meloxicam(DB00814)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Probenecid(DB01032)|Rosuvastatin(DB01098)|Sildenafil(DB00203)|Sorafenib(DB00398)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tenofovir(DB00300)|Tioguanine(DB00352)|Ursodeoxycholic acid(DB01586)|Verapamil(DB00661)|Zidovudine(DB00495)	CTTTGAGGTACTGCAACTGAT	0.388																																					p.Q595H		Atlas-SNP	.											.	ABCC4	248	.	0			c.G1785C						.						103.0	95.0	98.0					13																	95822825		2203	4300	6503	SO:0001583	missense	10257	exon14			GAGGTACTGCAAC	U66682	CCDS9474.1	13q31	2012-03-14			ENSG00000125257	ENSG00000125257		"""ATP binding cassette transporters / subfamily C"""	55	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter (ABC superfamily)"", ""bA464I2.1 (ATP-binding cassette, sub-family C (CFTR/MRP), member 4)"", ""multidrug resistance-associated protein 4"", ""multispecific organic anion transporter B"""	605250				8894702, 9661885	Standard	NM_005845		Approved	MRP4, EST170205, MOAT-B, MOATB	uc001vmd.4	O15439	OTTHUMG00000017216	ENST00000376887.4:c.1785G>C	chr13.hg19:g.95822825C>G	ENSP00000366084:p.Gln595His	47.0	0.0		44.0	19.0	NM_005845	A9Z1Z7|Q8IVZ4|Q8IZN6|Q8NEW8|Q9Y6J2	Missense_Mutation	SNP	ENST00000376887.4	hg19	CCDS9474.1	.	.	.	.	.	.	.	.	.	.	C	14.29	2.491407	0.44249	.	.	ENSG00000125257	ENST00000412704;ENST00000376887;ENST00000536256;ENST00000431522	D;D;D;D	0.88741	-2.42;-2.42;-1.81;-2.42	5.61	3.75	0.43078	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.87164	0.6109	L	0.31371	0.925	0.80722	D	1	B;B;P;B;P	0.47841	0.246;0.386;0.648;0.386;0.901	B;B;P;B;P	0.54544	0.083;0.175;0.596;0.175;0.755	D	0.85787	0.1365	10	0.87932	D	0	.	8.0651	0.30657	0.0:0.6654:0.0:0.3346	.	520;595;595;595;595	B7Z3Q7;A8K2Q2;O15439-2;Q8IVZ4;O15439	.;.;.;.;MRP4_HUMAN	H	595;595;520;595	ENSP00000388657:Q595H;ENSP00000366084:Q595H;ENSP00000442024:Q520H;ENSP00000398562:Q595H	ENSP00000366084:Q595H	Q	-	3	2	ABCC4	94620826	0.999000	0.42202	1.000000	0.80357	0.967000	0.64934	0.626000	0.24492	0.624000	0.30286	0.555000	0.69702	CAG	.	.		0.388	ABCC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045478.2	NM_005845	
FSCB	84075	hgsc.bcm.edu	37	14	44975744	44975744	+	Silent	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr14:44975744T>C	ENST00000340446.4	-	1	738	c.447A>G	c.(445-447)gaA>gaG	p.E149E	RP11-163M18.1_ENST00000556228.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA|RP11-163M18.1_ENST00000557465.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	149						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		TGTCCACTTTTTCTACAGGGG	0.418																																					p.E149E		Atlas-SNP	.											.	FSCB	173	.	0			c.A447G						.						195.0	195.0	195.0					14																	44975744		2203	4300	6503	SO:0001819	synonymous_variant	84075	exon1			CACTTTTTCTACA	AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.447A>G	chr14.hg19:g.44975744T>C		146.0	0.0		167.0	107.0	NM_032135	Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	ENST00000340446.4	hg19	CCDS9679.1																																																																																			.	.		0.418	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276788.1	NM_032135	
PLEKHG3	26030	hgsc.bcm.edu	37	14	65209799	65209799	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr14:65209799A>T	ENST00000394691.1	+	17	3185	c.3038A>T	c.(3037-3039)cAg>cTg	p.Q1013L	PLEKHG3_ENST00000247226.7_Missense_Mutation_p.Q957L|PLEKHG3_ENST00000484731.2_Missense_Mutation_p.Q518L|PLEKHG3_ENST00000471182.2_Missense_Mutation_p.Q546L|PLEKHG3_ENST00000492928.1_Intron			A1L390	PKHG3_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 3	1013							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(5)|kidney(2)|large_intestine(1)|lung(14)|prostate(2)|skin(3)|urinary_tract(2)	29				all cancers(60;0.00802)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)|BRCA - Breast invasive adenocarcinoma(234;0.0485)		ATGTCACCACAGCGTTTCTTC	0.642																																					p.Q957L		Atlas-SNP	.											.	PLEKHG3	89	.	0			c.A2870T						.						84.0	89.0	88.0					14																	65209799		2203	4300	6503	SO:0001583	missense	26030	exon15			CACCACAGCGTTT	AB011171	CCDS32098.1	14q23.3	2013-01-10	2004-12-01	2004-12-01	ENSG00000126822	ENSG00000126822		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20364	protein-coding gene	gene with protein product			"""KIAA0599"""	KIAA0599			Standard	XM_005267511		Approved	ARHGEF43	uc001xhp.2	A1L390	OTTHUMG00000029671	ENST00000394691.1:c.3038A>T	chr14.hg19:g.65209799A>T	ENSP00000378183:p.Gln1013Leu	92.0	0.0		73.0	22.0	NM_015549	A1L389|B5MEC9|O60339|Q6GMS3|Q6P4B1|Q7L3S3|Q86SW7|Q8TEF5|Q96EW6|Q9BT82	Missense_Mutation	SNP	ENST00000394691.1	hg19		.	.	.	.	.	.	.	.	.	.	A	7.975	0.749874	0.15778	.	.	ENSG00000126822	ENST00000247226;ENST00000394691;ENST00000471182;ENST00000484731	T;T;T;T	0.60672	0.62;0.17;1.52;1.52	5.55	-2.69	0.06022	.	0.515912	0.18076	N	0.152448	T	0.36936	0.0985	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.26547	0.152;0.066;0.014;0.024	B;B;B;B	0.24394	0.053;0.053;0.013;0.03	T	0.16335	-1.0406	10	0.46703	T	0.11	.	6.4868	0.22093	0.5123:0.2439:0.2438:0.0	.	546;518;1013;957	A1L390-2;G3V311;A1L390;A1L390-3	.;.;PKHG3_HUMAN;.	L	957;1013;546;518	ENSP00000247226:Q957L;ENSP00000378183:Q1013L;ENSP00000450945:Q546L;ENSP00000450973:Q518L	ENSP00000247226:Q957L	Q	+	2	0	PLEKHG3	64279552	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.084000	0.14891	-0.442000	0.07190	-1.101000	0.02118	CAG	.	.		0.642	PLEKHG3-010	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000412028.1	NM_015549	
CEP128	145508	hgsc.bcm.edu	37	14	80997175	80997175	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr14:80997175A>C	ENST00000555265.1	-	22	3311	c.2936T>G	c.(2935-2937)cTa>cGa	p.L979R	CEP128_ENST00000281129.3_Missense_Mutation_p.L979R|CEP128_ENST00000553717.1_5'UTR			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	979						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						GAAATCTTCTAGTAGGCTCAG	0.383																																					p.L979R		Atlas-SNP	.											.	CEP128	146	.	0			c.T2936G						.						93.0	87.0	89.0					14																	80997175		2203	4300	6503	SO:0001583	missense	145508	exon21			TCTTCTAGTAGGC	AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.2936T>G	chr14.hg19:g.80997175A>C	ENSP00000451162:p.Leu979Arg	71.0	0.0		68.0	38.0	NM_152446	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	ENST00000555265.1	hg19	CCDS32130.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.062342	0.76187	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619	T;T	0.58060	0.36;0.36	5.62	5.62	0.85841	.	0.104996	0.43110	D	0.000601	T	0.68742	0.3034	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66674	-0.5864	10	0.35671	T	0.21	.	16.1219	0.81365	1.0:0.0:0.0:0.0	.	979	Q6ZU80	CE128_HUMAN	R	979	ENSP00000281129:L979R;ENSP00000451162:L979R	ENSP00000281129:L979R	L	-	2	0	CEP128	80066928	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	7.135000	0.77276	2.254000	0.74563	0.528000	0.53228	CTA	.	.		0.383	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413415.1	NM_152446	
CCDC88C	440193	hgsc.bcm.edu	37	14	91787522	91787522	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr14:91787522T>A	ENST00000389857.6	-	13	1555	c.1469A>T	c.(1468-1470)gAg>gTg	p.E490V		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	490					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GCCGCTCTCCTCCAACACCAG	0.622																																					p.E490V		Atlas-SNP	.											.	CCDC88C	192	.	0			c.A1469T						.						45.0	46.0	46.0					14																	91787522		2019	4169	6188	SO:0001583	missense	440193	exon13			CTCTCCTCCAACA		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1469A>T	chr14.hg19:g.91787522T>A	ENSP00000374507:p.Glu490Val	110.0	0.0		97.0	22.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	hg19	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	T	16.57	3.158978	0.57368	.	.	ENSG00000015133	ENST00000389857	T	0.23754	1.89	4.98	4.98	0.66077	.	0.298098	0.23396	U	0.048640	T	0.41143	0.1146	M	0.70595	2.14	0.80722	D	1	D	0.53151	0.958	P	0.55161	0.77	T	0.35847	-0.9772	10	0.72032	D	0.01	-27.8784	9.85	0.41051	0.0:0.088:0.0:0.912	.	490	Q9P219	DAPLE_HUMAN	V	490	ENSP00000374507:E490V	ENSP00000374507:E490V	E	-	2	0	CCDC88C	90857275	1.000000	0.71417	0.999000	0.59377	0.247000	0.25773	4.525000	0.60559	2.011000	0.59026	0.459000	0.35465	GAG	.	.		0.622	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
UNC13C	440279	hgsc.bcm.edu	37	15	54306838	54306838	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr15:54306838T>A	ENST00000260323.11	+	1	1738	c.1738T>A	c.(1738-1740)Tca>Aca	p.S580T	UNC13C_ENST00000545554.1_Missense_Mutation_p.S580T|UNC13C_ENST00000537900.1_Missense_Mutation_p.S580T	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	580					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		CTCTCTCCTGTCATCTTCGGA	0.438																																					p.S580T		Atlas-SNP	.											.	UNC13C	674	.	0			c.T1738A						.						66.0	64.0	64.0					15																	54306838		1892	4113	6005	SO:0001583	missense	440279	exon1			CTCCTGTCATCTT	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1738T>A	chr15.hg19:g.54306838T>A	ENSP00000260323:p.Ser580Thr	44.0	0.0		35.0	28.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	T	17.91	3.503774	0.64298	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.83914	-1.78;-1.78;-1.78	5.17	5.17	0.71159	.	.	.	.	.	D	0.84906	0.5576	L	0.27053	0.805	0.47547	D	0.999452	D	0.58268	0.982	D	0.67548	0.952	D	0.86873	0.2037	9	0.72032	D	0.01	.	14.3313	0.66559	0.0:0.0:0.0:1.0	.	580	Q8NB66	UN13C_HUMAN	T	580	ENSP00000260323:S580T;ENSP00000438156:S580T;ENSP00000442569:S580T	ENSP00000260323:S580T	S	+	1	0	UNC13C	52094130	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.522000	0.81844	2.168000	0.68352	0.533000	0.62120	TCA	.	.		0.438	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
MESDC1	59274	hgsc.bcm.edu	37	15	81295203	81295203	+	Silent	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr15:81295203G>T	ENST00000267984.2	+	1	1909	c.591G>T	c.(589-591)gcG>gcT	p.A197A		NM_022566.2	NP_072088.1	Q9H1K6	MESD1_HUMAN	mesoderm development candidate 1	197										endometrium(1)|lung(2)	3						TGACGGACGCGTGCGCCCTGG	0.692																																					p.A197A		Atlas-SNP	.											.	MESDC1	7	.	0			c.G591T						.						29.0	30.0	30.0					15																	81295203		2198	4293	6491	SO:0001819	synonymous_variant	59274	exon1			GGACGCGTGCGCC	AY007810	CCDS10316.1	15q13	2008-07-18			ENSG00000140406	ENSG00000140406			13519	protein-coding gene	gene with protein product		615466				11247670	Standard	NM_022566		Approved	MGC99595	uc002bfz.3	Q9H1K6	OTTHUMG00000144185	ENST00000267984.2:c.591G>T	chr15.hg19:g.81295203G>T		2.0	0.0		9.0	7.0	NM_022566		Silent	SNP	ENST00000267984.2	hg19	CCDS10316.1																																																																																			.	.		0.692	MESDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000291390.1	NM_022566	
CLCN7	1186	hgsc.bcm.edu	37	16	1511413	1511413	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr16:1511413T>A	ENST00000382745.4	-	4	949	c.344A>T	c.(343-345)aAt>aTt	p.N115I	CLCN7_ENST00000448525.1_Missense_Mutation_p.N91I|CLCN7_ENST00000262318.8_Missense_Mutation_p.N91I	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	115					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				CACCGTGTGATTGATCCGCCG	0.682																																					p.N115I		Atlas-SNP	.											.	CLCN7	53	.	0			c.A344T						.						23.0	18.0	20.0					16																	1511413		2105	4141	6246	SO:0001583	missense	1186	exon4			GTGTGATTGATCC	Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.344A>T	chr16.hg19:g.1511413T>A	ENSP00000372193:p.Asn115Ile	68.0	0.0		59.0	26.0	NM_001287	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Missense_Mutation	SNP	ENST00000382745.4	hg19	CCDS32361.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.578206	0.45902	.	.	ENSG00000103249	ENST00000448525;ENST00000262318;ENST00000382745;ENST00000428756	D;D	0.91894	-2.93;-2.93	5.0	5.0	0.66597	Chloride channel, core (2);	0.132635	0.64402	D	0.000002	D	0.84674	0.5524	N	0.20986	0.625	0.50467	D	0.999871	B;P	0.49961	0.395;0.93	B;B	0.39068	0.197;0.289	D	0.83988	0.0336	10	0.27082	T	0.32	-40.6302	13.5235	0.61582	0.0:0.0:0.0:1.0	.	91;115	E9PDB9;P51798	.;CLCN7_HUMAN	I	91;68;115;57	ENSP00000410907:N91I;ENSP00000372193:N115I	ENSP00000262318:N68I	N	-	2	0	CLCN7	1451414	1.000000	0.71417	0.998000	0.56505	0.050000	0.14768	4.363000	0.59473	1.869000	0.54173	0.383000	0.25322	AAT	.	.		0.682	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103598.2	NM_001287	
GRIN2A	2903	hgsc.bcm.edu	37	16	10032379	10032379	+	Silent	SNP	T	T	A	rs35898789		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr16:10032379T>A	ENST00000396573.2	-	4	753	c.444A>T	c.(442-444)ggA>ggT	p.G148G	GRIN2A_ENST00000562109.1_Silent_p.G148G|GRIN2A_ENST00000566670.1_5'UTR|GRIN2A_ENST00000396575.2_Silent_p.G148G|GRIN2A_ENST00000330684.3_Silent_p.G148G|GRIN2A_ENST00000535259.1_5'UTR|GRIN2A_ENST00000404927.2_Silent_p.G148G	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	148					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGATGGACGCTCCAAACTGGA	0.507																																					p.G148G		Atlas-SNP	.											.	GRIN2A	366	.	0			c.A444T						.						55.0	50.0	52.0					16																	10032379		2193	4288	6481	SO:0001819	synonymous_variant	2903	exon4			GGACGCTCCAAAC		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.444A>T	chr16.hg19:g.10032379T>A		26.0	0.0		29.0	18.0	NM_000833	O00669|Q17RZ6	Silent	SNP	ENST00000396573.2	hg19	CCDS10539.1																																																																																			.	.		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		
ERN2	10595	hgsc.bcm.edu	37	16	23711862	23711862	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr16:23711862T>A	ENST00000457008.2	-	12	1405	c.1367A>T	c.(1366-1368)gAa>gTa	p.E456V	ERN2_ENST00000256797.4_Missense_Mutation_p.E556V					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		AGGCTCACCTTCAGGGTCGTC	0.567																																					p.E556V		Atlas-SNP	.											.	ERN2	131	.	0			c.A1667T						.						99.0	99.0	99.0					16																	23711862		2197	4300	6497	SO:0001583	missense	10595	exon13			TCACCTTCAGGGT	AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.1367A>T	chr16.hg19:g.23711862T>A	ENSP00000413812:p.Glu456Val	58.0	0.0		59.0	34.0	NM_033266		Missense_Mutation	SNP	ENST00000457008.2	hg19		.	.	.	.	.	.	.	.	.	.	T	10.35	1.325269	0.24080	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.61627	0.09;0.16	4.1	4.1	0.47936	.	0.463784	0.22028	N	0.065637	T	0.43299	0.1241	L	0.27053	0.805	0.48185	D	0.999602	P;B	0.48694	0.914;0.183	B;B	0.42995	0.404;0.058	T	0.29761	-1.0001	10	0.33940	T	0.23	.	9.7718	0.40593	0.0:0.0:0.0:1.0	.	456;508	E7ETG2;A5YM65	.;.	V	556;456	ENSP00000256797:E556V;ENSP00000413812:E456V	ENSP00000256797:E556V	E	-	2	0	ERN2	23619363	1.000000	0.71417	0.994000	0.49952	0.045000	0.14185	1.870000	0.39529	2.083000	0.62718	0.459000	0.35465	GAA	.	.		0.567	ERN2-002	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000434886.1		
SLC52A1	55065	hgsc.bcm.edu	37	17	4936947	4936947	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:4936947A>T	ENST00000424747.1	-	3	1549	c.837T>A	c.(835-837)ggT>ggA	p.G279G	SLC52A1_ENST00000254853.5_Silent_p.G279G|SLC52A1_ENST00000512825.2_Silent_p.G279G	NM_001104577.1	NP_001098047.1	Q9NWF4	S52A1_HUMAN	solute carrier family 52 (riboflavin transporter), member 1	279					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)										GCAGGAAGGCACCATGGGCTG	0.622																																					p.G279G		Atlas-SNP	.											.	.	.	.	0			c.T837A						.						68.0	50.0	56.0					17																	4936947		2203	4300	6503	SO:0001819	synonymous_variant	55065	exon3			GAAGGCACCATGG	AY070775	CCDS11066.1	17p13.3	2013-07-17	2013-07-17	2012-02-29	ENSG00000132517	ENSG00000132517		"""Solute carriers"""	30225	protein-coding gene	gene with protein product	"""riboflavin transporter 1"""	607883	"""G protein-coupled receptor 172B"""	GPR172B		12740431, 18632736	Standard	NM_001104577		Approved	FLJ10060, GPCR42, PAR2, hRFT1, RFVT1	uc002gao.4	Q9NWF4	OTTHUMG00000099448	ENST00000424747.1:c.837T>A	chr17.hg19:g.4936947A>T		108.0	0.0		84.0	72.0	NM_017986	B5MEV1|B5MEV2|Q6P9E0|Q86UT0	Silent	SNP	ENST00000424747.1	hg19	CCDS11066.1																																																																																			.	.		0.622	SLC52A1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216913.1	NM_017986	
TP53	7157	hgsc.bcm.edu	37	17	7578461	7578461	+	Missense_Mutation	SNP	C	C	A	rs121912654		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:7578461C>A	ENST00000269305.4	-	5	658	c.469G>T	c.(469-471)Gtc>Ttc	p.V157F	TP53_ENST00000445888.2_Missense_Mutation_p.V157F|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.V157F|TP53_ENST00000413465.2_Missense_Mutation_p.V157F|TP53_ENST00000420246.2_Missense_Mutation_p.V157F|TP53_ENST00000359597.4_Missense_Mutation_p.V157F	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	157	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		V -> A (in sporadic cancers; somatic mutation).|V -> D (in sporadic cancers; somatic mutation).|V -> F (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|V -> G (in sporadic cancers; somatic mutation).|V -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9419979}.|V -> L (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.V157F(161)|p.V157I(10)|p.0?(8)|p.V157L(6)|p.V64F(6)|p.V25F(6)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.V157del(2)|p.V157fs*9(2)|p.P153fs*22(2)|p.V157fs*22(2)|p.V157fs*24(2)|p.V157_C176del20(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156_V157del(1)|p.R156_V157insV(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157_M160delVRAM(1)|p.D148fs*23(1)|p.V157_R158delVR(1)|p.S149fs*72(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.R156fs*20(1)|p.V157_I162delVRAMAI(1)|p.V157fs*23(1)|p.V157fs*21(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGCGCGGACGCGGGTGCCG	0.617		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.V157F	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,carcinoma,+1,5	TP53	33396	.	231	Substitution - Missense(189)|Deletion - Frameshift(15)|Deletion - In frame(14)|Whole gene deletion(8)|Insertion - Frameshift(3)|Insertion - In frame(1)|Complex - frameshift(1)	lung(69)|liver(30)|upper_aerodigestive_tract(26)|breast(19)|oesophagus(14)|ovary(13)|stomach(9)|large_intestine(7)|haematopoietic_and_lymphoid_tissue(7)|central_nervous_system(6)|bone(5)|vulva(4)|urinary_tract(4)|skin(3)|pancreas(3)|endometrium(2)|kidney(2)|biliary_tract(2)|soft_tissue(2)|prostate(1)|adrenal_gland(1)|salivary_gland(1)|thymus(1)	c.G469T						.						50.0	52.0	51.0					17																	7578461		2202	4300	6502	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	CGCGGACGCGGGT	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.469G>T	chr17.hg19:g.7578461C>A	ENSP00000269305:p.Val157Phe	199.0	2.0		82.0	61.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.865109	0.32977	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99822	-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94;-6.94	5.47	2.42	0.29668	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.216722	0.39210	N	0.001429	D	0.99718	0.9891	M	0.86420	2.815	0.33606	D	0.603	D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;0.999;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.997;0.994;0.984;0.981;0.996;0.998;0.996	D	0.97998	1.0358	10	0.72032	D	0.01	-16.7152	5.3541	0.16051	0.0:0.6119:0.146:0.2421	.	118;157;157;64;157;157;157	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	F	157;157;157;157;157;157;146;64;25;64;25;157	ENSP00000410739:V157F;ENSP00000352610:V157F;ENSP00000269305:V157F;ENSP00000398846:V157F;ENSP00000391127:V157F;ENSP00000391478:V157F;ENSP00000425104:V25F;ENSP00000423862:V64F;ENSP00000424104:V157F	ENSP00000269305:V157F	V	-	1	0	TP53	7519186	0.137000	0.22531	0.013000	0.15412	0.150000	0.21749	0.548000	0.23314	0.386000	0.24997	-0.253000	0.11424	GTC	.	.		0.617	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
ZNF286A	57335	hgsc.bcm.edu	37	17	15619693	15619693	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:15619693A>T	ENST00000464847.2	+	5	1208	c.655A>T	c.(655-657)Aca>Tca	p.T219S	ZNF286A_ENST00000593105.1_Missense_Mutation_p.T209S|ZNF286A_ENST00000395894.2_3'UTR|ZNF286A_ENST00000421016.1_Missense_Mutation_p.T219S|ZNF286A_ENST00000585171.1_Intron|ZNF286A_ENST00000581529.1_3'UTR|ZNF286A_ENST00000413242.2_Missense_Mutation_p.T219S|ZNF286A_ENST00000583566.1_Missense_Mutation_p.T219S|ZNF286A_ENST00000472486.1_3'UTR			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A	219					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		TGCCTTCCATACACTTGAAAA	0.338																																					p.T219S		Atlas-SNP	.											.	ZNF286A	58	.	0			c.A655T						.						36.0	35.0	35.0					17																	15619693		2183	4272	6455	SO:0001583	missense	57335	exon6			TTCCATACACTTG	AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000464847.2:c.655A>T	chr17.hg19:g.15619693A>T	ENSP00000464218:p.Thr219Ser	86.0	0.0		96.0	49.0	NM_020652	B4DKF9|Q96JF3	Missense_Mutation	SNP	ENST00000464847.2	hg19	CCDS11172.1	.	.	.	.	.	.	.	.	.	.	a	2.925	-0.222388	0.06061	.	.	ENSG00000187607	ENST00000421016;ENST00000412988;ENST00000395894	T;T	0.28255	1.62;1.62	4.06	2.98	0.34508	.	0.812016	0.10443	N	0.674020	T	0.23370	0.0565	L	0.42744	1.35	0.09310	N	1	B	0.17038	0.02	B	0.16722	0.016	T	0.29610	-1.0006	10	0.21540	T	0.41	-0.9894	5.4125	0.16356	0.774:0.0:0.226:0.0	.	219	Q9HBT8	Z286A_HUMAN	S	219;209;219	ENSP00000397163:T219S;ENSP00000408168:T209S	ENSP00000435872:T219S	T	+	1	0	ZNF286A	15560418	0.004000	0.15560	0.509000	0.27700	0.825000	0.46686	1.156000	0.31712	0.729000	0.32403	0.528000	0.53228	ACA	.	.		0.338	ZNF286A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130696.4	NM_020652	
RHBDL3	162494	hgsc.bcm.edu	37	17	30616020	30616020	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:30616020A>T	ENST00000269051.4	+	4	518	c.504A>T	c.(502-504)acA>acT	p.T168T	RHBDL3_ENST00000536287.1_Silent_p.T70T|RHBDL3_ENST00000538145.1_Silent_p.T160T	NM_138328.2	NP_612201.1	P58872	RHBL3_HUMAN	rhomboid, veinlet-like 3 (Drosophila)	168						integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(2)|skin(1)	16		Breast(31;0.116)|Ovarian(249;0.182)				TCATGATCACAGTCACGCTGC	0.597																																					p.T168T		Atlas-SNP	.											.	RHBDL3	49	.	0			c.A504T						.						50.0	49.0	49.0					17																	30616020		2203	4300	6503	SO:0001819	synonymous_variant	162494	exon4			GATCACAGTCACG	AJ313480	CCDS32613.1	17q11.2	2013-01-10				ENSG00000141314		"""EF-hand domain containing"""	16502	protein-coding gene	gene with protein product			"""rhomboid, veinlet-like 4 (Drosophila)"""	RHBDL4		11900977	Standard	XM_006721733		Approved	VRHO	uc002hhe.1	P58872		ENST00000269051.4:c.504A>T	chr17.hg19:g.30616020A>T		246.0	0.0		180.0	106.0	NM_138328	A6NMH1|Q495Y4|Q495Y5|Q495Y6	Silent	SNP	ENST00000269051.4	hg19	CCDS32613.1																																																																																			.	.		0.597	RHBDL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000447120.1	NM_138328	
MRPL45	84311	hgsc.bcm.edu	37	17	36478426	36478426	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:36478426A>T	ENST00000312513.5	+	8	1030	c.869A>T	c.(868-870)gAa>gTa	p.E290V	GPR179_ENST00000584976.1_5'Flank	NM_032351.4	NP_115727.4	Q9BRJ2	RM45_HUMAN	mitochondrial ribosomal protein L45	290						mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	13	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CTGAAACCAGAAGAAGAATAT	0.542											OREG0024353	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E290V		Atlas-SNP	.											.	MRPL45	27	.	0			c.A869T						.						70.0	70.0	70.0					17																	36478426		2203	4300	6503	SO:0001583	missense	84311	exon8			AACCAGAAGAAGA	BC006235	CCDS11326.1, CCDS74047.1	17q21.2	2014-05-06			ENSG00000174100	ENSG00000278845		"""Mitochondrial ribosomal proteins / large subunits"""	16651	protein-coding gene	gene with protein product		611850				11551941, 12706105	Standard	XM_006725366		Approved	MGC11321	uc002hpy.3	Q9BRJ2	OTTHUMG00000188489	ENST00000312513.5:c.869A>T	chr17.hg19:g.36478426A>T	ENSP00000308901:p.Glu290Val	86.0	0.0	863	50.0	11.0	NM_032351	A1L436|Q6ZMJ5	Missense_Mutation	SNP	ENST00000312513.5	hg19	CCDS11326.1	.	.	.	.	.	.	.	.	.	.	A	4.085	0.013785	0.07959	.	.	ENSG00000174100	ENST00000312513	T	0.43294	0.95	5.23	1.83	0.25207	.	0.806405	0.11676	N	0.540263	T	0.19485	0.0468	N	0.08118	0	0.09310	N	0.999999	B	0.12013	0.005	B	0.04013	0.001	T	0.24225	-1.0166	10	0.21014	T	0.42	1.5056	5.7292	0.18030	0.1697:0.3013:0.529:0.0	.	290	Q9BRJ2	RM45_HUMAN	V	290	ENSP00000308901:E290V	ENSP00000308901:E290V	E	+	2	0	MRPL45	33731953	0.737000	0.28175	0.083000	0.20561	0.002000	0.02628	1.100000	0.31025	0.321000	0.23259	-0.202000	0.12741	GAA	.	.		0.542	MRPL45-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256792.3	NM_032351	
KIF19	124602	hgsc.bcm.edu	37	17	72351437	72351437	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:72351437T>C	ENST00000389916.4	+	20	3121	c.2983T>C	c.(2983-2985)Tcc>Ccc	p.S995P		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	995					ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						AGATGGATGCTCCCGGCATAA	0.652																																					p.S995P		Atlas-SNP	.											.	KIF19	102	.	0			c.T2983C						.						29.0	31.0	30.0					17																	72351437		1941	4139	6080	SO:0001583	missense	124602	exon20			GGATGCTCCCGGC	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.2983T>C	chr17.hg19:g.72351437T>C	ENSP00000374566:p.Ser995Pro	52.0	0.0		53.0	10.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	hg19	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	T	9.744	1.165620	0.21538	.	.	ENSG00000196169	ENST00000389916	T	0.70399	-0.48	4.69	1.19	0.21007	.	.	.	.	.	T	0.38214	0.1032	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21484	-1.0244	9	0.33940	T	0.23	.	3.2687	0.06874	0.2264:0.3311:0.0:0.4424	.	995	Q2TAC6	KIF19_HUMAN	P	995	ENSP00000374566:S995P	ENSP00000374566:S995P	S	+	1	0	KIF19	69863032	0.000000	0.05858	0.015000	0.15790	0.580000	0.36256	0.378000	0.20569	0.033000	0.15463	0.454000	0.30748	TCC	.	.		0.652	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
GALK1	2584	hgsc.bcm.edu	37	17	73760089	73760089	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:73760089C>A	ENST00000588479.1	-	2	818	c.244G>T	c.(244-246)Gcc>Tcc	p.A82S	GALK1_ENST00000437911.1_Missense_Mutation_p.A112S|GALK1_ENST00000225614.2_Missense_Mutation_p.A82S			P51570	GALK1_HUMAN	galactokinase 1	82					carbohydrate metabolic process (GO:0005975)|galactitol metabolic process (GO:0019402)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|galactose binding (GO:0005534)			endometrium(2)|large_intestine(1)|lung(1)|prostate(1)	5	all_cancers(13;1.5e-07)		all cancers(21;1.03e-06)|Epithelial(20;1.92e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|Lung(188;0.132)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGCTCATCGGCACCCTCAGAG	0.637																																					p.A82S		Atlas-SNP	.											.	GALK1	17	.	0			c.G244T						.						26.0	25.0	25.0					17																	73760089		2201	4299	6500	SO:0001583	missense	2584	exon2			CATCGGCACCCTC		CCDS11728.1	17q25.1	2013-09-19			ENSG00000108479	ENSG00000108479	2.7.1.6		4118	protein-coding gene	gene with protein product		604313		GALK		7670469	Standard	NM_000154		Approved		uc002jpk.3	P51570	OTTHUMG00000179832	ENST00000588479.1:c.244G>T	chr17.hg19:g.73760089C>A	ENSP00000465930:p.Ala82Ser	69.0	0.0		57.0	17.0	NM_000154	B2RC07|B4E1G6	Missense_Mutation	SNP	ENST00000588479.1	hg19	CCDS11728.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233864	0.58886	.	.	ENSG00000108479	ENST00000225614;ENST00000437911;ENST00000375188	D;D	0.83837	-1.77;-1.77	5.1	5.1	0.69264	Ribosomal protein S5 domain 2-type fold (1);Ribosomal protein S5 domain 2-type fold, subgroup (1);	0.104471	0.64402	N	0.000004	D	0.85583	0.5730	M	0.78637	2.42	0.80722	D	1	P;B	0.36647	0.563;0.012	B;B	0.40741	0.339;0.039	D	0.84903	0.0843	10	0.33940	T	0.23	-20.2379	18.5096	0.90911	0.0:1.0:0.0:0.0	.	82;82	B4E1A8;P51570	.;GALK1_HUMAN	S	82;112;185	ENSP00000225614:A82S;ENSP00000406305:A112S	ENSP00000225614:A82S	A	-	1	0	GALK1	71271684	1.000000	0.71417	0.262000	0.24481	0.787000	0.44495	7.164000	0.77533	2.369000	0.80426	0.655000	0.94253	GCC	.	.		0.637	GALK1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448430.1		
FASN	2194	hgsc.bcm.edu	37	17	80049390	80049390	+	Silent	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr17:80049390C>T	ENST00000306749.2	-	9	1418	c.1200G>A	c.(1198-1200)gtG>gtA	p.V400V		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	400	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	GGATGATGTGCACGTTGGAGC	0.716																																					p.V400V	Colon(59;314 1043 11189 28578 32273)	Atlas-SNP	.											.	FASN	154	.	0			c.G1200A						.						31.0	32.0	32.0					17																	80049390		2175	4289	6464	SO:0001819	synonymous_variant	2194	exon9			GATGTGCACGTTG	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.1200G>A	chr17.hg19:g.80049390C>T		157.0	0.0		128.0	36.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Silent	SNP	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.716	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
MC2R	4158	hgsc.bcm.edu	37	18	13885429	13885429	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr18:13885429A>G	ENST00000327606.3	-	2	269	c.89T>C	c.(88-90)aTa>aCa	p.I30T		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	30					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	TGTGAAAAATATCTCCTCCGG	0.413																																					p.I30T	Colon(141;1584 1782 35999 48227 48692)	Atlas-SNP	.											.	MC2R	78	.	0			c.T89C						.						150.0	130.0	137.0					18																	13885429		2203	4300	6503	SO:0001583	missense	4158	exon2			AAAAATATCTCCT		CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.89T>C	chr18.hg19:g.13885429A>G	ENSP00000333821:p.Ile30Thr	62.0	0.0		65.0	23.0	NM_000529	A8K016|Q3MI45|Q504X6	Missense_Mutation	SNP	ENST00000327606.3	hg19	CCDS11869.1	.	.	.	.	.	.	.	.	.	.	A	15.40	2.822711	0.50739	.	.	ENSG00000185231	ENST00000327606;ENST00000399821	T;T	0.39406	1.08;1.08	4.13	4.13	0.48395	.	0.190266	0.44097	D	0.000491	T	0.35537	0.0935	L	0.47716	1.5	0.36431	D	0.864923	B	0.33583	0.418	B	0.28139	0.086	T	0.52343	-0.8588	10	0.87932	D	0	.	13.4468	0.61146	1.0:0.0:0.0:0.0	.	30	Q01718	ACTHR_HUMAN	T	30	ENSP00000333821:I30T;ENSP00000382718:I30T	ENSP00000333821:I30T	I	-	2	0	MC2R	13875429	0.993000	0.37304	0.572000	0.28498	0.761000	0.43186	8.280000	0.89903	1.643000	0.50594	0.528000	0.53228	ATA	.	.		0.413	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254639.2		
ASXL3	80816	hgsc.bcm.edu	37	18	31320038	31320038	+	Silent	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr18:31320038A>T	ENST00000269197.5	+	11	2670	c.2670A>T	c.(2668-2670)acA>acT	p.T890T		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	890					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						CTGAAGGGACAGATAATAAGG	0.348																																					p.T890T		Atlas-SNP	.											.	ASXL3	405	.	0			c.A2670T						.						95.0	95.0	95.0					18																	31320038		1862	4093	5955	SO:0001819	synonymous_variant	80816	exon11			AGGGACAGATAAT	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2670A>T	chr18.hg19:g.31320038A>T		53.0	0.0		50.0	21.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	hg19	CCDS45847.1																																																																																			.	.		0.348	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
MAP2K2	5605	hgsc.bcm.edu	37	19	4110509	4110509	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:4110509T>A	ENST00000262948.5	-	3	701	c.448A>T	c.(448-450)Atg>Ttg	p.M150L	MAP2K2_ENST00000394867.4_Missense_Mutation_p.M53L|MAP2K2_ENST00000599345.1_5'UTR	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	GCACTCACCATGTGTTCCATG	0.627																																					p.M150L		Atlas-SNP	.											MAP2K2_ENST00000262948,right_upper_lobe,carcinoma,0,2	MAP2K2	72	.	0			c.A448T						.						76.0	66.0	69.0					19																	4110509		2203	4300	6503	SO:0001583	missense	5605	exon3			TCACCATGTGTTC	L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.448A>T	chr19.hg19:g.4110509T>A	ENSP00000262948:p.Met150Leu	59.0	0.0		17.0	8.0	NM_030662		Missense_Mutation	SNP	ENST00000262948.5	hg19	CCDS12120.1	.	.	.	.	.	.	.	.	.	.	t	29.9	5.046015	0.93685	.	.	ENSG00000126934	ENST00000262948;ENST00000394867	D;D	0.92249	-3.0;-3.0	5.3	5.3	0.74995	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94235	0.8149	L	0.46741	1.465	0.80722	D	1	D	0.67145	0.996	D	0.85130	0.997	D	0.94821	0.7987	10	0.87932	D	0	-55.061	14.0565	0.64772	0.0:0.0:0.0:1.0	.	150	P36507	MP2K2_HUMAN	L	150;53	ENSP00000262948:M150L;ENSP00000378336:M53L	ENSP00000262948:M150L	M	-	1	0	MAP2K2	4061509	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.849000	0.86908	1.999000	0.58509	0.459000	0.35465	ATG	.	.		0.627	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258957.2		
ZNF91	7644	hgsc.bcm.edu	37	19	23543010	23543010	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:23543010T>A	ENST00000300619.7	-	4	2976	c.2771A>T	c.(2770-2772)cAc>cTc	p.H924L	ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Missense_Mutation_p.H892L|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	924					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGTAGTAAGGTGTGAAGGCTG	0.408																																					p.H924L		Atlas-SNP	.											.	ZNF91	349	.	0			c.A2771T						.						62.0	66.0	65.0					19																	23543010		2185	4291	6476	SO:0001583	missense	7644	exon4			GTAAGGTGTGAAG	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2771A>T	chr19.hg19:g.23543010T>A	ENSP00000300619:p.His924Leu	22.0	0.0		28.0	9.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	T	2.959	-0.215012	0.06101	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.13089	2.62;2.62	1.31	1.31	0.21738	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06554	0.0168	N	0.11673	0.155	0.09310	N	1	B;P	0.43477	0.036;0.808	B;B	0.41332	0.017;0.354	T	0.29640	-1.0005	9	0.12766	T	0.61	.	7.5137	0.27587	0.0:0.0:0.0:1.0	.	892;924	Q05481-2;Q05481	.;ZNF91_HUMAN	L	924;892	ENSP00000300619:H924L;ENSP00000380272:H892L	ENSP00000300619:H924L	H	-	2	0	ZNF91	23334850	0.000000	0.05858	0.006000	0.13384	0.013000	0.08279	-0.369000	0.07533	0.565000	0.29255	0.165000	0.16767	CAC	.	.		0.408	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ERICH4	100170765	hgsc.bcm.edu	37	19	41949136	41949136	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:41949136C>A	ENST00000378187.2	+	1	74	c.62C>A	c.(61-63)cCc>cAc	p.P21H		NM_001130514.1	NP_001123986.1	A6NGS2	ERIC4_HUMAN		21																	GGCCCACCCCCCCAGGCCCTG	0.627																																					p.P21H		Atlas-SNP	.											.	C19orf69	4	.	0			c.C62A						.						21.0	27.0	25.0					19																	41949136		692	1591	2283	SO:0001583	missense	100170765	exon1			CACCCCCCCAGGC																												ENST00000378187.2:c.62C>A	chr19.hg19:g.41949136C>A	ENSP00000367429:p.Pro21His	26.0	0.0		24.0	10.0	NM_001130514		Missense_Mutation	SNP	ENST00000378187.2	hg19	CCDS46085.1	.	.	.	.	.	.	.	.	.	.	C	15.06	2.721975	0.48728	.	.	ENSG00000204978	ENST00000378187	.	.	.	4.77	4.77	0.60923	.	0.000000	0.36409	N	0.002603	T	0.56441	0.1985	L	0.32530	0.975	0.29900	N	0.824501	D	0.89917	1.0	D	0.71870	0.975	T	0.57573	-0.7788	9	0.87932	D	0	-14.3494	13.7003	0.62604	0.0:1.0:0.0:0.0	.	21	A6NGS2	CS069_HUMAN	H	21	.	ENSP00000367429:P21H	P	+	2	0	C19orf69	46640976	0.105000	0.21958	0.565000	0.28409	0.317000	0.28152	2.244000	0.43124	2.374000	0.81015	0.555000	0.69702	CCC	.	.		0.627	C19orf69-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
NUP62	23636	hgsc.bcm.edu	37	19	50412454	50412454	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:50412454T>C	ENST00000596217.1	-	2	2498	c.611A>G	c.(610-612)cAg>cGg	p.Q204R	NUP62_ENST00000413454.1_Missense_Mutation_p.Q204R|NUP62_ENST00000422090.2_Missense_Mutation_p.Q204R|NUP62_ENST00000352066.3_Missense_Mutation_p.Q204R|NUP62_ENST00000600583.1_5'Flank|NUP62_ENST00000597723.1_Missense_Mutation_p.Q204R|IL4I1_ENST00000341114.3_Intron|IL4I1_ENST00000595948.1_Intron|NUP62_ENST00000597029.1_Missense_Mutation_p.Q204R			P37198	NUP62_HUMAN	nucleoporin 62kDa	204	15 X 9 AA approximate repeats.|Ala-rich.|Thr-rich.				carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|hormone-mediated signaling pathway (GO:0009755)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of programmed cell death (GO:0043069)|negative regulation of Ras protein signal transduction (GO:0046580)|nucleocytoplasmic transport (GO:0006913)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|regulation of Ras protein signal transduction (GO:0046578)|regulation of signal transduction (GO:0009966)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleocytoplasmic shuttling complex (GO:0031074)|pore complex (GO:0046930)|ribonucleoprotein complex (GO:0030529)	chromatin binding (GO:0003682)|receptor signaling complex scaffold activity (GO:0030159)|SH2 domain binding (GO:0042169)|structural constituent of nuclear pore (GO:0017056)|thyroid hormone receptor binding (GO:0046966)|ubiquitin binding (GO:0043130)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|stomach(1)|urinary_tract(2)	19		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00242)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		AGCAGCTGGCTGTGTGGCACC	0.622																																					p.Q204R		Atlas-SNP	.											.	NUP62	50	.	0			c.A611G						.						77.0	74.0	75.0					19																	50412454		2203	4300	6503	SO:0001583	missense	23636	exon3			GCTGGCTGTGTGG	X58521	CCDS12788.1	19q13.33	2013-09-20	2002-08-29		ENSG00000213024	ENSG00000213024			8066	protein-coding gene	gene with protein product	"""nuclear pore glycoprotein p62"""	605815	"""nucleoporin 62kD"""			1915414	Standard	NM_016553		Approved	p62, DKFZp547L134, IBSN, SNDI, MGC841, FLJ20822, FLJ43869	uc002pqx.3	P37198	OTTHUMG00000183077	ENST00000596217.1:c.611A>G	chr19.hg19:g.50412454T>C	ENSP00000471191:p.Gln204Arg	106.0	0.0		86.0	38.0	NM_153719	B3KWU5|Q503A4|Q6GTM2|Q96C43|Q9NSL1	Missense_Mutation	SNP	ENST00000596217.1	hg19	CCDS12788.1	.	.	.	.	.	.	.	.	.	.	T	5.727	0.318587	0.10845	.	.	ENSG00000213024	ENST00000352066;ENST00000422090;ENST00000413454	T;T;T	0.37411	1.2;1.2;1.2	4.92	3.88	0.44766	Nucleoporin, NSP1-like, C-terminal (1);	0.460715	0.14835	U	0.295642	T	0.32823	0.0842	M	0.62723	1.935	0.27556	N	0.950354	B	0.33073	0.396	B	0.29785	0.107	T	0.17048	-1.0382	9	.	.	.	-7.928	8.7263	0.34471	0.0:0.0:0.1919:0.8081	.	204	P37198	NUP62_HUMAN	R	204	ENSP00000305503:Q204R;ENSP00000407331:Q204R;ENSP00000387991:Q204R	.	Q	-	2	0	NUP62	55104266	0.770000	0.28543	0.990000	0.47175	0.035000	0.12851	0.557000	0.23454	0.977000	0.38444	0.459000	0.35465	CAG	.	.		0.622	NUP62-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464991.1	NM_153719	
ZNF581	51545	hgsc.bcm.edu	37	19	56156253	56156253	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:56156253A>T	ENST00000587252.1	+	2	589	c.316A>T	c.(316-318)Agc>Tgc	p.S106C	ZNF581_ENST00000270451.5_Missense_Mutation_p.S106C|ZNF581_ENST00000588537.1_Missense_Mutation_p.S106C			Q9P0T4	ZN581_HUMAN	zinc finger protein 581	106					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)	3		Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.105)		TCAGCGACACAGCATCACCCA	0.597																																					p.S106C		Atlas-SNP	.											.	ZNF581	13	.	0			c.A316T						.						75.0	69.0	71.0					19																	56156253		2203	4300	6503	SO:0001583	missense	51545	exon2			CGACACAGCATCA	AK026203	CCDS12932.1	19q13.42	2013-09-20			ENSG00000171425	ENSG00000171425		"""Zinc fingers, C2H2-type"""	25017	protein-coding gene	gene with protein product						11042152	Standard	NM_016535		Approved	HSPC189, FLJ22550	uc002qlq.3	Q9P0T4	OTTHUMG00000180869	ENST00000587252.1:c.316A>T	chr19.hg19:g.56156253A>T	ENSP00000466047:p.Ser106Cys	229.0	0.0		170.0	85.0	NM_016535	B2RDM6	Missense_Mutation	SNP	ENST00000587252.1	hg19	CCDS12932.1	.	.	.	.	.	.	.	.	.	.	A	18.66	3.671045	0.67814	.	.	ENSG00000171425	ENST00000270451	T	0.07800	3.16	3.9	0.285	0.15705	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13970	0.0338	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.07195	-1.0785	9	0.87932	D	0	.	5.9637	0.19313	0.5968:0.3132:0.09:0.0	.	106	Q9P0T4	ZN581_HUMAN	C	106	ENSP00000270451:S106C	ENSP00000270451:S106C	S	+	1	0	ZNF581	60848065	0.083000	0.21467	0.504000	0.27639	0.987000	0.75469	0.487000	0.22356	-0.121000	0.11787	0.334000	0.21626	AGC	.	.		0.597	ZNF581-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453430.1	NM_016535	
ZNF835	90485	hgsc.bcm.edu	37	19	57175003	57175003	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr19:57175003A>T	ENST00000537055.2	-	2	1795	c.1564T>A	c.(1564-1566)Tgt>Agt	p.C522S		NM_001005850.2	NP_001005850.2	Q9Y2P0	ZN835_HUMAN	zinc finger protein 835	522					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(22)|pancreas(3)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	47						CCCTGTTGACAGGTTTCTCCT	0.587																																					p.C522S		Atlas-SNP	.											.	ZNF835	106	.	0			c.T1564A						.						64.0	69.0	67.0					19																	57175003		2132	4255	6387	SO:0001583	missense	90485	exon2			GTTGACAGGTTTC	AK023017	CCDS56105.1	19q13.43	2013-01-08			ENSG00000127903	ENSG00000127903		"""Zinc fingers, C2H2-type"""	34332	protein-coding gene	gene with protein product							Standard	NM_001005850		Approved	BC37295_3	uc010ygn.2	Q9Y2P0		ENST00000537055.2:c.1564T>A	chr19.hg19:g.57175003A>T	ENSP00000444747:p.Cys522Ser	188.0	0.0		143.0	56.0	NM_001005850	B7Z5Y0|G3V1S0	Missense_Mutation	SNP	ENST00000537055.2	hg19	CCDS56105.1	.	.	.	.	.	.	.	.	.	.	A	1.071	-0.670007	0.03403	.	.	ENSG00000127903	ENST00000342088;ENST00000537055	T	0.05786	3.39	2.39	-1.51	0.08664	.	.	.	.	.	T	0.02767	0.0083	N	0.14661	0.345	0.09310	N	1	B	0.27229	0.172	B	0.21708	0.036	T	0.44421	-0.9329	9	0.28530	T	0.3	.	0.5427	0.00648	0.2752:0.202:0.3232:0.1996	.	544	Q9Y2P0	ZN835_HUMAN	S	544;522	ENSP00000444747:C522S	ENSP00000341756:C544S	C	-	1	0	ZNF835	61866815	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.920000	0.00334	-0.412000	0.07519	-0.441000	0.05720	TGT	.	.		0.587	ZNF835-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459800.1	NM_001005850	
HSPA12B	116835	hgsc.bcm.edu	37	20	3732438	3732438	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr20:3732438G>A	ENST00000254963.2	+	13	1831	c.1686G>A	c.(1684-1686)ctG>ctA	p.L562L	HSPA12B_ENST00000542646.1_Silent_p.L396L	NM_001197327.1|NM_052970.4	NP_001184256.1|NP_443202.3	Q96MM6	HS12B_HUMAN	heat shock 70kD protein 12B	562							ATP binding (GO:0005524)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	14						AAAAGCTGCTGGTTCGCGACG	0.736																																					p.L562L		Atlas-SNP	.											.	HSPA12B	43	.	0			c.G1686A						.						3.0	3.0	3.0					20																	3732438		1699	3441	5140	SO:0001819	synonymous_variant	116835	exon13			GCTGCTGGTTCGC	AK056712	CCDS13061.1	20p13	2011-09-02	2003-04-10	2003-04-10	ENSG00000132622	ENSG00000132622		"""Heat shock proteins / HSP70"""	16193	protein-coding gene	gene with protein product		610702	"""chromosome 20 open reading frame 60"""	C20orf60		12552099	Standard	NM_052970		Approved	dJ1009E24.2	uc002wjd.3	Q96MM6	OTTHUMG00000031755	ENST00000254963.2:c.1686G>A	chr20.hg19:g.3732438G>A		2.0	0.0		5.0	5.0	NM_052970	D3DVX7|Q2TAK3|Q9BR52	Silent	SNP	ENST00000254963.2	hg19	CCDS13061.1																																																																																			.	.		0.736	HSPA12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077756.2	NM_052970	
RALGAPA2	57186	hgsc.bcm.edu	37	20	20585826	20585826	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr20:20585826T>A	ENST00000202677.7	-	15	2038	c.2031A>T	c.(2029-2031)cgA>cgT	p.R677R	RALGAPA2_ENST00000495793.1_5'UTR	NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	677					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						TACCTTTGCCTCGTTGCTTCT	0.413																																					p.R677R		Atlas-SNP	.											.	RALGAPA2	274	.	0			c.A2031T						.						83.0	78.0	80.0					20																	20585826		1886	4114	6000	SO:0001819	synonymous_variant	57186	exon15			TTTGCCTCGTTGC	AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.2031A>T	chr20.hg19:g.20585826T>A		99.0	0.0		97.0	23.0	NM_020343	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Silent	SNP	ENST00000202677.7	hg19	CCDS46584.1	.	.	.	.	.	.	.	.	.	.	T	10.75	1.437964	0.25900	.	.	ENSG00000188559	ENST00000430436	.	.	.	5.28	2.98	0.34508	.	.	.	.	.	T	0.55305	0.1912	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49011	-0.8983	4	.	.	.	.	7.0116	0.24865	0.133:0.0731:0.0:0.7939	.	.	.	.	V	494	.	.	E	-	2	0	RALGAPA2	20533826	0.997000	0.39634	1.000000	0.80357	0.981000	0.71138	0.348000	0.20031	0.809000	0.34255	0.377000	0.23210	GAG	.	.		0.413	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000471941.1	NM_020343	
PMEPA1	56937	hgsc.bcm.edu	37	20	56227157	56227157	+	Silent	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr20:56227157T>A	ENST00000341744.3	-	4	1135	c.816A>T	c.(814-816)gcA>gcT	p.A272A	PMEPA1_ENST00000395816.3_Silent_p.A222A|PMEPA1_ENST00000395814.1_Silent_p.A222A|PMEPA1_ENST00000347215.4_Silent_p.A237A|PMEPA1_ENST00000265626.4_Silent_p.A222A	NM_020182.4	NP_064567.2	Q969W9	PMEPA_HUMAN	prostate transmembrane protein, androgen induced 1	272					androgen receptor signaling pathway (GO:0030521)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|transforming growth factor beta receptor signaling pathway (GO:0007179)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	R-SMAD binding (GO:0070412)|WW domain binding (GO:0050699)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|prostate(1)	16						TCCAGATGGCTGCGCTCTCTA	0.642																																					p.A272A		Atlas-SNP	.											.	PMEPA1	29	.	0			c.A816T						.						26.0	29.0	28.0					20																	56227157		2199	4295	6494	SO:0001819	synonymous_variant	56937	exon4			GATGGCTGCGCTC	AF224278	CCDS13462.1, CCDS13463.1, CCDS13464.1	20q13.31-q13.33	2008-04-03	2008-04-03	2008-04-03	ENSG00000124225	ENSG00000124225			14107	protein-coding gene	gene with protein product	"""solid tumor-associated 1"""	606564	"""transmembrane, prostate androgen induced RNA"""	TMEPAI		10873380	Standard	NM_020182		Approved	STAG1	uc002xyq.4	Q969W9	OTTHUMG00000032831	ENST00000341744.3:c.816A>T	chr20.hg19:g.56227157T>A		27.0	0.0		37.0	12.0	NM_020182	Q5TDR6|Q8NER4|Q96B72|Q9UJD3	Silent	SNP	ENST00000341744.3	hg19	CCDS13463.1																																																																																			.	.		0.642	PMEPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079858.2	NM_020182	
TRMT2A	27037	hgsc.bcm.edu	37	22	20102931	20102931	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr22:20102931C>T	ENST00000252136.7	-	4	1136	c.748G>A	c.(748-750)Ggg>Agg	p.G250R	TRMT2A_ENST00000403707.3_Missense_Mutation_p.G250R|TRMT2A_ENST00000404751.3_Missense_Mutation_p.G250R|RANBP1_ENST00000331821.3_5'Flank|TRMT2A_ENST00000439169.2_Missense_Mutation_p.G250R|RANBP1_ENST00000402752.1_5'Flank|TRMT2A_ENST00000492988.1_5'UTR|RANBP1_ENST00000430524.1_5'Flank	NM_001257994.1|NM_022727.5|NM_182984.4	NP_001244923.1|NP_073564.3|NP_892029.2	Q8IZ69	TRM2A_HUMAN	tRNA methyltransferase 2 homolog A (S. cerevisiae)	250					RNA processing (GO:0006396)		nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)			breast(2)|endometrium(2)|lung(5)	9						CCATCCACCCCGACGCCAACC	0.612																																					p.G250R		Atlas-SNP	.											.	TRMT2A	34	.	0			c.G748A						.						75.0	66.0	69.0					22																	20102931		2203	4300	6503	SO:0001583	missense	27037	exon4			CCACCCCGACGCC	BC017184	CCDS13774.1, CCDS58793.1	22q11.21	2014-02-12	2012-06-12		ENSG00000099899	ENSG00000099899			24974	protein-coding gene	gene with protein product	"""HpaII tiny fragments locus 9C"""	611151				9417108, 18075473	Standard	NM_022727		Approved	HTF9C	uc002zrl.2	Q8IZ69	OTTHUMG00000150454	ENST00000252136.7:c.748G>A	chr22.hg19:g.20102931C>T	ENSP00000252136:p.Gly250Arg	75.0	0.0		58.0	21.0	NM_001257994	D3DX25|Q32P57|Q96ME6|Q9H732	Missense_Mutation	SNP	ENST00000252136.7	hg19	CCDS13774.1	.	.	.	.	.	.	.	.	.	.	C	36	5.646134	0.96704	.	.	ENSG00000099899	ENST00000252136;ENST00000403707;ENST00000404751;ENST00000439169	T;T;T	0.46063	0.89;0.89;0.88	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.64114	0.2569	M	0.73598	2.24	0.80722	D	1	D;P;D	0.69078	0.997;0.625;0.997	P;B;P	0.61722	0.893;0.186;0.893	T	0.67401	-0.5680	10	0.72032	D	0.01	-48.5105	19.0103	0.92870	0.0:1.0:0.0:0.0	.	250;250;250	F2Z2W7;Q8IZ69-2;Q8IZ69	.;.;TRM2A_HUMAN	R	250	ENSP00000252136:G250R;ENSP00000385807:G250R;ENSP00000395738:G250R	ENSP00000252136:G250R	G	-	1	0	TRMT2A	18482931	1.000000	0.71417	0.445000	0.26908	0.990000	0.78478	5.614000	0.67695	2.595000	0.87683	0.561000	0.74099	GGG	.	.		0.612	TRMT2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318168.3	NM_022727	
ELFN2	114794	hgsc.bcm.edu	37	22	37771020	37771020	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr22:37771020G>T	ENST00000402918.2	-	3	1340	c.555C>A	c.(553-555)aaC>aaA	p.N185K	RP1-63G5.5_ENST00000430883.1_RNA|RP1-63G5.8_ENST00000609322.1_RNA|ELFN2_ENST00000435824.1_5'Flank	NM_052906.3	NP_443138.2	Q5R3F8	PPR29_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 2	185	LRRCT.				negative regulation of phosphatase activity (GO:0010923)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	35	Melanoma(58;0.0574)					AGTTGAAGGGGTTGCCGGCCA	0.632																																					p.N185K		Atlas-SNP	.											.	ELFN2	89	.	0			c.C555A						.						39.0	42.0	41.0					22																	37771020		2203	4299	6502	SO:0001583	missense	114794	exon3			GAAGGGGTTGCCG	BC041596	CCDS33642.1	22q13.1	2013-02-11	2011-10-27	2011-10-27	ENSG00000166897	ENSG00000166897		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	29396	protein-coding gene	gene with protein product			"""leucine rich repeat containing 62"", ""extracellular leucine-rich repeat and fibronectin type III containing 2"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 2"", ""protein phosphatase 1, regulatory subunit 29"""	LRRC62, PPP1R29		17868438	Standard	XR_244427		Approved	dJ63G5.3, KIAA1904	uc003asq.4	Q5R3F8	OTTHUMG00000150558	ENST00000402918.2:c.555C>A	chr22.hg19:g.37771020G>T	ENSP00000385277:p.Asn185Lys	181.0	0.0		118.0	43.0	NM_052906	Q96PY3	Missense_Mutation	SNP	ENST00000402918.2	hg19	CCDS33642.1	.	.	.	.	.	.	.	.	.	.	G	15.23	2.770414	0.49680	.	.	ENSG00000166897	ENST00000349653;ENST00000402918	T;T	0.66099	-0.19;-0.19	4.84	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	M	0.71206	2.165	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.78288	-0.2262	10	0.87932	D	0	-36.2791	11.7337	0.51752	0.1436:0.0:0.8564:0.0	.	185	Q5R3F8	PPR29_HUMAN	K	185	ENSP00000300147:N185K;ENSP00000385277:N185K	ENSP00000300147:N185K	N	-	3	2	ELFN2	36100966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.181000	0.50903	2.399000	0.81585	0.514000	0.50259	AAC	.	.		0.632	ELFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318900.2	NM_052906	
NOL12	79159	hgsc.bcm.edu	37	22	38082401	38082401	+	Start_Codon_SNP	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr22:38082401T>A	ENST00000359114.4	+	1	72	c.2T>A	c.(1-3)aTg>aAg	p.M1K	NOL12_ENST00000493862.1_Intron	NM_024313.2	NP_077289.1	Q9UGY1	NOL12_HUMAN	nucleolar protein 12	1						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	8	Melanoma(58;0.0574)					CTCACTGCTATGGGCCGCAAC	0.617																																					p.M1K		Atlas-SNP	.											.	NOL12	22	.	0			c.T2A						.						35.0	34.0	34.0					22																	38082401		2201	4292	6493	SO:0001582	initiator_codon_variant	79159	exon1			CTGCTATGGGCCG	Z83844	CCDS13955.1	22q13.1	2012-05-02			ENSG00000256872	ENSG00000273899			28585	protein-coding gene	gene with protein product						12477932	Standard	NM_024313		Approved	MGC3731, Nop25, RRP17	uc003atp.3	Q9UGY1	OTTHUMG00000150660	ENST00000359114.4:c.2T>A	chr22.hg19:g.38082401T>A	ENSP00000352021:p.Met1Lys	66.0	0.0		50.0	20.0	NM_024313		Missense_Mutation	SNP	ENST00000359114.4	hg19	CCDS13955.1	.	.	.	.	.	.	.	.	.	.	T	14.26	2.482666	0.44147	.	.	ENSG00000256872	ENST00000359114	.	.	.	5.11	5.11	0.69529	.	0.209202	0.53938	D	0.000044	T	0.76011	0.3928	.	.	.	0.80722	D	1	D	0.54601	0.967	D	0.63597	0.916	T	0.79011	-0.1977	8	0.72032	D	0.01	-29.4926	12.3913	0.55360	0.0:0.0:0.0:1.0	.	1	Q9UGY1	NOL12_HUMAN	K	1	.	ENSP00000352021:M1K	M	+	2	0	Z83844.2	36412347	1.000000	0.71417	0.993000	0.49108	0.009000	0.06853	2.537000	0.45702	2.143000	0.66587	0.533000	0.62120	ATG	.	.		0.617	NOL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319476.1	NM_024313	Missense_Mutation
MIEF1	54471	hgsc.bcm.edu	37	22	39909580	39909580	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr22:39909580G>T	ENST00000325301.2	+	6	1068	c.644G>T	c.(643-645)tGg>tTg	p.W215L	MIEF1_ENST00000404569.1_Missense_Mutation_p.W215L|MIEF1_ENST00000402881.1_Missense_Mutation_p.W215L	NM_019008.4	NP_061881.2	Q9NQG6	MID51_HUMAN	mitochondrial elongation factor 1	215					mitochondrial fission (GO:0000266)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|GDP binding (GO:0019003)|identical protein binding (GO:0042802)										CAGAACCTGTGGTCATGTATT	0.507																																					p.W215L		Atlas-SNP	.											.	SMCR7L	33	.	0			c.G644T						.						130.0	112.0	118.0					22																	39909580		2203	4300	6503	SO:0001583	missense	54471	exon6			ACCTGTGGTCATG	AL365515	CCDS13995.1	22q13.1	2013-09-23	2013-09-23	2013-09-23	ENSG00000100335	ENSG00000100335			25979	protein-coding gene	gene with protein product		615497	"""Smith-Magenis syndrome chromosome region, candidate 7-like"""	SMCR7L		21508961, 21701560	Standard	NM_019008		Approved	FLJ20232, MiD51	uc003axx.3	Q9NQG6	OTTHUMG00000151105	ENST00000325301.2:c.644G>T	chr22.hg19:g.39909580G>T	ENSP00000327124:p.Trp215Leu	112.0	0.0		72.0	29.0	NM_019008	Q7L890|Q9BUI3	Missense_Mutation	SNP	ENST00000325301.2	hg19	CCDS13995.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327002	0.81690	.	.	ENSG00000100335	ENST00000402881;ENST00000325301;ENST00000404569	T;T;T	0.07216	3.21;3.21;3.21	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.31734	0.0806	M	0.76574	2.34	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.87578	0.992;0.998	T	0.00148	-1.1989	10	0.31617	T	0.26	-18.1649	20.6439	0.99570	0.0:0.0:1.0:0.0	.	215;215	Q9NQG6;B0QY95	MID51_HUMAN;.	L	215	ENSP00000385110:W215L;ENSP00000327124:W215L;ENSP00000385191:W215L	ENSP00000327124:W215L	W	+	2	0	SMCR7L	38239526	1.000000	0.71417	1.000000	0.80357	0.629000	0.37895	9.858000	0.99539	2.884000	0.98904	0.655000	0.94253	TGG	.	.		0.507	MIEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321325.1	NM_019008	
CHADL	150356	hgsc.bcm.edu	37	22	41632548	41632548	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr22:41632548T>A	ENST00000216241.9	-	4	2055	c.2003A>T	c.(2002-2004)gAg>gTg	p.E668V		NM_138481.1	NP_612490.1	Q6NUI6	CHADL_HUMAN	chondroadherin-like	668						proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(1)|kidney(1)|skin(1)	4						GTCGATGAGCTCCAGCTGGCT	0.657																																					p.E668V		Atlas-SNP	.											.	CHADL	20	.	0			c.A2003T						.						29.0	37.0	34.0					22																	41632548		692	1591	2283	SO:0001583	missense	150356	exon4			ATGAGCTCCAGCT	BC012882	CCDS46715.1	22q13.2	2008-10-31			ENSG00000100399	ENSG00000100399			25165	protein-coding gene	gene with protein product						12477932	Standard	NM_138481		Approved	SLRR4B	uc003azq.4	Q6NUI6	OTTHUMG00000150936	ENST00000216241.9:c.2003A>T	chr22.hg19:g.41632548T>A	ENSP00000216241:p.Glu668Val	164.0	0.0		108.0	41.0	NM_138481	Q05CY2|Q4G0S0|Q5JY13|Q86XY1|Q96E60	Missense_Mutation	SNP	ENST00000216241.9	hg19	CCDS46715.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.489547	0.84962	.	.	ENSG00000100399	ENST00000216241;ENST00000455425	T;T	0.58210	0.35;0.35	5.19	4.15	0.48705	.	0.055475	0.64402	D	0.000001	T	0.60663	0.2286	L	0.37507	1.11	0.48632	D	0.999685	D	0.89917	1.0	D	0.83275	0.996	T	0.59156	-0.7507	10	0.46703	T	0.11	.	11.1098	0.48226	0.0:0.074:0.0:0.926	.	668	Q6NUI6	CHADL_HUMAN	V	668;165	ENSP00000216241:E668V;ENSP00000412359:E165V	ENSP00000216241:E668V	E	-	2	0	CHADL	39962494	1.000000	0.71417	0.860000	0.33809	0.975000	0.68041	5.520000	0.67080	0.921000	0.36994	0.529000	0.55759	GAG	.	.		0.657	CHADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320597.1	NM_138481	
AKAP17A	8227	hgsc.bcm.edu	37	X	1718233	1718233	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:1718233G>T	ENST00000313871.3	+	4	1256	c.1060G>T	c.(1060-1062)Gag>Tag	p.E354*	AKAP17A_ENST00000381261.3_Nonsense_Mutation_p.E354*	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	354					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GCAGCTGCAGGAGAAGATCAA	0.622																																					p.E354X		Atlas-SNP	.											.	AKAP17A	46	.	0			c.G1060T						.						79.0	83.0	82.0					X																	1718233		2203	4293	6496	SO:0001587	stop_gained	8227	exon4			CTGCAGGAGAAGA	L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1060G>T	chrX.hg19:g.1718233G>T	ENSP00000324827:p.Glu354*	178.0	0.0		65.0	40.0	NM_005088	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Nonsense_Mutation	SNP	ENST00000313871.3	hg19	CCDS14116.1	.	.	.	.	.	.	.	.	.	.	g	18.51	3.639024	0.67130	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	.	.	.	1.74	1.74	0.24563	.	0.238718	0.34580	U	0.003859	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	.	11.9908	0.53173	0.0:0.0:1.0:0.0	.	.	.	.	X	354	.	ENSP00000324827:E354X	E	+	1	0	AKAP17A	1678233	1.000000	0.71417	0.002000	0.10522	0.459000	0.32528	1.708000	0.37899	0.657000	0.30906	0.100000	0.15512	GAG	.	.		0.622	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055609.2	NM_005088	
ARX	170302	hgsc.bcm.edu	37	X	25033712	25033712	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:25033712T>A	ENST00000379044.4	-	1	353	c.143A>T	c.(142-144)cAg>cTg	p.Q48L		NM_139058.2	NP_620689.1	Q96QS3	ARX_HUMAN	aristaless related homeobox	48					axon guidance (GO:0007411)|cell proliferation in forebrain (GO:0021846)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex tangential migration (GO:0021800)|embryonic olfactory bulb interneuron precursor migration (GO:0021831)|epithelial cell fate commitment (GO:0072148)|globus pallidus development (GO:0021759)|lipid digestion (GO:0044241)|positive regulation of organ growth (GO:0046622)|regulation of cell proliferation (GO:0042127)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			kidney(1)|large_intestine(2)|lung(1)	4						AGGCAAGCTCTGCGCGGCTCC	0.602																																					p.Q48L		Atlas-SNP	.											.	ARX	19	.	0			c.A143T						.						32.0	28.0	30.0					X																	25033712		2201	4299	6500	SO:0001583	missense	170302	exon1			AAGCTCTGCGCGG	AY038071	CCDS14215.1	Xp21.3	2011-06-20			ENSG00000004848	ENSG00000004848		"""Homeoboxes / PRD class"""	18060	protein-coding gene	gene with protein product	"""cancer/testis antigen 121"""	300382	"""mental retardation, X-linked 54"", ""mental retardation, X-linked 43"", ""mental retardation, X-linked 36"", ""mental retardation, X-linked 29"", ""mental retardation, X-linked 32"", ""mental retardation, X-linked 33"", ""mental retardation, X-linked 38"", ""mental retardation, X-linked 87"", ""mental retardation, X-linked 76"""	MRXS1, PRTS, MRX76, MRX54, MRX43, MRX36, MRX29, MRX32, MRX33, MRX38, MRX87		11889467, 15850492, 17480217	Standard	NM_139058		Approved	ISSX, CT121, EIEE1	uc004dbp.4	Q96QS3	OTTHUMG00000021275	ENST00000379044.4:c.143A>T	chrX.hg19:g.25033712T>A	ENSP00000368332:p.Gln48Leu	132.0	0.0		48.0	40.0	NM_139058		Missense_Mutation	SNP	ENST00000379044.4	hg19	CCDS14215.1	.	.	.	.	.	.	.	.	.	.	T	17.16	3.317523	0.60524	.	.	ENSG00000004848	ENST00000379044	D	0.89552	-2.53	4.9	3.7	0.42460	.	0.000000	0.64402	U	0.000001	D	0.84995	0.5596	L	0.58101	1.795	0.42529	D	0.99303	P	0.38922	0.651	B	0.35859	0.212	T	0.83127	-0.0115	10	0.72032	D	0.01	.	9.4992	0.39006	0.0:0.0:0.335:0.6649	.	48	Q96QS3	ARX_HUMAN	L	48	ENSP00000368332:Q48L	ENSP00000368332:Q48L	Q	-	2	0	ARX	24943633	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.555000	0.45854	0.668000	0.31126	0.486000	0.48141	CAG	.	.		0.602	ARX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056109.1		
ERCC6L	54821	hgsc.bcm.edu	37	X	71425152	71425152	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:71425152G>T	ENST00000334463.3	-	2	3600	c.3465C>A	c.(3463-3465)aaC>aaA	p.N1155K	ERCC6L_ENST00000373657.1_Missense_Mutation_p.N1032K|PIN4_ENST00000423432.2_Intron	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	1155					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					AGCTGGACTTGTTTTCTGAAG	0.498																																					p.N1155K		Atlas-SNP	.											.	ERCC6L	98	.	0			c.C3465A						.						97.0	88.0	91.0					X																	71425152		2203	4300	6503	SO:0001583	missense	54821	exon2			GGACTTGTTTTCT	AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.3465C>A	chrX.hg19:g.71425152G>T	ENSP00000334675:p.Asn1155Lys	59.0	0.0		49.0	39.0	NM_017669	Q8NCI1|Q96H93|Q9NXQ8	Missense_Mutation	SNP	ENST00000334463.3	hg19	CCDS35329.1	.	.	.	.	.	.	.	.	.	.	G	10.40	1.340716	0.24339	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	D;D	0.90676	-2.68;-2.71	5.58	-1.91	0.07641	.	.	.	.	.	T	0.80232	0.4585	L	0.31294	0.92	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.64588	-0.6372	9	0.39692	T	0.17	-1.8011	1.5871	0.02646	0.292:0.2532:0.3272:0.1277	.	1155	Q2NKX8	ERC6L_HUMAN	K	1032;1155	ENSP00000362761:N1032K;ENSP00000334675:N1155K	ENSP00000334675:N1155K	N	-	3	2	ERCC6L	71341877	0.000000	0.05858	0.001000	0.08648	0.058000	0.15608	-0.286000	0.08399	-0.170000	0.10816	0.600000	0.82982	AAC	.	.		0.498	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057174.2	NM_017669	
BRWD3	254065	hgsc.bcm.edu	37	X	79989645	79989645	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:79989645T>A	ENST00000373275.4	-	11	1274	c.1058A>T	c.(1057-1059)gAg>gTg	p.E353V		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	353					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AGCAATTTTCTCAGGAACCTC	0.323																																					p.E353V		Atlas-SNP	.											.	BRWD3	251	.	0			c.A1058T						.						116.0	109.0	112.0					X																	79989645		2203	4298	6501	SO:0001583	missense	254065	exon11			ATTTTCTCAGGAA		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1058A>T	chrX.hg19:g.79989645T>A	ENSP00000362372:p.Glu353Val	81.0	0.0		63.0	6.0	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	ENST00000373275.4	hg19	CCDS14447.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.210659	0.79240	.	.	ENSG00000165288	ENST00000373275	T	0.18960	2.18	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.167651	0.53938	D	0.000058	T	0.28830	0.0715	L	0.41710	1.295	0.36637	D	0.876605	P	0.40282	0.711	P	0.49953	0.627	T	0.16958	-1.0385	9	.	.	.	-8.1349	14.3934	0.66996	0.0:0.0:0.0:1.0	.	353	Q6RI45	BRWD3_HUMAN	V	353	ENSP00000362372:E353V	.	E	-	2	0	BRWD3	79876301	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.610000	0.61155	1.976000	0.57569	0.441000	0.28932	GAG	.	.		0.323	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
CYLC1	1538	hgsc.bcm.edu	37	X	83126557	83126557	+	Silent	SNP	G	G	A			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:83126557G>A	ENST00000329312.4	+	3	193	c.156G>A	c.(154-156)ttG>ttA	p.L52L		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	52					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						CAAGACCTTTGAAATCACAAA	0.299																																					p.L52L		Atlas-SNP	.											.	CYLC1	272	.	0			c.G156A						.						61.0	56.0	58.0					X																	83126557		2203	4297	6500	SO:0001819	synonymous_variant	1538	exon3			ACCTTTGAAATCA	Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.156G>A	chrX.hg19:g.83126557G>A		99.0	0.0		58.0	35.0	NM_021118	A0AVQ8|Q5JQQ9	Silent	SNP	ENST00000329312.4	hg19	CCDS35341.1																																																																																			.	.		0.299	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057371.1	NM_021118	
SAGE1	55511	hgsc.bcm.edu	37	X	134994077	134994077	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chrX:134994077A>T	ENST00000370709.3	+	17	2486	c.2486A>T	c.(2485-2487)tAt>tTt	p.Y829F	SAGE1_ENST00000537770.1_Missense_Mutation_p.Y453F|SAGE1_ENST00000535938.1_Missense_Mutation_p.Y829F|SAGE1_ENST00000324447.3_Missense_Mutation_p.Y829F			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	829						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GATATAAAATATCAATTAATG	0.358																																					p.Y829F		Atlas-SNP	.											.	SAGE1	160	.	0			c.A2486T						.						42.0	43.0	43.0					X																	134994077		2203	4297	6500	SO:0001583	missense	55511	exon18			TAAAATATCAATT	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2486A>T	chrX.hg19:g.134994077A>T	ENSP00000359743:p.Tyr829Phe	55.0	0.0		37.0	31.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	hg19	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	A	10.73	1.433633	0.25813	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.30448	1.53;1.53;1.56;1.53	2.43	0.972	0.19704	.	0.641883	0.15518	N	0.258210	T	0.18341	0.0440	L	0.46157	1.445	0.09310	N	1	P;B	0.35982	0.531;0.005	B;B	0.32289	0.143;0.002	T	0.12293	-1.0553	10	0.10902	T	0.67	.	5.1531	0.15021	0.414:0.0:0.0:0.586	.	453;829	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	F	829;829;453;829	ENSP00000323191:Y829F;ENSP00000445959:Y829F;ENSP00000438276:Y453F;ENSP00000359743:Y829F	ENSP00000323191:Y829F	Y	+	2	0	SAGE1	134821743	0.000000	0.05858	0.006000	0.13384	0.797000	0.45037	0.352000	0.20113	0.934000	0.37316	0.150000	0.16122	TAT	.	.		0.358	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
LRRK1	79705	hgsc.bcm.edu	37	15	101606245	101606246	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr15:101606245_101606246delGT	ENST00000388948.3	+	32	5962_5963	c.5603_5604delGT	c.(5602-5604)agtfs	p.S1868fs	RP11-505E24.2_ENST00000559857.1_RNA|LRRK1_ENST00000284395.5_Frame_Shift_Del_p.S1865fs|LRRK1_ENST00000532145.1_3'UTR	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			AGTTCTTCCAGTGTGCCTTTCT	0.624																																					p.1868_1868del		Atlas-Indel,Pindel	.											.	LRRK1	310	.	0			c.5602_5603del						.																																			SO:0001589	frameshift_variant	79705	exon32			.	AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.5603_5604delGT	chr15.hg19:g.101606247_101606248delGT	ENSP00000373600:p.Ser1868fs	104.0	0.0		70.0	57.0	NM_024652		Frame_Shift_Del	DEL	ENST00000388948.3	hg19	CCDS42086.1																																																																																			.	.		0.624	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384567.2	NM_024652	
P4HA1	5033	hgsc.bcm.edu	37	10	74803644	74803660	+	Intron	DEL	CCTCTTAGATACTCTGT	CCTCTTAGATACTCTGT	-	rs200350484|rs1130892		TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	CCTCTTAGATACTCTGT	CCTCTTAGATACTCTGT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr10:74803644_74803660delCCTCTTAGATACTCTGT	ENST00000307116.2	-	9	1265				P4HA1_ENST00000412021.2_Intron|P4HA1_ENST00000373008.2_Splice_Site_p.YRVSKR378fs|P4HA1_ENST00000263556.3_Splice_Site_p.YRVSKR378fs|P4HA1_ENST00000440381.1_Splice_Site_p.YRVSKR378fs|P4HA1_ENST00000394890.2_Intron			P13674	P4HA1_HUMAN	prolyl 4-hydroxylase, alpha polypeptide I						collagen fibril organization (GO:0030199)|peptidyl-proline hydroxylation to 4-hydroxy-L-proline (GO:0018401)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|procollagen-proline 4-dioxygenase complex (GO:0016222)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15	Prostate(51;0.0198)				Hydralazine(DB01275)|L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	TACTCCCTTACCTCTTAGATACTCTGTACTGTGCTGT	0.406																																					p.378_383del	Colon(147;367 2405 2662 52127)	Atlas-Indel,Pindel	.											.	P4HA1	86	.	0			c.1134_1148del						.																																			SO:0001627	intron_variant	5033	exon9			.		CCDS7320.1, CCDS41537.1, CCDS44432.1	10q21.3-q23.1	2008-12-09	2008-12-09		ENSG00000122884	ENSG00000122884	1.14.11.2		8546	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(I)"""	176710	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide I"""	P4HA		2556027	Standard	NM_001017962		Approved	C-P4Halpha(I)	uc001jtg.3	P13674	OTTHUMG00000018449	ENST00000307116.2:c.1148+1078ACAGAGTATCTAAGAGG>-	chr10.hg19:g.74803644_74803660delCCTCTTAGATACTCTGT		76.0	0.0		24.0	13.0	NM_001142596	C9JL12|Q15082|Q15083|Q5VSQ5	In_Frame_Del	DEL	ENST00000307116.2	hg19																																																																																				.	.		0.406	P4HA1-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000048601.1	NM_000917	
BAI3	577	hgsc.bcm.edu	37	6	70040467	70040467	+	Intron	DEL	A	A	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr6:70040467delA	ENST00000370598.1	+	23	3923				BAI3_ENST00000546190.1_5'Flank|BAI3_ENST00000238918.8_Intron	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3						G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTGTCCTGGTAAACATCAAAA	0.358																																					.		Atlas-INDEL	.											.	BAI3	451	.	0			c.3102+2A>-						.						78.0	72.0	74.0					6																	70040467		2203	4300	6503	SO:0001627	intron_variant	577	exon23			.	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3102+3A>-	chr6.hg19:g.70040467delA		42.0	0.0		40.0	14.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Splice_Site	DEL	ENST00000370598.1	hg19	CCDS4968.1																																																																																			.	.		0.358	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
NME6	10201	hgsc.bcm.edu	37	3	48339972	48339972	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:48339972delT	ENST00000452211.1	-	3	272	c.35delA	c.(34-36)cagfs	p.Q12fs	NME6_ENST00000444069.1_Intron|NME6_ENST00000450160.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000415644.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000415053.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000451657.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000426723.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000442597.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000426689.2_Frame_Shift_Del_p.Q12fs|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000435684.1_Frame_Shift_Del_p.Q12fs|NME6_ENST00000421967.1_Frame_Shift_Del_p.Q20fs|NME6_ENST00000447314.1_Intron			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	12					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		TAGAGTGAGCTGGAGAGCCTG	0.542																																					p.Q20fs		Atlas-Indel,Pindel	.											.	NME6	14	.	0			c.60delG						.						106.0	87.0	93.0					3																	48339972		2203	4300	6503	SO:0001589	frameshift_variant	10201	exon2			.	AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.35delA	chr3.hg19:g.48339972delT	ENSP00000392352:p.Gln12fs	109.0	0.0		97.0	27.0	NM_005793	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Frame_Shift_Del	DEL	ENST00000452211.1	hg19																																																																																				.	.		0.542	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000346107.1	NM_005793	
IPO7	10527	hgsc.bcm.edu	37	11	9462080	9462080	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr11:9462080delA	ENST00000379719.3	+	23	2916	c.2774delA	c.(2773-2775)gaafs	p.E925fs		NM_006391.2	NP_006382.1	O95373	IPO7_HUMAN	importin 7	925	Asp-rich.				innate immune response (GO:0045087)|protein import into nucleus (GO:0006606)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)|small GTPase regulator activity (GO:0005083)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				all cancers(16;8.29e-09)|Epithelial(150;4.76e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0217)		CAGGCTGGTGAAGATGGAGAT	0.418																																					p.E925fs		Atlas-Indel,Pindel	.											.	IPO7	72	.	0			c.2773delG						.						120.0	111.0	114.0					11																	9462080		2201	4294	6495	SO:0001589	frameshift_variant	10527	exon23			.	AF098799	CCDS31425.1	11p15.3	2010-12-02	2003-03-11	2003-03-14	ENSG00000205339	ENSG00000205339		"""Importins"""	9852	protein-coding gene	gene with protein product		605586	"""RAN binding protein 7"""	RANBP7		9214382	Standard	NM_006391		Approved	Imp7	uc001mho.3	O95373	OTTHUMG00000165753	ENST00000379719.3:c.2774delA	chr11.hg19:g.9462080delA	ENSP00000369042:p.Glu925fs	137.0	0.0		152.0	48.0	NM_006391	A6NNM5|B2R786|Q1RMF7|Q9H177|Q9NTE3	Frame_Shift_Del	DEL	ENST00000379719.3	hg19	CCDS31425.1																																																																																			.	.		0.418	IPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386022.1	NM_006391	
SCN11A	11280	hgsc.bcm.edu	37	3	38951586	38951586	+	Frame_Shift_Del	DEL	G	G	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:38951586delG	ENST00000302328.3	-	8	1270	c.1072delC	c.(1072-1074)caafs	p.Q358fs	SCN11A_ENST00000456224.3_Frame_Shift_Del_p.Q358fs|SCN11A_ENST00000450244.1_Frame_Shift_Del_p.Q358fs|AC116038.1_ENST00000401122.1_RNA|SCN11A_ENST00000444237.2_Frame_Shift_Del_p.Q358fs	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	358					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAGGAATCTTGGGTCATCAGC	0.398																																					p.Q358fs		Atlas-Indel,Pindel	.											.	SCN11A	296	.	0			c.1073delA						.						80.0	74.0	76.0					3																	38951586		2203	4300	6503	SO:0001589	frameshift_variant	11280	exon8			.	AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.1072delC	chr3.hg19:g.38951586delG	ENSP00000307599:p.Gln358fs	59.0	0.0		94.0	23.0	NM_014139	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Frame_Shift_Del	DEL	ENST00000302328.3	hg19	CCDS33737.1																																																																																			.	.		0.398	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109746.4	NM_014139	
FBLN2	2199	hgsc.bcm.edu	37	3	13670764	13670765	+	Frame_Shift_Del	DEL	GC	GC	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	GC	GC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:13670764_13670765delGC	ENST00000295760.7	+	12	2742_2743	c.2673_2674delGC	c.(2671-2676)cagcggfs	p.R892fs	FBLN2_ENST00000404922.3_Frame_Shift_Del_p.R939fs|FBLN2_ENST00000492059.1_Frame_Shift_Del_p.R939fs|FBLN2_ENST00000535798.1_Frame_Shift_Del_p.R918fs	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	892	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CCGGCTTTCAGCGGGATGCCTT	0.649																																					p.938_938del		Atlas-INDEL	.											.	FBLN2	137	.	0			c.2813_2814del						.																																			SO:0001589	frameshift_variant	2199	exon13			.	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2673_2674delGC	chr3.hg19:g.13670764_13670765delGC	ENSP00000295760:p.Arg892fs	108.0	0.0		106.0	54.0	NM_001165035	B7Z9C5|Q8IUI0|Q8IUI1	Frame_Shift_Del	DEL	ENST00000295760.7	hg19	CCDS46762.1																																																																																			.	.		0.649	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
FBLN2	2199	hgsc.bcm.edu	37	3	13670765	13670766	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-CC-A5UD-01A-11D-A28X-10	TCGA-CC-A5UD-10A-01D-A28X-10	CG	CG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	6b1d8861-8326-40ac-b595-5862822407d8	c0bd90d9-4ca2-40af-af50-d23f00558550	g.chr3:13670765_13670766delCG	ENST00000295760.7	+	12	2743_2744	c.2674_2675delCG	c.(2674-2676)cggfs	p.R892fs	FBLN2_ENST00000404922.3_Frame_Shift_Del_p.R939fs|FBLN2_ENST00000492059.1_Frame_Shift_Del_p.R939fs|FBLN2_ENST00000535798.1_Frame_Shift_Del_p.R918fs	NM_001998.2	NP_001989.2	P98095	FBLN2_HUMAN	fibulin 2	892	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(3)|prostate(3)|urinary_tract(1)	24			UCEC - Uterine corpus endometrioid carcinoma (1;0.00416)			CGGCTTTCAGCGGGATGCCTTT	0.653																																					p.938_939del		Pindel	.											.	FBLN2	137	.	0			c.2814_2815del						.																																			SO:0001589	frameshift_variant	2199	exon13			.	X82494	CCDS46761.1, CCDS46762.1	3p25-p24	2010-06-15			ENSG00000163520	ENSG00000163520		"""Fibulins"""	3601	protein-coding gene	gene with protein product		135821				7806230	Standard	NM_001165035		Approved		uc011ava.2	P98095	OTTHUMG00000155437	ENST00000295760.7:c.2674_2675delCG	chr3.hg19:g.13670765_13670766delCG	ENSP00000295760:p.Arg892fs	109.0	0.0		105.0	31.0	NM_001165035	B7Z9C5|Q8IUI0|Q8IUI1	Frame_Shift_Del	DEL	ENST00000295760.7	hg19	CCDS46762.1																																																																																			.	.		0.653	FBLN2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000340083.3	NM_001004019	
