#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
UBR4	23352	hgsc.bcm.edu	37	1	19455517	19455517	+	Silent	SNP	A	A	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:19455517A>C	ENST00000375254.3	-	61	8985	c.8958T>G	c.(8956-8958)ccT>ccG	p.P2986P	UBR4_ENST00000375217.2_Silent_p.P2979P|UBR4_ENST00000375226.2_Silent_p.P2962P|UBR4_ENST00000375267.2_Silent_p.P2986P	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2986					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTCGTAATTGAGGCAGGGTCT	0.498																																					p.P2986P		Atlas-SNP	.											.	UBR4	415	.	0			c.T8958G						.						146.0	121.0	129.0					1																	19455517		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon61			TAATTGAGGCAGG	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8958T>G	chr1.hg19:g.19455517A>C		170.0	0.0		129.0	38.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	hg19	CCDS189.1																																																																																			.	.		0.498	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
TCEB3	6924	hgsc.bcm.edu	37	1	24080866	24080866	+	Silent	SNP	G	G	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:24080866G>A	ENST00000418390.2	+	7	2056	c.1785G>A	c.(1783-1785)gtG>gtA	p.V595V	TCEB3_ENST00000609199.1_Silent_p.V569V	NM_003198.2	NP_003189.2	Q14241	ELOA1_HUMAN	transcription elongation factor B (SIII), polypeptide 3 (110kDa, elongin A)	595	Activation domain. {ECO:0000250}.|F-box. {ECO:0000255|PROSITE- ProRule:PRU00080}.				gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;0.000112)|all_lung(284;0.00016)|Renal(390;0.000219)|Breast(348;0.0044)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;2.42e-24)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;4.74e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|KIRC - Kidney renal clear cell carcinoma(1967;0.00334)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		TCTTTGAAGTGGGAGGAGTCC	0.463																																					p.V595V		Atlas-SNP	.											.	TCEB3	61	.	0			c.G1785A						.						167.0	151.0	156.0					1																	24080866		2203	4300	6503	SO:0001819	synonymous_variant	6924	exon7			TGAAGTGGGAGGA	L47345	CCDS239.2	1p36.1	2010-06-22	2002-08-29		ENSG00000011007	ENSG00000011007			11620	protein-coding gene	gene with protein product		600786	"""transcription elongation factor B (SIII), polypeptide 3 (110kD, elongin A)"""			8586449, 7660129	Standard	NM_003198		Approved	SIII, TCEB3A	uc001bho.3	Q14241	OTTHUMG00000002957	ENST00000418390.2:c.1785G>A	chr1.hg19:g.24080866G>A		98.0	0.0		105.0	34.0	NM_003198	B2R7Q8|Q8IXH1	Silent	SNP	ENST00000418390.2	hg19	CCDS239.2																																																																																			.	.		0.463	TCEB3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000008230.2	NM_003198	
FUCA1	2517	hgsc.bcm.edu	37	1	24181042	24181042	+	Silent	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:24181042C>A	ENST00000374479.3	-	5	784	c.777G>T	c.(775-777)gtG>gtT	p.V259V		NM_000147.4	NP_000138.2	P04066	FUCO_HUMAN	fucosidase, alpha-L- 1, tissue	259					fucose metabolic process (GO:0006004)|glycosaminoglycan catabolic process (GO:0006027)|glycoside catabolic process (GO:0016139)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			breast(1)|endometrium(1)|large_intestine(3)|lung(3)	8		Colorectal(325;3.46e-05)|Renal(390;0.000219)|Lung NSC(340;0.000233)|all_lung(284;0.000321)|Ovarian(437;0.00348)|Breast(348;0.00957)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-24)|Colorectal(126;5.69e-08)|COAD - Colon adenocarcinoma(152;3.15e-06)|GBM - Glioblastoma multiforme(114;9.04e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000986)|KIRC - Kidney renal clear cell carcinoma(1967;0.00342)|STAD - Stomach adenocarcinoma(196;0.0128)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.144)		CATTTACTACCACCTCATCCT	0.413																																					p.V259V		Atlas-SNP	.											.	FUCA1	24	.	0			c.G777T						.						92.0	91.0	91.0					1																	24181042		2203	4300	6503	SO:0001819	synonymous_variant	2517	exon5			TACTACCACCTCA	BC017338	CCDS244.2	1p34	2012-10-02			ENSG00000179163	ENSG00000179163	3.2.1.51		4006	protein-coding gene	gene with protein product		612280				2803312	Standard	NM_000147		Approved		uc001bie.3	P04066	OTTHUMG00000002965	ENST00000374479.3:c.777G>T	chr1.hg19:g.24181042C>A		105.0	0.0		63.0	33.0	NM_000147	B2RBG3|Q14334|Q14335|Q3LID0|Q8NAC2	Silent	SNP	ENST00000374479.3	hg19	CCDS244.2																																																																																			.	.		0.413	FUCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008259.2	NM_000147	
LEPRE1	64175	hgsc.bcm.edu	37	1	43212987	43212987	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:43212987C>T	ENST00000296388.5	-	14	2062	c.2011G>A	c.(2011-2013)Gcc>Acc	p.A671T	LEPRE1_ENST00000236040.4_Missense_Mutation_p.A671T|LEPRE1_ENST00000397054.3_Missense_Mutation_p.A671T|LEPRE1_ENST00000462474.1_5'UTR			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	671	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	AGGGCGATGGCACAGCGCTGC	0.622											OREG0013422	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A671T		Atlas-SNP	.											.	LEPRE1	130	.	0			c.G2011A						.						58.0	59.0	59.0					1																	43212987		2203	4300	6503	SO:0001583	missense	64175	exon14			CGATGGCACAGCG	AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.2011G>A	chr1.hg19:g.43212987C>T	ENSP00000296388:p.Ala671Thr	84.0	0.0	914	72.0	32.0	NM_001146289	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	ENST00000296388.5	hg19	CCDS472.2	.	.	.	.	.	.	.	.	.	.	C	35	5.522291	0.96431	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.62105	0.05;0.05;0.05	5.36	5.36	0.76844	Oxoglutarate/iron-dependent oxygenase (2);Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.77916	0.4202	M	0.66560	2.04	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.79614	-0.1730	10	0.66056	D	0.02	-25.9617	16.6203	0.84928	0.0:1.0:0.0:0.0	.	671;536;671	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	T	671;671;671;536	ENSP00000380245:A671T;ENSP00000236040:A671T;ENSP00000296388:A671T	ENSP00000236040:A671T	A	-	1	0	LEPRE1	42985574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.466000	0.80914	2.523000	0.85059	0.655000	0.94253	GCC	.	.		0.622	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000019790.2	NM_022356	
CD101	9398	hgsc.bcm.edu	37	1	117559864	117559864	+	Missense_Mutation	SNP	G	G	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:117559864G>C	ENST00000256652.4	+	5	1439	c.1381G>C	c.(1381-1383)Gct>Cct	p.A461P	CD101_ENST00000369470.1_Missense_Mutation_p.A461P	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	461	Ig-like C2-type 4.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						CGAGTTTGTGGCTGGCATGGG	0.582																																					p.A461P		Atlas-SNP	.											.	CD101	95	.	0			c.G1381C						.						78.0	70.0	73.0					1																	117559864		2203	4300	6503	SO:0001583	missense	9398	exon5			TTTGTGGCTGGCA	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.1381G>C	chr1.hg19:g.117559864G>C	ENSP00000256652:p.Ala461Pro	142.0	0.0		119.0	8.0	NM_001256109	Q15856	Missense_Mutation	SNP	ENST00000256652.4	hg19	CCDS891.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082095	0.76528	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.23950	1.88;1.88	4.72	4.72	0.59763	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.098836	0.44285	D	0.000474	T	0.40040	0.1101	M	0.72118	2.19	0.45076	D	0.998096	D	0.89917	1.0	D	0.74023	0.982	T	0.17930	-1.0353	10	0.54805	T	0.06	-19.4866	13.3731	0.60723	0.0:0.0:1.0:0.0	.	461	Q93033	IGSF2_HUMAN	P	461	ENSP00000256652:A461P;ENSP00000358482:A461P	ENSP00000256652:A461P	A	+	1	0	CD101	117361387	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.420000	0.44679	2.594000	0.87642	0.655000	0.94253	GCT	.	.		0.582	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
PAQR6	79957	hgsc.bcm.edu	37	1	156214169	156214169	+	Silent	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:156214169G>T	ENST00000292291.5	-	8	944	c.786C>A	c.(784-786)atC>atA	p.I262I	PAQR6_ENST00000368270.1_Silent_p.I238I|PAQR6_ENST00000492619.1_5'UTR|PAQR6_ENST00000335852.1_Missense_Mutation_p.S180Y|PAQR6_ENST00000540423.1_Silent_p.I259I|PAQR6_ENST00000356983.2_Missense_Mutation_p.S180Y	NM_001272104.1|NM_001272105.1|NM_198406.2	NP_001259033.1|NP_001259034.1|NP_940798.1	Q6TCH4	PAQR6_HUMAN	progestin and adipoQ receptor family member VI	262						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			lung(4)|ovary(1)	5	Hepatocellular(266;0.158)					GCACTGCACAGATGTGGAATA	0.622																																					p.S180Y	GBM(16;219 398 12385 32425 38531)	Atlas-SNP	.											.	PAQR6	23	.	0			c.C539A						.						8.0	8.0	8.0					1																	156214169		2177	4277	6454	SO:0001819	synonymous_variant	79957	exon7			TGCACAGATGTGG	AF455045	CCDS1135.1, CCDS1136.1, CCDS60301.1, CCDS72945.1, CCDS72946.1	1q23	2008-02-05			ENSG00000160781	ENSG00000160781			30132	protein-coding gene	gene with protein product		614579				12477932	Standard	NM_024897		Approved	FLJ22672	uc010phh.2	Q6TCH4	OTTHUMG00000017490	ENST00000292291.5:c.786C>A	chr1.hg19:g.156214169G>T		32.0	0.0		47.0	13.0	NM_024897	B7Z9R9|D3DVB4|D3DVB6|Q5TCK9|Q6PDU0|Q7Z4Q7|Q7Z4Q9|Q8N121|Q8N3M2|Q9H621	Missense_Mutation	SNP	ENST00000292291.5	hg19	CCDS1136.1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768777	0.49680	.	.	ENSG00000160781	ENST00000360733;ENST00000335852;ENST00000356983	T;T;T	0.38722	1.12;1.12;1.12	4.71	3.78	0.43462	.	.	.	.	.	T	0.35480	0.0933	.	.	.	0.80722	D	1	D;D;P	0.64830	0.994;0.994;0.617	P;P;B	0.51895	0.683;0.683;0.403	T	0.14117	-1.0484	8	0.39692	T	0.17	-7.3744	11.8718	0.52525	0.0:0.0:0.8239:0.1761	.	112;40;180	B4DJ42;Q7Z4Q8;Q6TCH4-2	.;.;.	Y	180	ENSP00000353961:S180Y;ENSP00000338330:S180Y;ENSP00000349474:S180Y	ENSP00000338330:S180Y	S	-	2	0	PAQR6	154480793	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.472000	0.35376	1.188000	0.43014	0.462000	0.41574	TCT	.	.		0.622	PAQR6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046297.2	NM_024897	
ATP1A2	477	hgsc.bcm.edu	37	1	160100081	160100081	+	Splice_Site	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:160100081G>T	ENST00000361216.3	+	12	1740	c.1651G>T	c.(1651-1653)Gga>Tga	p.G551*	ATP1A2_ENST00000392233.3_Splice_Site_p.G551*	NM_000702.3	NP_000693.1	P50993	AT1A2_HUMAN	ATPase, Na+/K+ transporting, alpha 2 polypeptide	551					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|cardiac muscle contraction (GO:0060048)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|locomotion (GO:0040011)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of heart contraction (GO:0045822)|negative regulation of striated muscle contraction (GO:0045988)|neurotransmitter uptake (GO:0001504)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of smooth muscle contraction (GO:0006940)|regulation of striated muscle contraction (GO:0006942)|regulation of the force of heart contraction (GO:0002026)|regulation of vasoconstriction (GO:0019229)|relaxation of cardiac muscle (GO:0055119)|response to nicotine (GO:0035094)|sodium ion export from cell (GO:0036376)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	caveola (GO:0005901)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|endosome (GO:0005768)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|T-tubule (GO:0030315)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(30)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	69	all_cancers(52;1.11e-16)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)|LUSC - Lung squamous cell carcinoma(543;0.246)			GCGTGTGCTGGGTGAGAGGCC	0.622																																					p.G551X		Atlas-SNP	.											.	ATP1A2	167	.	0			c.G1651T						.						46.0	48.0	47.0					1																	160100081		2203	4300	6503	SO:0001630	splice_region_variant	477	exon12			GTGCTGGGTGAGA	AB018321	CCDS1196.1	1q23.2	2014-09-17	2010-04-20		ENSG00000018625	ENSG00000018625	3.6.3.9	"""ATPases / P-type"""	800	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-2"", ""sodium pump subunit alpha-2"", ""sodium-potassium ATPase catalytic subunit alpha-2"""	182340	"""migraine, hemiplegic 2"", ""ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide"""	MHP2		9403481	Standard	NM_000702		Approved	FHM2	uc001fvc.3	P50993	OTTHUMG00000024080	ENST00000361216.3:c.1651+1G>T	chr1.hg19:g.160100081G>T		79.0	0.0		87.0	22.0	NM_000702	D3DVE4|Q07059|Q5JW74|Q86UZ5|Q9UQ25	Nonsense_Mutation	SNP	ENST00000361216.3	hg19	CCDS1196.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.075725|8.075725	0.98640|0.98640	.|.	.|.	ENSG00000018625|ENSG00000018625	ENST00000361216;ENST00000392233;ENST00000435866|ENST00000447527	.|.	.|.	.|.	4.61|4.61	4.61|4.61	0.57282|0.57282	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.64316	.|0.2587	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.65125	.|-0.6244	.|3	0.87932|.	D|.	0|.	.|.	16.564|16.564	0.84574|0.84574	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|C	551;551;254|261	.|.	ENSP00000354490:G551X|.	G|W	+|+	1|3	0|0	ATP1A2|ATP1A2	158366705|158366705	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.963000|0.963000	0.63663|0.63663	9.614000|9.614000	0.98353|0.98353	2.283000|2.283000	0.76528|0.76528	0.511000|0.511000	0.50034|0.50034	GGA|TGG	.	.		0.622	ATP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060642.2	NM_000702	Nonsense_Mutation
DUSP27	92235	hgsc.bcm.edu	37	1	167096907	167096907	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:167096907C>T	ENST00000361200.2	+	6	2705	c.2539C>T	c.(2539-2541)Ctt>Ttt	p.L847F	DUSP27_ENST00000485151.1_Intron|DUSP27_ENST00000271385.5_Missense_Mutation_p.L847F|DUSP27_ENST00000443333.1_Missense_Mutation_p.L847F			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	847					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						GCAGATGGAGCTTAGGGAGAA	0.493																																					p.L847F		Atlas-SNP	.											.	DUSP27	235	.	0			c.C2539T						.						71.0	65.0	67.0					1																	167096907		2203	4300	6503	SO:0001583	missense	92235	exon5			ATGGAGCTTAGGG	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2539C>T	chr1.hg19:g.167096907C>T	ENSP00000354483:p.Leu847Phe	157.0	0.0		150.0	14.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	C	9.713	1.157582	0.21454	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.04502	3.61;3.61;3.61	5.47	1.42	0.22433	.	0.084937	0.40302	N	0.001137	T	0.02455	0.0075	M	0.63428	1.95	0.36705	D	0.880344	P	0.50272	0.933	B	0.42386	0.386	T	0.46596	-0.9180	10	0.87932	D	0	-16.9947	5.0654	0.14580	0.3598:0.4207:0.0:0.2194	.	847	Q5VZP5	DUS27_HUMAN	F	847	ENSP00000354483:L847F;ENSP00000271385:L847F;ENSP00000404874:L847F	ENSP00000271385:L847F	L	+	1	0	DUSP27	165363531	0.916000	0.31088	0.910000	0.35882	0.126000	0.20510	1.871000	0.39539	0.258000	0.21686	-0.332000	0.08345	CTT	.	.		0.493	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
PAPPA2	60676	hgsc.bcm.edu	37	1	176759102	176759102	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:176759102G>A	ENST00000367662.3	+	18	6037	c.4873G>A	c.(4873-4875)Gaa>Aaa	p.E1625K		NM_020318.2	NP_064714.2	Q9BXP8	PAPP2_HUMAN	pappalysin 2	1625	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(7)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(19)|lung(136)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|upper_aerodigestive_tract(8)|urinary_tract(1)	226						CTGTAACCAGGAACGTGAAAA	0.428																																					p.E1625K		Atlas-SNP	.											.	PAPPA2	665	.	0			c.G4873A						.						162.0	154.0	156.0					1																	176759102		1938	4138	6076	SO:0001583	missense	60676	exon18			AACCAGGAACGTG	BG354569	CCDS41438.1, CCDS41439.1	1q23-q25	2008-05-23	2004-07-07	2004-07-09	ENSG00000116183	ENSG00000116183			14615	protein-coding gene	gene with protein product			"""placenta-specific 3"""	PLAC3		11018262, 11264294	Standard	NM_021936		Approved	PAPPE, PAPP-A2	uc001gkz.3	Q9BXP8	OTTHUMG00000035025	ENST00000367662.3:c.4873G>A	chr1.hg19:g.176759102G>A	ENSP00000356634:p.Glu1625Lys	115.0	0.0		111.0	31.0	NM_020318	A9Z1Y8|Q96PH7|Q96PH8|Q9H4C9	Missense_Mutation	SNP	ENST00000367662.3	hg19	CCDS41438.1	.	.	.	.	.	.	.	.	.	.	G	7.706	0.694129	0.15039	.	.	ENSG00000116183	ENST00000367662	T	0.01548	4.78	5.64	4.68	0.58851	Complement control module (1);Sushi/SCR/CCP (2);	0.481828	0.20204	N	0.097028	T	0.01940	0.0061	L	0.34521	1.04	0.80722	D	1	B	0.25955	0.138	B	0.25987	0.065	T	0.61143	-0.7122	10	0.20519	T	0.43	-20.1431	12.1547	0.54070	0.0:0.2626:0.7374:0.0	.	1625	Q9BXP8	PAPP2_HUMAN	K	1625	ENSP00000356634:E1625K	ENSP00000356634:E1625K	E	+	1	0	PAPPA2	175025725	0.711000	0.27906	1.000000	0.80357	0.766000	0.43426	1.711000	0.37930	2.651000	0.90000	0.650000	0.86243	GAA	.	.		0.428	PAPPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084763.1		
TDRD5	163589	hgsc.bcm.edu	37	1	179564900	179564900	+	Nonsense_Mutation	SNP	A	A	T	rs183977806		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:179564900A>T	ENST00000367614.1	+	4	1137	c.778A>T	c.(778-780)Aag>Tag	p.K260*	TDRD5_ENST00000294848.8_Nonsense_Mutation_p.K260*|TDRD5_ENST00000444136.1_Nonsense_Mutation_p.K260*	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	260					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						AAAGACTTCCAAGTTAAATGT	0.373																																					p.K260X		Atlas-SNP	.											.	TDRD5	149	.	0			c.A778T						.						83.0	84.0	84.0					1																	179564900		2203	4300	6503	SO:0001587	stop_gained	163589	exon4			ACTTCCAAGTTAA	AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.778A>T	chr1.hg19:g.179564900A>T	ENSP00000356586:p.Lys260*	318.0	0.0		353.0	107.0	NM_173533	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Nonsense_Mutation	SNP	ENST00000367614.1	hg19	CCDS1332.1	.	.	.	.	.	.	.	.	.	.	A	40	7.969106	0.98588	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136	.	.	.	5.48	3.15	0.36227	.	0.938732	0.08883	N	0.879808	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	13.2353	4.8045	0.13314	0.7141:0.0:0.2859:0.0	.	.	.	.	X	260	.	ENSP00000294848:K260X	K	+	1	0	TDRD5	177831523	0.017000	0.18338	0.003000	0.11579	0.905000	0.53344	2.520000	0.45554	0.925000	0.37094	0.477000	0.44152	AAG	.	A|1.000;G|0.000		0.373	TDRD5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000085295.1	NM_173533	
FAM129A	116496	hgsc.bcm.edu	37	1	184764697	184764697	+	Missense_Mutation	SNP	G	G	T	rs201876014		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:184764697G>T	ENST00000367511.3	-	14	2394	c.2201C>A	c.(2200-2202)aCg>aAg	p.T734K	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	734	Glu-rich.				negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CTCCCCATTCGTATCTTCTTC	0.522																																					p.T734K		Atlas-SNP	.											.	FAM129A	98	.	0			c.C2201A						.						115.0	120.0	118.0					1																	184764697		2203	4300	6503	SO:0001583	missense	116496	exon14			CCATTCGTATCTT	AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2201C>A	chr1.hg19:g.184764697G>T	ENSP00000356481:p.Thr734Lys	60.0	0.0		80.0	51.0	NM_052966	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	ENST00000367511.3	hg19	CCDS1364.1	.	.	.	.	.	.	.	.	.	.	g	16.75	3.209232	0.58343	.	.	ENSG00000135842	ENST00000367511	T	0.10668	2.85	5.44	1.31	0.21738	.	1.607640	0.03629	N	0.237594	T	0.08088	0.0202	L	0.32530	0.975	0.09310	N	1	B	0.16802	0.019	B	0.18561	0.022	T	0.34825	-0.9813	10	0.07030	T	0.85	-0.4004	4.771	0.13155	0.3444:0.0:0.5138:0.1417	.	734	Q9BZQ8	NIBAN_HUMAN	K	734	ENSP00000356481:T734K	ENSP00000356481:T734K	T	-	2	0	FAM129A	183031320	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-1.236000	0.02925	0.247000	0.21414	-0.320000	0.08662	ACG	.	G|1.000;A|0.000		0.522	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085786.1		
C1orf106	55765	hgsc.bcm.edu	37	1	200877890	200877890	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:200877890T>G	ENST00000367342.4	+	7	1062	c.862T>G	c.(862-864)Tct>Gct	p.S288A	C1orf106_ENST00000413687.2_Missense_Mutation_p.S203A	NM_018265.3	NP_060735.3	Q3KP66	CA106_HUMAN	chromosome 1 open reading frame 106	288	Pro-rich.									endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(2)	21						TCCTCCAGAGTCTCCAGCCCC	0.597																																					p.S302A		Atlas-SNP	.											.	C1orf106	59	.	0			c.T904G						.						84.0	99.0	94.0					1																	200877890		2203	4300	6503	SO:0001583	missense	55765	exon7			CCAGAGTCTCCAG	AK001763	CCDS44292.1	1q32.1	2011-02-15			ENSG00000163362	ENSG00000163362			25599	protein-coding gene	gene with protein product						14702039	Standard	NM_018265		Approved	FLJ10901	uc001gvo.4	Q3KP66	OTTHUMG00000035789	ENST00000367342.4:c.862T>G	chr1.hg19:g.200877890T>G	ENSP00000356311:p.Ser288Ala	284.0	0.0		365.0	45.0	NM_018265	B4E1K9|E9PFY0|Q9NV65|Q9NVI0	Missense_Mutation	SNP	ENST00000367342.4	hg19		.	.	.	.	.	.	.	.	.	.	T	15.37	2.814824	0.50527	.	.	ENSG00000163362	ENST00000367342;ENST00000413687	T;T	0.51325	0.71;0.77	4.88	1.02	0.19986	.	0.145914	0.47093	N	0.000254	T	0.36331	0.0963	M	0.62723	1.935	0.24058	N	0.996026	B	0.09022	0.002	B	0.08055	0.003	T	0.22417	-1.0217	10	0.22706	T	0.39	-11.4219	4.4203	0.11477	0.0:0.1799:0.3267:0.4934	.	288	Q3KP66	CA106_HUMAN	A	288;203	ENSP00000356311:S288A;ENSP00000392105:S203A	ENSP00000356311:S288A	S	+	1	0	C1orf106	199144513	0.984000	0.35163	0.938000	0.37757	0.806000	0.45545	0.277000	0.18734	-0.080000	0.12685	0.455000	0.32223	TCT	.	.		0.597	C1orf106-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000087057.2	NM_018265	
CR2	1380	hgsc.bcm.edu	37	1	207649761	207649761	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:207649761A>G	ENST00000367058.3	+	14	2911	c.2722A>G	c.(2722-2724)Aaa>Gaa	p.K908E	CR2_ENST00000458541.2_Missense_Mutation_p.K881E|CR2_ENST00000367059.3_Intron|CR2_ENST00000367057.3_Missense_Mutation_p.K967E	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	908	Sushi 14. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CCCTCATTGTAAAGGTGCTTT	0.408																																					p.K967E		Atlas-SNP	.											.	CR2	164	.	0			c.A2899G						.						44.0	42.0	43.0					1																	207649761		2203	4300	6503	SO:0001583	missense	1380	exon15			CATTGTAAAGGTG	M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2722A>G	chr1.hg19:g.207649761A>G	ENSP00000356025:p.Lys908Glu	96.0	0.0		119.0	40.0	NM_001006658	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	ENST00000367058.3	hg19	CCDS1478.1	.	.	.	.	.	.	.	.	.	.	A	16.38	3.106877	0.56291	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000458541	T;T;T	0.47177	0.85;0.85;0.85	4.87	4.87	0.63330	Complement control module (2);Sushi/SCR/CCP (1);	.	.	.	.	T	0.31451	0.0797	L	0.35723	1.085	0.47374	D	0.999408	B;B	0.30727	0.059;0.292	B;B	0.27380	0.06;0.079	T	0.11299	-1.0593	9	0.02654	T	1	.	11.4381	0.50081	1.0:0.0:0.0:0.0	.	908;967	P20023;P20023-3	CR2_HUMAN;.	E	908;967;881	ENSP00000356025:K908E;ENSP00000356024:K967E;ENSP00000404222:K881E	ENSP00000356024:K967E	K	+	1	0	CR2	205716384	0.989000	0.36119	0.997000	0.53966	0.935000	0.57460	0.693000	0.25497	2.135000	0.66039	0.533000	0.62120	AAA	.	.		0.408	CR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000088274.1	NM_001877	
ACTN2	88	hgsc.bcm.edu	37	1	236925852	236925852	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:236925852G>A	ENST00000366578.4	+	21	2784	c.2618G>A	c.(2617-2619)gGc>gAc	p.G873D	ACTN2_ENST00000542672.1_Missense_Mutation_p.G873D|ACTN2_ENST00000546208.1_Missense_Mutation_p.G367D	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	873					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			TCGGGCCCAGGCAGTGTGCCT	0.597																																					p.G873D		Atlas-SNP	.											.	ACTN2	191	.	0			c.G2618A						.						58.0	52.0	54.0					1																	236925852		2203	4300	6503	SO:0001583	missense	88	exon21			GCCCAGGCAGTGT	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.2618G>A	chr1.hg19:g.236925852G>A	ENSP00000355537:p.Gly873Asp	131.0	0.0		174.0	102.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	hg19	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	6.323	0.427669	0.11987	.	.	ENSG00000077522	ENST00000542672;ENST00000366578;ENST00000546208;ENST00000545611	T;T;T	0.39787	1.06;1.06;1.06	5.43	5.43	0.79202	EF-hand, Ca insensitive (1);EF-hand-like domain (1);	0.099100	0.64402	D	0.000002	T	0.21841	0.0526	N	0.02751	-0.505	0.80722	D	1	B;B;B;B	0.18863	0.017;0.004;0.031;0.015	B;B;B;B	0.26969	0.075;0.02;0.075;0.03	T	0.17349	-1.0372	10	0.02654	T	1	.	19.6166	0.95636	0.0:0.0:1.0:0.0	.	658;873;643;873	B7Z4K1;B2RCS5;Q59FD9;P35609	.;.;.;ACTN2_HUMAN	D	873;873;367;642	ENSP00000443495:G873D;ENSP00000355537:G873D;ENSP00000438384:G367D	ENSP00000355537:G873D	G	+	2	0	ACTN2	234992475	0.999000	0.42202	0.951000	0.38953	0.338000	0.28826	2.856000	0.48341	2.721000	0.93114	0.655000	0.94253	GGC	.	.		0.597	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
EXO1	9156	hgsc.bcm.edu	37	1	242052844	242052844	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:242052844A>G	ENST00000366548.3	+	16	3076	c.2483A>G	c.(2482-2484)gAa>gGa	p.E828G	EXO1_ENST00000518483.1_3'UTR|EXO1_ENST00000348581.5_Missense_Mutation_p.E828G	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	828	Interaction with MLH1.|Interaction with MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			CCAGAAGCGGAAGAGGATATA	0.403								Editing and processing nucleases																													p.E828G		Atlas-SNP	.											EXO1,NS,carcinoma,0,1	EXO1	103	.	0			c.A2483G						.						95.0	96.0	96.0					1																	242052844		2203	4300	6503	SO:0001583	missense	9156	exon16			AAGCGGAAGAGGA	AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.2483A>G	chr1.hg19:g.242052844A>G	ENSP00000355506:p.Glu828Gly	148.0	1.0		152.0	47.0	NM_130398	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	ENST00000366548.3	hg19	CCDS1620.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.677379	0.88445	.	.	ENSG00000174371	ENST00000366548;ENST00000348581	T;T	0.76186	-1.0;-1.0	5.53	5.53	0.82687	.	0.057931	0.64402	D	0.000002	D	0.83022	0.5164	M	0.67953	2.075	0.40806	D	0.983384	D;D	0.76494	0.999;0.991	D;P	0.64042	0.921;0.7	D	0.85452	0.1161	10	0.72032	D	0.01	-12.2096	13.1877	0.59691	1.0:0.0:0.0:0.0	.	827;828	A8K5H6;Q9UQ84	.;EXO1_HUMAN	G	828	ENSP00000355506:E828G;ENSP00000311873:E828G	ENSP00000311873:E828G	E	+	2	0	EXO1	240119467	1.000000	0.71417	0.995000	0.50966	0.949000	0.60115	3.768000	0.55295	2.088000	0.63022	0.533000	0.62120	GAA	.	.		0.403	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096405.1	NM_006027	
OR2G6	391211	hgsc.bcm.edu	37	1	248685216	248685216	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr1:248685216A>T	ENST00000343414.4	+	1	301	c.269A>T	c.(268-270)aAa>aTa	p.K90I		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			AAGAAAGACAAAACCATGAGC	0.512																																					p.K90I		Atlas-SNP	.											OR2G6,colon,carcinoma,0,1	OR2G6	124	.	0			c.A269T						.						123.0	117.0	119.0					1																	248685216		2203	4300	6503	SO:0001583	missense	391211	exon1			AAGACAAAACCAT		CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.269A>T	chr1.hg19:g.248685216A>T	ENSP00000341291:p.Lys90Ile	153.0	0.0		167.0	48.0	NM_001013355	B2RP33	Missense_Mutation	SNP	ENST00000343414.4	hg19	CCDS31119.1	.	.	.	.	.	.	.	.	.	.	N	9.806	1.181975	0.21787	.	.	ENSG00000188558	ENST00000343414	T	0.38560	1.13	3.68	3.68	0.42216	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46758	U	0.000268	T	0.69851	0.3157	H	0.97103	3.94	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.64487	-0.6396	10	0.87932	D	0	.	3.8217	0.08837	0.6608:0.2231:0.1161:0.0	.	90	Q5TZ20	OR2G6_HUMAN	I	90	ENSP00000341291:K90I	ENSP00000341291:K90I	K	+	2	0	OR2G6	246751839	0.001000	0.12720	0.007000	0.13788	0.092000	0.18411	0.256000	0.18351	1.523000	0.49018	0.329000	0.21502	AAA	.	.		0.512	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097358.1	XM_372842	
C2orf16	84226	hgsc.bcm.edu	37	2	27804119	27804119	+	Silent	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:27804119C>T	ENST00000408964.2	+	1	4731	c.4680C>T	c.(4678-4680)aaC>aaT	p.N1560N	ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000416005.2_5'Flank|ZNF512_ENST00000556601.1_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000379717.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1560	Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					CCCGTCATAACCCCTCTTGGA	0.532																																					p.N1560N		Atlas-SNP	.											.	C2orf16	357	.	0			c.C4680T						.						118.0	118.0	118.0					2																	27804119		1895	4112	6007	SO:0001819	synonymous_variant	84226	exon1			TCATAACCCCTCT	AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.4680C>T	chr2.hg19:g.27804119C>T		115.0	0.0		81.0	42.0	NM_032266	B9EIQ4|Q53S01|Q8ND64|Q9H088	Silent	SNP	ENST00000408964.2	hg19	CCDS42666.1																																																																																			.	.		0.532	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353292.1	NM_032266	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43937431	43937431	+	Missense_Mutation	SNP	G	G	A	rs183194066		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:43937431G>A	ENST00000282406.4	+	13	2286	c.2176G>A	c.(2176-2178)Gtt>Att	p.V726I		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	726	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GCGGTGGTTTGTTCTTAAAGG	0.353																																					p.V726I		Atlas-SNP	.											.	PLEKHH2	156	.	0			c.G2176A						.						109.0	124.0	119.0					2																	43937431		2203	4299	6502	SO:0001583	missense	130271	exon13			TGGTTTGTTCTTA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2176G>A	chr2.hg19:g.43937431G>A	ENSP00000282406:p.Val726Ile	179.0	0.0		128.0	51.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	hg19	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161086	0.78226	.	.	ENSG00000152527	ENST00000282406	T	0.18810	2.19	5.02	4.14	0.48551	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.065835	0.64402	N	0.000013	T	0.38108	0.1028	L	0.46157	1.445	0.58432	D	0.999998	D;D;D	0.89917	0.972;0.996;1.0	P;D;D	0.85130	0.836;0.987;0.997	T	0.08166	-1.0735	10	0.49607	T	0.09	-12.5885	13.0333	0.58856	0.0778:0.0:0.9222:0.0	.	726;163;726	Q8IVE3;Q8IVE3-2;Q8IVE3-3	PKHH2_HUMAN;.;.	I	726	ENSP00000282406:V726I	ENSP00000282406:V726I	V	+	1	0	PLEKHH2	43790935	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.412000	0.66392	1.098000	0.41479	0.563000	0.77884	GTT	.	.		0.353	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
EML6	400954	hgsc.bcm.edu	37	2	55186295	55186295	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:55186295C>A	ENST00000356458.6	+	33	5270	c.4750C>A	c.(4750-4752)Cac>Aac	p.H1584N	EML6_ENST00000490828.1_3'UTR	NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	1584						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						CTGGAAGGACCACTTCCTCAT	0.522																																					p.H1584N		Atlas-SNP	.											.	EML6	85	.	0			c.C4750A						.						98.0	86.0	90.0					2																	55186295		692	1591	2283	SO:0001583	missense	400954	exon33			AAGGACCACTTCC		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.4750C>A	chr2.hg19:g.55186295C>A	ENSP00000348842:p.His1584Asn	92.0	0.0		63.0	32.0	NM_001039753	A8MUB5|B6ZDG7	Missense_Mutation	SNP	ENST00000356458.6	hg19	CCDS46286.1	.	.	.	.	.	.	.	.	.	.	C	16.82	3.227413	0.58668	.	.	ENSG00000214595	ENST00000356458	T	0.25250	1.81	5.78	5.78	0.91487	WD40 repeat-like-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.13372	0.0324	N	0.02357	-0.585	0.58432	D	0.999995	B	0.17667	0.023	B	0.18871	0.023	T	0.22173	-1.0224	10	0.19147	T	0.46	.	20.0114	0.97452	0.0:1.0:0.0:0.0	.	1584	Q6ZMW3	EMAL6_HUMAN	N	1584	ENSP00000348842:H1584N	ENSP00000348842:H1584N	H	+	1	0	EML6	55039799	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.757000	0.68766	2.724000	0.93272	0.555000	0.69702	CAC	.	.		0.522	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
IWS1	55677	hgsc.bcm.edu	37	2	128255759	128255759	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:128255759C>G	ENST00000295321.4	-	6	1781	c.1522G>C	c.(1522-1524)Gca>Cca	p.A508P	IWS1_ENST00000455721.2_Intron|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	508	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		GAATCTTCTGCTTCTTTTACC	0.313																																					p.A508P		Atlas-SNP	.											.	IWS1	61	.	0			c.G1522C						.						190.0	195.0	193.0					2																	128255759		2202	4299	6501	SO:0001583	missense	55677	exon6			CTTCTGCTTCTTT	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1522G>C	chr2.hg19:g.128255759C>G	ENSP00000295321:p.Ala508Pro	199.0	0.0		126.0	54.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	hg19	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404115	0.62288	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	T	0.17691	2.26	5.69	5.69	0.88448	.	0.115899	0.56097	D	0.000021	T	0.17831	0.0428	L	0.56769	1.78	0.80722	D	1	P	0.45474	0.859	B	0.34038	0.174	T	0.03344	-1.1046	10	0.32370	T	0.25	-19.4506	17.9972	0.89187	0.0:1.0:0.0:0.0	.	508	Q96ST2	IWS1_HUMAN	P	508;461	ENSP00000295321:A508P	ENSP00000295321:A508P	A	-	1	0	IWS1	127972229	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.183000	0.58317	2.685000	0.91497	0.557000	0.71058	GCA	.	.		0.313	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
PER2	8864	hgsc.bcm.edu	37	2	239184411	239184411	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:239184411C>A	ENST00000254657.3	-	4	700	c.421G>T	c.(421-423)Gcc>Tcc	p.A141S	PER2_ENST00000355768.2_Missense_Mutation_p.A141S|PER2_ENST00000440245.1_Missense_Mutation_p.A141S|PER2_ENST00000254658.3_Missense_Mutation_p.A141S	NM_022817.2	NP_073728.1	O15055	PER2_HUMAN	period circadian clock 2	141					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|fatty acid metabolic process (GO:0006631)|gluconeogenesis (GO:0006094)|glycogen biosynthetic process (GO:0005978)|histone H3 deacetylation (GO:0070932)|lactate biosynthetic process (GO:0019249)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of DNA-templated transcription, termination (GO:0060567)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of glutamate uptake involved in transmission of nerve impulse (GO:0051946)|regulation of insulin secretion (GO:0050796)|regulation of neurogenesis (GO:0050767)|regulation of vasoconstriction (GO:0019229)|response to ischemia (GO:0002931)|transcription, DNA-templated (GO:0006351)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	pre-mRNA binding (GO:0036002)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|ubiquitin binding (GO:0043130)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0423)|all_lung(227;0.114)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Lung NSC(271;0.223)|Hepatocellular(293;0.244)		Epithelial(121;6.84e-24)|OV - Ovarian serous cystadenocarcinoma(60;9.73e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;6.77e-05)|Lung(119;0.00941)|LUSC - Lung squamous cell carcinoma(224;0.0161)		CTCCTGAGGGCGTACTTCAAG	0.493																																					p.A141S		Atlas-SNP	.											.	PER2	85	.	0			c.G421T						.						237.0	223.0	228.0					2																	239184411		2203	4300	6503	SO:0001583	missense	8864	exon4			TGAGGGCGTACTT	AB002345	CCDS2528.1	2q37.3	2012-12-13	2012-12-13		ENSG00000132326	ENSG00000132326			8846	protein-coding gene	gene with protein product		603426	"""period (Drosophila) homolog 2"", ""period homolog 2 (Drosophila)"""			9427249, 17218255	Standard	NM_022817		Approved	KIAA0347	uc002vyc.3	O15055	OTTHUMG00000152884	ENST00000254657.3:c.421G>T	chr2.hg19:g.239184411C>A	ENSP00000254657:p.Ala141Ser	129.0	0.0		76.0	38.0	NM_022817	A2I2P7|Q4ZG49|Q6DT41|Q9UQ45	Missense_Mutation	SNP	ENST00000254657.3	hg19	CCDS2528.1	.	.	.	.	.	.	.	.	.	.	C	18.38	3.611819	0.66558	.	.	ENSG00000132326	ENST00000254657;ENST00000254658;ENST00000440245;ENST00000355768	T;T;T;T	0.62639	1.77;0.01;0.84;0.01	4.43	4.43	0.53597	.	0.000000	0.85682	D	0.000000	T	0.81173	0.4767	M	0.87038	2.855	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.999;0.995;1.0;0.999	D	0.85029	0.0916	10	0.72032	D	0.01	-34.1693	14.9485	0.71050	0.0:1.0:0.0:0.0	.	141;141;141;141	F5GYD5;B4DH14;O15055-2;O15055	.;.;.;PER2_HUMAN	S	141	ENSP00000254657:A141S;ENSP00000254658:A141S;ENSP00000397516:A141S;ENSP00000348013:A141S	ENSP00000254657:A141S	A	-	1	0	PER2	238849150	1.000000	0.71417	0.994000	0.49952	0.053000	0.15095	7.534000	0.82004	2.194000	0.70268	0.655000	0.94253	GCC	.	.		0.493	PER2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257167.1	NM_022817	
KY	339855	hgsc.bcm.edu	37	3	134346635	134346635	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr3:134346635G>T	ENST00000423778.2	-	5	424	c.363C>A	c.(361-363)aaC>aaA	p.N121K	KY_ENST00000503669.1_Missense_Mutation_p.N121K|KY_ENST00000508956.1_Missense_Mutation_p.N100K|KY_ENST00000508041.1_5'UTR	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	121					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GGGGTCTTGTGTTTCCATTTT	0.423																																					p.N121K		Atlas-SNP	.											.	KY	92	.	0			c.C363A						.						136.0	133.0	134.0					3																	134346635		1916	4136	6052	SO:0001583	missense	339855	exon5			TCTTGTGTTTCCA	AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.363C>A	chr3.hg19:g.134346635G>T	ENSP00000397598:p.Asn121Lys	125.0	0.0		91.0	32.0	NM_178554	B7Z1S4|Q6ZT15	Missense_Mutation	SNP	ENST00000423778.2	hg19	CCDS46920.1	.	.	.	.	.	.	.	.	.	.	G	13.94	2.386268	0.42308	.	.	ENSG00000174611	ENST00000508956;ENST00000423778;ENST00000503669;ENST00000310263	.	.	.	5.67	4.8	0.61643	.	0.138770	0.49916	D	0.000129	T	0.47563	0.1452	L	0.56769	1.78	0.32062	N	0.595599	B;B;B;B	0.17852	0.002;0.024;0.006;0.023	B;B;B;B	0.12837	0.002;0.005;0.003;0.008	T	0.52946	-0.8507	9	0.23891	T	0.37	-8.4855	12.4582	0.55716	0.078:0.0:0.922:0.0	.	100;121;121;82	Q8NBH2-3;B4DGA7;Q8NBH2-4;Q8NBH2-2	.;.;.;.	K	100;121;121;121	.	ENSP00000309520:N121K	N	-	3	2	KY	135829325	0.992000	0.36948	0.998000	0.56505	0.998000	0.95712	0.829000	0.27449	1.409000	0.46915	0.655000	0.94253	AAC	.	.		0.423	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357320.1	NM_178554	
BCHE	590	hgsc.bcm.edu	37	3	165503966	165503966	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr3:165503966T>C	ENST00000264381.3	-	3	1817	c.1651A>G	c.(1651-1653)Aca>Gca	p.T551A	BCHE_ENST00000540653.1_Missense_Mutation_p.T13A	NM_000055.2	NP_000046.1	P06276	CHLE_HUMAN	butyrylcholinesterase	551					cellular protein metabolic process (GO:0044267)|choline metabolic process (GO:0019695)|cocaine metabolic process (GO:0050783)|learning (GO:0007612)|negative regulation of cell proliferation (GO:0008285)|negative regulation of synaptic transmission (GO:0050805)|neuroblast differentiation (GO:0014016)|response to alkaloid (GO:0043279)|response to drug (GO:0042493)|response to folic acid (GO:0051593)|response to glucocorticoid (GO:0051384)|synaptic transmission, cholinergic (GO:0007271)	blood microparticle (GO:0072562)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)	acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|catalytic activity (GO:0003824)|choline binding (GO:0033265)|cholinesterase activity (GO:0004104)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(34)|ovary(4)|pancreas(2)|stomach(1)	55					Aclidinium(DB08897)|Ambenonium(DB01122)|Bambuterol(DB01408)|Chloroprocaine(DB01161)|Chlorphenesin(DB00856)|Chlorpromazine(DB00477)|Choline(DB00122)|Cinchocaine(DB00527)|Cisplatin(DB00515)|Clevidipine(DB04920)|Cyclopentolate(DB00979)|Decamethonium(DB01245)|Demecarium(DB00944)|Diethylcarbamazine(DB00711)|Dipivefrin(DB00449)|Doxacurium chloride(DB01135)|Drospirenone(DB01395)|Echothiophate(DB01057)|Edrophonium(DB01010)|Ephedrine(DB01364)|Ethopropazine(DB00392)|Galantamine(DB00674)|Hexafluronium(DB00941)|Irinotecan(DB00762)|Isoflurophate(DB00677)|Malathion(DB00772)|Mefloquine(DB00358)|Mirabegron(DB08893)|Mivacurium(DB01226)|Neostigmine(DB01400)|Nizatidine(DB00585)|Oxybuprocaine(DB00892)|Pancuronium(DB01337)|Pegvisomant(DB00082)|Pentagastrin(DB00183)|Perindopril(DB00790)|Pipecuronium(DB01338)|Pralidoxime(DB00733)|Procainamide(DB01035)|Procaine(DB00721)|Pyridostigmine(DB00545)|Ramipril(DB00178)|Rivastigmine(DB00989)|Succinylcholine(DB00202)|Sulpiride(DB00391)|Terbutaline(DB00871)|Triamcinolone(DB00620)|Triflupromazine(DB00508)|Trimethaphan(DB01116)	AAAAATGATGTCCAGAATCGA	0.348																																					p.T551A		Atlas-SNP	.											.	BCHE	136	.	0			c.A1651G						.						135.0	121.0	126.0					3																	165503966		2203	4299	6502	SO:0001583	missense	590	exon3			ATGATGTCCAGAA	M16541	CCDS3198.1	3q26.1-q26.2	2013-07-10			ENSG00000114200	ENSG00000114200	3.1.1.8		983	protein-coding gene	gene with protein product		177400	"""cholinesterase 1"", ""cholinesterase (serum) 2"""	CHE1, CHE2		1769657, 2318303	Standard	NM_000055		Approved	E1	uc003fem.4	P06276	OTTHUMG00000158131	ENST00000264381.3:c.1651A>G	chr3.hg19:g.165503966T>C	ENSP00000264381:p.Thr551Ala	94.0	0.0		87.0	45.0	NM_000055	A8K7P8	Missense_Mutation	SNP	ENST00000264381.3	hg19	CCDS3198.1	.	.	.	.	.	.	.	.	.	.	T	11.92	1.784020	0.31593	.	.	ENSG00000114200	ENST00000264381;ENST00000479451;ENST00000540653;ENST00000488954	D;D;T;D	0.95238	-3.65;-3.65;-1.03;-3.65	5.72	5.72	0.89469	Acetylcholinesterase, tetramerisation (1);	0.267280	0.40554	N	0.001070	D	0.91570	0.7337	L	0.39898	1.24	0.22531	N	0.999011	B	0.15141	0.012	B	0.10450	0.005	D	0.84208	0.0454	10	0.56958	D	0.05	.	15.1866	0.73006	0.0:0.0:0.0:1.0	.	551	P06276	CHLE_HUMAN	A	551;81;13;81	ENSP00000264381:T551A;ENSP00000418325:T81A;ENSP00000443583:T13A;ENSP00000418504:T81A	ENSP00000264381:T551A	T	-	1	0	BCHE	166986660	1.000000	0.71417	0.977000	0.42913	0.390000	0.30446	5.581000	0.67471	2.184000	0.69523	0.533000	0.62120	ACA	.	.		0.348	BCHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350254.1		
LRRC66	339977	hgsc.bcm.edu	37	4	52869443	52869443	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr4:52869443G>T	ENST00000343457.3	-	2	618	c.612C>A	c.(610-612)agC>agA	p.S204R		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	204						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						ATATCTTGTTGCTCTTTAAAC	0.368																																					p.S204R		Atlas-SNP	.											.	LRRC66	128	.	0			c.C612A						.						140.0	130.0	133.0					4																	52869443		1833	4089	5922	SO:0001583	missense	339977	exon2			CTTGTTGCTCTTT	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.612C>A	chr4.hg19:g.52869443G>T	ENSP00000341944:p.Ser204Arg	109.0	0.0		80.0	5.0	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	hg19	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758293	0.31137	.	.	ENSG00000188993	ENST00000343457	T	0.57595	0.39	5.55	2.67	0.31697	.	0.552778	0.17941	N	0.156846	T	0.33731	0.0873	N	0.13098	0.295	0.28198	N	0.927468	P	0.41624	0.757	B	0.41036	0.346	T	0.18618	-1.0331	10	0.66056	D	0.02	-2.796	6.591	0.22646	0.1777:0.1542:0.6681:0.0	.	204	Q68CR7	LRC66_HUMAN	R	204	ENSP00000341944:S204R	ENSP00000341944:S204R	S	-	3	2	LRRC66	52564200	0.976000	0.34144	0.982000	0.44146	0.016000	0.09150	1.607000	0.36836	0.895000	0.36342	-0.175000	0.13238	AGC	.	.		0.368	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
EIF4E	1977	hgsc.bcm.edu	37	4	99823068	99823068	+	Silent	SNP	A	A	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr4:99823068A>C	ENST00000450253.2	-	2	1608	c.84T>G	c.(82-84)gtT>gtG	p.V28V	EIF4E_ENST00000280892.6_Silent_p.V48V|EIF4E_ENST00000504432.1_Silent_p.V56V|EIF4E_ENST00000504472.1_5'UTR|EIF4E_ENST00000505992.1_Silent_p.V28V	NM_001968.3	NP_001959.1	P06730	IF4E_HUMAN	eukaryotic translation initiation factor 4E	28					cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|lung development (GO:0030324)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of mitotic cell cycle (GO:0045931)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)|viral process (GO:0016032)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)|extracellular vesicular exosome (GO:0070062)|mRNA cap binding complex (GO:0005845)|RISC complex (GO:0016442)	poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation initiation factor activity (GO:0003743)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)|LUSC - Lung squamous cell carcinoma(721;0.00227)		CTGGGTTAGCAACCTCCTGAT	0.398																																					p.V48V		Atlas-SNP	.											.	EIF4E	18	.	0			c.T144G						.						165.0	161.0	162.0					4																	99823068		2203	4300	6503	SO:0001819	synonymous_variant	1977	exon2			GTTAGCAACCTCC	M15353	CCDS34031.1, CCDS47109.1, CCDS54779.1	4q21-q25	2008-02-05			ENSG00000151247	ENSG00000151247			3287	protein-coding gene	gene with protein product		133440		EIF4EL1, EIF4F		9330633, 1916814	Standard	NM_001968		Approved	EIF4E1	uc011cea.1	P06730	OTTHUMG00000161090	ENST00000450253.2:c.84T>G	chr4.hg19:g.99823068A>C		132.0	0.0		47.0	39.0	NM_001130678	B7Z6V1|D6RCQ6|Q96E95	Silent	SNP	ENST00000450253.2	hg19	CCDS34031.1	.	.	.	.	.	.	.	.	.	.	A	10.44	1.350923	0.24512	.	.	ENSG00000151247	ENST00000511644	.	.	.	5.85	4.68	0.58851	.	.	.	.	.	T	0.58221	0.2107	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55611	-0.8114	4	.	.	.	-21.5605	7.7084	0.28663	0.8069:0.0:0.0685:0.1246	.	.	.	.	G	25	.	.	C	-	1	0	EIF4E	100042091	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.373000	0.52394	1.144000	0.42321	-0.288000	0.09946	TGC	.	.		0.398	EIF4E-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000363739.1	NM_001968	
PCDHB6	56130	hgsc.bcm.edu	37	5	140529886	140529886	+	Silent	SNP	C	C	T	rs143226291		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr5:140529886C>T	ENST00000231136.1	+	1	48	c.48C>T	c.(46-48)ttC>ttT	p.F16F	PCDHB6_ENST00000543635.1_Intron	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	16					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGGCTTTCTTCATTTTATTGA	0.418																																					p.F16F		Atlas-SNP	.											.	PCDHB6	161	.	0			c.C48T						.	C		0,4406		0,0,2203	170.0	169.0	169.0		48	-5.3	0.0	5	dbSNP_134	169	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	PCDHB6	NM_018939.2		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		16/795	140529886	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	56130	exon1			TTTCTTCATTTTA	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.48C>T	chr5.hg19:g.140529886C>T		101.0	0.0		62.0	16.0	NM_018939	B2R8R9	Silent	SNP	ENST00000231136.1	hg19	CCDS4248.1																																																																																			.	C|1.000;T|0.000		0.418	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
N4BP3	23138	hgsc.bcm.edu	37	5	177548620	177548620	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr5:177548620A>G	ENST00000274605.5	+	5	1612	c.1253A>G	c.(1252-1254)gAg>gGg	p.E418G		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	418						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAGGACGCAGAGCTGGTCCGG	0.667																																					p.E418G		Atlas-SNP	.											.	N4BP3	25	.	0			c.A1253G						.						38.0	44.0	42.0					5																	177548620		2203	4299	6502	SO:0001583	missense	23138	exon5			ACGCAGAGCTGGT	AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.1253A>G	chr5.hg19:g.177548620A>G	ENSP00000274605:p.Glu418Gly	104.0	0.0		84.0	39.0	NM_015111	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	ENST00000274605.5	hg19	CCDS34307.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.004504	0.54254	.	.	ENSG00000145911	ENST00000274605	T	0.45668	0.89	5.33	5.33	0.75918	.	0.103321	0.64402	D	0.000003	T	0.36524	0.0970	L	0.46157	1.445	0.37392	D	0.912475	B	0.31256	0.316	B	0.29077	0.098	T	0.45440	-0.9261	10	0.62326	D	0.03	-28.7585	11.6945	0.51536	1.0:0.0:0.0:0.0	.	418	O15049	N4BP3_HUMAN	G	418	ENSP00000274605:E418G	ENSP00000274605:E418G	E	+	2	0	N4BP3	177481226	1.000000	0.71417	1.000000	0.80357	0.287000	0.27160	6.069000	0.71209	2.026000	0.59711	0.459000	0.35465	GAG	.	.		0.667	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373552.2	NM_015111	
KCNK17	89822	hgsc.bcm.edu	37	6	39271872	39271872	+	Silent	SNP	G	G	T	rs374325536		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr6:39271872G>T	ENST00000373231.4	-	4	781	c.549C>A	c.(547-549)ggC>ggA	p.G183G	KCNK17_ENST00000453413.2_Silent_p.G183G	NM_031460.3	NP_113648.2	Q96T54	KCNKH_HUMAN	potassium channel, subfamily K, member 17	183					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|skin(2)	14						AGAGGAGGGCGCCAGAGCCCG	0.657																																					p.G183G		Atlas-SNP	.											.	KCNK17	61	.	0			c.C549A						.						42.0	46.0	45.0					6																	39271872		2202	4300	6502	SO:0001819	synonymous_variant	89822	exon4			GAGGGCGCCAGAG	AF358910	CCDS4842.1, CCDS47419.1	6p21	2012-03-07			ENSG00000124780	ENSG00000124780		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14465	protein-coding gene	gene with protein product		607370				16382106	Standard	NM_031460		Approved	K2p17.1, TALK-2, TALK2, TASK4, TASK-4	uc003ooo.3	Q96T54	OTTHUMG00000014646	ENST00000373231.4:c.549C>A	chr6.hg19:g.39271872G>T		93.0	0.0		114.0	60.0	NM_001135111	E9PB46|Q5TCF4|Q8TAW4|Q9BXD1|Q9H592	Silent	SNP	ENST00000373231.4	hg19	CCDS4842.1																																																																																			.	.		0.657	KCNK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040453.2	NM_031460	
KIF6	221458	hgsc.bcm.edu	37	6	39607459	39607459	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr6:39607459C>T	ENST00000287152.7	-	4	420	c.326G>A	c.(325-327)gGg>gAg	p.G109E	KIF6_ENST00000373216.3_Missense_Mutation_p.G109E|KIF6_ENST00000373215.3_Missense_Mutation_p.G109E|KIF6_ENST00000538893.1_Missense_Mutation_p.G109E	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	109	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CTCTGCACCCCCTGTGATAGT	0.423																																					p.G109E		Atlas-SNP	.											.	KIF6	233	.	0			c.G326A						.						180.0	135.0	150.0					6																	39607459		2203	4300	6503	SO:0001583	missense	221458	exon4			GCACCCCCTGTGA	AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.326G>A	chr6.hg19:g.39607459C>T	ENSP00000287152:p.Gly109Glu	117.0	0.0		103.0	60.0	NM_145027	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	ENST00000287152.7	hg19	CCDS4844.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	32|32	5.171911|5.171911	0.94807|0.94807	.|.	.|.	ENSG00000164627|ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373215;ENST00000538893|ENST00000458470	D;D;D;D|.	0.84800|.	-1.9;-1.9;-1.9;-1.9|.	5.67|5.67	5.67|5.67	0.87782|0.87782	Kinesin, motor domain (5);|.	.|.	.|.	.|.	.|.	D|D	0.90721|0.90721	0.7088|0.7088	H|H	0.98901|0.98901	4.365|4.365	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;0.999;1.0|.	D|D	0.93998|0.93998	0.7273|0.7273	9|5	0.87932|.	D|.	0|.	.|.	19.3678|19.3678	0.94471|0.94471	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	109;109;109|.	E7EUN7;F6VGH2;Q6ZMV9|.	.;.;KIF6_HUMAN|.	E|R	109|1	ENSP00000287152:G109E;ENSP00000362312:G109E;ENSP00000362311:G109E;ENSP00000441435:G109E|.	ENSP00000287152:G109E|.	G|G	-|-	2|1	0|0	KIF6|KIF6	39715437|39715437	1.000000|1.000000	0.71417|0.71417	0.821000|0.821000	0.32701|0.32701	0.965000|0.965000	0.64279|0.64279	7.696000|7.696000	0.84270|0.84270	2.687000|2.687000	0.91594|0.91594	0.655000|0.655000	0.94253|0.94253	GGG|GGG	.	.		0.423	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040455.2	NM_145027	
ELFN1	392617	hgsc.bcm.edu	37	7	1785060	1785060	+	Silent	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:1785060G>T	ENST00000424383.2	+	3	1315	c.828G>T	c.(826-828)ccG>ccT	p.P276P	ELFN1_ENST00000561626.1_Silent_p.P276P|ELFN1_ENST00000541472.1_Silent_p.P276P			P0C7U0	ELFN1_HUMAN	extracellular leucine-rich repeat and fibronectin type III domain containing 1	276					negative regulation of phosphatase activity (GO:0010923)|synapse organization (GO:0050808)	dendrite (GO:0030425)|excitatory synapse (GO:0060076)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)	1						gccgctccccgccgcccccgc	0.716																																					p.P276P		Atlas-SNP	.											.	ELFN1	22	.	0			c.G828T						.						6.0	10.0	9.0					7																	1785060		681	1564	2245	SO:0001819	synonymous_variant	392617	exon2			CTCCCCGCCGCCC		CCDS59046.1	7p22.3	2013-02-11	2011-10-27	2011-10-27	ENSG00000225968	ENSG00000225968		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"""	33154	protein-coding gene	gene with protein product		614964	"""extracellular leucine-rich repeat and fibronectin type III containing 1"", ""extracellular leucine-rich repeat and fibronectin type III domain containing 1"", ""protein phosphatase 1, regulatory subunit 28"""	PPP1R28		17868438	Standard	NM_001128636		Approved		uc010ksg.2	P0C7U0	OTTHUMG00000151495	ENST00000424383.2:c.828G>T	chr7.hg19:g.1785060G>T		72.0	0.0		80.0	19.0	NM_001128636	H3BS57	Silent	SNP	ENST00000424383.2	hg19	CCDS59046.1																																																																																			.	.		0.716	ELFN1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322893.2	NM_001128636	
BMPER	168667	hgsc.bcm.edu	37	7	33945272	33945272	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:33945272G>T	ENST00000297161.2	+	2	421	c.47G>T	c.(46-48)cGc>cTc	p.R16L	BMPER_ENST00000426693.1_Missense_Mutation_p.R16L	NM_133468.4	NP_597725.1	Q8N8U9	BMPER_HUMAN	BMP binding endothelial regulator	16					blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|endothelial cell activation (GO:0042118)|inner ear development (GO:0048839)|negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of endothelial cell migration (GO:0010594)|regulation of pathway-restricted SMAD protein phosphorylation (GO:0060393)|ureteric bud development (GO:0001657)	extracellular space (GO:0005615)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(24)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						CGTTACTGCCGCCGCTCGCCT	0.657																																					p.R16L		Atlas-SNP	.											.	BMPER	131	.	0			c.G47T						.						46.0	43.0	44.0					7																	33945272		2203	4300	6503	SO:0001583	missense	168667	exon2			ACTGCCGCCGCTC		CCDS5442.1	7p14.3	2009-02-18			ENSG00000164619	ENSG00000164619			24154	protein-coding gene	gene with protein product	"""crossveinless-2"""	608699				12897139, 14766204	Standard	NM_133468		Approved	Cv2, CRIM3	uc011kap.2	Q8N8U9	OTTHUMG00000128675	ENST00000297161.2:c.47G>T	chr7.hg19:g.33945272G>T	ENSP00000297161:p.Arg16Leu	54.0	0.0		73.0	26.0	NM_133468	A8K1P8|Q8TF36	Missense_Mutation	SNP	ENST00000297161.2	hg19	CCDS5442.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.720401	0.48728	.	.	ENSG00000164619	ENST00000297161;ENST00000426693;ENST00000436222	T;T	0.18810	2.19;2.19	3.65	1.57	0.23409	.	0.821803	0.10575	N	0.658668	T	0.06781	0.0173	N	0.00926	-1.1	0.24705	N	0.993235	B	0.02656	0.0	B	0.01281	0.0	T	0.35699	-0.9778	10	0.26408	T	0.33	.	8.5787	0.33614	0.0:0.0:0.474:0.526	.	16	Q8N8U9	BMPER_HUMAN	L	16	ENSP00000297161:R16L;ENSP00000393950:R16L	ENSP00000297161:R16L	R	+	2	0	BMPER	33911797	0.994000	0.37717	0.969000	0.41365	0.692000	0.40212	0.898000	0.28404	0.822000	0.34565	0.557000	0.71058	CGC	.	.		0.657	BMPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250570.2	NM_133468	
SHFM1	7979	hgsc.bcm.edu	37	7	96324128	96324128	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:96324128T>A	ENST00000248566.2	-	2	279	c.152A>T	c.(151-153)gAc>gTc	p.D51V	SHFM1_ENST00000413065.1_Missense_Mutation_p.D51V|SHFM1_ENST00000417009.1_Missense_Mutation_p.D51V|SHFM1_ENST00000444799.1_Missense_Mutation_p.D51V	NM_006304.1	NP_006295.1	P60896	DSS1_HUMAN	split hand/foot malformation (ectrodactyly) type 1	51	Asp/Glu-rich (highly acidic).				double-strand break repair via homologous recombination (GO:0000724)	proteasome complex (GO:0000502)				breast(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_cancers(62;4.24e-09)|all_epithelial(64;5.59e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0353)|Lung NSC(181;0.0987)					ATTAGAGAAGTCATCCTCTAC	0.348								Homologous recombination																													p.D51V		Atlas-SNP	.											.	SHFM1	12	.	0			c.A152T						.						170.0	168.0	169.0					7																	96324128		2203	4300	6503	SO:0001583	missense	7979	exon2			GAGAAGTCATCCT	U41515	CCDS5646.1	7q21.3	2010-04-22			ENSG00000127922	ENSG00000127922			10845	protein-coding gene	gene with protein product	"""deleted in split-hand/foot 1"""	601285		SHFD1		1895319, 8733122	Standard	NM_006304		Approved	DSS1, Shfdg1, ECD, SEM1, SHSF1	uc003uoi.3	P60896	OTTHUMG00000150680	ENST00000248566.2:c.152A>T	chr7.hg19:g.96324128T>A	ENSP00000248566:p.Asp51Val	115.0	0.0		98.0	52.0	NM_006304	Q13437|Q61067	Missense_Mutation	SNP	ENST00000248566.2	hg19	CCDS5646.1	.	.	.	.	.	.	.	.	.	.	T	15.88	2.964468	0.53507	.	.	ENSG00000127922	ENST00000417009;ENST00000444799;ENST00000413065;ENST00000248566	T;T;T;T	0.59906	0.23;0.23;0.23;0.23	5.04	5.04	0.67666	.	0.000000	0.85682	D	0.000000	T	0.76241	0.3960	.	.	.	0.80722	D	1	D;D	0.89917	1.0;0.987	D;D	0.91635	0.999;0.942	T	0.80002	-0.1565	9	0.87932	D	0	.	15.1597	0.72775	0.0:0.0:0.0:1.0	.	51;51	F2Z309;P60896	.;DSS1_HUMAN	V	51	ENSP00000416322:D51V;ENSP00000390049:D51V;ENSP00000409481:D51V;ENSP00000248566:D51V	ENSP00000248566:D51V	D	-	2	0	SHFM1	96162064	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.815000	0.86186	2.202000	0.70862	0.528000	0.53228	GAC	.	.		0.348	SHFM1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319595.1	NM_006304	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000424859.1_5'UTR|LHFPL3_ENST00000401970.2_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		39.0	0.0		38.0	3.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
SND1	27044	hgsc.bcm.edu	37	7	127347629	127347629	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:127347629G>T	ENST00000354725.3	+	9	1160	c.966G>T	c.(964-966)agG>agT	p.R322S		NM_014390.2	NP_055205.2	Q7KZF4	SND1_HUMAN	staphylococcal nuclease and tudor domain containing 1	322	TNase-like 2. {ECO:0000255|PROSITE- ProRule:PRU00272}.				gene silencing by RNA (GO:0031047)|osteoblast differentiation (GO:0001649)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|dense body (GO:0097433)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|RISC complex (GO:0016442)	nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|transcription cofactor activity (GO:0003712)			central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	41						AAGAGCGCAGGCTGAGAATAT	0.483																																					p.R322S		Atlas-SNP	.											.	SND1	104	.	0			c.G966T						.						130.0	116.0	121.0					7																	127347629		2203	4300	6503	SO:0001583	missense	27044	exon9			GCGCAGGCTGAGA		CCDS34747.1	7q31.3	2014-03-24			ENSG00000197157	ENSG00000197157		"""Tudor domain containing"""	30646	protein-coding gene	gene with protein product	"""p100 EBNA2 co-activator"", ""Tudor-SN"""	602181				7651391, 9003410, 12819296	Standard	NM_014390		Approved	TDRD11, p100	uc003vmi.3	Q7KZF4	OTTHUMG00000157560	ENST00000354725.3:c.966G>T	chr7.hg19:g.127347629G>T	ENSP00000346762:p.Arg322Ser	93.0	0.0		110.0	17.0	NM_014390	Q13122|Q96AG0	Missense_Mutation	SNP	ENST00000354725.3	hg19	CCDS34747.1	.	.	.	.	.	.	.	.	.	.	G	19.54	3.846359	0.71603	.	.	ENSG00000197157	ENST00000354725;ENST00000438400	T	0.34275	1.37	5.29	4.39	0.52855	Staphylococcal nuclease (SNase-like) (4);Staphylococcal nuclease (SNase-like), OB-fold (1);	0.186986	0.56097	D	0.000037	T	0.53270	0.1786	M	0.85710	2.77	0.49213	D	0.999761	B	0.27166	0.17	B	0.42593	0.392	T	0.60347	-0.7281	10	0.72032	D	0.01	-17.4254	12.4975	0.55937	0.0873:0.0:0.9127:0.0	.	322	Q7KZF4	SND1_HUMAN	S	322;312	ENSP00000346762:R322S	ENSP00000346762:R322S	R	+	3	2	SND1	127134865	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.106000	0.41835	2.621000	0.88768	0.557000	0.71058	AGG	.	.		0.483	SND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349148.1	NM_014390	
PLXNA4	91584	hgsc.bcm.edu	37	7	131848926	131848926	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr7:131848926C>T	ENST00000359827.3	-	24	5437	c.4475G>A	c.(4474-4476)cGc>cAc	p.R1492H	PLXNA4_ENST00000321063.4_Missense_Mutation_p.R1492H			Q9HCM2	PLXA4_HUMAN	plexin A4	1492					anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						AATCTGCTGGCGGATGAGCTT	0.602																																					p.R1492H		Atlas-SNP	.											PLXNA4_ENST00000359827,NS,carcinoma,0,2	PLXNA4	873	.	0			c.G4475A						.						79.0	88.0	85.0					7																	131848926		2203	4300	6503	SO:0001583	missense	91584	exon24			TGCTGGCGGATGA	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.4475G>A	chr7.hg19:g.131848926C>T	ENSP00000352882:p.Arg1492His	94.0	0.0		98.0	23.0	NM_020911	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	C	35	5.484409	0.96323	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.15487	2.42;2.42	5.45	5.45	0.79879	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	T	0.51278	0.1665	M	0.88241	2.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.58645	-0.7600	10	0.59425	D	0.04	.	19.3079	0.94171	0.0:1.0:0.0:0.0	.	1492	Q9HCM2	PLXA4_HUMAN	H	1492	ENSP00000323194:R1492H;ENSP00000352882:R1492H	ENSP00000323194:R1492H	R	-	2	0	PLXNA4	131499466	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.550000	0.86006	0.655000	0.94253	CGC	.	.		0.602	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
CSMD1	64478	hgsc.bcm.edu	37	8	2813254	2813254	+	Missense_Mutation	SNP	G	G	C	rs534317062		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr8:2813254G>C	ENST00000520002.1	-	65	10409	c.9854C>G	c.(9853-9855)gCg>gGg	p.A3285G	CSMD1_ENST00000400186.3_Missense_Mutation_p.A3108G|CSMD1_ENST00000537824.1_Missense_Mutation_p.A3284G|CSMD1_ENST00000602723.1_Missense_Mutation_p.A3108G|CSMD1_ENST00000602557.1_Missense_Mutation_p.A3285G|CSMD1_ENST00000542608.1_Missense_Mutation_p.A3107G			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3285	Sushi 28. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		TCTCACATCCGCGTGTGCCGG	0.483																																					p.A3284G		Atlas-SNP	.											.	CSMD1	1469	.	0			c.C9851G						.						132.0	130.0	131.0					8																	2813254		1965	4164	6129	SO:0001583	missense	64478	exon64			ACATCCGCGTGTG			8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9854C>G	chr8.hg19:g.2813254G>C	ENSP00000430733:p.Ala3285Gly	144.0	0.0		50.0	41.0	NM_033225	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	ENST00000520002.1	hg19		.	.	.	.	.	.	.	.	.	.	G	1.772	-0.484170	0.04383	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	5.64	5.64	0.86602	Complement control module (2);Sushi/SCR/CCP (3);	0.088045	0.48767	D	0.000178	T	0.35038	0.0918	N	0.05158	-0.105	0.80722	D	1	D;P;B	0.76494	0.999;0.498;0.304	D;P;B	0.83275	0.996;0.624;0.429	T	0.22765	-1.0207	10	0.25751	T	0.34	.	10.7635	0.46279	0.1147:0.0:0.8853:0.0	.	3285;3285;3107	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	G	3108;3285;3146;3284;3107	ENSP00000383047:A3108G;ENSP00000430733:A3285G;ENSP00000441462:A3284G;ENSP00000446243:A3107G	ENSP00000320445:A3146G	A	-	2	0	CSMD1	2800661	0.922000	0.31269	0.156000	0.22583	0.011000	0.07611	3.114000	0.50383	2.656000	0.90262	0.460000	0.39030	GCG	.	.		0.483	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000374500.2	NM_033225	
TMEM74	157753	hgsc.bcm.edu	37	8	109796520	109796520	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr8:109796520C>T	ENST00000297459.3	-	2	986	c.808G>A	c.(808-810)Gag>Aag	p.E270K	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	270					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			TTTGCAGACTCTTTGGAAGAG	0.493																																					p.E270K		Atlas-SNP	.											.	TMEM74	70	.	0			c.G808A						.						87.0	84.0	85.0					8																	109796520		2203	4300	6503	SO:0001583	missense	157753	exon2			CAGACTCTTTGGA	AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.808G>A	chr8.hg19:g.109796520C>T	ENSP00000297459:p.Glu270Lys	237.0	0.0		144.0	14.0	NM_153015		Missense_Mutation	SNP	ENST00000297459.3	hg19	CCDS6310.1	.	.	.	.	.	.	.	.	.	.	C	19.10	3.760950	0.69763	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.93	5.93	0.95920	.	0.288210	0.39687	N	0.001298	T	0.56307	0.1976	L	0.51422	1.61	0.46678	D	0.999155	P	0.45531	0.86	B	0.41510	0.359	T	0.51545	-0.8692	9	0.25106	T	0.35	-15.4478	20.3404	0.98760	0.0:1.0:0.0:0.0	.	270	Q96NL1	TMM74_HUMAN	K	270	.	ENSP00000297459:E270K	E	-	1	0	TMEM74	109865696	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.879000	0.63100	2.812000	0.96745	0.637000	0.83480	GAG	.	.		0.493	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380755.1	NM_153015	
C9orf172	389813	hgsc.bcm.edu	37	9	139739752	139739752	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr9:139739752G>T	ENST00000436881.1	+	1	886	c.886G>T	c.(886-888)Gcc>Tcc	p.A296S		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	296	Pro-rich.									endometrium(2)|large_intestine(1)|lung(6)	9						CAGCTTTGCAGCCAGTCCCGG	0.682																																					p.A296S		Atlas-SNP	.											.	C9orf172	23	.	0			c.G886T						.						16.0	17.0	17.0					9																	139739752		1885	4094	5979	SO:0001583	missense	389813	exon1			TTTGCAGCCAGTC		CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.886G>T	chr9.hg19:g.139739752G>T	ENSP00000412388:p.Ala296Ser	99.0	0.0		51.0	47.0	NM_001080482		Missense_Mutation	SNP	ENST00000436881.1	hg19	CCDS48059.1	.	.	.	.	.	.	.	.	.	.	.	0.011	-1.706190	0.00719	.	.	ENSG00000232434	ENST00000436881	.	.	.	3.61	1.62	0.23740	.	.	.	.	.	T	0.17704	0.0425	N	0.19112	0.55	0.09310	N	1	B	0.17038	0.02	B	0.14023	0.01	T	0.31024	-0.9958	8	0.07030	T	0.85	.	5.5261	0.16959	0.3703:0.0:0.6297:0.0	.	296	C9J069	CI172_HUMAN	S	296	.	ENSP00000412388:A296S	A	+	1	0	C9orf172	138859573	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.322000	0.19576	0.592000	0.29728	0.442000	0.29010	GCC	.	.		0.682	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001080482	
RBM17	84991	hgsc.bcm.edu	37	10	6154319	6154319	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr10:6154319A>G	ENST00000446108.1	+	8	1495	c.851A>G	c.(850-852)gAg>gGg	p.E284G	RBM17_ENST00000379888.4_Missense_Mutation_p.E284G	NM_001145547.1	NP_001139019.1	Q96I25	SPF45_HUMAN	RNA binding motif protein 17	284					alternative mRNA splicing, via spliceosome (GO:0000380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(2)	19						GACGCCACAGAGAAAGGTGTG	0.597																																					p.E284G		Atlas-SNP	.											.	RBM17	45	.	0			c.A851G						.						40.0	33.0	36.0					10																	6154319		2203	4300	6503	SO:0001583	missense	84991	exon8			CCACAGAGAAAGG	AF083384	CCDS7077.1	10p15.1	2013-01-28			ENSG00000134453	ENSG00000134453		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	16944	protein-coding gene	gene with protein product	"""splicing factor 45kDa"""	606935				9731529	Standard	NM_032905		Approved	SPF45, MGC14439	uc001ijb.3	Q96I25	OTTHUMG00000017618	ENST00000446108.1:c.851A>G	chr10.hg19:g.6154319A>G	ENSP00000388638:p.Glu284Gly	111.0	0.0		192.0	76.0	NM_001145547	Q96GY6	Missense_Mutation	SNP	ENST00000446108.1	hg19	CCDS7077.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	16.17|16.17	3.046183|3.046183	0.55110|0.55110	.|.	.|.	ENSG00000134453|ENSG00000134453	ENST00000379888;ENST00000446108|ENST00000447032	.|.	.|.	.|.	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	0.046083|.	0.85682|.	D|.	0.000000|.	T|T	0.55847|0.55847	0.1946|0.1946	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	B|.	0.26002|.	0.139|.	B|.	0.21360|.	0.034|.	T|T	0.52548|0.52548	-0.8561|-0.8561	9|5	0.22109|.	T|.	0.4|.	-31.0153|-31.0153	15.7261|15.7261	0.77761|0.77761	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	284|.	Q96I25|.	SPF45_HUMAN|.	G|G	284|191	.|.	ENSP00000369218:E284G|.	E|R	+|+	2|1	0|2	RBM17|RBM17	6194325|6194325	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.337000|0.337000	0.28794|0.28794	9.036000|9.036000	0.93758|0.93758	2.119000|2.119000	0.64992|0.64992	0.379000|0.379000	0.24179|0.24179	GAG|AGA	.	.		0.597	RBM17-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046635.1	NM_032905	
PTPLA	9200	hgsc.bcm.edu	37	10	17636234	17636234	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr10:17636234G>T	ENST00000361271.3	-	6	791	c.754C>A	c.(754-756)Ctt>Att	p.L252I		NM_014241.3	NP_055056.3	B0YJ81	HACD1_HUMAN	protein tyrosine phosphatase-like (proline instead of catalytic arginine), member A	252					fatty acid biosynthetic process (GO:0006633)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	lyase activity (GO:0016829)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	13						GTTATAAGAAGAAAATAATAG	0.289																																					p.L252I		Atlas-SNP	.											PTPLA,NS,carcinoma,0,1	PTPLA	34	.	0			c.C754A						.						58.0	61.0	60.0					10																	17636234		2202	4295	6497	SO:0001583	missense	9200	exon6			TAAGAAGAAAATA	AF114494	CCDS7121.1	10p14-p13	2008-08-01	2005-11-11		ENSG00000165996	ENSG00000165996			9639	protein-coding gene	gene with protein product	"""cementum attachment protein"""	610467	"""protein tyrosine phosphatase-like (proline instead of catalytic arginine), member a"""			10644438	Standard	XM_005252641		Approved	CAP	uc001ipg.3	B0YJ81	OTTHUMG00000017750	ENST00000361271.3:c.754C>A	chr10.hg19:g.17636234G>T	ENSP00000355308:p.Leu252Ile	357.0	0.0		487.0	160.0	NM_014241	B0YJ80|Q6JIC5|Q96FW7|Q9HB93|Q9UHX2	Missense_Mutation	SNP	ENST00000361271.3	hg19	CCDS7121.1	.	.	.	.	.	.	.	.	.	.	G	28.1	4.892142	0.91889	.	.	ENSG00000165996	ENST00000361271	T	0.36340	1.26	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.57154	0.2034	M	0.72353	2.195	0.80722	D	1	P	0.46859	0.885	P	0.55222	0.771	T	0.55667	-0.8105	10	0.59425	D	0.04	-21.2146	20.2406	0.98372	0.0:0.0:1.0:0.0	.	252	B0YJ81	HACD1_HUMAN	I	252	ENSP00000355308:L252I	ENSP00000355308:L252I	L	-	1	0	PTPLA	17676240	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.846000	0.99502	2.857000	0.98124	0.650000	0.86243	CTT	.	.		0.289	PTPLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047046.1	NM_014241	
RHOBTB1	9886	hgsc.bcm.edu	37	10	62648855	62648855	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr10:62648855A>G	ENST00000337910.5	-	6	908	c.571T>C	c.(571-573)Ttt>Ctt	p.F191L	RHOBTB1_ENST00000357917.4_Missense_Mutation_p.F191L	NM_001242359.1|NM_014836.4	NP_001229288.1|NP_055651.1	O94844	RHBT1_HUMAN	Rho-related BTB domain containing 1	191	Rho-like.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23	Prostate(12;0.0112)					AACTGGTCAAACACGCTTGTT	0.463																																					p.F191L		Atlas-SNP	.											.	RHOBTB1	61	.	0			c.T571C						.						143.0	142.0	142.0					10																	62648855		2203	4300	6503	SO:0001583	missense	9886	exon6			GGTCAAACACGCT	AB018283	CCDS7261.1	10q22.1	2013-01-08			ENSG00000072422	ENSG00000072422		"""BTB/POZ domain containing"""	18738	protein-coding gene	gene with protein product		607351				11222756	Standard	NM_014836		Approved	KIAA0740	uc001jlh.3	O94844	OTTHUMG00000018292	ENST00000337910.5:c.571T>C	chr10.hg19:g.62648855A>G	ENSP00000338671:p.Phe191Leu	99.0	0.0		62.0	22.0	NM_014836		Missense_Mutation	SNP	ENST00000337910.5	hg19	CCDS7261.1	.	.	.	.	.	.	.	.	.	.	A	17.61	3.433077	0.62844	.	.	ENSG00000072422	ENST00000357917;ENST00000337910	T;T	0.75367	-0.93;-0.93	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.40196	0.1107	N	0.00339	-1.615	0.80722	D	1	B	0.15930	0.015	B	0.23419	0.046	T	0.55711	-0.8098	10	0.02654	T	1	.	16.1026	0.81194	1.0:0.0:0.0:0.0	.	191	O94844	RHBT1_HUMAN	L	191	ENSP00000350595:F191L;ENSP00000338671:F191L	ENSP00000338671:F191L	F	-	1	0	RHOBTB1	62318861	1.000000	0.71417	0.940000	0.37924	0.969000	0.65631	5.738000	0.68613	2.198000	0.70561	0.383000	0.25322	TTT	.	.		0.463	RHOBTB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048220.1		
PLCE1	51196	hgsc.bcm.edu	37	10	96066392	96066392	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr10:96066392A>G	ENST00000371380.3	+	25	6066	c.5831A>G	c.(5830-5832)aAt>aGt	p.N1944S	PLCE1_ENST00000371385.3_Missense_Mutation_p.N1636S|PLCE1_ENST00000260766.3_Missense_Mutation_p.N1944S|PLCE1_ENST00000371375.1_Missense_Mutation_p.N1636S			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	1944	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GTGGAAAACAATAGTTCAGCG	0.393																																					p.N1944S		Atlas-SNP	.											.	PLCE1	543	.	0			c.A5831G						.						104.0	93.0	96.0					10																	96066392		1895	4140	6035	SO:0001583	missense	51196	exon26			AAAACAATAGTTC		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.5831A>G	chr10.hg19:g.96066392A>G	ENSP00000360431:p.Asn1944Ser	119.0	0.0		79.0	14.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	hg19	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	A	19.12	3.766322	0.69878	.	.	ENSG00000138193	ENST00000260766;ENST00000371380;ENST00000371385;ENST00000371375	T;T;T;T	0.13538	2.58;2.58;2.58;2.58	5.43	5.43	0.79202	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.22627	0.0546	N	0.20845	0.615	0.41657	D	0.989164	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.87578	0.998;0.995;0.988	T	0.08006	-1.0743	10	0.27082	T	0.32	.	15.4603	0.75349	1.0:0.0:0.0:0.0	.	1928;1636;1944	B7ZM61;Q9P212-2;Q9P212	.;.;PLCE1_HUMAN	S	1944;1944;1636;1636	ENSP00000260766:N1944S;ENSP00000360431:N1944S;ENSP00000360438:N1636S;ENSP00000360426:N1636S	ENSP00000260766:N1944S	N	+	2	0	PLCE1	96056382	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	6.237000	0.72345	2.197000	0.70478	0.533000	0.62120	AAT	.	.		0.393	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
SLC5A12	159963	hgsc.bcm.edu	37	11	26734192	26734192	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:26734192T>C	ENST00000396005.3	-	2	710	c.401A>G	c.(400-402)cAg>cGg	p.Q134R	SLC5A12_ENST00000280467.6_Missense_Mutation_p.Q134R	NM_178498.3	NP_848593.2	Q1EHB4	SC5AC_HUMAN	solute carrier family 5 (sodium/monocarboxylate cotransporter), member 12	134					sodium ion transport (GO:0006814)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	symporter activity (GO:0015293)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(2)|prostate(1)|skin(2)|stomach(1)	35						ACTTACCGTCTGTACAATGTA	0.423																																					p.Q134R		Atlas-SNP	.											SLC5A12_ENST00000280467,right_upper_lobe,carcinoma,0,2	SLC5A12	134	.	0			c.A401G						.						333.0	285.0	301.0					11																	26734192		2203	4299	6502	SO:0001583	missense	159963	exon2			ACCGTCTGTACAA	BC049207	CCDS7860.2	11p14.2	2013-07-19	2013-07-19		ENSG00000148942	ENSG00000148942		"""Solute carriers"""	28750	protein-coding gene	gene with protein product		612455	"""solute carrier family 5 (sodium/glucose cotransporter), member 12"""			12477932	Standard	NM_178498		Approved	MGC52019, SMCT2	uc001mra.2	Q1EHB4	OTTHUMG00000150706	ENST00000396005.3:c.401A>G	chr11.hg19:g.26734192T>C	ENSP00000379326:p.Gln134Arg	114.0	0.0		79.0	37.0	NM_178498	Q86UC7	Missense_Mutation	SNP	ENST00000396005.3	hg19	CCDS7860.2	.	.	.	.	.	.	.	.	.	.	T	27.0	4.787648	0.90367	.	.	ENSG00000148942	ENST00000396005;ENST00000280467	D;D	0.87650	-2.28;-2.28	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.92893	0.7739	M	0.77486	2.375	0.80722	D	1	D;D	0.71674	0.961;0.998	P;D	0.70487	0.823;0.969	D	0.93529	0.6868	10	0.59425	D	0.04	.	15.2167	0.73274	0.0:0.0:0.0:1.0	.	134;134	Q1EHB4-2;Q1EHB4	.;SC5AC_HUMAN	R	134	ENSP00000379326:Q134R;ENSP00000280467:Q134R	ENSP00000280467:Q134R	Q	-	2	0	SLC5A12	26690768	1.000000	0.71417	0.995000	0.50966	0.923000	0.55619	7.655000	0.83696	2.040000	0.60383	0.533000	0.62120	CAG	.	.		0.423	SLC5A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319681.1	NM_178498	
GYLTL1B	120071	hgsc.bcm.edu	37	11	45949843	45949843	+	Nonsense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:45949843C>T	ENST00000531526.1	+	13	1981	c.1870C>T	c.(1870-1872)Cga>Tga	p.R624*	GYLTL1B_ENST00000325468.5_Nonsense_Mutation_p.R624*|GYLTL1B_ENST00000529052.1_Nonsense_Mutation_p.R593*|GYLTL1B_ENST00000401752.1_Nonsense_Mutation_p.R624*|GYLTL1B_ENST00000536139.1_Nonsense_Mutation_p.R593*	NM_152312.3	NP_689525.3	Q8N3Y3	LARG2_HUMAN	glycosyltransferase-like 1B	624					muscle cell cellular homeostasis (GO:0046716)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(2)|endometrium(6)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(35;0.226)		GGTGGTGCCACGAGACTGTCC	0.637																																					p.R624X		Atlas-SNP	.											.	GYLTL1B	45	.	0			c.C1870T						.						173.0	167.0	169.0					11																	45949843		2203	4299	6502	SO:0001587	stop_gained	120071	exon13			GTGCCACGAGACT		CCDS31473.1	11p11.12	2013-02-22			ENSG00000165905	ENSG00000165905		"""Glycosyltransferase family 8 domain containing"""	16522	protein-coding gene	gene with protein product		609709				15661757, 15958417	Standard	XM_005252785		Approved	PP5656, FLJ35207, LARGE2	uc001nbv.1	Q8N3Y3	OTTHUMG00000167037	ENST00000531526.1:c.1870C>T	chr11.hg19:g.45949843C>T	ENSP00000432869:p.Arg624*	115.0	0.0		82.0	46.0	NM_152312	A6NN75|Q8N8Y6|Q8NAK3|Q8WY62	Nonsense_Mutation	SNP	ENST00000531526.1	hg19	CCDS31473.1	.	.	.	.	.	.	.	.	.	.	C	38	6.657050	0.97739	.	.	ENSG00000165905	ENST00000529052;ENST00000531526;ENST00000401752;ENST00000325468;ENST00000536139	.	.	.	5.57	2.41	0.29592	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.2775	14.0692	0.64851	0.3941:0.6059:0.0:0.0	.	.	.	.	X	593;624;624;624;593	.	ENSP00000324570:R624X	R	+	1	2	GYLTL1B	45906419	0.323000	0.24643	0.170000	0.22879	0.747000	0.42532	0.938000	0.28965	0.656000	0.30886	0.561000	0.74099	CGA	.	.		0.637	GYLTL1B-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392572.1	NM_152312	
KRTAP5-10	387273	hgsc.bcm.edu	37	11	71277043	71277043	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:71277043G>T	ENST00000398531.1	+	1	435	c.410G>T	c.(409-411)tGt>tTt	p.C137F	KRTAP5-10_ENST00000376536.4_Missense_Mutation_p.C89F	NM_001012710.1	NP_001012728.1	Q6L8G5	KR510_HUMAN	keratin associated protein 5-10	137	7 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(2)|large_intestine(1)|lung(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	12						TGTGGTTCTTGTGGCTGCTCC	0.637																																					p.C137F		Atlas-SNP	.											.	KRTAP5-10	37	.	0			c.G410T						.						85.0	112.0	103.0					11																	71277043		2199	4292	6491	SO:0001583	missense	387273	exon1			GTTCTTGTGGCTG	AB126079	CCDS41684.1	11q13.4	2008-02-05			ENSG00000204572	ENSG00000204572		"""Keratin associated proteins"""	23605	protein-coding gene	gene with protein product						15144888	Standard	NM_001012710		Approved	KRTAP5.10	uc001oqt.1	Q6L8G5	OTTHUMG00000057585	ENST00000398531.1:c.410G>T	chr11.hg19:g.71277043G>T	ENSP00000381542:p.Cys137Phe	184.0	0.0		70.0	39.0	NM_001012710	B9EHA4	Missense_Mutation	SNP	ENST00000398531.1	hg19	CCDS41684.1	.	.	.	.	.	.	.	.	.	.	.	3.585	-0.084715	0.07097	.	.	ENSG00000204572	ENST00000398531;ENST00000376536	T;T	0.01113	5.32;5.53	1.95	1.95	0.26073	.	.	.	.	.	T	0.01421	0.0046	L	0.56199	1.76	0.21527	N	0.999652	B	0.33549	0.417	B	0.30646	0.118	T	0.45352	-0.9267	9	0.72032	D	0.01	.	4.4788	0.11757	0.1965:0.0:0.8035:0.0	.	137	Q6L8G5	KR510_HUMAN	F	137;89	ENSP00000381542:C137F;ENSP00000365719:C89F	ENSP00000365719:C89F	C	+	2	0	KRTAP5-10	70954691	0.015000	0.18098	0.783000	0.31826	0.129000	0.20672	1.589000	0.36644	1.415000	0.47037	0.467000	0.42956	TGT	.	.		0.637	KRTAP5-10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000127968.2		
KLHL35	283212	hgsc.bcm.edu	37	11	75139638	75139638	+	Silent	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:75139638G>T	ENST00000539798.1	-	2	914	c.915C>A	c.(913-915)atC>atA	p.I305I	KLHL35_ENST00000376292.4_Silent_p.I85I	NM_001039548.2	NP_001034637.2	Q6PF15	KLH35_HUMAN	kelch-like family member 35	305										lung(2)|stomach(1)	3						CGCAACCGCCGATGACCACGA	0.627																																					p.I305I	Colon(77;683 1691 18820 23811)	Atlas-SNP	.											.	KLHL35	15	.	0			c.C915A						.						36.0	42.0	40.0					11																	75139638		2015	4139	6154	SO:0001819	synonymous_variant	283212	exon2			ACCGCCGATGACC		CCDS44685.1, CCDS44685.2	11q13.4	2013-02-22	2013-02-22		ENSG00000149243	ENSG00000149243		"""Kelch-like"", ""BTB/POZ domain containing"""	26597	protein-coding gene	gene with protein product			"""kelch-like 35 (Drosophila)"""				Standard	NM_001039548		Approved	FLJ33790	uc001owm.2	Q6PF15	OTTHUMG00000133573	ENST00000539798.1:c.915C>A	chr11.hg19:g.75139638G>T		48.0	0.0		18.0	16.0	NM_001039548	A2RU06|F5H412|Q86XM7|Q8NBB1	Silent	SNP	ENST00000539798.1	hg19	CCDS44685.2																																																																																			.	.		0.627	KLHL35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_173583	
FAT3	120114	hgsc.bcm.edu	37	11	92532846	92532846	+	Missense_Mutation	SNP	A	A	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:92532846A>T	ENST00000298047.6	+	9	6684	c.6667A>T	c.(6667-6669)Atc>Ttc	p.I2223F	FAT3_ENST00000525166.1_Missense_Mutation_p.I2073F|FAT3_ENST00000409404.2_Missense_Mutation_p.I2223F			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2223	Cadherin 20. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ATATATCATTATCGATGGGGA	0.408										TCGA Ovarian(4;0.039)																											p.I2223F		Atlas-SNP	.											.	FAT3	1822	.	0			c.A6667T						.						49.0	47.0	48.0					11																	92532846		1923	4140	6063	SO:0001583	missense	120114	exon9			ATCATTATCGATG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.6667A>T	chr11.hg19:g.92532846A>T	ENSP00000298047:p.Ile2223Phe	63.0	0.0		35.0	26.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	A	11.26	1.586369	0.28268	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.53423	0.62;0.62;0.62	6.16	3.65	0.41850	.	.	.	.	.	T	0.45915	0.1366	M	0.71036	2.16	0.49798	D	0.999822	B	0.31383	0.321	B	0.38225	0.268	T	0.32798	-0.9893	9	0.27082	T	0.32	.	5.2285	0.15408	0.4837:0.0:0.5163:0.0	.	2223	Q8TDW7-3	.	F	2223;2223;2073	ENSP00000298047:I2223F;ENSP00000387040:I2223F;ENSP00000432586:I2073F	ENSP00000298047:I2223F	I	+	1	0	FAT3	92172494	0.997000	0.39634	0.785000	0.31869	0.862000	0.49288	3.510000	0.53393	1.016000	0.39470	0.528000	0.53228	ATC	.	.		0.408	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
GUCY1A2	2977	hgsc.bcm.edu	37	11	106810453	106810453	+	Silent	SNP	A	A	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:106810453A>T	ENST00000526355.2	-	4	1407	c.939T>A	c.(937-939)ccT>ccA	p.P313P	GUCY1A2_ENST00000347596.2_Silent_p.P313P|GUCY1A2_ENST00000282249.2_Silent_p.P313P	NM_000855.2	NP_000846.1	P33402	GCYA2_HUMAN	guanylate cyclase 1, soluble, alpha 2	313					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|positive regulation of cGMP biosynthetic process (GO:0030828)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)			breast(5)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(18)|liver(1)|lung(32)|ovary(1)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	74		all_epithelial(67;3.66e-05)|Melanoma(852;0.000382)|Acute lymphoblastic leukemia(157;0.001)|all_hematologic(158;0.0017)|Breast(348;0.026)|all_neural(303;0.068)		BRCA - Breast invasive adenocarcinoma(274;8.04e-05)|Epithelial(105;0.0036)|all cancers(92;0.0476)	Isosorbide Mononitrate(DB01020)|Nitric Oxide(DB00435)	TGAGGTCCGCAGGAACTTGGG	0.438																																					p.P313P		Atlas-SNP	.											.	GUCY1A2	180	.	0			c.T939A						.						78.0	73.0	75.0					11																	106810453		2201	4298	6499	SO:0001819	synonymous_variant	2977	exon4			GTCCGCAGGAACT	X63282	CCDS8335.1, CCDS58170.1	11q21-q22	2008-03-18			ENSG00000152402	ENSG00000152402	4.6.1.2		4684	protein-coding gene	gene with protein product		601244		GUC1A2		1683630	Standard	NM_000855		Approved	GC-SA2	uc001pjg.2	P33402	OTTHUMG00000166296	ENST00000526355.2:c.939T>A	chr11.hg19:g.106810453A>T		129.0	0.0		61.0	49.0	NM_000855	A1L4C4|B7ZLT5	Silent	SNP	ENST00000526355.2	hg19	CCDS8335.1																																																																																			.	.		0.438	GUCY1A2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389003.2		
ELMOD1	55531	hgsc.bcm.edu	37	11	107526740	107526740	+	Missense_Mutation	SNP	C	C	G	rs190625125		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:107526740C>G	ENST00000265840.7	+	11	1045	c.780C>G	c.(778-780)ttC>ttG	p.F260L	ELMOD1_ENST00000531234.1_Missense_Mutation_p.F254L|ELMOD1_ENST00000443271.2_Missense_Mutation_p.F252L	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	260	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		AAACCCATTTCTACAATATCG	0.388																																					p.F260L		Atlas-SNP	.											ELMOD1,NS,carcinoma,0,1	ELMOD1	40	.	0			c.C780G						.						94.0	87.0	89.0					11																	107526740		1867	4090	5957	SO:0001583	missense	55531	exon11			CCATTTCTACAAT	AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.780C>G	chr11.hg19:g.107526740C>G	ENSP00000265840:p.Phe260Leu	81.0	0.0		28.0	25.0	NM_018712	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	ENST00000265840.7	hg19	CCDS44723.1	.	.	.	.	.	.	.	.	.	.	C	15.71	2.914298	0.52546	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	T;T;T	0.27557	1.66;1.66;1.66	6.16	6.16	0.99307	Engulfment/cell motility, ELMO (2);	0.071070	0.64402	D	0.000001	T	0.25827	0.0629	N	0.20766	0.605	0.53688	D	0.999977	B;B	0.20052	0.041;0.018	B;B	0.24269	0.052;0.024	T	0.04693	-1.0933	10	0.25106	T	0.35	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	260;252	Q8N336;G5E9S5	ELMD1_HUMAN;.	L	254;260;252	ENSP00000433232:F254L;ENSP00000265840:F260L;ENSP00000412257:F252L	ENSP00000265840:F260L	F	+	3	2	ELMOD1	107031950	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.215000	0.51169	2.937000	0.99478	0.650000	0.86243	TTC	.	C|1.000;T|0.000		0.388	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389406.1	NM_018712	
ABCG4	64137	hgsc.bcm.edu	37	11	119025505	119025505	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:119025505G>T	ENST00000449422.2	+	6	754	c.566G>T	c.(565-567)gGc>gTc	p.G189V	ABCG4_ENST00000531739.1_Missense_Mutation_p.G189V|ABCG4_ENST00000307417.3_Missense_Mutation_p.G189V	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	189	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		ACGGCACTGGGCCTGATGTCG	0.642																																					p.G189V		Atlas-SNP	.											.	ABCG4	77	.	0			c.G566T						.						98.0	92.0	94.0					11																	119025505		2200	4295	6495	SO:0001583	missense	64137	exon6			CACTGGGCCTGAT	AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.566G>T	chr11.hg19:g.119025505G>T	ENSP00000406874:p.Gly189Val	87.0	0.0		33.0	29.0	NM_022169	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	ENST00000449422.2	hg19	CCDS8415.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.542891	0.86022	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	D;D;D	0.95238	-3.65;-3.65;-3.65	5.11	4.13	0.48395	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.050273	0.85682	D	0.000000	D	0.98378	0.9461	H	0.99286	4.5	0.80722	D	1	D	0.67145	0.996	D	0.68765	0.96	D	0.98891	1.0773	10	0.87932	D	0	-19.0063	14.3175	0.66463	0.0:0.0:0.8509:0.1491	.	189	Q9H172	ABCG4_HUMAN	V	189	ENSP00000304111:G189V;ENSP00000406874:G189V;ENSP00000434318:G189V	ENSP00000304111:G189V	G	+	2	0	ABCG4	118530715	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.918000	0.87506	2.386000	0.81285	0.491000	0.48974	GGC	.	.		0.642	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000388215.1	NM_022169	
IGSF9B	22997	hgsc.bcm.edu	37	11	133794761	133794761	+	Silent	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr11:133794761C>T	ENST00000321016.8	-	15	2303	c.2073G>A	c.(2071-2073)caG>caA	p.Q691Q	IGSF9B_ENST00000533871.2_Silent_p.Q691Q			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	691	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		TGATCAGATCCTGCATGACGG	0.587																																					p.Q691Q		Atlas-SNP	.											.	IGSF9B	290	.	0			c.G2073A						.						113.0	123.0	119.0					11																	133794761		2089	4217	6306	SO:0001819	synonymous_variant	22997	exon15			CAGATCCTGCATG	AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2073G>A	chr11.hg19:g.133794761C>T		46.0	0.0		15.0	13.0	NM_014987	G5EA26	Silent	SNP	ENST00000321016.8	hg19																																																																																				.	.		0.587	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_290502	
PLXNC1	10154	hgsc.bcm.edu	37	12	94692459	94692459	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr12:94692459C>T	ENST00000258526.4	+	27	4375	c.4126C>T	c.(4126-4128)Ccc>Tcc	p.P1376S	PLXNC1_ENST00000547057.1_Missense_Mutation_p.P423S|PLXNC1_ENST00000545312.1_Missense_Mutation_p.P115S	NM_005761.2	NP_005752.1	O60486	PLXC1_HUMAN	plexin C1	1376					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(12)|lung(30)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTGGAGTTTACCCAACAGCAG	0.373																																					p.P1376S		Atlas-SNP	.											.	PLXNC1	135	.	0			c.C4126T						.						72.0	74.0	73.0					12																	94692459		2203	4300	6503	SO:0001583	missense	10154	exon27			AGTTTACCCAACA	AF030339	CCDS9049.1	12q23	2009-04-17				ENSG00000136040		"""CD molecules"", ""Plexins"""	9106	protein-coding gene	gene with protein product		604259					Standard	NR_037687		Approved	VESPR, CD232	uc001tdc.3	O60486	OTTHUMG00000170235	ENST00000258526.4:c.4126C>T	chr12.hg19:g.94692459C>T	ENSP00000258526:p.Pro1376Ser	155.0	0.0		169.0	32.0	NM_005761	Q59H25	Missense_Mutation	SNP	ENST00000258526.4	hg19	CCDS9049.1	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365118	0.41902	.	.	ENSG00000136040	ENST00000258526;ENST00000547057;ENST00000545312	T;T;T	0.15487	2.42;2.42;2.42	5.95	5.95	0.96441	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.051093	0.85682	D	0.000000	T	0.31606	0.0802	L	0.35288	1.05	0.80722	D	1	P;D	0.61697	0.573;0.99	P;D	0.71870	0.46;0.975	T	0.01205	-1.1419	10	0.16896	T	0.51	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	423;1376	B4DHQ7;O60486	.;PLXC1_HUMAN	S	1376;423;115	ENSP00000258526:P1376S;ENSP00000446720:P423S;ENSP00000439225:P115S	ENSP00000258526:P1376S	P	+	1	0	PLXNC1	93216590	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.991000	0.56973	2.824000	0.97209	0.655000	0.94253	CCC	.	.		0.373	PLXNC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408126.2		
N6AMT2	221143	hgsc.bcm.edu	37	13	21306081	21306081	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr13:21306081T>A	ENST00000382758.1	-	4	454	c.407A>T	c.(406-408)gAc>gTc	p.D136V	N6AMT2_ENST00000382754.4_Missense_Mutation_p.D136V			Q8WVE0	N6MT2_HUMAN	N-6 adenine-specific DNA methyltransferase 2 (putative)	136						extracellular vesicular exosome (GO:0070062)	methyltransferase activity (GO:0008168)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(3)|lung(3)	7		all_cancers(29;5.91e-19)|all_epithelial(30;1.42e-15)|all_lung(29;5.9e-14)|Lung SC(185;0.0367)		all cancers(112;0.000234)|Epithelial(112;0.000471)|OV - Ovarian serous cystadenocarcinoma(117;0.0111)|Lung(94;0.0161)|LUSC - Lung squamous cell carcinoma(192;0.0431)		TATTACGATGTCAAAACTATG	0.413																																					p.D136V		Atlas-SNP	.											.	N6AMT2	26	.	0			c.A407T						.						133.0	125.0	128.0					13																	21306081		2203	4300	6503	SO:0001583	missense	221143	exon4			ACGATGTCAAAAC	AK055408	CCDS9293.1	13q12.11	2006-12-14			ENSG00000150456	ENSG00000150456			27351	protein-coding gene	gene with protein product						12477932	Standard	NM_174928		Approved		uc001uno.1	Q8WVE0	OTTHUMG00000016519	ENST00000382758.1:c.407A>T	chr13.hg19:g.21306081T>A	ENSP00000372206:p.Asp136Val	109.0	0.0		1065.0	43.0	NM_174928	B5G4V1	Missense_Mutation	SNP	ENST00000382758.1	hg19	CCDS9293.1	.	.	.	.	.	.	.	.	.	.	T	16.70	3.195870	0.58126	.	.	ENSG00000150456	ENST00000382758;ENST00000382754	T;T	0.35421	1.31;1.31	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.71426	0.3338	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.80369	-0.1411	10	0.87932	D	0	.	16.4484	0.83959	0.0:0.0:0.0:1.0	.	136	Q8WVE0	N6MT2_HUMAN	V	136	ENSP00000372206:D136V;ENSP00000372202:D136V	ENSP00000372202:D136V	D	-	2	0	N6AMT2	20204081	1.000000	0.71417	0.873000	0.34254	0.036000	0.12997	7.634000	0.83273	2.285000	0.76669	0.533000	0.62120	GAC	.	.		0.413	N6AMT2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044083.1	NM_174928	
RB1	5925	hgsc.bcm.edu	37	13	48881475	48881475	+	Missense_Mutation	SNP	T	T	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr13:48881475T>A	ENST00000267163.4	+	2	335	c.197T>A	c.(196-198)aTa>aAa	p.I66K		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	66					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(3)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AAATTAAAGATACCAGATCAT	0.318		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.I66K		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	18	Whole gene deletion(15)|Unknown(3)	bone(10)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|eye(1)|soft_tissue(1)|endometrium(1)|stomach(1)	c.T197A						.						134.0	137.0	136.0					13																	48881475		2203	4300	6503	SO:0001583	missense	5925	exon2	Familial Cancer Database		TAAAGATACCAGA	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.197T>A	chr13.hg19:g.48881475T>A	ENSP00000267163:p.Ile66Lys	195.0	0.0		54.0	41.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	T	15.43	2.831991	0.50845	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.92965	-3.14	4.83	4.83	0.62350	.	0.941668	0.09031	N	0.858753	D	0.85729	0.5764	N	0.14661	0.345	0.43657	D	0.996079	B	0.23735	0.09	B	0.21360	0.034	T	0.78486	-0.2185	10	0.72032	D	0.01	.	11.0932	0.48128	0.0:0.0:0.0:1.0	.	66	P06400	RB_HUMAN	K	45;66	ENSP00000267163:I66K	ENSP00000267163:I66K	I	+	2	0	RB1	47779476	1.000000	0.71417	0.973000	0.42090	0.981000	0.71138	3.717000	0.54911	1.923000	0.55706	0.528000	0.53228	ATA	.	.		0.318	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
RB1	5925	hgsc.bcm.edu	37	13	48881477	48881477	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr13:48881477C>G	ENST00000267163.4	+	2	337	c.199C>G	c.(199-201)Cca>Gca	p.P67A		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	67					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(3)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	ATTAAAGATACCAGATCATGT	0.318		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.P67A		Atlas-SNP	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	.	RB1	1068	.	18	Whole gene deletion(15)|Unknown(3)	bone(10)|haematopoietic_and_lymphoid_tissue(2)|breast(2)|eye(1)|soft_tissue(1)|endometrium(1)|stomach(1)	c.C199G						.						135.0	138.0	137.0					13																	48881477		2203	4300	6503	SO:0001583	missense	5925	exon2	Familial Cancer Database		AAGATACCAGATC	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.199C>G	chr13.hg19:g.48881477C>G	ENSP00000267163:p.Pro67Ala	195.0	0.0		54.0	43.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Missense_Mutation	SNP	ENST00000267163.4	hg19	CCDS31973.1	.	.	.	.	.	.	.	.	.	.	C	10.87	1.472402	0.26423	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	D	0.91407	-2.84	4.83	3.98	0.46160	.	0.121948	0.56097	D	0.000029	D	0.85111	0.5622	L	0.40543	1.245	0.39844	D	0.973156	B	0.02656	0.0	B	0.01281	0.0	T	0.80417	-0.1391	10	0.36615	T	0.2	.	10.7368	0.46130	0.1906:0.8094:0.0:0.0	.	67	P06400	RB_HUMAN	A	46;67	ENSP00000267163:P67A	ENSP00000267163:P67A	P	+	1	0	RB1	47779478	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	0.529000	0.23019	1.125000	0.41998	-0.188000	0.12872	CCA	.	.		0.318	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
METTL21C	196541	hgsc.bcm.edu	37	13	103338746	103338746	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr13:103338746C>T	ENST00000267273.6	-	4	435	c.430G>A	c.(430-432)Gat>Aat	p.D144N		NM_001010977.1	NP_001010977.1	Q5VZV1	MT21C_HUMAN	methyltransferase like 21C	144					peptidyl-lysine methylation (GO:0018022)|protein methylation (GO:0006479)	nucleus (GO:0005634)	protein-lysine N-methyltransferase activity (GO:0016279)			breast(1)|large_intestine(3)|lung(2)|skin(1)	7						CCCAGGACATCAGGCAAATCT	0.433																																					p.D144N		Atlas-SNP	.											.	METTL21C	23	.	0			c.G430A						.						58.0	57.0	57.0					13																	103338746		2203	4300	6503	SO:0001583	missense	196541	exon4			GGACATCAGGCAA		CCDS32003.1	13q33.1	2011-03-03	2011-03-03	2011-03-03	ENSG00000139780	ENSG00000139780			33717	protein-coding gene	gene with protein product		615259	"""chromosome 13 open reading frame 39"""	C13orf39			Standard	NM_001010977		Approved	LOC196541	uc001vpj.4	Q5VZV1	OTTHUMG00000017304	ENST00000267273.6:c.430G>A	chr13.hg19:g.103338746C>T	ENSP00000267273:p.Asp144Asn	82.0	0.0		187.0	33.0	NM_001010977		Missense_Mutation	SNP	ENST00000267273.6	hg19	CCDS32003.1	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463723	0.63513	.	.	ENSG00000139780	ENST00000267273	T	0.06849	3.25	5.68	5.68	0.88126	.	0.144740	0.64402	D	0.000010	T	0.09555	0.0235	L	0.41356	1.27	0.46521	D	0.999084	B	0.28419	0.211	B	0.30029	0.11	T	0.07139	-1.0788	10	0.54805	T	0.06	-0.9339	13.0479	0.58937	0.0:0.9266:0.0:0.0734	.	144	Q5VZV1	MT21C_HUMAN	N	144	ENSP00000267273:D144N	ENSP00000267273:D144N	D	-	1	0	METTL21C	102136747	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.744000	0.68664	2.691000	0.91804	0.650000	0.86243	GAT	.	.		0.433	METTL21C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045682.2	NM_001010977	
NYNRIN	57523	hgsc.bcm.edu	37	14	24884995	24884995	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr14:24884995C>T	ENST00000382554.3	+	9	4358	c.4040C>T	c.(4039-4041)cCt>cTt	p.P1347L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1347					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TCCTGCTCCCCTTACACGCCA	0.607																																					p.P1347L		Atlas-SNP	.											.	NYNRIN	120	.	0			c.C4040T						.						111.0	117.0	115.0					14																	24884995		2051	4185	6236	SO:0001583	missense	57523	exon9			GCTCCCCTTACAC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.4040C>T	chr14.hg19:g.24884995C>T	ENSP00000371994:p.Pro1347Leu	82.0	0.0		49.0	24.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	C	15.67	2.901344	0.52227	.	.	ENSG00000205978	ENST00000382554	T	0.11385	2.78	4.93	4.05	0.47172	Ribonuclease H-like (1);	.	.	.	.	T	0.08044	0.0201	N	0.24115	0.695	0.28694	N	0.90444	B	0.09022	0.002	B	0.10450	0.005	T	0.13361	-1.0512	9	0.87932	D	0	.	7.2135	0.25947	0.0:0.8061:0.0:0.1939	.	1347	Q9P2P1	NYNRI_HUMAN	L	1347	ENSP00000371994:P1347L	ENSP00000371994:P1347L	P	+	2	0	NYNRIN	23954835	0.004000	0.15560	0.894000	0.35097	0.976000	0.68499	1.214000	0.32419	1.298000	0.44778	0.655000	0.94253	CCT	.	.		0.607	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
DYNC1H1	1778	hgsc.bcm.edu	37	14	102467511	102467511	+	Silent	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr14:102467511C>T	ENST00000360184.4	+	20	4379	c.4215C>T	c.(4213-4215)tcC>tcT	p.S1405S		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	1405	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						AACTGAAATCCGAAGCACTTA	0.438																																					p.S1405S		Atlas-SNP	.											.	DYNC1H1	395	.	0			c.C4215T						.						217.0	224.0	222.0					14																	102467511		2203	4300	6503	SO:0001819	synonymous_variant	1778	exon20			GAAATCCGAAGCA	AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.4215C>T	chr14.hg19:g.102467511C>T		196.0	0.0		81.0	44.0	NM_001376	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	ENST00000360184.4	hg19	CCDS9966.1																																																																																			.	.		0.438	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414574.1	NM_001376	
ISL2	64843	hgsc.bcm.edu	37	15	76632778	76632778	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr15:76632778G>T	ENST00000290759.4	+	4	833	c.673G>T	c.(673-675)Gtg>Ttg	p.V225L	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	225					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						GGAGCAGCTGGTGGAGATGAC	0.622																																					p.V225L	GBM(97;953 1391 16164 31496 36951)	Atlas-SNP	.											.	ISL2	20	.	0			c.G673T						.						36.0	40.0	39.0					15																	76632778		2197	4292	6489	SO:0001583	missense	64843	exon4			CAGCTGGTGGAGA	AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.673G>T	chr15.hg19:g.76632778G>T	ENSP00000290759:p.Val225Leu	192.0	0.0		151.0	62.0	NM_145805	B3KM37	Missense_Mutation	SNP	ENST00000290759.4	hg19	CCDS10290.1	.	.	.	.	.	.	.	.	.	.	G	36	5.737768	0.96865	.	.	ENSG00000159556	ENST00000290759	D	0.96104	-3.91	5.19	5.19	0.71726	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.94165	0.8128	L	0.31420	0.93	0.80722	D	1	P	0.41848	0.763	P	0.48571	0.582	D	0.94964	0.8111	10	0.87932	D	0	.	16.5729	0.84629	0.0:0.0:1.0:0.0	.	225	Q96A47	ISL2_HUMAN	L	225	ENSP00000290759:V225L	ENSP00000290759:V225L	V	+	1	0	ISL2	74419833	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.716000	0.98752	2.584000	0.87258	0.555000	0.69702	GTG	.	.		0.622	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289779.1		
MEFV	4210	hgsc.bcm.edu	37	16	3297138	3297138	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr16:3297138G>T	ENST00000219596.1	-	5	1504	c.1465C>A	c.(1465-1467)Cag>Aag	p.Q489K	MEFV_ENST00000541159.1_Missense_Mutation_p.Q278K|MEFV_ENST00000339854.4_Missense_Mutation_p.Q309K|MEFV_ENST00000536379.1_Missense_Mutation_p.Q278K	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	489	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCAACCATCTGGCCCACGTCC	0.587																																					p.Q489K		Atlas-SNP	.											.	MEFV	170	.	0			c.C1465A						.						188.0	167.0	174.0					16																	3297138		2197	4300	6497	SO:0001583	missense	4210	exon5			CCATCTGGCCCAC	AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1465C>A	chr16.hg19:g.3297138G>T	ENSP00000219596:p.Gln489Lys	111.0	0.0		100.0	4.0	NM_000243	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Missense_Mutation	SNP	ENST00000219596.1	hg19	CCDS10498.1	.	.	.	.	.	.	.	.	.	.	G	2.758	-0.258602	0.05791	.	.	ENSG00000103313	ENST00000545159;ENST00000219596;ENST00000339854;ENST00000541159;ENST00000536379;ENST00000534868	T;T;T;T	0.63580	-0.05;0.4;0.37;0.4	5.29	3.15	0.36227	.	0.741932	0.12025	N	0.506522	T	0.46678	0.1405	L	0.39566	1.225	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.31503	-0.9941	10	0.08837	T	0.75	-34.618	7.4954	0.27485	0.0:0.1469:0.5702:0.2829	.	489	O15553	MEFV_HUMAN	K	489;489;309;278;278;278	ENSP00000219596:Q489K;ENSP00000339639:Q309K;ENSP00000438711:Q278K;ENSP00000445079:Q278K	ENSP00000219596:Q489K	Q	-	1	0	MEFV	3237139	0.008000	0.16893	0.088000	0.20740	0.012000	0.07955	0.569000	0.23638	1.429000	0.47314	0.655000	0.94253	CAG	.	.		0.587	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251464.1	NM_000243	
TP53	7157	hgsc.bcm.edu	37	17	7577534	7577534	+	Missense_Mutation	SNP	C	C	A	rs28934571		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:7577534C>A	ENST00000269305.4	-	7	936	c.747G>T	c.(745-747)agG>agT	p.R249S	TP53_ENST00000445888.2_Missense_Mutation_p.R249S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.R249S|TP53_ENST00000359597.4_Missense_Mutation_p.R249S|TP53_ENST00000420246.2_Missense_Mutation_p.R249S|TP53_ENST00000455263.2_Missense_Mutation_p.R249S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	249	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in a sporadic cancer; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> M (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> S (in sporadic cancers; somatic mutation; does not induce SNAI1 degradation; dbSNP:rs28934571). {ECO:0000269|PubMed:1694291, ECO:0000269|PubMed:16959974}.|R -> T (in sporadic cancers; somatic mutation).|R -> W (in sporadic cancers; somatic mutation).|RP -> SA (in a sporadic cancer; somatic mutation).|RP -> SS (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R249S(348)|p.0?(8)|p.R249R(5)|p.?(5)|p.M246_P250delMNRRP(2)|p.R248_P250delRRP(1)|p.R249_P250delRP(1)|p.R249_P250insR(1)|p.R249_P250>SS(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R249fs*14(1)|p.R249_T256delRPILTIIT(1)|p.P250fs*14(1)|p.R249_I251delRPI(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGATGGGCCTCCGGTTCA	0.572		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.R249S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,right_lower_lobe,carcinoma,-2,1	TP53	33396	.	378	Substitution - Missense(348)|Deletion - In frame(8)|Whole gene deletion(8)|Unknown(5)|Substitution - coding silent(5)|Insertion - Frameshift(1)|Insertion - In frame(1)|Deletion - Frameshift(1)|Complex - compound substitution(1)	liver(240)|lung(44)|upper_aerodigestive_tract(12)|breast(12)|central_nervous_system(10)|stomach(7)|ovary(6)|prostate(6)|cervix(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(5)|biliary_tract(5)|urinary_tract(5)|bone(4)|endometrium(3)|oesophagus(3)|skin(2)|peritoneum(1)|kidney(1)|salivary_gland(1)|pancreas(1)	c.G747T						.						155.0	113.0	127.0					17																	7577534		2203	4300	6503	SO:0001583	missense	7157	exon7	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GATGGGCCTCCGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.747G>T	chr17.hg19:g.7577534C>A	ENSP00000269305:p.Arg249Ser	115.0	1.0		47.0	36.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344264	0.61073	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D;D	0.99865	-7.29;-7.29;-7.29;-7.29;-7.29;-7.29;-7.29	4.62	-0.0929	0.13654	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99792	0.9912	M	0.92367	3.3	0.50039	D	0.999848	D;D;D;D;D	0.89917	0.996;0.996;0.997;0.99;1.0	D;D;D;D;D	0.79108	0.968;0.966;0.981;0.955;0.992	D	0.98720	1.0708	10	0.72032	D	0.01	-3.0658	3.2479	0.06803	0.1392:0.5551:0.1362:0.1695	rs28934571	249;249;249;249;249	P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;P53_HUMAN;.;.	S	249;249;249;249;249;249;238;117	ENSP00000410739:R249S;ENSP00000352610:R249S;ENSP00000269305:R249S;ENSP00000398846:R249S;ENSP00000391127:R249S;ENSP00000391478:R249S;ENSP00000425104:R117S	ENSP00000269305:R249S	R	-	3	2	TP53	7518259	0.011000	0.17503	0.998000	0.56505	0.783000	0.44284	-1.379000	0.02554	0.253000	0.21552	0.462000	0.41574	AGG	.	.		0.572	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
NAA38	84316	hgsc.bcm.edu	37	17	7760598	7760598	+	Intron	SNP	G	G	C	rs201706296		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:7760598G>C	ENST00000335155.5	-	2	81				CYB5D1_ENST00000570446.1_5'Flank|LSMD1_ENST00000575771.1_Intron|LSMD1_ENST00000575071.1_Intron|LSMD1_ENST00000575208.1_Intron|CYB5D1_ENST00000571846.1_5'Flank|CYB5D1_ENST00000332439.4_5'Flank|LSMD1_ENST00000576861.1_Intron|LSMD1_ENST00000570555.1_5'Flank|LSMD1_ENST00000576384.1_5'Flank|LSMD1_ENST00000333775.5_Missense_Mutation_p.C48W			Q9BRA0	LSMD1_HUMAN							negative regulation of apoptotic process (GO:0043066)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)|nucleus (GO:0005634)				endometrium(1)|lung(2)|ovary(1)	4		all_cancers(10;0.11)|Prostate(122;0.219)				AGCCCGCGGGGCACTCACACA	0.692																																					p.C48W	GBM(66;626 1401 29924 42527)	Atlas-SNP	.											.	LSMD1	8	.	0			c.C144G						.						13.0	18.0	16.0					17																	7760598		2143	4212	6355	SO:0001627	intron_variant	84316	exon1			CGCGGGGCACTCA																												ENST00000335155.5:c.82-82C>G	chr17.hg19:g.7760598G>C		106.0	0.0		39.0	32.0	NM_032356	Q8N4M0	Missense_Mutation	SNP	ENST00000335155.5	hg19		.	.	.	.	.	.	.	.	.	.	G	5.519	0.280739	0.10458	.	.	ENSG00000183011	ENST00000333775	T	0.48522	0.81	4.83	3.5	0.40072	.	1.036590	0.07611	N	0.925311	T	0.39384	0.1076	.	.	.	0.80722	D	1	B	0.28584	0.216	B	0.34180	0.177	T	0.09292	-1.0681	8	.	.	.	.	7.6789	0.28502	0.1436:0.0:0.8564:0.0	.	48	Q9BRA0-2	.	W	48	ENSP00000332103:C48W	.	C	-	3	2	LSMD1	7701323	0.065000	0.20965	0.911000	0.35937	0.304000	0.27724	0.531000	0.23052	1.114000	0.41781	0.462000	0.41574	TGC	.	G|0.999;A|0.001		0.692	LSMD1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding			
LIG3	3980	hgsc.bcm.edu	37	17	33319683	33319683	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:33319683C>T	ENST00000378526.4	+	8	1560	c.1427C>T	c.(1426-1428)tCg>tTg	p.S476L	LIG3_ENST00000262327.5_Missense_Mutation_p.S476L	NM_013975.3	NP_039269.2	P49916	DNLI3_HUMAN	ligase III, DNA, ATP-dependent	476					base-excision repair (GO:0006284)|base-excision repair, DNA ligation (GO:0006288)|DNA biosynthetic process (GO:0071897)|DNA repair (GO:0006281)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitochondrial DNA repair (GO:0043504)|negative regulation of DNA recombination (GO:0045910)|nucleotide-excision repair (GO:0006289)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(8)|lung(9)|ovary(3)|pancreas(2)|prostate(1)|skin(3)|stomach(1)	31		Ovarian(249;0.17)			Bleomycin(DB00290)	GTCCAGGCCTCGCTGATGACA	0.622								Other BER factors																													p.S476L		Atlas-SNP	.											.	LIG3	164	.	0			c.C1427T						.						55.0	48.0	50.0					17																	33319683		2203	4300	6503	SO:0001583	missense	3980	exon8			AGGCCTCGCTGAT		CCDS11284.2, CCDS11285.2	17q11.2-q12	2008-10-29			ENSG00000005156	ENSG00000005156			6600	protein-coding gene	gene with protein product		600940	"""ligase II, DNA, ATP-dependent"""	LIG2		7760816	Standard	NM_002311		Approved		uc002hik.2	P49916	OTTHUMG00000128519	ENST00000378526.4:c.1427C>T	chr17.hg19:g.33319683C>T	ENSP00000367787:p.Ser476Leu	84.0	0.0		61.0	22.0	NM_013975	Q16714|Q6NVK3	Missense_Mutation	SNP	ENST00000378526.4	hg19	CCDS11284.2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372567	0.82573	.	.	ENSG00000005156	ENST00000378526;ENST00000262327	T;T	0.19394	2.15;2.15	5.5	5.5	0.81552	DNA ligase, ATP-dependent, N-terminal (2);	0.059458	0.64402	D	0.000001	T	0.24586	0.0596	M	0.66939	2.045	0.50313	D	0.999865	P;P;P	0.38922	0.651;0.651;0.607	B;B;B	0.28991	0.068;0.068;0.097	T	0.08106	-1.0738	10	0.66056	D	0.02	-8.3791	18.5685	0.91126	0.0:1.0:0.0:0.0	.	476;476;476	E5KLB5;P49916;E5KLB6	.;DNLI3_HUMAN;.	L	476	ENSP00000367787:S476L;ENSP00000262327:S476L	ENSP00000262327:S476L	S	+	2	0	LIG3	30343796	1.000000	0.71417	0.047000	0.18901	0.957000	0.61999	7.461000	0.80834	2.861000	0.98227	0.655000	0.94253	TCG	.	.		0.622	LIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250330.3	NM_013975	
KRTAP4-4	84616	hgsc.bcm.edu	37	17	39316584	39316584	+	Silent	SNP	G	G	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:39316584G>A	ENST00000390661.3	-	1	399	c.360C>T	c.(358-360)tgC>tgT	p.C120C		NM_032524.1	NP_115913.1	Q9BYR3	KRA44_HUMAN	keratin associated protein 4-4	120	26 X 5 AA repeats of C-C-[GRQVCH]-[SPT]- [VSTQR].					keratin filament (GO:0045095)				kidney(1)|large_intestine(1)|lung(5)	7		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000449)			TGGGGCAGCAGCAGGTGGGCT	0.662																																					p.C120C		Atlas-SNP	.											.	KRTAP4-4	21	.	0			c.C360T						.						39.0	46.0	44.0					17																	39316584		2201	4295	6496	SO:0001819	synonymous_variant	84616	exon1			GCAGCAGCAGGTG	AJ406936	CCDS11383.1	17q21.2	2013-06-25			ENSG00000171396	ENSG00000171396		"""Keratin associated proteins"""	16928	protein-coding gene	gene with protein product			"""keratin associated protein 4-13"""	KRTAP4-13		11279113	Standard	NM_032524		Approved	KAP4.4, KAP4.13	uc002hwc.3	Q9BYR3	OTTHUMG00000133428	ENST00000390661.3:c.360C>T	chr17.hg19:g.39316584G>A		105.0	0.0		93.0	44.0	NM_032524	Q9BYU7	Silent	SNP	ENST00000390661.3	hg19	CCDS11383.1																																																																																			.	.		0.662	KRTAP4-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257291.1		
TRIM25	7706	hgsc.bcm.edu	37	17	54981814	54981814	+	Missense_Mutation	SNP	T	T	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:54981814T>G	ENST00000316881.4	-	3	778	c.729A>C	c.(727-729)caA>caC	p.Q243H	TRIM25_ENST00000537230.1_Missense_Mutation_p.Q243H	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	243	Interaction with influenza A virus NS1.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					CCGTGTATTCTTGTTGTAGCT	0.512																																					p.Q243H		Atlas-SNP	.											.	TRIM25	52	.	0			c.A729C						.						163.0	147.0	153.0					17																	54981814		2203	4300	6503	SO:0001583	missense	7706	exon3			GTATTCTTGTTGT	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.729A>C	chr17.hg19:g.54981814T>G	ENSP00000323889:p.Gln243His	76.0	0.0		92.0	32.0	NM_005082		Missense_Mutation	SNP	ENST00000316881.4	hg19	CCDS11591.1	.	.	.	.	.	.	.	.	.	.	T	15.79	2.935906	0.52972	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.43688	0.94;0.94	5.76	-6.17	0.02091	.	0.527372	0.18118	N	0.151152	T	0.30293	0.0760	M	0.67953	2.075	0.20196	N	0.999922	B	0.14012	0.009	B	0.14023	0.01	T	0.29882	-0.9997	10	0.62326	D	0.03	.	3.9418	0.09331	0.1286:0.4421:0.2476:0.1817	.	243	Q14258	TRI25_HUMAN	H	243	ENSP00000323889:Q243H;ENSP00000445961:Q243H	ENSP00000323889:Q243H	Q	-	3	2	TRIM25	52336813	0.000000	0.05858	0.532000	0.27989	0.650000	0.38633	-0.873000	0.04214	-0.664000	0.05324	0.533000	0.62120	CAA	.	.		0.512	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082	
TTYH2	94015	hgsc.bcm.edu	37	17	72218751	72218751	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:72218751C>A	ENST00000269346.4	+	2	331	c.257C>A	c.(256-258)tCc>tAc	p.S86Y	TTYH2_ENST00000529107.1_Missense_Mutation_p.S65Y	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	86						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						CAGCACCACTCCTGCTGCATC	0.647																																					p.S86Y		Atlas-SNP	.											.	TTYH2	63	.	0			c.C257A						.						81.0	65.0	71.0					17																	72218751		2203	4300	6503	SO:0001583	missense	94015	exon2			ACCACTCCTGCTG		CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.257C>A	chr17.hg19:g.72218751C>A	ENSP00000269346:p.Ser86Tyr	39.0	0.0		82.0	20.0	NM_032646	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Missense_Mutation	SNP	ENST00000269346.4	hg19	CCDS32717.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.084635	0.76642	.	.	ENSG00000141540	ENST00000269346;ENST00000529107	T;T	0.12984	2.63;2.63	5.05	5.05	0.67936	.	0.187469	0.47852	D	0.000204	T	0.38134	0.1029	M	0.78223	2.4	0.80722	D	1	D;D	0.60160	0.987;0.971	D;P	0.63703	0.917;0.905	T	0.20009	-1.0288	10	0.59425	D	0.04	-16.6	17.5539	0.87885	0.0:1.0:0.0:0.0	.	65;86	B4DKD1;Q9BSA4	.;TTYH2_HUMAN	Y	86;65	ENSP00000269346:S86Y;ENSP00000433089:S65Y	ENSP00000269346:S86Y	S	+	2	0	TTYH2	69730346	0.999000	0.42202	0.670000	0.29842	0.776000	0.43924	5.467000	0.66737	2.493000	0.84123	0.655000	0.94253	TCC	.	.		0.647	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387459.1		
DNAH17	8632	hgsc.bcm.edu	37	17	76503830	76503830	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr17:76503830G>T	ENST00000585328.1	-	28	4409	c.4285C>A	c.(4285-4287)Ccg>Acg	p.P1429T	DNAH17_ENST00000389840.5_Missense_Mutation_p.P1428T	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1428	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			CCTGTCCGCGGGTGCGGCTCG	0.552																																					p.P1432T		Atlas-SNP	.											.	DNAH17	347	.	0			c.C4294A						.						23.0	24.0	24.0					17																	76503830		2038	4196	6234	SO:0001583	missense	8632	exon28			TCCGCGGGTGCGG	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.4285C>A	chr17.hg19:g.76503830G>T	ENSP00000465516:p.Pro1429Thr	31.0	0.0		27.0	18.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	G	4.132	0.022823	0.08006	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.59906	0.23	4.92	3.88	0.44766	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.33614	0.0869	N	0.11064	0.09	0.32192	N	0.579001	B	0.02656	0.0	B	0.11329	0.006	T	0.33369	-0.9871	9	0.15499	T	0.54	.	8.1441	0.31102	0.0784:0.0:0.654:0.2676	.	1428	Q9UFH2	DYH17_HUMAN	T	1429;1428	ENSP00000374490:P1428T	ENSP00000300671:P1429T	P	-	1	0	DNAH17	74015425	0.798000	0.28890	1.000000	0.80357	0.985000	0.73830	0.122000	0.15687	2.236000	0.73375	0.563000	0.77884	CCG	.	.		0.552	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
TPGS2	25941	hgsc.bcm.edu	37	18	34385439	34385439	+	Missense_Mutation	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr18:34385439C>A	ENST00000334295.4	-	4	707	c.280G>T	c.(280-282)Gca>Tca	p.A94S	TPGS2_ENST00000587129.1_Missense_Mutation_p.A94S|TPGS2_ENST00000593035.1_Intron|TPGS2_ENST00000590842.1_Missense_Mutation_p.A94S|TPGS2_ENST00000589049.1_Missense_Mutation_p.A94S|TPGS2_ENST00000383056.3_Intron	NM_015476.2	NP_056291.2	Q68CL5	TPGS2_HUMAN	tubulin polyglutamylase complex subunit 2	94						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CTGTTAATTGCCATGCTTCCC	0.453																																					p.A94S		Atlas-SNP	.											.	.	.	.	0			c.G280T						.						283.0	236.0	252.0					18																	34385439		2203	4300	6503	SO:0001583	missense	25941	exon4			TAATTGCCATGCT	BC015178	CCDS32817.1, CCDS62421.1, CCDS62422.1, CCDS62423.1, CCDS62424.1, CCDS74214.1, CCDS74215.1	18q12.2	2011-11-25	2011-11-25	2011-11-25	ENSG00000134779	ENSG00000134779			24561	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 10"""	C18orf10		12477932	Standard	NM_015476		Approved	DKFZP586M1523, HsT3006	uc031rhw.1	Q68CL5		ENST00000334295.4:c.280G>T	chr18.hg19:g.34385439C>A	ENSP00000335144:p.Ala94Ser	156.0	0.0		97.0	43.0	NM_001271954	B4DIX2|K7EIJ9|Q4KN59|Q8WTU3|Q96BT9|Q9Y435	Missense_Mutation	SNP	ENST00000334295.4	hg19	CCDS32817.1	.	.	.	.	.	.	.	.	.	.	C	9.767	1.171608	0.21704	.	.	ENSG00000134779	ENST00000334295	T	0.28255	1.62	5.7	-0.0592	0.13794	Cell wall assembly/cell proliferation coordinating protein, KNR4-like (1);	0.796894	0.11948	N	0.513942	T	0.21590	0.0520	L	0.29908	0.895	0.23704	N	0.997061	B;B	0.30236	0.199;0.274	B;B	0.30179	0.076;0.112	T	0.18871	-1.0323	10	0.38643	T	0.18	0.2599	10.9003	0.47047	0.0:0.5243:0.0:0.4757	.	94;94	Q68CL5-3;Q68CL5	.;TPGS2_HUMAN	S	94	ENSP00000335144:A94S	ENSP00000335144:A94S	A	-	1	0	C18orf10	32639437	0.945000	0.32115	0.987000	0.45799	0.508000	0.34012	0.082000	0.14847	0.047000	0.15862	0.655000	0.94253	GCA	.	.		0.453	TPGS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000440410.2	NM_015476	
MADCAM1	8174	hgsc.bcm.edu	37	19	497839	497839	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr19:497839C>G	ENST00000215637.3	+	2	105	c.59C>G	c.(58-60)tCc>tGc	p.S20C	MADCAM1_ENST00000382683.4_Intron|AC005775.2_ENST00000592413.1_RNA|MADCAM1_ENST00000346144.4_Missense_Mutation_p.S20C|MADCAM1_ENST00000587541.1_Intron	NM_130760.2	NP_570116.2	Q13477	MADCA_HUMAN	mucosal vascular addressin cell adhesion molecule 1	20					aging (GO:0007568)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|embryo development (GO:0009790)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|leukocyte tethering or rolling (GO:0050901)|positive regulation of leukocyte migration (GO:0002687)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding involved in cell-matrix adhesion (GO:0098640)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(10;4.25e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCAGGCCAGTCCCTCCAGGTG	0.801																																					p.S20C		Atlas-SNP	.											.	MADCAM1	29	.	0			c.C59G						.						1.0	2.0	2.0					19																	497839		973	2063	3036	SO:0001583	missense	8174	exon2			GCCAGTCCCTCCA	U43628	CCDS12028.1, CCDS12029.1	19p13.3	2013-01-11			ENSG00000099866	ENSG00000099866		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6765	protein-coding gene	gene with protein product	"""mucosal addressin cell adhesion molecule-1"""	102670				9162097, 8609404	Standard	NM_130762		Approved	MACAM1	uc002los.3	Q13477	OTTHUMG00000180548	ENST00000215637.3:c.59C>G	chr19.hg19:g.497839C>G	ENSP00000215637:p.Ser20Cys	3.0	0.0		10.0	6.0	NM_130760	A5PKV4|B2RPL9|O60222|O75867|Q5UGI7	Missense_Mutation	SNP	ENST00000215637.3	hg19	CCDS12028.1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.907375	0.33628	.	.	ENSG00000099866	ENST00000537731;ENST00000542525;ENST00000543297;ENST00000215637;ENST00000346144	T;T	0.19938	2.43;2.11	1.41	-0.0249	0.13937	.	93.576700	0.00166	U	0.000000	T	0.09335	0.0230	N	0.02011	-0.69	0.09310	N	0.999999	B;B	0.06786	0.001;0.0	B;B	0.01281	0.0;0.0	T	0.24941	-1.0146	10	0.46703	T	0.11	.	5.9779	0.19391	0.0:0.5957:0.4043:0.0	.	20;20	B2RPL9;Q13477	.;MADCA_HUMAN	C	20	ENSP00000215637:S20C;ENSP00000304247:S20C	ENSP00000215637:S20C	S	+	2	0	MADCAM1	448839	0.001000	0.12720	0.001000	0.08648	0.628000	0.37860	0.595000	0.24029	0.076000	0.16826	0.165000	0.16767	TCC	.	.		0.801	MADCAM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451884.1	NM_130760	
PRSS57	400668	hgsc.bcm.edu	37	19	687062	687062	+	Nonsense_Mutation	SNP	C	C	A	rs376121318		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr19:687062C>A	ENST00000329267.7	-	4	537	c.508G>T	c.(508-510)Gag>Tag	p.E170*		NM_214710.3	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine, 57	170	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(5)	6						GGCGGCAGCTCCTCAAAGTCA	0.672																																					p.E170X		Atlas-SNP	.											.	PRSS57	18	.	0			c.G508T						.	C	stop/GLU	0,4406		0,0,2203	43.0	41.0	42.0		508	3.5	0.5	19		42	3,8597	3.0+/-9.4	0,3,4297	no	stop-gained	PRSS57	NM_214710.3		0,3,6500	AA,AC,CC		0.0349,0.0,0.0231		170/284	687062	3,13003	2203	4300	6503	SO:0001587	stop_gained	400668	exon4			GCAGCTCCTCAAA	AY358594	CCDS12041.1	19p13.3	2012-03-26	2011-03-07	2011-03-07		ENSG00000185198		"""Serine peptidases / Serine peptidases"""	31397	protein-coding gene	gene with protein product			"""protease, serine-like 1"""	PRSSL1		12975309	Standard	NM_214710		Approved	UNQ782	uc002lpl.1	Q6UWY2		ENST00000329267.7:c.508G>T	chr19.hg19:g.687062C>A	ENSP00000327386:p.Glu170*	256.0	1.0		148.0	59.0	NM_214710	B2RNW8	Nonsense_Mutation	SNP	ENST00000329267.7	hg19	CCDS12041.1	.	.	.	.	.	.	.	.	.	.	C	13.06	2.125780	0.37533	0.0	3.49E-4	ENSG00000185198	ENST00000329267	.	.	.	4.6	3.51	0.40186	.	0.702099	0.12310	N	0.480283	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	7.6261	0.28212	0.0:0.7436:0.1667:0.0897	.	.	.	.	X	170	.	ENSP00000327386:E170X	E	-	1	0	PRSS57	638062	0.146000	0.22672	0.527000	0.27925	0.043000	0.13939	1.382000	0.34374	2.107000	0.64212	0.462000	0.41574	GAG	.	.		0.672	PRSS57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452480.2	NM_214710	
SYDE1	85360	hgsc.bcm.edu	37	19	15224669	15224669	+	Silent	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr19:15224669C>T	ENST00000342784.2	+	8	2134	c.2103C>T	c.(2101-2103)gaC>gaT	p.D701D	SYDE1_ENST00000600440.1_Silent_p.D634D|SYDE1_ENST00000600252.1_Silent_p.D358D	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	701					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						ACTTCGAAGACGACTTCGATG	0.597																																					p.D701D		Atlas-SNP	.											.	SYDE1	44	.	0			c.C2103T						.						134.0	143.0	140.0					19																	15224669		2203	4300	6503	SO:0001819	synonymous_variant	85360	exon8			CGAAGACGACTTC	BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.2103C>T	chr19.hg19:g.15224669C>T		113.0	0.0		81.0	17.0	NM_033025	Q7L2I8|Q8N6J2|Q9H8K4	Silent	SNP	ENST00000342784.2	hg19	CCDS12324.1																																																																																			.	.		0.597	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465666.1	NM_033025	
RPS16	6217	hgsc.bcm.edu	37	19	39926515	39926515	+	Silent	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr19:39926515C>A	ENST00000251453.3	-	1	73	c.21G>T	c.(19-21)ctG>ctT	p.L7L	RPS16_ENST00000339471.4_Silent_p.L7L|RPS16_ENST00000601655.1_Silent_p.L7L|RPS16_ENST00000599539.1_Silent_p.L7L	NM_001020.4	NP_001011.1	P62249	RS16_HUMAN	ribosomal protein S16	7					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			central_nervous_system(1)|large_intestine(2)|lung(2)|skin(2)	7	all_cancers(60;3.08e-07)|all_lung(34;2.66e-08)|Lung NSC(34;3e-08)|all_epithelial(25;6.57e-07)|Ovarian(47;0.0569)		Epithelial(26;4.14e-26)|all cancers(26;2.68e-23)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCACAGACTGCAGCGGGCCCT	0.667																																					p.L7L		Atlas-SNP	.											.	RPS16	12	.	0			c.G21T						.						46.0	46.0	46.0					19																	39926515		2202	4300	6502	SO:0001819	synonymous_variant	6217	exon1			AGACTGCAGCGGG	M60854	CCDS12535.1	19q13.1	2011-04-05				ENSG00000105193		"""S ribosomal proteins"""	10396	protein-coding gene	gene with protein product	"""40S ribosomal protein S16"""	603675				2016298, 9582194	Standard	XM_005259137		Approved	S16	uc002olk.3	P62249		ENST00000251453.3:c.21G>T	chr19.hg19:g.39926515C>A		37.0	0.0		40.0	29.0	NM_001020	B2RDD5|P17008	Silent	SNP	ENST00000251453.3	hg19	CCDS12535.1																																																																																			.	.		0.667	RPS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464511.1	NM_001020	
GGTLC1	92086	hgsc.bcm.edu	37	20	23966368	23966368	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr20:23966368T>C	ENST00000335694.4	-	5	671	c.467A>G	c.(466-468)gAg>gGg	p.E156G	GGTLC1_ENST00000278765.4_Missense_Mutation_p.E156G|GGTLC1_ENST00000286890.4_Missense_Mutation_p.E156G	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	156					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						CCGGGGCTCCTCCACGGCCCA	0.607																																					p.E156G		Atlas-SNP	.											.	GGTLC1	37	.	0			c.A467G						.						75.0	78.0	77.0					20																	23966368		2203	4293	6496	SO:0001583	missense	92086	exon5			GGCTCCTCCACGG	AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.467A>G	chr20.hg19:g.23966368T>C	ENSP00000337587:p.Glu156Gly	52.0	0.0		63.0	41.0	NM_178311	D3DW43|Q08246	Missense_Mutation	SNP	ENST00000335694.4	hg19	CCDS13163.1	.	.	.	.	.	.	.	.	.	.	t	8.818	0.936846	0.18206	.	.	ENSG00000149435	ENST00000286890;ENST00000278765;ENST00000335694	T;T;T	0.07908	3.15;3.15;3.15	0.844	0.844	0.18943	.	0.406919	0.26082	N	0.026454	T	0.08626	0.0214	M	0.62016	1.91	0.30145	N	0.80361	B	0.15930	0.015	B	0.18263	0.021	T	0.09862	-1.0655	10	0.40728	T	0.16	-28.6386	5.802	0.18420	0.0:1.0E-4:0.0:0.9999	.	156	Q9BX51	GGTL1_HUMAN	G	156	ENSP00000286890:E156G;ENSP00000278765:E156G;ENSP00000337587:E156G	ENSP00000278765:E156G	E	-	2	0	GGTLC1	23914368	0.837000	0.29446	0.220000	0.23810	0.222000	0.24845	0.469000	0.22067	0.077000	0.16863	0.076000	0.15429	GAG	.	.		0.607	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078366.2	NM_178311.2	
POFUT1	23509	hgsc.bcm.edu	37	20	30818724	30818724	+	Missense_Mutation	SNP	A	A	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr20:30818724A>G	ENST00000375749.3	+	6	900	c.838A>G	c.(838-840)Atg>Gtg	p.M280V	POFUT1_ENST00000539210.1_Missense_Mutation_p.M69V|POFUT1_ENST00000486717.1_3'UTR	NM_015352.1	NP_056167.1	Q9H488	OFUT1_HUMAN	protein O-fucosyltransferase 1	280					angiogenesis (GO:0001525)|embryo development (GO:0009790)|fucose metabolic process (GO:0006004)|heart development (GO:0007507)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|O-glycan processing (GO:0016266)|protein O-linked fucosylation (GO:0036066)|protein O-linked glycosylation (GO:0006493)|regulation of transcription, DNA-templated (GO:0006355)|somitogenesis (GO:0001756)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	fucosyltransferase activity (GO:0008417)|peptide-O-fucosyltransferase activity (GO:0046922)			breast(1)|endometrium(1)|large_intestine(1)|lung(2)|urinary_tract(1)	6			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCCCCTCACGATGACTATGTG	0.617																																					p.M280V		Atlas-SNP	.											.	POFUT1	52	.	0			c.A838G						.						91.0	83.0	86.0					20																	30818724		2203	4300	6503	SO:0001583	missense	23509	exon6			CTCACGATGACTA	AF375884	CCDS13198.1, CCDS13199.1	20q11	2013-03-06			ENSG00000101346	ENSG00000101346	2.4.1.221	"""Fucosyltransferases"""	14988	protein-coding gene	gene with protein product	"""peptide-O-fucosyltransferase"", ""GDP-fucose protein O-fucosyltransferase 1"""	607491				9023546, 9525914	Standard	NM_015352		Approved	O-FUT, O-Fuc-T, KIAA0180, FUT12	uc002wxp.3	Q9H488	OTTHUMG00000133268	ENST00000375749.3:c.838A>G	chr20.hg19:g.30818724A>G	ENSP00000364902:p.Met280Val	104.0	0.0		120.0	5.0	NM_015352	A8K4R8|E1P5M4|Q14685|Q5W185|Q9BW76	Missense_Mutation	SNP	ENST00000375749.3	hg19	CCDS13198.1	.	.	.	.	.	.	.	.	.	.	A	9.094	1.002379	0.19121	.	.	ENSG00000101346	ENST00000375749;ENST00000539210	T;T	0.29142	1.58;1.58	5.19	1.25	0.21368	.	0.542116	0.21731	N	0.069973	T	0.21718	0.0523	L	0.60455	1.87	0.30163	N	0.801988	B	0.11235	0.004	B	0.18263	0.021	T	0.23119	-1.0197	10	0.11485	T	0.65	-11.5451	3.5038	0.07683	0.6309:0.1709:0.0739:0.1243	.	280	Q9H488	OFUT1_HUMAN	V	280;69	ENSP00000364902:M280V;ENSP00000446154:M69V	ENSP00000364902:M280V	M	+	1	0	POFUT1	30282385	0.991000	0.36638	0.995000	0.50966	0.835000	0.47333	0.488000	0.22371	0.254000	0.21573	0.477000	0.44152	ATG	.	.		0.617	POFUT1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078613.1	NM_015352	
GNAS	2778	hgsc.bcm.edu	37	20	57429286	57429286	+	Missense_Mutation	SNP	C	C	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr20:57429286C>T	ENST00000306120.3	+	1	776	c.776C>T	c.(775-777)cCg>cTg	p.P259L	GNAS_ENST00000371100.4_Silent_p.P322P|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371098.2_Intron|GNAS_ENST00000371102.4_Silent_p.P322P|GNAS_ENST00000371075.3_Intron|GNAS_ENST00000371099.2_Silent_p.P322P			P63092	GNAS2_HUMAN	GNAS complex locus	0			E -> V (in AHO). {ECO:0000269|PubMed:12624854}.		activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			ACGACACTCCCGTCAACATGG	0.642			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											p.P260L	Colon(117;935 1597 6045 8307 46442)	Atlas-SNP	.		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	GNAS_ENST00000371100,NS,carcinoma,0,1	GNAS	867	.	0			c.C779T						.						20.0	25.0	23.0					20																	57429286		1910	4105	6015	SO:0001583	missense	2778	exon1			CACTCCCGTCAAC	M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000306120.3:c.776C>T	chr20.hg19:g.57429286C>T	ENSP00000302237:p.Pro259Leu	115.0	0.0		194.0	103.0	NM_001077490	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	ENST00000306120.3	hg19		.	.	.	.	.	.	.	.	.	.	C	13.02	2.111752	0.37242	.	.	ENSG00000087460	ENST00000306120	.	.	.	3.76	2.51	0.30379	.	9.224370	0.00166	N	0.000004	T	0.64159	0.2573	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52268	-0.8598	6	0.72032	D	0.01	.	7.2563	0.26179	0.0:0.7984:0.0:0.2016	.	.	.	.	L	259	.	ENSP00000302237:P259L	P	+	2	0	GNAS	56862681	0.551000	0.26497	1.000000	0.80357	0.896000	0.52359	0.590000	0.23954	0.780000	0.33566	0.462000	0.41574	CCG	.	.		0.642	GNAS-050	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000267987.1	NM_000516	
DIP2A	23181	hgsc.bcm.edu	37	21	47976001	47976001	+	Silent	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr21:47976001G>T	ENST00000417564.2	+	29	3516	c.3495G>T	c.(3493-3495)gtG>gtT	p.V1165V	DIP2A_ENST00000400274.1_Silent_p.V1161V|DIP2A_ENST00000427143.2_Silent_p.V1101V|DIP2A_ENST00000318711.7_Silent_p.V1166V			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1165					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		TAGCGGGAGTGAAGGTAGGTC	0.493																																					p.V1165V		Atlas-SNP	.											.	DIP2A	332	.	0			c.G3495T						.						139.0	141.0	140.0					21																	47976001		1955	4137	6092	SO:0001819	synonymous_variant	23181	exon29			GGGAGTGAAGGTA	AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3495G>T	chr21.hg19:g.47976001G>T		109.0	0.0		71.0	18.0	NM_015151	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	ENST00000417564.2	hg19	CCDS46655.1																																																																																			.	.		0.493	DIP2A-012	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376736.1	NM_015151	
POTEH	23784	hgsc.bcm.edu	37	22	16287880	16287880	+	Silent	SNP	C	C	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr22:16287880C>A	ENST00000343518.6	-	1	57	c.6G>T	c.(4-6)gtG>gtT	p.V2V		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	2										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CAGCCTCAGCCACCATCTGCT	0.552																																					p.V2V		Atlas-SNP	.											.	POTEH	114	.	0			c.G6T						.						61.0	71.0	68.0					22																	16287880		1968	3794	5762	SO:0001819	synonymous_variant	23784	exon1			CTCAGCCACCATC	AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.6G>T	chr22.hg19:g.16287880C>A		727.0	1.0		507.0	111.0	NM_001136213	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	ENST00000343518.6	hg19	CCDS46658.1																																																																																			.	.		0.552	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000276918.4	NM_001136213	
SREBF2	6721	hgsc.bcm.edu	37	22	42273342	42273342	+	Missense_Mutation	SNP	C	C	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr22:42273342C>G	ENST00000361204.4	+	8	1662	c.1496C>G	c.(1495-1497)tCc>tGc	p.S499C		NM_004599.2	NP_004590.2	Q12772	SRBP2_HUMAN	sterol regulatory element binding transcription factor 2	499					cellular lipid metabolic process (GO:0044255)|cellular response to laminar fluid shear stress (GO:0071499)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cholesterol homeostasis (GO:2000188)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|response to low-density lipoprotein particle (GO:0055098)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SREBP-SCAP-Insig complex (GO:0032937)	E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(6)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	38						CCCCTGACTTCCCTGCTGCAG	0.617																																					p.S499C		Atlas-SNP	.											.	SREBF2	99	.	0			c.C1496G						.						107.0	104.0	105.0					22																	42273342		2203	4300	6503	SO:0001583	missense	6721	exon8			TGACTTCCCTGCT	U02031	CCDS14023.1	22q13.2	2013-05-21			ENSG00000198911	ENSG00000198911		"""Basic helix-loop-helix proteins"""	11290	protein-coding gene	gene with protein product		600481				7903453	Standard	NM_004599		Approved	SREBP2, bHLHd2	uc003bbi.3	Q12772	OTTHUMG00000151261	ENST00000361204.4:c.1496C>G	chr22.hg19:g.42273342C>G	ENSP00000354476:p.Ser499Cys	101.0	0.0		73.0	42.0	NM_004599	Q05BD5|Q6GTH7|Q86V36|Q9UH04	Missense_Mutation	SNP	ENST00000361204.4	hg19	CCDS14023.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307905	0.81247	.	.	ENSG00000198911	ENST00000361204;ENST00000444813;ENST00000457567	T	0.58506	0.33	6.06	3.99	0.46301	.	0.315300	0.39985	N	0.001216	T	0.65015	0.2651	M	0.72353	2.195	0.52099	D	0.999942	P	0.51147	0.942	P	0.50934	0.654	T	0.67848	-0.5564	10	0.59425	D	0.04	-3.0553	12.4248	0.55540	0.0:0.8657:0.0:0.1343	.	499	Q12772	SRBP2_HUMAN	C	499	ENSP00000354476:S499C	ENSP00000354476:S499C	S	+	2	0	SREBF2	40603288	0.594000	0.26849	0.215000	0.23724	0.985000	0.73830	3.991000	0.56973	0.901000	0.36495	0.643000	0.83706	TCC	.	.		0.617	SREBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321956.1	NM_004599	
MSL3	10943	hgsc.bcm.edu	37	X	11790751	11790751	+	Missense_Mutation	SNP	G	G	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:11790751G>A	ENST00000312196.4	+	12	1498	c.1393G>A	c.(1393-1395)Gaa>Aaa	p.E465K	MSL3_ENST00000361672.2_Missense_Mutation_p.E316K|MSL3_ENST00000398527.2_Missense_Mutation_p.E453K|MSL3_ENST00000380693.3_Missense_Mutation_p.E299K	NM_078629.3	NP_523353.2	Q8N5Y2	MS3L1_HUMAN	male-specific lethal 3 homolog (Drosophila)	465	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|multicellular organismal development (GO:0007275)|transcription from RNA polymerase II promoter (GO:0006366)	MSL complex (GO:0072487)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|urinary_tract(1)	19						GAAACTTCCAGAAATCCTTGG	0.358																																					p.E465K		Atlas-SNP	.											.	MSL3	88	.	0			c.G1393A						.						77.0	69.0	72.0					X																	11790751		2203	4300	6503	SO:0001583	missense	10943	exon12			CTTCCAGAAATCC	AF117065	CCDS14147.1, CCDS14148.1, CCDS14149.1, CCDS55369.1, CCDS65213.1	Xp22.3	2008-10-29	2008-10-29	2008-10-29	ENSG00000005302	ENSG00000005302			7370	protein-coding gene	gene with protein product		300609	"""male-specific lethal-3 (Drosophila)-like 1"", ""male-specific lethal 3-like 1 (Drosophila)"""	MSL3L1		10395802, 10908644	Standard	NM_078628		Approved		uc004cuw.3	Q8N5Y2	OTTHUMG00000021132	ENST00000312196.4:c.1393G>A	chrX.hg19:g.11790751G>A	ENSP00000312244:p.Glu465Lys	246.0	0.0		203.0	121.0	NM_078629	A6NCU2|A6NHW8|A8K165|B4DUV8|B7Z227|Q9UG70|Q9Y5Z8	Missense_Mutation	SNP	ENST00000312196.4	hg19	CCDS14147.1	.	.	.	.	.	.	.	.	.	.	G	27.9	4.875542	0.91664	.	.	ENSG00000005302	ENST00000312196;ENST00000361672;ENST00000398527;ENST00000380693	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	5.0	5.0	0.66597	.	0.000000	0.85682	D	0.000000	T	0.40694	0.1127	M	0.89968	3.075	0.54753	D	0.999988	D;D;D;D	0.76494	0.999;0.997;0.996;0.999	D;D;D;D	0.81914	0.995;0.989;0.987;0.995	T	0.46789	-0.9166	10	0.32370	T	0.25	.	17.5611	0.87908	0.0:0.0:1.0:0.0	.	453;316;406;465	B4DUV8;B7Z227;Q8N5Y2-2;Q8N5Y2	.;.;.;MS3L1_HUMAN	K	465;316;453;299	ENSP00000312244:E465K;ENSP00000354562:E316K;ENSP00000381538:E453K;ENSP00000370069:E299K	ENSP00000312244:E465K	E	+	1	0	MSL3	11700672	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.649000	0.91067	2.074000	0.62210	0.600000	0.82982	GAA	.	.		0.358	MSL3-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055757.1	NM_006800	
CXorf58	254158	hgsc.bcm.edu	37	X	23928463	23928463	+	Nonsense_Mutation	SNP	C	C	G			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:23928463C>G	ENST00000379211.3	+	2	593	c.44C>G	c.(43-45)tCa>tGa	p.S15*	APOO_ENST00000379220.3_5'Flank|APOO_ENST00000379226.4_5'Flank	NM_001169574.1|NM_152761.2	NP_001163045.1|NP_689974.2	Q96LI9	CX058_HUMAN	chromosome X open reading frame 58	15										breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)	14						ATTCTGAAATCAGGTACAAGA	0.358																																					p.S15X		Atlas-SNP	.											.	CXorf58	53	.	0			c.C44G						.						129.0	98.0	109.0					X																	23928463		2203	4300	6503	SO:0001587	stop_gained	254158	exon2			TGAAATCAGGTAC	AK058173	CCDS14209.1	Xp22.11	2012-11-28			ENSG00000165182	ENSG00000165182			26356	protein-coding gene	gene with protein product							Standard	NM_152761		Approved	FLJ25444	uc004daz.1	Q96LI9	OTTHUMG00000021258	ENST00000379211.3:c.44C>G	chrX.hg19:g.23928463C>G	ENSP00000368511:p.Ser15*	381.0	0.0		374.0	204.0	NM_152761		Nonsense_Mutation	SNP	ENST00000379211.3	hg19	CCDS14209.1	.	.	.	.	.	.	.	.	.	.	C	38	6.777893	0.97833	.	.	ENSG00000165182	ENST00000379211	.	.	.	3.52	1.74	0.24563	.	0.261790	0.20378	N	0.093510	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-3.7147	5.1842	0.15176	0.0:0.7194:0.0:0.2806	.	.	.	.	X	15	.	ENSP00000368511:S15X	S	+	2	0	CXorf58	23838384	0.760000	0.28428	0.037000	0.18230	0.003000	0.03518	0.933000	0.28897	0.334000	0.23590	-0.192000	0.12808	TCA	.	.		0.358	CXorf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056071.1	NM_152761	
MAGED1	9500	hgsc.bcm.edu	37	X	51638488	51638488	+	Missense_Mutation	SNP	T	T	C			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:51638488T>C	ENST00000375722.1	+	3	637	c.385T>C	c.(385-387)Tcc>Ccc	p.S129P	MAGED1_ENST00000494718.1_3'UTR|MAGED1_ENST00000326587.7_Missense_Mutation_p.S129P|MAGED1_ENST00000375772.3_Missense_Mutation_p.S129P|MAGED1_ENST00000375695.2_Missense_Mutation_p.S185P			Q9Y5V3	MAGD1_HUMAN	melanoma antigen family D, 1	129					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|circadian regulation of gene expression (GO:0032922)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of circadian rhythm (GO:0042752)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|large_intestine(10)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	32	Ovarian(276;0.236)					CTATGATTTTTCCCAGGCAGC	0.512										Multiple Myeloma(10;0.10)																											p.S185P		Atlas-SNP	.											.	MAGED1	84	.	0			c.T553C						.						42.0	37.0	39.0					X																	51638488		2203	4297	6500	SO:0001583	missense	9500	exon4			GATTTTTCCCAGG	AF124440	CCDS14337.1, CCDS35279.1	Xp11.23	2008-08-01			ENSG00000179222	ENSG00000179222			6813	protein-coding gene	gene with protein product		300224				10409427	Standard	NM_006986		Approved	NRAGE, DLXIN-1	uc004dpn.3	Q9Y5V3	OTTHUMG00000021540	ENST00000375722.1:c.385T>C	chrX.hg19:g.51638488T>C	ENSP00000364874:p.Ser129Pro	196.0	0.0		178.0	42.0	NM_001005333	Q5VSH6|Q8IZ84|Q8WY92|Q9H352|Q9HBT4|Q9UF36	Missense_Mutation	SNP	ENST00000375722.1	hg19	CCDS14337.1	.	.	.	.	.	.	.	.	.	.	T	12.24	1.877151	0.33162	.	.	ENSG00000179222	ENST00000375772;ENST00000375722;ENST00000326587;ENST00000375695	T;T;T;T	0.57107	0.42;0.42;0.42;0.42	3.91	3.91	0.45181	.	0.000000	0.42821	D	0.000641	T	0.40743	0.1129	L	0.34521	1.04	0.31722	N	0.638211	P;B	0.37731	0.607;0.236	B;B	0.39419	0.299;0.081	T	0.52298	-0.8594	10	0.46703	T	0.11	.	8.3147	0.32093	0.0:0.0:0.0:1.0	.	185;129	Q9Y5V3-2;Q9Y5V3	.;MAGD1_HUMAN	P	129;129;129;185	ENSP00000364927:S129P;ENSP00000364874:S129P;ENSP00000325333:S129P;ENSP00000364847:S185P	ENSP00000325333:S129P	S	+	1	0	MAGED1	51655228	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.904000	0.48719	1.781000	0.52344	0.422000	0.28245	TCC	.	.		0.512	MAGED1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056593.1	NM_001005332	
PHF8	23133	hgsc.bcm.edu	37	X	54013589	54013589	+	Silent	SNP	G	G	A	rs148356929		TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:54013589G>A	ENST00000357988.5	-	16	2383	c.2025C>T	c.(2023-2025)ccC>ccT	p.P675P	PHF8_ENST00000338946.6_Silent_p.P538P|PHF8_ENST00000338154.6_Silent_p.P639P|PHF8_ENST00000322659.8_Silent_p.P639P	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	675					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						GCAATTTCCGGGGAAATTCTA	0.423																																					p.P675P		Atlas-SNP	.											.	PHF8	198	.	0			c.C2025T						.						70.0	61.0	64.0					X																	54013589		2203	4300	6503	SO:0001819	synonymous_variant	23133	exon16			TTTCCGGGGAAAT	AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.2025C>T	chrX.hg19:g.54013589G>A		173.0	0.0		153.0	86.0	NM_001184896	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Silent	SNP	ENST00000357988.5	hg19	CCDS55420.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.574|9.574	1.121761|1.121761	0.20877|0.20877	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000396282|ENST00000443302	T|T	0.31247|0.45668	1.5|0.89	5.08|5.08	0.976|0.976	0.19727|0.19727	.|.	0.594842|0.594842	0.18063|0.18063	N|N	0.152871|0.152871	T|T	0.39410|0.39410	0.1077|0.1077	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.07731|0.07731	-1.0757|-1.0757	7|7	0.45353|0.28530	T|T	0.12|0.3	-6.1382|-6.1382	7.6553|7.6553	0.28371|0.28371	0.4155:0.0:0.5845:0.0|0.4155:0.0:0.5845:0.0	.|.	.|.	.|.	.|.	L|S	543|403	ENSP00000379578:P543L|ENSP00000397129:P403S	ENSP00000379578:P543L|ENSP00000397129:P403S	P|P	-|-	2|1	0|0	PHF8|PHF8	54030314|54030314	0.951000|0.951000	0.32395|0.32395	0.991000|0.991000	0.47740|0.47740	0.986000|0.986000	0.74619|0.74619	-0.032000|-0.032000	0.12266|0.12266	-0.249000|-0.249000	0.09569|0.09569	-0.407000|-0.407000	0.06327|0.06327	CCC|CCG	.	G|1.000;C|0.000		0.423	PHF8-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056784.2	NM_015107	
AR	367	hgsc.bcm.edu	37	X	66765551	66765552	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:66765551_66765552CC>AA	ENST00000374690.3	+	1	1087_1088	c.563_564CC>AA	c.(562-564)gCC>gAA	p.A188E	AR_ENST00000504326.1_Missense_Mutation_p.A188E|AR_ENST00000396044.3_Missense_Mutation_p.A188E|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	186	Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	CTGAGCGAGGCCAGCACCATGC	0.624									Androgen Insensitivity Syndrome																												p.A188D|p.A188A		Atlas-SNP	.											.	AR	249	.	0			c.C563A|c.C564A						.																																			SO:0001583	missense	367	exon1	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	GCGAGGCCAGCAC|CGAGGCCAGCACC	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	Exception_encountered	chrX.hg19:g.66765551_66765552delinsAA	ENSP00000363822:p.Ala188Glu	156.0|157.0	0.0		172.0|170.0	58.0|57.0	NM_000044	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation|Silent	SNP	ENST00000374690.3	hg19	CCDS14387.1																																																																																			.	.		0.624	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057007.1	NM_000044	
TAF1	6872	hgsc.bcm.edu	37	X	70598216	70598216	+	Silent	SNP	T	T	A			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:70598216T>A	ENST00000373790.4	+	7	1113	c.1062T>A	c.(1060-1062)ggT>ggA	p.G354G	TAF1_ENST00000423759.1_Silent_p.G375G|TAF1_ENST00000449580.1_Silent_p.G354G|TAF1_ENST00000276072.3_Silent_p.G375G	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	354	Protein kinase 1.				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ATATGCTGGGTGTCCCTGAAG	0.453																																					p.G375G		Atlas-SNP	.											.	TAF1	439	.	0			c.T1125A						.						197.0	161.0	174.0					X																	70598216		2203	4300	6503	SO:0001819	synonymous_variant	6872	exon7			GCTGGGTGTCCCT		CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.1062T>A	chrX.hg19:g.70598216T>A		258.0	0.0		227.0	56.0	NM_004606	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Silent	SNP	ENST00000373790.4	hg19	CCDS35325.1																																																																																			.	.		0.453	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000058995.2	NM_004606	
RBMXL3	139804	hgsc.bcm.edu	37	X	114426238	114426238	+	Missense_Mutation	SNP	G	G	T			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chrX:114426238G>T	ENST00000424776.3	+	1	2276	c.2234G>T	c.(2233-2235)gGt>gTt	p.G745V	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	745	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						GGAGGAGGAGGTCGCTCACTC	0.667																																					p.G745V		Atlas-SNP	.											.	RBMXL3	83	.	0			c.G2234T						.						58.0	56.0	57.0					X																	114426238		692	1591	2283	SO:0001583	missense	139804	exon1			GAGGAGGTCGCTC	AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2234G>T	chrX.hg19:g.114426238G>T	ENSP00000417451:p.Gly745Val	133.0	0.0		75.0	64.0	NM_001145346	B4DXC0	Missense_Mutation	SNP	ENST00000424776.3	hg19	CCDS55478.1	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270666	0.23221	.	.	ENSG00000175718	ENST00000424776	T	0.07800	3.16	0.0465	0.0465	0.14256	.	.	.	.	.	T	0.09862	0.0242	N	0.08118	0	0.32236	N	0.573298	D	0.64830	0.994	D	0.67725	0.953	T	0.32322	-0.9911	8	0.87932	D	0	.	.	.	.	.	745	Q8N7X1	RMXL3_HUMAN	V	745	ENSP00000417451:G745V	ENSP00000417451:G745V	G	+	2	0	RBMXL3	114332494	0.566000	0.26618	0.016000	0.15963	0.017000	0.09413	-0.352000	0.07701	0.122000	0.18314	0.124000	0.15798	GGT	.	.		0.667	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057968.3	NM_001145346	
ACVR2A	92	hgsc.bcm.edu	37	2	148684720	148684736	+	Frame_Shift_Del	DEL	ATGTGTAGGTGAAAGAA	ATGTGTAGGTGAAAGAA	-			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	ATGTGTAGGTGAAAGAA	ATGTGTAGGTGAAAGAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:148684720_148684736delATGTGTAGGTGAAAGAA	ENST00000241416.7	+	11	2055_2071	c.1419_1435delATGTGTAGGTGAAAGAA	c.(1417-1437)ggatgtgtaggtgaaagaattfs	p.CVGERI474fs	ACVR2A_ENST00000495775.1_3'UTR|ACVR2A_ENST00000404590.1_Frame_Shift_Del_p.CVGERI474fs|ACVR2A_ENST00000535787.1_Frame_Shift_Del_p.CVGERI366fs	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	474	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		TATCAGCTGGATGTGTAGGTGAAAGAATTACCCAGAT	0.41																																					p.473_478del		Atlas-Indel,Pindel	.											.	ACVR2A	125	.	0			c.1418_1434del						.																																			SO:0001589	frameshift_variant	92	exon11			.		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.1419_1435delATGTGTAGGTGAAAGAA	chr2.hg19:g.148684720_148684736delATGTGTAGGTGAAAGAA	ENSP00000241416:p.Cys474fs	138.0	0.0		51.0	15.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Frame_Shift_Del	DEL	ENST00000241416.7	hg19	CCDS33301.1																																																																																			.	.		0.410	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
Unknown	0	hgsc.bcm.edu	37	2	98160311	98160311	+	IGR	DEL	C	C	-			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:98160311delC								AC159540.1 (69262 upstream) : ANKRD36B (3716 downstream)																							CAGAATCTTTCTTGTCACTTG	0.318																																					p.K576fs		Atlas-INDEL	.											.	.	.	.	0			c.1726delA						.						1.0	1.0	1.0					2																	98160311		89	138	227	SO:0001628	intergenic_variant	57730	exon26			.																													chr2.hg19:g.98160311delC		78.0	0.0		44.0	11.0	NM_025190		Frame_Shift_Del	DEL		hg19																																																																																				.	.	0	0.318								
ITGB5	3693	hgsc.bcm.edu	37	3	124483275	124483275	+	Frame_Shift_Del	DEL	T	T	-			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr3:124483275delT	ENST00000296181.4	-	14	2563	c.2267delA	c.(2266-2268)aagfs	p.K756fs	ITGB5_ENST00000461306.1_5'Flank	NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	756					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		GCTCTGAAACTTTGCAAACTC	0.557																																					p.K756fs		Atlas-Indel,Pindel	.											.	ITGB5	66	.	0			c.2268delG						.						63.0	59.0	60.0					3																	124483275		2203	4300	6503	SO:0001589	frameshift_variant	3693	exon14			.	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.2267delA	chr3.hg19:g.124483275delT	ENSP00000296181:p.Lys756fs	79.0	0.0		60.0	21.0	NM_002213	B0LPF8|B2RD70	Frame_Shift_Del	DEL	ENST00000296181.4	hg19	CCDS3030.1																																																																																			.	.		0.557	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
DHX57	90957	hgsc.bcm.edu	37	2	39046259	39046261	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	CTT	CTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr2:39046259_39046261delCTT	ENST00000295373.6	-	18	3443_3445	c.3317_3319delAAG	c.(3316-3321)gaagct>gct	p.E1106del		NM_198963.1	NP_945314.1	Q6P158	DHX57_HUMAN	DEAH (Asp-Glu-Ala-Asp/His) box polypeptide 57	1106							ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(20)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	62		all_hematologic(82;0.248)				TTCTGGTTAGCTTCTTCTTTTTT	0.36																																					p.1106_1107del	Melanoma(191;1090 2095 4375 23729 47341)	Atlas-Indel,Pindel	.											.	DHX57	127	.	0			c.3318_3320del						.																																			SO:0001651	inframe_deletion	90957	exon18			.	AF070590	CCDS1800.1	2p22.3	2008-02-05			ENSG00000163214	ENSG00000163214		"""DEAH-boxes"""	20086	protein-coding gene	gene with protein product							Standard	NM_198963		Approved	DDX57	uc002rrf.3	Q6P158	OTTHUMG00000102103	ENST00000295373.6:c.3317_3319delAAG	chr2.hg19:g.39046265_39046267delCTT	ENSP00000295373:p.Glu1106del	191.0	0.0		137.0	52.0	NM_198963	A2RRC7|Q53SI4|Q6P9G1|Q7Z6H3|Q8NG17|Q96M33	In_Frame_Del	DEL	ENST00000295373.6	hg19	CCDS1800.1																																																																																			.	.		0.360	DHX57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219940.2	NM_145646	
LRRC49	54839	hgsc.bcm.edu	37	15	71305223	71305225	+	In_Frame_Del	DEL	TCG	TCG	-	rs199883910|rs150157186	byFrequency	TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	TCG	TCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr15:71305223_71305225delTCG	ENST00000260382.5	+	14	1934_1936	c.1674_1676delTCG	c.(1672-1677)tatcgt>tat	p.R559del	LRRC49_ENST00000443425.2_In_Frame_Del_p.R515del|LRRC49_ENST00000436542.2_3'UTR|LRRC49_ENST00000560158.2_In_Frame_Del_p.R247del|LRRC49_ENST00000544974.2_In_Frame_Del_p.R549del|LRRC49_ENST00000560369.1_In_Frame_Del_p.R564del|LRRC49_ENST00000560691.1_In_Frame_Del_p.R265del	NM_001199017.1|NM_017691.3	NP_001185946.1|NP_060161.2	Q8IUZ0	LRC49_HUMAN	leucine rich repeat containing 49	559						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(3)|skin(3)	34						TACCCCAGTATCGTCTGATTTCC	0.365																																					p.563_564del		Atlas-Indel,Pindel	.											.	LRRC49	73	.	0			c.1688_1690del						.																																			SO:0001651	inframe_deletion	54839	exon14			.		CCDS32282.1, CCDS55971.1, CCDS58376.1, CCDS61694.1	15q23	2005-08-09				ENSG00000137821			25965	protein-coding gene	gene with protein product						12477932	Standard	NM_001199017		Approved	FLJ20156	uc010ukf.2	Q8IUZ0		ENST00000260382.5:c.1674_1676delTCG	chr15.hg19:g.71305223_71305225delTCG	ENSP00000260382:p.Arg559del	88.0	0.0		63.0	29.0	NM_001199017	B3KVX1|B7Z366|F5H1J4|G5E9T5|H0YLN4|Q9NXM6	In_Frame_Del	DEL	ENST00000260382.5	hg19	CCDS32282.1																																																																																			.	.		0.365	LRRC49-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417209.3	NM_017691	
ANKRD18B	441459	hgsc.bcm.edu	37	9	33524684	33524685	+	Frame_Shift_Ins	INS	-	-	A	rs3843933	byFrequency	TCGA-CC-A8HU-01A-11D-A35Z-10	TCGA-CC-A8HU-10A-01D-A35Z-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1e5d7d4f-5e5c-46e5-b7de-7cc07db0791d	bb86c7c8-28de-4fbb-830b-e0328aa71b1d	g.chr9:33524684_33524685insA	ENST00000290943.6	+	1	293_294	c.197_198insA	c.(196-201)agaaaafs	p.RK66fs		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	66										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						GTCCGCGACAGAAAAGACAGGT	0.708																																					p.R66fs		Pindel	.											.	ANKRD18B	46	.	0			c.197_198insA						.																																			SO:0001589	frameshift_variant	441459	exon1			.			9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.201dupA	chr9.hg19:g.33524688_33524688dupA	ENSP00000290943:p.Arg66fs	153.0	0.0		65.0	27.0	NM_001244752		Frame_Shift_Ins	INS	ENST00000290943.6	hg19																																																																																				.	.		0.708	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000313729.2	XM_001718334	
