#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
IL23R	149233	hgsc.bcm.edu	37	1	67724414	67724414	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:67724414T>G	ENST00000347310.5	+	11	1664	c.1493T>G	c.(1492-1494)cTc>cGc	p.L498R	IL23R_ENST00000371002.1_3'UTR|IL23R_ENST00000395227.1_Missense_Mutation_p.L243R|IL23R_ENST00000473881.1_3'UTR	NM_144701.2	NP_653302.2	Q5VWK5	IL23R_HUMAN	interleukin 23 receptor	498					defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|interleukin-23-mediated signaling pathway (GO:0038155)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|regulation of tyrosine phosphorylation of Stat1 protein (GO:0042510)|response to interferon-gamma (GO:0034341)|response to lipopolysaccharide (GO:0032496)	interleukin-23 receptor complex (GO:0072536)|receptor complex (GO:0043235)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	21						GGAAGCCATCTCAGCAATAAT	0.358																																					p.L498R		Atlas-SNP	.											.	IL23R	52	.	0			c.T1493G						.						59.0	61.0	60.0					1																	67724414		2203	4300	6503	SO:0001583	missense	149233	exon11			GCCATCTCAGCAA	AF461422	CCDS637.1	1p31.2	2008-02-05			ENSG00000162594	ENSG00000162594			19100	protein-coding gene	gene with protein product		607562				12023369	Standard	NM_144701		Approved	IL-23R	uc001ddo.3	Q5VWK5	OTTHUMG00000009092	ENST00000347310.5:c.1493T>G	chr1.hg19:g.67724414T>G	ENSP00000321345:p.Leu498Arg	257.0	0.0		169.0	79.0	NM_144701	C9JGX4|Q4VGP1|Q4VGP2|Q4VGP3|Q4VGP4|Q4VGP5|Q4VGP6|Q5VWK7|Q8IW84|Q8NFQ9|Q96AS1	Missense_Mutation	SNP	ENST00000347310.5	hg19	CCDS637.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.98|13.98	2.398180|2.398180	0.42512|0.42512	.|.	.|.	ENSG00000162594|ENSG00000162594	ENST00000347310;ENST00000395227|ENST00000425614	T;T|.	0.34275|.	1.37;1.43|.	5.62|5.62	1.79|1.79	0.24919|0.24919	.|.	0.518502|.	0.18862|.	N|.	0.129107|.	T|T	0.18635|0.18635	0.0447|0.0447	L|L	0.46157|0.46157	1.445|1.445	0.09310|0.09310	N|N	1|1	B;P;D;B;B|.	0.58620|.	0.356;0.496;0.983;0.356;0.091|.	B;B;P;B;B|.	0.56700|.	0.104;0.178;0.804;0.104;0.022|.	T|T	0.18999|0.18999	-1.0319|-1.0319	10|5	0.66056|.	D|.	0.02|.	-19.0109|-19.0109	4.3881|4.3881	0.11327|0.11327	0.0:0.1794:0.17:0.6506|0.0:0.1794:0.17:0.6506	.|.	244;133;96;243;498|.	Q5VWK5-2;Q5VWK5-5;Q5VWK5-7;Q5VWK5-6;Q5VWK5|.	.;.;.;.;IL23R_HUMAN|.	R|A	498;243|260	ENSP00000321345:L498R;ENSP00000378652:L243R|.	ENSP00000321345:L498R|.	L|S	+|+	2|1	0|0	IL23R|IL23R	67497002|67497002	0.000000|0.000000	0.05858|0.05858	0.011000|0.011000	0.14972|0.14972	0.007000|0.007000	0.05969|0.05969	0.279000|0.279000	0.18771|0.18771	0.971000|0.971000	0.38288|0.38288	0.528000|0.528000	0.53228|0.53228	CTC|TCA	.	.		0.358	IL23R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025199.2	NM_144701	
ELTD1	64123	hgsc.bcm.edu	37	1	79472325	79472325	+	Silent	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:79472325C>A	ENST00000370742.3	-	1	78	c.15G>T	c.(13-15)ccG>ccT	p.P5P		NM_022159.3	NP_071442.2	Q9HBW9	ELTD1_HUMAN	EGF, latrophilin and seven transmembrane domain containing 1	5					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(45)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	69				COAD - Colon adenocarcinoma(225;0.0905)|Colorectal(170;0.103)|all cancers(265;0.105)|Epithelial(280;0.148)		CACCTAGGAGCGGGAGGCGTT	0.682																																					p.P5P		Atlas-SNP	.											.	ELTD1	143	.	0			c.G15T						.						13.0	17.0	16.0					1																	79472325		1965	4126	6091	SO:0001819	synonymous_variant	64123	exon1			TAGGAGCGGGAGG	AF192403	CCDS41352.1	1p33-p32	2014-08-08			ENSG00000162618	ENSG00000162618		"""-"", ""GPCR / Class B : Orphans"""	20822	protein-coding gene	gene with protein product						11050079	Standard	NM_022159		Approved	ETL	uc001diq.4	Q9HBW9	OTTHUMG00000009738	ENST00000370742.3:c.15G>T	chr1.hg19:g.79472325C>A		138.0	0.0		178.0	81.0	NM_022159	B1AR71|Q5KU34	Silent	SNP	ENST00000370742.3	hg19	CCDS41352.1																																																																																			.	.		0.682	ELTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026859.1	NM_022159	
AGL	178	hgsc.bcm.edu	37	1	100356775	100356775	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:100356775G>T	ENST00000294724.4	+	22	3290		c.e22-1		AGL_ENST00000361302.3_Splice_Site|AGL_ENST00000370165.3_Splice_Site|AGL_ENST00000370163.3_Splice_Site|AGL_ENST00000370161.2_Splice_Site|AGL_ENST00000361915.3_Splice_Site|AGL_ENST00000361522.4_Splice_Site	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		TGAATTTTCAGGTTTAATGTC	0.368																																					.		Atlas-SNP	.											.	AGL	137	.	0			c.2813-1G>T						.						84.0	84.0	84.0					1																	100356775		2203	4300	6503	SO:0001630	splice_region_variant	178	exon22			TTTTCAGGTTTAA	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2813-1G>T	chr1.hg19:g.100356775G>T		62.0	0.0		80.0	37.0	NM_000642	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Splice_Site	SNP	ENST00000294724.4	hg19	CCDS759.1	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966920	0.34659	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	.	.	.	5.71	5.71	0.89125	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.852	0.96744	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AGL	100129363	1.000000	0.71417	1.000000	0.80357	0.019000	0.09904	8.952000	0.93031	2.703000	0.92315	0.579000	0.79373	.	.	.		0.368	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	Intron
AGL	178	hgsc.bcm.edu	37	1	100356784	100356784	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:100356784T>G	ENST00000294724.4	+	22	3299	c.2821T>G	c.(2821-2823)Tct>Gct	p.S941A	AGL_ENST00000361302.3_Missense_Mutation_p.S925A|AGL_ENST00000370165.3_Missense_Mutation_p.S941A|AGL_ENST00000370163.3_Missense_Mutation_p.S941A|AGL_ENST00000370161.2_Missense_Mutation_p.S925A|AGL_ENST00000361915.3_Missense_Mutation_p.S941A|AGL_ENST00000361522.4_Missense_Mutation_p.S924A	NM_000028.2	NP_000019.2	P35573	GDE_HUMAN	amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase	941					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|response to glucocorticoid (GO:0051384)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|inclusion body (GO:0016234)|isoamylase complex (GO:0043033)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)	4-alpha-glucanotransferase activity (GO:0004134)|amylo-alpha-1,6-glucosidase activity (GO:0004135)|glycogen debranching enzyme activity (GO:0004133)|polysaccharide binding (GO:0030247)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(9)|lung(35)|ovary(1)|prostate(4)|skin(3)|urinary_tract(1)	69		all_epithelial(167;2.2e-06)|all_lung(203;0.000295)|Lung NSC(277;0.00131)		Epithelial(280;0.15)|COAD - Colon adenocarcinoma(174;0.151)|Lung(183;0.209)|all cancers(265;0.237)		AGGTTTAATGTCTGTATTGGC	0.373																																					p.S941A		Atlas-SNP	.											.	AGL	137	.	0			c.T2821G						.						89.0	90.0	89.0					1																	100356784		2203	4300	6503	SO:0001583	missense	178	exon22			TTAATGTCTGTAT	BC078663	CCDS759.1, CCDS760.1, CCDS761.1	1p21	2010-04-27	2010-04-27		ENSG00000162688	ENSG00000162688	2.4.1.25, 3.2.1.33		321	protein-coding gene	gene with protein product	"""glycogen debranching enzyme"", ""glycogen storage disease type III"""	610860	"""amylo-1, 6-glucosidase, 4-alpha-glucanotransferase"""			1505983	Standard	NM_000028		Approved		uc001dsi.1	P35573	OTTHUMG00000010803	ENST00000294724.4:c.2821T>G	chr1.hg19:g.100356784T>G	ENSP00000294724:p.Ser941Ala	70.0	0.0		86.0	41.0	NM_000644	A6NCX7|A6NEK2|D3DT51|P78354|P78544|Q59H92|Q6AZ90|Q9UF08	Missense_Mutation	SNP	ENST00000294724.4	hg19	CCDS759.1	.	.	.	.	.	.	.	.	.	.	T	14.80	2.642920	0.47153	.	.	ENSG00000162688	ENST00000361915;ENST00000370165;ENST00000370163;ENST00000294724;ENST00000361302;ENST00000370161;ENST00000361522	T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.55705	0.1937	M	0.83223	2.63	0.58432	D	0.999999	D;D;D	0.69078	0.997;0.997;0.995	D;D;D	0.68765	0.96;0.96;0.913	T	0.63413	-0.6643	10	0.66056	D	0.02	.	15.9785	0.80089	0.0:0.0:0.0:1.0	.	924;925;941	P35573-2;P35573-3;P35573	.;.;GDE_HUMAN	A	941;941;941;941;925;925;924	ENSP00000355106:S941A;ENSP00000359184:S941A;ENSP00000359182:S941A;ENSP00000294724:S941A;ENSP00000354971:S925A;ENSP00000359180:S925A;ENSP00000354635:S924A	ENSP00000294724:S941A	S	+	1	0	AGL	100129372	1.000000	0.71417	1.000000	0.80357	0.036000	0.12997	5.570000	0.67398	2.183000	0.69458	0.472000	0.43445	TCT	.	.		0.373	AGL-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029778.1	NM_000028	
ADORA3	140	hgsc.bcm.edu	37	1	112031572	112031572	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:112031572C>A	ENST00000369716.4	-	3	665	c.532G>T	c.(532-534)Gcc>Tcc	p.A178S	ADORA3_ENST00000369717.4_Missense_Mutation_p.A97S|RNU6-792P_ENST00000363490.1_RNA	NM_020683.6	NP_065734.5	P33765	AA3R_HUMAN	adenosine A3 receptor	0					activation of adenylate cyclase activity (GO:0007190)|histamine secretion by mast cell (GO:0002553)|inflammatory response (GO:0006954)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of inflammatory response (GO:0050729)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of mucus secretion (GO:0070257)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of heart contraction (GO:0008016)|response to wounding (GO:0009611)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	G-protein coupled adenosine receptor activity (GO:0001609)			NS(1)|breast(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)|skin(1)	12		all_cancers(81;1.63e-06)|all_epithelial(167;5.01e-06)|all_lung(203;8.02e-05)|Lung NSC(277;0.000156)		all cancers(265;0.0185)|Colorectal(144;0.0186)|Lung(183;0.0238)|COAD - Colon adenocarcinoma(174;0.0644)|Epithelial(280;0.0872)|LUSC - Lung squamous cell carcinoma(189;0.134)	Adenosine(DB00640)|Aminophylline(DB01223)|Enprofylline(DB00824)	TTGTAGTGGGCATTGTAGTTG	0.502																																					p.A178S		Atlas-SNP	.											.	ADORA3	104	.	0			c.G532T						.						217.0	199.0	205.0					1																	112031572		2203	4300	6503	SO:0001583	missense	140	exon3			AGTGGGCATTGTA	BC029831	CCDS838.1, CCDS839.1, CCDS41369.1	1p13.2	2014-09-17			ENSG00000121933	ENSG00000121933		"""GPCR / Class A : Adenosine receptors"", ""Immunoglobulin superfamily / V-set domain containing"""	268	protein-coding gene	gene with protein product		600445				7607699	Standard	NM_020683		Approved	AD026	uc001ebf.3	P33765	OTTHUMG00000011957	ENST00000369716.4:c.532G>T	chr1.hg19:g.112031572C>A	ENSP00000358730:p.Ala178Ser	237.0	0.0		280.0	128.0	NM_020683	A2A3P4|Q6UWU0|Q9BYZ1	Missense_Mutation	SNP	ENST00000369716.4	hg19	CCDS838.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.601|2.601	-0.292967|-0.292967	0.05568|0.05568	.|.	.|.	ENSG00000121933|ENSG00000121933	ENST00000369717;ENST00000369716|ENST00000414219	T;T|.	0.03951|.	3.75;3.75|.	4.85|4.85	-0.947|-0.947	0.10382|0.10382	.|.	0.727104|.	0.12401|.	N|.	0.472129|.	T|T	0.07638|0.07638	0.0192|0.0192	N|N	0.20807|0.20807	0.61|0.61	0.09310|0.09310	N|N	0.999999|0.999999	P;B|.	0.36909|.	0.573;0.419|.	B;B|.	0.38378|.	0.272;0.118|.	T|T	0.37663|0.37663	-0.9696|-0.9696	10|5	0.39692|.	T|.	0.17|.	-7.5827|-7.5827	4.946|4.946	0.13989|0.13989	0.0:0.4504:0.151:0.3986|0.0:0.4504:0.151:0.3986	.|.	97;178|.	Q5QNY7;P33765-2|.	.;.|.	S|I	97;178|37	ENSP00000358731:A97S;ENSP00000358730:A178S|.	ENSP00000358730:A178S|.	A|M	-|-	1|3	0|0	ADORA3|ADORA3	111833095|111833095	0.002000|0.002000	0.14202|0.14202	0.000000|0.000000	0.03702|0.03702	0.151000|0.151000	0.21798|0.21798	0.021000|0.021000	0.13489|0.13489	-0.066000|-0.066000	0.12998|0.12998	0.462000|0.462000	0.41574|0.41574	GCC|ATG	.	.		0.502	ADORA3-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157679.1	NM_000677, NM_020683	
PRRX1	5396	hgsc.bcm.edu	37	1	170633465	170633465	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:170633465G>T	ENST00000239461.6	+	1	419	c.106G>T	c.(106-108)Gtc>Ttc	p.V36F	PRRX1_ENST00000367760.3_Missense_Mutation_p.V36F|PRRX1_ENST00000497230.2_Missense_Mutation_p.V36F	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	36					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)			large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					GAACTTCTCCGTCAGTCACCT	0.682																																					p.V36F		Atlas-SNP	.											.	PRRX1	81	.	0			c.G106T						.						44.0	42.0	42.0					1																	170633465		2203	4300	6503	SO:0001583	missense	5396	exon1			TTCTCCGTCAGTC	M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.106G>T	chr1.hg19:g.170633465G>T	ENSP00000239461:p.Val36Phe	259.0	0.0		356.0	209.0	NM_006902	B5BUM7|O60807	Missense_Mutation	SNP	ENST00000239461.6	hg19	CCDS1290.1	.	.	.	.	.	.	.	.	.	.	G	18.23	3.576999	0.65878	.	.	ENSG00000116132	ENST00000367760;ENST00000239461;ENST00000497230	D;D;D	0.92397	-2.93;-3.03;-2.92	4.63	3.72	0.42706	.	0.067852	0.64402	D	0.000013	D	0.90885	0.7136	L	0.32530	0.975	0.80722	D	1	D;D	0.64830	0.989;0.994	D;D	0.77004	0.975;0.989	D	0.92077	0.5669	10	0.87932	D	0	.	11.4981	0.50422	0.0883:0.0:0.9117:0.0	.	36;36	P54821;P54821-2	PRRX1_HUMAN;.	F	36	ENSP00000356734:V36F;ENSP00000239461:V36F;ENSP00000450762:V36F	ENSP00000239461:V36F	V	+	1	0	PRRX1	168900089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.656000	0.91102	1.175000	0.42826	0.555000	0.69702	GTC	.	.		0.682	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085236.3	NM_006902	
CACNA1E	777	hgsc.bcm.edu	37	1	181701871	181701871	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:181701871G>T	ENST00000367573.2	+	20	2649	c.2649G>T	c.(2647-2649)tgG>tgT	p.W883C	CACNA1E_ENST00000367570.1_Missense_Mutation_p.W883C|CACNA1E_ENST00000367567.4_Missense_Mutation_p.W490C|CACNA1E_ENST00000526775.1_Missense_Mutation_p.W864C|CACNA1E_ENST00000360108.3_Missense_Mutation_p.W864C|CACNA1E_ENST00000357570.5_Missense_Mutation_p.W834C|CACNA1E_ENST00000358338.5_Missense_Mutation_p.W815C	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	883					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						AGCCACCATGGCTGGCCAGGC	0.667																																					p.W883C		Atlas-SNP	.											.	CACNA1E	778	.	0			c.G2649T						.						21.0	26.0	25.0					1																	181701871		2018	4170	6188	SO:0001583	missense	777	exon20			ACCATGGCTGGCC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.2649G>T	chr1.hg19:g.181701871G>T	ENSP00000356545:p.Trp883Cys	159.0	0.0		231.0	132.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213460	0.39102	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96011	-3.82;-3.82;-3.82;-3.82;-3.88;-3.83;-3.82	4.13	4.13	0.48395	.	0.908022	0.09802	N	0.753923	D	0.93953	0.8064	N	0.08118	0	0.58432	D	0.999999	D;D;D	0.69078	0.997;0.994;0.997	P;P;P	0.60173	0.823;0.87;0.823	D	0.92193	0.5761	10	0.52906	T	0.07	.	15.4265	0.75055	0.0:0.0:1.0:0.0	.	864;883;883	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	C	883;864;834;815;490;864;883	ENSP00000356542:W883C;ENSP00000434814:W864C;ENSP00000350183:W834C;ENSP00000351101:W815C;ENSP00000356539:W490C;ENSP00000353222:W864C;ENSP00000356545:W883C	ENSP00000350183:W834C	W	+	3	0	CACNA1E	179968494	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	3.352000	0.52239	2.592000	0.87571	0.555000	0.69702	TGG	.	.		0.667	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
F13B	2165	hgsc.bcm.edu	37	1	197032133	197032133	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:197032133T>C	ENST00000367412.1	-	2	162	c.119A>G	c.(118-120)tAt>tGt	p.Y40C		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	40	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TTTAAAAGTATAGTAATATTG	0.338																																					p.Y40C		Atlas-SNP	.											.	F13B	137	.	0			c.A119G						.						108.0	121.0	117.0					1																	197032133		2203	4300	6503	SO:0001583	missense	2165	exon2			AAAGTATAGTAAT	M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.119A>G	chr1.hg19:g.197032133T>C	ENSP00000356382:p.Tyr40Cys	134.0	0.0		227.0	121.0	NM_001994	A8K3E5|Q5VYL5	Missense_Mutation	SNP	ENST00000367412.1	hg19	CCDS1388.1	.	.	.	.	.	.	.	.	.	.	T	16.54	3.152946	0.57259	.	.	ENSG00000143278	ENST00000367412	T	0.28069	1.63	5.58	5.58	0.84498	Complement control module (2);Sushi/SCR/CCP (1);	0.000000	0.30401	N	0.009712	T	0.57344	0.2047	M	0.78223	2.4	0.54753	D	0.999985	D	0.89917	1.0	D	0.91635	0.999	T	0.59456	-0.7451	10	0.46703	T	0.11	.	15.7383	0.77863	0.0:0.0:0.0:1.0	.	40	P05160	F13B_HUMAN	C	40	ENSP00000356382:Y40C	ENSP00000356382:Y40C	Y	-	2	0	F13B	195298756	1.000000	0.71417	0.966000	0.40874	0.450000	0.32258	5.217000	0.65252	2.120000	0.65058	0.533000	0.62120	TAT	.	.		0.338	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088821.2	NM_001994	
NAV1	89796	hgsc.bcm.edu	37	1	201752875	201752875	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:201752875G>A	ENST00000367296.4	+	7	3119	c.2699G>A	c.(2698-2700)aGc>aAc	p.S900N	IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000295624.6_Missense_Mutation_p.S900N|NAV1_ENST00000367295.1_Missense_Mutation_p.S509N|NAV1_ENST00000367300.3_Missense_Mutation_p.S900N|NAV1_ENST00000367302.1_Missense_Mutation_p.S913N|NAV1_ENST00000469130.1_3'UTR|NAV1_ENST00000367297.4_Missense_Mutation_p.S900N	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	900					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						GCCTTCCCCAGCAGTACTCCC	0.612																																					p.S900N		Atlas-SNP	.											.	NAV1	143	.	0			c.G2699A						.						53.0	54.0	54.0					1																	201752875		2203	4300	6503	SO:0001583	missense	89796	exon7			TCCCCAGCAGTAC	AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.2699G>A	chr1.hg19:g.201752875G>A	ENSP00000356265:p.Ser900Asn	57.0	0.0		111.0	34.0	NM_020443	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Missense_Mutation	SNP	ENST00000367296.4	hg19	CCDS1414.2	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390760	0.42410	.	.	ENSG00000134369	ENST00000367302;ENST00000367296;ENST00000295624;ENST00000367297;ENST00000367300;ENST00000391966;ENST00000367295	T;T;T;T;T;T	0.07567	3.18;3.21;3.21;3.21;3.18;3.21	5.28	5.28	0.74379	.	0.157867	0.43416	D	0.000561	T	0.06188	0.0160	N	0.14661	0.345	0.30559	N	0.76467	B;B;B;P;B	0.41848	0.257;0.095;0.046;0.763;0.231	B;B;B;B;B	0.39027	0.098;0.037;0.067;0.288;0.075	T	0.20472	-1.0274	10	0.18710	T	0.47	-28.688	16.7189	0.85405	0.0:0.0:1.0:0.0	.	900;509;900;408;900	Q8NEY1-6;Q8NEY1-5;Q8NEY1;A8MYI2;Q8NEY1-3	.;.;NAV1_HUMAN;.;.	N	913;900;900;900;900;408;509	ENSP00000356271:S913N;ENSP00000356265:S900N;ENSP00000295624:S900N;ENSP00000356266:S900N;ENSP00000356269:S900N;ENSP00000356264:S509N	ENSP00000295624:S900N	S	+	2	0	NAV1	200019498	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.164000	0.58190	2.480000	0.83734	0.460000	0.39030	AGC	.	.		0.612	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000087013.1	NM_020443	
ELF3	1999	hgsc.bcm.edu	37	1	201982370	201982370	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:201982370C>G	ENST00000359651.3	+	6	3941	c.749C>G	c.(748-750)cCc>cGc	p.P250R	RP11-510N19.5_ENST00000504773.1_RNA|ELF3_ENST00000367284.5_Missense_Mutation_p.P250R|RP11-465N4.4_ENST00000419190.1_RNA|ELF3_ENST00000367283.3_Missense_Mutation_p.P250R					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CGAGGCCGGCCCCGAAAGCTG	0.637																																					p.P250R		Atlas-SNP	.											.	ELF3	92	.	0			c.C749G						.						73.0	78.0	76.0					1																	201982370		2203	4300	6503	SO:0001583	missense	1999	exon7			GCCGGCCCCGAAA	AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.749C>G	chr1.hg19:g.201982370C>G	ENSP00000352673:p.Pro250Arg	185.0	0.0		258.0	161.0	NM_001114309		Missense_Mutation	SNP	ENST00000359651.3	hg19	CCDS1419.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.119787	0.77323	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.18174	2.23;2.23;2.23	5.63	4.73	0.59995	AT hook, DNA-binding motif (1);	2.375910	0.01495	N	0.017244	T	0.39682	0.1087	M	0.69823	2.125	0.47994	D	0.999565	D	0.60160	0.987	P	0.55871	0.786	T	0.01323	-1.1385	10	0.72032	D	0.01	.	9.4021	0.38440	0.0:0.7786:0.1437:0.0777	.	250	P78545	ELF3_HUMAN	R	250;250;250;227	ENSP00000352673:P250R;ENSP00000356253:P250R;ENSP00000356252:P250R	ENSP00000311348:P227R	P	+	2	0	ELF3	200248993	0.886000	0.30341	1.000000	0.80357	0.987000	0.75469	1.057000	0.30492	1.396000	0.46663	0.561000	0.74099	CCC	.	.		0.637	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087360.1	NM_004433	
USH2A	7399	hgsc.bcm.edu	37	1	216173882	216173882	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:216173882G>C	ENST00000307340.3	-	33	6734	c.6348C>G	c.(6346-6348)caC>caG	p.H2116Q	USH2A_ENST00000366943.2_Missense_Mutation_p.H2116Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2116	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GTAGAAACTGGTGGGGTGTAA	0.458										HNSCC(13;0.011)																											p.H2116Q		Atlas-SNP	.											.	USH2A	1168	.	0			c.C6348G						.						106.0	100.0	102.0					1																	216173882		2203	4300	6503	SO:0001583	missense	7399	exon33			AAACTGGTGGGGT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6348C>G	chr1.hg19:g.216173882G>C	ENSP00000305941:p.His2116Gln	87.0	0.0		119.0	39.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	G	10.02	1.235871	0.22626	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54071	0.59;0.59	5.79	1.25	0.21368	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.143577	0.31566	N	0.007431	T	0.46776	0.1410	L	0.56396	1.775	0.33080	D	0.536452	B	0.18863	0.031	B	0.15870	0.014	T	0.56335	-0.7996	10	0.54805	T	0.06	.	12.0995	0.53774	0.2729:0.0:0.7271:0.0	.	2116	O75445	USH2A_HUMAN	Q	2116	ENSP00000305941:H2116Q;ENSP00000355910:H2116Q	ENSP00000305941:H2116Q	H	-	3	2	USH2A	214240505	1.000000	0.71417	0.540000	0.28089	0.366000	0.29705	1.139000	0.31504	0.358000	0.24211	0.650000	0.86243	CAC	.	.		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
EXO1	9156	hgsc.bcm.edu	37	1	242048690	242048690	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:242048690A>C	ENST00000366548.3	+	15	2879	c.2286A>C	c.(2284-2286)agA>agC	p.R762S	EXO1_ENST00000348581.5_Missense_Mutation_p.R762S|EXO1_ENST00000518483.1_Missense_Mutation_p.R762S	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	762	Interaction with MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GACCTGCCAGAGCCAGTGGGC	0.473								Editing and processing nucleases																													p.R762S		Atlas-SNP	.											.	EXO1	103	.	0			c.A2286C						.						58.0	63.0	61.0					1																	242048690		2203	4300	6503	SO:0001583	missense	9156	exon13			TGCCAGAGCCAGT	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.2286A>C	chr1.hg19:g.242048690A>C	ENSP00000355506:p.Arg762Ser	87.0	0.0		133.0	62.0	NM_006027	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	hg19	CCDS1620.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.42|16.42	3.117412|3.117412	0.56505|0.56505	.|.	.|.	ENSG00000174371|ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483|ENST00000521202	T;T;T|.	0.70164|.	-0.46;-0.46;-0.46|.	5.87|5.87	2.16|2.16	0.27623|0.27623	.|.	0.225948|.	0.47455|.	D|.	0.000239|.	T|T	0.59891|0.59891	0.2227|0.2227	L|L	0.60455|0.60455	1.87|1.87	0.38282|0.38282	D|D	0.942459|0.942459	P;P;P|.	0.39782|.	0.561;0.688;0.561|.	B;B;B|.	0.34242|.	0.053;0.178;0.116|.	T|T	0.56920|0.56920	-0.7899|-0.7899	10|5	0.72032|.	D|.	0.01|.	-36.6227|-36.6227	9.5309|9.5309	0.39193|0.39193	0.7902:0.0:0.2098:0.0|0.7902:0.0:0.2098:0.0	.|.	761;762;762|.	A8K5H6;Q9UQ84-4;Q9UQ84|.	.;.;EXO1_HUMAN|.	S|R	762|127	ENSP00000355506:R762S;ENSP00000311873:R762S;ENSP00000430251:R762S|.	ENSP00000311873:R762S|.	R|S	+|+	3|1	2|0	EXO1|EXO1	240115313|240115313	1.000000|1.000000	0.71417|0.71417	0.849000|0.849000	0.33467|0.33467	0.985000|0.985000	0.73830|0.73830	1.906000|1.906000	0.39887|0.39887	0.102000|0.102000	0.17638|0.17638	0.460000|0.460000	0.39030|0.39030	AGA|AGC	.	.		0.473	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
OR2T12	127064	hgsc.bcm.edu	37	1	248458206	248458206	+	Silent	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr1:248458206G>A	ENST00000317996.1	-	1	674	c.675C>T	c.(673-675)ctC>ctT	p.L225L		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	225						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			TAGAGCGCATGAGCAGAACAG	0.507																																					p.L225L		Atlas-SNP	.											.	OR2T12	113	.	0			c.C675T						.						139.0	122.0	128.0					1																	248458206		2203	4300	6503	SO:0001819	synonymous_variant	127064	exon1			GCGCATGAGCAGA	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.675C>T	chr1.hg19:g.248458206G>A		322.0	0.0		497.0	188.0	NM_001004692		Silent	SNP	ENST00000317996.1	hg19	CCDS31110.1																																																																																			.	.		0.507	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
DNMT3A	1788	hgsc.bcm.edu	37	2	25467466	25467466	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:25467466C>A	ENST00000264709.3	-	14	1947	c.1610G>T	c.(1609-1611)tGc>tTc	p.C537F	DNMT3A_ENST00000402667.1_Missense_Mutation_p.C314F|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000321117.5_Missense_Mutation_p.C537F|DNMT3A_ENST00000380746.4_Missense_Mutation_p.C348F	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	537	ADD. {ECO:0000255|PROSITE- ProRule:PRU00865}.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCAGATGGTGCAGTAGGACTG	0.602			"""Mis, F, N, S"""		AML																																p.C537F		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.G1610T						.						122.0	104.0	110.0					2																	25467466		2203	4300	6503	SO:0001583	missense	1788	exon14			ATGGTGCAGTAGG		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1610G>T	chr2.hg19:g.25467466C>A	ENSP00000264709:p.Cys537Phe	73.0	0.0		56.0	24.0	NM_175629	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	ENST00000264709.3	hg19	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.892617	0.91889	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	D;D;D;D	0.99376	-5.79;-5.79;-5.79;-5.79	5.65	5.65	0.86999	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	M	0.78916	2.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.97	D	0.99211	1.0876	10	0.87932	D	0	-10.7178	17.2343	0.86994	0.0:1.0:0.0:0.0	.	537;348	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	F	348;537;537;314	ENSP00000370122:C348F;ENSP00000324375:C537F;ENSP00000264709:C537F;ENSP00000384237:C314F	ENSP00000264709:C537F	C	-	2	0	DNMT3A	25320970	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.818000	0.86416	2.655000	0.90218	0.655000	0.94253	TGC	.	.		0.602	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	
DNMT3A	1788	hgsc.bcm.edu	37	2	25467523	25467523	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:25467523T>C	ENST00000264709.3	-	14	1892		c.e14-2		DNMT3A_ENST00000402667.1_Splice_Site|DNMT3A_ENST00000474887.1_5'Flank|DNMT3A_ENST00000321117.5_Splice_Site|DNMT3A_ENST00000380746.4_Splice_Site	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha						C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAAGCAGTTCTAGACAGCAGC	0.612			"""Mis, F, N, S"""		AML																																.		Atlas-SNP	.		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	.	DNMT3A	1807	.	0			c.988-2A>G						.						78.0	71.0	74.0					2																	25467523		2203	4300	6503	SO:0001630	splice_region_variant	1788	exon11			CAGTTCTAGACAG		CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.1555-2A>G	chr2.hg19:g.25467523T>C		62.0	0.0		35.0	21.0	NM_153759	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Splice_Site	SNP	ENST00000264709.3	hg19	CCDS33157.1	.	.	.	.	.	.	.	.	.	.	T	19.73	3.881731	0.72294	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709;ENST00000402667	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5913	0.61961	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNMT3A	25321027	1.000000	0.71417	0.750000	0.31169	0.850000	0.48378	8.015000	0.88690	2.146000	0.66826	0.533000	0.62120	.	.	.		0.612	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000211587.1	NM_022552	Intron
DQX1	165545	hgsc.bcm.edu	37	2	74751076	74751076	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:74751076C>T	ENST00000404568.3	-	4	1009	c.790G>A	c.(790-792)Gtg>Atg	p.V264M	DQX1_ENST00000393951.2_Missense_Mutation_p.V264M|DQX1_ENST00000495597.1_5'UTR	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	264	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						AACACTAGCACATCTCCTGGA	0.493																																					p.V264M		Atlas-SNP	.											.	DQX1	95	.	0			c.G790A						.						29.0	29.0	29.0					2																	74751076		2203	4300	6503	SO:0001583	missense	165545	exon4			CTAGCACATCTCC	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.790G>A	chr2.hg19:g.74751076C>T	ENSP00000384621:p.Val264Met	102.0	0.0		68.0	26.0	NM_133637	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	hg19	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	C	18.91	3.724610	0.68959	.	.	ENSG00000144045	ENST00000393951;ENST00000404568	T;T	0.03717	3.83;3.83	5.53	5.53	0.82687	Helicase, C-terminal (1);	0.077842	0.53938	D	0.000056	T	0.07007	0.0178	L	0.45470	1.425	0.44789	D	0.997791	P	0.47350	0.894	B	0.43950	0.437	T	0.09185	-1.0686	10	0.62326	D	0.03	-20.7461	16.9468	0.86232	0.0:1.0:0.0:0.0	.	264	Q8TE96	DQX1_HUMAN	M	264	ENSP00000377523:V264M;ENSP00000384621:V264M	ENSP00000377523:V264M	V	-	1	0	DQX1	74604584	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.780000	0.55386	2.601000	0.87937	0.609000	0.83330	GTG	.	.		0.493	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
HTRA2	27429	hgsc.bcm.edu	37	2	74757927	74757927	+	Silent	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:74757927A>G	ENST00000258080.3	+	2	1320	c.690A>G	c.(688-690)gcA>gcG	p.A230A	HTRA2_ENST00000467961.1_3'UTR|AUP1_ENST00000377526.3_5'Flank|HTRA2_ENST00000352222.3_Silent_p.A230A	NM_013247.4	NP_037379.1	O43464	HTRA2_HUMAN	HtrA serine peptidase 2	230	Serine protease.				adult walking behavior (GO:0007628)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to interferon-beta (GO:0035458)|cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|ceramide metabolic process (GO:0006672)|execution phase of apoptosis (GO:0097194)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitochondrion organization (GO:0007005)|negative regulation of cell cycle (GO:0045786)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|neuron development (GO:0048666)|pentacyclic triterpenoid metabolic process (GO:0019742)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell death (GO:0010942)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)|regulation of mitochondrion degradation (GO:1903146)|regulation of multicellular organism growth (GO:0040014)|response to herbicide (GO:0009635)	CD40 receptor complex (GO:0035631)|chromatin (GO:0000785)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)|unfolded protein binding (GO:0051082)			endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12						CAGACATCGCAACGCTGAGGA	0.577																																					p.A230A		Atlas-SNP	.											.	HTRA2	22	.	0			c.A690G						.						80.0	86.0	84.0					2																	74757927		2203	4300	6503	SO:0001819	synonymous_variant	27429	exon2			CATCGCAACGCTG		CCDS1951.1, CCDS1952.1	2p13.1	2011-07-21	2005-08-19	2005-08-19	ENSG00000115317	ENSG00000115317		"""Serine peptidases / Serine peptidases"", ""Parkinson disease"""	14348	protein-coding gene	gene with protein product		606441	"""protease, serine, 25"""	PRSS25		10644717, 10971580	Standard	XM_005264266		Approved	OMI, PARK13	uc002smi.1	O43464	OTTHUMG00000129957	ENST00000258080.3:c.690A>G	chr2.hg19:g.74757927A>G		64.0	0.0		49.0	25.0	NM_013247	Q9HBZ4|Q9P0Y3|Q9P0Y4	Silent	SNP	ENST00000258080.3	hg19	CCDS1951.1																																																																																			.	.		0.577	HTRA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252219.2	NM_013247	
ACTR1B	10120	hgsc.bcm.edu	37	2	98275016	98275016	+	Silent	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:98275016A>C	ENST00000289228.5	-	6	747	c.531T>G	c.(529-531)ccT>ccG	p.P177P		NM_005735.3	NP_005726.1	P42025	ACTY_HUMAN	ARP1 actin-related protein 1 homolog B, centractin beta (yeast)	177					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)			endometrium(1)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	15						TGATGGAGTGAGGCATGGCAA	0.607																																					p.P177P		Atlas-SNP	.											ACTR1B,caecum,carcinoma,0,1	ACTR1B	34	.	0			c.T531G						.						172.0	150.0	157.0					2																	98275016		2203	4300	6503	SO:0001819	synonymous_variant	10120	exon6			GGAGTGAGGCATG	X82207	CCDS2033.1	2q11.1-q11.2	2008-05-20	2001-11-28		ENSG00000115073	ENSG00000115073			168	protein-coding gene	gene with protein product		605144	"""ARP1 (actin-related protein 1, yeast) homolog B (centractin beta)"""	CTRN2		7696711, 10343100	Standard	NM_005735		Approved		uc002syb.2	P42025	OTTHUMG00000130549	ENST00000289228.5:c.531T>G	chr2.hg19:g.98275016A>C		96.0	0.0		69.0	33.0	NM_005735	D3DVH2|Q53SK5|Q9BRB7	Silent	SNP	ENST00000289228.5	hg19	CCDS2033.1																																																																																			.	.		0.607	ACTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252973.1	NM_005735	
LRP1B	53353	hgsc.bcm.edu	37	2	141665624	141665624	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:141665624C>A	ENST00000389484.3	-	22	4313	c.3342G>T	c.(3340-3342)tgG>tgT	p.W1114C		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	1114	LDL-receptor class A 9. {ECO:0000255|PROSITE-ProRule:PRU00124}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.W1114*(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		CATCACACACCCATGCTTTGT	0.398										TSP Lung(27;0.18)																											p.W1114C	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,NS,carcinoma,0,1	LRP1B	1315	.	1	Substitution - Nonsense(1)	liver(1)	c.G3342T						.						180.0	143.0	156.0					2																	141665624		2203	4300	6503	SO:0001583	missense	53353	exon22			ACACACCCATGCT	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.3342G>T	chr2.hg19:g.141665624C>A	ENSP00000374135:p.Trp1114Cys	150.0	0.0		183.0	96.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	24.6	4.552808	0.86127	.	.	ENSG00000168702	ENST00000389484;ENST00000544579;ENST00000434794	D;D	0.96300	-3.97;-3.97	5.58	5.58	0.84498	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.98861	0.9615	H	0.96269	3.795	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.971;0.999	D	0.99349	1.0914	10	0.72032	D	0.01	.	19.5654	0.95390	0.0:1.0:0.0:0.0	.	297;1114	Q96NT6;Q9NZR2	.;LRP1B_HUMAN	C	1114;1052;259	ENSP00000374135:W1114C;ENSP00000413239:W259C	ENSP00000374135:W1114C	W	-	3	0	LRP1B	141382094	1.000000	0.71417	0.993000	0.49108	0.980000	0.70556	7.729000	0.84864	2.641000	0.89580	0.585000	0.79938	TGG	.	.		0.398	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
TTN	7273	hgsc.bcm.edu	37	2	179496878	179496878	+	Silent	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:179496878C>T	ENST00000591111.1	-	186	39044	c.38820G>A	c.(38818-38820)gtG>gtA	p.V12940V	TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Silent_p.V14581V|TTN_ENST00000359218.5_Silent_p.V5641V|TTN_ENST00000342175.6_Silent_p.V5708V|TTN_ENST00000460472.2_Silent_p.V5516V|TTN_ENST00000342992.6_Silent_p.V12013V|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12940					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACTTACCAAGCACAGTGAGTT	0.333																																					p.V14581V		Atlas-SNP	.											.	TTN	18412	.	0			c.G43743A						.						63.0	55.0	58.0					2																	179496878		1831	4097	5928	SO:0001819	synonymous_variant	7273	exon236			ACCAAGCACAGTG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38820G>A	chr2.hg19:g.179496878C>T		64.0	0.0		59.0	32.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.333	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ITGA4	3676	hgsc.bcm.edu	37	2	182323028	182323028	+	Silent	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr2:182323028C>T	ENST00000397033.2	+	2	733	c.303C>T	c.(301-303)tgC>tgT	p.C101C	ITGA4_ENST00000478440.1_3'UTR|ITGA4_ENST00000339307.4_Silent_p.C101C	NM_000885.4	NP_000876.3	P13612	ITA4_HUMAN	integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)	101					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|blood vessel remodeling (GO:0001974)|cell-matrix adhesion (GO:0007160)|cell-matrix adhesion involved in ameboidal cell migration (GO:0003366)|chorio-allantoic fusion (GO:0060710)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|face development (GO:0060324)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte tethering or rolling (GO:0050901)|negative regulation of protein homodimerization activity (GO:0090074)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell migration (GO:0072678)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha4-beta7 complex (GO:0034669)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.0593)		Natalizumab(DB00108)|Tinzaparin(DB06822)	GCCAGACGTGCGAACAGCTCC	0.587																																					p.C101C		Atlas-SNP	.											.	ITGA4	142	.	0			c.C303T						.						31.0	36.0	34.0					2																	182323028		2005	4160	6165	SO:0001819	synonymous_variant	3676	exon2			GACGTGCGAACAG		CCDS42788.1	2q31-q32	2010-03-23			ENSG00000115232	ENSG00000115232		"""CD molecules"", ""Integrins"""	6140	protein-coding gene	gene with protein product		192975		CD49D		1537388	Standard	NM_000885		Approved	CD49d	uc002unu.3	P13612	OTTHUMG00000154212	ENST00000397033.2:c.303C>T	chr2.hg19:g.182323028C>T		140.0	0.0		117.0	44.0	NM_000885	D3DPG4|Q7Z4L6	Silent	SNP	ENST00000397033.2	hg19	CCDS42788.1																																																																																			.	.		0.587	ITGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334427.1		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	T	rs121913396|rs121913416		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:41266098A>T	ENST00000349496.5	+	3	375	c.95A>T	c.(94-96)gAc>gTc	p.D32V	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32V|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25V|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32V|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32V	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95T						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>T	chr3.hg19:g.41266098A>T	ENSP00000344456:p.Asp32Val	188.0	0.0		164.0	41.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.184569	0.78677	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70037	0.3178	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.74325	-0.3702	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	V	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25V;ENSP00000385604:D32V;ENSP00000412219:D32V;ENSP00000379486:D32V;ENSP00000344456:D32V;ENSP00000411226:D25V;ENSP00000379488:D32V;ENSP00000409302:D32V;ENSP00000401599:D32V	ENSP00000344456:D32V	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
PTPN23	25930	hgsc.bcm.edu	37	3	47449186	47449186	+	Splice_Site	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:47449186G>T	ENST00000265562.4	+	13	1080		c.e13-1		PTPN23_ENST00000431726.1_Splice_Site	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23						cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CACCCCCCCAGGAGCCCCCTT	0.637																																					.		Atlas-SNP	.											.	PTPN23	85	.	0			c.1004-1G>T						.						57.0	62.0	60.0					3																	47449186		2203	4300	6503	SO:0001630	splice_region_variant	25930	exon13			CCCCCAGGAGCCC	AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1004-1G>T	chr3.hg19:g.47449186G>T		91.0	0.0		91.0	54.0	NM_015466	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Splice_Site	SNP	ENST00000265562.4	hg19	CCDS2754.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.975735	0.74360	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	.	.	.	5.09	5.09	0.68999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4365	0.87554	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTPN23	47424190	1.000000	0.71417	0.999000	0.59377	0.801000	0.45260	7.605000	0.82844	2.633000	0.89246	0.655000	0.94253	.	.	.		0.637	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257492.2	NM_015466	Intron
GMPPB	29925	hgsc.bcm.edu	37	3	49759578	49759578	+	Silent	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:49759578G>A	ENST00000480687.1	-	9	887	c.771C>T	c.(769-771)gaC>gaT	p.D257D	GMPPB_ENST00000308388.6_Silent_p.D257D|AMIGO3_ENST00000535833.1_5'UTR|GMPPB_ENST00000308375.6_Silent_p.D257D|AMIGO3_ENST00000320431.7_5'Flank			Q9Y5P6	GMPPB_HUMAN	GDP-mannose pyrophosphorylase B	257					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|mannose-1-phosphate guanylyltransferase activity (GO:0004475)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GGGCACTTGGGTCCTGAGAGC	0.612																																					p.D257D		Atlas-SNP	.											.	GMPPB	14	.	0			c.C771T						.						57.0	57.0	57.0					3																	49759578		2203	4300	6503	SO:0001819	synonymous_variant	29925	exon8			ACTTGGGTCCTGA	AF135421	CCDS2802.1, CCDS2803.1	3p21.31	2008-02-05			ENSG00000173540	ENSG00000173540	2.7.7.22		22932	protein-coding gene	gene with protein product		615320					Standard	NM_013334		Approved	KIAA1851	uc003cxl.1	Q9Y5P6	OTTHUMG00000158151	ENST00000480687.1:c.771C>T	chr3.hg19:g.49759578G>A		76.0	0.0		69.0	25.0	NM_021971	A8K6N5|Q9H7U3	Silent	SNP	ENST00000480687.1	hg19	CCDS2803.1																																																																																			.	.		0.612	GMPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350291.1	NM_013334	
APPL1	26060	hgsc.bcm.edu	37	3	57271521	57271521	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:57271521A>G	ENST00000288266.3	+	3	302	c.155A>G	c.(154-156)aAt>aGt	p.N52S		NM_012096.2	NP_036228.1	Q9UKG1	DP13A_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1	52	Required for RAB5A binding.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|insulin receptor signaling pathway (GO:0008286)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of glucose import (GO:0046324)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|protein kinase B binding (GO:0043422)			breast(3)|endometrium(3)|kidney(3)|large_intestine(10)|liver(2)|lung(4)|prostate(2)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0124)|Kidney(284;0.0144)		TTTCCATAGAATGAATTAAGT	0.229																																					p.N52S		Atlas-SNP	.											.	APPL1	59	.	0			c.A155G						.						23.0	24.0	23.0					3																	57271521		2188	4261	6449	SO:0001630	splice_region_variant	26060	exon3			CATAGAATGAATT	AB037849	CCDS2882.1	3p21.1-p14.3	2013-01-11			ENSG00000157500	ENSG00000157500		"""Pleckstrin homology (PH) domain containing"""	24035	protein-coding gene	gene with protein product		604299				10490823, 17030088	Standard	NM_012096		Approved	APPL	uc003dio.3	Q9UKG1	OTTHUMG00000133756	ENST00000288266.3:c.154-1A>G	chr3.hg19:g.57271521A>G		548.0	0.0		469.0	149.0	NM_012096	Q9P2B9	Missense_Mutation	SNP	ENST00000288266.3	hg19	CCDS2882.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.470027	0.84533	.	.	ENSG00000157500	ENST00000288266;ENST00000495803;ENST00000444459	T;T;T	0.29917	1.55;3.71;1.55	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.47728	0.1461	L	0.51422	1.61	0.80722	D	1	P;D;P	0.63046	0.636;0.992;0.757	B;P;B	0.62649	0.075;0.905;0.132	T	0.33471	-0.9867	10	0.39692	T	0.17	.	16.0347	0.80617	1.0:0.0:0.0:0.0	.	35;35;52	B4DQX8;C9JAB0;Q9UKG1	.;.;DP13A_HUMAN	S	52;52;35	ENSP00000288266:N52S;ENSP00000419644:N52S;ENSP00000406095:N35S	ENSP00000288266:N52S	N	+	2	0	APPL1	57246561	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.770000	0.91746	2.179000	0.69175	0.528000	0.53228	AAT	.	.		0.229	APPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258196.2	NM_012096	Missense_Mutation
C3orf17	25871	hgsc.bcm.edu	37	3	112732231	112732231	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:112732231T>C	ENST00000314400.5	-	4	552	c.361A>G	c.(361-363)Acc>Gcc	p.T121A	C3orf17_ENST00000383675.2_Intron|C3orf17_ENST00000393857.2_5'UTR|C3orf17_ENST00000472762.1_5'Flank	NM_015412.3	NP_056227.2	Q6NW34	CC017_HUMAN	chromosome 3 open reading frame 17	121					negative regulation of neuron differentiation (GO:0045665)|positive regulation of Notch signaling pathway (GO:0045747)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|lung(6)|prostate(2)|skin(1)	13						CATACTTTGGTAGTTAAGGGC	0.368																																					p.T121A		Atlas-SNP	.											.	C3orf17	37	.	0			c.A361G						.						103.0	106.0	105.0					3																	112732231		2203	4300	6503	SO:0001583	missense	25871	exon4			CTTTGGTAGTTAA	AL117573	CCDS33824.1	3q13.2	2009-11-06			ENSG00000163608	ENSG00000163608			24496	protein-coding gene	gene with protein product						12477932	Standard	NR_027794		Approved	DKFZP434F2021, NET17	uc003dzr.3	Q6NW34	OTTHUMG00000159286	ENST00000314400.5:c.361A>G	chr3.hg19:g.112732231T>C	ENSP00000320251:p.Thr121Ala	544.0	0.0		541.0	335.0	NM_015412	D3DN69|Q68DM6|Q9H7U0|Q9UFM4	Missense_Mutation	SNP	ENST00000314400.5	hg19	CCDS33824.1	.	.	.	.	.	.	.	.	.	.	T	5.833	0.337870	0.11013	.	.	ENSG00000163608	ENST00000314400;ENST00000472166	T;T	0.41400	1.0;1.0	5.9	-4.84	0.03151	.	1.066830	0.07101	N	0.840417	T	0.26991	0.0661	L	0.56769	1.78	0.09310	N	0.999998	B	0.20052	0.041	B	0.14578	0.011	T	0.34153	-0.9840	10	0.09843	T	0.71	2.238	0.6485	0.00823	0.2361:0.2877:0.2426:0.2337	.	121	Q6NW34	CC017_HUMAN	A	121;46	ENSP00000320251:T121A;ENSP00000417613:T46A	ENSP00000320251:T121A	T	-	1	0	C3orf17	114214921	0.000000	0.05858	0.000000	0.03702	0.241000	0.25554	-0.191000	0.09601	-0.697000	0.05092	-0.313000	0.08912	ACC	.	.		0.368	C3orf17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354405.3	NM_015412	
MECOM	2122	hgsc.bcm.edu	37	3	168806927	168806927	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:168806927T>C	ENST00000464456.1	-	14	4055	c.2855A>G	c.(2854-2856)cAt>cGt	p.H952R	MECOM_ENST00000460814.1_Missense_Mutation_p.H952R|MECOM_ENST00000494292.1_Missense_Mutation_p.H1140R|MECOM_ENST00000264674.3_Missense_Mutation_p.H1026R|MECOM_ENST00000472280.1_Missense_Mutation_p.H962R|MECOM_ENST00000392736.3_Missense_Mutation_p.H961R|MECOM_ENST00000468789.1_Missense_Mutation_p.H961R|MECOM_ENST00000433243.2_Missense_Mutation_p.H962R	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						GTGCCTTATATGATCTAGAGC	0.338																																					p.H1149R		Atlas-SNP	.											.	MECOM	216	.	0			c.A3446G						.						99.0	97.0	98.0					3																	168806927		2203	4300	6503	SO:0001583	missense	2122	exon16			CTTATATGATCTA	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.2855A>G	chr3.hg19:g.168806927T>C	ENSP00000419770:p.His952Arg	111.0	0.0		123.0	74.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	T	15.90	2.969814	0.53614	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.05447	3.49;3.48;3.45;3.59;3.44;3.48;3.44;3.59	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000004	T	0.16938	0.0407	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D	0.67145	0.991;0.996;0.985;0.993;0.994	P;D;P;P;P	0.63793	0.852;0.918;0.622;0.857;0.829	T	0.00573	-1.1664	10	0.44086	T	0.13	-13.9098	15.9147	0.79503	0.0:0.0:0.0:1.0	.	1149;953;1140;1026;961	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	R	1026;961;952;962;1140;961;952;962	ENSP00000264674:H1026R;ENSP00000376493:H961R;ENSP00000419770:H952R;ENSP00000420048:H962R;ENSP00000417899:H1140R;ENSP00000419995:H961R;ENSP00000420466:H952R;ENSP00000394302:H962R	ENSP00000264674:H1026R	H	-	2	0	MECOM	170289621	1.000000	0.71417	1.000000	0.80357	0.752000	0.42762	6.977000	0.76141	2.227000	0.72691	0.460000	0.39030	CAT	.	.		0.338	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
NCEH1	57552	hgsc.bcm.edu	37	3	172351796	172351796	+	Silent	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr3:172351796T>C	ENST00000475381.1	-	5	929	c.696A>G	c.(694-696)ccA>ccG	p.P232P	NCEH1_ENST00000273512.3_Silent_p.P264P|NCEH1_ENST00000538775.1_Silent_p.P272P|NCEH1_ENST00000543711.1_Silent_p.P99P			Q6PIU2	NCEH1_HUMAN	neutral cholesterol ester hydrolase 1	232					lipid catabolic process (GO:0016042)|protein dephosphorylation (GO:0006470)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carboxylic ester hydrolase activity (GO:0052689)|phosphate ion binding (GO:0042301)|serine hydrolase activity (GO:0017171)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15						GCTGATAAGATGGTGTGTTAA	0.398																																					p.P272P		Atlas-SNP	.											.	NCEH1	63	.	0			c.A816G						.						106.0	99.0	102.0					3																	172351796		2203	4300	6503	SO:0001819	synonymous_variant	57552	exon5			ATAAGATGGTGTG	AB037784	CCDS54681.1, CCDS54682.1	3q26.31	2009-07-23	2009-07-23	2009-07-23	ENSG00000144959	ENSG00000144959			29260	protein-coding gene	gene with protein product		613234	"""arylacetamide deacetylase-like 1"""	AADACL1		10718198	Standard	NM_001146276		Approved	KIAA1363, NCEH	uc011bpx.2	Q6PIU2	OTTHUMG00000156872	ENST00000475381.1:c.696A>G	chr3.hg19:g.172351796T>C		121.0	0.0		134.0	42.0	NM_001146276	B7Z2K4|B7Z3A1|B7Z5U2|B7Z906|B7ZAW6|F5H7K4|Q86WZ1|Q9P2I4	Silent	SNP	ENST00000475381.1	hg19		.	.	.	.	.	.	.	.	.	.	T	0.539	-0.854617	0.02630	.	.	ENSG00000144959	ENST00000424772	.	.	.	5.67	0.583	0.17417	.	.	.	.	.	T	0.50803	0.1637	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35871	-0.9771	4	.	.	.	-29.6019	5.0145	0.14330	0.2723:0.0:0.495:0.2327	.	.	.	.	R	263	.	.	H	-	2	0	NCEH1	173834490	0.969000	0.33509	0.997000	0.53966	0.031000	0.12232	0.027000	0.13621	0.065000	0.16485	-1.260000	0.01463	CAT	.	.		0.398	NCEH1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000346367.3	NM_020792	
PCDH7	5099	hgsc.bcm.edu	37	4	30724307	30724307	+	Silent	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr4:30724307G>T	ENST00000361762.2	+	1	2271	c.1263G>T	c.(1261-1263)ggG>ggT	p.G421G	PCDH7_ENST00000543491.1_Silent_p.G421G	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	421					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GCAAGATTGGGCGCATCCCCC	0.632																																					p.G421G		Atlas-SNP	.											.	PCDH7	215	.	0			c.G1263T						.						44.0	44.0	44.0					4																	30724307		2203	4300	6503	SO:0001819	synonymous_variant	5099	exon1			GATTGGGCGCATC	AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.1263G>T	chr4.hg19:g.30724307G>T		189.0	0.0		150.0	57.0	NM_032457	O60246|O60247|Q4W5C4	Silent	SNP	ENST00000361762.2	hg19	CCDS33971.1	.	.	.	.	.	.	.	.	.	.	G	5.264	0.234177	0.09969	.	.	ENSG00000169851	ENST00000511884	.	.	.	5.48	-1.44	0.08856	.	.	.	.	.	T	0.54127	0.1839	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49995	-0.8879	4	.	.	.	.	8.7181	0.34423	0.1976:0.479:0.3234:0.0	.	.	.	.	S	111	.	.	A	+	1	0	PCDH7	30333405	0.004000	0.15560	0.998000	0.56505	0.919000	0.55068	-1.060000	0.03475	-0.051000	0.13334	-0.140000	0.14226	GCG	.	.		0.632	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000360366.1	NM_032457, NM_002589	
DKK2	27123	hgsc.bcm.edu	37	4	107845304	107845304	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr4:107845304G>A	ENST00000285311.3	-	4	1292	c.587C>T	c.(586-588)gCt>gTt	p.A196V	DKK2_ENST00000513208.1_Missense_Mutation_p.A96V|DKK2_ENST00000510463.1_Missense_Mutation_p.A150V	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	196	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		GAAATGACGAGCACAGCAAAA	0.488																																					p.A196V		Atlas-SNP	.											.	DKK2	96	.	0			c.C587T						.						125.0	115.0	118.0					4																	107845304		2203	4300	6503	SO:0001583	missense	27123	exon4			TGACGAGCACAGC	AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.587C>T	chr4.hg19:g.107845304G>A	ENSP00000285311:p.Ala196Val	206.0	0.0		127.0	55.0	NM_014421	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	ENST00000285311.3	hg19	CCDS3675.1	.	.	.	.	.	.	.	.	.	.	G	35	5.474217	0.96291	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.64085	-0.08;0.06;0.12	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.81664	0.4870	M	0.82823	2.61	0.80722	D	1	D	0.63880	0.993	D	0.70227	0.968	D	0.83701	0.0182	10	0.87932	D	0	-13.917	19.6876	0.95986	0.0:0.0:1.0:0.0	.	196	Q9UBU2	DKK2_HUMAN	V	196;96;150	ENSP00000285311:A196V;ENSP00000421255:A96V;ENSP00000423797:A150V	ENSP00000285311:A196V	A	-	2	0	DKK2	108064753	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.657000	0.90304	0.585000	0.79938	GCT	.	.		0.488	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253959.4		
QRFPR	84109	hgsc.bcm.edu	37	4	122251638	122251638	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr4:122251638C>A	ENST00000394427.2	-	5	1249	c.838G>T	c.(838-840)Gct>Tct	p.A280S	QRFPR_ENST00000334383.5_Missense_Mutation_p.G242V|Y_RNA_ENST00000384419.1_RNA	NM_198179.2	NP_937822.2	Q96P65	QRFPR_HUMAN	pyroglutamylated RFamide peptide receptor	280					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide Y receptor activity (GO:0004983)			endometrium(1)|kidney(2)|large_intestine(9)|lung(10)|prostate(2)|skin(3)|stomach(1)	28						GCAAAGAGAGCCACCACTGTC	0.413																																					p.A280S		Atlas-SNP	.											.	QRFPR	65	.	0			c.G838T						.						157.0	149.0	152.0					4																	122251638		2203	4300	6503	SO:0001583	missense	84109	exon5			AGAGAGCCACCAC	AF411117	CCDS3719.1	4q27	2012-08-10	2008-12-18	2008-12-18	ENSG00000186867	ENSG00000186867		"""GPCR / Class A : RF amide peptide receptors"""	15565	protein-coding gene	gene with protein product		606925	"""G protein-coupled receptor 103"""	GPR103		11574155	Standard	NM_198179		Approved		uc010inj.1	Q96P65	OTTHUMG00000133036	ENST00000394427.2:c.838G>T	chr4.hg19:g.122251638C>A	ENSP00000377948:p.Ala280Ser	119.0	0.0		64.0	27.0	NM_198179		Missense_Mutation	SNP	ENST00000394427.2	hg19	CCDS3719.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.324117|2.324117	0.41197|0.41197	.|.	.|.	ENSG00000186867|ENSG00000186867	ENST00000394427|ENST00000334383	T|T	0.37584|0.69926	1.19|-0.44	5.66|5.66	3.7|3.7	0.42460|0.42460	GPCR, rhodopsin-like superfamily (1);|.	0.457827|.	0.23955|.	N|.	0.042906|.	T|T	0.56108|0.56108	0.1963|0.1963	L|L	0.28014|0.28014	0.82|0.82	0.36549|0.36549	D|D	0.871734|0.871734	B|.	0.06786|.	0.001|.	B|.	0.11329|.	0.006|.	T|T	0.63292|0.63292	-0.6670|-0.6670	10|7	0.38643|0.72032	T|D	0.18|0.01	.|.	4.7779|4.7779	0.13189|0.13189	0.3172:0.4973:0.1067:0.0789|0.3172:0.4973:0.1067:0.0789	.|.	280|.	Q96P65|.	QRFPR_HUMAN|.	S|V	280|242	ENSP00000377948:A280S|ENSP00000335610:G242V	ENSP00000377948:A280S|ENSP00000335610:G242V	A|G	-|-	1|2	0|0	QRFPR|QRFPR	122471088|122471088	0.987000|0.987000	0.35691|0.35691	1.000000|1.000000	0.80357|0.80357	0.892000|0.892000	0.51952|0.51952	0.800000|0.800000	0.27042|0.27042	1.350000|1.350000	0.45770|0.45770	0.655000|0.655000	0.94253|0.94253	GCT|GGC	.	.		0.413	QRFPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256641.2	NM_198179	
MEGF10	84466	hgsc.bcm.edu	37	5	126774132	126774132	+	Splice_Site	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr5:126774132A>C	ENST00000274473.6	+	18	2373	c.2106A>C	c.(2104-2106)ccA>ccC	p.P702P	MEGF10_ENST00000503335.2_Splice_Site_p.P702P	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	702	Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		TAATTTCAGCATGTCCACCTG	0.512																																					p.P702P		Atlas-SNP	.											.	MEGF10	152	.	0			c.A2106C						.						128.0	116.0	120.0					5																	126774132		2203	4300	6503	SO:0001630	splice_region_variant	84466	exon18			TTCAGCATGTCCA	AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2105-1A>C	chr5.hg19:g.126774132A>C		76.0	0.0		95.0	28.0	NM_032446	Q68DE5|Q8WUL3	Silent	SNP	ENST00000274473.6	hg19	CCDS4142.1																																																																																			.	.		0.512	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250973.2	NM_032446	Silent
PCDHB2	56133	hgsc.bcm.edu	37	5	140476384	140476385	+	Missense_Mutation	DNP	GC	GC	TG			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr5:140476384_140476385GC>TG	ENST00000194155.4	+	1	2158_2159	c.2010_2011GC>TG	c.(2008-2013)caGCcc>caTGcc	p.670_671QP>HA		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	670	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTTCTCCCAGCCCTACCTGCT	0.688																																					p.Q670H|p.P671A		Atlas-SNP	.											.	PCDHB2	163	.	0			c.G2010T|c.C2011G						.																																			SO:0001583	missense	56133	exon1			CTCCCAGCCCTAC|TCCCAGCCCTACC	AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	Exception_encountered	chr5.hg19:g.140476384_140476385delinsTG	ENSP00000194155:p.Q670_P671delinsHA	17.0	0.0		22.0	9.0|10.0	NM_018936	Q4KMU1	Missense_Mutation	SNP	ENST00000194155.4	hg19	CCDS4244.1																																																																																			.	.		0.688	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251801.2	NM_018936	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140798888	140798888	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr5:140798888T>G	ENST00000398594.2	+	1	1462	c.1462T>G	c.(1462-1464)Tcc>Gcc	p.S488A	PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGB2_ENST00000522605.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	488	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGGCCGTGTCTCCTACTCTCT	0.632																																					p.S488A		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.T1462G						.						74.0	85.0	82.0					5																	140798888		2138	4242	6380	SO:0001583	missense	56099	exon1			CGTGTCTCCTACT	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1462T>G	chr5.hg19:g.140798888T>G	ENSP00000381594:p.Ser488Ala	86.0	0.0		111.0	50.0	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	hg19	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	t	10.90	1.480387	0.26598	.	.	ENSG00000254122	ENST00000398594	T	0.52754	0.65	5.19	4.01	0.46588	Cadherin (4);Cadherin-like (1);	0.000000	0.32884	U	0.005523	T	0.53498	0.1800	L	0.60957	1.885	0.19775	N	0.999959	P;D	0.55172	0.933;0.97	P;P	0.55577	0.777;0.779	T	0.47509	-0.9112	10	0.59425	D	0.04	.	6.9361	0.24466	0.1886:0.0:0.1317:0.6797	.	488;488	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	A	488	ENSP00000381594:S488A	ENSP00000381594:S488A	S	+	1	0	PCDHGB7	140779072	0.000000	0.05858	0.740000	0.30986	0.021000	0.10359	0.241000	0.18065	0.791000	0.33826	0.402000	0.26972	TCC	.	.		0.632	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
ZNF184	7738	hgsc.bcm.edu	37	6	27419760	27419760	+	Silent	SNP	T	T	C	rs371959671		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:27419760T>C	ENST00000211936.6	-	6	1862	c.1578A>G	c.(1576-1578)caA>caG	p.Q526Q	ZNF184_ENST00000377419.1_Silent_p.Q526Q	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	526				Q -> G (in Ref. 4; AAC51180). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						AAGCTTTCTCTTGAGTATGAG	0.383																																					p.Q526Q		Atlas-SNP	.											.	ZNF184	89	.	0			c.A1578G						.	T		0,4406		0,0,2203	66.0	68.0	67.0		1578	-2.3	1.0	6		67	2,8596	2.2+/-6.3	0,2,4297	no	coding-synonymous	ZNF184	NM_007149.2		0,2,6500	CC,CT,TT		0.0233,0.0,0.0154		526/752	27419760	2,13002	2203	4299	6502	SO:0001819	synonymous_variant	7738	exon6			TTTCTCTTGAGTA	U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.1578A>G	chr6.hg19:g.27419760T>C		51.0	0.0		107.0	28.0	NM_007149	B2R715|O60792|Q8TBA9	Silent	SNP	ENST00000211936.6	hg19	CCDS4624.1																																																																																			.	.		0.383	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040146.1	NM_007149	
HLA-G	3135	hgsc.bcm.edu	37	6	29797329	29797329	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:29797329G>T	ENST00000360323.6	+	4	778	c.754G>T	c.(754-756)Gtg>Ttg	p.V252L	HLA-G_ENST00000376818.3_Missense_Mutation_p.V160L|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000428701.1_Missense_Mutation_p.V252L|HLA-G_ENST00000376828.2_Missense_Mutation_p.V257L			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	252	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						GACCCAGGACGTGGAGCTCGT	0.617																																					p.V252L		Atlas-SNP	.											.	HLA-G	90	.	0			c.G754T						.						79.0	72.0	75.0					6																	29797329		2203	4300	6503	SO:0001583	missense	3135	exon5			CAGGACGTGGAGC		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.754G>T	chr6.hg19:g.29797329G>T	ENSP00000353472:p.Val252Leu	81.0	0.0		172.0	44.0	NM_002127		Missense_Mutation	SNP	ENST00000360323.6	hg19	CCDS4668.1	.	.	.	.	.	.	.	.	.	.	.	2.104	-0.405355	0.04832	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818	T;T;T;T	0.03580	3.88;3.88;3.88;3.88	1.72	0.423	0.16463	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.519636	0.15656	U	0.251124	T	0.01835	0.0058	M	0.79258	2.445	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.0	T	0.37244	-0.9714	10	0.87932	D	0	.	5.0576	0.14540	0.822:0.0:0.178:0.0	.	257;160;252	Q5RJ85;Q31611;P17693	.;.;HLAG_HUMAN	L	257;252;252;160	ENSP00000366024:V257L;ENSP00000412927:V252L;ENSP00000353472:V252L;ENSP00000366014:V160L	ENSP00000353472:V252L	V	+	1	0	HLA-G	29905308	0.001000	0.12720	0.128000	0.21923	0.006000	0.05464	-0.276000	0.08514	-0.037000	0.13646	-1.054000	0.02325	GTG	.	.		0.617	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
KLC4	89953	hgsc.bcm.edu	37	6	43039049	43039049	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:43039049G>T	ENST00000394056.2	+	10	1687	c.1192G>T	c.(1192-1194)Gct>Tct	p.A398S	KLC4_ENST00000394058.1_Missense_Mutation_p.A398S|KLC4_ENST00000453940.2_Missense_Mutation_p.A321S|KLC4_ENST00000479388.1_Missense_Mutation_p.A398S|KLC4_ENST00000347162.5_Missense_Mutation_p.A398S|KLC4_ENST00000259708.3_Missense_Mutation_p.A416S			Q9NSK0	KLC4_HUMAN	kinesin light chain 4	398						cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			endometrium(2)|large_intestine(7)|lung(5)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(4)	23			all cancers(41;0.00169)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0376)|KIRC - Kidney renal clear cell carcinoma(2;0.0453)			ATATGCTGAGGCTGAGACACT	0.502																																					p.A416S		Atlas-SNP	.											.	KLC4	89	.	0			c.G1246T						.						81.0	78.0	79.0					6																	43039049		2203	4300	6503	SO:0001583	missense	89953	exon9			GCTGAGGCTGAGA	AK055293	CCDS4882.1, CCDS4883.1, CCDS47429.1, CCDS75459.1	6p21.1	2013-01-10	2005-09-13	2005-09-13	ENSG00000137171	ENSG00000137171		"""Tetratricopeptide (TTC) repeat domain containing"""	21624	protein-coding gene	gene with protein product			"""kinesin-like 8"""	KNSL8			Standard	NM_001289034		Approved	bA387M24.3	uc003otw.1	Q9NSK0	OTTHUMG00000014720	ENST00000394056.2:c.1192G>T	chr6.hg19:g.43039049G>T	ENSP00000377620:p.Ala398Ser	107.0	0.0		186.0	123.0	NM_201523	B3KNY4|B3KPI3|B3KSQ3|B4DME9|Q66K28|Q96EG6	Missense_Mutation	SNP	ENST00000394056.2	hg19	CCDS4883.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.782598	0.70222	.	.	ENSG00000137171	ENST00000347162;ENST00000453940;ENST00000259708;ENST00000479388;ENST00000394056;ENST00000394058	D;T;D;D;D;D	0.88201	-2.35;-0.62;-2.35;-2.35;-2.35;-2.35	5.43	5.43	0.79202	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.097761	0.45606	D	0.000357	D	0.93719	0.7993	M	0.93720	3.45	0.80722	D	1	P;P;P	0.42357	0.777;0.687;0.733	P;P;P	0.53006	0.715;0.468;0.517	D	0.94521	0.7727	10	0.87932	D	0	-23.6703	13.6474	0.62290	0.0758:0.0:0.9242:0.0	.	321;416;398	B4DME9;Q9NSK0-3;Q9NSK0	.;.;KLC4_HUMAN	S	398;321;416;398;398;398	ENSP00000340221:A398S;ENSP00000395806:A321S;ENSP00000259708:A416S;ENSP00000418031:A398S;ENSP00000377620:A398S;ENSP00000377622:A398S	ENSP00000259708:A416S	A	+	1	0	KLC4	43147027	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.632000	0.83247	2.810000	0.96702	0.650000	0.86243	GCT	.	.		0.502	KLC4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040579.2	NM_138343	
FILIP1	27145	hgsc.bcm.edu	37	6	76024770	76024770	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:76024770G>A	ENST00000237172.7	-	5	1108	c.778C>T	c.(778-780)Caa>Taa	p.Q260*	FILIP1_ENST00000393004.2_Nonsense_Mutation_p.Q260*|FILIP1_ENST00000370020.1_Nonsense_Mutation_p.Q161*|FILIP1_ENST00000498523.1_5'UTR	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	260										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						AGGCCAAGTTGTTCAATGTGC	0.403																																					p.Q260X		Atlas-SNP	.											.	FILIP1	173	.	0			c.C778T						.						200.0	190.0	194.0					6																	76024770		2203	4300	6503	SO:0001587	stop_gained	27145	exon5			CAAGTTGTTCAAT	AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.778C>T	chr6.hg19:g.76024770G>A	ENSP00000237172:p.Gln260*	80.0	0.0		48.0	42.0	NM_015687	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Nonsense_Mutation	SNP	ENST00000237172.7	hg19	CCDS4984.1	.	.	.	.	.	.	.	.	.	.	G	38	6.680395	0.97759	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	-32.4465	20.3046	0.98621	0.0:0.0:1.0:0.0	.	.	.	.	X	260;260;161	.	ENSP00000237172:Q260X	Q	-	1	0	FILIP1	76081490	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.420000	0.97426	2.878000	0.98634	0.650000	0.86243	CAA	.	.		0.403	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041263.1	XM_029179	
TBC1D32	221322	hgsc.bcm.edu	37	6	121434235	121434235	+	Nonsense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:121434235G>A	ENST00000398212.2	-	28	3191	c.3142C>T	c.(3142-3144)Cag>Tag	p.Q1048*	TBC1D32_ENST00000275159.6_Nonsense_Mutation_p.Q1089*|TBC1D32_ENST00000398197.2_5'UTR	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	1048					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										GAAGTTTGCTGCTGTTTCAGG	0.313																																					p.Q1048X		Atlas-SNP	.											.	C6orf170	146	.	0			c.C3142T						.						156.0	149.0	151.0					6																	121434235		1806	4083	5889	SO:0001587	stop_gained	221322	exon28			TTTGCTGCTGTTT	AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.3142C>T	chr6.hg19:g.121434235G>A	ENSP00000381270:p.Gln1048*	183.0	0.0		89.0	79.0	NM_152730	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Nonsense_Mutation	SNP	ENST00000398212.2	hg19	CCDS43501.1	.	.	.	.	.	.	.	.	.	.	G	39	7.389046	0.98252	.	.	ENSG00000146350	ENST00000275159;ENST00000398212	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	17.5884	0.87989	0.0:0.0:1.0:0.0	.	.	.	.	X	1089;1048	.	ENSP00000275159:Q1089X	Q	-	1	0	C6orf170	121475934	1.000000	0.71417	1.000000	0.80357	0.354000	0.29330	4.575000	0.60908	2.833000	0.97629	0.585000	0.79938	CAG	.	.		0.313	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380937.2	NM_152730	
L3MBTL3	84456	hgsc.bcm.edu	37	6	130374111	130374111	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:130374111A>C	ENST00000529410.1	+	9	1036	c.557A>C	c.(556-558)gAt>gCt	p.D186A	L3MBTL3_ENST00000533560.1_Missense_Mutation_p.D161A|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.D186A|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.D186A|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.D161A|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.D161A			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	186					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		ACCAAGGAGGATGGAGAAGAG	0.458																																					p.D186A		Atlas-SNP	.											.	L3MBTL3	99	.	0			c.A557C						.						82.0	70.0	74.0					6																	130374111		2203	4300	6503	SO:0001583	missense	84456	exon7			AGGAGGATGGAGA	AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.557A>C	chr6.hg19:g.130374111A>C	ENSP00000431962:p.Asp186Ala	81.0	0.0		72.0	61.0	NM_032438	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	ENST00000529410.1	hg19	CCDS34537.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.479597	0.63849	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000528385;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T;T	0.54675	2.47;2.47;2.47;0.56;2.47;2.47;2.47	5.13	5.13	0.70059	.	0.247429	0.40144	N	0.001167	T	0.43678	0.1258	L	0.51422	1.61	0.42742	D	0.993748	D;B	0.55385	0.971;0.009	P;B	0.49752	0.621;0.011	T	0.39375	-0.9617	10	0.37606	T	0.19	.	13.4676	0.61263	1.0:0.0:0.0:0.0	.	161;186	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	A	186;161;186;186;161;161;186	ENSP00000431962:D186A;ENSP00000437185:D161A;ENSP00000354526:D186A;ENSP00000433257:D186A;ENSP00000357121:D161A;ENSP00000436706:D161A;ENSP00000357118:D186A	ENSP00000354526:D186A	D	+	2	0	L3MBTL3	130415804	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	4.249000	0.58766	2.068000	0.61886	0.460000	0.39030	GAT	.	.		0.458	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042195.2	XM_027074	
UST	10090	hgsc.bcm.edu	37	6	149285691	149285691	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:149285691C>A	ENST00000367463.4	+	5	776	c.673C>A	c.(673-675)Cgc>Agc	p.R225S	RP11-162J8.2_ENST00000413845.1_RNA	NM_005715.2	NP_005706.1	Q9Y2C2	UST_HUMAN	uronyl-2-sulfotransferase	225					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|protein sulfation (GO:0006477)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(4)|lung(2)|ovary(2)	12		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.78e-10)|GBM - Glioblastoma multiforme(68;0.138)		GCAGGAGGAGCGCTACCTGGT	0.567																																					p.R225S		Atlas-SNP	.											UST,colon,carcinoma,0,1	UST	42	.	0			c.C673A						.						69.0	62.0	64.0					6																	149285691		2203	4300	6503	SO:0001583	missense	10090	exon5			GAGGAGCGCTACC	AB020316	CCDS5213.1	6q25.1	2008-02-05			ENSG00000111962	ENSG00000111962		"""Sulfotransferases, membrane-bound"""	17223	protein-coding gene	gene with protein product		610752				10187838	Standard	NM_005715		Approved	2OST	uc003qmg.3	Q9Y2C2	OTTHUMG00000016135	ENST00000367463.4:c.673C>A	chr6.hg19:g.149285691C>A	ENSP00000356433:p.Arg225Ser	76.0	0.0		56.0	50.0	NM_005715	B2RCX6	Missense_Mutation	SNP	ENST00000367463.4	hg19	CCDS5213.1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.542122	0.85917	.	.	ENSG00000111962	ENST00000367463	T	0.72051	-0.62	5.91	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.74535	0.3729	M	0.78049	2.395	0.80722	D	1	D	0.60575	0.988	D	0.66351	0.943	T	0.71122	-0.4684	10	0.13470	T	0.59	-19.565	12.3424	0.55101	0.3226:0.6774:0.0:0.0	.	225	Q9Y2C2	UST_HUMAN	S	225	ENSP00000356433:R225S	ENSP00000356433:R225S	R	+	1	0	UST	149327384	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.424000	0.66464	2.793000	0.96121	0.655000	0.94253	CGC	.	.		0.567	UST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043363.1	NM_005715	
NPC1L1	29881	hgsc.bcm.edu	37	7	44573141	44573141	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr7:44573141C>T	ENST00000289547.4	-	8	2353	c.2298G>A	c.(2296-2298)atG>atA	p.M766I	NPC1L1_ENST00000546276.1_Missense_Mutation_p.M766I|NPC1L1_ENST00000423141.1_3'UTR|NPC1L1_ENST00000381160.3_Missense_Mutation_p.M766I	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	766	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	GCACAGCTGGCATGGGGGTCA	0.632																																					p.M766I		Atlas-SNP	.											NPC1L1,bladder,carcinoma,0,1	NPC1L1	141	.	0			c.G2298A						.						58.0	58.0	58.0					7																	44573141		2203	4300	6503	SO:0001583	missense	29881	exon8			AGCTGGCATGGGG		CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.2298G>A	chr7.hg19:g.44573141C>T	ENSP00000289547:p.Met766Ile	188.0	0.0		190.0	112.0	NM_001101648	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	ENST00000289547.4	hg19	CCDS5491.1	.	.	.	.	.	.	.	.	.	.	c	27.1	4.801563	0.90538	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.95518	-3.73;-3.73;-3.73	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.96923	0.8995	M	0.67625	2.065	0.58432	D	0.999997	P;D;D	0.76494	0.678;0.988;0.999	P;D;D	0.71656	0.835;0.934;0.974	D	0.96522	0.9386	10	0.40728	T	0.16	-46.062	15.2998	0.73940	0.0:1.0:0.0:0.0	.	766;766;766	B7ZLE6;Q17RV5;D3DVK9	.;.;.	I	766	ENSP00000289547:M766I;ENSP00000370552:M766I;ENSP00000438033:M766I	ENSP00000289547:M766I	M	-	3	0	NPC1L1	44539666	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.207000	0.77899	2.197000	0.70478	0.511000	0.50034	ATG	.	.		0.632	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251256.1	NM_013389	
GNAT3	346562	hgsc.bcm.edu	37	7	80123960	80123960	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr7:80123960G>A	ENST00000398291.3	-	2	215	c.122C>T	c.(121-123)gCa>gTa	p.A41V	CD36_ENST00000435819.1_Intron	NM_001102386.1	NP_001095856.1	A8MTJ3	GNAT3_HUMAN	guanine nucleotide binding protein, alpha transducing 3	41					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|blood coagulation (GO:0007596)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|detection of visible light (GO:0009584)|platelet activation (GO:0030168)|response to nicotine (GO:0035094)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|synaptic transmission (GO:0007268)	acrosomal vesicle (GO:0001669)|apical plasma membrane (GO:0016324)|axoneme (GO:0005930)|heterotrimeric G-protein complex (GO:0005834)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled photoreceptor activity (GO:0008020)|G-protein coupled receptor binding (GO:0001664)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	9						AGATTCTCCTGCTCCTGCAAC	0.279																																					p.A41V		Atlas-SNP	.											.	GNAT3	65	.	0			c.C122T						.						76.0	69.0	71.0					7																	80123960		1811	4071	5882	SO:0001583	missense	346562	exon2			TCTCCTGCTCCTG		CCDS47625.1	7q21.11	2007-06-13			ENSG00000214415	ENSG00000214415			22800	protein-coding gene	gene with protein product		139395					Standard	NM_001102386		Approved	gustducin, GDCA	uc011kgu.2	A8MTJ3	OTTHUMG00000155401	ENST00000398291.3:c.122C>T	chr7.hg19:g.80123960G>A	ENSP00000381339:p.Ala41Val	296.0	0.0		316.0	103.0	NM_001102386	A4D1B2|A4D1B3|B9EJG5	Missense_Mutation	SNP	ENST00000398291.3	hg19	CCDS47625.1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772410	0.90108	.	.	ENSG00000214415	ENST00000398291	D	0.89415	-2.51	4.87	4.87	0.63330	G protein alpha subunit, helical insertion (1);	0.129764	0.51477	U	0.000100	D	0.95674	0.8593	M	0.93808	3.46	0.80722	D	1	D	0.62365	0.991	D	0.65684	0.937	D	0.96841	0.9618	9	.	.	.	.	17.1202	0.86700	0.0:0.0:1.0:0.0	.	41	A8MTJ3	GNAT3_HUMAN	V	41	ENSP00000381339:A41V	.	A	-	2	0	GNAT3	79961896	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	9.023000	0.93683	2.415000	0.81967	0.585000	0.79938	GCA	.	.		0.279	GNAT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339909.3	XM_294370	
DYNC1I1	1780	hgsc.bcm.edu	37	7	95705439	95705439	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr7:95705439A>G	ENST00000324972.6	+	15	1824	c.1631A>G	c.(1630-1632)cAt>cGt	p.H544R	DYNC1I1_ENST00000447467.2_Missense_Mutation_p.H527R|DYNC1I1_ENST00000457059.1_Missense_Mutation_p.H527R|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.H524R|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.H507R|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.H507R	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	544					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TCCCCCGTGCATCCTGCGCTT	0.582											OREG0018174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.H544R		Atlas-SNP	.											.	DYNC1I1	111	.	0			c.A1631G						.						135.0	115.0	122.0					7																	95705439		2203	4300	6503	SO:0001583	missense	1780	exon15			CCGTGCATCCTGC	AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.1631A>G	chr7.hg19:g.95705439A>G	ENSP00000320130:p.His544Arg	101.0	0.0	1315	89.0	66.0	NM_004411	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	ENST00000324972.6	hg19	CCDS5644.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.296044	0.81025	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.06294	3.32;3.32;3.32;3.32;3.32;3.32	4.38	4.38	0.52667	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	M	0.70595	2.14	0.80722	D	1	D;D;D;D;P	0.69078	0.995;0.997;0.997;0.978;0.928	P;D;D;P;P	0.66602	0.882;0.945;0.945;0.742;0.614	T	0.04650	-1.0936	10	0.20519	T	0.43	-2.995	13.7249	0.62752	1.0:0.0:0.0:0.0	.	527;524;527;544;507	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	R	527;544;507;524;507;527	ENSP00000392337:H527R;ENSP00000320130:H544R;ENSP00000438377:H507R;ENSP00000398118:H524R;ENSP00000352348:H507R;ENSP00000412444:H527R	ENSP00000320130:H544R	H	+	2	0	DYNC1I1	95543375	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.005000	0.93587	1.984000	0.57885	0.260000	0.18958	CAT	.	.		0.582	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333432.1	NM_004411	
RAD54B	25788	hgsc.bcm.edu	37	8	95399347	95399347	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr8:95399347T>C	ENST00000336148.5	-	11	1974	c.1850A>G	c.(1849-1851)aAg>aGg	p.K617R		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	617					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GTATAGACTCTTTTCTTCATT	0.378								Direct reversal of damage;Homologous recombination																													p.K617R		Atlas-SNP	.											.	RAD54B	88	.	0			c.A1850G						.						129.0	119.0	123.0					8																	95399347		2203	4300	6503	SO:0001583	missense	25788	exon11			AGACTCTTTTCTT	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.1850A>G	chr8.hg19:g.95399347T>C	ENSP00000336606:p.Lys617Arg	55.0	0.0		92.0	54.0	NM_012415	F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	hg19	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	T	5.615	0.298218	0.10622	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.88975	-2.45	5.39	-2.57	0.06248	.	1.152260	0.05915	N	0.632357	T	0.66297	0.2775	N	0.01705	-0.755	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.58098	-0.7696	10	0.14656	T	0.56	-0.0335	1.8742	0.03215	0.1189:0.2476:0.1903:0.4431	.	617	Q9Y620	RA54B_HUMAN	R	617;289	ENSP00000336606:K617R	ENSP00000336606:K617R	K	-	2	0	RAD54B	95468523	0.000000	0.05858	0.056000	0.19401	0.883000	0.51084	-0.206000	0.09398	0.009000	0.14813	-0.472000	0.04984	AAG	.	.		0.378	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
LRP12	29967	hgsc.bcm.edu	37	8	105511591	105511591	+	Silent	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr8:105511591C>A	ENST00000276654.5	-	4	537	c.429G>T	c.(427-429)tcG>tcT	p.S143S	LRP12_ENST00000424843.2_Silent_p.S124S	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	143	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TGTTGTCATCCGAATGAAACC	0.353																																					p.S143S		Atlas-SNP	.											LRP12,NS,carcinoma,0,1	LRP12	124	.	0			c.G429T						.						151.0	150.0	150.0					8																	105511591		2203	4300	6503	SO:0001819	synonymous_variant	29967	exon4			GTCATCCGAATGA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.429G>T	chr8.hg19:g.105511591C>A		96.0	0.0		147.0	41.0	NM_013437	A8K137|B4DRQ2	Silent	SNP	ENST00000276654.5	hg19	CCDS6303.1																																																																																			.	.		0.353	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
EIF3H	8667	hgsc.bcm.edu	37	8	117658834	117658834	+	Silent	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr8:117658834C>T	ENST00000276682.4	-	9	1645	c.879G>A	c.(877-879)caG>caA	p.Q293Q	EIF3H_ENST00000521861.1_Silent_p.Q279Q					eukaryotic translation initiation factor 3, subunit H											large_intestine(2)|lung(10)|skin(1)	13	all_cancers(13;3.98e-22)|Lung NSC(37;0.000183)|Ovarian(258;0.0172)					GCTGGCGACGCTGCTGATACT	0.522																																					p.Q279Q		Atlas-SNP	.											.	EIF3H	28	.	0			c.G837A						.						118.0	126.0	124.0					8																	117658834		2203	4300	6503	SO:0001819	synonymous_variant	8667	exon7			GCGACGCTGCTGA	U54559	CCDS6319.1	8q24.11	2007-07-27	2007-07-27	2007-07-27	ENSG00000147677	ENSG00000147677			3273	protein-coding gene	gene with protein product		603912	"""eukaryotic translation initiation factor 3, subunit 3 gamma, 40kDa"""	EIF3S3		9341143	Standard	NM_003756		Approved	eIF3-gamma, eIF3-p40, eIF3h	uc003yoa.3	O15372	OTTHUMG00000164919	ENST00000276682.4:c.879G>A	chr8.hg19:g.117658834C>T		60.0	0.0		50.0	20.0	NM_003756		Silent	SNP	ENST00000276682.4	hg19																																																																																				.	.		0.522	EIF3H-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000380913.1	NM_003756	
EXOSC3	51010	hgsc.bcm.edu	37	9	37783971	37783971	+	Silent	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr9:37783971T>C	ENST00000327304.5	-	2	426	c.414A>G	c.(412-414)ccA>ccG	p.P138P	EXOSC3_ENST00000396521.3_Silent_p.P138P|RP11-613M10.9_ENST00000540557.1_3'UTR|EXOSC3_ENST00000490516.1_5'UTR	NM_016042.3	NP_057126.2	Q9NQT5	EXOS3_HUMAN	exosome component 3	138					CUT catabolic process (GO:0071034)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|isotype switching (GO:0045190)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of isotype switching (GO:0045830)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytoplasmic exosome (RNase complex) (GO:0000177)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(1)	4				GBM - Glioblastoma multiforme(29;0.00771)|Lung(182;0.221)		ACAAAGAAGCTGGCTCACTCC	0.393																																					p.P138P		Atlas-SNP	.											.	EXOSC3	8	.	0			c.A414G						.						145.0	136.0	139.0					9																	37783971		2203	4300	6503	SO:0001819	synonymous_variant	51010	exon2			AGAAGCTGGCTCA	BC002437	CCDS35016.1, CCDS43805.1	9p11	2009-01-20			ENSG00000107371	ENSG00000107371			17944	protein-coding gene	gene with protein product	"""exosome component Rrp40"", ""CGI-102 protein"""	606489				10810093, 11110791	Standard	NM_016042		Approved	hRrp40p, Rrp40p, RRP40, CGI-102, p10, hRrp-40	uc004aal.3	Q9NQT5	OTTHUMG00000019932	ENST00000327304.5:c.414A>G	chr9.hg19:g.37783971T>C		82.0	0.0		41.0	17.0	NM_016042	A8K0K6|Q5QP85|Q9Y3A8	Silent	SNP	ENST00000327304.5	hg19	CCDS35016.1																																																																																			.	.		0.393	EXOSC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052478.3	NM_016042	
NR4A3	8013	hgsc.bcm.edu	37	9	102595735	102595735	+	Splice_Site	SNP	G	G	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr9:102595735G>C	ENST00000395097.2	+	5	1982	c.1253G>C	c.(1252-1254)aGa>aCa	p.R418T	NR4A3_ENST00000338488.4_Missense_Mutation_p.R418T|NR4A3_ENST00000330847.1_Splice_Site_p.R429T	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3	418					gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				GATTATTCCAGAGTAAGTTTT	0.413			T	EWSR1	extraskeletal myxoid chondrosarcoma																																p.R429T		Atlas-SNP	.		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	.	NR4A3	80	.	0			c.G1286C						.						135.0	133.0	134.0					9																	102595735		2203	4300	6503	SO:0001630	splice_region_variant	8013	exon6			ATTCCAGAGTAAG	U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1254+1G>C	chr9.hg19:g.102595735G>C		123.0	0.0		108.0	48.0	NM_173200	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Missense_Mutation	SNP	ENST00000395097.2	hg19	CCDS6743.1	.	.	.	.	.	.	.	.	.	.	G	15.64	2.893608	0.52121	.	.	ENSG00000119508	ENST00000395097;ENST00000338488;ENST00000395096;ENST00000330847	T;D;T	0.88741	0.76;-2.42;0.76	5.71	5.71	0.89125	Nuclear hormone receptor, ligand-binding (2);	0.499688	0.18576	N	0.137192	D	0.86997	0.6068	N	0.08118	0	0.47621	D	0.999478	D;B;D	0.55800	0.973;0.135;0.964	P;B;P	0.55222	0.481;0.01;0.771	D	0.88169	0.2863	10	0.46703	T	0.11	.	20.2245	0.98337	0.0:0.0:1.0:0.0	.	429;418;418	Q92570-3;Q92570;Q92570-2	.;NR4A3_HUMAN;.	T	418;418;242;429	ENSP00000378531:R418T;ENSP00000340301:R418T;ENSP00000333122:R429T	ENSP00000333122:R429T	R	+	2	0	NR4A3	101635556	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.954000	0.76001	2.861000	0.98227	0.650000	0.86243	AGA	.	.		0.413	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055482.1		Missense_Mutation
RGS3	5998	hgsc.bcm.edu	37	9	116268749	116268749	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr9:116268749G>A	ENST00000374140.2	+	13	1270	c.1061G>A	c.(1060-1062)tGt>tAt	p.C354Y	RGS3_ENST00000374136.1_5'UTR|RGS3_ENST00000317613.6_Missense_Mutation_p.C242Y|RGS3_ENST00000350696.5_Missense_Mutation_p.C354Y|RGS3_ENST00000343817.5_Missense_Mutation_p.C73Y|RGS3_ENST00000394646.3_Missense_Mutation_p.C73Y	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	354	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CACTGGAAATGTGTGGAGCTG	0.662																																					p.C354Y		Atlas-SNP	.											.	RGS3	251	.	0			c.G1061A						.						35.0	30.0	32.0					9																	116268749		2202	4297	6499	SO:0001583	missense	5998	exon13			GGAAATGTGTGGA	AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.1061G>A	chr9.hg19:g.116268749G>A	ENSP00000363255:p.Cys354Tyr	307.0	0.0		176.0	64.0	NM_144488	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	ENST00000374140.2	hg19	CCDS43869.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.870930	0.91587	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613;ENST00000343817;ENST00000394646	T;T;T;T;T	0.26518	1.73;1.73;1.73;1.73;1.73	5.27	5.27	0.74061	PDZ/DHR/GLGF (4);	0.092297	0.85682	D	0.000000	T	0.35248	0.0925	N	0.12961	0.28	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;1.0;0.989;0.999	D;D;D;P;D	0.87578	0.996;0.998;0.998;0.894;0.994	T	0.30995	-0.9959	10	0.87932	D	0	.	16.2171	0.82237	0.0:0.0:1.0:0.0	.	73;73;244;242;354	B3KUB2;P49796-4;B3KWG8;P49796-5;P49796	.;.;.;.;RGS3_HUMAN	Y	354;354;242;73;73	ENSP00000363255:C354Y;ENSP00000259406:C354Y;ENSP00000312844:C242Y;ENSP00000340284:C73Y;ENSP00000378141:C73Y	ENSP00000312844:C242Y	C	+	2	0	RGS3	115308570	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.774000	0.91767	2.735000	0.93741	0.655000	0.94253	TGT	.	.		0.662	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055561.3	NM_017790	
NPFFR1	64106	hgsc.bcm.edu	37	10	72015502	72015502	+	Silent	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:72015502C>A	ENST00000277942.6	-	4	503	c.504G>T	c.(502-504)ctG>ctT	p.L168L		NM_022146.4	NP_071429.1	Q9GZQ6	NPFF1_HUMAN	neuropeptide FF receptor 1	168					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			endometrium(2)|lung(1)	3						TGAGCAGCGCCAGGGCCCAGA	0.662																																					p.L168L		Atlas-SNP	.											.	NPFFR1	21	.	0			c.G504T						.						23.0	29.0	27.0					10																	72015502		2202	4296	6498	SO:0001819	synonymous_variant	64106	exon4			CAGCGCCAGGGCC	AB040104	CCDS53539.1	10q21-q22	2012-08-10	2006-02-15	2006-02-15	ENSG00000148734	ENSG00000148734		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	17425	protein-coding gene	gene with protein product	"""neuropeptide FF 1"""	607448	"""G protein-coupled receptor 147"""	GPR147		11024015	Standard	NM_022146		Approved	OT7T022, NPFF1R1	uc021psj.1	Q9GZQ6	OTTHUMG00000018404	ENST00000277942.6:c.504G>T	chr10.hg19:g.72015502C>A		105.0	0.0		97.0	32.0	NM_022146	A2RRF0|Q8NGR0|Q96RN3	Silent	SNP	ENST00000277942.6	hg19	CCDS53539.1																																																																																			.	.		0.662	NPFFR1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048504.2	NM_022146	
PRF1	5551	hgsc.bcm.edu	37	10	72360312	72360312	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:72360312G>T	ENST00000441259.1	-	2	507	c.347C>A	c.(346-348)gCt>gAt	p.A116D	PRF1_ENST00000373209.2_Missense_Mutation_p.A116D	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	116	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CCGGGCCACAGCTTCAGTGGA	0.662			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.A116D		Atlas-SNP	.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	64	.	0			c.C347A						.						40.0	38.0	39.0					10																	72360312		2203	4300	6503	SO:0001583	missense	5551	exon2	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GCCACAGCTTCAG	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.347C>A	chr10.hg19:g.72360312G>T	ENSP00000398568:p.Ala116Asp	88.0	0.0		65.0	20.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	hg19	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	G	10.33	1.321184	0.23994	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.91295	-2.82;-2.82	5.65	-11.3	0.00108	Membrane attack complex component/perforin (MACPF) domain (1);	1.476590	0.04138	N	0.319109	T	0.76421	0.3985	N	0.16743	0.435	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.64575	-0.6375	10	0.05351	T	0.99	2.0238	11.0522	0.47896	0.0:0.2942:0.1926:0.5132	.	116	P14222	PERF_HUMAN	D	116	ENSP00000362305:A116D;ENSP00000398568:A116D	ENSP00000316746:A116D	A	-	2	0	PRF1	72030318	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.354000	0.07681	-2.204000	0.00743	-0.181000	0.13052	GCT	.	.		0.662	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
KCNIP2	30819	hgsc.bcm.edu	37	10	103589645	103589645	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:103589645G>T	ENST00000356640.2	-	3	454	c.179C>A	c.(178-180)gCc>gAc	p.A60D	KCNIP2_ENST00000461105.1_Missense_Mutation_p.A75D|KCNIP2_ENST00000353068.3_Intron|KCNIP2_ENST00000348850.5_Intron|KCNIP2-AS1_ENST00000412353.1_RNA|KCNIP2_ENST00000343195.4_Intron|KCNIP2_ENST00000370046.1_Intron|KCNIP2_ENST00000355657.2_5'UTR|KCNIP2_ENST00000358038.3_Intron	NM_014591.4|NM_173191.2	NP_055406.2|NP_775283.1	Q9NS61	KCIP2_HUMAN	Kv channel interacting protein 2	60					clustering of voltage-gated potassium channels (GO:0045163)|detection of calcium ion (GO:0005513)|membrane repolarization (GO:0086009)|muscle contraction (GO:0006936)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of cation channel activity (GO:2001257)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|calcium ion binding (GO:0005509)|ER retention sequence binding (GO:0046923)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein N-terminus binding (GO:0047485)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11		Colorectal(252;0.122)		Epithelial(162;4.93e-09)|all cancers(201;2.63e-07)		GGAGGCTGGGGCGGCTAATGC	0.662																																					p.A75D		Atlas-SNP	.											.	KCNIP2	45	.	0			c.C224A						.						61.0	55.0	57.0					10																	103589645		2140	4228	6368	SO:0001583	missense	30819	exon3			GCTGGGGCGGCTA		CCDS7521.1, CCDS7522.1, CCDS7523.1, CCDS7524.1, CCDS7525.1, CCDS7526.1, CCDS41562.1	10q24.32	2013-09-20	2001-11-29		ENSG00000120049	ENSG00000120049		"""EF-hand domain containing"""	15522	protein-coding gene	gene with protein product		604661	"""Kv channel-interacting protein 2"""			10676964	Standard	NM_173192		Approved	KCHIP2	uc001kuc.3	Q9NS61	OTTHUMG00000018937	ENST00000356640.2:c.179C>A	chr10.hg19:g.103589645G>T	ENSP00000349055:p.Ala60Asp	39.0	0.0		28.0	13.0	NM_014591	A6NJE5|A8MQ75|Q3YAC6|Q3YAC8|Q3YAC9|Q7Z6F1|Q96K86|Q96T41|Q96T42|Q96T43|Q96T44|Q9H0N4|Q9HD10|Q9HD11|Q9NS60|Q9NY10|Q9NZI1	Missense_Mutation	SNP	ENST00000356640.2	hg19	CCDS7522.1	.	.	.	.	.	.	.	.	.	.	g	13.67	2.305205	0.40795	.	.	ENSG00000120049	ENST00000356640;ENST00000461105	T;T	0.69435	-0.27;-0.4	3.87	0.787	0.18596	.	0.936579	0.08816	N	0.889542	T	0.45935	0.1367	N	0.14661	0.345	0.50171	D	0.999853	B;B	0.14805	0.011;0.0	B;B	0.17433	0.018;0.0	T	0.36529	-0.9744	10	0.87932	D	0	.	3.4681	0.07557	0.3142:0.0:0.5055:0.1803	.	75;60	Q9NS61-6;Q9NS61	.;KCIP2_HUMAN	D	60;75	ENSP00000349055:A60D;ENSP00000420040:A75D	ENSP00000349055:A60D	A	-	2	0	KCNIP2	103579635	1.000000	0.71417	0.893000	0.35052	0.993000	0.82548	0.938000	0.28965	0.032000	0.15435	0.457000	0.33378	GCC	.	.		0.662	KCNIP2-009	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049973.1		
PCGF6	84108	hgsc.bcm.edu	37	10	105104793	105104793	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:105104793A>G	ENST00000369847.3	-	6	837	c.770T>C	c.(769-771)cTg>cCg	p.L257P	PCGF6_ENST00000490296.1_5'UTR|PCGF6_ENST00000337211.4_Intron	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	257				L -> P (in Ref. 2; BAF83368). {ECO:0000305}.	negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		AATGAACTCCAGTAATAAAGA	0.348																																					p.L257P		Atlas-SNP	.											.	PCGF6	23	.	0			c.T770C						.						104.0	102.0	103.0					10																	105104793		2203	4300	6503	SO:0001583	missense	84108	exon6			AACTCCAGTAATA	AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.770T>C	chr10.hg19:g.105104793A>G	ENSP00000358862:p.Leu257Pro	171.0	0.0		142.0	44.0	NM_001011663	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	ENST00000369847.3	hg19	CCDS31275.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977370	0.74360	.	.	ENSG00000156374	ENST00000369847	T	0.38240	1.15	5.67	5.67	0.87782	.	0.140599	0.48767	D	0.000166	T	0.66346	0.2780	M	0.88105	2.93	0.80722	D	1	D	0.71674	0.998	D	0.81914	0.995	T	0.72874	-0.4160	10	0.59425	D	0.04	.	15.5854	0.76479	1.0:0.0:0.0:0.0	.	257	Q9BYE7	PCGF6_HUMAN	P	257	ENSP00000358862:L257P	ENSP00000358862:L257P	L	-	2	0	PCGF6	105094783	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.409000	0.80053	2.163000	0.67991	0.459000	0.35465	CTG	.	.		0.348	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050132.1	NM_032154	
DMBT1	1755	hgsc.bcm.edu	37	10	124335940	124335940	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:124335940G>T	ENST00000338354.3	+	7	415	c.309G>T	c.(307-309)agG>agT	p.R103S	DMBT1_ENST00000368909.3_Missense_Mutation_p.R103S|DMBT1_ENST00000368956.2_Missense_Mutation_p.R103S|DMBT1_ENST00000330163.4_Missense_Mutation_p.R103S|DMBT1_ENST00000368955.3_Missense_Mutation_p.R103S|DMBT1_ENST00000344338.3_Missense_Mutation_p.R103S|DMBT1_ENST00000359586.6_Missense_Mutation_p.R103S			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	103	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TGGCCCTGAGGCTGGTGAATG	0.562																																					p.R103S	Ovarian(182;93 2026 18125 22222 38972)	Atlas-SNP	.											.	DMBT1	677	.	0			c.G309T						.						131.0	134.0	133.0					10																	124335940		2020	4213	6233	SO:0001583	missense	1755	exon7			CCTGAGGCTGGTG		CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.309G>T	chr10.hg19:g.124335940G>T	ENSP00000342210:p.Arg103Ser	30.0	0.0		37.0	13.0	NM_007329	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	ENST00000338354.3	hg19		.	.	.	.	.	.	.	.	.	.	g	10.35	1.326100	0.24080	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	4.54	-2.95	0.05564	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	.	.	.	.	T	0.75517	0.3860	H	0.99347	4.525	0.09310	N	0.999998	D;P;P;D;D	0.76494	0.995;0.879;0.827;0.999;0.999	D;P;B;D;D	0.85130	0.964;0.605;0.177;0.997;0.937	T	0.63060	-0.6721	9	0.87932	D	0	.	3.526	0.07760	0.5256:0.1148:0.2547:0.1049	.	103;103;103;103;103	F8WEF7;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	S	103	ENSP00000342210:R103S;ENSP00000343175:R103S;ENSP00000327747:R103S;ENSP00000357905:R103S;ENSP00000357951:R103S;ENSP00000357952:R103S;ENSP00000352593:R103S	ENSP00000331522:R103S	R	+	3	2	DMBT1	124325930	0.308000	0.24509	0.094000	0.20943	0.011000	0.07611	-0.372000	0.07504	-0.726000	0.04895	-1.094000	0.02160	AGG	.	.		0.562	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050792.2	NM_004406	
CTBP2	1488	hgsc.bcm.edu	37	10	126714944	126714944	+	Intron	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr10:126714944G>A	ENST00000337195.5	-	3	458				CTBP2_ENST00000411419.2_Intron|CTBP2_ENST00000531469.1_Intron|CTBP2_ENST00000494626.2_Intron|CTBP2_ENST00000309035.6_Missense_Mutation_p.A462V	NM_001329.2	NP_001320.1	P56545	CTBP2_HUMAN	C-terminal binding protein 2						negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)|viral genome replication (GO:0019079)|white fat cell differentiation (GO:0050872)	cell junction (GO:0030054)|nucleus (GO:0005634)|synapse (GO:0045202)|transcriptional repressor complex (GO:0017053)	NAD binding (GO:0051287)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25		all_lung(145;0.0132)|Lung NSC(174;0.0193)|all_neural(114;0.116)|Colorectal(57;0.173)		Colorectal(40;0.00572)|COAD - Colon adenocarcinoma(40;0.0127)|GBM - Glioblastoma multiforme(135;0.147)		GTTAGTCAAGGCCACCCCTGC	0.662																																					p.A462V		Atlas-SNP	.											.	CTBP2	100	.	0			c.C1385T						.						37.0	43.0	41.0					10																	126714944		2202	4300	6502	SO:0001627	intron_variant	1488	exon1			GTCAAGGCCACCC	AF016507	CCDS7643.1, CCDS7644.1	10q26.13	2008-08-01			ENSG00000175029	ENSG00000175029			2495	protein-coding gene	gene with protein product		602619				9479502, 11864595	Standard	NM_022802		Approved	ribeye	uc001lie.4	P56545	OTTHUMG00000019224	ENST00000337195.5:c.58+12621C>T	chr10.hg19:g.126714944G>A		67.0	0.0		58.0	36.0	NM_022802	A8K2X5|D3DRF5|O43449|Q5SQP7|Q69YI3|Q86SV0|Q9H2T8	Missense_Mutation	SNP	ENST00000337195.5	hg19	CCDS7643.1	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662585	0.67700	.	.	ENSG00000175029	ENST00000309035	D	0.84442	-1.85	4.31	4.31	0.51392	.	0.741433	0.11399	N	0.568022	D	0.82476	0.5045	.	.	.	0.80722	D	1	B	0.31548	0.328	B	0.31101	0.124	T	0.81415	-0.0943	9	0.72032	D	0.01	.	15.5276	0.75923	0.0:0.0:1.0:0.0	.	462	P56545-2	.	V	462	ENSP00000311825:A462V	ENSP00000311825:A462V	A	-	2	0	CTBP2	126704934	1.000000	0.71417	0.997000	0.53966	0.790000	0.44656	8.470000	0.90399	2.396000	0.81511	0.467000	0.42956	GCC	.	.		0.662	CTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050900.3	NM_001083914	
GUCY1A2	2977	hgsc.bcm.edu	37	11	106810594	106810594	+	Silent	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr11:106810594C>A	ENST00000526355.2	-	4	1266	c.798G>T	c.(796-798)gtG>gtT	p.V266V	GUCY1A2_ENST00000282249.2_Silent_p.V266V|GUCY1A2_ENST00000347596.2_Silent_p.V266V	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	266					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	GTTCCACTTCCACATCCAGCC	0.438																																					p.V266V		Atlas-SNP	.											.	GUCY1A2	180	.	0			c.G798T						.						100.0	96.0	97.0					11																	106810594		2201	4298	6499	SO:0001819	synonymous_variant	2977	exon4			CACTTCCACATCC	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.798G>T	chr11.hg19:g.106810594C>A		88.0	0.0		71.0	50.0	NM_000855	A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	hg19	CCDS8335.1																																																																																			.	.		0.438	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
ZNF202	7753	hgsc.bcm.edu	37	11	123600474	123600474	+	Silent	SNP	C	C	A	rs143645376	byFrequency	TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr11:123600474C>A	ENST00000529691.1	-	3	681	c.462G>T	c.(460-462)gtG>gtT	p.V154V	ZNF202_ENST00000530393.1_Silent_p.V154V|ZNF202_ENST00000336139.4_Silent_p.V154V			O95125	ZN202_HUMAN	zinc finger protein 202	154			V -> A (in dbSNP:rs1144507). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9790754, ECO:0000269|Ref.2, ECO:0000269|Ref.3, ECO:0000269|Ref.4}.		lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		ACTCAGGCTCCACTCCTAAAT	0.567																																					p.V154V		Atlas-SNP	.											.	ZNF202	72	.	0			c.G462T						.						81.0	74.0	76.0					11																	123600474		2202	4299	6501	SO:0001819	synonymous_variant	7753	exon5			AGGCTCCACTCCT	AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.462G>T	chr11.hg19:g.123600474C>A		72.0	0.0		51.0	11.0	NM_003455	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Silent	SNP	ENST00000529691.1	hg19	CCDS8443.1																																																																																			.	C|0.998;T|0.002		0.567	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387419.1	NM_003455	
GALNT8	26290	hgsc.bcm.edu	37	12	4848403	4848403	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr12:4848403C>G	ENST00000252318.2	+	3	921	c.584C>G	c.(583-585)tCc>tGc	p.S195C	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	195	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GAAGCTCTGTCCATTATACAA	0.428																																					p.S195C	Colon(108;631 1558 7270 20097 39846)	Atlas-SNP	.											.	GALNT8	89	.	0			c.C584G						.						141.0	126.0	131.0					12																	4848403		2203	4300	6503	SO:0001583	missense	26290	exon3			CTCTGTCCATTAT	AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.584C>G	chr12.hg19:g.4848403C>G	ENSP00000252318:p.Ser195Cys	112.0	0.0		75.0	37.0	NM_017417	B2RU02	Missense_Mutation	SNP	ENST00000252318.2	hg19	CCDS8533.1	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233228	0.58886	.	.	ENSG00000130035	ENST00000252318	T	0.60548	0.18	4.36	4.36	0.52297	Glycosyl transferase, family 2 (1);	0.000000	0.64402	D	0.000001	T	0.78323	0.4265	M	0.86573	2.825	0.51012	D	0.999901	D	0.89917	1.0	D	0.97110	1.0	T	0.82912	-0.0222	10	0.87932	D	0	.	14.4135	0.67132	0.0:1.0:0.0:0.0	.	195	Q9NY28	GALT8_HUMAN	C	195	ENSP00000252318:S195C	ENSP00000252318:S195C	S	+	2	0	GALNT8	4718664	0.998000	0.40836	0.861000	0.33841	0.259000	0.26198	4.073000	0.57570	2.251000	0.74343	0.561000	0.74099	TCC	.	.		0.428	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388277.2	NM_017417	
A2ML1	144568	hgsc.bcm.edu	37	12	8988264	8988264	+	Splice_Site	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr12:8988264T>C	ENST00000299698.7	+	6	823		c.e6+2			NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1											NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						AGGAATATGGTAGGTGGGGAA	0.537																																					.		Atlas-SNP	.											.	A2ML1	199	.	0			c.643+2T>C						.						90.0	90.0	90.0					12																	8988264		1963	4153	6116	SO:0001630	splice_region_variant	144568	exon6			ATATGGTAGGTGG	AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.643+2T>C	chr12.hg19:g.8988264T>C		133.0	0.0		80.0	32.0	NM_144670		Splice_Site	SNP	ENST00000299698.7	hg19	CCDS8596.2	.	.	.	.	.	.	.	.	.	.	T	14.04	2.416756	0.42918	.	.	ENSG00000166535	ENST00000299698;ENST00000539161	.	.	.	3.88	3.88	0.44766	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3814	0.38316	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	A2ML1	8879531	1.000000	0.71417	1.000000	0.80357	0.632000	0.37999	4.342000	0.59341	1.984000	0.57885	0.459000	0.35465	.	.	.		0.537	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250304.3	NM_144670	Intron
HOXC6	3223	hgsc.bcm.edu	37	12	54423561	54423561	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr12:54423561G>T	ENST00000243108.4	+	2	687	c.523G>T	c.(523-525)Gcc>Tcc	p.A175S	RP11-834C11.14_ENST00000512206.1_RNA|HOXC4_ENST00000303406.4_Intron|RP11-834C11.12_ENST00000513209.1_Intron|HOXC6_ENST00000394331.3_Missense_Mutation_p.A93S	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6	175					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CATCGAGATCGCCAACGCGCT	0.562																																					p.A175S		Atlas-SNP	.											.	HOXC6	30	.	0			c.G523T						.						90.0	96.0	94.0					12																	54423561		2203	4300	6503	SO:0001583	missense	3223	exon2			GAGATCGCCAACG		CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.523G>T	chr12.hg19:g.54423561G>T	ENSP00000243108:p.Ala175Ser	86.0	0.0		50.0	25.0	NM_004503	B2RBV2|Q6DK09	Missense_Mutation	SNP	ENST00000243108.4	hg19	CCDS8871.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.290494	0.80914	.	.	ENSG00000197757	ENST00000394331;ENST00000243108	D;D	0.97888	-4.59;-4.59	4.69	4.69	0.59074	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.97303	0.9118	L	0.28115	0.83	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.97151	0.9831	10	0.37606	T	0.19	.	16.5532	0.84477	0.0:0.0:1.0:0.0	.	175	P09630	HXC6_HUMAN	S	93;175	ENSP00000377864:A93S;ENSP00000243108:A175S	ENSP00000243108:A175S	A	+	1	0	HOXC6	52709828	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.578000	0.98200	2.434000	0.82447	0.561000	0.74099	GCC	.	.		0.562	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358943.2		
SMAD9	4093	hgsc.bcm.edu	37	13	37446983	37446983	+	Missense_Mutation	SNP	C	C	A	rs200651392		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr13:37446983C>A	ENST00000399275.2	-	2	621	c.482G>T	c.(481-483)cGc>cTc	p.R161L	SMAD9_ENST00000379826.4_Missense_Mutation_p.R161L|SMAD9_ENST00000350148.5_Missense_Mutation_p.R161L			O15198	SMAD9_HUMAN	SMAD family member 9	161					BMP signaling pathway (GO:0030509)|bone development (GO:0060348)|cartilage development (GO:0051216)|cellular response to organic cyclic compound (GO:0071407)|hindbrain development (GO:0030902)|intracellular signal transduction (GO:0035556)|midbrain development (GO:0030901)|Mullerian duct regression (GO:0001880)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|response to hypoxia (GO:0001666)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)	18		Breast(139;0.0615)|Lung SC(185;0.0743)|Prostate(109;0.184)		all cancers(112;3.38e-07)|Epithelial(112;1.93e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00804)|BRCA - Breast invasive adenocarcinoma(63;0.0129)|GBM - Glioblastoma multiforme(144;0.026)		GGAGGCGCTGCGGAACTTGGC	0.577																																					p.R161L		Atlas-SNP	.											SMAD9_ENST00000379826,NS,carcinoma,0,2	SMAD9	91	.	0			c.G482T						.						131.0	113.0	119.0					13																	37446983		2203	4300	6503	SO:0001583	missense	4093	exon3			GCGCTGCGGAACT		CCDS9360.1, CCDS45032.1	13q12-q14	2014-09-17	2006-11-06	2004-05-26	ENSG00000120693	ENSG00000120693		"""SMADs"""	6774	protein-coding gene	gene with protein product		603295	"""MAD, mothers against decapentaplegic homolog 9 (Drosophila)"", ""SMAD, mothers against DPP homolog 9 (Drosophila)"""	MADH6, MADH9		9205116	Standard	NM_001127217		Approved		uc001uvw.3	O15198	OTTHUMG00000016740	ENST00000399275.2:c.482G>T	chr13.hg19:g.37446983C>A	ENSP00000382216:p.Arg161Leu	89.0	0.0		65.0	22.0	NM_005905	A2A2Y6|O14989|Q5TBA1	Missense_Mutation	SNP	ENST00000399275.2	hg19	CCDS45032.1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354459	0.61293	.	.	ENSG00000120693	ENST00000399275;ENST00000350148;ENST00000379826	D;D;D	0.94280	-3.39;-3.38;-3.39	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.94361	0.8187	M	0.74258	2.255	0.80722	D	1	B;B	0.31548	0.023;0.328	B;B	0.42625	0.105;0.393	D	0.92068	0.5662	10	0.20046	T	0.44	.	18.4945	0.90860	0.0:1.0:0.0:0.0	.	161;161	O15198-2;O15198	.;SMAD9_HUMAN	L	161	ENSP00000382216:R161L;ENSP00000239885:R161L;ENSP00000369154:R161L	ENSP00000239885:R161L	R	-	2	0	SMAD9	36344983	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.469000	0.80959	2.670000	0.90874	0.563000	0.77884	CGC	.	C|0.999;T|0.001		0.577	SMAD9-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044525.2	NM_005905	
DACH1	1602	hgsc.bcm.edu	37	13	72049330	72049330	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr13:72049330G>T	ENST00000359684.2	-	11	2187	c.2188C>A	c.(2188-2190)Cca>Aca	p.P730T	DACH1_ENST00000354591.4_Missense_Mutation_p.P476T|DACH1_ENST00000313174.7_Missense_Mutation_p.P530T|DACH1_ENST00000305425.4_Missense_Mutation_p.P678T			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	730					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		TCTATCTCTGGGGTCAGAGAG	0.408																																					p.P678T		Atlas-SNP	.											.	DACH1	123	.	0			c.C2032A						.						87.0	84.0	85.0					13																	72049330		1850	4108	5958	SO:0001583	missense	1602	exon10			TCTCTGGGGTCAG	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2188C>A	chr13.hg19:g.72049330G>T	ENSP00000352712:p.Pro730Thr	103.0	0.0		59.0	26.0	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	hg19		.	.	.	.	.	.	.	.	.	.	G	18.86	3.712457	0.68730	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.33216	1.46;1.5;1.49;1.42	5.61	4.76	0.60689	.	0.057000	0.64402	D	0.000001	T	0.50274	0.1606	L	0.55481	1.735	0.33128	D	0.542748	D;D;P	0.69078	0.996;0.997;0.551	P;D;B	0.70716	0.866;0.97;0.431	T	0.63651	-0.6589	10	0.49607	T	0.09	-3.3432	15.9357	0.79704	0.0:0.0:0.8639:0.1361	.	474;528;676	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	T	678;530;476;730;730	ENSP00000304994:P678T;ENSP00000318506:P530T;ENSP00000346604:P476T;ENSP00000352712:P730T	ENSP00000304994:P678T	P	-	1	0	DACH1	70947331	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.415000	0.80131	1.343000	0.45638	0.650000	0.86243	CCA	.	.		0.408	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	
C14orf93	60686	hgsc.bcm.edu	37	14	23456717	23456717	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:23456717C>T	ENST00000299088.6	-	7	1753	c.1324G>A	c.(1324-1326)Gcc>Acc	p.A442T	C14orf93_ENST00000397379.3_Missense_Mutation_p.A442T|C14orf93_ENST00000341470.4_Intron|C14orf93_ENST00000397382.4_Missense_Mutation_p.A442T|RP11-298I3.4_ENST00000556503.1_RNA|RP11-298I3.4_ENST00000555294.1_RNA|RP11-298I3.4_ENST00000557615.1_RNA|C14orf93_ENST00000406429.2_Intron|C14orf93_ENST00000397377.1_Missense_Mutation_p.A262T	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	442						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		GGAGGGCGGGCCACCCACACA	0.572																																					p.A442T		Atlas-SNP	.											.	C14orf93	33	.	0			c.G1324A						.						94.0	86.0	89.0					14																	23456717		2203	4300	6503	SO:0001583	missense	60686	exon7			GGCGGGCCACCCA	AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.1324G>A	chr14.hg19:g.23456717C>T	ENSP00000299088:p.Ala442Thr	62.0	0.0		72.0	49.0	NM_021944	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Missense_Mutation	SNP	ENST00000299088.6	hg19	CCDS9583.1	.	.	.	.	.	.	.	.	.	.	c	35	5.517139	0.96416	.	.	ENSG00000100802	ENST00000299088;ENST00000397379;ENST00000397382;ENST00000397377	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000018	T	0.61048	0.2316	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69731	-0.5066	10	0.72032	D	0.01	-15.3837	18.7998	0.92011	0.0:1.0:0.0:0.0	.	442	Q9H972	CN093_HUMAN	T	442;442;442;262	ENSP00000299088:A442T;ENSP00000380535:A442T;ENSP00000380538:A442T;ENSP00000380533:A262T	ENSP00000299088:A442T	A	-	1	0	C14orf93	22526557	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.562000	0.67346	2.737000	0.93849	0.645000	0.84053	GCC	.	.		0.572	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071688.5	NM_021944	
NFKBIA	4792	hgsc.bcm.edu	37	14	35871694	35871694	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:35871694T>A	ENST00000216797.5	-	5	913	c.812A>T	c.(811-813)cAg>cTg	p.Q271L	NFKBIA_ENST00000557389.1_Missense_Mutation_p.Q181L|NFKBIA_ENST00000557140.1_Missense_Mutation_p.Q228L|NFKBIA_ENST00000557100.1_5'UTR	NM_020529.2	NP_065390.1	P25963	IKBA_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, alpha	271					apoptotic process (GO:0006915)|cellular response to cold (GO:0070417)|cytoplasmic sequestering of NF-kappaB (GO:0007253)|cytoplasmic sequestering of transcription factor (GO:0042994)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of DNA binding (GO:0043392)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of Notch signaling pathway (GO:0045746)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070427)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein import into nucleus, translocation (GO:0000060)|regulation of cell proliferation (GO:0042127)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to exogenous dsRNA (GO:0043330)|response to muramyl dipeptide (GO:0032495)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I-kappaB/NF-kappaB complex (GO:0033256)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|nuclear localization sequence binding (GO:0008139)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(1)|large_intestine(2)|liver(1)	7	Breast(36;0.0484)|Hepatocellular(127;0.158)		Lung(238;9.25e-06)|LUAD - Lung adenocarcinoma(48;1.53e-05)|Epithelial(34;0.00314)|all cancers(34;0.00891)	GBM - Glioblastoma multiforme(112;0.0222)	Acetylsalicylic acid(DB00945)	TAGTGTCAGCTGGCCCAGCTG	0.557																																					p.Q271L		Atlas-SNP	.											.	NFKBIA	28	.	0			c.A812T						.						88.0	91.0	90.0					14																	35871694		2203	4300	6503	SO:0001583	missense	4792	exon5			GTCAGCTGGCCCA		CCDS9656.1	14q13	2014-09-17			ENSG00000100906	ENSG00000100906		"""Ankyrin repeat domain containing"""	7797	protein-coding gene	gene with protein product		164008		NFKBI		1829648	Standard	NM_020529		Approved	IKBA, MAD-3, IkappaBalpha	uc001wtf.4	P25963	OTTHUMG00000140220	ENST00000216797.5:c.812A>T	chr14.hg19:g.35871694T>A	ENSP00000216797:p.Gln271Leu	106.0	0.0		91.0	35.0	NM_020529	B2R8L6	Missense_Mutation	SNP	ENST00000216797.5	hg19	CCDS9656.1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.917344	0.52546	.	.	ENSG00000100906	ENST00000216797;ENST00000557140;ENST00000557389	T;T;T	0.35973	1.28;1.28;1.28	5.76	5.76	0.90799	Ankyrin repeat-containing domain (1);	.	.	.	.	T	0.27098	0.0664	L	0.28115	0.83	0.39503	D	0.968227	B;B	0.09022	0.002;0.0	B;B	0.09377	0.004;0.0	T	0.06935	-1.0799	9	0.41790	T	0.15	-12.2413	12.3378	0.55077	0.1263:0.0:0.0:0.8737	.	228;271	G3V3I4;P25963	.;IKBA_HUMAN	L	271;228;181	ENSP00000216797:Q271L;ENSP00000451257:Q228L;ENSP00000450514:Q181L	ENSP00000216797:Q271L	Q	-	2	0	NFKBIA	34941445	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.174000	0.50847	2.195000	0.70347	0.533000	0.62120	CAG	.	.		0.557	NFKBIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276683.1	NM_020529	
MIS18BP1	55320	hgsc.bcm.edu	37	14	45693923	45693923	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:45693923T>C	ENST00000310806.4	-	11	2325	c.1867A>G	c.(1867-1869)Att>Gtt	p.I623V		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	623					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						AGAATATCAATGGATACATCC	0.299																																					p.I623V		Atlas-SNP	.											.	MIS18BP1	92	.	0			c.A1867G						.						57.0	57.0	57.0					14																	45693923		2202	4297	6499	SO:0001583	missense	55320	exon11			TATCAATGGATAC	AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.1867A>G	chr14.hg19:g.45693923T>C	ENSP00000309790:p.Ile623Val	66.0	0.0		63.0	15.0	NM_018353	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	ENST00000310806.4	hg19	CCDS9684.1	.	.	.	.	.	.	.	.	.	.	T	0.554	-0.847955	0.02651	.	.	ENSG00000129534	ENST00000310806	T	0.17528	2.27	5.25	2.84	0.33178	.	0.857102	0.10489	N	0.668608	T	0.11580	0.0282	N	0.25647	0.755	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.36768	-0.9734	10	0.25751	T	0.34	-0.7599	7.3375	0.26617	0.0:0.177:0.0:0.823	.	623	Q6P0N0	M18BP_HUMAN	V	623	ENSP00000309790:I623V	ENSP00000309790:I623V	I	-	1	0	MIS18BP1	44763673	0.015000	0.18098	0.076000	0.20297	0.975000	0.68041	-0.022000	0.12480	0.383000	0.24910	0.477000	0.44152	ATT	.	.		0.299	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276795.2		
KCNH5	27133	hgsc.bcm.edu	37	14	63174666	63174667	+	Missense_Mutation	DNP	CC	CC	AG			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:63174666_63174667CC>AG	ENST00000322893.7	-	11	2794_2795	c.2526_2527GG>CT	c.(2524-2529)gaGGac>gaCTac	p.842_843ED>DY	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	842					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		CTCTTGGGGTCCTCAGACAATA	0.436																																					p.D843Y|p.E842D		Atlas-SNP	.											.	KCNH5	320	.	0			c.G2527T|c.G2526C						.																																			SO:0001583	missense	27133	exon11			TGGGGTCCTCAGA|GGGGTCCTCAGAC	U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2526_2527delinsAG	chr14.hg19:g.63174666_63174667delinsAG	ENSP00000321427:p.E842_D843delinsDY	111.0|112.0	0.0		117.0|119.0	66.0|67.0	NM_139318	C9JP98	Missense_Mutation	SNP	ENST00000322893.7	hg19	CCDS9756.1																																																																																			.	.		0.436	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411747.1	NM_139318	
ZFYVE26	23503	hgsc.bcm.edu	37	14	68273376	68273376	+	Silent	SNP	T	T	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:68273376T>C	ENST00000347230.4	-	6	1041	c.903A>G	c.(901-903)ctA>ctG	p.L301L	ZFYVE26_ENST00000555452.1_Silent_p.L301L	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	301					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		GCTCAGGATCTAGATGATCCG	0.478																																					p.L301L		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.A903G						.						79.0	75.0	77.0					14																	68273376		2203	4300	6503	SO:0001819	synonymous_variant	23503	exon6			AGGATCTAGATGA	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.903A>G	chr14.hg19:g.68273376T>C		95.0	0.0		80.0	47.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Silent	SNP	ENST00000347230.4	hg19	CCDS9788.1																																																																																			.	.		0.478	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
TRIP11	9321	hgsc.bcm.edu	37	14	92472209	92472209	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr14:92472209G>T	ENST00000267622.4	-	11	2484	c.2111C>A	c.(2110-2112)tCt>tAt	p.S704Y		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	704					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TTTTTCCAGAGAAAGCTGATT	0.373			T	PDGFRB	AML																																p.S704Y	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	184	.	0			c.C2111A						.						106.0	112.0	110.0					14																	92472209		2203	4299	6502	SO:0001583	missense	9321	exon11			TCCAGAGAAAGCT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.2111C>A	chr14.hg19:g.92472209G>T	ENSP00000267622:p.Ser704Tyr	131.0	0.0		114.0	40.0	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	hg19	CCDS9899.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.921|5.921	0.354062|0.354062	0.11182|0.11182	.|.	.|.	ENSG00000100815|ENSG00000100815	ENST00000554357|ENST00000267622;ENST00000542257	.|T	.|0.04360	.|3.64	6.16|6.16	5.22|5.22	0.72569|0.72569	.|.	.|0.386281	.|0.29444	.|N	.|0.012127	T|T	0.07683|0.07683	0.0193|0.0193	M|M	0.66939|0.66939	2.045|2.045	0.31504|0.31504	N|N	0.664407|0.664407	.|B;B	.|0.19200	.|0.007;0.034	.|B;B	.|0.18561	.|0.016;0.022	T|T	0.01869|0.01869	-1.1257|-1.1257	5|10	.|0.26408	.|T	.|0.33	.|.	12.8277|12.8277	0.57728|0.57728	0.0:0.2069:0.678:0.1151|0.0:0.2069:0.678:0.1151	.|.	.|440;704	.|F5H1Z0;Q15643	.|.;TRIPB_HUMAN	L|Y	419|704;440	.|ENSP00000267622:S704Y	.|ENSP00000267622:S704Y	F|S	-|-	3|2	2|0	TRIP11|TRIP11	91541962|91541962	0.974000|0.974000	0.33945|0.33945	0.993000|0.993000	0.49108|0.49108	0.302000|0.302000	0.27658|0.27658	1.706000|1.706000	0.37878|0.37878	2.937000|2.937000	0.99478|0.99478	0.650000|0.650000	0.86243|0.86243	TTC|TCT	.	.		0.373	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
MAGEL2	54551	hgsc.bcm.edu	37	15	23889234	23889234	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr15:23889234G>A	ENST00000532292.1	-	1	1941	c.1847C>T	c.(1846-1848)gCg>gTg	p.A616V		NM_019066.4	NP_061939.3	Q9UJ55	MAGL2_HUMAN	MAGE-like 2	499					Arp2/3 complex-mediated actin nucleation (GO:0034314)|protein K63-linked ubiquitination (GO:0070534)|retrograde transport, endosome to Golgi (GO:0042147)	endosome (GO:0005768)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	7		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;1.84e-06)|Epithelial(43;1.2e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)		CTCTGCGAGCGCTTCAAGGTA	0.562																																					p.A1219V		Atlas-SNP	.											.	MAGEL2	108	.	0			c.C3656T						.						61.0	64.0	63.0					15																	23889234		2035	4193	6228	SO:0001583	missense	54551	exon1			GCGAGCGCTTCAA	AJ243531	CCDS73700.1	15q11-q12	2008-07-18				ENSG00000254585			6814	protein-coding gene	gene with protein product		605283		NDNL1		10556298	Standard	NM_019066		Approved	nM15	uc001ywj.4	Q9UJ55		ENST00000532292.1:c.1847C>T	chr15.hg19:g.23889234G>A	ENSP00000433433:p.Ala616Val	81.0	0.0		67.0	35.0	NM_019066		Missense_Mutation	SNP	ENST00000532292.1	hg19		.	.	.	.	.	.	.	.	.	.	G	16.61	3.170309	0.57584	.	.	ENSG00000254585	ENST00000532292	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	T	0.63355	0.2504	M	0.81112	2.525	0.09310	N	1	.	.	.	.	.	.	T	0.57429	-0.7813	5	.	.	.	.	13.5932	0.61971	0.0:0.0:1.0:0.0	.	.	.	.	C	648	.	.	R	-	1	0	MAGEL2	21440327	0.341000	0.24801	0.017000	0.16124	0.637000	0.38172	4.118000	0.57884	2.671000	0.90904	0.563000	0.77884	CGC	.	.		0.562	MAGEL2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000395182.2	NM_019066	
DNAJC17	55192	hgsc.bcm.edu	37	15	41060161	41060161	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr15:41060161C>T	ENST00000220496.4	-	11	922	c.892G>A	c.(892-894)Gac>Aac	p.D298N	C15orf62_ENST00000344320.6_5'Flank|DNAJC17_ENST00000558727.1_5'UTR	NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	298					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		CCCTCCTGGTCTTCCTGCTGC	0.557																																					p.D298N		Atlas-SNP	.											.	DNAJC17	18	.	0			c.G892A						.						73.0	67.0	69.0					15																	41060161		2203	4300	6503	SO:0001583	missense	55192	exon11			CCTGGTCTTCCTG	AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.892G>A	chr15.hg19:g.41060161C>T	ENSP00000220496:p.Asp298Asn	14.0	0.0		21.0	16.0	NM_018163		Missense_Mutation	SNP	ENST00000220496.4	hg19	CCDS10065.1	.	.	.	.	.	.	.	.	.	.	C	31	5.077981	0.94000	.	.	ENSG00000104129	ENST00000220496	T	0.26518	1.73	5.74	5.74	0.90152	.	0.092864	0.64402	D	0.000001	T	0.52741	0.1753	M	0.83223	2.63	0.80722	D	1	D	0.58970	0.984	P	0.59357	0.856	T	0.56323	-0.7998	10	0.87932	D	0	.	18.055	0.89362	0.0:1.0:0.0:0.0	.	298	Q9NVM6	DJC17_HUMAN	N	298	ENSP00000220496:D298N	ENSP00000220496:D298N	D	-	1	0	DNAJC17	38847453	1.000000	0.71417	0.948000	0.38648	0.454000	0.32378	6.446000	0.73460	2.873000	0.98535	0.561000	0.74099	GAC	.	.		0.557	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252356.2	NM_018163	
FBN1	2200	hgsc.bcm.edu	37	15	48888574	48888574	+	Splice_Site	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr15:48888574A>G	ENST00000316623.5	-	6	899	c.444T>C	c.(442-444)ccT>ccC	p.P148P		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	148	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTTCACAAACAGCTGTAAAAT	0.428																																					p.P148P		Atlas-SNP	.											.	FBN1	310	.	0			c.T444C						.						87.0	81.0	83.0					15																	48888574		2197	4296	6493	SO:0001630	splice_region_variant	2200	exon6			ACAAACAGCTGTA	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.443-1T>C	chr15.hg19:g.48888574A>G		63.0	0.0		55.0	11.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	hg19	CCDS32232.1																																																																																			.	.		0.428	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		Silent
TRIP4	9325	hgsc.bcm.edu	37	15	64686298	64686298	+	Missense_Mutation	SNP	G	G	T	rs115051562	byFrequency	TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr15:64686298G>T	ENST00000261884.3	+	2	315	c.255G>T	c.(253-255)caG>caT	p.Q85H	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	85					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						CTTTGCAGCAGTGCTTCAAAA	0.328																																					p.Q85H		Atlas-SNP	.											.	TRIP4	43	.	0			c.G255T						.						77.0	76.0	76.0					15																	64686298		2203	4300	6503	SO:0001583	missense	9325	exon2			GCAGCAGTGCTTC	L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.255G>T	chr15.hg19:g.64686298G>T	ENSP00000261884:p.Gln85His	180.0	0.0		155.0	8.0	NM_016213	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	ENST00000261884.3	hg19	CCDS10194.1	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416659	0.42918	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.68	2.76	0.32466	.	0.719058	0.14356	N	0.324751	T	0.31765	0.0807	L	0.36672	1.1	0.23089	N	0.998312	B	0.29162	0.235	B	0.31812	0.136	T	0.22173	-1.0224	9	0.45353	T	0.12	-16.4616	6.7238	0.23345	0.2764:0.1228:0.6008:0.0	.	85	Q15650	TRIP4_HUMAN	H	85	.	ENSP00000261884:Q85H	Q	+	3	2	TRIP4	62473351	0.000000	0.05858	0.992000	0.48379	0.985000	0.73830	-0.539000	0.06113	0.875000	0.35847	0.655000	0.94253	CAG	.	G|0.986;A|0.014		0.328	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256635.2	NM_016213	
GRIN2A	2903	hgsc.bcm.edu	37	16	9934503	9934503	+	Splice_Site	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:9934503C>A	ENST00000396573.2	-	8	1961		c.e8+1		GRIN2A_ENST00000396575.2_Splice_Site|GRIN2A_ENST00000562109.1_Splice_Site|GRIN2A_ENST00000404927.2_Splice_Site|GRIN2A_ENST00000330684.3_Splice_Site|GRIN2A_ENST00000535259.1_Splice_Site	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A						directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AATTCACACACCTAGAAAAGC	0.433																																					.		Atlas-SNP	.											.	GRIN2A	366	.	0			c.1651+1G>T						.						107.0	91.0	97.0					16																	9934503		2197	4300	6497	SO:0001630	splice_region_variant	2903	exon8			CACACACCTAGAA		CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.1651+1G>T	chr16.hg19:g.9934503C>A		138.0	0.0		137.0	41.0	NM_001134407	O00669|Q17RZ6	Splice_Site	SNP	ENST00000396573.2	hg19	CCDS10539.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771776	0.90108	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.9735	0.89120	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GRIN2A	9842004	1.000000	0.71417	0.985000	0.45067	0.955000	0.61496	7.388000	0.79795	2.469000	0.83416	0.655000	0.94253	.	.	.		0.433	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251930.3		Intron
TMC7	79905	hgsc.bcm.edu	37	16	19049311	19049311	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:19049311G>A	ENST00000304381.5	+	8	1251	c.1121G>A	c.(1120-1122)gGg>gAg	p.G374E	TMC7_ENST00000421369.3_Missense_Mutation_p.G264E|TMC7_ENST00000569532.1_Missense_Mutation_p.G374E|TMC7_ENST00000561963.1_3'UTR	NM_024847.3	NP_079123.3	Q7Z402	TMC7_HUMAN	transmembrane channel-like 7	374					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	28						GCTGTTTTAGGGGCATGCTTT	0.398																																					p.G374E		Atlas-SNP	.											.	TMC7	75	.	0			c.G1121A						.						217.0	187.0	197.0					16																	19049311		2197	4300	6497	SO:0001583	missense	79905	exon8			TTTTAGGGGCATG	AY263165	CCDS10573.1, CCDS53992.1, CCDS73837.1	16p13.11	2008-02-05			ENSG00000170537	ENSG00000170537			23000	protein-coding gene	gene with protein product						12812529, 12906855	Standard	XM_005255597		Approved	FLJ21240	uc002dfq.3	Q7Z402	OTTHUMG00000131456	ENST00000304381.5:c.1121G>A	chr16.hg19:g.19049311G>A	ENSP00000304710:p.Gly374Glu	108.0	0.0		80.0	26.0	NM_024847	E7ERB6|Q5H9Q8|Q7Z5M4|Q86WX0|Q9H766	Missense_Mutation	SNP	ENST00000304381.5	hg19	CCDS10573.1	.	.	.	.	.	.	.	.	.	.	G	14.43	2.533866	0.45073	.	.	ENSG00000170537	ENST00000304381;ENST00000421369	T;T	0.52057	0.68;0.68	5.5	-0.185	0.13276	.	0.422877	0.25319	N	0.031530	T	0.33847	0.0877	L	0.52126	1.63	0.20403	N	0.999908	B;P	0.37612	0.229;0.602	B;B	0.38296	0.128;0.27	T	0.14671	-1.0464	10	0.42905	T	0.14	.	2.2645	0.04075	0.1252:0.5038:0.1472:0.2238	.	374;374	Q7Z402;B3KSZ3	TMC7_HUMAN;.	E	374;264	ENSP00000304710:G374E;ENSP00000397081:G264E	ENSP00000304710:G374E	G	+	2	0	TMC7	18956812	0.016000	0.18221	0.016000	0.15963	0.511000	0.34104	0.277000	0.18734	0.211000	0.20683	-0.284000	0.09977	GGG	.	.		0.398	TMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254276.3	NM_024847	
VWA3A	146177	hgsc.bcm.edu	37	16	22149725	22149725	+	Silent	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:22149725A>G	ENST00000389398.5	+	22	2280	c.2184A>G	c.(2182-2184)gtA>gtG	p.V728V	VWA3A_ENST00000389397.4_5'UTR	NM_173615.3	NP_775886.3	A6NCI4	VWA3A_HUMAN	von Willebrand factor A domain containing 3A	728						extracellular region (GO:0005576)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7				GBM - Glioblastoma multiforme(48;0.0439)		CAGGAAAAGTACTGGGAAGTT	0.577																																					p.V728V		Atlas-SNP	.											.	VWA3A	115	.	0			c.A2184G						.						40.0	44.0	43.0					16																	22149725		1957	4147	6104	SO:0001819	synonymous_variant	146177	exon22			AAAAGTACTGGGA	AK128606, AK098260	CCDS45441.1	16p12.1	2008-02-05				ENSG00000175267			27088	protein-coding gene	gene with protein product						12477932	Standard	XM_006721021		Approved	FLJ46765, FLJ40941	uc010vbq.2	A6NCI4		ENST00000389398.5:c.2184A>G	chr16.hg19:g.22149725A>G		85.0	0.0		62.0	37.0	NM_173615	A4QMU8|A6NNC0|Q6UTX4|Q6ZQZ9|Q8IUY6|Q8N9W1	Silent	SNP	ENST00000389398.5	hg19	CCDS45441.1																																																																																			.	.		0.577	VWA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000430052.1		
SCNN1G	6340	hgsc.bcm.edu	37	16	23226546	23226546	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:23226546C>A	ENST00000300061.2	+	13	1849	c.1706C>A	c.(1705-1707)gCc>gAc	p.A569D	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	569					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TGGCAGAAAGCCAAGGAGTGG	0.567																																					p.A569D		Atlas-SNP	.											.	SCNN1G	82	.	0			c.C1706A						.						93.0	89.0	90.0					16																	23226546		2197	4300	6497	SO:0001583	missense	6340	exon13			AGAAAGCCAAGGA	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1706C>A	chr16.hg19:g.23226546C>A	ENSP00000300061:p.Ala569Asp	53.0	0.0		64.0	43.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	hg19	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	C	17.87	3.495716	0.64186	.	.	ENSG00000166828	ENST00000300061	T	0.71579	-0.58	5.22	5.22	0.72569	.	0.246452	0.35555	N	0.003128	T	0.51227	0.1662	N	0.08118	0	0.42033	D	0.991032	P	0.50272	0.933	P	0.44860	0.462	T	0.51332	-0.8719	10	0.19590	T	0.45	-0.3453	11.2783	0.49180	0.0:0.9165:0.0:0.0835	.	569	P51170	SCNNG_HUMAN	D	569	ENSP00000300061:A569D	ENSP00000300061:A569D	A	+	2	0	SCNN1G	23134047	0.889000	0.30405	1.000000	0.80357	0.954000	0.61252	1.803000	0.38863	2.411000	0.81874	0.561000	0.74099	GCC	.	.		0.567	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
CES1	1066	hgsc.bcm.edu	37	16	55862715	55862715	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:55862715C>T	ENST00000361503.4	-	2	351	c.221G>A	c.(220-222)tGg>tAg	p.W74*	CES1_ENST00000566555.1_5'Flank|CES1_ENST00000422046.2_Nonsense_Mutation_p.W74*|CES1_ENST00000360526.3_Nonsense_Mutation_p.W75*			P23141	EST1_HUMAN	carboxylesterase 1	74					epithelial cell differentiation (GO:0030855)|metabolic process (GO:0008152)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)								all cancers(182;0.13)|Epithelial(162;0.137)	Benzocaine(DB01086)|Capecitabine(DB01101)|Ciclesonide(DB01410)|Clopidogrel(DB00758)|Cyclandelate(DB04838)|Dabigatran etexilate(DB06695)|Indomethacin(DB00328)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Mycophenolate mofetil(DB00688)|Oseltamivir(DB00198)|Probucol(DB01599)|Rufinamide(DB06201)|Tamoxifen(DB00675)|Trandolapril(DB00519)	CACAAAGCTCCATGGTTCTGC	0.537																																					p.W75X	NSCLC(162;1801 2756 42904 52896)	Atlas-SNP	.											.	CES1	78	.	0			c.G224A						.						110.0	109.0	110.0					16																	55862715		2198	4300	6498	SO:0001587	stop_gained	1066	exon2			AAGCTCCATGGTT	BC012418	CCDS32450.1, CCDS45488.1, CCDS45489.1	16q22.2	2010-10-12	2010-10-12		ENSG00000198848	ENSG00000198848	3.1.1.1	"""Carboxylesterases"""	1863	protein-coding gene	gene with protein product	"""human monocyte/macrophage serine esterase 1"""	114835	"""carboxylesterase 1 (monocyte/macrophage serine esterase 1)"""			2070086, 20931200	Standard	XM_005255774		Approved	HMSE, CES2, HMSE1, SES1, CEH, CES1A1, CES1A2	uc002eil.3	P23141		ENST00000361503.4:c.221G>A	chr16.hg19:g.55862715C>T	ENSP00000355193:p.Trp74*	153.0	0.0		131.0	12.0	NM_001025195	A6NIM1|A8K3K8|A8K844|E9PAU8|P82127|Q00015|Q13657|Q14062|Q16737|Q16788|Q549X7|Q549X8|Q86UK2|Q96EE8|Q9UC52|Q9UDG8|Q9UK77|Q9ULY2	Nonsense_Mutation	SNP	ENST00000361503.4	hg19	CCDS45488.1	.	.	.	.	.	.	.	.	.	.	.	19.73	3.881416	0.72294	.	.	ENSG00000198848	ENST00000360526;ENST00000361503;ENST00000422046	.	.	.	4.48	4.48	0.54585	.	0.000000	0.45606	D	0.000354	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.6933	0.69101	0.0:1.0:0.0:0.0	.	.	.	.	X	75;74;74	.	ENSP00000353720:W75X	W	-	2	0	CES1	54420216	1.000000	0.71417	0.371000	0.25978	0.013000	0.08279	7.126000	0.77201	2.051000	0.60960	0.393000	0.25936	TGG	.	.		0.537	CES1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000433285.1	NM_001266	
CES2	8824	hgsc.bcm.edu	37	16	66976621	66976621	+	Silent	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:66976621G>A	ENST00000317091.4	+	10	2529	c.1545G>A	c.(1543-1545)ccG>ccA	p.P515P	CES2_ENST00000417689.1_Silent_p.P515P|RP11-361L15.4_ENST00000566869.1_RNA	NM_003869.5	NP_003860.2	O00748	EST2_HUMAN	carboxylesterase 2	451					catabolic process (GO:0009056)	endoplasmic reticulum (GO:0005783)	carboxylic ester hydrolase activity (GO:0052689)|methylumbelliferyl-acetate deacetylase activity (GO:0047374)			breast(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|urinary_tract(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0663)|Epithelial(162;0.166)	Dabigatran etexilate(DB06695)|Irinotecan(DB00762)|Mycophenolate mofetil(DB00688)|Prasugrel(DB06209)	TCAGGCCACCGCACATGAAGG	0.562																																					p.P515P	Ovarian(70;1230 1691 37888 38351)	Atlas-SNP	.											.	CES2	43	.	0			c.G1545A						.						92.0	85.0	88.0					16																	66976621		2200	4300	6500	SO:0001819	synonymous_variant	8824	exon10			GCCACCGCACATG	BC032095	CCDS10825.1, CCDS45507.1	16q22.1	2010-10-12	2010-10-12		ENSG00000172831	ENSG00000172831		"""Carboxylesterases"""	1864	protein-coding gene	gene with protein product		605278	"""carboxylesterase 2 (intestine, liver)"""			9169443, 9144407, 20931200	Standard	NM_198061		Approved	CE-2, iCE, CES2A1	uc002eqr.3	O00748	OTTHUMG00000137517	ENST00000317091.4:c.1545G>A	chr16.hg19:g.66976621G>A		76.0	0.0		99.0	31.0	NM_003869	A8K367|Q16859|Q5MAB8|Q7Z366|Q8IUP4|Q8TCP8	Silent	SNP	ENST00000317091.4	hg19	CCDS10825.1																																																																																			.	.		0.562	CES2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268838.2	NM_003869	
CTCF	10664	hgsc.bcm.edu	37	16	67650677	67650677	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:67650677G>T	ENST00000264010.4	+	5	1426	c.982G>T	c.(982-984)Gac>Tac	p.D328Y	AC009095.4_ENST00000388909.4_RNA|CTCF_ENST00000401394.1_5'UTR	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	328					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		CCCAGACTGCGACATGGCCTT	0.498																																					p.D328Y	Colon(175;1200 1966 6945 23069 27405)	Atlas-SNP	.											.	CTCF	193	.	0			c.G982T						.						301.0	254.0	270.0					16																	67650677		2198	4300	6498	SO:0001583	missense	10664	exon5			GACTGCGACATGG	U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.982G>T	chr16.hg19:g.67650677G>T	ENSP00000264010:p.Asp328Tyr	112.0	0.0		134.0	36.0	NM_006565	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	ENST00000264010.4	hg19	CCDS10841.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831258	0.91036	.	.	ENSG00000102974	ENST00000264010	T	0.07688	3.17	4.89	4.89	0.63831	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.153953	0.43919	D	0.000502	T	0.34745	0.0908	M	0.85299	2.745	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.20672	-1.0268	10	0.59425	D	0.04	.	18.2991	0.90157	0.0:0.0:1.0:0.0	.	328	P49711	CTCF_HUMAN	Y	328	ENSP00000264010:D328Y	ENSP00000264010:D328Y	D	+	1	0	CTCF	66208178	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	9.397000	0.97276	2.553000	0.86117	0.555000	0.69702	GAC	.	.		0.498	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268870.2	NM_006565	
ZNF23	7571	hgsc.bcm.edu	37	16	71482852	71482852	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:71482852G>C	ENST00000393539.2	-	6	1889	c.1076C>G	c.(1075-1077)aCa>aGa	p.T359R	ZNF23_ENST00000564528.1_Missense_Mutation_p.T301R|ZNF23_ENST00000539742.1_5'UTR|ZNF23_ENST00000358700.2_3'UTR|AC010547.9_ENST00000561908.1_3'UTR|ZNF23_ENST00000428724.2_Missense_Mutation_p.T301R|ZNF23_ENST00000497160.1_3'UTR|ZNF23_ENST00000417828.1_Missense_Mutation_p.T359R|ZNF23_ENST00000357254.4_Missense_Mutation_p.T359R	NM_145911.1	NP_666016.1	P17027	ZNF23_HUMAN	zinc finger protein 23	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(14)|stomach(1)|urinary_tract(1)	29		Ovarian(137;0.00768)		BRCA - Breast invasive adenocarcinoma(221;0.0686)		CTTTTCTCCTGTGTGGATGCT	0.428																																					p.T359R		Atlas-SNP	.											.	ZNF23	65	.	0			c.C1076G						.						70.0	65.0	67.0					16																	71482852		2198	4300	6498	SO:0001583	missense	7571	exon6			TCTCCTGTGTGGA	X52347	CCDS10900.1	16q22.2	2013-03-28	2012-07-12		ENSG00000167377	ENSG00000167377		"""Zinc fingers, C2H2-type"""	13023	protein-coding gene	gene with protein product		194527	"""zinc finger protein 359"""	ZNF359			Standard	NM_145911		Approved	KOX16, Zfp612, ZNF612	uc002faf.3	P17027	OTTHUMG00000176797	ENST00000393539.2:c.1076C>G	chr16.hg19:g.71482852G>C	ENSP00000377171:p.Thr359Arg	77.0	0.0		60.0	23.0	NM_145911	Q8NDP5|Q96IT3|Q9UG42	Missense_Mutation	SNP	ENST00000393539.2	hg19	CCDS10900.1	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534941	0.64972	.	.	ENSG00000167377	ENST00000393539;ENST00000357254;ENST00000417828;ENST00000428724;ENST00000539742;ENST00000358700	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	4.15	3.18	0.36537	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.45606	D	0.000343	T	0.45155	0.1328	M	0.62016	1.91	0.42091	D	0.991292	D;D	0.89917	1.0;0.995	D;D	0.80764	0.994;0.91	T	0.47368	-0.9123	10	0.87932	D	0	-23.2998	11.4521	0.50158	0.0:0.0:0.8182:0.1818	.	359;359	B3KR55;P17027	.;ZNF23_HUMAN	R	359;359;359;301;301;159	ENSP00000377171:T359R;ENSP00000349796:T359R;ENSP00000395712:T359R;ENSP00000387673:T301R	ENSP00000349796:T359R	T	-	2	0	ZNF23	70040353	0.994000	0.37717	0.998000	0.56505	0.975000	0.68041	2.119000	0.41958	1.298000	0.44778	0.561000	0.74099	ACA	.	.		0.428	ZNF23-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268985.23	NM_145911	
CRISPLD2	83716	hgsc.bcm.edu	37	16	84884214	84884214	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr16:84884214A>G	ENST00000262424.5	+	5	757	c.533A>G	c.(532-534)aAc>aGc	p.N178S	AC025280.1_ENST00000584136.1_RNA|CRISPLD2_ENST00000567845.1_Missense_Mutation_p.N178S|CRISPLD2_ENST00000564567.1_Missense_Mutation_p.N178S|CRISPLD2_ENST00000566431.1_3'UTR	NM_031476.3	NP_113664.1	Q9H0B8	CRLD2_HUMAN	cysteine-rich secretory protein LCCL domain containing 2	178	SCP.				extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|lung development (GO:0030324)	extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|transport vesicle (GO:0030133)	heparin binding (GO:0008201)			endometrium(3)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)	18						TGTGCTGTGAACACCTGCCGG	0.463																																					p.N178S		Atlas-SNP	.											.	CRISPLD2	36	.	0			c.A533G						.						164.0	150.0	155.0					16																	84884214		2199	4300	6499	SO:0001583	missense	83716	exon5			CTGTGAACACCTG	AL136861	CCDS10949.1	16q24.1	2008-02-05	2005-02-16	2005-02-16	ENSG00000103196	ENSG00000103196			25248	protein-coding gene	gene with protein product		612434	"""LCCL domain containing cysteine-rich secretory protein 2"""	LCRISP2		11230166	Standard	NM_031476		Approved	DKFZP434B044	uc010voh.1	Q9H0B8	OTTHUMG00000137644	ENST00000262424.5:c.533A>G	chr16.hg19:g.84884214A>G	ENSP00000262424:p.Asn178Ser	96.0	0.0		85.0	20.0	NM_031476	D3DUM0|Q6P590|Q6UWH0|Q6UXC6|Q96IB1|Q96K61	Missense_Mutation	SNP	ENST00000262424.5	hg19	CCDS10949.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130502	0.56828	.	.	ENSG00000103196	ENST00000262424	T	0.07021	3.23	5.84	4.72	0.59763	CAP domain (3);	0.250702	0.45867	D	0.000338	T	0.07593	0.0191	N	0.20530	0.585	0.80722	D	1	B;B;P	0.44044	0.0;0.022;0.825	B;B;B	0.42625	0.011;0.041;0.393	T	0.21552	-1.0242	10	0.66056	D	0.02	.	12.0712	0.53618	0.8559:0.1441:0.0:0.0	.	178;178;178	Q9H0B8;Q9H0B8-2;Q9H0B8-3	CRLD2_HUMAN;.;.	S	178	ENSP00000262424:N178S	ENSP00000262424:N178S	N	+	2	0	CRISPLD2	83441715	1.000000	0.71417	0.995000	0.50966	0.871000	0.50021	6.956000	0.76013	1.002000	0.39104	0.459000	0.35465	AAC	.	.		0.463	CRISPLD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269086.2	NM_031476	
KRTAP4-7	100132476	hgsc.bcm.edu	37	17	39240735	39240735	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr17:39240735A>C	ENST00000391417.4	+	1	277	c.277A>C	c.(277-279)Agc>Cgc	p.S93R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	118	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						ctgtatgtccagctgctgcaa	0.682																																					p.S93R		Atlas-SNP	.											.	KRTAP4-7	49	.	0			c.A277C						.						10.0	16.0	14.0					17																	39240735		683	1572	2255	SO:0001583	missense	100132476	exon1			ATGTCCAGCTGCT	AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.277A>C	chr17.hg19:g.39240735A>C	ENSP00000375236:p.Ser93Arg	21.0	0.0		40.0	34.0	NM_033061	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	ENST00000391417.4	hg19	CCDS45673.1	.	.	.	.	.	.	.	.	.	.	.	12.99	2.103902	0.37145	.	.	ENSG00000240871;ENSG00000212722	ENST00000391417;ENST00000377734	T	0.00642	6.02	3.69	2.56	0.30785	.	.	.	.	.	T	0.01558	0.0050	.	.	.	0.30411	N	0.779047	D	0.53462	0.96	P	0.54815	0.761	T	0.41215	-0.9521	8	0.62326	D	0.03	.	8.1351	0.31050	0.6023:0.3977:0.0:0.0	.	93	Q9BYR0	KRA47_HUMAN	R	93;84	ENSP00000375236:S93R	ENSP00000375236:S93R	S	+	1	0	KRTAP4-9;KRTAP4-7	36494261	0.987000	0.35691	0.998000	0.56505	0.882000	0.50991	0.768000	0.26590	0.356000	0.24157	0.254000	0.18369	AGC	.	.		0.682	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257686.1		
MISP	126353	hgsc.bcm.edu	37	19	763554	763554	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:763554G>T	ENST00000215582.6	+	5	2107	c.2004G>T	c.(2002-2004)tgG>tgT	p.W668C		NM_173481.2	NP_775752.1	Q8IVT2	MISP_HUMAN	mitotic spindle positioning	668					mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											CAGAGCGCTGGGAATCCCGCA	0.627																																					p.W668C		Atlas-SNP	.											.	C19orf21	56	.	0			c.G2004T						.						54.0	49.0	51.0					19																	763554		2203	4300	6503	SO:0001583	missense	126353	exon5			GCGCTGGGAATCC	BC052236	CCDS12042.1	19p13.3	2014-06-25	2013-05-03	2013-05-03	ENSG00000099812	ENSG00000099812			27000	protein-coding gene	gene with protein product	"""mitotic interactor and substrate of Plk1"""	615289	"""chromosome 19 open reading frame 21"""	C19orf21		23574715, 23509069, 24475924	Standard	NM_173481		Approved	DKFZp686H18209, Caprice		Q8IVT2	OTTHUMG00000181786	ENST00000215582.6:c.2004G>T	chr19.hg19:g.763554G>T	ENSP00000215582:p.Trp668Cys	43.0	0.0		26.0	12.0	NM_173481		Missense_Mutation	SNP	ENST00000215582.6	hg19	CCDS12042.1	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822688	0.71028	.	.	ENSG00000099812	ENST00000215582	D	0.84442	-1.85	4.62	4.62	0.57501	.	0.000000	0.56097	D	0.000038	D	0.90758	0.7099	M	0.62723	1.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91778	0.5433	10	0.87932	D	0	-24.4772	14.9823	0.71319	0.0:0.0:1.0:0.0	.	668	Q8IVT2	CS021_HUMAN	C	668	ENSP00000215582:W668C	ENSP00000215582:W668C	W	+	3	0	C19orf21	714554	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.281000	0.72632	2.306000	0.77630	0.561000	0.74099	TGG	.	.		0.627	MISP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457600.2	NM_173481	
PRKCSH	5589	hgsc.bcm.edu	37	19	11553327	11553327	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:11553327G>A	ENST00000589838.1	+	6	595	c.595G>A	c.(595-597)Gaa>Aaa	p.E199K	PRKCSH_ENST00000252455.2_Missense_Mutation_p.E199K|PRKCSH_ENST00000412601.1_Missense_Mutation_p.E199K|PRKCSH_ENST00000591462.1_Missense_Mutation_p.E199K|PRKCSH_ENST00000592741.1_Missense_Mutation_p.E199K|PRKCSH_ENST00000587327.1_Missense_Mutation_p.E199K			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	199					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						GAAGCTGTGGGAAGGTATGGC	0.552																																					p.E199K		Atlas-SNP	.											.	PRKCSH	55	.	0			c.G595A						.						98.0	75.0	83.0					19																	11553327		2203	4300	6503	SO:0001583	missense	5589	exon7			CTGTGGGAAGGTA		CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.595G>A	chr19.hg19:g.11553327G>A	ENSP00000465461:p.Glu199Lys	66.0	0.0		40.0	16.0	NM_001001329	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	ENST00000589838.1	hg19	CCDS32911.1	.	.	.	.	.	.	.	.	.	.	G	31	5.072765	0.93950	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.73897	1.12;-0.79	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	D	0.84897	0.5574	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;P;D	0.87578	0.998;0.885;0.997	T	0.82102	-0.0623	10	0.20046	T	0.44	-24.0032	17.2438	0.87021	0.0:0.0:1.0:0.0	.	199;199;199	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	K	199	ENSP00000252455:E199K;ENSP00000395616:E199K	ENSP00000252455:E199K	E	+	1	0	PRKCSH	11414327	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.467000	0.90390	2.372000	0.80975	0.655000	0.94253	GAA	.	.		0.552	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000458817.1		
ZNF793	390927	hgsc.bcm.edu	37	19	38028629	38028629	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:38028629C>T	ENST00000587143.1	+	6	1304	c.1069C>T	c.(1069-1071)Cat>Tat	p.H357Y	ZNF793_ENST00000588578.1_3'UTR|ZNF793_ENST00000445217.1_Missense_Mutation_p.H357Y|ZNF793_ENST00000589319.1_Intron|ZNF793_ENST00000542455.1_Missense_Mutation_p.H357Y			Q6ZN11	ZN793_HUMAN	zinc finger protein 793	357					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(2)|lung(1)	3			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CCTCAATAAACATTGGAGAAC	0.443																																					p.H357Y	Melanoma(44;400 1431 1499 19093)	Atlas-SNP	.											.	ZNF793	50	.	0			c.C1069T						.						76.0	84.0	81.0					19																	38028629		2156	4288	6444	SO:0001583	missense	390927	exon8			AATAAACATTGGA	AK131417	CCDS46062.1	19q13.12	2013-01-08				ENSG00000188227		"""Zinc fingers, C2H2-type"", ""-"""	33115	protein-coding gene	gene with protein product							Standard	NM_001013659		Approved		uc010efm.3	Q6ZN11		ENST00000587143.1:c.1069C>T	chr19.hg19:g.38028629C>T	ENSP00000468605:p.His357Tyr	98.0	0.0		51.0	18.0	NM_001013659	E9PGN4|Q7Z3Q9	Missense_Mutation	SNP	ENST00000587143.1	hg19	CCDS46062.1	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708892	0.68615	.	.	ENSG00000188227	ENST00000542455;ENST00000418827;ENST00000445217;ENST00000322299	D;D	0.86769	-2.17;-2.17	4.13	3.04	0.35103	.	0.000000	0.38837	N	0.001543	D	0.94909	0.8354	H	0.95114	3.625	0.33293	D	0.563767	D	0.89917	1.0	D	0.87578	0.998	D	0.97021	0.9743	10	0.87932	D	0	.	12.7454	0.57278	0.0:0.8325:0.1675:0.0	.	357	E9PGN4	.	Y	357;357;357;356	ENSP00000444355:H357Y;ENSP00000396402:H357Y	ENSP00000318811:H356Y	H	+	1	0	ZNF793	42720469	0.998000	0.40836	0.983000	0.44433	0.951000	0.60555	5.043000	0.64208	1.007000	0.39238	0.650000	0.86243	CAT	.	.		0.443	ZNF793-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458621.1	NM_001013659	
CKM	1158	hgsc.bcm.edu	37	19	45810804	45810804	+	Silent	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:45810804G>T	ENST00000221476.3	-	7	1056	c.882C>A	c.(880-882)ggC>ggA	p.G294G		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	294	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	TCACATGCACGCCTCCACGCA	0.607																																					p.G294G		Atlas-SNP	.											.	CKM	40	.	0			c.C882A						.						80.0	70.0	73.0					19																	45810804		2203	4300	6503	SO:0001819	synonymous_variant	1158	exon7			ATGCACGCCTCCA	M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.882C>A	chr19.hg19:g.45810804G>T		65.0	0.0		42.0	16.0	NM_001824	Q96QL9	Silent	SNP	ENST00000221476.3	hg19	CCDS12659.1																																																																																			.	.		0.607	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1		
ALDH16A1	126133	hgsc.bcm.edu	37	19	49962955	49962955	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:49962955C>T	ENST00000293350.4	+	4	512	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	ALDH16A1_ENST00000433981.2_5'UTR|ALDH16A1_ENST00000598015.1_3'UTR|ALDH16A1_ENST00000455361.2_Missense_Mutation_p.R117W|ALDH16A1_ENST00000540132.1_Intron	NM_153329.3	NP_699160.2	Q8IZ83	A16A1_HUMAN	aldehyde dehydrogenase 16 family, member A1	117						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(5)|skin(2)|urinary_tract(3)	20		all_lung(116;5.39e-06)|Lung NSC(112;1.97e-05)|all_neural(266;0.0966)|Ovarian(192;0.15)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0251)		GAAGCACCAGCGGCTGCTGTG	0.622																																					p.R117W		Atlas-SNP	.											.	ALDH16A1	54	.	0			c.C349T						.						44.0	48.0	47.0					19																	49962955		2203	4299	6502	SO:0001583	missense	126133	exon4			CACCAGCGGCTGC	AY007096	CCDS12766.1, CCDS46141.1	19q13.33	2014-08-12			ENSG00000161618	ENSG00000161618		"""Aldehyde dehydrogenases"""	28114	protein-coding gene	gene with protein product		613358					Standard	NM_153329		Approved	MGC10204	uc002pnt.3	Q8IZ83	OTTHUMG00000183163	ENST00000293350.4:c.349C>T	chr19.hg19:g.49962955C>T	ENSP00000293350:p.Arg117Trp	90.0	0.0		65.0	27.0	NM_001145396	B4DLQ1|C9JBH6|Q86YF0|Q8IYL4|Q8TEI8	Missense_Mutation	SNP	ENST00000293350.4	hg19	CCDS12766.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220844	0.79464	.	.	ENSG00000161618	ENST00000293350;ENST00000455361	T;T	0.76578	-1.03;-1.03	5.32	2.87	0.33458	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.247502	0.40640	N	0.001053	D	0.85617	0.5738	M	0.86268	2.805	0.80722	D	1	D;D	0.76494	0.999;0.998	P;P	0.60886	0.88;0.87	D	0.86934	0.2075	10	0.87932	D	0	-8.6509	9.913	0.41417	0.4416:0.5584:0.0:0.0	.	117;117	B4DLQ1;Q8IZ83	.;A16A1_HUMAN	W	117	ENSP00000293350:R117W;ENSP00000410142:R117W	ENSP00000293350:R117W	R	+	1	2	ALDH16A1	54654767	0.844000	0.29557	1.000000	0.80357	0.948000	0.59901	0.466000	0.22019	1.355000	0.45865	0.460000	0.39030	CGG	.	.		0.622	ALDH16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465358.1	NM_153329	
NLRP4	147945	hgsc.bcm.edu	37	19	56372857	56372857	+	Silent	SNP	C	C	A	rs200258143		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:56372857C>A	ENST00000301295.6	+	4	2384	c.1962C>A	c.(1960-1962)acC>acA	p.T654T	NLRP4_ENST00000587891.1_Silent_p.T579T|NLRP4_ENST00000346986.5_Silent_p.T654T	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	654					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		GCGAGTCGACCTTTGTGACCT	0.557																																					p.T654T		Atlas-SNP	.											.	NLRP4	331	.	0			c.C1962A						.						118.0	99.0	106.0					19																	56372857		2203	4300	6503	SO:0001819	synonymous_variant	147945	exon4			GTCGACCTTTGTG	AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1962C>A	chr19.hg19:g.56372857C>A		85.0	0.0		43.0	20.0	NM_134444	Q86W87|Q96AY6	Silent	SNP	ENST00000301295.6	hg19	CCDS12936.1																																																																																			.	C|1.000;G|0.000		0.557	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457367.2	NM_134444	
ZIM3	114026	hgsc.bcm.edu	37	19	57647323	57647323	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:57647323G>A	ENST00000269834.1	-	5	767	c.382C>T	c.(382-384)Cca>Tca	p.P128S	U3_ENST00000516874.1_RNA	NM_052882.1	NP_443114.1	Q96PE6	ZIM3_HUMAN	zinc finger, imprinted 3	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(27)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(1)	52		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.243)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		ATGCCCAGTGGAAGTATTTTC	0.388																																					p.P128S		Atlas-SNP	.											.	ZIM3	107	.	0			c.C382T						.						224.0	216.0	219.0					19																	57647323		2203	4300	6503	SO:0001583	missense	114026	exon5			CCAGTGGAAGTAT	AF365931	CCDS33125.1	19q13.4	2013-01-08				ENSG00000141946		"""Zinc fingers, C2H2-type"", ""-"""	16366	protein-coding gene	gene with protein product							Standard	NM_052882		Approved	ZNF657	uc002qnz.1	Q96PE6		ENST00000269834.1:c.382C>T	chr19.hg19:g.57647323G>A	ENSP00000269834:p.Pro128Ser	146.0	0.0		84.0	40.0	NM_052882	Q14CA6	Missense_Mutation	SNP	ENST00000269834.1	hg19	CCDS33125.1	.	.	.	.	.	.	.	.	.	.	G	2.902	-0.227190	0.06022	.	.	ENSG00000141946	ENST00000269834	T	0.04083	3.71	2.18	2.18	0.27775	.	.	.	.	.	T	0.02494	0.0076	N	0.12182	0.205	0.09310	N	1	B	0.23377	0.084	B	0.19148	0.024	T	0.43734	-0.9373	9	0.07325	T	0.83	.	8.2657	0.31813	0.0:0.0:0.7631:0.2369	.	128	Q96PE6	ZIM3_HUMAN	S	128	ENSP00000269834:P128S	ENSP00000269834:P128S	P	-	1	0	ZIM3	62339135	0.011000	0.17503	0.003000	0.11579	0.100000	0.18952	0.737000	0.26144	1.523000	0.49018	0.313000	0.20887	CCA	.	.		0.388	ZIM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465078.1		
ZNF417	147687	hgsc.bcm.edu	37	19	58420786	58420786	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:58420786T>A	ENST00000312026.5	-	3	1024	c.860A>T	c.(859-861)cAg>cTg	p.Q287L	ZNF417_ENST00000595559.1_Missense_Mutation_p.Q286L|CTD-2583A14.9_ENST00000602124.1_Intron|ZNF417_ENST00000536263.1_Missense_Mutation_p.Q88L	NM_152475.2	NP_689688.2	Q8TAU3	ZN417_HUMAN	zinc finger protein 417	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|stomach(3)|upper_aerodigestive_tract(1)	18		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0151)		GTGGACTCGCTGATGTTGAAT	0.463																																					p.Q287L		Atlas-SNP	.											.	ZNF417	44	.	0			c.A860T						.						158.0	156.0	156.0					19																	58420786		2203	4300	6503	SO:0001583	missense	147687	exon3			ACTCGCTGATGTT	BC025783	CCDS12965.1, CCDS74469.1	19q13.43	2013-01-08				ENSG00000173480		"""Zinc fingers, C2H2-type"", ""-"""	20646	protein-coding gene	gene with protein product							Standard	NM_152475		Approved	MGC34079	uc002qqq.3	Q8TAU3		ENST00000312026.5:c.860A>T	chr19.hg19:g.58420786T>A	ENSP00000311319:p.Gln287Leu	270.0	0.0		188.0	72.0	NM_152475	B4DEU1	Missense_Mutation	SNP	ENST00000312026.5	hg19	CCDS12965.1	.	.	.	.	.	.	.	.	.	.	.	7.949	0.744362	0.15710	.	.	ENSG00000173480	ENST00000312026;ENST00000536263	T;T	0.27256	2.51;1.68	1.68	0.577	0.17385	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14657	0.0354	N	0.17631	0.505	0.09310	N	1	B;P	0.50272	0.403;0.933	B;B	0.41271	0.111;0.352	T	0.13548	-1.0505	9	0.66056	D	0.02	.	5.5656	0.17168	0.0:0.1624:0.0:0.8376	.	287;287	F5H0M9;Q8TAU3	.;ZN417_HUMAN	L	287;88	ENSP00000311319:Q287L;ENSP00000442760:Q88L	ENSP00000311319:Q287L	Q	-	2	0	ZNF417	63112598	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	0.070000	0.14573	-0.036000	0.13669	0.155000	0.16302	CAG	.	.		0.463	ZNF417-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466860.1	NM_152475	
ZSCAN18	65982	hgsc.bcm.edu	37	19	58597611	58597611	+	Silent	SNP	G	G	A	rs147947490	byFrequency	TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:58597611G>A	ENST00000240727.6	-	6	1167	c.768C>T	c.(766-768)gaC>gaT	p.D256D	ZSCAN18_ENST00000421612.2_Silent_p.D121D|ZSCAN18_ENST00000600404.1_Silent_p.D312D|ZSCAN18_ENST00000601144.1_Silent_p.D256D	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	256					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		TGGAGGCAGCGTCAGGCTGGG	0.542																																					p.D312D		Atlas-SNP	.											.	ZSCAN18	104	.	0			c.C936T						.						74.0	64.0	67.0					19																	58597611		2203	4300	6503	SO:0001819	synonymous_variant	65982	exon6			GGCAGCGTCAGGC	AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.768C>T	chr19.hg19:g.58597611G>A		208.0	0.0		102.0	48.0	NM_001145542	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Silent	SNP	ENST00000240727.6	hg19	CCDS12971.1																																																																																			.	G|0.993;C|0.007		0.542	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000466706.1	NM_023926	
CST9	128822	hgsc.bcm.edu	37	20	23584366	23584366	+	Silent	SNP	T	T	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr20:23584366T>A	ENST00000376971.3	-	2	272	c.261A>T	c.(259-261)cgA>cgT	p.R87R		NM_001008693.2	NP_001008693.2	Q5W186	CST9_HUMAN	cystatin 9 (testatin)	87						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			central_nervous_system(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Colorectal(13;0.0993)					CCATCTTACCTCGCCACTGTT	0.468																																					p.R87R		Atlas-SNP	.											.	CST9	26	.	0			c.A261T						.						150.0	136.0	140.0					20																	23584366		2203	4300	6503	SO:0001819	synonymous_variant	128822	exon2			CTTACCTCGCCAC	AF494536	CCDS33450.1	20p11.21	2012-08-14			ENSG00000173335	ENSG00000173335			13261	protein-coding gene	gene with protein product						20565543	Standard	NM_001008693		Approved	CLM, CTES7A	uc002wtl.3	Q5W186	OTTHUMG00000032076	ENST00000376971.3:c.261A>T	chr20.hg19:g.23584366T>A		41.0	0.0		33.0	16.0	NM_001008693	B2RP76|Q8TD53	Silent	SNP	ENST00000376971.3	hg19	CCDS33450.1																																																																																			.	.		0.468	CST9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078341.1	NM_001008693.1	
AAR2	25980	hgsc.bcm.edu	37	20	34832689	34832689	+	Silent	SNP	G	G	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr20:34832689G>T	ENST00000373932.3	+	3	1174	c.828G>T	c.(826-828)cgG>cgT	p.R276R	AAR2_ENST00000397286.3_Silent_p.R276R|AAR2_ENST00000320849.4_Silent_p.R276R	NM_015511.3	NP_056326.2	Q9Y312	AAR2_HUMAN	AAR2 splicing factor homolog (S. cerevisiae)	276																	ATTGGAAGCGGCTCCTGAACC	0.522																																					p.R276R		Atlas-SNP	.											.	.	.	.	0			c.G828T						.						213.0	177.0	189.0					20																	34832689		2203	4300	6503	SO:0001819	synonymous_variant	25980	exon3			GAAGCGGCTCCTG		CCDS13273.1	20q11.23	2012-07-20	2012-07-20	2012-07-20	ENSG00000131043	ENSG00000131043			15886	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 4"""	C20orf4			Standard	NM_015511		Approved	bA234K24.2	uc002xfc.3	Q9Y312	OTTHUMG00000032380	ENST00000373932.3:c.828G>T	chr20.hg19:g.34832689G>T		137.0	0.0		189.0	129.0	NM_001271874	E1P5S7|Q9H4F9|Q9P1P3|Q9UFK9	Silent	SNP	ENST00000373932.3	hg19	CCDS13273.1																																																																																			.	.		0.522	AAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079001.2	NM_015511	
CHD6	84181	hgsc.bcm.edu	37	20	40049157	40049157	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr20:40049157G>A	ENST00000373233.3	-	31	6295	c.6118C>T	c.(6118-6120)Cat>Tat	p.H2040Y		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2040					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CCTTGACTATGGCAGTTTCCG	0.413																																					p.H2040Y		Atlas-SNP	.											.	CHD6	312	.	0			c.C6118T						.						133.0	124.0	127.0					20																	40049157		2203	4300	6503	SO:0001583	missense	84181	exon31			GACTATGGCAGTT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6118C>T	chr20.hg19:g.40049157G>A	ENSP00000362330:p.His2040Tyr	36.0	0.0		39.0	8.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392189	0.42410	.	.	ENSG00000124177	ENST00000373233	D	0.85702	-2.02	5.97	5.97	0.96955	.	0.552403	0.17827	N	0.160672	T	0.80691	0.4671	L	0.29908	0.895	0.80722	D	1	B	0.27068	0.167	B	0.25614	0.062	T	0.76924	-0.2779	10	0.66056	D	0.02	-0.9564	18.6044	0.91261	0.0:0.0:1.0:0.0	.	2040	Q8TD26	CHD6_HUMAN	Y	2040	ENSP00000362330:H2040Y	ENSP00000362330:H2040Y	H	-	1	0	CHD6	39482571	0.999000	0.42202	0.990000	0.47175	0.839000	0.47603	4.313000	0.59160	2.828000	0.97474	0.655000	0.94253	CAT	.	.		0.413	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
DYRK1A	1859	hgsc.bcm.edu	37	21	38865317	38865317	+	Splice_Site	SNP	A	A	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr21:38865317A>T	ENST00000398960.2	+	7	1026		c.e7-1		DYRK1A_ENST00000451934.1_Splice_Site|DYRK1A_ENST00000338785.3_Splice_Site|DYRK1A_ENST00000398956.2_Splice_Site|DYRK1A_ENST00000321219.8_Splice_Site|DYRK1A_ENST00000339659.4_Splice_Site|DYRK1A_ENST00000455387.2_Splice_Site	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A						circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						AATATATTTCAGATATACCAG	0.358																																					.	Melanoma(114;464 1602 31203 43785 45765)	Atlas-SNP	.											.	DYRK1A	85	.	0			c.952-2A>T						.						78.0	78.0	78.0					21																	38865317		2203	4300	6503	SO:0001630	splice_region_variant	1859	exon9			TATTTCAGATATA	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.952-1A>T	chr21.hg19:g.38865317A>T		68.0	0.0		62.0	31.0	NM_101395	O60769|Q92582|Q92810|Q9UNM5	Splice_Site	SNP	ENST00000398960.2	hg19	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	.	24.5	4.535165	0.85812	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0172	0.80450	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DYRK1A	37787187	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	9.287000	0.95975	2.239000	0.73571	0.528000	0.53228	.	.	.		0.358	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	Intron
PPM1F	9647	hgsc.bcm.edu	37	22	22277762	22277762	+	Silent	SNP	C	C	T			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr22:22277762C>T	ENST00000263212.5	-	8	1173	c.1068G>A	c.(1066-1068)ctG>ctA	p.L356L	PPM1F_ENST00000538191.1_Silent_p.L252L|PPM1F_ENST00000407142.1_Silent_p.L188L	NM_014634.3	NP_055449.1	P49593	PPM1F_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1F	356					cellular response to drug (GO:0035690)|histone dephosphorylation (GO:0016576)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of stress fiber assembly (GO:0051496)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	calmodulin-dependent protein phosphatase activity (GO:0033192)|metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(2)|upper_aerodigestive_tract(1)	12	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.155)		CACAGGCAAGCAGCAGGTAGT	0.642																																					p.L356L		Atlas-SNP	.											.	PPM1F	34	.	0			c.G1068A						.						51.0	54.0	53.0					22																	22277762		2203	4300	6503	SO:0001819	synonymous_variant	9647	exon8			GGCAAGCAGCAGG	D13640	CCDS13796.1	22q11.22	2012-04-17	2010-03-05		ENSG00000100034	ENSG00000100034	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	19388	protein-coding gene	gene with protein product	"""partner of PIX 2"", ""Ca(2+)/calmodulin-dependent protein kinase phosphatase"""		"""protein phosphatase 1F (PP2C domain containing)"""			11864573, 11559703	Standard	NM_014634		Approved	FEM-2, KIAA0015, POPX2, CaMKPase, CAMKP	uc002zvp.2	P49593	OTTHUMG00000150835	ENST00000263212.5:c.1068G>A	chr22.hg19:g.22277762C>T		106.0	0.0		139.0	52.0	NM_014634	A8K6G3|B7Z2C3|Q96PM2	Silent	SNP	ENST00000263212.5	hg19	CCDS13796.1																																																																																			.	.		0.642	PPM1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320267.2	NM_014634	
ARSF	416	hgsc.bcm.edu	37	X	3019189	3019189	+	Silent	SNP	A	A	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chrX:3019189A>G	ENST00000381127.1	+	8	1250	c.1029A>G	c.(1027-1029)acA>acG	p.T343T	ARSF_ENST00000537104.1_Silent_p.T343T|ARSF_ENST00000359361.2_Silent_p.T343T	NM_001201538.1|NM_001201539.1	NP_001188467.1|NP_001188468.1	P54793	ARSF_HUMAN	arylsulfatase F	343					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	38		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TCTACTTTACATCAGATCACG	0.413																																					p.T343T		Atlas-SNP	.											.	ARSF	97	.	0			c.A1029G						.						154.0	128.0	137.0					X																	3019189		2203	4299	6502	SO:0001819	synonymous_variant	416	exon8			CTTTACATCAGAT	X97868	CCDS14123.1	Xp22.3	2013-02-14			ENSG00000062096	ENSG00000062096		"""Arylsulfatase family"""	721	protein-coding gene	gene with protein product		300003				7720070	Standard	NM_004042		Approved		uc022brz.1	P54793	OTTHUMG00000021081	ENST00000381127.1:c.1029A>G	chrX.hg19:g.3019189A>G		276.0	0.0		131.0	110.0	NM_004042	Q8TCC5	Silent	SNP	ENST00000381127.1	hg19	CCDS14123.1																																																																																			.	.		0.413	ARSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055652.1		
PTCHD1	139411	hgsc.bcm.edu	37	X	23410846	23410846	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chrX:23410846G>A	ENST00000379361.4	+	3	2071	c.1211G>A	c.(1210-1212)tGc>tAc	p.C404Y		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	404	SSD. {ECO:0000255|PROSITE- ProRule:PRU00199}.				cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						ATTTTCTGCTGCAATTCCTGT	0.463																																					p.C404Y		Atlas-SNP	.											.	PTCHD1	213	.	0			c.G1211A						.						127.0	111.0	116.0					X																	23410846		2203	4300	6503	SO:0001583	missense	139411	exon3			TCTGCTGCAATTC	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1211G>A	chrX.hg19:g.23410846G>A	ENSP00000368666:p.Cys404Tyr	69.0	0.0		45.0	40.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	hg19	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	G	11.01	1.514265	0.27123	.	.	ENSG00000165186	ENST00000379361	D	0.91407	-2.84	5.32	5.32	0.75619	Sterol-sensing domain (1);	0.113194	0.64402	D	0.000005	T	0.81479	0.4831	N	0.14661	0.345	0.38181	D	0.939612	B	0.02656	0.0	B	0.06405	0.002	T	0.77487	-0.2569	10	0.26408	T	0.33	-19.1593	11.8355	0.52321	0.0829:0.0:0.9171:0.0	.	404	Q96NR3	PTHD1_HUMAN	Y	404	ENSP00000368666:C404Y	ENSP00000368666:C404Y	C	+	2	0	PTCHD1	23320767	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.313000	0.72844	2.353000	0.79882	0.600000	0.82982	TGC	.	.		0.463	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
SAGE1	55511	hgsc.bcm.edu	37	X	134988645	134988645	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chrX:134988645C>G	ENST00000370709.3	+	6	671	c.671C>G	c.(670-672)aCt>aGt	p.T224S	SAGE1_ENST00000537770.1_Intron|SAGE1_ENST00000535938.1_Missense_Mutation_p.T224S|SAGE1_ENST00000324447.3_Missense_Mutation_p.T224S			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	224						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					GTGTTGTTGACTCTTCGACCA	0.428																																					p.T224S		Atlas-SNP	.											.	SAGE1	160	.	0			c.C671G						.						206.0	170.0	182.0					X																	134988645		2203	4300	6503	SO:0001583	missense	55511	exon7			TGTTGACTCTTCG	AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.671C>G	chrX.hg19:g.134988645C>G	ENSP00000359743:p.Thr224Ser	134.0	0.0		96.0	89.0	NM_018666	Q5JNW0	Missense_Mutation	SNP	ENST00000370709.3	hg19	CCDS14652.1	.	.	.	.	.	.	.	.	.	.	C	5.227	0.227336	0.09916	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000370709	T;T;T	0.38560	1.13;1.13;1.13	1.22	1.22	0.21188	.	0.178696	0.37715	U	0.001962	T	0.22322	0.0538	N	0.17082	0.46	0.09310	N	0.999997	P	0.39022	0.655	B	0.38264	0.269	T	0.08391	-1.0724	10	0.44086	T	0.13	.	5.406	0.16323	0.0:1.0:0.0:0.0	.	224	Q9NXZ1	SAGE1_HUMAN	S	224	ENSP00000323191:T224S;ENSP00000445959:T224S;ENSP00000359743:T224S	ENSP00000323191:T224S	T	+	2	0	SAGE1	134816311	0.301000	0.24444	0.039000	0.18376	0.030000	0.12068	0.507000	0.22675	0.891000	0.36235	0.292000	0.19580	ACT	.	.		0.428	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058448.1	NM_018666	
TBL1Y	90665	hgsc.bcm.edu	37	Y	6939610	6939610	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chrY:6939610A>C	ENST00000383032.1	+	11	1389	c.742A>C	c.(742-744)Aca>Cca	p.T248P	TBL1Y_ENST00000355162.2_Missense_Mutation_p.T248P|TBL1Y_ENST00000346432.3_Missense_Mutation_p.T248P	NM_033284.1	NP_150600.1	Q9BQ87	TBL1Y_HUMAN	transducin (beta)-like 1, Y-linked	248					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				kidney(1)|large_intestine(4)|lung(2)|skin(1)	8						GAGTGATGGAACACTATTGGC	0.488																																					p.T248P		Atlas-SNP	.											.	TBL1Y	15	.	0			c.A742C						.						84.0	73.0	75.0					Y																	6939610		598	1951	2549	SO:0001583	missense	90665	exon10			GATGGAACACTAT	AF332220	CCDS14779.1	Yp11.2	2013-01-10	2009-12-17		ENSG00000092377	ENSG00000092377		"""WD repeat domain containing"""	18502	protein-coding gene	gene with protein product		400033					Standard	NM_033284		Approved	TBL1	uc004frd.3	Q9BQ87	OTTHUMG00000035299	ENST00000383032.1:c.742A>C	chrY.hg19:g.6939610A>C	ENSP00000372499:p.Thr248Pro	94.0	0.0		38.0	34.0	NM_134258	A1L4B3	Missense_Mutation	SNP	ENST00000383032.1	hg19	CCDS14779.1																																																																																			.	.		0.488	TBL1Y-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085360.1	NM_033284	
MT-CYB	4519	hgsc.bcm.edu	37	M	15380	15380	+	Missense_Mutation	SNP	A	A	C			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chrM:15380A>C	ENST00000361789.2	+	1	634	c.634A>C	c.(634-636)Acc>Ccc	p.T212P	MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-ND6_ENST00000361681.2_5'Flank|MT-TE_ENST00000387459.1_RNA			P00156	CYB_HUMAN	mitochondrially encoded cytochrome b	212					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, ubiquinol to cytochrome c (GO:0006122)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|ubiquinol-cytochrome-c reductase activity (GO:0008121)			breast(6)|endometrium(25)|kidney(33)|prostate(1)	65						CCCTAGGAATCACCTCCCATT	0.448											OREG0007583	type=REGULATORY REGION|TFbs=ESR1|Dataset=Estrogen Receptor Alpha Binding Sites|EvidenceSubtype=Chromatin immunoprecipitation with tag sequencing (ChIP-TS)																									p.T212P		Atlas-SNP	.											.	.	.	.	0			c.A634C						.																																			SO:0001583	missense	0	exon1			GGAATCACCTCCC			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198727	ENSG00000198727		"""Cytochrome b genes"", ""Mitochondrial respiratory chain complex / Complex III"""	7427	protein-coding gene	gene with protein product		516020	"""cytochrome b"""	MTCYB			Standard			Approved	COB, CYTB, UQCR3		P00156		ENST00000361789.2:c.634A>C	chrM.hg19:g.15380A>C	ENSP00000354554:p.Thr212Pro	10.0	0.0	585	26.0	26.0	ENST00000361789	Q34786|Q8HBR6|Q8HNQ0|Q8HNQ1|Q8HNQ9|Q8HNR4|Q8HNR7|Q8W7V8|Q8WCV9|Q8WCY2|Q8WCY7|Q8WCY8|Q9B1A6|Q9B1B6|Q9B1B8|Q9B1D4|Q9B1X6|Q9B2V0|Q9B2V8|Q9B2W0|Q9B2W3|Q9B2W8|Q9B2X1|Q9B2X7|Q9B2X9|Q9B2Y3|Q9B2Z0|Q9B2Z4|Q9T6H6|Q9T9Y0|Q9TEH4	Missense_Mutation	SNP	ENST00000361789.2	hg19																																																																																				.	.		0.448	MT-CYB-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024038	
ANKEF1	63926	hgsc.bcm.edu	37	20	10030419	10030424	+	In_Frame_Del	DEL	ATTTAA	ATTTAA	-			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	ATTTAA	ATTTAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr20:10030419_10030424delATTTAA	ENST00000378380.3	+	6	1531_1536	c.1202_1207delATTTAA	c.(1201-1209)tatttaaac>tac	p.LN402del	ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000603542.1_RNA|SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000378392.1_In_Frame_Del_p.LN402del	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	402							calcium ion binding (GO:0005509)										GGAACCAGATATTTAAACAAGTCTTT	0.413																																					p.401_402del		Atlas-Indel,Pindel	.											.	.	.	.	0			c.1201_1206del						.																																			SO:0001651	inframe_deletion	63926	exon6			.	AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.1202_1207delATTTAA	chr20.hg19:g.10030419_10030424delATTTAA	ENSP00000367631:p.Leu402_Asn403del	126.0	0.0		81.0	27.0	NM_198798	B3KUQ0|Q9H6Y9	In_Frame_Del	DEL	ENST00000378380.3	hg19	CCDS13108.1																																																																																			.	.		0.413	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
IFNA14	3448	hgsc.bcm.edu	37	9	21239412	21239412	+	Frame_Shift_Del	DEL	G	G	-	rs702212	byFrequency	TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr9:21239412delG	ENST00000380222.2	-	1	566	c.523delC	c.(523-525)ctcfs	p.L175fs		NM_002172.2	NP_002163.2	P01570	IFN14_HUMAN	interferon, alpha 14	175				L -> F (in Ref. 1; CAA23803). {ECO:0000305}.	adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|cytokine receptor binding (GO:0005126)|type I interferon receptor binding (GO:0005132)	p.L175I(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(7)	11				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		GAAAAAGAGAGGGATCTCATG	0.388																																					p.L175fs		Atlas-Indel,Pindel	.											.	IFNA14	29	.	1	Substitution - Missense(1)	lung(1)	c.524delT						.						267.0	267.0	267.0					9																	21239412		2203	4300	6503	SO:0001589	frameshift_variant	3448	exon1			.		CCDS6501.1	9p22	2010-08-24			ENSG00000228083	ENSG00000228083		"""Interferons"""	5420	protein-coding gene	gene with protein product		147579				1385305	Standard	NM_002172		Approved	LEIF2H, IFN-alphaH	uc010mis.3	P01570	OTTHUMG00000019665	ENST00000380222.2:c.523delC	chr9.hg19:g.21239412delG	ENSP00000369571:p.Leu175fs	159.0	0.0		128.0	45.0	NM_002172	Q5VZ56|Q7M4S1	Frame_Shift_Del	DEL	ENST00000380222.2	hg19	CCDS6501.1																																																																																			.	.		0.388	IFNA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051894.1	NM_002172	
LRIG3	121227	hgsc.bcm.edu	37	12	59284530	59284539	+	Frame_Shift_Del	DEL	AAACTCTTTC	AAACTCTTTC	-	rs144966301		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	AAACTCTTTC	AAACTCTTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr12:59284530_59284539delAAACTCTTTC	ENST00000320743.3	-	4	709_718	c.423_432delGAAAGAGTTT	c.(421-432)ctgaaagagtttfs	p.LKEF141fs	LRIG3_ENST00000379141.4_Frame_Shift_Del_p.LKEF81fs	NM_153377.4	NP_700356.2	Q6UXM1	LRIG3_HUMAN	leucine-rich repeats and immunoglobulin-like domains 3	141					otolith morphogenesis (GO:0032474)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)			LRIG3/ROS1(2)	breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(12)|liver(1)|lung(14)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48			GBM - Glioblastoma multiforme(1;1.17e-18)			CAAGGGACTGAAACTCTTTCAGATGTTCAG	0.381			T	ROS1	NSCLC																																p.142_145del		Atlas-Indel,Pindel	.		Dom	yes		12	12q14.1	121227	leucine-rich repeats and immunoglobulin-like domains 3		E	.	LRIG3	120	.	0			c.424_433del						.																																			SO:0001589	frameshift_variant	121227	exon4			.	AY505340	CCDS8960.1, CCDS44933.1	12q13.2	2013-01-11				ENSG00000139263		"""Immunoglobulin superfamily / I-set domain containing"""	30991	protein-coding gene	gene with protein product		608870					Standard	NM_153377		Approved	FLJ90440, KIAA3016	uc001sqr.4	Q6UXM1	OTTHUMG00000169940	ENST00000320743.3:c.423_432delGAAAGAGTTT	chr12.hg19:g.59284530_59284539delAAACTCTTTC	ENSP00000326759:p.Leu141fs	86.0	0.0		49.0	12.0	NM_153377	Q6UXL7|Q8NC72	Frame_Shift_Del	DEL	ENST00000320743.3	hg19	CCDS8960.1																																																																																			.	.		0.381	LRIG3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406623.1	NM_153377	
ZNF507	22847	hgsc.bcm.edu	37	19	32845521	32845524	+	Frame_Shift_Del	DEL	AGAA	AGAA	-	rs367792223		TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	AGAA	AGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr19:32845521_32845524delAGAA	ENST00000311921.4	+	2	1977_1980	c.1785_1788delAGAA	c.(1783-1788)agagaafs	p.RE595fs	ZNF507_ENST00000355898.5_Frame_Shift_Del_p.RE595fs|ZNF507_ENST00000544431.1_Frame_Shift_Del_p.RE595fs	NM_001136156.1|NM_014910.4	NP_001129628.1|NP_055725.2	Q8TCN5	ZN507_HUMAN	zinc finger protein 507	595					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	31	Esophageal squamous(110;0.162)					AAAAATTGAGAGAAAGGACAGACC	0.485																																					p.595_596del		Atlas-Indel,Pindel	.											.	ZNF507	92	.	0			c.1784_1787del						.																																			SO:0001589	frameshift_variant	22847	exon3			.	AB029007	CCDS32985.1	19q13.12	2008-02-05				ENSG00000168813		"""Zinc fingers, C2H2-type"""	23783	protein-coding gene	gene with protein product							Standard	NM_014910		Approved	KIAA1084	uc002ntd.3	Q8TCN5		ENST00000311921.4:c.1785_1788delAGAA	chr19.hg19:g.32845521_32845524delAGAA	ENSP00000312277:p.Arg595fs	116.0	0.0		72.0	37.0	NM_001136156	A8K911|Q2TBF1|Q6MZU0|Q9UPR8	Frame_Shift_Del	DEL	ENST00000311921.4	hg19	CCDS32985.1																																																																																			.	.		0.485	ZNF507-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450301.3	NM_014910	
TUBB	203068	hgsc.bcm.edu	37	6	30691141	30691162	+	Frame_Shift_Del	DEL	GGGCCAAAGGCCACTACACAGA	GGGCCAAAGGCCACTACACAGA	-			TCGA-CC-A7IL-01A-11D-A33Q-10	TCGA-CC-A7IL-10A-01D-A33Q-10	GGGCCAAAGGCCACTACACAGA	GGGCCAAAGGCCACTACACAGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	5e30b274-44cd-410b-a15b-08a2080a3ba4	f75b1d6b-8497-4452-b100-4b5bda7ff6e7	g.chr6:30691141_30691162delGGGCCAAAGGCCACTACACAGA	ENST00000327892.8	+	4	608_629	c.302_323delGGGCCAAAGGCCACTACACAGA	c.(301-324)tgggccaaaggccactacacagagfs	p.WAKGHYTE101fs	TUBB_ENST00000396384.1_Frame_Shift_Del_p.WAKGHYTE29fs|TUBB_ENST00000396389.1_Frame_Shift_Del_p.WAKGHYTE83fs|TUBB_ENST00000435534.1_Frame_Shift_Del_p.WAKGHYTE101fs|XXbac-BPG252P9.9_ENST00000607476.1_RNA|TUBB_ENST00000330914.3_Frame_Shift_Del_p.WAKGHYTE29fs	NM_178014.2	NP_821133.1	P07437	TBB5_HUMAN	tubulin, beta class I	101					cell division (GO:0051301)|cellular component movement (GO:0006928)|cellular process (GO:0009987)|cytoskeleton-dependent intracellular transport (GO:0030705)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|natural killer cell mediated cytotoxicity (GO:0042267)|protein polymerization (GO:0051258)|spindle assembly (GO:0051225)	cell body (GO:0044297)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nuclear envelope lumen (GO:0005641)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|MHC class I protein binding (GO:0042288)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(1)|endometrium(1)|kidney(8)|large_intestine(3)|lung(1)|ovary(1)|urinary_tract(1)	16					Colchicine(DB01394)|Podofilox(DB01179)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)	GGTAACAACTGGGCCAAAGGCCACTACACAGAGGGCGCCGAG	0.536																																					p.101_108del		Atlas-Indel,Pindel	.											.	TUBB	30	.	0			c.301_322del						.																																			SO:0001589	frameshift_variant	203068	exon4			.	AB062393	CCDS4687.1	6p21.33	2011-10-10	2011-10-10		ENSG00000196230	ENSG00000196230		"""Tubulins"""	20778	protein-coding gene	gene with protein product	"""class I beta-tubulin"", ""beta1-tubulin"""	191130	"""tubulin, beta polypeptide"", ""tubulin, beta"""			11504633, 8270253	Standard	NM_001293212		Approved	OK/SW-cl.56, MGC16435, M40, Tubb5	uc003nrl.3	P07437	OTTHUMG00000031059	ENST00000327892.8:c.302_323delGGGCCAAAGGCCACTACACAGA	chr6.hg19:g.30691141_30691162delGGGCCAAAGGCCACTACACAGA	ENSP00000339001:p.Trp101fs	191.0	0.0		293.0	38.0	NM_178014	P05218|Q8WUC1|Q9CY33	Frame_Shift_Del	DEL	ENST00000327892.8	hg19	CCDS4687.1																																																																																			.	.		0.536	TUBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076074.2	NM_178014	
