#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
EFHD2	79180	hgsc.bcm.edu	37	1	15753664	15753664	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:15753664A>G	ENST00000375980.4	+	3	552	c.475A>G	c.(475-477)Aag>Gag	p.K159E		NM_024329.5	NP_077305.2	Q96C19	EFHD2_HUMAN	EF-hand domain family, member D2	159	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					membrane (GO:0016020)	calcium ion binding (GO:0005509)			large_intestine(1)|skin(1)	2		Renal(390;0.00145)|Breast(348;0.00173)|Colorectal(325;0.00215)|all_lung(284;0.00366)|Lung NSC(340;0.00395)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)|Hepatocellular(190;0.152)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.59e-07)|COAD - Colon adenocarcinoma(227;3.79e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000119)|KIRC - Kidney renal clear cell carcinoma(229;0.00251)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		GATCTTCCGCAAGGCGGCGGC	0.701																																					p.K159E		Atlas-SNP	.											.	EFHD2	10	.	0			c.A475G						.						17.0	19.0	18.0					1																	15753664		2202	4299	6501	SO:0001583	missense	79180	exon3			TTCCGCAAGGCGG	BC014923	CCDS155.1	1p36	2014-07-01	2005-01-25		ENSG00000142634	ENSG00000142634		"""EF-hand domain containing"""	28670	protein-coding gene	gene with protein product	"""swiprosin-1"""		"""EF hand domain containing 2"""			21244694	Standard	NM_024329		Approved	MGC4342	uc001awh.2	Q96C19	OTTHUMG00000002254	ENST00000375980.4:c.475A>G	chr1.hg19:g.15753664A>G	ENSP00000365147:p.Lys159Glu	131.0	0.0		67.0	30.0	NM_024329	Q5JYW9	Missense_Mutation	SNP	ENST00000375980.4	hg19	CCDS155.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.20|18.20	3.571326|3.571326	0.65765|0.65765	.|.	.|.	ENSG00000142634|ENSG00000142634	ENST00000375980;ENST00000375975|ENST00000445566	T|.	0.46063|.	0.88|.	4.07|4.07	4.07|4.07	0.47477|0.47477	EF-hand-like domain (1);|.	0.000000|.	0.85682|.	U|.	0.000000|.	T|T	0.76456|0.76456	0.3990|0.3990	M|M	0.84948|0.84948	2.725|2.725	0.58432|0.58432	D|D	0.999991|0.999991	D|.	0.58620|.	0.983|.	P|.	0.58721|.	0.844|.	T|T	0.79562|0.79562	-0.1752|-0.1752	10|5	0.54805|.	T|.	0.06|.	-37.7629|-37.7629	12.5858|12.5858	0.56416|0.56416	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	159|.	Q96C19|.	EFHD2_HUMAN|.	E|R	159;60|61	ENSP00000365147:K159E|.	ENSP00000365142:K60E|.	K|Q	+|+	1|2	0|0	EFHD2|EFHD2	15626251|15626251	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.617000|0.617000	0.37484|0.37484	7.280000|7.280000	0.78610|0.78610	1.795000|1.795000	0.52594|0.52594	0.459000|0.459000	0.35465|0.35465	AAG|CAA	.	.		0.701	EFHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006433.1	NM_024329	
ZMYM1	79830	hgsc.bcm.edu	37	1	35578710	35578710	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:35578710A>G	ENST00000373330.1	+	11	1453	c.1279A>G	c.(1279-1281)Aat>Gat	p.N427D	ZMYM1_ENST00000373329.1_3'UTR|ZMYM1_ENST00000359858.4_Missense_Mutation_p.N427D			Q5SVZ6	ZMYM1_HUMAN	zinc finger, MYM-type 1	427						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(8)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				ACAAAAAGACAATATGAAATC	0.348																																					p.N427D		Atlas-SNP	.											.	ZMYM1	86	.	0			c.A1279G						.						66.0	62.0	63.0					1																	35578710		1873	4120	5993	SO:0001583	missense	79830	exon10			AAAGACAATATGA	AK096206	CCDS41302.1	1p34.3	2008-05-02	2005-09-12		ENSG00000197056	ENSG00000197056		"""Zinc fingers, MYM type"""	26253	protein-coding gene	gene with protein product			"""zinc finger, MYM domain containing 1"""			12477932	Standard	XM_005271216		Approved	FLJ23151, MYM	uc001bym.3	Q5SVZ6	OTTHUMG00000004374	ENST00000373330.1:c.1279A>G	chr1.hg19:g.35578710A>G	ENSP00000362427:p.Asn427Asp	238.0	0.0		144.0	31.0	NM_024772	D3DPR7|Q7Z3Q4	Missense_Mutation	SNP	ENST00000373330.1	hg19	CCDS41302.1	.	.	.	.	.	.	.	.	.	.	A	9.135	1.012458	0.19277	.	.	ENSG00000197056	ENST00000417119;ENST00000359858;ENST00000373329;ENST00000373330	T;T;T;T	0.17528	2.27;2.55;2.29;2.55	4.52	3.39	0.38822	.	1.320380	0.04926	N	0.455904	T	0.14830	0.0358	L	0.44542	1.39	0.09310	N	1	B;B	0.26002	0.083;0.139	B;B	0.19946	0.027;0.027	T	0.35574	-0.9783	10	0.12103	T	0.63	-6.1605	6.8918	0.24234	0.8971:0.0:0.1029:0.0	.	408;427	B4DSJ9;Q5SVZ6	.;ZMYM1_HUMAN	D	427;427;352;427	ENSP00000394233:N427D;ENSP00000352920:N427D;ENSP00000362426:N352D;ENSP00000362427:N427D	ENSP00000352920:N427D	N	+	1	0	ZMYM1	35351297	0.000000	0.05858	0.002000	0.10522	0.340000	0.28889	-0.403000	0.07214	1.061000	0.40601	0.482000	0.46254	AAT	.	.		0.348	ZMYM1-001	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012705.1	NM_024772	
CFAP57	149465	hgsc.bcm.edu	37	1	43637963	43637963	+	5'UTR	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:43637963A>G	ENST00000372492.4	+	0	144				EBNA1BP2_ENST00000431635.2_Silent_p.L44L|WDR65_ENST00000528956.1_5'Flank|EBNA1BP2_ENST00000472982.1_5'Flank|EBNA1BP2_ENST00000236051.2_5'Flank	NM_001195831.2	NP_001182760.2	Q96MR6	WDR65_HUMAN												NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				CTACTGCTCAACTTTTGATTG	0.602																																					p.L44L		Atlas-SNP	.											.	EBNA1BP2	37	.	0			c.T130C						.						63.0	61.0	61.0					1																	43637963		692	1591	2283	SO:0001623	5_prime_UTR_variant	10969	exon1			TGCTCAACTTTTG																												ENST00000372492.4:c.-181A>G	chr1.hg19:g.43637963A>G		93.0	0.0		49.0	13.0	NM_001159936	A6NKQ3|Q17RI9|Q5TAI0	Silent	SNP	ENST00000372492.4	hg19																																																																																				.	.		0.602	WDR65-002	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000384325.1		
IL12RB2	3595	hgsc.bcm.edu	37	1	67833704	67833704	+	Silent	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:67833704T>C	ENST00000262345.1	+	10	2095	c.1455T>C	c.(1453-1455)atT>atC	p.I485I	IL12RB2_ENST00000371000.1_Silent_p.I485I|IL12RB2_ENST00000544434.1_Silent_p.I485I|IL12RB2_ENST00000541374.1_Silent_p.I485I	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	485	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						CTGCTCTGATTTCAGGTACCT	0.498																																					p.I485I		Atlas-SNP	.											.	IL12RB2	94	.	0			c.T1455C						.						142.0	123.0	129.0					1																	67833704		2203	4300	6503	SO:0001819	synonymous_variant	3595	exon10			TCTGATTTCAGGT	U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.1455T>C	chr1.hg19:g.67833704T>C		53.0	0.0		47.0	6.0	NM_001559	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Silent	SNP	ENST00000262345.1	hg19	CCDS638.1																																																																																			.	.		0.498	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025202.2	NM_001559	
MAN1A2	10905	hgsc.bcm.edu	37	1	117944848	117944848	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:117944848C>T	ENST00000356554.3	+	2	1078	c.343C>T	c.(343-345)Cat>Tat	p.H115Y	MAN1A2_ENST00000482811.1_Intron	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	115					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		TCGAGCTGATCATGAGAAGGC	0.363																																					p.H115Y	Ovarian(33;199 881 8228 13687 31538)	Atlas-SNP	.											.	MAN1A2	50	.	0			c.C343T						.						64.0	68.0	67.0					1																	117944848		2203	4300	6503	SO:0001583	missense	10905	exon2			GCTGATCATGAGA	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.343C>T	chr1.hg19:g.117944848C>T	ENSP00000348959:p.His115Tyr	186.0	0.0		122.0	27.0	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	hg19	CCDS895.1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.421808	0.25639	.	.	ENSG00000198162	ENST00000356554	D	0.83163	-1.69	5.67	5.67	0.87782	.	0.105494	0.64402	D	0.000004	T	0.68705	0.3030	M	0.65975	2.015	0.80722	D	1	B	0.06786	0.001	B	0.08055	0.003	T	0.67730	-0.5595	10	0.02654	T	1	-9.1071	17.2449	0.87025	0.0:1.0:0.0:0.0	.	115	O60476	MA1A2_HUMAN	Y	115	ENSP00000348959:H115Y	ENSP00000348959:H115Y	H	+	1	0	MAN1A2	117746371	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.364000	0.79526	2.669000	0.90835	0.591000	0.81541	CAT	.	.		0.363	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
RCSD1	92241	hgsc.bcm.edu	37	1	167666394	167666394	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:167666394A>C	ENST00000367854.3	+	6	864	c.533A>C	c.(532-534)cAg>cCg	p.Q178P	RCSD1_ENST00000537350.1_Missense_Mutation_p.Q148P	NM_052862.3	NP_443094.3	Q6JBY9	CPZIP_HUMAN	RCSD domain containing 1	178					cellular hyperosmotic response (GO:0071474)|skeletal muscle contraction (GO:0003009)	actin filament (GO:0005884)	actin filament binding (GO:0051015)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	24	all_hematologic(923;0.215)					CGAAGGTCACAGTCAGACTGT	0.502																																					p.Q178P		Atlas-SNP	.											.	RCSD1	64	.	0			c.A533C						.						77.0	75.0	75.0					1																	167666394		2203	4300	6503	SO:0001583	missense	92241	exon6			GGTCACAGTCAGA	BC072399	CCDS1263.1	1q24.2	2008-02-05			ENSG00000198771	ENSG00000198771			28310	protein-coding gene	gene with protein product		610579				12477932	Standard	NM_052862		Approved	MK2S4, MGC21854	uc001gem.3	Q6JBY9	OTTHUMG00000035318	ENST00000367854.3:c.533A>C	chr1.hg19:g.167666394A>C	ENSP00000356828:p.Gln178Pro	167.0	0.0		167.0	12.0	NM_052862	B1AK48|Q4G0E7|Q6IN93|Q8IZM2|Q96DX0|Q9NST4	Missense_Mutation	SNP	ENST00000367854.3	hg19	CCDS1263.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.265292	0.59431	.	.	ENSG00000198771	ENST00000367854;ENST00000361496;ENST00000537350	T;T	0.50548	0.75;0.74	5.44	5.44	0.79542	.	0.203521	0.39274	N	0.001401	T	0.49389	0.1554	L	0.54323	1.7	0.34477	D	0.703451	D;D	0.76494	0.998;0.999	D;D	0.80764	0.986;0.994	T	0.53954	-0.8365	9	0.33940	T	0.23	-28.3369	10.0869	0.42423	0.8407:0.0:0.0:0.1593	.	148;178	B7ZKW8;Q6JBY9	.;CPZIP_HUMAN	P	178;154;148	ENSP00000356828:Q178P;ENSP00000439409:Q148P	ENSP00000355291:Q154P	Q	+	2	0	RCSD1	165933018	1.000000	0.71417	0.993000	0.49108	0.662000	0.39071	3.667000	0.54547	2.051000	0.60960	0.477000	0.44152	CAG	.	.		0.502	RCSD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085451.1	NM_052862	
USH2A	7399	hgsc.bcm.edu	37	1	216040477	216040477	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:216040477T>C	ENST00000307340.3	-	44	9103	c.8717A>G	c.(8716-8718)aAc>aGc	p.N2906S	USH2A_ENST00000366943.2_Missense_Mutation_p.N2906S	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2906	Fibronectin type-III 15. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		ACCCACACTGTTGTGTACGAA	0.378										HNSCC(13;0.011)																											p.N2906S		Atlas-SNP	.											.	USH2A	1168	.	0			c.A8717G						.						102.0	91.0	95.0					1																	216040477		2203	4300	6503	SO:0001583	missense	7399	exon44			ACACTGTTGTGTA	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8717A>G	chr1.hg19:g.216040477T>C	ENSP00000305941:p.Asn2906Ser	129.0	0.0		134.0	57.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944807	0.73672	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.61392	0.11;0.11	5.72	5.72	0.89469	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.000000	0.47093	D	0.000257	T	0.77329	0.4114	M	0.80746	2.51	0.45087	D	0.998104	D	0.89917	1.0	D	0.87578	0.998	T	0.79085	-0.1948	10	0.49607	T	0.09	.	15.9962	0.80250	0.0:0.0:0.0:1.0	.	2906	O75445	USH2A_HUMAN	S	2906	ENSP00000305941:N2906S;ENSP00000355910:N2906S	ENSP00000305941:N2906S	N	-	2	0	USH2A	214107100	1.000000	0.71417	0.998000	0.56505	0.773000	0.43773	4.225000	0.58600	2.188000	0.69820	0.455000	0.32223	AAC	.	.		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
TRIM58	25893	hgsc.bcm.edu	37	1	248024000	248024000	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:248024000A>G	ENST00000366481.3	+	2	550	c.502A>G	c.(502-504)Act>Gct	p.T168A		NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	168						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GGGGAAAAAGACTGTCATTTG	0.478																																					p.T168A		Atlas-SNP	.											.	TRIM58	143	.	0			c.A502G						.						106.0	106.0	106.0					1																	248024000		2203	4300	6503	SO:0001583	missense	25893	exon2			AAAAAGACTGTCA	AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.502A>G	chr1.hg19:g.248024000A>G	ENSP00000355437:p.Thr168Ala	163.0	0.0		140.0	67.0	NM_015431	Q6B0H9	Missense_Mutation	SNP	ENST00000366481.3	hg19	CCDS1636.1	.	.	.	.	.	.	.	.	.	.	A	0.802	-0.755082	0.03019	.	.	ENSG00000162722	ENST00000366481	T	0.04551	3.6	4.02	4.02	0.46733	.	0.250410	0.28109	N	0.016580	T	0.05135	0.0137	L	0.43757	1.38	0.09310	N	1	B	0.21688	0.059	B	0.20184	0.028	T	0.30563	-0.9974	10	0.30854	T	0.27	.	9.5646	0.39391	1.0:0.0:0.0:0.0	.	168	Q8NG06	TRI58_HUMAN	A	168	ENSP00000355437:T168A	ENSP00000355437:T168A	T	+	1	0	TRIM58	246090623	0.922000	0.31269	0.117000	0.21633	0.018000	0.09664	1.997000	0.40786	1.814000	0.52955	0.533000	0.62120	ACT	.	.		0.478	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096860.1	NM_015431	
OR14I1	401994	hgsc.bcm.edu	37	1	248844793	248844793	+	Silent	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:248844793C>A	ENST00000342623.3	-	1	836	c.813G>T	c.(811-813)gtG>gtT	p.V271V		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	271						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						TCAGAGCAATCACTAAATCCT	0.448																																					p.V271V		Atlas-SNP	.											.	OR14I1	64	.	0			c.G813T						.						117.0	108.0	111.0					1																	248844793		2203	4300	6503	SO:0001819	synonymous_variant	401994	exon1			AGCAATCACTAAA		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.813G>T	chr1.hg19:g.248844793C>A		64.0	0.0		65.0	14.0	NM_001004734		Silent	SNP	ENST00000342623.3	hg19	CCDS31125.1																																																																																			.	.		0.448	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734	
FAM179A	165186	hgsc.bcm.edu	37	2	29259514	29259514	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr2:29259514C>A	ENST00000379558.4	+	18	2877	c.2526C>A	c.(2524-2526)caC>caA	p.H842Q	FAM179A_ENST00000465300.1_3'UTR|FAM179A_ENST00000403861.2_Missense_Mutation_p.H787Q	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	842										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGAGCTTACACCCCATGCTGC	0.537																																					p.H842Q		Atlas-SNP	.											.	FAM179A	106	.	0			c.C2526A						.						132.0	104.0	113.0					2																	29259514		2203	4300	6503	SO:0001583	missense	165186	exon18			CTTACACCCCATG	AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.2526C>A	chr2.hg19:g.29259514C>A	ENSP00000368876:p.His842Gln	98.0	0.0		90.0	36.0	NM_199280	Q6ZUF5	Missense_Mutation	SNP	ENST00000379558.4	hg19	CCDS1769.2	.	.	.	.	.	.	.	.	.	.	C	8.920	0.960921	0.18583	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.12984	2.63;2.63	6.04	-3.33	0.04958	Armadillo-like helical (1);Armadillo-type fold (1);	0.649320	0.15513	N	0.258430	T	0.06234	0.0161	N	0.20401	0.57	0.24522	N	0.994158	B;B;B	0.27351	0.176;0.11;0.008	B;B;B	0.24541	0.054;0.024;0.007	T	0.42447	-0.9451	10	0.14252	T	0.57	.	8.6265	0.33892	0.0866:0.298:0.5113:0.1042	.	787;842;140	F8W8E4;Q6ZUX3;Q6ZUX3-3	.;F179A_HUMAN;.	Q	842;787	ENSP00000368876:H842Q;ENSP00000384699:H787Q	ENSP00000368876:H842Q	H	+	3	2	FAM179A	29113018	0.002000	0.14202	0.482000	0.27366	0.367000	0.29736	-0.785000	0.04628	-0.402000	0.07633	-0.311000	0.09066	CAC	.	.		0.537	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317848.4	NM_199280	
ASTL	431705	hgsc.bcm.edu	37	2	96799781	96799781	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr2:96799781A>C	ENST00000342380.2	-	4	259	c.260T>G	c.(259-261)cTg>cGg	p.L87R		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GGTTGCTGACAGCAGTCGGAA	0.617																																					p.L87R		Atlas-SNP	.											.	ASTL	59	.	0			c.T260G						.						128.0	89.0	102.0					2																	96799781		2203	4300	6503	SO:0001583	missense	431705	exon4			GCTGACAGCAGTC	AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.260T>G	chr2.hg19:g.96799781A>C	ENSP00000343674:p.Leu87Arg	67.0	0.0		36.0	13.0	NM_001002036		Missense_Mutation	SNP	ENST00000342380.2	hg19	CCDS33249.1	.	.	.	.	.	.	.	.	.	.	A	11.43	1.636919	0.29157	.	.	ENSG00000188886	ENST00000342380	T	0.68025	-0.3	4.95	3.7	0.42460	.	1.079380	0.07436	N	0.896553	T	0.54951	0.1890	L	0.27053	0.805	0.09310	N	1	P	0.44578	0.838	B	0.41691	0.364	T	0.47911	-0.9080	10	0.54805	T	0.06	-3.0998	7.5437	0.27753	0.8094:0.0:0.0:0.1906	.	87	Q6HA08	ASTL_HUMAN	R	87	ENSP00000343674:L87R	ENSP00000343674:L87R	L	-	2	0	ASTL	96163508	0.009000	0.17119	0.031000	0.17742	0.886000	0.51366	1.371000	0.34250	1.994000	0.58287	0.472000	0.43445	CTG	.	.		0.617	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338801.1		
ST6GAL2	84620	hgsc.bcm.edu	37	2	107423271	107423271	+	Silent	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr2:107423271G>A	ENST00000409382.3	-	6	2063	c.1453C>T	c.(1453-1455)Cta>Tta	p.L485L	ST6GAL2_ENST00000361686.4_Silent_p.L485L	NM_001142351.1	NP_001135823.1	Q96JF0	SIAT2_HUMAN	ST6 beta-galactosamide alpha-2,6-sialyltranferase 2	485					growth (GO:0040007)|multicellular organismal development (GO:0007275)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-galactoside alpha-2,6-sialyltransferase activity (GO:0003835)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(1)|lung(30)|ovary(5)|pancreas(6)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	65						TCATAGAGTAGTGGGTGGTAC	0.607																																					p.L485L		Atlas-SNP	.											.	ST6GAL2	159	.	0			c.C1453T						.						85.0	75.0	78.0					2																	107423271		2203	4300	6503	SO:0001819	synonymous_variant	84620	exon6			AGAGTAGTGGGTG	AB059555	CCDS2073.1, CCDS46380.1	2q11-q12	2008-02-05	2005-02-07	2005-02-07	ENSG00000144057	ENSG00000144057	2.4.99.2		10861	protein-coding gene	gene with protein product		608472	"""sialyltransferase 2 (monosialoganglioside sialyltransferase)"""	SIAT2			Standard	NM_032528		Approved	KIAA1877, St6gal2, St6GalII	uc002tdr.3	Q96JF0	OTTHUMG00000130923	ENST00000409382.3:c.1453C>T	chr2.hg19:g.107423271G>A		89.0	0.0		75.0	35.0	NM_032528	D3DVK3|Q53QP4|Q86Y44|Q8IUG7|Q96HE4	Silent	SNP	ENST00000409382.3	hg19	CCDS2073.1	.	.	.	.	.	.	.	.	.	.	G	9.624	1.134495	0.21123	.	.	ENSG00000144057	ENST00000361803	.	.	.	5.8	3.03	0.35002	.	.	.	.	.	T	0.58293	0.2112	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50955	-0.8766	4	.	.	.	-30.1954	8.8633	0.35272	0.2863:0.0:0.7137:0.0	.	.	.	.	I	50	.	.	T	-	2	0	ST6GAL2	106789703	1.000000	0.71417	0.593000	0.28771	0.851000	0.48451	2.900000	0.48687	0.361000	0.24292	0.655000	0.94253	ACT	.	.		0.607	ST6GAL2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330065.1	NM_032528	
MAP2	4133	hgsc.bcm.edu	37	2	210588377	210588377	+	Intron	SNP	A	A	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr2:210588377A>T	ENST00000360351.4	+	13	5579				MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Intron|MAP2_ENST00000199940.6_Missense_Mutation_p.K412M|MAP2_ENST00000475600.1_3'UTR|RNA5SP118_ENST00000410385.1_RNA|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2						axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TGTGGTTCCAAGGATAACATC	0.443																																					p.K412M	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.A1235T						.						100.0	98.0	98.0					2																	210588377		2203	4300	6503	SO:0001627	intron_variant	4133	exon12			GTTCCAAGGATAA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.5074-2056A>T	chr2.hg19:g.210588377A>T		234.0	0.0		167.0	74.0	NM_001039538	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	hg19	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	A	15.60	2.882619	0.51908	.	.	ENSG00000078018	ENST00000199940	D	0.94862	-3.54	5.65	5.65	0.86999	.	.	.	.	.	D	0.92093	0.7494	L	0.44542	1.39	0.80722	D	1	B	0.28636	0.218	B	0.36186	0.219	D	0.90064	0.4158	9	0.49607	T	0.09	.	10.5518	0.45092	0.9188:0.0:0.0812:0.0	.	412	Q8IUX2	.	M	412	ENSP00000199940:K412M	ENSP00000199940:K412M	K	+	2	0	MAP2	210296622	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.682000	0.54656	2.144000	0.66660	0.533000	0.62120	AAG	.	.		0.443	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
DOCK10	55619	hgsc.bcm.edu	37	2	225688292	225688292	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr2:225688292G>T	ENST00000258390.7	-	28	3176	c.3109C>A	c.(3109-3111)Cat>Aat	p.H1037N	DOCK10_ENST00000409592.3_Missense_Mutation_p.H1031N	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	1037					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CAAATCACATGGTCGGATAGG	0.418																																					p.H1037N		Atlas-SNP	.											.	DOCK10	308	.	0			c.C3109A						.						158.0	147.0	151.0					2																	225688292		1895	4115	6010	SO:0001583	missense	55619	exon28			TCACATGGTCGGA	AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.3109C>A	chr2.hg19:g.225688292G>T	ENSP00000258390:p.His1037Asn	91.0	0.0		89.0	44.0	NM_014689	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	ENST00000258390.7	hg19	CCDS46528.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386033	0.82902	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.64991	3.67;-0.13	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.82157	0.4976	M	0.84326	2.69	0.44309	D	0.997182	D;D	0.76494	0.999;0.996	D;D	0.78314	0.991;0.933	D	0.83482	0.0065	10	0.87932	D	0	.	20.2799	0.98512	0.0:0.0:1.0:0.0	.	1037;1031	Q96BY6;B3FL70	DOC10_HUMAN;.	N	1031;1037	ENSP00000386694:H1031N;ENSP00000258390:H1037N	ENSP00000258390:H1037N	H	-	1	0	DOCK10	225396536	1.000000	0.71417	0.333000	0.25482	0.914000	0.54420	8.192000	0.89718	2.800000	0.96347	0.643000	0.83706	CAT	.	.		0.418	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331246.1		
GPR149	344758	hgsc.bcm.edu	37	3	154146446	154146446	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr3:154146446A>T	ENST00000389740.2	-	1	1058	c.959T>A	c.(958-960)gTc>gAc	p.V320D		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	320					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			CCAAAGGACGACTTTTGTAAG	0.572																																					p.V320D		Atlas-SNP	.											.	GPR149	134	.	0			c.T959A						.						115.0	114.0	114.0					3																	154146446		1984	4148	6132	SO:0001583	missense	344758	exon1			AGGACGACTTTTG	AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.959T>A	chr3.hg19:g.154146446A>T	ENSP00000374390:p.Val320Asp	189.0	0.0		114.0	47.0	NM_001038705		Missense_Mutation	SNP	ENST00000389740.2	hg19	CCDS43162.1	.	.	.	.	.	.	.	.	.	.	A	19.98	3.927782	0.73327	.	.	ENSG00000174948	ENST00000389740	T	0.74842	-0.88	4.87	2.46	0.29980	GPCR, rhodopsin-like superfamily (1);	0.128153	0.52532	D	0.000079	T	0.80226	0.4584	M	0.66939	2.045	0.80722	D	1	D	0.58620	0.983	P	0.60012	0.867	T	0.78671	-0.2113	10	0.87932	D	0	-10.5652	8.9808	0.35964	0.8476:0.0:0.1524:0.0	.	320	Q86SP6	GP149_HUMAN	D	320	ENSP00000374390:V320D	ENSP00000374390:V320D	V	-	2	0	GPR149	155629140	1.000000	0.71417	0.708000	0.30435	0.854000	0.48673	3.765000	0.55272	0.238000	0.21222	0.533000	0.62120	GTC	.	.		0.572	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353430.1	XM_293580	
MFSD1	64747	hgsc.bcm.edu	37	3	158525238	158525238	+	Silent	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr3:158525238A>C	ENST00000264266.8	+	5	488	c.426A>C	c.(424-426)ggA>ggC	p.G142G	MFSD1_ENST00000415822.2_Silent_p.G191G|MFSD1_ENST00000392813.4_Silent_p.G152G			Q9H3U5	MFSD1_HUMAN	major facilitator superfamily domain containing 1	142					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|skin(1)	26			Lung(72;0.00372)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGGAATTTGGAAGATTTGTAT	0.279																																					p.G191G	Pancreas(62;1186 1654 36636 37908)	Atlas-SNP	.											.	MFSD1	88	.	0			c.A573C						.						176.0	178.0	177.0					3																	158525238		2203	4299	6502	SO:0001819	synonymous_variant	64747	exon5			ATTTGGAAGATTT	BC017661	CCDS3185.1, CCDS3185.2, CCDS54666.1	3q25.32	2005-11-17			ENSG00000118855	ENSG00000118855			25874	protein-coding gene	gene with protein product							Standard	NM_022736		Approved	FLJ14153, UG0581B09	uc003fcl.2	Q9H3U5	OTTHUMG00000158835	ENST00000264266.8:c.426A>C	chr3.hg19:g.158525238A>C		116.0	0.0		71.0	29.0	NM_022736	B4DGJ8|B4DMR8|B4DU49|B4DWU1|C9JS94|J3KQL7|Q05C07|Q5XKJ1|Q8IVS1|Q8IXG4|Q9H7X1	Silent	SNP	ENST00000264266.8	hg19																																																																																				.	.		0.279	MFSD1-018	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470730.1	NM_022736	
VPS8	23355	hgsc.bcm.edu	37	3	184646286	184646286	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr3:184646286G>C	ENST00000437079.3	+	32	2850	c.2679G>C	c.(2677-2679)gaG>gaC	p.E893D	VPS8_ENST00000446204.2_Missense_Mutation_p.E801D|VPS8_ENST00000436792.2_Missense_Mutation_p.E891D|VPS8_ENST00000287546.4_Missense_Mutation_p.E893D|VPS8_ENST00000463687.1_3'UTR	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	893							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			AATTTGAAGAGAGTCGACTCA	0.333																																					p.E893D		Atlas-SNP	.											.	VPS8	109	.	0			c.G2679C						.						124.0	118.0	120.0					3																	184646286		1836	4101	5937	SO:0001583	missense	23355	exon31			TGAAGAGAGTCGA	AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.2679G>C	chr3.hg19:g.184646286G>C	ENSP00000397879:p.Glu893Asp	116.0	0.0		96.0	44.0	NM_001009921	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	ENST00000437079.3	hg19	CCDS46971.1	.	.	.	.	.	.	.	.	.	.	G	12.37	1.916965	0.33815	.	.	ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204	T;T;T;T	0.18960	2.18;2.18;2.18;2.18	5.79	4.92	0.64577	Quinonprotein alcohol dehydrogenase-like (1);	0.045746	0.85682	D	0.000000	T	0.16514	0.0397	N	0.16656	0.425	0.53005	D	0.999968	B;B;B	0.28783	0.142;0.207;0.222	B;B;B	0.37833	0.043;0.259;0.093	T	0.09079	-1.0691	10	0.13470	T	0.59	-11.5984	14.3333	0.66572	0.0717:0.0:0.9283:0.0	.	893;801;891	Q8N3P4;Q8N3P4-2;Q8N3P4-3	VPS8_HUMAN;.;.	D	893;893;891;801	ENSP00000287546:E893D;ENSP00000397879:E893D;ENSP00000404704:E891D;ENSP00000405483:E801D	ENSP00000287546:E893D	E	+	3	2	VPS8	186128980	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.975000	0.49281	1.459000	0.47892	0.557000	0.71058	GAG	.	.		0.333	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_015303	
LGI2	55203	hgsc.bcm.edu	37	4	25005095	25005095	+	Missense_Mutation	SNP	A	A	G	rs150163590		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:25005095A>G	ENST00000382114.4	-	8	1801	c.1616T>C	c.(1615-1617)aTa>aCa	p.I539T		NM_018176.3	NP_060646.2	Q8N0V4	LGI2_HUMAN	leucine-rich repeat LGI family, member 2	539						extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|prostate(1)|skin(3)|stomach(2)	33		Breast(46;0.173)				GTCAACAATTATATGTTCAAA	0.393																																					p.I539T		Atlas-SNP	.											.	LGI2	62	.	0			c.T1616C						.	A	THR/ILE	0,4402		0,0,2201	49.0	52.0	51.0		1616	5.6	0.9	4	dbSNP_134	51	1,8597	1.2+/-3.3	0,1,4298	no	missense	LGI2	NM_018176.3	89	0,1,6499	GG,GA,AA		0.0116,0.0,0.0077	benign	539/546	25005095	1,12999	2201	4299	6500	SO:0001583	missense	55203	exon8			ACAATTATATGTT	AJ487516	CCDS3431.1	4p15.31	2008-07-28			ENSG00000153012	ENSG00000153012			18710	protein-coding gene	gene with protein product		608301				12023020, 16014869	Standard	NM_018176		Approved	KIAA1916, FLJ10675	uc003grf.2	Q8N0V4	OTTHUMG00000097749	ENST00000382114.4:c.1616T>C	chr4.hg19:g.25005095A>G	ENSP00000371548:p.Ile539Thr	147.0	0.0		105.0	43.0	NM_018176	Q3MIN2|Q8NDW6|Q96PX2|Q9NVK4	Missense_Mutation	SNP	ENST00000382114.4	hg19	CCDS3431.1	.	.	.	.	.	.	.	.	.	.	A	16.96	3.267141	0.59540	0.0	1.16E-4	ENSG00000153012	ENST00000382114;ENST00000282970	T	0.62105	0.05	5.57	5.57	0.84162	.	0.175658	0.52532	D	0.000062	T	0.59514	0.2199	L	0.36672	1.1	0.28809	N	0.898337	P	0.39131	0.661	B	0.43155	0.41	T	0.62124	-0.6920	10	0.59425	D	0.04	-26.848	15.737	0.77853	1.0:0.0:0.0:0.0	.	539	Q8N0V4	LGI2_HUMAN	T	539;187	ENSP00000371548:I539T	ENSP00000282970:I187T	I	-	2	0	LGI2	24614193	0.998000	0.40836	0.914000	0.36105	0.982000	0.71751	4.859000	0.62954	2.113000	0.64589	0.455000	0.32223	ATA	.	A|1.000;G|0.000		0.393	LGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214978.1		
GRXCR1	389207	hgsc.bcm.edu	37	4	42895442	42895442	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:42895442T>A	ENST00000399770.2	+	1	159	c.159T>A	c.(157-159)gaT>gaA	p.D53E	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	53					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						GTGGGATAGATGGACTAGGTG	0.507																																					p.D53E		Atlas-SNP	.											.	GRXCR1	78	.	0			c.T159A						.						184.0	186.0	186.0					4																	42895442		2005	4195	6200	SO:0001583	missense	389207	exon1			GATAGATGGACTA		CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.159T>A	chr4.hg19:g.42895442T>A	ENSP00000382670:p.Asp53Glu	119.0	0.0		89.0	47.0	NM_001080476		Missense_Mutation	SNP	ENST00000399770.2	hg19	CCDS43225.1	.	.	.	.	.	.	.	.	.	.	T	10.16	1.273902	0.23221	.	.	ENSG00000215203	ENST00000399770	T	0.32988	1.43	5.16	2.68	0.31781	.	0.294115	0.31624	U	0.007326	T	0.11410	0.0278	N	0.16790	0.44	0.37838	D	0.928956	P	0.38535	0.635	B	0.30855	0.121	T	0.27806	-1.0063	10	0.02654	T	1	-15.4176	6.7281	0.23369	0.0:0.4067:0.0:0.5933	.	53	A8MXD5	GRCR1_HUMAN	E	53	ENSP00000382670:D53E	ENSP00000382670:D53E	D	+	3	2	GRXCR1	42590199	0.031000	0.19500	0.968000	0.41197	0.053000	0.15095	-0.665000	0.05286	0.410000	0.25675	-0.417000	0.06048	GAT	.	.		0.507	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360576.1	NM_001080476	
KDR	3791	hgsc.bcm.edu	37	4	55964415	55964415	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:55964415C>G	ENST00000263923.4	-	17	2693	c.2398G>C	c.(2398-2400)Ggc>Cgc	p.G800R		NM_002253.2	NP_002244.1	P35968	VGFR2_HUMAN	kinase insert domain receptor (a type III receptor tyrosine kinase)	800					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion homeostasis (GO:0055074)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic hemopoiesis (GO:0035162)|endothelial cell differentiation (GO:0045446)|endothelium development (GO:0003158)|extracellular matrix organization (GO:0030198)|lung alveolus development (GO:0048286)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vasculogenesis (GO:2001214)|protein autophosphorylation (GO:0046777)|regulation of cell shape (GO:0008360)|signal transduction by phosphorylation (GO:0023014)|surfactant homeostasis (GO:0043129)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sorting endosome (GO:0097443)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|Hsp90 protein binding (GO:0051879)|integrin binding (GO:0005178)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(16)|lung(71)|ovary(2)|prostate(2)|skin(10)|soft_tissue(4)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	135	all_cancers(7;0.0255)|all_lung(4;0.00175)|Lung NSC(11;0.00384)|all_epithelial(27;0.034)|Glioma(25;0.08)|all_neural(26;0.101)		Epithelial(7;0.189)		Axitinib(DB06626)|Cabozantinib(DB08875)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GACAAGTAGCCTGTCTTCAGT	0.463			Mis		"""NSCLC, angiosarcoma"""					TSP Lung(20;0.16)																											p.G800R		Atlas-SNP	.		Dom	yes		4	4q11-q12	3791	vascular endothelial growth factor receptor 2		E	.	KDR	307	.	0			c.G2398C						.						107.0	92.0	97.0					4																	55964415		2203	4300	6503	SO:0001583	missense	3791	exon17			AGTAGCCTGTCTT	AF035121	CCDS3497.1	4q11-q12	2013-01-29			ENSG00000128052	ENSG00000128052	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6307	protein-coding gene	gene with protein product		191306				1417831	Standard	NM_002253		Approved	FLK1, VEGFR, VEGFR2, CD309	uc003has.3	P35968	OTTHUMG00000128734	ENST00000263923.4:c.2398G>C	chr4.hg19:g.55964415C>G	ENSP00000263923:p.Gly800Arg	139.0	0.0		83.0	21.0	NM_002253	A2RRS0|B5A925|C5IFA0|O60723|Q14178	Missense_Mutation	SNP	ENST00000263923.4	hg19	CCDS3497.1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802895	0.90623	.	.	ENSG00000128052	ENST00000263923	T	0.77877	-1.13	5.29	5.29	0.74685	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.86843	0.6030	L	0.60845	1.875	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87684	0.2549	10	0.87932	D	0	.	19.2932	0.94110	0.0:1.0:0.0:0.0	.	800	P35968	VGFR2_HUMAN	R	800	ENSP00000263923:G800R	ENSP00000263923:G800R	G	-	1	0	KDR	55659172	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.818000	0.86416	2.624000	0.88883	0.655000	0.94253	GGC	.	.		0.463	KDR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250645.1		
DCHS2	54798	hgsc.bcm.edu	37	4	155412382	155412382	+	Silent	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:155412382C>T	ENST00000339452.1	-	1	486	c.126G>A	c.(124-126)agG>agA	p.R42R	DCHS2_ENST00000456341.2_Silent_p.R35R|DCHS2_ENST00000443500.1_Silent_p.R42R	NM_001142552.1	NP_001136024.1	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	545					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		AGCGCTGCGTCCTGGCGCCGC	0.682																																					p.R42R		Atlas-SNP	.											.	DCHS2	594	.	0			c.G126A						.						20.0	34.0	30.0					4																	155412382		692	1591	2283	SO:0001819	synonymous_variant	54798	exon1			CTGCGTCCTGGCG	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000339452.1:c.126G>A	chr4.hg19:g.155412382C>T		86.0	0.0		63.0	14.0	NM_001142552	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	ENST00000339452.1	hg19	CCDS47150.1																																																																																			.	.		0.682	DCHS2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000365282.1	NM_001142552	
RAPGEF2	9693	hgsc.bcm.edu	37	4	160243510	160243510	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:160243510G>T	ENST00000264431.4	+	4	801	c.382G>T	c.(382-384)Gaa>Taa	p.E128*	RAPGEF2_ENST00000504604.1_3'UTR	NM_014247.2	NP_055062.1	Q9Y4G8	RPGF2_HUMAN	Rap guanine nucleotide exchange factor (GEF) 2	128					adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|blood vessel development (GO:0001568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|forebrain neuron development (GO:0021884)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of cell proliferation (GO:0008285)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of melanin biosynthetic process (GO:0048022)|nerve growth factor signaling pathway (GO:0038180)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|neuropeptide signaling pathway (GO:0007218)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein binding (GO:0032092)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rap GTPase activity (GO:0032854)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of vasculogenesis (GO:2001214)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|regulation of synaptic plasticity (GO:0048167)|small GTPase mediated signal transduction (GO:0007264)|ventricular system development (GO:0021591)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	beta-1 adrenergic receptor binding (GO:0031697)|calcium ion binding (GO:0005509)|cAMP binding (GO:0030552)|diacylglycerol binding (GO:0019992)|PDZ domain binding (GO:0030165)|Rap GTPase activator activity (GO:0046582)|Rap guanyl-nucleotide exchange factor activity (GO:0017034)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|signal transducer activity (GO:0004871)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	70	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0817)		ACAACTCTTGGAATTTATGCA	0.378																																					p.E128X		Atlas-SNP	.											.	RAPGEF2	171	.	0			c.G382T						.						99.0	90.0	93.0					4																	160243510		1887	4139	6026	SO:0001587	stop_gained	9693	exon4			CTCTTGGAATTTA	AB002311	CCDS43277.1	4q32.1	2004-03-01	2004-03-01	2004-03-01					16854	protein-coding gene	gene with protein product	"""Rap GEP"""	609530	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 1"""	PDZGEF1		9205841, 10934204	Standard	NM_014247		Approved	PDZ-GEF1, RA-GEF, DKFZP586O1422, KIAA0313	uc003iqg.4	Q9Y4G8		ENST00000264431.4:c.382G>T	chr4.hg19:g.160243510G>T	ENSP00000264431:p.Glu128*	152.0	0.0		71.0	53.0	NM_014247	D3DP27	Nonsense_Mutation	SNP	ENST00000264431.4	hg19	CCDS43277.1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.003154	0.74932	.	.	ENSG00000109756	ENST00000511336;ENST00000510510;ENST00000264431;ENST00000514565	.	.	.	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.6323	0.88112	0.0:0.0:1.0:0.0	.	.	.	.	X	56;126;128;109	.	ENSP00000264431:E128X	E	+	1	0	RAPGEF2	160462960	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	9.420000	0.97426	2.234000	0.73211	0.591000	0.81541	GAA	.	.		0.378	RAPGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364980.2	NM_014247	
ADAM29	11086	hgsc.bcm.edu	37	4	175898867	175898867	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:175898867C>A	ENST00000359240.3	+	5	2861	c.2191C>A	c.(2191-2193)Cag>Aag	p.Q731K	ADAM29_ENST00000514159.1_Missense_Mutation_p.Q731K|ADAM29_ENST00000445694.1_Missense_Mutation_p.Q731K|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Missense_Mutation_p.Q731K	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	731					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		GTTACCTCCCCAGAGTCAACC	0.468																																					p.Q731K	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											.	ADAM29	262	.	0			c.C2191A						.						109.0	101.0	104.0					4																	175898867		2203	4300	6503	SO:0001583	missense	11086	exon4			CCTCCCCAGAGTC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2191C>A	chr4.hg19:g.175898867C>A	ENSP00000352177:p.Gln731Lys	143.0	0.0		58.0	50.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	hg19	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.846237	0.00568	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01787	4.64;4.64;4.64;4.64	1.94	-0.328	0.12690	.	.	.	.	.	T	0.00998	0.0033	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48896	-0.8994	8	.	.	.	.	5.5148	0.16900	0.2255:0.5541:0.2204:0.0	.	731	Q9UKF5	ADA29_HUMAN	K	731	ENSP00000352177:Q731K;ENSP00000414544:Q731K;ENSP00000384229:Q731K;ENSP00000423517:Q731K	.	Q	+	1	0	ADAM29	176135442	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.324000	0.19610	-0.354000	0.08212	-0.195000	0.12781	CAG	.	.		0.468	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ADAM29	11086	hgsc.bcm.edu	37	4	175898869	175898869	+	Silent	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr4:175898869G>A	ENST00000359240.3	+	5	2863	c.2193G>A	c.(2191-2193)caG>caA	p.Q731Q	ADAM29_ENST00000514159.1_Silent_p.Q731Q|ADAM29_ENST00000445694.1_Silent_p.Q731Q|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000404450.4_Silent_p.Q731Q	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	731					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TACCTCCCCAGAGTCAACCTT	0.473																																					p.Q731Q	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											ADAM29,colon,carcinoma,0,1	ADAM29	262	.	0			c.G2193A						.						112.0	103.0	106.0					4																	175898869		2203	4300	6503	SO:0001819	synonymous_variant	11086	exon4			TCCCCAGAGTCAA	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2193G>A	chr4.hg19:g.175898869G>A		142.0	1.0		58.0	50.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Silent	SNP	ENST00000359240.3	hg19	CCDS3823.1																																																																																			.	.		0.473	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
ICE1	23379	hgsc.bcm.edu	37	5	5462512	5462512	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr5:5462512G>C	ENST00000296564.7	+	13	3287	c.3065G>C	c.(3064-3066)gGa>gCa	p.G1022A		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1022					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						ACCAGCTGTGGAGACACAGGG	0.493																																					p.G1022A		Atlas-SNP	.											.	KIAA0947	301	.	0			c.G3065C						.						106.0	108.0	107.0					5																	5462512		1981	4164	6145	SO:0001583	missense	23379	exon13			GCTGTGGAGACAC																												ENST00000296564.7:c.3065G>C	chr5.hg19:g.5462512G>C	ENSP00000296564:p.Gly1022Ala	102.0	0.0		67.0	15.0	NM_015325	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Missense_Mutation	SNP	ENST00000296564.7	hg19	CCDS47187.1	.	.	.	.	.	.	.	.	.	.	g	15.48	2.845800	0.51164	.	.	ENSG00000164151	ENST00000296564	T	0.14640	2.49	4.27	3.4	0.38934	.	0.867766	0.10011	N	0.727159	T	0.21761	0.0524	L	0.29908	0.895	0.09310	N	1	D	0.69078	0.997	D	0.64410	0.925	T	0.17018	-1.0383	10	0.39692	T	0.17	-21.1653	8.3389	0.32232	0.1126:0.0:0.8874:0.0	.	1022	Q9Y2F5	K0947_HUMAN	A	1022	ENSP00000296564:G1022A	ENSP00000296564:G1022A	G	+	2	0	KIAA0947	5515512	0.051000	0.20477	0.131000	0.22000	0.095000	0.18619	2.451000	0.44952	0.916000	0.36871	0.306000	0.20318	GGA	.	.		0.493	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365575.1		
ADCY2	108	hgsc.bcm.edu	37	5	7709399	7709399	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr5:7709399C>T	ENST00000338316.4	+	10	1566	c.1477C>T	c.(1477-1479)Cgc>Tgc	p.R493C	ADCY2_ENST00000537121.1_Missense_Mutation_p.R313C|RP11-711G10.1_ENST00000514105.2_RNA	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	493					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)	p.R493S(1)		NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GGCCTCGGTCCGCATGACCCG	0.587																																					p.R493C		Atlas-SNP	.											ADCY2_ENST00000537121,NS,carcinoma,-1,3	ADCY2	337	.	1	Substitution - Missense(1)	lung(1)	c.C1477T						.						75.0	63.0	67.0					5																	7709399		2203	4300	6503	SO:0001583	missense	108	exon10			TCGGTCCGCATGA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1477C>T	chr5.hg19:g.7709399C>T	ENSP00000342952:p.Arg493Cys	94.0	0.0		85.0	29.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	hg19	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	c	21.7	4.183479	0.78677	.	.	ENSG00000078295	ENST00000338316;ENST00000537121	T;D	0.82619	-1.16;-1.63	5.62	4.73	0.59995	.	0.052729	0.64402	D	0.000001	D	0.90525	0.7031	M	0.78456	2.415	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	P;D	0.68621	0.836;0.959	D	0.91702	0.5374	10	0.72032	D	0.01	.	15.7895	0.78343	0.1372:0.8628:0.0:0.0	.	313;493	B7Z2C1;Q08462	.;ADCY2_HUMAN	C	493;313	ENSP00000342952:R493C;ENSP00000444803:R313C	ENSP00000342952:R493C	R	+	1	0	ADCY2	7762399	0.990000	0.36364	0.934000	0.37439	0.985000	0.73830	2.958000	0.49145	1.330000	0.45394	0.558000	0.71614	CGC	.	.		0.587	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
DNAH5	1767	hgsc.bcm.edu	37	5	13917343	13917343	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr5:13917343C>T	ENST00000265104.4	-	8	1102	c.998G>A	c.(997-999)cGa>cAa	p.R333Q		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	333	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					ATCAGTGATTCGAATATCCAT	0.378									Kartagener syndrome																												p.R333Q		Atlas-SNP	.											.	DNAH5	868	.	0			c.G998A						.						143.0	120.0	127.0					5																	13917343		2203	4300	6503	SO:0001583	missense	1767	exon8	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GTGATTCGAATAT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.998G>A	chr5.hg19:g.13917343C>T	ENSP00000265104:p.Arg333Gln	64.0	0.0		63.0	26.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	C	13.41	2.230068	0.39399	.	.	ENSG00000039139	ENST00000265104	T	0.53857	0.6	5.54	3.44	0.39384	Dynein heavy chain, domain-1 (1);	0.194351	0.41823	N	0.000811	T	0.46347	0.1388	M	0.66939	2.045	0.32286	N	0.566894	B	0.06786	0.001	B	0.10450	0.005	T	0.50659	-0.8802	10	0.14656	T	0.56	.	10.3583	0.43977	0.0:0.74:0.1154:0.1446	.	333	Q8TE73	DYH5_HUMAN	Q	333	ENSP00000265104:R333Q	ENSP00000265104:R333Q	R	-	2	0	DNAH5	13970343	1.000000	0.71417	0.999000	0.59377	0.763000	0.43281	4.884000	0.63135	1.357000	0.45904	-0.219000	0.12488	CGA	.	.		0.378	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
PJA2	9867	hgsc.bcm.edu	37	5	108714271	108714271	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr5:108714271T>C	ENST00000361189.2	-	4	1156	c.917A>G	c.(916-918)cAt>cGt	p.H306R	PJA2_ENST00000361557.3_Missense_Mutation_p.H306R|PJA2_ENST00000511624.1_5'Flank	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	306					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		AGAACTTCCATGGTTCTTTTC	0.433																																					p.H306R		Atlas-SNP	.											.	PJA2	53	.	0			c.A917G						.						160.0	164.0	163.0					5																	108714271		2202	4300	6502	SO:0001583	missense	9867	exon4			CTTCCATGGTTCT	AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.917A>G	chr5.hg19:g.108714271T>C	ENSP00000354775:p.His306Arg	90.0	0.0		86.0	18.0	NM_014819	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	ENST00000361189.2	hg19	CCDS4099.1	.	.	.	.	.	.	.	.	.	.	T	2.825	-0.243940	0.05906	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05199	3.48;3.48	5.61	-2.87	0.05700	.	0.708561	0.13642	N	0.372925	T	0.03178	0.0093	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.38585	-0.9654	10	0.41790	T	0.15	10.0301	6.0681	0.19873	0.1113:0.318:0.0:0.5708	.	306	O43164	PJA2_HUMAN	R	306	ENSP00000354775:H306R;ENSP00000355284:H306R	ENSP00000354775:H306R	H	-	2	0	PJA2	108742170	0.959000	0.32827	0.021000	0.16686	0.520000	0.34377	0.478000	0.22212	-0.291000	0.09012	-0.250000	0.11733	CAT	.	.		0.433	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250663.1	NM_014819	
PCDHB1	29930	hgsc.bcm.edu	37	5	140433011	140433011	+	Silent	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr5:140433011T>A	ENST00000306549.3	+	1	2033	c.1956T>A	c.(1954-1956)gcT>gcA	p.A652A		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCAACCAGCTCTTTCCACTA	0.443																																					p.A652A		Atlas-SNP	.											.	PCDHB1	148	.	0			c.T1956A						.						142.0	138.0	139.0					5																	140433011		2203	4300	6503	SO:0001819	synonymous_variant	29930	exon1			ACCAGCTCTTTCC	AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.1956T>A	chr5.hg19:g.140433011T>A		108.0	0.0		81.0	33.0	NM_013340	Q2M257	Silent	SNP	ENST00000306549.3	hg19	CCDS4243.1																																																																																			.	.		0.443	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251822.2	NM_013340	
IRF4	3662	hgsc.bcm.edu	37	6	393203	393203	+	Silent	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr6:393203G>A	ENST00000380956.4	+	2	177	c.51G>A	c.(49-51)gtG>gtA	p.V17V	IRF4_ENST00000495137.1_Intron	NM_001195286.1|NM_002460.3	NP_001182215.1|NP_002451.2	Q15306	IRF4_HUMAN	interferon regulatory factor 4	17					cytokine-mediated signaling pathway (GO:0019221)|defense response to protozoan (GO:0042832)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|interferon-gamma-mediated signaling pathway (GO:0060333)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of DNA binding (GO:0043388)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of interleukin-13 biosynthetic process (GO:0045368)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 biosynthetic process (GO:0045404)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of T-helper cell differentiation (GO:0045622)|T cell activation (GO:0042110)|T-helper 17 cell lineage commitment (GO:0072540)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear nucleosome (GO:0000788)|nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)	5		Breast(5;0.0155)|all_lung(73;0.0691)|all_hematologic(90;0.0895)		OV - Ovarian serous cystadenocarcinoma(45;0.03)|BRCA - Breast invasive adenocarcinoma(62;0.0702)		TGAGCGCGGTGAGCTGCGGCA	0.706			T	IGH@	MM																																p.V17V		Atlas-SNP	.		Dom	yes		6	6p25-p23	3662	interferon regulatory factor 4		L	.	IRF4	65	.	0			c.G51A						.						28.0	31.0	30.0					6																	393203		2179	4255	6434	SO:0001819	synonymous_variant	3662	exon2			CGCGGTGAGCTGC	U52682	CCDS4469.1	6p25-p23	2008-08-29			ENSG00000137265	ENSG00000137265			6119	protein-coding gene	gene with protein product		601900		MUM1		8921401, 18417578	Standard	NM_002460		Approved	LSIRF	uc003msz.4	Q15306	OTTHUMG00000016294	ENST00000380956.4:c.51G>A	chr6.hg19:g.393203G>A		134.0	0.0		123.0	51.0	NM_001195286	Q5VUI7|Q99660	Silent	SNP	ENST00000380956.4	hg19	CCDS4469.1																																																																																			.	.		0.706	IRF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043638.1		
AGER	177	hgsc.bcm.edu	37	6	32149151	32149151	+	Silent	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr6:32149151C>T	ENST00000375076.4	-	10	1196	c.1095G>A	c.(1093-1095)agG>agA	p.R365R	AGER_ENST00000375069.3_Silent_p.R255R|AGER_ENST00000375067.3_Missense_Mutation_p.A314T|AGER_ENST00000375055.2_Intron|AGER_ENST00000438221.2_Intron|AGER_ENST00000375070.3_Silent_p.R396R|AGER_ENST00000375065.5_3'UTR|RNF5_ENST00000427134.2_Intron	NM_001136.4|NM_001206929.1|NM_001206932.1	NP_001127.1|NP_001193858.1|NP_001193861.1	Q15109	RAGE_HUMAN	advanced glycosylation end product-specific receptor	365					cell surface receptor signaling pathway (GO:0007166)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|neuron projection development (GO:0031175)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|response to wounding (GO:0009611)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|receptor activity (GO:0004872)|S100 protein binding (GO:0044548)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(1)|lung(5)|pancreas(2)	9						GGCGTTGCCGCCTTTGCCACA	0.652																																					p.A314T		Atlas-SNP	.											.	AGER	15	.	0			c.G940A						.						158.0	174.0	169.0					6																	32149151		1511	2709	4220	SO:0001819	synonymous_variant	177	exon9			TTGCCGCCTTTGC	M91211	CCDS4746.1, CCDS4747.1, CCDS56417.1, CCDS56418.1, CCDS75429.1	6p21.3	2013-01-29			ENSG00000204305	ENSG00000204305		"""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	320	protein-coding gene	gene with protein product		600214				7713518	Standard	NM_001136		Approved	RAGE	uc003oap.2	Q15109	OTTHUMG00000031120	ENST00000375076.4:c.1095G>A	chr6.hg19:g.32149151C>T		55.0	0.0		57.0	21.0	NM_172197	A2BFI7|A6NKF0|A7Y2U9|B0V176|Q15279|Q3L1R4|Q3L1R5|Q3L1R6|Q3L1R7|Q3L1R8|Q3L1S0|Q86SN1|Q9H2X7|Q9Y3R3|V5R6A3	Missense_Mutation	SNP	ENST00000375076.4	hg19	CCDS4746.1	.	.	.	.	.	.	.	.	.	.	C	14.76	2.631693	0.46944	.	.	ENSG00000204305	ENST00000375067	D	0.85411	-1.98	5.29	1.23	0.21249	.	.	.	.	.	T	0.46927	0.1418	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.39981	-0.9587	8	0.10377	T	0.69	-17.6448	7.408	0.27001	0.0:0.5571:0.0:0.4429	.	314	Q15109-2	.	T	314	ENSP00000364208:A314T	ENSP00000364208:A314T	A	-	1	0	AGER	32257129	0.348000	0.24861	0.010000	0.14722	0.317000	0.28152	0.476000	0.22180	0.330000	0.23485	0.551000	0.68910	GCG	.	.		0.652	AGER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076200.1	NM_001136	
DNAH8	1769	hgsc.bcm.edu	37	6	38858481	38858481	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr6:38858481T>C	ENST00000359357.3	+	56	8130	c.7876T>C	c.(7876-7878)Tgt>Cgt	p.C2626R	DNAH8_ENST00000449981.2_Missense_Mutation_p.C2843R|DNAH8_ENST00000441566.1_Missense_Mutation_p.C2590R			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2626	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						GCCTCAAATATGTGAGATGAT	0.348																																					p.C2843R		Atlas-SNP	.											.	DNAH8	1239	.	0			c.T8527C						.						192.0	185.0	187.0					6																	38858481		2203	4300	6503	SO:0001583	missense	1769	exon58			CAAATATGTGAGA	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.7876T>C	chr6.hg19:g.38858481T>C	ENSP00000352312:p.Cys2626Arg	87.0	0.0		62.0	30.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	T	1.434	-0.569383	0.03910	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.33438	1.41;1.41;1.41	6.17	3.67	0.42095	.	0.252701	0.45126	N	0.000398	T	0.03739	0.0106	N	0.01779	-0.725	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.30179	-0.9987	10	0.12103	T	0.63	.	10.5834	0.45269	0.2561:0.0:0.0:0.7439	.	2626	Q96JB1	DYH8_HUMAN	R	2831;2831;2626;2590	ENSP00000333363:C2831R;ENSP00000352312:C2626R;ENSP00000402294:C2590R	ENSP00000333363:C2831R	C	+	1	0	DNAH8	38966459	1.000000	0.71417	0.999000	0.59377	0.657000	0.38888	3.236000	0.51336	1.126000	0.42016	0.533000	0.62120	TGT	.	.		0.348	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
MAP7	9053	hgsc.bcm.edu	37	6	136704840	136704840	+	Silent	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr6:136704840T>A	ENST00000354570.3	-	6	1016	c.606A>T	c.(604-606)tcA>tcT	p.S202S	MAP7_ENST00000432797.2_Silent_p.S56S|MAP7_ENST00000454590.1_Silent_p.S224S|MAP7_ENST00000544465.1_Silent_p.S187S|MAP7_ENST00000438100.2_Intron	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	202					cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		AAGTTGCAGATGAAGAGGAGA	0.378																																					p.S224S		Atlas-SNP	.											.	MAP7	63	.	0			c.A672T						.						112.0	109.0	110.0					6																	136704840		2203	4300	6503	SO:0001819	synonymous_variant	9053	exon6			TGCAGATGAAGAG	X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.606A>T	chr6.hg19:g.136704840T>A		84.0	0.0		46.0	35.0	NM_001198609	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Silent	SNP	ENST00000354570.3	hg19	CCDS5178.1																																																																																			.	.		0.378	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042382.2	NM_003980	
FBXL18	80028	hgsc.bcm.edu	37	7	5541166	5541166	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:5541166T>A	ENST00000382368.3	-	3	857	c.734A>T	c.(733-735)gAg>gTg	p.E245V	FBXL18_ENST00000453700.3_Missense_Mutation_p.E245V	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	245									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		CCGCACCACCTCCTGGTTGAT	0.652																																					p.E245V		Atlas-SNP	.											.	FBXL18	99	.	0			c.A734T						.						31.0	38.0	36.0					7																	5541166		2085	4193	6278	SO:0001583	missense	80028	exon3			ACCACCTCCTGGT	AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.734A>T	chr7.hg19:g.5541166T>A	ENSP00000371805:p.Glu245Val	87.0	0.0		70.0	33.0	NM_024963	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	ENST00000382368.3	hg19	CCDS43546.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.19|17.19	3.326978|3.326978	0.60743|0.60743	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000382368;ENST00000312577;ENST00000453700|ENST00000458142	T;T|.	0.52057|.	0.71;0.68|.	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	0.103999|.	0.64402|.	D|.	0.000004|.	T|T	0.51873|0.51873	0.1700|0.1700	N|N	0.24115|0.24115	0.695|0.695	0.43777|0.43777	D|D	0.9963|0.9963	D;D|.	0.63880|.	0.993;0.985|.	P;P|.	0.56343|.	0.796;0.677|.	T|T	0.49113|0.49113	-0.8973|-0.8973	10|5	0.56958|.	D|.	0.05|.	.|.	14.6055|14.6055	0.68475|0.68475	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	245;245|.	F5H4Z4;Q96ME1-4|.	.;.|.	V|W	245|129	ENSP00000371805:E245V;ENSP00000444797:E245V|.	ENSP00000311990:E245V|.	E|R	-|-	2|1	0|2	FBXL18|FBXL18	5507692|5507692	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	6.240000|6.240000	0.72363|0.72363	2.044000|2.044000	0.60594|0.60594	0.533000|0.533000	0.62120|0.62120	GAG|AGG	.	.		0.652	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324093.1	NM_024963	
TRRAP	8295	hgsc.bcm.edu	37	7	98552830	98552830	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:98552830A>T	ENST00000359863.4	+	40	6028	c.5819A>T	c.(5818-5820)cAg>cTg	p.Q1940L	TRRAP_ENST00000446306.3_Missense_Mutation_p.Q1921L|TRRAP_ENST00000355540.3_Missense_Mutation_p.Q1922L	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1940					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GACGGGCACCAGATGCTGACC	0.612																																					p.Q1940L		Atlas-SNP	.											.	TRRAP	863	.	0			c.A5819T						.						52.0	45.0	48.0					7																	98552830		2203	4300	6503	SO:0001583	missense	8295	exon40			GGCACCAGATGCT	AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.5819A>T	chr7.hg19:g.98552830A>T	ENSP00000352925:p.Gln1940Leu	83.0	0.0		69.0	35.0	NM_001244580	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	ENST00000359863.4	hg19	CCDS59066.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.43|18.43	3.622430|3.622430	0.66787|0.66787	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306|ENST00000456197	T;T|.	0.65916|.	-0.18;-0.18|.	5.56|5.56	4.41|4.41	0.53225|0.53225	.|.	0.060078|.	0.64402|.	D|.	0.000002|.	T|.	0.53948|.	0.1828|.	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	P;B;B|.	0.34743|.	0.466;0.242;0.392|.	B;B;B|.	0.31869|.	0.137;0.054;0.096|.	T|.	0.47381|.	-0.9122|.	10|.	0.27785|.	T|.	0.31|.	.|.	11.3043|11.3043	0.49325|0.49325	0.9289:0.0:0.0711:0.0|0.9289:0.0:0.0711:0.0	.|.	1922;1661;1940|.	Q9Y4A5-2;Q59FH1;Q9Y4A5|.	.;.;TRRAP_HUMAN|.	L|X	1940;1922;1920|1662	ENSP00000352925:Q1940L;ENSP00000347733:Q1922L|.	ENSP00000347733:Q1922L|.	Q|R	+|+	2|1	0|2	TRRAP|TRRAP	98390766|98390766	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	9.339000|9.339000	0.96797|0.96797	0.944000|0.944000	0.37579|0.37579	0.533000|0.533000	0.62120|0.62120	CAG|AGA	.	.		0.612	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317978.1	NM_003496	
CYP3A5	1577	hgsc.bcm.edu	37	7	99270218	99270218	+	Silent	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:99270218G>T	ENST00000222982.4	-	4	402	c.303C>A	c.(301-303)gtC>gtA	p.V101V	CYP3A5_ENST00000480723.1_5'UTR|CYP3A5_ENST00000343703.5_Silent_p.V91V|CYP3A5_ENST00000339843.2_3'UTR|CYP3A5_ENST00000439761.1_Silent_p.V101V	NM_000777.3	NP_000768.1	P20815	CP3A5_HUMAN	cytochrome P450, family 3, subfamily A, polypeptide 5	101					alkaloid catabolic process (GO:0009822)|drug catabolic process (GO:0042737)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_epithelial(64;2.77e-08)|Lung NSC(181;0.00396)|all_lung(186;0.00659)|Esophageal squamous(72;0.0166)				ado-trastuzumab emtansine(DB05773)|Alfentanil(DB00802)|Alprazolam(DB00404)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Apixaban(DB06605)|Aprepitant(DB00673)|Argatroban(DB00278)|Aripiprazole(DB01238)|Artemether(DB06697)|Astemizole(DB00637)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Beclomethasone(DB00394)|Boceprevir(DB08873)|Brentuximab vedotin(DB08870)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Carbamazepine(DB00564)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Chlorphenamine(DB01114)|Cilostazol(DB01166)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Clarithromycin(DB01211)|Clonidine(DB00575)|Clopidogrel(DB00758)|Cocaine(DB00907)|Codeine(DB00318)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dapsone(DB00250)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diltiazem(DB00343)|Disulfiram(DB00822)|Docetaxel(DB01248)|Dolutegravir(DB08930)|Domperidone(DB01184)|Dutasteride(DB01126)|Enzalutamide(DB08899)|Eplerenone(DB00700)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Ethosuximide(DB00593)|Etoposide(DB00773)|Felodipine(DB01023)|Fentanyl(DB00813)|Finasteride(DB01216)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flutamide(DB00499)|Fluticasone Propionate(DB00588)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gestodene(DB06730)|Granisetron(DB00889)|Halofantrine(DB01218)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ifosfamide(DB01181)|Iloperidone(DB04946)|Imatinib(DB00619)|Indinavir(DB00224)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ketoconazole(DB01026)|Lapatinib(DB01259)|Lercanidipine(DB00528)|Levomethadyl Acetate(DB01227)|Lidocaine(DB00281)|Losartan(DB00678)|Lovastatin(DB00227)|Methadone(DB00333)|Midazolam(DB00683)|Mifepristone(DB00834)|Modafinil(DB00745)|Mycophenolate mofetil(DB00688)|Nateglinide(DB00731)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Norethindrone(DB00717)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Oxazepam(DB00842)|Oxcarbazepine(DB00776)|Oxybutynin(DB01062)|Oxycodone(DB00497)|Paclitaxel(DB01229)|Paliperidone(DB01267)|Pentamidine(DB00738)|Perampanel(DB08883)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Ponatinib(DB08901)|Pravastatin(DB00175)|Praziquantel(DB01058)|Progesterone(DB00396)|Propranolol(DB00571)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rifampicin(DB01045)|Rifapentine(DB01201)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Rosuvastatin(DB01098)|Salmeterol(DB00938)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sildenafil(DB00203)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sorafenib(DB00398)|Sulfasalazine(DB00795)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Temsirolimus(DB06287)|Teniposide(DB00444)|Testosterone(DB00624)|Thalidomide(DB01041)|Trazodone(DB00656)|Tretinoin(DB00755)|Triazolam(DB00897)|Troleandomycin(DB01361)|Udenafil(DB06267)|Valproic Acid(DB00313)|Vardenafil(DB00862)|Verapamil(DB00661)|Vincristine(DB00541)|Voriconazole(DB00582)|Zalcitabine(DB00943)|Zaleplon(DB00962)|Ziprasidone(DB00246)|Zolpidem(DB00425)	GATTTGTGAAGACAGAATAAC	0.373																																					p.V101V		Atlas-SNP	.											.	CYP3A5	46	.	0			c.C303A						.						175.0	158.0	164.0					7																	99270218		2203	4300	6503	SO:0001819	synonymous_variant	1577	exon4			TGTGAAGACAGAA	L26985	CCDS5672.1, CCDS55134.1	7q21.1	2007-12-14	2003-01-14		ENSG00000106258	ENSG00000106258		"""Cytochrome P450s"""	2638	protein-coding gene	gene with protein product		605325	"""cytochrome P450, subfamily IIIA (niphedipine oxidase), polypeptide 5"""				Standard	NR_033808		Approved	PCN3, P450PCN3, CP35		P20815	OTTHUMG00000156724	ENST00000222982.4:c.303C>A	chr7.hg19:g.99270218G>T		149.0	0.0		131.0	48.0	NM_001190484	A4D289|B7Z5I7|Q53WY8|Q75MV0|Q9HB56	Silent	SNP	ENST00000222982.4	hg19	CCDS5672.1																																																																																			.	.		0.373	CYP3A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345469.1		
ZNF777	27153	hgsc.bcm.edu	37	7	149152414	149152414	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:149152414G>T	ENST00000247930.4	-	2	1023	c.700C>A	c.(700-702)Ctg>Atg	p.L234M		NM_015694.2	NP_056509.2	Q9ULD5	ZN777_HUMAN	zinc finger protein 777	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(5)|lung(17)|ovary(1)|skin(2)|urinary_tract(1)	26	Melanoma(164;0.165)		OV - Ovarian serous cystadenocarcinoma(82;0.00358)			TTGCTCTCCAGATGGTTCGCG	0.567																																					p.L234M		Atlas-SNP	.											.	ZNF777	63	.	0			c.C700A						.						78.0	89.0	85.0					7																	149152414		2203	4300	6503	SO:0001583	missense	27153	exon2			TCTCCAGATGGTT	AB033111	CCDS43675.1	7q36.1	2013-01-08			ENSG00000196453	ENSG00000196453		"""Zinc fingers, C2H2-type"", ""-"""	22213	protein-coding gene	gene with protein product							Standard	NM_015694		Approved	KIAA1285	uc003wfv.3	Q9ULD5	OTTHUMG00000158967	ENST00000247930.4:c.700C>A	chr7.hg19:g.149152414G>T	ENSP00000247930:p.Leu234Met	73.0	0.0		66.0	26.0	NM_015694	Q8N2R2|Q8N659	Missense_Mutation	SNP	ENST00000247930.4	hg19	CCDS43675.1	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835354	0.50951	.	.	ENSG00000196453	ENST00000247930	T	0.28255	1.62	4.93	2.15	0.27550	.	0.000000	0.34932	N	0.003570	T	0.37972	0.1023	L	0.35542	1.07	0.26908	N	0.966969	D	0.76494	0.999	D	0.85130	0.997	T	0.08576	-1.0715	10	0.72032	D	0.01	-15.6501	6.3893	0.21577	0.3015:0.0:0.6985:0.0	.	234	Q9ULD5-2	.	M	234	ENSP00000247930:L234M	ENSP00000247930:L234M	L	-	1	2	ZNF777	148783347	0.986000	0.35501	0.950000	0.38849	0.966000	0.64601	1.844000	0.39269	0.503000	0.28060	-0.137000	0.14449	CTG	.	.		0.567	ZNF777-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352708.1	NM_015694	
GIMAP1	170575	hgsc.bcm.edu	37	7	150416151	150416151	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:150416151A>C	ENST00000307194.5	+	2	156	c.16A>C	c.(16-18)Atg>Ctg	p.M6L		NM_130759.3	NP_570115.1	Q8WWP7	GIMA1_HUMAN	GTPase, IMAP family member 1	6					B cell differentiation (GO:0030183)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GTP binding (GO:0005525)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	28			OV - Ovarian serous cystadenocarcinoma(82;0.0145)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGGAAGGAAGATGGCGACAGA	0.413																																					p.M6L		Atlas-SNP	.											.	.	.	.	0			c.A16C						.						158.0	138.0	145.0					7																	150416151		2203	4300	6503	SO:0001583	missense	0	exon2			AGGAAGATGGCGA	AJ306287	CCDS5906.1	7q36.1	2014-04-04			ENSG00000213203	ENSG00000213203		"""GTPases, IMAP"""	23237	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 2"""	608084				15474311, 18701445	Standard	NM_130759		Approved	HIMAP1, IMAP38, IMAP1, IAN2		Q8WWP7	OTTHUMG00000157489	ENST00000307194.5:c.16A>C	chr7.hg19:g.150416151A>C	ENSP00000302833:p.Met6Leu	73.0	0.0		50.0	23.0	NM_001199577	B2RCI3|Q8NAZ0	Missense_Mutation	SNP	ENST00000307194.5	hg19	CCDS5906.1	.	.	.	.	.	.	.	.	.	.	A	8.044	0.764579	0.15914	.	.	ENSG00000213203	ENST00000307194	T	0.04360	3.64	4.42	2.08	0.27032	.	105.238000	0.00741	U	0.001014	T	0.02455	0.0075	N	0.03608	-0.345	0.09310	N	0.999999	B	0.31485	0.325	B	0.21917	0.037	T	0.32903	-0.9889	10	0.23891	T	0.37	.	5.3634	0.16101	0.7725:0.0:0.2275:0.0	.	6	Q8WWP7	GIMA1_HUMAN	L	6	ENSP00000302833:M6L	ENSP00000302833:M6L	M	+	1	0	GIMAP1	150047084	0.014000	0.17966	0.516000	0.27786	0.112000	0.19704	0.054000	0.14205	0.846000	0.35142	0.533000	0.62120	ATG	.	.		0.413	GIMAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348951.2	NM_130759	
HTR5A	3361	hgsc.bcm.edu	37	7	154862937	154862937	+	Missense_Mutation	SNP	G	G	T	rs141719500		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:154862937G>T	ENST00000287907.2	+	1	904	c.328G>T	c.(328-330)Ggt>Tgt	p.G110C	HTR5A-AS1_ENST00000395731.2_Missense_Mutation_p.P26H|HTR5A-AS1_ENST00000493904.1_5'UTR|HTR5A-AS1_ENST00000543018.1_Missense_Mutation_p.P26H	NM_024012.3	NP_076917.1	P47898	5HT5A_HUMAN	5-hydroxytryptamine (serotonin) receptor 5A, G protein-coupled	110					cAMP-mediated signaling (GO:0019933)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|hippocampus development (GO:0021766)|response to estradiol (GO:0032355)|serotonin receptor signaling pathway (GO:0007210)	dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(3)|stomach(1)	48	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0238)	UCEC - Uterine corpus endometrioid carcinoma (81;0.171)	Asenapine(DB06216)|Loxapine(DB00408)|Olanzapine(DB00334)	CTGGCAGCTAGGTCGGAGGCT	0.662																																					p.G110C		Atlas-SNP	.											HTR5A,NS,carcinoma,0,1	HTR5A	114	.	0			c.G328T						.						50.0	42.0	45.0					7																	154862937		2203	4300	6503	SO:0001583	missense	3361	exon1			CAGCTAGGTCGGA		CCDS5936.1	7q36.1	2012-08-08	2012-02-03		ENSG00000157219	ENSG00000157219		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5300	protein-coding gene	gene with protein product		601305	"""5-hydroxytryptamine (serotonin) receptor 5A"""			7988681	Standard	NM_024012		Approved	5-HT5A	uc003wlu.2	P47898	OTTHUMG00000151327	ENST00000287907.2:c.328G>T	chr7.hg19:g.154862937G>T	ENSP00000287907:p.Gly110Cys	26.0	0.0		14.0	6.0	NM_024012	Q2M2D2	Missense_Mutation	SNP	ENST00000287907.2	hg19	CCDS5936.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.3|24.3	4.516282|4.516282	0.85495|0.85495	.|.	.|.	ENSG00000157219|ENSG00000220575	ENST00000287907|ENST00000395731;ENST00000543018	T|.	0.51325|.	0.71|.	4.52|4.52	4.52|4.52	0.55395|0.55395	GPCR, rhodopsin-like superfamily (1);|.	0.052450|.	0.85682|.	D|.	0.000000|.	D|D	0.90494|0.90494	0.7022|0.7022	H|H	0.98682|0.98682	4.3|4.3	0.80722|0.80722	D|D	1|1	D|D	0.89917|0.89917	1.0|1.0	D|D	0.97110|0.97110	1.0|1.0	D|D	0.94453|0.94453	0.7669|0.7669	10|8	0.87932|0.87932	D|D	0|0	.|.	17.4477|17.4477	0.87583|0.87583	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	110|26	P47898|B7Z8E6	5HT5A_HUMAN|.	C|H	110|26	ENSP00000287907:G110C|.	ENSP00000287907:G110C|ENSP00000379080:P26H	G|P	+|-	1|2	0|0	HTR5A|AC093726.4	154493870|154493870	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.824000|0.824000	0.46624|0.46624	9.228000|9.228000	0.95250|0.95250	2.338000|2.338000	0.79540|0.79540	0.563000|0.563000	0.77884|0.77884	GGT|CCT	.	G|1.000;C|0.000		0.662	HTR5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322240.1	NM_024012	
IMPAD1	54928	hgsc.bcm.edu	37	8	57892756	57892756	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr8:57892756T>C	ENST00000262644.4	-	2	646	c.388A>G	c.(388-390)Att>Gtt	p.I130V		NM_017813.4	NP_060283.3	Q9NX62	IMPA3_HUMAN	inositol monophosphatase domain containing 1	130					chondrocyte development (GO:0002063)|chondroitin sulfate metabolic process (GO:0030204)|embryonic digit morphogenesis (GO:0042733)|endochondral ossification (GO:0001958)|inositol biosynthetic process (GO:0006021)|phosphatidylinositol phosphorylation (GO:0046854)|post-embryonic development (GO:0009791)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|3'-nucleotidase activity (GO:0008254)|inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7		all_cancers(86;0.175)|all_lung(136;0.0321)|Lung NSC(129;0.0417)|all_epithelial(80;0.0448)				TCAGTATTAATCTGCATTAAA	0.343																																					p.I130V		Atlas-SNP	.											.	IMPAD1	27	.	0			c.A388G						.						72.0	63.0	66.0					8																	57892756		2203	4300	6503	SO:0001630	splice_region_variant	54928	exon2			TATTAATCTGCAT		CCDS6169.1	8q12.1	2013-05-16			ENSG00000104331	ENSG00000104331			26019	protein-coding gene	gene with protein product		614010				21549340	Standard	NM_017813		Approved	FLJ20421, IMPA3, gPAPP	uc003xte.4	Q9NX62	OTTHUMG00000164415	ENST00000262644.4:c.388-1A>G	chr8.hg19:g.57892756T>C		96.0	0.0		66.0	38.0	NM_017813	Q6NVY7	Missense_Mutation	SNP	ENST00000262644.4	hg19	CCDS6169.1	.	.	.	.	.	.	.	.	.	.	T	2.671	-0.277570	0.05679	.	.	ENSG00000104331	ENST00000262644;ENST00000517461	T;T	0.53206	0.63;0.91	5.66	5.66	0.87406	.	0.052331	0.85682	D	0.000000	T	0.22781	0.0550	N	0.05554	-0.025	0.53688	D	0.999977	B	0.11235	0.004	B	0.10450	0.005	T	0.15321	-1.0441	10	0.02654	T	1	0.0174	9.5556	0.39337	0.0:0.0779:0.0:0.9221	.	130	Q9NX62	IMPA3_HUMAN	V	130;55	ENSP00000262644:I130V;ENSP00000430185:I55V	ENSP00000262644:I130V	I	-	1	0	IMPAD1	58055310	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	4.712000	0.61888	2.152000	0.67230	0.528000	0.53228	ATT	.	.		0.343	IMPAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378665.1	NM_017813	Missense_Mutation
TMEM74	157753	hgsc.bcm.edu	37	8	109796877	109796877	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr8:109796877C>A	ENST00000297459.3	-	2	629	c.451G>T	c.(451-453)Gct>Tct	p.A151S	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	151					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			GATATGGCAGCCTCTTGGGAC	0.493																																					p.A151S		Atlas-SNP	.											.	TMEM74	70	.	0			c.G451T						.						83.0	87.0	86.0					8																	109796877		2203	4300	6503	SO:0001583	missense	157753	exon2			TGGCAGCCTCTTG	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.451G>T	chr8.hg19:g.109796877C>A	ENSP00000297459:p.Ala151Ser	143.0	0.0		240.0	114.0	NM_153015		Missense_Mutation	SNP	ENST00000297459.3	hg19	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	C	6.360	0.434450	0.12045	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.96	2.03	0.26663	.	0.457774	0.23573	N	0.046724	T	0.15392	0.0371	N	0.16478	0.41	0.19300	N	0.999978	B	0.18310	0.027	B	0.15052	0.012	T	0.20874	-1.0262	9	0.10902	T	0.67	-3.8437	2.2102	0.03945	0.3511:0.3112:0.2091:0.1285	.	151	Q96NL1	TMM74_HUMAN	S	151	.	ENSP00000297459:A151S	A	-	1	0	TMEM74	109866053	0.195000	0.23338	0.758000	0.31321	0.995000	0.86356	0.114000	0.15520	0.088000	0.17205	0.655000	0.94253	GCT	.	.		0.493	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
CSMD3	114788	hgsc.bcm.edu	37	8	113418769	113418769	+	Silent	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr8:113418769G>T	ENST00000297405.5	-	35	6037	c.5793C>A	c.(5791-5793)tcC>tcA	p.S1931S	CSMD3_ENST00000352409.3_Silent_p.S1861S|CSMD3_ENST00000343508.3_Silent_p.S1891S|CSMD3_ENST00000455883.2_Silent_p.S1827S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1931	Sushi 10. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S1931S(1)|p.S1891S(1)		breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AAGTAGGTAAGGAATCATTCC	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.S1931S		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,0,1	CSMD3	2325	.	2	Substitution - coding silent(2)	endometrium(2)	c.C5793A						.						81.0	82.0	81.0					8																	113418769		2203	4300	6503	SO:0001819	synonymous_variant	114788	exon35			AGGTAAGGAATCA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.5793C>A	chr8.hg19:g.113418769G>T		170.0	0.0		222.0	85.0	NM_198123	Q96PZ3	Silent	SNP	ENST00000297405.5	hg19	CCDS6315.1																																																																																			.	.		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
MRPL13	28998	hgsc.bcm.edu	37	8	121444294	121444294	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr8:121444294T>C	ENST00000306185.3	-	3	512	c.221A>G	c.(220-222)cAa>cGa	p.Q74R		NM_014078.5	NP_054797.2	Q9BYD1	RM13_HUMAN	mitochondrial ribosomal protein L13	74					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	6	Lung NSC(37;1.69e-07)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			GTATACTTTTTGTTCCCATTT	0.308																																					p.Q74R		Atlas-SNP	.											.	MRPL13	18	.	0			c.A221G						.						123.0	118.0	119.0					8																	121444294		2203	4295	6498	SO:0001583	missense	28998	exon3			ACTTTTTGTTCCC	AB049640	CCDS6332.1	8q22.1-q22.3	2012-09-13			ENSG00000172172	ENSG00000172172		"""Mitochondrial ribosomal proteins / large subunits"""	14278	protein-coding gene	gene with protein product		610200				11543634	Standard	NM_014078		Approved	L13, RPL13, L13mt, RPML13, L13A	uc003ypa.3	Q9BYD1	OTTHUMG00000165039	ENST00000306185.3:c.221A>G	chr8.hg19:g.121444294T>C	ENSP00000306548:p.Gln74Arg	138.0	0.0		207.0	21.0	NM_014078	B2R4R8|Q9UI04	Missense_Mutation	SNP	ENST00000306185.3	hg19	CCDS6332.1	.	.	.	.	.	.	.	.	.	.	T	13.33	2.204137	0.38905	.	.	ENSG00000172172	ENST00000306185;ENST00000518918	.	.	.	6.05	6.05	0.98169	Ribosomal protein L13 domain (2);	0.052647	0.85682	D	0.000000	T	0.67720	0.2923	M	0.67953	2.075	0.80722	D	1	P	0.38922	0.651	P	0.45428	0.48	T	0.65364	-0.6186	9	0.30078	T	0.28	-1.5778	15.5839	0.76468	0.0:0.0:0.0:1.0	.	74	Q9BYD1	RM13_HUMAN	R	74;50	.	ENSP00000306548:Q74R	Q	-	2	0	MRPL13	121513475	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.293000	0.78740	2.323000	0.78572	0.467000	0.42956	CAA	.	.		0.308	MRPL13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381523.1	NM_014078	
KDM4C	23081	hgsc.bcm.edu	37	9	6986628	6986628	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:6986628G>C	ENST00000381309.3	+	11	2204	c.1639G>C	c.(1639-1641)Gtc>Ctc	p.V547L	KDM4C_ENST00000535193.1_Missense_Mutation_p.V569L|KDM4C_ENST00000543771.1_Missense_Mutation_p.V547L|KDM4C_ENST00000536108.1_Missense_Mutation_p.V366L|KDM4C_ENST00000442236.2_Intron|KDM4C_ENST00000381306.3_Missense_Mutation_p.V547L|KDM4C_ENST00000428870.2_Missense_Mutation_p.V234L	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	547					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						AATCCCAGCGGTCCCCAGTGG	0.453																																					p.V569L		Atlas-SNP	.											.	KDM4C	186	.	0			c.G1705C						.						59.0	55.0	56.0					9																	6986628		2203	4300	6503	SO:0001583	missense	23081	exon11			CCAGCGGTCCCCA	AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.1639G>C	chr9.hg19:g.6986628G>C	ENSP00000370710:p.Val547Leu	100.0	0.0		61.0	11.0	NM_001146696	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	ENST00000381309.3	hg19	CCDS6471.1	.	.	.	.	.	.	.	.	.	.	G	2.403	-0.337167	0.05278	.	.	ENSG00000107077	ENST00000535193;ENST00000543771;ENST00000381309;ENST00000381306;ENST00000536108;ENST00000428870	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.3	0.0488	0.14286	.	3.220070	0.00589	N	0.000340	T	0.34571	0.0902	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.22146	0.065;0.065;0.007;0.006	B;B;B;B	0.24269	0.032;0.052;0.003;0.007	T	0.10268	-1.0637	10	0.23891	T	0.37	4.0028	5.9871	0.19440	0.4136:0.0:0.4688:0.1176	.	547;569;547;547	F5H347;F5H7P0;Q9H3R0;Q9H3R0-2	.;.;KDM4C_HUMAN;.	L	569;547;547;547;366;234	ENSP00000442382:V569L;ENSP00000445427:V547L;ENSP00000370710:V547L;ENSP00000370707:V547L;ENSP00000440656:V366L;ENSP00000405739:V234L	ENSP00000370707:V547L	V	+	1	0	KDM4C	6976628	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	0.001000	0.13038	0.065000	0.16485	-0.895000	0.02911	GTC	.	.		0.453	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051692.1	NM_015061	
FREM1	158326	hgsc.bcm.edu	37	9	14816776	14816776	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:14816776C>A	ENST00000380880.3	-	15	3423	c.2640G>T	c.(2638-2640)gaG>gaT	p.E880D	FREM1_ENST00000380881.4_Splice_Site_p.E881D|FREM1_ENST00000422223.2_Splice_Site_p.E880D			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	880					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		TTCTACCCACCTCAACATGTA	0.398																																					p.E880D		Atlas-SNP	.											.	FREM1	261	.	0			c.G2640T						.						47.0	49.0	48.0					9																	14816776		1844	4090	5934	SO:0001630	splice_region_variant	158326	exon16			ACCCACCTCAACA	AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.2640+1G>T	chr9.hg19:g.14816776C>A		63.0	0.0		40.0	25.0	NM_144966	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	ENST00000380880.3	hg19	CCDS47952.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.907761	0.33721	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380880	T;T;T	0.29655	1.56;1.56;1.56	5.65	4.75	0.60458	.	0.293619	0.42053	D	0.000765	T	0.22475	0.0542	L	0.28694	0.88	0.31559	N	0.6578	B	0.32051	0.354	B	0.34301	0.179	T	0.20672	-1.0268	9	.	.	.	-11.5591	10.3539	0.43952	0.0:0.9128:0.0:0.0872	.	880	Q5H8C1	FREM1_HUMAN	D	881;880;880	ENSP00000370263:E881D;ENSP00000412940:E880D;ENSP00000370262:E880D	.	E	-	3	2	FREM1	14806776	1.000000	0.71417	0.996000	0.52242	0.177000	0.22998	4.992000	0.63889	1.636000	0.50526	-0.136000	0.14681	GAG	.	.		0.398	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000339474.2	NM_144966	Missense_Mutation
GNE	10020	hgsc.bcm.edu	37	9	36246477	36246477	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:36246477T>C	ENST00000539815.1	-	2	207	c.167A>G	c.(166-168)aAt>aGt	p.N56S	GNE_ENST00000543356.2_Missense_Mutation_p.N51S|GNE_ENST00000396594.3_Missense_Mutation_p.N87S|GNE_ENST00000539208.1_5'UTR|GNE_ENST00000447283.2_Missense_Mutation_p.N56S|GNE_ENST00000377902.5_Missense_Mutation_p.N56S			Q9Y223	GLCNE_HUMAN	glucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase	56					carbohydrate phosphorylation (GO:0046835)|cell adhesion (GO:0007155)|N-acetylglucosamine biosynthetic process (GO:0006045)|N-acetylneuraminate metabolic process (GO:0006054)|UDP-N-acetylglucosamine metabolic process (GO:0006047)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|metal ion binding (GO:0046872)|N-acylmannosamine kinase activity (GO:0009384)|UDP-N-acetylglucosamine 2-epimerase activity (GO:0008761)			endometrium(8)|kidney(1)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			STAD - Stomach adenocarcinoma(86;0.228)			TCGATATGTATTTCTAAAGCC	0.408																																					p.N87S	GBM(184;106 2118 20004 35750 50727)	Atlas-SNP	.											.	GNE	141	.	0			c.A260G						.						40.0	42.0	42.0					9																	36246477		2182	4222	6404	SO:0001583	missense	10020	exon3			TATGTATTTCTAA	AF051852	CCDS6602.1, CCDS47965.1, CCDS55308.1, CCDS55309.1, CCDS55310.1	9p13.1	2008-02-05	2003-12-01		ENSG00000159921	ENSG00000159921			23657	protein-coding gene	gene with protein product		603824	"""UDP-N-acetylglucosamine-2-epimerase/N-acetylmannosamine kinase"""	IBM2		9305887, 9305888	Standard	NM_005476		Approved	Uae1	uc010mli.3	Q9Y223	OTTHUMG00000019899	ENST00000539815.1:c.167A>G	chr9.hg19:g.36246477T>C	ENSP00000439155:p.Asn56Ser	47.0	0.0		33.0	22.0	NM_001128227	A6PZH2|A6PZH3|A7UNU7|B2R6E1|B7Z372|B7Z428|D3DRP7|F5H499|H0YFA7|Q0VA94	Missense_Mutation	SNP	ENST00000539815.1	hg19	CCDS6602.1	.	.	.	.	.	.	.	.	.	.	T	5.379	0.255115	0.10185	.	.	ENSG00000159921	ENST00000377902;ENST00000396594;ENST00000339267;ENST00000539815;ENST00000543356;ENST00000447283	D;D;D;D	0.98926	-5.24;-5.24;-5.24;-5.24	5.02	5.02	0.67125	.	0.041538	0.85682	D	0.000000	D	0.94387	0.8195	N	0.11106	0.095	0.80722	D	1	B;B;B;B	0.25563	0.007;0.049;0.009;0.129	B;B;B;B	0.23716	0.007;0.019;0.012;0.048	D	0.93002	0.6424	10	0.15066	T	0.55	-17.5327	12.9937	0.58634	0.0:0.0:0.0:1.0	.	15;87;56;56	Q9Y223-3;Q9Y223-2;Q9Y223;A7UNU7	.;.;GLCNE_HUMAN;.	S	56;87;51;56;28;56	ENSP00000367134:N56S;ENSP00000379839:N87S;ENSP00000439155:N56S;ENSP00000414760:N56S	ENSP00000340770:N51S	N	-	2	0	GNE	36236477	1.000000	0.71417	1.000000	0.80357	0.031000	0.12232	7.301000	0.78850	2.006000	0.58801	0.383000	0.25322	AAT	.	.		0.408	GNE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052412.4	NM_005476	
TRPM3	80036	hgsc.bcm.edu	37	9	73442764	73442764	+	Splice_Site	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:73442764T>A	ENST00000377111.2	-	6	1215	c.972A>T	c.(970-972)acA>acT	p.T324T	TRPM3_ENST00000361823.5_Splice_Site_p.T171T|TRPM3_ENST00000396285.1_Splice_Site_p.T171T|TRPM3_ENST00000423814.3_Splice_Site_p.T326T|TRPM3_ENST00000360823.2_Splice_Site_p.T171T|TRPM3_ENST00000357533.2_Splice_Site_p.T326T|TRPM3_ENST00000358082.3_Splice_Site_p.T171T|TRPM3_ENST00000377105.1_Splice_Site_p.T171T|TRPM3_ENST00000396280.5_Splice_Site_p.T171T|TRPM3_ENST00000396283.1_Splice_Site_p.T171T|TRPM3_ENST00000377101.1_Splice_Site_p.T171T|TRPM3_ENST00000396292.4_Splice_Site_p.T171T|TRPM3_ENST00000377106.1_Splice_Site_p.T171T|TRPM3_ENST00000377110.3_Splice_Site_p.T324T|TRPM3_ENST00000408909.2_Splice_Site_p.T171T	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	324					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GCTACTTACTTGTGTTTATCT	0.423																																					p.T324T		Atlas-SNP	.											.	TRPM3	700	.	0			c.A972T						.						185.0	168.0	174.0					9																	73442764		2203	4300	6503	SO:0001630	splice_region_variant	80036	exon6			CTTACTTGTGTTT	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.973+1A>T	chr9.hg19:g.73442764T>A		80.0	0.0		81.0	20.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Silent	SNP	ENST00000377111.2	hg19		.	.	.	.	.	.	.	.	.	.	T	15.01	2.706398	0.48412	.	.	ENSG00000083067	ENST00000396280	.	.	.	5.53	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-21.6134	10.003	0.41940	0.0:0.1412:0.0:0.8588	.	.	.	.	X	171	.	.	K	-	1	0	TRPM3	72632584	0.999000	0.42202	1.000000	0.80357	0.994000	0.84299	0.469000	0.22067	0.931000	0.37242	0.528000	0.53228	AAG	.	.		0.423	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	Silent
TRPM3	80036	hgsc.bcm.edu	37	9	73479369	73479369	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:73479369G>C	ENST00000377111.2	-	2	479	c.236C>G	c.(235-237)cCc>cGc	p.P79R	TRPM3_ENST00000361823.5_5'UTR|TRPM3_ENST00000377097.3_5'Flank|TRPM3_ENST00000396285.1_5'Flank|TRPM3_ENST00000423814.3_Missense_Mutation_p.P81R|TRPM3_ENST00000360823.2_5'UTR|TRPM3_ENST00000357533.2_Missense_Mutation_p.P81R|TRPM3_ENST00000358082.3_5'Flank|TRPM3_ENST00000377105.1_5'UTR|TRPM3_ENST00000437699.3_5'UTR|TRPM3_ENST00000396280.5_5'Flank|TRPM3_ENST00000396283.1_5'UTR|TRPM3_ENST00000377101.1_5'UTR|TRPM3_ENST00000396292.4_5'Flank|TRPM3_ENST00000377106.1_5'UTR|TRPM3_ENST00000377110.3_Missense_Mutation_p.P79R|TRPM3_ENST00000408909.2_5'Flank	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	79					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TTTGGTGCTGGGTATGATGTG	0.328																																					p.P79R		Atlas-SNP	.											.	TRPM3	700	.	0			c.C236G						.						163.0	155.0	158.0					9																	73479369		1804	4075	5879	SO:0001583	missense	80036	exon2			GTGCTGGGTATGA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.236C>G	chr9.hg19:g.73479369G>C	ENSP00000366315:p.Pro79Arg	51.0	0.0		38.0	12.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377111.2	hg19		.	.	.	.	.	.	.	.	.	.	G	23.5	4.425469	0.83667	.	.	ENSG00000083067	ENST00000377111;ENST00000377110;ENST00000357533;ENST00000423814	T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17	5.88	5.88	0.94601	.	0.132785	0.52532	D	0.000076	T	0.79405	0.4440	M	0.74546	2.27	0.80722	D	1	P;D;P;D	0.65815	0.835;0.973;0.946;0.995	B;P;P;D	0.65323	0.391;0.822;0.894;0.934	T	0.78961	-0.1997	10	0.54805	T	0.06	-0.864	20.2296	0.98347	0.0:0.0:1.0:0.0	.	79;81;79;79	Q9HCF6;Q4VXD2;Q9HCF6-2;Q9HCF6-10	TRPM3_HUMAN;.;.;.	R	79;79;81;81	ENSP00000366315:P79R;ENSP00000366314:P79R;ENSP00000350140:P81R;ENSP00000389542:P81R	ENSP00000350140:P81R	P	-	2	0	TRPM3	72669189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.312000	0.78968	2.782000	0.95742	0.563000	0.77884	CCC	.	.		0.328	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000214157.5	NM_206945	
PRUNE2	158471	hgsc.bcm.edu	37	9	79322771	79322771	+	Silent	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:79322771C>T	ENST00000376718.3	-	8	4542	c.4419G>A	c.(4417-4419)gaG>gaA	p.E1473E	PRUNE2_ENST00000428286.1_Silent_p.E1114E	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1473					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CGTTCTCTGGCTCTAGAAAGT	0.448																																					p.E1473E		Atlas-SNP	.											.	PRUNE2	331	.	0			c.G4419A						.						47.0	48.0	48.0					9																	79322771		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon8			CTCTGGCTCTAGA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4419G>A	chr9.hg19:g.79322771C>T		65.0	0.0		37.0	19.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.488548	0.01018	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.49	-0.808	0.10868	.	.	.	.	.	T	0.21427	0.0516	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25572	-1.0128	4	.	.	.	-1.5801	3.323	0.07057	0.2949:0.2947:0.0:0.4104	.	.	.	.	T	795	.	.	A	-	1	0	PRUNE2	78512591	0.000000	0.05858	0.049000	0.19019	0.021000	0.10359	0.067000	0.14510	-0.106000	0.12110	-0.169000	0.13324	GCC	.	.		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PSAT1	29968	hgsc.bcm.edu	37	9	80923477	80923477	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:80923477T>C	ENST00000376588.3	+	6	786	c.718T>C	c.(718-720)Tac>Cac	p.Y240H	PSAT1_ENST00000347159.2_Missense_Mutation_p.Y240H	NM_058179.2	NP_478059.1	Q9Y617	SERC_HUMAN	phosphoserine aminotransferase 1	240					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-serine biosynthetic process (GO:0006564)|pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	O-phospho-L-serine:2-oxoglutarate aminotransferase activity (GO:0004648)|pyridoxal phosphate binding (GO:0030170)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|urinary_tract(1)	20						CAGCTCCTTGTACAACACGCC	0.527																																					p.Y240H	Colon(34;187 791 10662 18313 37609)	Atlas-SNP	.											.	PSAT1	33	.	0			c.T718C						.						92.0	75.0	81.0					9																	80923477		2203	4300	6503	SO:0001583	missense	29968	exon6			TCCTTGTACAACA	BC004863	CCDS6659.1, CCDS6660.1	9q21.2	2008-08-11			ENSG00000135069	ENSG00000135069			19129	protein-coding gene	gene with protein product		610936				12633500, 3651428	Standard	NM_058179		Approved	PSA	uc004ala.3	Q9Y617	OTTHUMG00000020066	ENST00000376588.3:c.718T>C	chr9.hg19:g.80923477T>C	ENSP00000365773:p.Tyr240His	40.0	0.0		31.0	18.0	NM_021154	Q5T7G5|Q5T7G6|Q96AW2|Q9BQ12	Missense_Mutation	SNP	ENST00000376588.3	hg19	CCDS6660.1	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555298	0.65425	.	.	ENSG00000135069	ENST00000421149;ENST00000347159;ENST00000376588	D;D	0.87650	-2.28;-2.28	5.72	5.72	0.89469	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.93588	0.7953	M	0.82517	2.595	0.80722	D	1	D;B	0.89917	1.0;0.015	D;B	0.71414	0.973;0.025	D	0.94271	0.7511	10	0.66056	D	0.02	-7.6481	15.9995	0.80280	0.0:0.0:0.0:1.0	.	240;240	Q9Y617-2;Q9Y617	.;SERC_HUMAN	H	64;240;240	ENSP00000317606:Y240H;ENSP00000365773:Y240H	ENSP00000317606:Y240H	Y	+	1	0	PSAT1	80113297	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	7.645000	0.83430	2.186000	0.69663	0.528000	0.53228	TAC	.	.		0.527	PSAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052777.1	NM_021154	
GFI1B	8328	hgsc.bcm.edu	37	9	135862139	135862139	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:135862139C>T	ENST00000339463.3	+	6	893	c.74C>T	c.(73-75)cCg>cTg	p.P25L	GFI1B_ENST00000534944.1_Missense_Mutation_p.P25L|GFI1B_ENST00000372123.1_Missense_Mutation_p.P25L|GFI1B_ENST00000372122.1_Missense_Mutation_p.P25L|GFI1B_ENST00000372124.1_Missense_Mutation_p.P25L|GFI1B_ENST00000450530.1_Missense_Mutation_p.P25L			Q5VTD9	GFI1B_HUMAN	growth factor independent 1B transcription repressor	25					cell proliferation (GO:0008283)|chromatin modification (GO:0016568)|multicellular organismal development (GO:0007275)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of histone H3-K9 methylation (GO:0051574)|regulation of erythrocyte differentiation (GO:0045646)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear matrix (GO:0016363)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II transcription factor binding (GO:0001085)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;9.04e-07)|Epithelial(140;1.17e-05)		GAAGATGAACCGCTCTGGCCT	0.642																																					p.P25L		Atlas-SNP	.											.	GFI1B	37	.	0			c.C74T						.						59.0	53.0	55.0					9																	135862139		2203	4300	6503	SO:0001583	missense	8328	exon2			ATGAACCGCTCTG	AF081946	CCDS6957.1, CCDS48049.1	9q34.13	2014-09-17	2007-10-04		ENSG00000165702	ENSG00000165702		"""Zinc fingers, C2H2-type"""	4238	protein-coding gene	gene with protein product		604383	"""growth factor independent 1B (potential regulator of CDKN1A, translocated in CML)"""			9878267	Standard	NM_001135031		Approved		uc004ccg.3	Q5VTD9	OTTHUMG00000020848	ENST00000339463.3:c.74C>T	chr9.hg19:g.135862139C>T	ENSP00000344782:p.Pro25Leu	64.0	0.0		34.0	17.0	NM_001135031	O95270|Q5VTD8|Q6FHZ2|Q6T888	Missense_Mutation	SNP	ENST00000339463.3	hg19	CCDS6957.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286287	0.23478	.	.	ENSG00000165702	ENST00000372124;ENST00000339463;ENST00000450530;ENST00000534944;ENST00000372123;ENST00000372122	T;T;T;T;T;T	0.08008	3.18;3.14;3.14;3.18;3.18;3.14	5.28	-2.43	0.06522	.	0.575690	0.17209	N	0.182786	T	0.03608	0.0103	N	0.04043	-0.29	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.37337	-0.9710	10	0.30078	T	0.28	-2.9696	12.6834	0.56934	0.0:0.229:0.0:0.771	.	25;25	Q5VTD9-2;Q5VTD9	.;GFI1B_HUMAN	L	25	ENSP00000361197:P25L;ENSP00000344782:P25L;ENSP00000409546:P25L;ENSP00000446134:P25L;ENSP00000361196:P25L;ENSP00000361195:P25L	ENSP00000344782:P25L	P	+	2	0	GFI1B	134851960	0.000000	0.05858	0.000000	0.03702	0.412000	0.31113	-0.037000	0.12164	-0.733000	0.04850	-0.266000	0.10368	CCG	.	.		0.642	GFI1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393840.1	NM_004188	
KCNT1	57582	hgsc.bcm.edu	37	9	138676396	138676396	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:138676396T>A	ENST00000263604.3	+	26	2902	c.2902T>A	c.(2902-2904)Tac>Aac	p.Y968N	KCNT1_ENST00000488444.2_Missense_Mutation_p.Y968N|KCNT1_ENST00000490355.2_Missense_Mutation_p.Y966N|KCNT1_ENST00000491806.2_Missense_Mutation_p.Y954N|KCNT1_ENST00000487664.1_Missense_Mutation_p.Y942N|KCNT1_ENST00000486577.2_Missense_Mutation_p.Y946N|KCNT1_ENST00000298480.5_Missense_Mutation_p.Y987N|KCNT1_ENST00000371757.2_Missense_Mutation_p.Y987N			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	968					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CGTGAAGGACTACATGATCAC	0.706																																					p.Y987N		Atlas-SNP	.											.	KCNT1	139	.	0			c.T2959A						.						14.0	14.0	14.0					9																	138676396		2174	4286	6460	SO:0001583	missense	57582	exon26			AAGGACTACATGA	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2902T>A	chr9.hg19:g.138676396T>A	ENSP00000263604:p.Tyr968Asn	114.0	0.0		62.0	24.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	hg19		.	.	.	.	.	.	.	.	.	.	T	23.9	4.472489	0.84640	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.79454	-1.27;-1.27;-1.27;-1.27	4.62	4.62	0.57501	.	0.075052	0.56097	U	0.000037	D	0.86360	0.5914	M	0.74647	2.275	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.99;0.99;0.997;0.987	D	0.85236	0.1035	10	0.30078	T	0.28	-22.1584	14.0134	0.64511	0.0:0.0:0.0:1.0	.	954;987;942;968	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	N	942;987;987;946;954;968;966;968	ENSP00000417851:Y942N;ENSP00000298480:Y987N;ENSP00000360822:Y987N;ENSP00000263604:Y968N	ENSP00000263604:Y968N	Y	+	1	0	KCNT1	137816217	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.613000	0.61176	1.714000	0.51371	0.375000	0.23000	TAC	.	.		0.706	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
FAM69B	138311	hgsc.bcm.edu	37	9	139612124	139612124	+	Nonsense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr9:139612124C>A	ENST00000371692.4	+	2	255	c.159C>A	c.(157-159)taC>taA	p.Y53*		NM_152421.3	NP_689634.2	Q5VUD6	FA69B_HUMAN	family with sequence similarity 69, member B	53						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|endometrium(3)|large_intestine(2)|lung(1)|prostate(1)	8	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;1.03e-05)|Epithelial(140;0.00013)		ACTCGTCCTACTCGGAGCGCT	0.662																																					p.Y53X		Atlas-SNP	.											.	FAM69B	22	.	0			c.C159A						.						110.0	89.0	96.0					9																	139612124		2202	4300	6502	SO:0001587	stop_gained	138311	exon2			GTCCTACTCGGAG		CCDS7004.1	9q34.3	2012-08-03			ENSG00000165716	ENSG00000165716			28290	protein-coding gene	gene with protein product		614543				21334309	Standard	NM_152421		Approved	MGC20262, C9orf136	uc004cik.3	Q5VUD6	OTTHUMG00000020940	ENST00000371692.4:c.159C>A	chr9.hg19:g.139612124C>A	ENSP00000360757:p.Tyr53*	28.0	0.0		27.0	15.0	NM_152421	Q5VUD7|Q8N5N0|Q8WYU5	Nonsense_Mutation	SNP	ENST00000371692.4	hg19	CCDS7004.1	.	.	.	.	.	.	.	.	.	.	C	21.5	4.157802	0.78114	.	.	ENSG00000165716	ENST00000371692	.	.	.	4.67	1.75	0.24633	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.6156	8.2485	0.31704	0.0:0.7294:0.0:0.2706	.	.	.	.	X	53	.	ENSP00000360757:Y53X	Y	+	3	2	FAM69B	138731945	1.000000	0.71417	0.857000	0.33713	0.304000	0.27724	1.259000	0.32956	0.060000	0.16281	0.478000	0.44815	TAC	.	.		0.662	FAM69B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055102.1	NM_152421	
PARD3	56288	hgsc.bcm.edu	37	10	34558586	34558586	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr10:34558586T>C	ENST00000374789.3	-	22	3752	c.3427A>G	c.(3427-3429)Agt>Ggt	p.S1143G	PARD3_ENST00000374790.3_Splice_Site_p.S1083G|PARD3_ENST00000545693.1_Splice_Site_p.S1127G|PARD3_ENST00000374788.3_Splice_Site_p.S1140G|PARD3_ENST00000350537.4_Splice_Site_p.S1097G|PARD3_ENST00000466092.1_5'Flank|PARD3_ENST00000374794.3_Splice_Site_p.S1031G|PARD3_ENST00000346874.4_Splice_Site_p.S1106G|PARD3_ENST00000545260.1_Splice_Site_p.S1053G	NM_019619.3	NP_062565.2	Q8TEW0	PARD3_HUMAN	par-3 family cell polarity regulator	1143					apical constriction (GO:0003383)|asymmetric cell division (GO:0008356)|axonogenesis (GO:0007409)|cell cycle (GO:0007049)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|centrosome localization (GO:0051642)|establishment of epithelial cell polarity (GO:0090162)|establishment or maintenance of cell polarity (GO:0007163)|microtubule cytoskeleton organization (GO:0000226)|myelination in peripheral nervous system (GO:0022011)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein targeting to membrane (GO:0006612)|regulation of actin filament-based process (GO:0032970)|regulation of cellular localization (GO:0060341)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing, spreading of cells (GO:0044319)	apical part of cell (GO:0045177)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|internode region of axon (GO:0033269)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|tight junction (GO:0005923)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	63		Breast(68;0.0707)				GGCGCCTACCTGTCTACAGGT	0.498																																					p.S1143G		Atlas-SNP	.											.	PARD3	131	.	0			c.A3427G						.						79.0	66.0	71.0					10																	34558586		2203	4300	6503	SO:0001630	splice_region_variant	56288	exon22			CCTACCTGTCTAC	AF252293	CCDS7178.1, CCDS53509.1, CCDS53510.1, CCDS53511.1, CCDS53512.1, CCDS53513.1, CCDS53514.1, CCDS53515.1, CCDS53516.1	10p11.22	2014-06-13	2013-08-28		ENSG00000148498	ENSG00000148498			16051	protein-coding gene	gene with protein product	"""atypical PKC isotype-specific interacting protein"", ""par-3 family cell polarity regulator alpha"", ""protein phosphatase 1, regulatory subunit 118"""	606745	"""par-3 (partitioning defective 3, C.elegans) homolog"", ""par-3 partitioning defective 3 homolog (C. elegans)"""			10934474	Standard	NM_001184790		Approved	PAR3, PARD3A, Bazooka, Baz, ASIP, PPP1R118	uc010qej.2	Q8TEW0	OTTHUMG00000017948	ENST00000374789.3:c.3428+1A>G	chr10.hg19:g.34558586T>C		96.0	0.0		77.0	28.0	NM_019619	F5H5T0|Q5T2U1|Q5VUA2|Q5VUA3|Q5VWV0|Q5VWV1|Q5VWV3|Q5VWV4|Q5VWV5|Q6IQ47|Q8TCZ9|Q8TEW1|Q8TEW2|Q8TEW3|Q96K28|Q96RM6|Q96RM7|Q9BY57|Q9BY58|Q9HC48|Q9NWL4|Q9NYE6	Missense_Mutation	SNP	ENST00000374789.3	hg19	CCDS7178.1	.	.	.	.	.	.	.	.	.	.	T	19.32	3.805839	0.70682	.	.	ENSG00000148498	ENST00000545693;ENST00000545260;ENST00000374789;ENST00000374788;ENST00000346874;ENST00000374794;ENST00000350537;ENST00000374790	T;T;T;T;T;T;T;T	0.20332	2.15;2.08;2.21;2.21;2.24;2.19;2.08;2.15	5.78	4.65	0.58169	.	0.252027	0.56097	N	0.000029	T	0.23965	0.0580	L	0.54323	1.7	0.80722	D	1	B;P;B;P;P;B;P;P	0.42296	0.004;0.729;0.001;0.775;0.675;0.002;0.675;0.547	B;B;B;B;B;B;B;B	0.41988	0.014;0.288;0.004;0.276;0.372;0.014;0.372;0.205	T	0.01626	-1.1309	10	0.52906	T	0.07	.	11.9932	0.53186	0.0:0.0676:0.0:0.9324	.	1031;1053;1060;1097;1127;1106;1140;1143	Q8TEW0-5;Q8TEW0-3;Q8TEW0-7;Q8TEW0-6;F5H5T0;Q8TEW0-4;Q8TEW0-2;Q8TEW0	.;.;.;.;.;.;.;PARD3_HUMAN	G	1127;1053;1143;1140;1106;1031;1097;1083	ENSP00000443147:S1127G;ENSP00000440857:S1053G;ENSP00000363921:S1143G;ENSP00000363920:S1140G;ENSP00000340591:S1106G;ENSP00000363926:S1031G;ENSP00000311986:S1097G;ENSP00000363922:S1083G	ENSP00000340591:S1106G	S	-	1	0	PARD3	34598592	1.000000	0.71417	1.000000	0.80357	0.756000	0.42949	4.435000	0.59941	1.129000	0.42072	0.482000	0.46254	AGT	.	.		0.498	PARD3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047527.1	NM_019619	Missense_Mutation
CSTF2T	23283	hgsc.bcm.edu	37	10	53458521	53458521	+	Silent	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr10:53458521T>A	ENST00000331173.4	-	1	834	c.789A>T	c.(787-789)ccA>ccT	p.P263P	PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000401604.2_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	263	Gly-rich.				mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		GCCCTGGAGCTGGAATTCCAC	0.567																																					p.P263P		Atlas-SNP	.											.	CSTF2T	64	.	0			c.A789T						.						44.0	48.0	47.0					10																	53458521		2203	4300	6503	SO:0001819	synonymous_variant	23283	exon1			TGGAGCTGGAATT	AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.789A>T	chr10.hg19:g.53458521T>A		49.0	0.0		48.0	23.0	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Silent	SNP	ENST00000331173.4	hg19	CCDS7245.1																																																																																			.	.		0.567	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
PCDH15	65217	hgsc.bcm.edu	37	10	55582876	55582876	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr10:55582876G>T	ENST00000320301.6	-	33	5004	c.4610C>A	c.(4609-4611)tCa>tAa	p.S1537*	PCDH15_ENST00000361849.3_Nonsense_Mutation_p.S1539*|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000414778.1_Intron|PCDH15_ENST00000437009.1_Nonsense_Mutation_p.S1468*|PCDH15_ENST00000395433.1_Nonsense_Mutation_p.S1514*|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000395432.2_Nonsense_Mutation_p.S1497*|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395430.1_Nonsense_Mutation_p.S1534*	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1537					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				TGAATTTGTTGATACTTGACT	0.373										HNSCC(58;0.16)																											p.S1544X		Atlas-SNP	.											.	PCDH15	1715	.	0			c.C4631A						.						85.0	92.0	89.0					10																	55582876		2203	4299	6502	SO:0001587	stop_gained	65217	exon35			TTTGTTGATACTT	AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4610C>A	chr10.hg19:g.55582876G>T	ENSP00000322604:p.Ser1537*	65.0	0.0		53.0	22.0	NM_001142763	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Nonsense_Mutation	SNP	ENST00000320301.6	hg19	CCDS7248.1	.	.	.	.	.	.	.	.	.	.	G	41	9.141149	0.99078	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.4151	0.67145	0.0:0.0:0.8524:0.1476	.	.	.	.	X	1497;1539;1514;1537;1534;1544;1468	.	ENSP00000322604:S1537X	S	-	2	0	PCDH15	55252882	0.952000	0.32445	0.034000	0.17996	0.002000	0.02628	3.852000	0.55934	2.700000	0.92200	0.650000	0.86243	TCA	.	.		0.373	PCDH15-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000048121.2	NM_033056	
CCSER2	54462	hgsc.bcm.edu	37	10	86131217	86131217	+	Nonsense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr10:86131217G>T	ENST00000224756.8	+	2	594	c.409G>T	c.(409-411)Gag>Tag	p.E137*	CCSER2_ENST00000372088.2_Nonsense_Mutation_p.E137*|CCSER2_ENST00000359979.4_Nonsense_Mutation_p.E137*	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2	137					microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											ATCTACAGAGGAGTTAAACCA	0.343																																					p.E137X		Atlas-SNP	.											.	CCSER2	7	.	0			c.G409T						.						86.0	81.0	83.0					10																	86131217		2203	4299	6502	SO:0001587	stop_gained	54462	exon2			ACAGAGGAGTTAA		CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.409G>T	chr10.hg19:g.86131217G>T	ENSP00000224756:p.Glu137*	173.0	0.0		163.0	72.0	NM_018999	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	Nonsense_Mutation	SNP	ENST00000224756.8	hg19	CCDS31235.1	.	.	.	.	.	.	.	.	.	.	G	36	5.764336	0.96906	.	.	ENSG00000107771	ENST00000359979;ENST00000224756;ENST00000372088	.	.	.	5.93	5.93	0.95920	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-21.3851	17.8219	0.88653	0.0:0.0:1.0:0.0	.	.	.	.	X	137	.	ENSP00000224756:E137X	E	+	1	0	FAM190B	86121197	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.076000	0.64413	2.802000	0.96397	0.561000	0.74099	GAG	.	.		0.343	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049132.2	NM_018999	
TEX36	387718	hgsc.bcm.edu	37	10	127350498	127350498	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr10:127350498C>A	ENST00000368821.3	-	2	254	c.100G>T	c.(100-102)Gct>Tct	p.A34S		NM_001128202.1	NP_001121674.1	Q5VZQ5	TEX36_HUMAN	testis expressed 36	34																	TTTGACGTAGCACTGGTGATG	0.517																																					p.A34S		Atlas-SNP	.											.	.	.	.	0			c.G100T						.						159.0	132.0	140.0					10																	127350498		692	1591	2283	SO:0001583	missense	387718	exon2			ACGTAGCACTGGT		CCDS44493.1	10q26.13	2012-08-13	2012-08-13	2012-08-13	ENSG00000175018	ENSG00000175018			31653	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 122"""	C10orf122			Standard	NM_001128202		Approved	bA383C5.1	uc001lik.4	Q5VZQ5	OTTHUMG00000019229	ENST00000368821.3:c.100G>T	chr10.hg19:g.127350498C>A	ENSP00000357811:p.Ala34Ser	82.0	0.0		64.0	25.0	NM_001128202	Q0P5T8	Missense_Mutation	SNP	ENST00000368821.3	hg19	CCDS44493.1	.	.	.	.	.	.	.	.	.	.	C	13.19	2.162916	0.38217	.	.	ENSG00000175018	ENST00000532135;ENST00000526819;ENST00000368821	T;T;T	0.39056	1.1;1.1;1.1	4.24	0.0483	0.14284	.	0.851199	0.09991	N	0.729694	T	0.27933	0.0688	L	0.40543	1.245	0.09310	N	1	B;B	0.27882	0.017;0.192	B;B	0.28784	0.045;0.094	T	0.25293	-1.0136	10	0.25106	T	0.35	4.0621	2.7712	0.05335	0.2038:0.4283:0.0:0.368	.	34;34	Q5VZQ5;E9PJL2	CJ122_HUMAN;.	S	34	ENSP00000431764:A34S;ENSP00000434299:A34S;ENSP00000357811:A34S	ENSP00000357811:A34S	A	-	1	0	C10orf122	127340488	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.414000	0.07114	0.011000	0.14865	0.563000	0.77884	GCT	.	.		0.517	TEX36-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000050915.1	NM_001128202	
HPX	3263	hgsc.bcm.edu	37	11	6453022	6453022	+	Silent	SNP	T	T	C	rs377761910		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:6453022T>C	ENST00000265983.3	-	9	1078	c.978A>G	c.(976-978)gtA>gtG	p.V326V		NM_000613.2	NP_000604.1	P02790	HEMO_HUMAN	hemopexin	326					cellular iron ion homeostasis (GO:0006879)|heme metabolic process (GO:0042168)|heme transport (GO:0015886)|hemoglobin metabolic process (GO:0020027)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of immunoglobulin production (GO:0002639)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|viral process (GO:0016032)	blood microparticle (GO:0072562)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme transporter activity (GO:0015232)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(11)|prostate(1)	15		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;5.46e-08)|BRCA - Breast invasive adenocarcinoma(625;0.19)		GGAAGACATATACCTGGGTGC	0.517																																					p.V326V		Atlas-SNP	.											.	HPX	33	.	0			c.A978G						.	T		0,4402		0,0,2201	143.0	151.0	148.0		978	-11.4	0.1	11		148	2,8590	2.2+/-6.3	0,2,4294	no	coding-synonymous	HPX	NM_000613.2		0,2,6495	CC,CT,TT		0.0233,0.0,0.0154		326/463	6453022	2,12992	2201	4296	6497	SO:0001819	synonymous_variant	3263	exon9			GACATATACCTGG	J03048	CCDS7763.1	11p15.5-p15.4	2012-10-02			ENSG00000110169	ENSG00000110169			5171	protein-coding gene	gene with protein product		142290				2989777, 2842511	Standard	NM_000613		Approved		uc001mdg.2	P02790	OTTHUMG00000133399	ENST00000265983.3:c.978A>G	chr11.hg19:g.6453022T>C		45.0	0.0		42.0	20.0	NM_000613	B2R957	Silent	SNP	ENST00000265983.3	hg19	CCDS7763.1																																																																																			.	.		0.517	HPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257256.1	NM_000613	
OLFML1	283298	hgsc.bcm.edu	37	11	7530924	7530924	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:7530924A>C	ENST00000329293.3	+	3	1108	c.714A>C	c.(712-714)aaA>aaC	p.K238N	CTD-2516F10.2_ENST00000530201.1_RNA|OLFML1_ENST00000528758.1_3'UTR|OLFML1_ENST00000530135.1_Missense_Mutation_p.K238N	NM_198474.3	NP_940876.2	Q6UWY5	OLFL1_HUMAN	olfactomedin-like 1	238	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.					extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(3)|prostate(2)	24				Epithelial(150;6.96e-08)|BRCA - Breast invasive adenocarcinoma(625;0.194)		AGATAATCAAATATAACCTGC	0.453																																					p.K238N		Atlas-SNP	.											.	OLFML1	54	.	0			c.A714C						.						49.0	51.0	50.0					11																	7530924		2201	4296	6497	SO:0001583	missense	283298	exon3			AATCAAATATAAC	AY358591	CCDS7779.1	11p15	2008-02-05			ENSG00000183801	ENSG00000183801			24473	protein-coding gene	gene with protein product							Standard	NM_198474		Approved	UNQ564	uc001mfi.3	Q6UWY5	OTTHUMG00000165527	ENST00000329293.3:c.714A>C	chr11.hg19:g.7530924A>C	ENSP00000332511:p.Lys238Asn	116.0	0.0		81.0	31.0	NM_198474	B4DP03|Q569G4	Missense_Mutation	SNP	ENST00000329293.3	hg19	CCDS7779.1	.	.	.	.	.	.	.	.	.	.	A	18.76	3.693527	0.68386	.	.	ENSG00000183801	ENST00000530135;ENST00000329293	D;D	0.92397	-3.03;-3.03	5.66	5.66	0.87406	Olfactomedin-like (3);	0.000000	0.85682	D	0.000000	D	0.95834	0.8644	M	0.81497	2.545	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.75484	0.971;0.986	D	0.96273	0.9200	10	0.87932	D	0	.	13.8537	0.63513	1.0:0.0:0.0:0.0	.	102;238	B4DN61;Q6UWY5	.;OLFL1_HUMAN	N	238	ENSP00000433455:K238N;ENSP00000332511:K238N	ENSP00000332511:K238N	K	+	3	2	OLFML1	7487500	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.898000	0.48672	2.153000	0.67306	0.460000	0.39030	AAA	.	.		0.453	OLFML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384656.1	NM_198474	
SLC17A6	57084	hgsc.bcm.edu	37	11	22380971	22380971	+	Silent	SNP	T	T	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:22380971T>G	ENST00000263160.3	+	4	908	c.471T>G	c.(469-471)gcT>gcG	p.A157A	CTD-2140G10.4_ENST00000534543.1_RNA	NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	157					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TTTTCGGAGCTGCCATACTTC	0.368																																					p.A157A		Atlas-SNP	.											.	SLC17A6	135	.	0			c.T471G						.						116.0	106.0	110.0					11																	22380971		2203	4300	6503	SO:0001819	synonymous_variant	57084	exon4			CGGAGCTGCCATA	AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.471T>G	chr11.hg19:g.22380971T>G		62.0	0.0		47.0	20.0	NM_020346	A6NKS2	Silent	SNP	ENST00000263160.3	hg19	CCDS7856.1																																																																																			.	.		0.368	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387671.1	NM_020346	
OR8J1	219477	hgsc.bcm.edu	37	11	56127868	56127868	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:56127868C>A	ENST00000303039.3	+	1	178	c.146C>A	c.(145-147)aCc>aAc	p.T49N		NM_001005205.2	NP_001005205.2	Q8NGP2	OR8J1_HUMAN	olfactory receptor, family 8, subfamily J, member 1	49						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T49N(1)		breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(30)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	47	Esophageal squamous(21;0.00448)					ATCACCCTCACCAGTGTTGAC	0.507																																					p.T49N		Atlas-SNP	.											OR8J1,NS,carcinoma,0,1	OR8J1	87	.	1	Substitution - Missense(1)	lung(1)	c.C146A						.						162.0	147.0	152.0					11																	56127868		2201	4296	6497	SO:0001583	missense	219477	exon1			CCCTCACCAGTGT	AB065748	CCDS31529.1	11q11	2012-08-09			ENSG00000172487	ENSG00000172487		"""GPCR / Class A : Olfactory receptors"""	14855	protein-coding gene	gene with protein product							Standard	NM_001005205		Approved		uc010rjh.2	Q8NGP2	OTTHUMG00000166859	ENST00000303039.3:c.146C>A	chr11.hg19:g.56127868C>A	ENSP00000304060:p.Thr49Asn	168.0	0.0		145.0	71.0	NM_001005205	B2RNQ6|B9EH63|Q6IFC2|Q96RC3	Missense_Mutation	SNP	ENST00000303039.3	hg19	CCDS31529.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300860	0.60195	.	.	ENSG00000172487	ENST00000303039	T	0.03035	4.07	4.05	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.090101	0.48767	D	0.000167	T	0.17408	0.0418	M	0.90309	3.105	0.21933	N	0.999468	P	0.42973	0.796	P	0.59889	0.865	T	0.01566	-1.1323	10	0.87932	D	0	.	7.5856	0.27991	0.0:0.7983:0.0:0.2017	.	49	Q8NGP2	OR8J1_HUMAN	N	49	ENSP00000304060:T49N	ENSP00000304060:T49N	T	+	2	0	OR8J1	55884444	0.001000	0.12720	0.997000	0.53966	0.981000	0.71138	1.045000	0.30341	1.053000	0.40415	0.643000	0.83706	ACC	.	.		0.507	OR8J1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391606.2	NM_001005205	
AQP11	282679	hgsc.bcm.edu	37	11	77301269	77301269	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:77301269A>T	ENST00000313578.3	+	1	590	c.232A>T	c.(232-234)Acg>Tcg	p.T78S	AQP11_ENST00000528638.1_Intron	NM_173039.2	NP_766627.1	Q8NBQ7	AQP11_HUMAN	aquaporin 11	78					endosomal lumen acidification (GO:0048388)|protein homooligomerization (GO:0051260)|proximal tubule development (GO:0072014)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			kidney(2)|large_intestine(1)|lung(5)	8	all_cancers(14;1.75e-17)|all_epithelial(13;4.7e-20)|Ovarian(111;0.249)		Epithelial(5;4.73e-49)|BRCA - Breast invasive adenocarcinoma(5;1.4e-30)			CCCCACCTGGACGCTGACGCT	0.632																																					p.T78S		Atlas-SNP	.											.	AQP11	14	.	0			c.A232T						.						49.0	49.0	49.0					11																	77301269		2200	4292	6492	SO:0001583	missense	282679	exon1			ACCTGGACGCTGA	AB028147	CCDS8251.1	11q13.5	2008-02-05			ENSG00000178301	ENSG00000178301		"""Ion channels / Aquaporins"""	19940	protein-coding gene	gene with protein product		609914				16107722	Standard	NM_173039		Approved		uc001oyj.3	Q8NBQ7	OTTHUMG00000165194	ENST00000313578.3:c.232A>T	chr11.hg19:g.77301269A>T	ENSP00000318770:p.Thr78Ser	51.0	0.0		46.0	19.0	NM_173039		Missense_Mutation	SNP	ENST00000313578.3	hg19	CCDS8251.1	.	.	.	.	.	.	.	.	.	.	A	12.63	1.995996	0.35226	.	.	ENSG00000178301	ENST00000313578	D	0.84800	-1.9	5.53	-0.832	0.10785	Aquaporin-like (2);	0.500796	0.21099	N	0.080189	T	0.65260	0.2674	N	0.22421	0.69	0.26926	N	0.966578	B	0.13145	0.007	B	0.10450	0.005	T	0.46034	-0.9220	10	0.08837	T	0.75	-3.3863	2.4133	0.04430	0.279:0.2741:0.3467:0.1002	.	78	Q8NBQ7	AQP11_HUMAN	S	78	ENSP00000318770:T78S	ENSP00000318770:T78S	T	+	1	0	AQP11	76978917	1.000000	0.71417	0.999000	0.59377	0.982000	0.71751	1.142000	0.31540	0.181000	0.19994	0.397000	0.26171	ACG	.	.		0.632	AQP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382582.1	NM_173039	
MAML2	84441	hgsc.bcm.edu	37	11	95825257	95825257	+	Silent	SNP	T	T	C	rs575986134	byFrequency	TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:95825257T>C	ENST00000524717.1	-	2	3222	c.1938A>G	c.(1936-1938)caA>caG	p.Q646Q		NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	646					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				gctgctgctgttgttgctgct	0.517			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid								T|||	5	0.000998403	0.0	0.0	5008	,	,		17451	0.005		0.0	False		,,,				2504	0.0				p.Q646Q		Atlas-SNP	.		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	MAML2,colon,carcinoma,0,1	MAML2	94	.	0			c.A1938G						.						37.0	42.0	40.0					11																	95825257		2095	4114	6209	SO:0001819	synonymous_variant	84441	exon2			CTGCTGTTGTTGC	AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.1938A>G	chr11.hg19:g.95825257T>C		54.0	1.0		44.0	4.0	NM_032427	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Silent	SNP	ENST00000524717.1	hg19	CCDS44714.1																																																																																			.	.		0.517	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395540.1		
DYNC2H1	79659	hgsc.bcm.edu	37	11	103018556	103018556	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:103018556G>A	ENST00000375735.2	+	19	2902	c.2758G>A	c.(2758-2760)Gat>Aat	p.D920N	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.D920N	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	920	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		GACTGTGATTGATGATCTCAT	0.299																																					p.D920N		Atlas-SNP	.											.	DYNC2H1	246	.	0			c.G2758A						.						118.0	116.0	117.0					11																	103018556		1843	4077	5920	SO:0001583	missense	79659	exon19			GTGATTGATGATC	AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2758G>A	chr11.hg19:g.103018556G>A	ENSP00000364887:p.Asp920Asn	61.0	0.0		46.0	14.0	NM_001377	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	ENST00000375735.2	hg19	CCDS53701.1	.	.	.	.	.	.	.	.	.	.	G	35	5.552527	0.96501	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.28069	1.63;1.63	5.49	5.49	0.81192	.	0.499919	0.16053	U	0.231871	T	0.61438	0.2347	M	0.87547	2.89	0.80722	D	1	D;D	0.76494	0.97;0.999	P;D	0.72982	0.566;0.979	T	0.57365	-0.7824	10	0.17369	T	0.5	.	19.7446	0.96247	0.0:0.0:1.0:0.0	.	920;920	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	N	920	ENSP00000364887:D920N;ENSP00000381167:D920N	ENSP00000364887:D920N	D	+	1	0	DYNC2H1	102523766	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.374000	0.97172	2.751000	0.94390	0.650000	0.86243	GAT	.	.		0.299	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387196.1	XM_370652	
BUD13	84811	hgsc.bcm.edu	37	11	116628662	116628662	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:116628662C>T	ENST00000260210.4	-	8	1527	c.1504G>A	c.(1504-1506)Gcc>Acc	p.A502T	BUD13_ENST00000375445.3_Missense_Mutation_p.A368T	NM_032725.3	NP_116114.1	Q9BRD0	BUD13_HUMAN	BUD13 homolog (S. cerevisiae)	502					mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)	nucleus (GO:0005634)|RES complex (GO:0070274)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|pancreas(2)|skin(1)|urinary_tract(1)	22	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.81e-06)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.154)		CGGCTCTGGGCAAGCCTGGGC	0.468																																					p.A502T		Atlas-SNP	.											.	BUD13	41	.	0			c.G1504A						.						74.0	76.0	75.0					11																	116628662		2201	4296	6497	SO:0001583	missense	84811	exon8			TCTGGGCAAGCCT	BC006350	CCDS8374.1, CCDS53712.1	11q23.3	2012-06-07	2007-01-12		ENSG00000137656	ENSG00000137656			28199	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 71"""		"""BUD13 homolog (yeast)"""			12477932	Standard	NM_032725		Approved	MGC13125, fSAP71, Cwc26	uc001ppn.3	Q9BRD0	OTTHUMG00000045136	ENST00000260210.4:c.1504G>A	chr11.hg19:g.116628662C>T	ENSP00000260210:p.Ala502Thr	42.0	0.0		35.0	13.0	NM_032725	A8K0S0|Q96LS7	Missense_Mutation	SNP	ENST00000260210.4	hg19	CCDS8374.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103346	0.76983	.	.	ENSG00000137656	ENST00000375445;ENST00000260210	T;T	0.19938	2.16;2.11	6.17	5.27	0.74061	.	0.091610	0.85682	D	0.000000	T	0.37571	0.1008	L	0.50919	1.6	0.80722	D	1	B;D	0.59767	0.441;0.986	B;P	0.61275	0.241;0.886	T	0.05683	-1.0870	9	.	.	.	-3.4742	15.5723	0.76349	0.0:0.9345:0.0:0.0655	.	368;502	Q9BRD0-2;Q9BRD0	.;BUD13_HUMAN	T	368;502	ENSP00000364594:A368T;ENSP00000260210:A502T	.	A	-	1	0	BUD13	116133872	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.300000	0.78841	1.632000	0.50472	0.655000	0.94253	GCC	.	.		0.468	BUD13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000104864.1	NM_032725	
Unknown	0	hgsc.bcm.edu	37	11	124095697	124095697	+	IGR	SNP	A	A	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr11:124095697A>C								OR10D3 (38745 upstream) : OR8G1 (24725 downstream)																							ACTTTGTGACAGAGAAGAACA	0.438																																					p.T100T		Atlas-SNP	.											.	.	.	.	0			c.A300C						.						177.0	174.0	175.0					11																	124095697		2156	4293	6449	SO:0001628	intergenic_variant	26492	exon1			TGTGACAGAGAAG																													chr11.hg19:g.124095697A>C		103.0	0.0		68.0	21.0	NM_001007249		Silent	SNP		hg19																																																																																				.	.	0	0.438								
BCAT1	586	hgsc.bcm.edu	37	12	25002861	25002861	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:25002861G>T	ENST00000261192.7	-	6	1059	c.533C>A	c.(532-534)cCt>cAt	p.P178H	BCAT1_ENST00000539282.1_Missense_Mutation_p.P190H|BCAT1_ENST00000538118.1_Missense_Mutation_p.P177H|BCAT1_ENST00000539780.1_Missense_Mutation_p.P141H|BCAT1_ENST00000342945.5_Missense_Mutation_p.P117H|BCAT1_ENST00000544418.1_5'UTR	NM_001178091.1|NM_005504.6	NP_001171562.1|NP_005495.2	P54687	BCAT1_HUMAN	branched chain amino-acid transaminase 1, cytosolic	178					branched-chain amino acid biosynthetic process (GO:0009082)|branched-chain amino acid catabolic process (GO:0009083)|cell proliferation (GO:0008283)|cellular nitrogen compound metabolic process (GO:0034641)|G1/S transition of mitotic cell cycle (GO:0000082)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	branched-chain-amino-acid transaminase activity (GO:0004084)|L-isoleucine transaminase activity (GO:0052656)|L-leucine transaminase activity (GO:0052654)|L-valine transaminase activity (GO:0052655)			breast(1)|large_intestine(1)|lung(3)|prostate(2)	7	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Ovarian(17;0.107)|Colorectal(261;0.196)				Gabapentin(DB00996)|L-Isoleucine(DB00167)|L-Leucine(DB00149)|L-Valine(DB00161)	GGCTTTGGTAGGCTTCTTGAC	0.418																																					p.P190H		Atlas-SNP	.											.	BCAT1	44	.	0			c.C569A						.						63.0	63.0	63.0					12																	25002861		1847	4089	5936	SO:0001583	missense	586	exon6			TTGGTAGGCTTCT		CCDS44845.1, CCDS53760.1, CCDS53761.1, CCDS53762.1, CCDS53763.1	12p12.1	2012-10-02	2010-05-07		ENSG00000060982	ENSG00000060982	2.6.1.42		976	protein-coding gene	gene with protein product		113520	"""branched chain aminotransferase 1, cytosolic"""	BCT1		9165094	Standard	NM_005504		Approved		uc010six.2	P54687	OTTHUMG00000169053	ENST00000261192.7:c.533C>A	chr12.hg19:g.25002861G>T	ENSP00000261192:p.Pro178His	102.0	0.0		79.0	36.0	NM_001178093	B3KY27|B7Z2M5|B7Z5L0|F5H5E4|Q68DQ7|Q96MY9	Missense_Mutation	SNP	ENST00000261192.7	hg19	CCDS44845.1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267356	0.80469	.	.	ENSG00000060982	ENST00000261192;ENST00000538118;ENST00000342945;ENST00000539282;ENST00000539780	T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85	5.33	5.33	0.75918	.	0.179879	0.49305	D	0.000149	T	0.64659	0.2618	H	0.95004	3.61	0.52501	D	0.999956	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;1.0	D;D;D;D;D	0.81914	0.986;0.992;0.976;0.995;0.991	T	0.76080	-0.3090	10	0.87932	D	0	-10.9616	19.0238	0.92925	0.0:0.0:1.0:0.0	.	141;190;117;178;177	B7Z5L0;F5H5E4;B3KY27;P54687;Q68DQ7	.;.;.;BCAT1_HUMAN;.	H	178;177;117;190;141	ENSP00000261192:P178H;ENSP00000440817:P177H;ENSP00000339805:P117H;ENSP00000443459:P190H;ENSP00000440827:P141H	ENSP00000261192:P178H	P	-	2	0	BCAT1	24894128	1.000000	0.71417	0.998000	0.56505	0.929000	0.56500	7.191000	0.77763	2.490000	0.84030	0.655000	0.94253	CCT	.	.		0.418	BCAT1-001	KNOWN	upstream_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000402080.1	NM_005504	
ADAMTS20	80070	hgsc.bcm.edu	37	12	43860553	43860553	+	Silent	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:43860553T>C	ENST00000389420.3	-	9	1268	c.1269A>G	c.(1267-1269)aaA>aaG	p.K423K	ADAMTS20_ENST00000553158.1_Silent_p.K423K	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	423	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		ACTTTGTAACTTTCATTTCTT	0.328																																					p.K423K		Atlas-SNP	.											.	ADAMTS20	635	.	0			c.A1269G						.						117.0	118.0	118.0					12																	43860553		2203	4300	6503	SO:0001819	synonymous_variant	80070	exon9			TGTAACTTTCATT	AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.1269A>G	chr12.hg19:g.43860553T>C		79.0	0.0		54.0	17.0	NM_025003	A6NNC9|J3QT00	Silent	SNP	ENST00000389420.3	hg19	CCDS31778.2																																																																																			.	.		0.328	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403643.1	NM_025003	
NFE2	4778	hgsc.bcm.edu	37	12	54686660	54686660	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:54686660G>A	ENST00000540264.2	-	2	1129	c.620C>T	c.(619-621)cCc>cTc	p.P207L	RP11-968A15.8_ENST00000553061.1_RNA|NFE2_ENST00000435572.2_Missense_Mutation_p.P207L|NFE2_ENST00000312156.4_Missense_Mutation_p.P207L|NFE2_ENST00000553070.1_Missense_Mutation_p.P207L			Q16621	NFE2_HUMAN	nuclear factor, erythroid 2	207					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|hemostasis (GO:0007599)|labyrinthine layer blood vessel development (GO:0060716)|multicellular organismal development (GO:0007275)|negative regulation of bone mineralization (GO:0030502)|negative regulation of syncytium formation by plasma membrane fusion (GO:0034242)|nucleosome disassembly (GO:0006337)|positive regulation of peptidyl-lysine acetylation (GO:2000758)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|WW domain binding (GO:0050699)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(7)|upper_aerodigestive_tract(2)	16						GCCTGAGGAGGGCTCTAAGGC	0.607																																					p.P207L		Atlas-SNP	.											.	NFE2	28	.	0			c.C620T						.						45.0	43.0	43.0					12																	54686660		2203	4300	6503	SO:0001583	missense	4778	exon4			GAGGAGGGCTCTA	BC005044	CCDS8876.1	12q13	2013-08-23	2013-08-23			ENSG00000123405		"""basic leucine zipper proteins"""	7780	protein-coding gene	gene with protein product		601490	"""nuclear factor (erythroid-derived 2), 45kD"", ""nuclear factor (erythroid-derived 2), 45kDa"""			8355703	Standard	NM_001136023		Approved	NF-E2	uc001sfr.5	Q16621		ENST00000540264.2:c.620C>T	chr12.hg19:g.54686660G>A	ENSP00000439120:p.Pro207Leu	151.0	0.0		103.0	26.0	NM_001261461	Q07720|Q6ICV9	Missense_Mutation	SNP	ENST00000540264.2	hg19	CCDS8876.1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.864415	0.32977	.	.	ENSG00000123405	ENST00000312156;ENST00000435572;ENST00000540264;ENST00000553070;ENST00000553198	.	.	.	4.99	4.99	0.66335	.	0.632696	0.16449	N	0.213949	T	0.21307	0.0513	N	0.08118	0	0.29767	N	0.835087	B	0.20052	0.041	B	0.19391	0.025	T	0.09773	-1.0659	9	0.09084	T	0.74	-1.7122	11.1153	0.48256	0.0:0.0:0.8158:0.1842	.	207	Q16621	NFE2_HUMAN	L	207	.	ENSP00000312436:P207L	P	-	2	0	NFE2	52972927	0.023000	0.18921	0.676000	0.29932	0.748000	0.42578	2.142000	0.42177	2.767000	0.95098	0.655000	0.94253	CCC	.	.		0.607	NFE2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405747.1	NM_006163	
DEPDC4	120863	hgsc.bcm.edu	37	12	100660786	100660786	+	Silent	SNP	A	A	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:100660786A>T	ENST00000416321.1	-	1	71	c.69T>A	c.(67-69)ctT>ctA	p.L23L	SCYL2_ENST00000360820.2_5'Flank	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	23					intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TCTGACTGACAAGTCTACGGA	0.622																																					p.L23L		Atlas-SNP	.											.	DEPDC4	34	.	0			c.T69A						.						81.0	88.0	85.0					12																	100660786		2203	4300	6503	SO:0001819	synonymous_variant	120863	exon1			ACTGACAAGTCTA	AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.69T>A	chr12.hg19:g.100660786A>T		77.0	0.0		60.0	21.0	NM_152317	Q496C8|Q96BW0	Silent	SNP	ENST00000416321.1	hg19	CCDS9075.1																																																																																			.	.		0.622	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408482.1	NM_152317	
CCDC53	51019	hgsc.bcm.edu	37	12	102433674	102433674	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:102433674T>C	ENST00000240079.6	-	5	568	c.407A>G	c.(406-408)tAt>tGt	p.Y136C	CCDC53_ENST00000539515.1_5'UTR|CCDC53_ENST00000545679.1_Missense_Mutation_p.Y135C	NM_016053.2	NP_057137.1	Q9Y3C0	CCD53_HUMAN	coiled-coil domain containing 53	136						actin cytoskeleton (GO:0015629)|intracellular membrane-bounded organelle (GO:0043231)|WASH complex (GO:0071203)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ATATCTGGCATATCTTGGATC	0.403																																					p.Y136C		Atlas-SNP	.											.	CCDC53	14	.	0			c.A407G						.						220.0	207.0	211.0					12																	102433674		1867	4120	5987	SO:0001583	missense	51019	exon5			CTGGCATATCTTG	AF151874	CCDS44959.1, CCDS73512.1	12q23.3	2014-05-09			ENSG00000120860	ENSG00000120860			24256	protein-coding gene	gene with protein product						10810093, 20498093	Standard	XM_005268939		Approved	CGI-116	uc010svw.2	Q9Y3C0	OTTHUMG00000168187	ENST00000240079.6:c.407A>G	chr12.hg19:g.102433674T>C	ENSP00000240079:p.Tyr136Cys	67.0	0.0		64.0	36.0	NM_016053	B2RC74|Q53FF0|Q6IAI4|Q96QK0	Missense_Mutation	SNP	ENST00000240079.6	hg19	CCDS44959.1	.	.	.	.	.	.	.	.	.	.	T	19.89	3.910426	0.72983	.	.	ENSG00000120860	ENST00000240079;ENST00000545679	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.85873	0.5798	M	0.93507	3.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89304	0.3628	9	0.87932	D	0	-12.213	13.7576	0.62946	0.0:0.0:0.0:1.0	.	135;136	F5GZ97;Q9Y3C0	.;CCD53_HUMAN	C	136;135	.	ENSP00000240079:Y136C	Y	-	2	0	CCDC53	100957804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.025000	0.70864	2.233000	0.73108	0.524000	0.50904	TAT	.	.		0.403	CCDC53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398685.1	NM_016053	
UBC	7316	hgsc.bcm.edu	37	12	125397123	125397123	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr12:125397123G>A	ENST00000536769.1	-	1	2771	c.1195C>T	c.(1195-1197)Ccg>Tcg	p.P399S	MIR5188_ENST00000583467.1_RNA|UBC_ENST00000546120.1_Missense_Mutation_p.P323S|UBC_ENST00000339647.5_Missense_Mutation_p.P399S|UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank			P0CG48	UBC_HUMAN	ubiquitin C	399	Ubiquitin-like 6. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		GTGTCACTCGGCTCCACCTCG	0.532																																					p.P399S		Atlas-SNP	.											.	UBC	79	.	0			c.C1195T						.						217.0	191.0	200.0					12																	125397123		2203	4297	6500	SO:0001583	missense	7316	exon2			CACTCGGCTCCAC		CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1195C>T	chr12.hg19:g.125397123G>A	ENSP00000441543:p.Pro399Ser	310.0	0.0		238.0	87.0	NM_021009	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	ENST00000536769.1	hg19	CCDS9260.1	.	.	.	.	.	.	.	.	.	.	G	0.770	-0.766022	0.02974	.	.	ENSG00000150991	ENST00000536769;ENST00000541046;ENST00000339647;ENST00000546120	T;T;T	0.73575	-0.76;-0.76;-0.76	3.75	3.75	0.43078	Ubiquitin supergroup (1);Ubiquitin (2);	0.000000	0.46758	U	0.000261	T	0.51601	0.1684	N	0.05574	-0.02	0.80722	D	1	P	0.42456	0.78	B	0.41917	0.37	T	0.57934	-0.7725	10	0.02654	T	1	.	13.1544	0.59509	0.0:0.0:1.0:0.0	.	399	P0CG48	UBC_HUMAN	S	399;323;399;323	ENSP00000441543:P399S;ENSP00000344818:P399S;ENSP00000438394:P323S	ENSP00000344818:P399S	P	-	1	0	UBC	123963076	1.000000	0.71417	1.000000	0.80357	0.020000	0.10135	8.202000	0.89737	1.936000	0.56123	0.556000	0.70494	CCG	.	.		0.532	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400177.1	NM_021009	
COG3	83548	hgsc.bcm.edu	37	13	46083887	46083887	+	Missense_Mutation	SNP	G	G	T	rs551149553		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr13:46083887G>T	ENST00000349995.5	+	15	1767	c.1655G>T	c.(1654-1656)gGa>gTa	p.G552V	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	552					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		GATCTTCATGGAATGTGGTAT	0.408																																					p.G552V	Ovarian(150;1048 1859 18083 21577 42700)	Atlas-SNP	.											.	COG3	52	.	0			c.G1655T						.						210.0	201.0	204.0					13																	46083887		2203	4300	6503	SO:0001583	missense	83548	exon15			TTCATGGAATGTG	AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1655G>T	chr13.hg19:g.46083887G>T	ENSP00000258654:p.Gly552Val	199.0	0.0		83.0	30.0	NM_031431	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	ENST00000349995.5	hg19	CCDS9398.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943981	0.92593	.	.	ENSG00000136152	ENST00000349995	T	0.42131	0.98	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.65616	0.2708	M	0.72479	2.2	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.91635	0.965;0.999	T	0.62642	-0.6811	10	0.42905	T	0.14	-15.3587	19.0006	0.92832	0.0:0.0:1.0:0.0	.	389;552	B4E2F3;Q96JB2	.;COG3_HUMAN	V	552	ENSP00000258654:G552V	ENSP00000258654:G552V	G	+	2	0	COG3	44981888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.230000	0.95299	2.749000	0.94314	0.655000	0.94253	GGA	.	.		0.408	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044777.2		
UGGT2	55757	hgsc.bcm.edu	37	13	96555132	96555132	+	Silent	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr13:96555132A>G	ENST00000376747.3	-	21	2548	c.2478T>C	c.(2476-2478)gaT>gaC	p.D826D		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	826					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TTTTAATTTTATCTCCAGAGT	0.313																																					p.D826D		Atlas-SNP	.											.	UGGT2	127	.	0			c.T2478C						.						81.0	88.0	86.0					13																	96555132		2201	4298	6499	SO:0001819	synonymous_variant	55757	exon21			AATTTTATCTCCA	AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.2478T>C	chr13.hg19:g.96555132A>G		83.0	0.0		94.0	20.0	NM_020121	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Silent	SNP	ENST00000376747.3	hg19	CCDS9480.1																																																																																			.	.		0.313	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045507.1	NM_020121	
NPAS3	64067	hgsc.bcm.edu	37	14	34269611	34269611	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr14:34269611G>T	ENST00000356141.4	+	12	2098	c.2098G>T	c.(2098-2100)Ggg>Tgg	p.G700W	NPAS3_ENST00000346562.2_Missense_Mutation_p.G668W|NPAS3_ENST00000551492.1_Missense_Mutation_p.G705W|NPAS3_ENST00000548645.1_Missense_Mutation_p.G670W|NPAS3_ENST00000357798.5_Missense_Mutation_p.G687W			Q8IXF0	NPAS3_HUMAN	neuronal PAS domain protein 3	700	Gly-rich.				locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|positive regulation of transcription, DNA-templated (GO:0045893)|startle response (GO:0001964)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(3)|kidney(1)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	40	Breast(36;0.0102)|Hepatocellular(127;0.133)		LUAD - Lung adenocarcinoma(48;0.00169)|Lung(238;0.00968)	GBM - Glioblastoma multiforme(1;1.31e-09)|all cancers(1;0.000112)|OV - Ovarian serous cystadenocarcinoma(311;0.115)		CGGCGGCGGTGGGGGTGGCGG	0.741																																					p.G700W		Atlas-SNP	.											.	NPAS3	266	.	0			c.G2098T						.						13.0	17.0	16.0					14																	34269611		2110	4125	6235	SO:0001583	missense	64067	exon12			GGCGGTGGGGGTG	AF164438	CCDS9645.1, CCDS53891.1, CCDS53892.1, CCDS55912.1	14q13.1	2013-08-23			ENSG00000151322	ENSG00000151322		"""Basic helix-loop-helix proteins"""	19311	protein-coding gene	gene with protein product		609430					Standard	NM_022123		Approved	MOP6, PASD6, bHLHe12	uc001wru.3	Q8IXF0	OTTHUMG00000140215	ENST00000356141.4:c.2098G>T	chr14.hg19:g.34269611G>T	ENSP00000348460:p.Gly700Trp	92.0	0.0		74.0	16.0	NM_001164749	Q86US6|Q86US7|Q8IXF2|Q9BY81|Q9H323|Q9Y4L8	Missense_Mutation	SNP	ENST00000356141.4	hg19	CCDS53891.1	.	.	.	.	.	.	.	.	.	.	G	3.715	-0.058644	0.07317	.	.	ENSG00000151322	ENST00000551634;ENST00000551492;ENST00000346562;ENST00000548645;ENST00000356141;ENST00000357798	T;T;T;T;T;T	0.49139	0.79;0.79;0.79;0.79;0.79;0.79	4.09	-0.934	0.10428	.	0.547135	0.16443	N	0.214209	T	0.28797	0.0714	N	0.08118	0	0.34107	D	0.662589	P;P;P;P	0.47604	0.898;0.836;0.898;0.898	P;B;P;P	0.46885	0.53;0.329;0.53;0.53	T	0.42732	-0.9434	10	0.72032	D	0.01	.	7.2409	0.26096	0.5271:0.0:0.4729:0.0	.	670;700;668;687	Q8IXF0-2;Q8IXF0;Q8IXF0-4;Q8IXF0-3	.;NPAS3_HUMAN;.;.	W	674;705;668;670;700;687	ENSP00000448373:G674W;ENSP00000450392:G705W;ENSP00000319610:G668W;ENSP00000448916:G670W;ENSP00000348460:G700W;ENSP00000350446:G687W	ENSP00000319610:G668W	G	+	1	0	NPAS3	33339362	.	.	0.153000	0.22517	0.064000	0.16182	.	.	-0.316000	0.08690	-0.350000	0.07774	GGG	.	.		0.741	NPAS3-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000276645.1		
KCNK10	54207	hgsc.bcm.edu	37	14	88707142	88707142	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr14:88707142G>A	ENST00000340700.5	-	3	861	c.410C>T	c.(409-411)gCg>gTg	p.A137V	KCNK10_ENST00000319231.5_Missense_Mutation_p.A142V|KCNK10_ENST00000312350.5_Missense_Mutation_p.A142V	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	137					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						ACTGACTCCCGCATTGTCAGC	0.408																																					p.A142V		Atlas-SNP	.											.	KCNK10	273	.	0			c.C425T						.						92.0	83.0	86.0					14																	88707142		2203	4300	6503	SO:0001583	missense	54207	exon3			ACTCCCGCATTGT	AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.410C>T	chr14.hg19:g.88707142G>A	ENSP00000343104:p.Ala137Val	49.0	0.0		29.0	12.0	NM_138318	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	ENST00000340700.5	hg19	CCDS9880.1	.	.	.	.	.	.	.	.	.	.	G	34	5.300928	0.95601	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231;ENST00000556282	D;D;D;T	0.91894	-2.92;-2.93;-2.92;0.83	5.91	5.91	0.95273	.	0.045738	0.85682	D	0.000000	D	0.93936	0.8059	L	0.60455	1.87	0.80722	D	1	D;D;P	0.61697	0.99;0.99;0.642	P;P;B	0.54210	0.745;0.657;0.235	D	0.93446	0.6798	10	0.52906	T	0.07	.	19.9007	0.96985	0.0:0.0:1.0:0.0	.	137;142;142	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	V	137;142;142;125	ENSP00000343104:A137V;ENSP00000310568:A142V;ENSP00000312811:A142V;ENSP00000452587:A125V	ENSP00000310568:A142V	A	-	2	0	KCNK10	87776895	1.000000	0.71417	0.838000	0.33150	0.992000	0.81027	7.511000	0.81718	2.791000	0.96007	0.655000	0.94253	GCG	.	.		0.408	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410167.1	NM_021161	
BTBD7	55727	hgsc.bcm.edu	37	14	93720042	93720042	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr14:93720042C>T	ENST00000334746.5	-	7	2010	c.1703G>A	c.(1702-1704)gGc>gAc	p.G568D	BTBD7_ENST00000554565.1_Missense_Mutation_p.G217D|BTBD7_ENST00000393170.2_Missense_Mutation_p.G142D	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	568					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		AACATAGATGCCAGCATTTTT	0.398																																					p.G568D		Atlas-SNP	.											.	BTBD7	112	.	0			c.G1703A						.						172.0	154.0	160.0					14																	93720042		2203	4300	6503	SO:0001583	missense	55727	exon7			TAGATGCCAGCAT	AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1703G>A	chr14.hg19:g.93720042C>T	ENSP00000335615:p.Gly568Asp	61.0	0.0		62.0	20.0	NM_001002860	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	ENST00000334746.5	hg19	CCDS32146.1	.	.	.	.	.	.	.	.	.	.	C	15.99	2.994814	0.54041	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.52295	0.97;0.67	5.75	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.66336	0.2779	L	0.61387	1.9	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.967	D;D;P	0.70016	0.964;0.967;0.71	T	0.70813	-0.4770	10	0.87932	D	0	.	16.8217	0.85748	0.0:0.8713:0.1287:0.0	.	142;217;568	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	D	568;217;183;142	ENSP00000335615:G568D;ENSP00000451010:G217D	ENSP00000335615:G568D	G	-	2	0	BTBD7	92789795	1.000000	0.71417	0.923000	0.36655	0.018000	0.09664	7.487000	0.81328	1.409000	0.46915	-0.182000	0.12963	GGC	.	.		0.398	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412701.1	NM_001002860	
BAG5	9529	hgsc.bcm.edu	37	14	104026264	104026264	+	Missense_Mutation	SNP	T	T	C	rs143892215		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr14:104026264T>C	ENST00000445922.2	-	2	1484	c.1238A>G	c.(1237-1239)gAt>gGt	p.D413G	BAG5_ENST00000337322.4_Missense_Mutation_p.D454G|BAG5_ENST00000299204.4_Missense_Mutation_p.D413G|RP11-894P9.2_ENST00000556332.1_RNA	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	413	BAG 5. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			TCCCTGCGGATCAACAGCATC	0.498																																					p.D454G	NSCLC(171;1832 2055 18950 31566 41632)	Atlas-SNP	.											.	BAG5	47	.	0			c.A1361G						.						87.0	84.0	85.0					14																	104026264		2203	4300	6503	SO:0001583	missense	9529	exon2			TGCGGATCAACAG	AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.1238A>G	chr14.hg19:g.104026264T>C	ENSP00000391713:p.Asp413Gly	121.0	0.0		98.0	44.0	NM_001015049	O94950|Q86W59	Missense_Mutation	SNP	ENST00000445922.2	hg19	CCDS9982.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436991	0.62955	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322	D;D;D	0.90385	-2.66;-2.66;-2.66	5.74	5.74	0.90152	BAG domain (3);	0.106420	0.64402	D	0.000009	D	0.95227	0.8452	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95592	0.8655	10	0.72032	D	0.01	-42.7673	16.3426	0.83092	0.0:0.0:0.0:1.0	.	413;454	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	G	413;413;454	ENSP00000299204:D413G;ENSP00000391713:D413G;ENSP00000338814:D454G	ENSP00000299204:D413G	D	-	2	0	BAG5	103096017	1.000000	0.71417	0.997000	0.53966	0.256000	0.26092	7.446000	0.80609	2.317000	0.78254	0.460000	0.39030	GAT	.	T|1.000;A|0.000		0.498	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414990.1		
RASGRP1	10125	hgsc.bcm.edu	37	15	38794569	38794569	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr15:38794569T>G	ENST00000310803.5	-	12	1659	c.1482A>C	c.(1480-1482)gaA>gaC	p.E494D	RASGRP1_ENST00000559830.1_Missense_Mutation_p.E459D|RASGRP1_ENST00000450598.2_Missense_Mutation_p.E459D|RASGRP1_ENST00000539159.1_Missense_Mutation_p.E446D|RASGRP1_ENST00000558164.1_Missense_Mutation_p.E459D|RP11-102L12.2_ENST00000560231.1_RNA|RASGRP1_ENST00000561180.1_Missense_Mutation_p.E545D	NM_001128602.1|NM_005739.3	NP_001122074.1|NP_005730.2	O95267	GRP1_HUMAN	RAS guanyl releasing protein 1 (calcium and DAG-regulated)	494	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				activation of Rho GTPase activity (GO:0032862)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|inflammatory response to antigenic stimulus (GO:0002437)|innate immune response (GO:0045087)|mast cell degranulation (GO:0043303)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)|secretory granule localization (GO:0032252)|signal transduction (GO:0007165)|vesicle transport along microtubule (GO:0047496)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mast cell granule (GO:0042629)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20		all_cancers(109;6.38e-17)|all_epithelial(112;5.51e-15)|Lung NSC(122;2.12e-11)|all_lung(180;5.63e-10)|Melanoma(134;0.0574)		GBM - Glioblastoma multiforme(113;1.97e-07)|BRCA - Breast invasive adenocarcinoma(123;0.00248)		TCTTTTCAAATTCTTCCTGAG	0.398																																					p.E494D		Atlas-SNP	.											.	RASGRP1	50	.	0			c.A1482C						.						91.0	82.0	85.0					15																	38794569		1836	4095	5931	SO:0001583	missense	10125	exon12			TTCAAATTCTTCC	AF106071	CCDS45221.1, CCDS45222.1	15q15	2013-01-10				ENSG00000172575		"""EF-hand domain containing"""	9878	protein-coding gene	gene with protein product		603962				10087292, 9789079	Standard	NM_005739		Approved	CalDAG-GEFII, RASGRP	uc001zke.4	O95267		ENST00000310803.5:c.1482A>C	chr15.hg19:g.38794569T>G	ENSP00000310244:p.Glu494Asp	88.0	0.0		78.0	43.0	NM_005739	Q56CZ0|Q58G75|Q59HB1|Q5I3A8|Q6GV31|Q6NX39|Q7LDG6|Q9UI94|Q9UNN9	Missense_Mutation	SNP	ENST00000310803.5	hg19	CCDS45222.1	.	.	.	.	.	.	.	.	.	.	T	10.31	1.314558	0.23908	.	.	ENSG00000172575	ENST00000310803;ENST00000450598;ENST00000415523;ENST00000431814;ENST00000539159;ENST00000414708;ENST00000541438	T;T;T;T	0.79554	-1.28;-0.06;-1.28;-1.28	5.01	-2.22	0.06952	EF-hand-like domain (1);	0.051715	0.85682	D	0.000000	T	0.73737	0.3625	L	0.41079	1.255	0.48632	D	0.99968	B;B;B;B	0.26975	0.121;0.109;0.109;0.165	B;B;B;B	0.40602	0.069;0.317;0.317;0.334	T	0.57940	-0.7724	10	0.13108	T	0.6	-23.6629	13.1072	0.59253	0.0:0.2262:0.0:0.7738	.	459;459;494;459	C9JM27;C9JCE5;O95267;O95267-2	.;.;GRP1_HUMAN;.	D	494;459;459;459;446;459;459	ENSP00000310244:E494D;ENSP00000388540:E459D;ENSP00000444762:E446D;ENSP00000413105:E459D	ENSP00000310244:E494D	E	-	3	2	RASGRP1	36581861	0.478000	0.25917	0.970000	0.41538	0.989000	0.77384	-0.405000	0.07196	-0.648000	0.05437	-0.417000	0.06048	GAA	.	.		0.398	RASGRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418223.1	NM_005739	
ITGA11	22801	hgsc.bcm.edu	37	15	68657110	68657110	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr15:68657110C>T	ENST00000315757.7	-	4	378	c.292G>A	c.(292-294)Gag>Aag	p.E98K	ITGA11_ENST00000423218.2_Missense_Mutation_p.E98K|ITGA11_ENST00000562826.1_5'UTR	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	98					cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TCTTTCCGCTCGGACACGTTG	0.632																																					p.E98K		Atlas-SNP	.											.	ITGA11	110	.	0			c.G292A						.						83.0	92.0	89.0					15																	68657110		2106	4220	6326	SO:0001583	missense	22801	exon4			TCCGCTCGGACAC	AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.292G>A	chr15.hg19:g.68657110C>T	ENSP00000327290:p.Glu98Lys	118.0	0.0		123.0	28.0	NM_001004439	J3KQM2|Q8WYI8|Q9UKQ1	Missense_Mutation	SNP	ENST00000315757.7	hg19	CCDS45291.1	.	.	.	.	.	.	.	.	.	.	c	32	5.173550	0.94807	.	.	ENSG00000137809	ENST00000315757;ENST00000423218;ENST00000537153	T;T	0.71934	-0.61;-0.61	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	D	0.82300	0.5007	M	0.80183	2.485	0.58432	D	0.999998	P;D	0.76494	0.791;0.999	B;D	0.65443	0.18;0.935	T	0.79591	-0.1740	10	0.12430	T	0.62	.	17.2813	0.87129	0.0:1.0:0.0:0.0	.	98;98	A8K8T0;Q9UKX5	.;ITA11_HUMAN	K	98	ENSP00000327290:E98K;ENSP00000403392:E98K	ENSP00000327290:E98K	E	-	1	0	ITGA11	66444164	1.000000	0.71417	0.975000	0.42487	0.988000	0.76386	7.230000	0.78097	2.342000	0.79632	0.556000	0.70494	GAG	.	.		0.632	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_012211	
CCNF	899	hgsc.bcm.edu	37	16	2499459	2499459	+	Silent	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr16:2499459G>T	ENST00000397066.4	+	12	1483	c.1395G>T	c.(1393-1395)ggG>ggT	p.G465G		NM_001761.2	NP_001752.2	P41002	CCNF_HUMAN	cyclin F	465					mitotic nuclear division (GO:0007067)|negative regulation of centrosome duplication (GO:0010826)|placenta development (GO:0001890)|protein ubiquitination (GO:0016567)|re-entry into mitotic cell cycle (GO:0000320)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	centriole (GO:0005814)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)				breast(3)|central_nervous_system(1)|kidney(4)|large_intestine(2)|lung(5)|prostate(4)|skin(1)	20		Ovarian(90;0.17)				TGACGCACGGGCAGAGTAAGG	0.652																																					p.G465G		Atlas-SNP	.											.	CCNF	110	.	0			c.G1395T						.						27.0	29.0	28.0					16																	2499459		2197	4300	6497	SO:0001819	synonymous_variant	899	exon12			GCACGGGCAGAGT	Z36714	CCDS10467.1	16p13.3	2008-02-05			ENSG00000162063	ENSG00000162063		"""F-boxes /  ""other"""""	1591	protein-coding gene	gene with protein product		600227				7896286	Standard	NM_001761		Approved	FBX1, FBXO1	uc002cqd.1	P41002	OTTHUMG00000128858	ENST00000397066.4:c.1395G>T	chr16.hg19:g.2499459G>T		14.0	0.0		13.0	6.0	NM_001761	B2R8H3|Q96EG9	Silent	SNP	ENST00000397066.4	hg19	CCDS10467.1																																																																																			.	.		0.652	CCNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250801.1	NM_001761	
RBBP6	5930	hgsc.bcm.edu	37	16	24579152	24579152	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr16:24579152T>G	ENST00000319715.4	+	16	2424	c.1992T>G	c.(1990-1992)gaT>gaG	p.D664E	RBBP6_ENST00000348022.2_Intron|RBBP6_ENST00000381039.3_Intron	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	664					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		TTACAAATGATTTTGCTAAGG	0.328																																					p.D664E		Atlas-SNP	.											.	RBBP6	158	.	0			c.T1992G						.						70.0	75.0	74.0					16																	24579152		2197	4300	6497	SO:0001583	missense	5930	exon16			AAATGATTTTGCT		CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1992T>G	chr16.hg19:g.24579152T>G	ENSP00000317872:p.Asp664Glu	250.0	0.0		178.0	15.0	NM_006910	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	ENST00000319715.4	hg19	CCDS10621.1	.	.	.	.	.	.	.	.	.	.	T	14.41	2.527439	0.44969	.	.	ENSG00000122257	ENST00000319715	T	0.34859	1.34	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000016	T	0.38983	0.1061	N	0.11201	0.11	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.29912	-0.9996	10	0.15066	T	0.55	-22.3832	15.8684	0.79084	0.0:0.0:0.0:1.0	.	664	Q7Z6E9	RBBP6_HUMAN	E	664	ENSP00000317872:D664E	ENSP00000317872:D664E	D	+	3	2	RBBP6	24486653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.351000	0.59398	2.156000	0.67533	0.460000	0.39030	GAT	.	.		0.328	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214067.2	NM_006910	
DNAJA2	10294	hgsc.bcm.edu	37	16	47005262	47005262	+	Splice_Site	SNP	T	T	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr16:47005262T>G	ENST00000317089.5	-	3	576	c.361A>C	c.(361-363)Aaa>Caa	p.K121Q	RP11-169E6.1_ENST00000562536.1_RNA	NM_005880.3	NP_005871.1	O60884	DNJA2_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 2	121					positive regulation of cell proliferation (GO:0008284)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	14		all_cancers(37;0.00125)|all_lung(18;0.00338)|all_epithelial(9;0.00358)|Lung NSC(13;0.0309)|Breast(268;0.116)				GATATTCACTTGAGTGGATGC	0.383																																					p.K121Q		Atlas-SNP	.											.	DNAJA2	28	.	0			c.A361C						.						92.0	88.0	89.0					16																	47005262		2203	4300	6503	SO:0001630	splice_region_variant	10294	exon3			TTCACTTGAGTGG	AF116720	CCDS10726.1	16q12.1	2011-09-02			ENSG00000069345	ENSG00000069345		"""Heat shock proteins / DNAJ (HSP40)"""	14884	protein-coding gene	gene with protein product		611322				9710638, 11147971	Standard	NM_005880		Approved	HIRIP4, DNAJ, CPR3, DNJ3	uc002eeo.2	O60884	OTTHUMG00000133104	ENST00000317089.5:c.362+1A>C	chr16.hg19:g.47005262T>G		99.0	0.0		225.0	158.0	NM_005880	B2R7L7|O14711	Missense_Mutation	SNP	ENST00000317089.5	hg19	CCDS10726.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.364029	0.61513	.	.	ENSG00000069345	ENST00000317089	T	0.43294	0.95	5.47	5.47	0.80525	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.40448	0.1117	L	0.52011	1.625	0.80722	D	1	B	0.15141	0.012	B	0.12837	0.008	T	0.19224	-1.0312	10	0.44086	T	0.13	-20.3169	15.5365	0.76007	0.0:0.0:0.0:1.0	.	121	O60884	DNJA2_HUMAN	Q	121	ENSP00000314030:K121Q	ENSP00000314030:K121Q	K	-	1	0	DNAJA2	45562763	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	8.036000	0.88901	2.069000	0.61940	0.459000	0.35465	AAA	.	.		0.383	DNAJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256769.2		Missense_Mutation
CD68	968	hgsc.bcm.edu	37	17	7483022	7483022	+	Silent	SNP	G	G	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr17:7483022G>C	ENST00000250092.6	+	1	238	c.27G>C	c.(25-27)ggG>ggC	p.G9G	AC113189.5_ENST00000415124.1_RNA|AC113189.5_ENST00000417897.1_RNA|CD68_ENST00000380498.6_Silent_p.G9G|SNORA67_ENST00000384423.1_RNA|AC113189.5_ENST00000573187.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA|SNORD10_ENST00000459579.1_RNA|AC113189.5_ENST00000572046.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule	9					cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						TTTTCTCGGGGGCCCTGCTGG	0.647																																					p.G9G		Atlas-SNP	.											.	CD68	17	.	0			c.G27C						.						31.0	30.0	31.0					17																	7483022		2203	4299	6502	SO:0001819	synonymous_variant	968	exon1			CTCGGGGGCCCTG	S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146	ENST00000250092.6:c.27G>C	chr17.hg19:g.7483022G>C		55.0	0.0		22.0	12.0	NM_001040059	B4DVT4|Q53HR6|Q53XI3|Q96BI7	Silent	SNP	ENST00000250092.6	hg19	CCDS11114.1																																																																																			.	.		0.647	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226949.3	NM_001251	
CACNB1	782	hgsc.bcm.edu	37	17	37347830	37347830	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr17:37347830T>C	ENST00000394303.3	-	3	395	c.188A>G	c.(187-189)tAc>tGc	p.Y63C	CACNB1_ENST00000344140.5_Missense_Mutation_p.Y63C|CACNB1_ENST00000394310.3_Missense_Mutation_p.Y63C|CACNB1_ENST00000582877.1_5'UTR	NM_000723.4	NP_000714.3	Q02641	CACB1_HUMAN	calcium channel, voltage-dependent, beta 1 subunit	63					axon guidance (GO:0007411)|protein targeting to membrane (GO:0006612)|transport (GO:0006810)	sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)|prostate(1)|skin(1)	16					Dronedarone(DB04855)|Ibutilide(DB00308)|Magnesium Sulfate(DB00653)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACGGCTGGTGTAGGACTCCGC	0.602																																					p.Y63C	Esophageal Squamous(5;100 366 38393 41452 45827)	Atlas-SNP	.											.	CACNB1	89	.	0			c.A188G						.						69.0	58.0	62.0					17																	37347830		2203	4300	6503	SO:0001583	missense	782	exon3			CTGGTGTAGGACT		CCDS11334.1, CCDS42311.1, CCDS45665.1	17q21-q22	2013-03-20			ENSG00000067191	ENSG00000067191		"""Calcium channel subunits"""	1401	protein-coding gene	gene with protein product		114207		CACNLB1		8381767, 8395940	Standard	NM_000723		Approved		uc002hrm.2	Q02641	OTTHUMG00000133217	ENST00000394303.3:c.188A>G	chr17.hg19:g.37347830T>C	ENSP00000377840:p.Tyr63Cys	64.0	0.0		46.0	12.0	NM_199248	A8K114|O15331|Q02639|Q02640|Q8N3X9|Q9C085|Q9UD79	Missense_Mutation	SNP	ENST00000394303.3	hg19	CCDS42311.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.390062	0.82902	.	.	ENSG00000067191	ENST00000539338;ENST00000394303;ENST00000344140;ENST00000394310;ENST00000536613	T;T;T	0.78816	-1.16;-1.21;-1.17	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.87541	0.6203	M	0.77103	2.36	0.80722	D	1	D;D;B;D;D	0.89917	0.999;1.0;0.181;0.999;1.0	D;D;B;D;D	0.91635	0.995;0.999;0.276;0.993;0.999	D	0.88963	0.3395	10	0.66056	D	0.02	-12.9674	14.115	0.65146	0.0:0.0:0.0:1.0	.	16;63;63;63;63	F5H6X1;Q6TME4;Q02641-2;Q02641-3;Q02641	.;.;.;.;CACB1_HUMAN	C	13;63;63;63;16	ENSP00000377840:Y63C;ENSP00000345461:Y63C;ENSP00000377847:Y63C	ENSP00000345461:Y63C	Y	-	2	0	CACNB1	34601356	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.824000	0.86668	2.025000	0.59659	0.477000	0.44152	TAC	.	.		0.602	CACNB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256945.3		
ZCCHC2	54877	hgsc.bcm.edu	37	18	60242216	60242216	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr18:60242216C>G	ENST00000269499.5	+	13	3320	c.2902C>G	c.(2902-2904)Cct>Gct	p.P968A	ZCCHC2_ENST00000586834.1_Missense_Mutation_p.P647A	NM_017742.4	NP_060212.4	Q9C0B9	ZCHC2_HUMAN	zinc finger, CCHC domain containing 2	968						cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)|phosphatidylinositol binding (GO:0035091)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	25						CACCCCAGGCCCTGCCCCGAG	0.612																																					p.P968A		Atlas-SNP	.											.	ZCCHC2	64	.	0			c.C2902G						.						48.0	54.0	52.0					18																	60242216		2124	4235	6359	SO:0001583	missense	54877	exon13			CCAGGCCCTGCCC	AB051531	CCDS45880.1	18q21.33	2012-04-19			ENSG00000141664	ENSG00000141664		"""Zinc fingers, CCHC domain containing"""	22916	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 49"""	C18orf49		11214970	Standard	NM_017742		Approved	FLJ20281, KIAA1744, FLJ20222	uc002lip.4	Q9C0B9		ENST00000269499.5:c.2902C>G	chr18.hg19:g.60242216C>G	ENSP00000269499:p.Pro968Ala	58.0	0.0		52.0	21.0	NM_017742	B2RPG6|Q8N3S1|Q9NXF6	Missense_Mutation	SNP	ENST00000269499.5	hg19	CCDS45880.1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645117	0.67358	.	.	ENSG00000141664	ENST00000269499	T	0.24350	1.86	4.77	4.77	0.60923	.	0.147675	0.45126	D	0.000397	T	0.41488	0.1161	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.18935	-1.0321	10	0.46703	T	0.11	-15.3702	18.3609	0.90374	0.0:1.0:0.0:0.0	.	968	Q9C0B9	ZCHC2_HUMAN	A	968	ENSP00000269499:P968A	ENSP00000269499:P968A	P	+	1	0	ZCCHC2	58393196	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.624000	0.74243	2.630000	0.89119	0.655000	0.94253	CCT	.	.		0.612	ZCCHC2-005	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000450083.1	NM_017742	
CDH7	1005	hgsc.bcm.edu	37	18	63511191	63511191	+	Silent	SNP	T	T	A	rs139333396	byFrequency	TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr18:63511191T>A	ENST00000397968.2	+	7	1551	c.1125T>A	c.(1123-1125)ccT>ccA	p.P375P	CDH7_ENST00000536984.2_Silent_p.P375P|CDH7_ENST00000323011.3_Silent_p.P375P	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	375	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				ATGAGCCCCCTGTGTTCTCTT	0.488																																					p.P375P		Atlas-SNP	.											.	CDH7	362	.	0			c.T1125A						.						189.0	156.0	167.0					18																	63511191		2203	4300	6503	SO:0001819	synonymous_variant	1005	exon7			GCCCCCTGTGTTC	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1125T>A	chr18.hg19:g.63511191T>A		183.0	0.0		137.0	48.0	NM_004361	Q9H157	Silent	SNP	ENST00000397968.2	hg19	CCDS11993.1																																																																																			.	T|0.999;C|0.001		0.488	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
MUC16	94025	hgsc.bcm.edu	37	19	9059979	9059979	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:9059979G>T	ENST00000397910.4	-	3	27670	c.27467C>A	c.(27466-27468)tCt>tAt	p.S9156Y		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9158	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AACGGGAGAAGATGAGGTCAT	0.512																																					p.S9156Y		Atlas-SNP	.											MUC16_ENST00000397910,NS,carcinoma,0,2	MUC16	4315	.	0			c.C27467A						.						81.0	78.0	79.0					19																	9059979		2045	4201	6246	SO:0001583	missense	94025	exon3			GGAGAAGATGAGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.27467C>A	chr19.hg19:g.9059979G>T	ENSP00000381008:p.Ser9156Tyr	95.0	0.0		66.0	19.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	g	1.279	-0.610881	0.03690	.	.	ENSG00000181143	ENST00000397910	T	0.22336	1.96	2.26	-1.29	0.09288	.	.	.	.	.	T	0.10680	0.0261	N	0.08118	0	.	.	.	B	0.22080	0.064	B	0.28385	0.089	T	0.25676	-1.0125	8	0.87932	D	0	.	6.8976	0.24265	0.4413:0.0:0.5587:0.0	.	9156	B5ME49	.	Y	9156	ENSP00000381008:S9156Y	ENSP00000381008:S9156Y	S	-	2	0	MUC16	8920979	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.229000	0.17833	-0.589000	0.05874	-1.694000	0.00725	TCT	.	.		0.512	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9084032	9084032	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:9084032T>A	ENST00000397910.4	-	1	7986	c.7783A>T	c.(7783-7785)Agc>Tgc	p.S2595C		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2595	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACCAAAAGGCTCTCAGGAGTA	0.458																																					p.S2595C		Atlas-SNP	.											.	MUC16	4315	.	0			c.A7783T						.						145.0	142.0	143.0					19																	9084032		1947	4140	6087	SO:0001583	missense	94025	exon1			AAAGGCTCTCAGG	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.7783A>T	chr19.hg19:g.9084032T>A	ENSP00000381008:p.Ser2595Cys	128.0	0.0		96.0	23.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	0.181	-1.061768	0.01950	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	0.225	-0.451	0.12214	.	.	.	.	.	T	0.01353	0.0044	N	0.08118	0	.	.	.	P	0.41041	0.736	B	0.34652	0.187	T	0.44345	-0.9334	7	0.87932	D	0	.	.	.	.	.	2595	B5ME49	.	C	2595	ENSP00000381008:S2595C	ENSP00000381008:S2595C	S	-	1	0	MUC16	8945032	0.014000	0.17966	0.087000	0.20705	0.089000	0.18198	-0.623000	0.05546	-0.946000	0.03677	-0.991000	0.02546	AGC	.	.		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
CALR	811	hgsc.bcm.edu	37	19	13054713	13054713	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:13054713A>G	ENST00000316448.5	+	9	1313	c.1240A>G	c.(1240-1242)Aag>Gag	p.K414E	RAD23A_ENST00000592268.1_5'Flank|CTC-425F1.4_ENST00000589120.1_RNA|RAD23A_ENST00000316856.3_5'Flank|RAD23A_ENST00000586534.1_5'Flank|RAD23A_ENST00000541222.1_5'Flank	NM_004343.3	NP_004334.1	P27797	CALR_HUMAN	calreticulin	414	C-domain.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cardiac muscle cell differentiation (GO:0055007)|cell cycle arrest (GO:0007050)|cellular calcium ion homeostasis (GO:0006874)|cellular protein metabolic process (GO:0044267)|cellular response to lithium ion (GO:0071285)|cellular senescence (GO:0090398)|chaperone-mediated protein folding (GO:0061077)|cortical actin cytoskeleton organization (GO:0030866)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucocorticoid receptor signaling pathway (GO:0042921)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|peptide antigen assembly with MHC class I protein complex (GO:0002502)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of DNA replication (GO:0045740)|positive regulation of gene expression (GO:0010628)|positive regulation of phagocytosis (GO:0050766)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|post-translational protein modification (GO:0043687)|protein export from nucleus (GO:0006611)|protein folding (GO:0006457)|protein localization to nucleus (GO:0034504)|protein maturation by protein folding (GO:0022417)|protein N-linked glycosylation via asparagine (GO:0018279)|protein stabilization (GO:0050821)|regulation of apoptotic process (GO:0042981)|regulation of meiosis (GO:0040020)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to testosterone (GO:0033574)|sequestering of calcium ion (GO:0051208)|spermatogenesis (GO:0007283)	acrosomal vesicle (GO:0001669)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|intracellular (GO:0005622)|membrane (GO:0016020)|MHC class I peptide loading complex (GO:0042824)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|proteinaceous extracellular matrix (GO:0005578)|sarcoplasmic reticulum (GO:0016529)	androgen receptor binding (GO:0050681)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|chaperone binding (GO:0051087)|complement component C1q binding (GO:0001849)|DNA binding (GO:0003677)|glycoprotein binding (GO:0001948)|hormone binding (GO:0042562)|integrin binding (GO:0005178)|iron ion binding (GO:0005506)|mRNA binding (GO:0003729)|peptide binding (GO:0042277)|poly(A) RNA binding (GO:0044822)|protein binding involved in protein folding (GO:0044183)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(1)	10					Antihemophilic Factor(DB00025)|Melatonin(DB01065)|Tenecteplase(DB00031)	CGGCCAGGCCAAGGACGAGCT	0.597																																					p.K414E		Atlas-SNP	.											.	CALR	31	.	0			c.A1240G						.						166.0	131.0	143.0					19																	13054713		2202	4299	6501	SO:0001583	missense	811	exon9			CAGGCCAAGGACG	M84739	CCDS12288.1	19p13.3-p13.2	2014-09-17				ENSG00000179218			1455	protein-coding gene	gene with protein product	"""Sicca syndrome antigen A (autoantigen Ro; calreticulin)"", ""autoantigen Ro"""	109091				2365822	Standard	NM_004343		Approved	RO, SSA, cC1qR, CRT, FLJ26680	uc002mvu.2	P27797		ENST00000316448.5:c.1240A>G	chr19.hg19:g.13054713A>G	ENSP00000320866:p.Lys414Glu	181.0	0.0		109.0	37.0	NM_004343	Q6IAT4|Q9UDG2	Missense_Mutation	SNP	ENST00000316448.5	hg19	CCDS12288.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744183	0.49151	.	.	ENSG00000179218	ENST00000316448;ENST00000539083	T	0.51817	0.69	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	N	0.19112	0.55	0.53688	D	0.99997	P	0.51449	0.945	P	0.45753	0.492	T	0.39461	-0.9613	10	0.59425	D	0.04	-39.2548	14.7288	0.69365	1.0:0.0:0.0:0.0	.	414	P27797	CALR_HUMAN	E	414;293	ENSP00000320866:K414E	ENSP00000320866:K414E	K	+	1	0	CALR	12915713	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	6.595000	0.74109	2.123000	0.65237	0.454000	0.30748	AAG	.	.		0.597	CALR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451952.1	NM_004343	
NOVA2	4858	hgsc.bcm.edu	37	19	46457041	46457041	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:46457041C>A	ENST00000263257.5	-	3	587	c.393G>T	c.(391-393)aaG>aaT	p.K131N		NM_002516.2	NP_002507.1	Q9UNW9	NOVA2_HUMAN	neuro-oncological ventral antigen 2	131	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				regulation of RNA metabolic process (GO:0051252)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(5)|lung(13)	21		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00245)|GBM - Glioblastoma multiforme(486;0.0782)|Epithelial(262;0.179)		AGCTGACCTGCTTGGCTCTGT	0.512																																					p.K131N		Atlas-SNP	.											.	NOVA2	38	.	0			c.G393T						.						237.0	212.0	220.0					19																	46457041		2203	4300	6503	SO:0001583	missense	4858	exon3			GACCTGCTTGGCT	U70477	CCDS12679.1	19q13.3	2008-07-17				ENSG00000104967			7887	protein-coding gene	gene with protein product	"""neuro-oncological ventral antigen 3"""	601991		NOVA3		9344654, 10368286	Standard	NM_002516		Approved	ANOVA	uc002pdv.2	Q9UNW9		ENST00000263257.5:c.393G>T	chr19.hg19:g.46457041C>A	ENSP00000263257:p.Lys131Asn	140.0	0.0		67.0	25.0	NM_002516	O43267|Q9UEA1	Missense_Mutation	SNP	ENST00000263257.5	hg19	CCDS12679.1	.	.	.	.	.	.	.	.	.	.	C	12.59	1.983346	0.35036	.	.	ENSG00000104967	ENST00000263257	T	0.63417	-0.04	4.86	1.6	0.23607	K Homology (1);K Homology, type 1 (1);	0.117466	0.56097	D	0.000028	T	0.66208	0.2766	L	0.47716	1.5	0.52099	D	0.99994	D	0.71674	0.998	D	0.76071	0.987	T	0.60005	-0.7347	10	0.29301	T	0.29	-11.151	6.6552	0.22984	0.0:0.6226:0.0:0.3774	.	131	Q9UNW9	NOVA2_HUMAN	N	131	ENSP00000263257:K131N	ENSP00000263257:K131N	K	-	3	2	NOVA2	51148881	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.371000	0.34250	0.266000	0.21894	0.563000	0.77884	AAG	.	.		0.512	NOVA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437210.2	NM_002516	
CARD8	22900	hgsc.bcm.edu	37	19	48734194	48734194	+	Silent	SNP	C	C	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:48734194C>T	ENST00000359009.4	-	5	609	c.297G>A	c.(295-297)gaG>gaA	p.E99E	CARD8_ENST00000357778.5_5'UTR|CARD8_ENST00000447740.2_Silent_p.E154E|CARD8_ENST00000520153.1_Silent_p.E154E|CARD8_ENST00000519940.1_Silent_p.E204E|CARD8_ENST00000520015.1_Silent_p.E204E|CARD8_ENST00000391898.3_Silent_p.E204E|CARD8_ENST00000520753.1_Silent_p.E204E|CARD8_ENST00000521613.1_Silent_p.E154E|ZNF114_ENST00000597695.1_Intron			Q9Y2G2	CARD8_HUMAN	caspase recruitment domain family, member 8	99			E -> A (in dbSNP:rs59878320). {ECO:0000269|PubMed:14702039}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)|NLRP3 inflammasome complex (GO:0072559)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|NACHT domain binding (GO:0032089)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(4)|lung(8)|prostate(1)|skin(1)	15		all_lung(116;0.000112)|Lung NSC(112;0.000192)|all_epithelial(76;0.000349)|all_neural(266;0.0228)|Ovarian(192;0.113)|Prostate(7;0.184)		OV - Ovarian serous cystadenocarcinoma(262;0.000112)|all cancers(93;0.000293)|Epithelial(262;0.0129)|GBM - Glioblastoma multiforme(486;0.0336)		TCACTGTGACCTCATCCCTTA	0.587																																					p.E204E		Atlas-SNP	.											.	CARD8	53	.	0			c.G612A						.						61.0	47.0	52.0					19																	48734194		2203	4300	6503	SO:0001819	synonymous_variant	22900	exon6			TGTGACCTCATCC	AB023172	CCDS12712.1, CCDS12712.2, CCDS54287.1, CCDS54288.1, CCDS54289.1	19q13.33	2011-05-24			ENSG00000105483	ENSG00000105483			17057	protein-coding gene	gene with protein product		609051				10231032, 11408476	Standard	NM_001184900		Approved	TUCAN, KIAA0955, CARDINAL, NDPP, Dakar	uc010xzj.2	Q9Y2G2	OTTHUMG00000165047	ENST00000359009.4:c.297G>A	chr19.hg19:g.48734194C>T		135.0	0.0		98.0	68.0	NM_001184900	B5KVR6|B7Z496|B7Z4A2|E9PEM7|G3XAM9|Q6PGP8|Q96P82	Silent	SNP	ENST00000359009.4	hg19																																																																																				.	.		0.587	CARD8-202	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_014959	
ZNF551	90233	hgsc.bcm.edu	37	19	58193543	58193543	+	Silent	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:58193543G>T	ENST00000282296.5	+	1	197	c.12G>T	c.(10-12)ccG>ccT	p.P4P	ZNF551_ENST00000356715.4_5'UTR|AC003006.7_ENST00000599221.1_3'UTR|ZNF551_ENST00000599402.1_3'UTR|AC003006.7_ENST00000594684.1_5'UTR|ZNF551_ENST00000596085.1_5'UTR			Q7Z340	ZN551_HUMAN	zinc finger protein 551	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGCCCGCCCCGGTCGGCCGCC	0.672																																					p.P4P		Atlas-SNP	.											.	ZNF551	65	.	0			c.G12T						.						10.0	10.0	10.0					19																	58193543		1853	3521	5374	SO:0001819	synonymous_variant	90233	exon1			CGCCCCGGTCGGC	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.12G>T	chr19.hg19:g.58193543G>T		17.0	0.0		17.0	10.0	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Silent	SNP	ENST00000282296.5	hg19	CCDS12959.2																																																																																			.	.		0.672	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
C20orf27	54976	hgsc.bcm.edu	37	20	3739248	3739248	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr20:3739248C>A	ENST00000379772.3	-	3	907	c.97G>T	c.(97-99)Gat>Tat	p.D33Y	C20orf27_ENST00000217195.8_Missense_Mutation_p.D58Y	NM_001258429.1	NP_001245358.1	Q9GZN8	CT027_HUMAN	chromosome 20 open reading frame 27	33										central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)|urinary_tract(1)	7						AGCTTCTCATCAAAGTGGACG	0.572																																					p.D58Y		Atlas-SNP	.											.	C20orf27	17	.	0			c.G172T						.						140.0	117.0	125.0					20																	3739248		2203	4300	6503	SO:0001583	missense	54976	exon3			TCTCATCAAAGTG	AK000557	CCDS33436.1, CCDS58763.1	20p13	2011-01-25			ENSG00000101220	ENSG00000101220			15873	protein-coding gene	gene with protein product	"""hypothetical protein LOC54976"""					11780052	Standard	NM_001258429		Approved	FLJ20550	uc002wjh.2	Q9GZN8	OTTHUMG00000031753	ENST00000379772.3:c.97G>T	chr20.hg19:g.3739248C>A	ENSP00000369097:p.Asp33Tyr	46.0	0.0		23.0	18.0	NM_001039140	A8K4J0|D3DVX8|Q5JX81|Q9NWX3	Missense_Mutation	SNP	ENST00000379772.3	hg19	CCDS58763.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.559198|4.559198	0.86335|0.86335	.|.	.|.	ENSG00000101220|ENSG00000101220	ENST00000379772;ENST00000217195;ENST00000399672;ENST00000379765|ENST00000399683	.|.	.|.	.|.	4.69|4.69	4.69|4.69	0.59074|0.59074	.|.	0.063181|.	0.64402|.	U|.	0.000015|.	T|T	0.73345|0.73345	0.3575|0.3575	M|M	0.69823|0.69823	2.125|2.125	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D|.	0.89917|.	0.958;0.997;1.0|.	P;D;D|.	0.81914|.	0.748;0.931;0.995|.	T|T	0.73186|0.73186	-0.4062|-0.4062	9|5	0.72032|.	D|.	0.01|.	-4.6801|-4.6801	15.5218|15.5218	0.75871|0.75871	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	33;58;33|.	Q9GZN8;Q9GZN8-2;E9PAL2|.	CT027_HUMAN;.;.|.	Y|F	33;58;33;33|26	.|.	ENSP00000217195:D58Y|.	D|L	-|-	1|3	0|2	C20orf27|C20orf27	3687248|3687248	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.845000|4.845000	0.62853|0.62853	2.613000|2.613000	0.88420|0.88420	0.650000|0.650000	0.86243|0.86243	GAT|TTG	.	.		0.572	C20orf27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077750.2	NM_001039140	
SSTR4	6754	hgsc.bcm.edu	37	20	23016896	23016896	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr20:23016896G>A	ENST00000255008.3	+	1	840	c.776G>A	c.(775-777)aGg>aAg	p.R259K	RP4-753D10.3_ENST00000440921.1_RNA	NM_001052.2	NP_001043.2	P31391	SSR4_HUMAN	somatostatin receptor 4	259					arachidonic acid metabolic process (GO:0019369)|cell migration (GO:0016477)|cellular response to glucocorticoid stimulus (GO:0071385)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP metabolic process (GO:0030815)|negative regulation of cell proliferation (GO:0008285)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	somatostatin receptor activity (GO:0004994)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	32	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)					AAAATCACCAGGCTGGTGCTG	0.622																																					p.R259K	Esophageal Squamous(15;850 1104 16640)	Atlas-SNP	.											.	SSTR4	83	.	0			c.G776A						.						165.0	175.0	172.0					20																	23016896		2198	4293	6491	SO:0001583	missense	6754	exon1			TCACCAGGCTGGT		CCDS42856.1	20p11.21	2014-07-11			ENSG00000132671	ENSG00000132671		"""GPCR / Class A : Somatostatin receptors"""	11333	protein-coding gene	gene with protein product		182454				8483934	Standard	NM_001052		Approved		uc002wsr.2	P31391	OTTHUMG00000032054	ENST00000255008.3:c.776G>A	chr20.hg19:g.23016896G>A	ENSP00000255008:p.Arg259Lys	44.0	0.0		33.0	10.0	NM_001052	Q17RM1|Q17RM3|Q9UIY1	Missense_Mutation	SNP	ENST00000255008.3	hg19	CCDS42856.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.912077	0.52439	.	.	ENSG00000132671	ENST00000255008	T	0.34472	1.36	3.36	3.36	0.38483	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	U	0.000008	T	0.34250	0.0891	L	0.38838	1.175	0.23056	N	0.998361	B	0.33379	0.41	B	0.40329	0.326	T	0.34179	-0.9839	10	0.51188	T	0.08	.	13.4152	0.60963	0.0:0.0:1.0:0.0	.	259	P31391	SSR4_HUMAN	K	259	ENSP00000255008:R259K	ENSP00000255008:R259K	R	+	2	0	SSTR4	22964896	0.816000	0.29132	0.358000	0.25811	0.922000	0.55478	2.982000	0.49337	1.694000	0.51137	0.655000	0.94253	AGG	.	.		0.622	SSTR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078308.1		
TBC1D25	4943	hgsc.bcm.edu	37	X	48418242	48418242	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chrX:48418242G>T	ENST00000376771.4	+	6	1287	c.946G>T	c.(946-948)Gac>Tac	p.D316Y	snoU13_ENST00000459609.1_RNA|TBC1D25_ENST00000537536.1_Missense_Mutation_p.D62Y	NM_002536.2	NP_002527.1	Q3MII6	TBC25_HUMAN	TBC1 domain family, member 25	316	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.				autophagy (GO:0006914)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of autophagic vacuole maturation (GO:1901096)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)	Rab GTPase activator activity (GO:0005097)			large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	4						GGCGCTGCACGACCTGCTCAC	0.622																																					p.D316Y		Atlas-SNP	.											.	TBC1D25	70	.	0			c.G946T						.						40.0	34.0	36.0					X																	48418242		2203	4300	6503	SO:0001583	missense	4943	exon6			CTGCACGACCTGC	L08240	CCDS35242.1	Xp11.23	2014-01-28	2007-01-12	2007-01-12	ENSG00000068354	ENSG00000068354			8092	protein-coding gene	gene with protein product		311240	"""ornithine aminotransferase-like 1"""	OATL1		21383079	Standard	NM_002536		Approved		uc004dka.1	Q3MII6	OTTHUMG00000024123	ENST00000376771.4:c.946G>T	chrX.hg19:g.48418242G>T	ENSP00000365962:p.Asp316Tyr	77.0	0.0		63.0	53.0	NM_002536	Q08AN9|Q3MII4|Q8TAR9	Missense_Mutation	SNP	ENST00000376771.4	hg19	CCDS35242.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757031	0.69648	.	.	ENSG00000068354	ENST00000376771;ENST00000537536	T;T	0.04809	3.55;3.55	5.79	5.79	0.91817	Rab-GAP/TBC domain (4);	0.000000	0.85682	D	0.000000	T	0.22205	0.0535	M	0.76574	2.34	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.76575	0.985;0.985;0.988	T	0.00100	-1.2065	10	0.87932	D	0	-19.2738	16.2999	0.82804	0.0:0.0:1.0:0.0	.	320;258;316	B4DF03;B4DGU3;Q3MII6	.;.;TBC25_HUMAN	Y	316;62	ENSP00000365962:D316Y;ENSP00000444091:D62Y	ENSP00000365962:D316Y	D	+	1	0	TBC1D25	48303186	1.000000	0.71417	0.950000	0.38849	0.814000	0.46013	9.078000	0.94023	2.454000	0.82982	0.529000	0.55759	GAC	.	.		0.622	TBC1D25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060764.2	NM_002536	
ARMCX1	51309	hgsc.bcm.edu	37	X	100808723	100808724	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chrX:100808723_100808724CC>AA	ENST00000372829.3	+	4	1181_1182	c.810_811CC>AA	c.(808-813)gcCCtt>gcAAtt	p.L271I		NM_016608.1	NP_057692.1	Q9P291	ARMX1_HUMAN	armadillo repeat containing, X-linked 1	271						integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(2)|ovary(3)|pancreas(1)|urinary_tract(1)	19						CTTACAATGCCCTTAATAACTT	0.411																																					p.A270A|p.L271I		Atlas-SNP	.											.	ARMCX1	67	.	0			c.C810A|c.C811A						.																																			SO:0001583	missense	51309	exon4			CAATGCCCTTAAT|AATGCCCTTAATA	AB039670	CCDS14487.1	Xq21.33-q22.2	2014-03-21			ENSG00000126947	ENSG00000126947		"""Armadillo repeat containing"""	18073	protein-coding gene	gene with protein product		300362				11162520, 16221301, 22569362	Standard	NM_016608		Approved	ALEX1, GASP7	uc004ehv.3	Q9P291	OTTHUMG00000022033	Exception_encountered	chrX.hg19:g.100808723_100808724delinsAA	ENSP00000361917:p.Leu271Ile	34.0	0.0		33.0	27.0	NM_016608	Q53HK2|Q9H2Q0	Silent|Missense_Mutation	SNP	ENST00000372829.3	hg19	CCDS14487.1																																																																																			.	.		0.411	ARMCX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057561.1	NM_016608	
RHOXF1	158800	hgsc.bcm.edu	37	X	119243261	119243261	+	Splice_Site	SNP	C	C	G			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chrX:119243261C>G	ENST00000217999.2	-	3	519		c.e3-1		RP4-755D9.1_ENST00000553843.1_RNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1						gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						TAAACCAAACCTACAATCAGA	0.388																																					.		Atlas-SNP	.											.	RHOXF1	24	.	0			c.445-1G>C						.						69.0	58.0	62.0					X																	119243261		2203	4300	6503	SO:0001630	splice_region_variant	158800	exon4			CCAAACCTACAAT		CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.445-1G>C	chrX.hg19:g.119243261C>G		64.0	0.0		39.0	35.0	NM_139282	O95030|Q3SYE0	Splice_Site	SNP	ENST00000217999.2	hg19	CCDS14593.1	.	.	.	.	.	.	.	.	.	.	.	13.42	2.233303	0.39498	.	.	ENSG00000101883	ENST00000217999	.	.	.	3.23	3.23	0.37069	.	.	.	.	.	.	.	.	.	.	.	0.38797	D	0.955107	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.1652	0.37048	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RHOXF1	119127289	0.093000	0.21703	0.014000	0.15608	0.604000	0.37047	2.440000	0.44855	1.899000	0.54978	0.600000	0.82982	.	.	.		0.388	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058083.2	NM_139282	Intron
GPR119	139760	hgsc.bcm.edu	37	X	129518890	129518890	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chrX:129518890T>A	ENST00000276218.2	-	1	621	c.532A>T	c.(532-534)Atg>Ttg	p.M178L		NM_178471.2	NP_848566.1	Q8TDV5	GP119_HUMAN	G protein-coupled receptor 119	178					insulin secretion (GO:0030073)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(3)|prostate(1)	11						AAGAGGAGCATGGCTGGGAAG	0.532																																					p.M178L		Atlas-SNP	.											.	GPR119	34	.	0			c.A532T						.						108.0	88.0	95.0					X																	129518890		2203	4300	6503	SO:0001583	missense	139760	exon1			GGAGCATGGCTGG	AY288416	CCDS14625.1	Xq26.1	2014-01-30			ENSG00000147262	ENSG00000147262		"""GPCR / Class A : Orphans"""	19060	protein-coding gene	gene with protein product		300513				12044878, 14623098	Standard	NM_178471		Approved	hGPCR2, GPCR2	uc011muv.2	Q8TDV5	OTTHUMG00000022397	ENST00000276218.2:c.532A>T	chrX.hg19:g.129518890T>A	ENSP00000276218:p.Met178Leu	54.0	0.0		38.0	32.0	NM_178471	Q495H7|Q4VBN3	Missense_Mutation	SNP	ENST00000276218.2	hg19	CCDS14625.1	.	.	.	.	.	.	.	.	.	.	T	0.167	-1.075821	0.01903	.	.	ENSG00000147262	ENST00000276218	T	0.28255	1.62	4.75	0.111	0.14619	GPCR, rhodopsin-like superfamily (1);	0.417657	0.24085	N	0.041691	T	0.05593	0.0147	N	0.00750	-1.22	0.22330	N	0.9992	B	0.02656	0.0	B	0.01281	0.0	T	0.27640	-1.0068	10	0.02654	T	1	0.0029	1.1145	0.01711	0.175:0.1613:0.3382:0.3254	.	178	Q8TDV5	GP119_HUMAN	L	178	ENSP00000276218:M178L	ENSP00000276218:M178L	M	-	1	0	GPR119	129346571	0.998000	0.40836	0.906000	0.35671	0.906000	0.53458	1.313000	0.33585	-0.332000	0.08489	-0.483000	0.04790	ATG	.	.		0.532	GPR119-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058270.1	NM_178471	
RB1	5925	hgsc.bcm.edu	37	13	48954325	48954326	+	Frame_Shift_Del	DEL	TC	TC	-	rs34873197		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	TC	TC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr13:48954325_48954326delTC	ENST00000267163.4	+	16	1584_1585	c.1446_1447delTC	c.(1444-1449)tttcatfs	p.FH482fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	482	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.H483fs*9(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACAACATTTTTCATATGTCTTT	0.238		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.482_482del		Atlas-INDEL	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	24	Whole gene deletion(15)|Unknown(8)|Deletion - Frameshift(1)	bone(11)|breast(5)|eye(2)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.1445_1446del						.																																			SO:0001589	frameshift_variant	5925	exon16	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1446_1447delTC	chr13.hg19:g.48954325_48954326delTC	ENSP00000267163:p.Phe482fs	199.0	0.0		37.0	20.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.238	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RB1	5925	hgsc.bcm.edu	37	13	48954328	48954334	+	Frame_Shift_Del	DEL	TATGTCT	TATGTCT	-	rs367661403|rs587778832		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	TATGTCT	TATGTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr13:48954328_48954334delTATGTCT	ENST00000267163.4	+	16	1587_1593	c.1449_1455delTATGTCT	c.(1447-1455)catatgtctfs	p.HMS483fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	483	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.M484fs*8(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACATTTTTCATATGTCTTTATTGGCGT	0.251		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.483_485del		Atlas-INDEL	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	24	Whole gene deletion(15)|Unknown(8)|Deletion - Frameshift(1)	bone(11)|breast(5)|central_nervous_system(2)|adrenal_gland(1)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.1448_1454del	GRCh37	CD962139|CI030637|CI071455|CM016043	RB1	D|I|M		.																																			SO:0001589	frameshift_variant	5925	exon16	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1449_1455delTATGTCT	chr13.hg19:g.48954328_48954334delTATGTCT	ENSP00000267163:p.His483fs	206.0	0.0		36.0	20.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.251	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
ZNF669	79862	hgsc.bcm.edu	37	1	247264138	247264138	+	Frame_Shift_Del	DEL	A	A	-			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr1:247264138delA	ENST00000343381.6	-	4	1105	c.933delT	c.(931-933)tgtfs	p.C311fs	ZNF669_ENST00000358785.4_3'UTR|ZNF669_ENST00000448299.2_Frame_Shift_Del_p.C225fs	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			ATGTTTTCCCACATTCCTTAC	0.378																																					p.G312fs		Atlas-Indel,Pindel	.											.	ZNF669	46	.	0			c.934delG						.						89.0	91.0	90.0					1																	247264138		2203	4300	6503	SO:0001589	frameshift_variant	79862	exon4			.		CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.933delT	chr1.hg19:g.247264138delA	ENSP00000342818:p.Cys311fs	84.0	0.0		92.0	22.0	NM_024804	B3KP94|Q5VT39|Q9H9Q6	Frame_Shift_Del	DEL	ENST00000343381.6	hg19	CCDS31088.1																																																																																			.	.		0.378	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000098394.4	NM_024804	
RPS4Y1	6192	hgsc.bcm.edu	37	Y	2722723	2722724	+	Frame_Shift_Ins	INS	-	-	CT			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chrY:2722723_2722724insCT	ENST00000250784.8	+	5	582_583	c.443_444insCT	c.(442-447)cgctacfs	p.Y149fs	RPS4Y1_ENST00000477725.1_3'UTR	NM_001008.3	NP_000999.1	P22090	RS4Y1_HUMAN	ribosomal protein S4, Y-linked 1	149					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(1)|lung(2)	3						CGAACCATCCGCTACCCAGATC	0.421																																					p.R148fs	Melanoma(193;1927 2965 17170 18413)	Atlas-Indel,Pindel	.											.	RPS4Y1	4	.	0			c.443_444insCT						.																																			SO:0001589	frameshift_variant	6192	exon5			.		CCDS14773.1	Yp11.3	2011-04-05	2004-05-21	2004-05-26	ENSG00000129824	ENSG00000129824		"""S ribosomal proteins"""	10425	protein-coding gene	gene with protein product	"""ribosomal protein S4Y"", ""40S ribosomal protein S4, Y"""	470000	"""ribosomal protein S4, Y-linked"""	RPS4Y			Standard	NM_001008		Approved	MGC5070, MGC119100, S4	uc004fqi.3	P22090	OTTHUMG00000036152	ENST00000250784.8:c.444_445dupCT	chrY.hg19:g.2722724_2722725dupCT	ENSP00000250784:p.Tyr149fs	141.0	0.0		122.0	99.0	NM_001008	A8K9V4	Frame_Shift_Ins	INS	ENST00000250784.8	hg19	CCDS14773.1																																																																																			.	.		0.421	RPS4Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088052.2	NM_001008	
ZNF680	340252	hgsc.bcm.edu	37	7	63982871	63982872	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:63982871_63982872delAT	ENST00000309683.6	-	4	411_412	c.260_261delAT	c.(259-261)tatfs	p.Y87fs	ZNF680_ENST00000476563.1_5'UTR	NM_178558.4	NP_848653.2	Q8NEM1	ZN680_HUMAN	zinc finger protein 680	87					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)	27		Lung NSC(55;0.118)|all_lung(88;0.243)				TGAAATGAGAATATATAACTGA	0.292																																					p.87_88del		Atlas-Indel,Pindel	.											.	ZNF680	58	.	0			c.261_262del						.																																			SO:0001589	frameshift_variant	340252	exon4			.	AK074911	CCDS34644.1, CCDS47594.1	7q11.21	2013-01-08			ENSG00000173041	ENSG00000173041		"""Zinc fingers, C2H2-type"", ""-"""	26897	protein-coding gene	gene with protein product	"""hypothetical protein FLJ90430"""					12477932	Standard	NM_178558		Approved	FLJ90430	uc003tta.2	Q8NEM1	OTTHUMG00000156542	ENST00000309683.6:c.260_261delAT	chr7.hg19:g.63982875_63982876delAT	ENSP00000309330:p.Tyr87fs	54.0	0.0		46.0	14.0	NM_178558	B3KVJ4|Q6ZNF3|Q8NC79	Frame_Shift_Del	DEL	ENST00000309683.6	hg19	CCDS34644.1																																																																																			.	.		0.292	ZNF680-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344568.1	NM_178558	
STX10	8677	hgsc.bcm.edu	37	19	13259885	13259886	+	Frame_Shift_Ins	INS	-	-	A			TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr19:13259885_13259886insA	ENST00000587230.1	-	4	384_385	c.320_321insT	c.(319-321)gtcfs	p.V107fs	STX10_ENST00000343587.5_Intron|STX10_ENST00000242770.5_Frame_Shift_Ins_p.V107fs|IER2_ENST00000292433.3_5'Flank|IER2_ENST00000588173.1_5'Flank|IER2_ENST00000587885.1_5'Flank|STX10_ENST00000589083.1_Frame_Shift_Ins_p.V107fs	NM_001271609.1	NP_001258538.1	O60499	STX10_HUMAN	syntaxin 10	107					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			CTGTTGGGCTGACCATATGGTC	0.554																																					p.V107fs		Atlas-Indel,Pindel	.											.	STX10	12	.	0			c.321_322insT						.																																			SO:0001589	frameshift_variant	8677	exon4			.	AF035531	CCDS32922.1, CCDS62569.1, CCDS62570.1, CCDS62571.1	19p13.13	2008-07-22				ENSG00000104915			11428	protein-coding gene	gene with protein product		603765				9446797	Standard	NM_003765		Approved	hsyn10, SYN10	uc021upq.2	O60499		ENST00000587230.1:c.321dupT	chr19.hg19:g.13259886_13259886dupA	ENSP00000466298:p.Val107fs	139.0	0.0		71.0	16.0	NM_003765	A6NC41|Q6IAP4|Q96AE8	Frame_Shift_Ins	INS	ENST00000587230.1	hg19	CCDS32922.1																																																																																			.	.		0.554	STX10-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452918.1	NM_003765	
FAM220A	84792	hgsc.bcm.edu	37	7	6370320	6370355	+	In_Frame_Del	DEL	GCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	GCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	-	rs138213138|rs368468737|rs75910050|rs374494633	byFrequency	TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	GCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	GCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr7:6370320_6370355delGCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	ENST00000313324.4	-	2	898_933	c.431_466delAGTGCCCCAAAGGAGAGCCTCGGGTGTCACGACTGC	c.(430-468)cagtgccccaaaggagagcctcgggtgtcacgactgcca>cca	p.QCPKGEPRVSRL144del	FAM220A_ENST00000533877.1_5'Flank	NM_001037163.1	NP_001032240.1	Q7Z4H9	F220A_HUMAN	family with sequence similarity 220, member A	144						nucleus (GO:0005634)		p.C145C(1)|p.P150H(1)									TGATGGCGTGGCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACTGTCCTCTGTG	0.602																																					p.144_156del		Pindel	.											.	.	.	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	ovary(1)|lung(1)	c.432_467del						.																																			SO:0001651	inframe_deletion	84792	exon2			.	BC006110	CCDS34599.1	7p22.1	2012-03-19	2012-03-19	2012-03-19	ENSG00000178397	ENSG00000178397			22422	protein-coding gene	gene with protein product	"""STAT3-interacting protein as a repressor"""		"""chromosome 7 open reading frame 70"""	C7orf70			Standard	NM_001037163		Approved	SIPAR, MGC12966	uc003spu.3	Q7Z4H9	OTTHUMG00000122091	ENST00000313324.4:c.431_466delAGTGCCCCAAAGGAGAGCCTCGGGTGTCACGACTGC	chr7.hg19:g.6370320_6370355delGCAGTCGTGACACCCGAGGCTCTCCTTTGGGGCACT	ENSP00000317289:p.Gln144_Leu155del	98.0	0.0		42.0	12.0	NM_001037163	Q75ML2|Q8NA52|Q9BRR7	In_Frame_Del	DEL	ENST00000313324.4	hg19	CCDS34599.1																																																																																			.	.		0.602	FAM220A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000242853.2	NM_001037163	
RB1	5925	hgsc.bcm.edu	37	13	48954325	48954334	+	Frame_Shift_Del	DEL	TCATATGTCT	TCATATGTCT	-	rs367661403|rs587778832|rs34873197		TCGA-CC-A7IF-01A-11D-A33K-10	TCGA-CC-A7IF-10A-01D-A33K-10	TCATATGTCT	TCATATGTCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d6bd5100-cf29-4f48-82d6-9f3a0c8891a2	37a06484-87a9-4ed4-b9bc-9f9a5ae7a317	g.chr13:48954325_48954334delTCATATGTCT	ENST00000267163.4	+	16	1584_1593	c.1446_1455delTCATATGTCT	c.(1444-1455)tttcatatgtctfs	p.FHMS482fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	482	Domain A.|Pocket; binds T and E1A.				androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(8)|p.H483fs*9(1)|p.M484fs*8(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ACAACATTTTTCATATGTCTTTATTGGCGT	0.248		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.482_485del		Pindel	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	25	Whole gene deletion(15)|Unknown(8)|Deletion - Frameshift(2)	bone(11)|breast(5)|eye(2)|central_nervous_system(2)|adrenal_gland(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)|lung(1)	c.1445_1454del	GRCh37	CD962139|CI030637|CI071455|CM016043	RB1	D|I|M		.																																			SO:0001589	frameshift_variant	5925	exon16	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.1446_1455delTCATATGTCT	chr13.hg19:g.48954325_48954334delTCATATGTCT	ENSP00000267163:p.Phe482fs	210.0	0.0		44.0	20.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Del	DEL	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.248	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
