#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
SKI	6497	hgsc.bcm.edu	37	1	2234733	2234733	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:2234733T>C	ENST00000378536.4	+	3	1177	c.1105T>C	c.(1105-1107)Tgt>Cgt	p.C369R	SKI_ENST00000478223.2_3'UTR	NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	369					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		GAGCCTGGGCTGTGTTCACCC	0.617																																					p.C369R	Ovarian(177;144 1678 13697 20086 27838 40755)	Atlas-SNP	.											.	SKI	33	.	0			c.T1105C						.						145.0	146.0	145.0					1																	2234733		2203	4300	6503	SO:0001583	missense	6497	exon3			CTGGGCTGTGTTC	X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1105T>C	chr1.hg19:g.2234733T>C	ENSP00000367797:p.Cys369Arg	108.0	0.0		62.0	4.0	NM_003036	Q5SYT7	Missense_Mutation	SNP	ENST00000378536.4	hg19	CCDS39.1	.	.	.	.	.	.	.	.	.	.	t	6.330	0.428917	0.11987	.	.	ENSG00000157933	ENST00000378536	D	0.95690	-3.78	4.42	4.42	0.53409	.	0.217731	0.48767	D	0.000170	D	0.91720	0.7382	L	0.54323	1.7	0.53688	D	0.999974	P	0.34462	0.454	B	0.27262	0.078	D	0.89751	0.3940	10	0.15499	T	0.54	-14.4652	13.1714	0.59599	0.0:0.0:0.0:1.0	.	369	P12755	SKI_HUMAN	R	369	ENSP00000367797:C369R	ENSP00000367797:C369R	C	+	1	0	SKI	2224593	1.000000	0.71417	0.769000	0.31535	0.205000	0.24178	2.348000	0.44045	1.767000	0.52121	0.454000	0.30748	TGT	.	.		0.617	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000004070.1	NM_003036	
CASZ1	54897	hgsc.bcm.edu	37	1	10707949	10707949	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:10707949C>T	ENST00000377022.3	-	16	3723	c.3406G>A	c.(3406-3408)Gtg>Atg	p.V1136M	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Missense_Mutation_p.V1136M	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1136	Pro-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		AGGTGAGGCACTGACGCTGGG	0.657																																					p.V1136M		Atlas-SNP	.											.	CASZ1	150	.	0			c.G3406A						.						72.0	77.0	75.0					1																	10707949		2203	4300	6503	SO:0001583	missense	54897	exon16			GAGGCACTGACGC	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.3406G>A	chr1.hg19:g.10707949C>T	ENSP00000366221:p.Val1136Met	96.0	0.0		57.0	4.0	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	hg19	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	C	12.41	1.929587	0.34096	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	5.65	5.65	0.86999	.	0.047698	0.85682	D	0.000000	T	0.50429	0.1615	L	0.39898	1.24	0.35386	D	0.790363	B;B	0.33940	0.433;0.264	B;B	0.27887	0.084;0.04	T	0.59495	-0.7444	9	0.42905	T	0.14	-24.7409	19.7244	0.96157	0.0:1.0:0.0:0.0	.	1136;1136	Q86V15-2;Q86V15	.;CASZ1_HUMAN	M	1136	.	ENSP00000339445:V1136M	V	-	1	0	CASZ1	10630536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.836000	0.55813	2.659000	0.90383	0.655000	0.94253	GTG	.	.		0.657	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
CASZ1	54897	hgsc.bcm.edu	37	1	10711116	10711116	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:10711116T>C	ENST00000377022.3	-	12	3015	c.2698A>G	c.(2698-2700)Acc>Gcc	p.T900A	RP4-734G22.3_ENST00000606802.1_RNA|CASZ1_ENST00000344008.5_Missense_Mutation_p.T900A	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	900					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		CTGGCTGGGGTGACCTGCTGC	0.716																																					p.T900A		Atlas-SNP	.											.	CASZ1	150	.	0			c.A2698G						.						7.0	9.0	8.0					1																	10711116		2134	4255	6389	SO:0001583	missense	54897	exon12			CTGGGGTGACCTG	AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.2698A>G	chr1.hg19:g.10711116T>C	ENSP00000366221:p.Thr900Ala	47.0	0.0		24.0	5.0	NM_001079843	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Missense_Mutation	SNP	ENST00000377022.3	hg19	CCDS41246.1	.	.	.	.	.	.	.	.	.	.	T	0.201	-1.044952	0.01997	.	.	ENSG00000130940	ENST00000377022;ENST00000344008	.	.	.	4.75	-4.81	0.03180	.	0.580004	0.18783	N	0.131266	T	0.18593	0.0446	N	0.14661	0.345	0.22034	N	0.999405	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.11867	-1.0570	9	0.28530	T	0.3	-9.8464	7.8164	0.29263	0.0:0.3252:0.4187:0.2561	.	900;900	Q86V15-2;Q86V15	.;CASZ1_HUMAN	A	900	.	ENSP00000339445:T900A	T	-	1	0	CASZ1	10633703	0.362000	0.24980	0.881000	0.34555	0.881000	0.50899	-0.157000	0.10085	-0.651000	0.05415	0.482000	0.46254	ACC	.	.		0.716	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005673.2	NM_017766	
PRAMEF4	400735	hgsc.bcm.edu	37	1	12942113	12942113	+	Missense_Mutation	SNP	C	C	T	rs200492309	byFrequency	TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:12942113C>T	ENST00000235349.5	-	3	507	c.437G>A	c.(436-438)cGg>cAg	p.R146Q		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	146					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		CAAGGGCTGCCGTCCTCTCAT	0.493													c|||	203	0.0405351	0.0567	0.0403	5008	,	,		19769	0.0377		0.0467	False		,,,				2504	0.0153				p.R146Q		Atlas-SNP	.											PRAMEF4,NS,carcinoma,0,1	PRAMEF4	62	.	0			c.G437A						.	T	GLN/ARG	94,2784		2,90,1347	55.0	67.0	63.0		437	0.3	0.0	1	dbSNP_134	63	120,5190		9,102,2544	no	missense	PRAMEF4	NM_001009611.2	43	11,192,3891	TT,TC,CC		2.2599,3.2662,2.6136	benign	146/479	12942113	214,7974	1439	2655	4094	SO:0001583	missense	400735	exon3			GGCTGCCGTCCTC		CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.437G>A	chr1.hg19:g.12942113C>T	ENSP00000235349:p.Arg146Gln	59.0	1.0		28.0	2.0	NM_001009611	Q5LJB5	Missense_Mutation	SNP	ENST00000235349.5	hg19	CCDS30592.1	.	.	.	.	.	.	.	.	.	.	t	0.015	-1.557126	0.00910	0.032662	0.022599	ENSG00000243073	ENST00000235349	T	0.14766	2.48	1.48	0.324	0.15898	.	1.417450	0.04830	N	0.438520	T	0.01523	0.0049	N	0.02876	-0.465	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.36890	-0.9729	10	0.11794	T	0.64	.	4.2466	0.10674	0.0:0.4291:0.0:0.5709	.	146	O60810	PRAM4_HUMAN	Q	146	ENSP00000235349:R146Q	ENSP00000235349:R146Q	R	-	2	0	PRAMEF4	12864700	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.357000	0.07651	-0.313000	0.08728	-0.724000	0.03597	CGG	.	C|0.750;T|0.250		0.493	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005518.1	NM_001009611	
PADI3	51702	hgsc.bcm.edu	37	1	17606886	17606886	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:17606886T>C	ENST00000375460.3	+	14	1637	c.1597T>C	c.(1597-1599)Tcc>Ccc	p.S533P	MIR3972_ENST00000582732.1_RNA	NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	533					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CCAGGTGCTCTCCAATAAAGA	0.522																																					p.S533P		Atlas-SNP	.											.	PADI3	81	.	0			c.T1597C						.						146.0	134.0	138.0					1																	17606886		2203	4300	6503	SO:0001583	missense	51702	exon14			GTGCTCTCCAATA	AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1597T>C	chr1.hg19:g.17606886T>C	ENSP00000364609:p.Ser533Pro	183.0	0.0		80.0	5.0	NM_016233	Q58EY7|Q70SX5	Missense_Mutation	SNP	ENST00000375460.3	hg19	CCDS179.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.689416	0.48097	.	.	ENSG00000142619	ENST00000375460	T	0.27104	1.69	4.43	1.88	0.25563	Protein-arginine deiminase, C-terminal (1);	0.818839	0.11392	N	0.568715	T	0.27241	0.0668	M	0.68317	2.08	0.25143	N	0.990484	P	0.47484	0.896	B	0.42827	0.399	T	0.15321	-1.0441	10	0.59425	D	0.04	-20.6483	5.7136	0.17948	0.1682:0.0:0.1752:0.6566	.	533	Q9ULW8	PADI3_HUMAN	P	533	ENSP00000364609:S533P	ENSP00000364609:S533P	S	+	1	0	PADI3	17479473	0.554000	0.26522	0.992000	0.48379	0.633000	0.38033	0.133000	0.15912	0.138000	0.18790	0.383000	0.25322	TCC	.	.		0.522	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006805.1		
SRRM1	10250	hgsc.bcm.edu	37	1	24995725	24995725	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:24995725T>C	ENST00000323848.9	+	14	2166	c.1851T>C	c.(1849-1851)ccT>ccC	p.P617P	SRRM1_ENST00000447431.2_Silent_p.P629P|snoU13_ENST00000459464.1_RNA|SRRM1_ENST00000374389.4_Silent_p.P626P|SRRM1_ENST00000479034.1_3'UTR	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	617	Arg-rich.|Necessary for speckles and matrix localization.|Pro-rich.|Ser-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		CGGCTTCACCTCCTCCCCCTC	0.552																																					p.P617P	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.T1851C						.						101.0	101.0	101.0					1																	24995725		2203	4300	6503	SO:0001819	synonymous_variant	10250	exon14			TTCACCTCCTCCC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.1851T>C	chr1.hg19:g.24995725T>C		196.0	0.0		124.0	5.0	NM_005839	O60585|Q5VVN4	Silent	SNP	ENST00000323848.9	hg19	CCDS255.1																																																																																			.	.		0.552	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
GRIK3	2899	hgsc.bcm.edu	37	1	37291209	37291209	+	Silent	SNP	G	G	T	rs138685291	byFrequency	TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:37291209G>T	ENST00000373091.3	-	11	1765	c.1749C>A	c.(1747-1749)atC>atA	p.I583I	GRIK3_ENST00000373093.4_Silent_p.I583I	NM_000831.3	NP_000822.2	Q13003	GRIK3_HUMAN	glutamate receptor, ionotropic, kainate 3	583					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	adenylate cyclase inhibiting G-protein coupled glutamate receptor activity (GO:0001640)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|kainate selective glutamate receptor activity (GO:0015277)	p.I583I(1)		breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(27)|lung(35)|ovary(5)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	89		Myeloproliferative disorder(586;0.0258)|all_neural(195;0.169)				CTTACCTGGCGATGACGAAGA	0.582																																					p.I583I		Atlas-SNP	.											GRIK3,caecum,carcinoma,0,2	GRIK3	195	.	1	Substitution - coding silent(1)	lung(1)	c.C1749A						.						65.0	62.0	63.0					1																	37291209		2203	4300	6503	SO:0001819	synonymous_variant	2899	exon11			CCTGGCGATGACG	U16127	CCDS416.1	1p34.3	2012-08-29			ENSG00000163873	ENSG00000163873		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4581	protein-coding gene	gene with protein product		138243				8128318	Standard	NM_000831		Approved	GluK3, GLUR7	uc001caz.2	Q13003	OTTHUMG00000004189	ENST00000373091.3:c.1749C>A	chr1.hg19:g.37291209G>T		74.0	0.0		37.0	2.0	NM_000831	A9Z1Z8|B1AMS6|Q13004|Q16136	Silent	SNP	ENST00000373091.3	hg19	CCDS416.1																																																																																			.	G|1.000;A|0.000		0.582	GRIK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012053.1	NM_000831	
MACF1	23499	hgsc.bcm.edu	37	1	39934403	39934403	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:39934403A>G	ENST00000372915.3	+	94	21654	c.21567A>G	c.(21565-21567)cgA>cgG	p.R7189R	MACF1_ENST00000567887.1_Splice_Site_p.R7333R|MACF1_ENST00000564288.1_Splice_Site_p.R7296R|MACF1_ENST00000539005.1_Splice_Site_p.R5101R|MACF1_ENST00000545844.1_Splice_Site_p.R5231R|MACF1_ENST00000289893.4_Splice_Site_p.R5739R|MACF1_ENST00000361689.2_Splice_Site_p.R5231R|MACF1_ENST00000317713.7_Splice_Site_p.R5231R			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	7189	C-terminal tail. {ECO:0000250}.|GAR. {ECO:0000255|PROSITE- ProRule:PRU00792}.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ATCCCTGCCGAGGTAAGGAAC	0.483																																					p.R5231R		Atlas-SNP	.											.	MACF1	909	.	0			c.A15693G						.						105.0	99.0	101.0					1																	39934403		2203	4300	6503	SO:0001630	splice_region_variant	23499	exon92			CTGCCGAGGTAAG	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.21568+1A>G	chr1.hg19:g.39934403A>G		148.0	0.0		93.0	4.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Silent	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.52|17.52	3.410202|3.410202	0.62399|0.62399	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000360115;ENST00000442046|ENST00000372925;ENST00000446276	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|.	.|.	.|.	.|.	T|T	0.73869|0.73869	0.3642|0.3642	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.72530|0.72530	-0.4265|-0.4265	4|4	.|.	.|.	.|.	.|.	16.8222|16.8222	0.85835|0.85835	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|.	.|.	.|.	G|G	344;132|4235;219	.|.	.|.	E|S	+|+	2|1	0|0	MACF1|MACF1	39706990|39706990	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	5.212000|5.212000	0.65225|0.65225	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.	.		0.483	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	Silent
HECTD3	79654	hgsc.bcm.edu	37	1	45469991	45469991	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:45469991A>G	ENST00000372172.4	-	17	2272	c.2201T>C	c.(2200-2202)cTg>cCg	p.L734P	HECTD3_ENST00000486132.1_5'UTR|HECTD3_ENST00000372168.3_Missense_Mutation_p.L344P	NM_024602.5	NP_078878.3	Q5T447	HECD3_HUMAN	HECT domain containing E3 ubiquitin protein ligase 3	734	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|stomach(1)	28	Acute lymphoblastic leukemia(166;0.155)					TTGCCAGGTCAGCAAGTCCAG	0.592																																					p.L734P		Atlas-SNP	.											.	HECTD3	158	.	0			c.T2201C						.						119.0	120.0	119.0					1																	45469991		2122	4259	6381	SO:0001583	missense	79654	exon17			CAGGTCAGCAAGT	BC019105	CCDS41318.1	1p34.1	2012-02-23	2012-02-23		ENSG00000126107	ENSG00000126107			26117	protein-coding gene	gene with protein product			"""HECT domain containing 3"""			12477932	Standard	NM_024602		Approved	FLJ21156	uc009vxk.3	Q5T447	OTTHUMG00000008587	ENST00000372172.4:c.2201T>C	chr1.hg19:g.45469991A>G	ENSP00000361245:p.Leu734Pro	143.0	0.0		74.0	4.0	NM_024602	B3KPV7|B3KRH4|Q5T448|Q9H783	Missense_Mutation	SNP	ENST00000372172.4	hg19	CCDS41318.1	.	.	.	.	.	.	.	.	.	.	.	25.1	4.602233	0.87055	.	.	ENSG00000126107	ENST00000372172;ENST00000372168	T;T	0.62364	0.03;0.03	5.78	5.78	0.91487	HECT (4);	0.066178	0.64402	D	0.000007	D	0.82572	0.5066	M	0.88241	2.94	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.91635	0.999;0.98	D	0.86111	0.1562	10	0.87932	D	0	.	16.1213	0.81359	1.0:0.0:0.0:0.0	.	734;344	Q5T447;Q5T447-2	HECD3_HUMAN;.	P	734;344	ENSP00000361245:L734P;ENSP00000361241:L344P	ENSP00000361241:L344P	L	-	2	0	HECTD3	45242578	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.070000	0.93974	2.202000	0.70862	0.523000	0.50628	CTG	.	.		0.592	HECTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023734.1	NM_024602	
LDLRAD1	388633	hgsc.bcm.edu	37	1	54474701	54474701	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:54474701T>G	ENST00000371360.1	-	6	589	c.572A>C	c.(571-573)cAg>cCg	p.Q191P	LDLRAD1_ENST00000545928.1_Missense_Mutation_p.Q148P|LDLRAD1_ENST00000420619.1_Missense_Mutation_p.Q152P|LDLRAD1_ENST00000371362.3_Missense_Mutation_p.Q102P	NM_001010978.2	NP_001010978.2	Q5T700	LRAD1_HUMAN	low density lipoprotein receptor class A domain containing 1	191	LDL-receptor class A 3; atypical. {ECO:0000255|PROSITE-ProRule:PRU00124}.					integral component of membrane (GO:0016021)				large_intestine(3)|prostate(1)|skin(3)	7						GGAGCAGTGCTGTACATGGTC	0.602																																					p.Q191P		Atlas-SNP	.											.	LDLRAD1	22	.	0			c.A572C						.						123.0	117.0	119.0					1																	54474701		2203	4300	6503	SO:0001583	missense	388633	exon6			CAGTGCTGTACAT		CCDS30725.1, CCDS60145.1, CCDS60146.1, CCDS60147.1	1p32.3	2008-02-05	2005-10-07		ENSG00000203985	ENSG00000203985			32069	protein-coding gene	gene with protein product			"""low density lipoprotein receptor A domain containing 1"""				Standard	NM_001010978		Approved		uc001cwm.2	Q5T700	OTTHUMG00000008433	ENST00000371360.1:c.572A>C	chr1.hg19:g.54474701T>G	ENSP00000360411:p.Gln191Pro	176.0	0.0		100.0	4.0	NM_001010978	A0PJY0|B7ZME3|Q5T6Z9	Missense_Mutation	SNP	ENST00000371360.1	hg19	CCDS30725.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.344125	0.61073	.	.	ENSG00000203985	ENST00000371362;ENST00000371360;ENST00000545928;ENST00000420619	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	4.25	4.25	0.50352	.	0.000000	0.53938	D	0.000048	D	0.91646	0.7360	M	0.71581	2.175	0.46774	D	0.999193	D;D	0.89917	0.997;1.0	P;D	0.85130	0.849;0.997	D	0.90151	0.4221	10	0.29301	T	0.29	-17.6216	12.5085	0.55995	0.0:0.0:0.0:1.0	.	148;191	B7ZME3;Q5T700	.;LRAD1_HUMAN	P	102;191;148;152	ENSP00000360413:Q102P;ENSP00000360411:Q191P;ENSP00000445871:Q148P;ENSP00000411017:Q152P	ENSP00000360411:Q191P	Q	-	2	0	LDLRAD1	54247289	1.000000	0.71417	0.995000	0.50966	0.689000	0.40095	5.221000	0.65272	1.788000	0.52465	0.533000	0.62120	CAG	.	.		0.602	LDLRAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023243.1	NM_001010978	
TTC4	7268	hgsc.bcm.edu	37	1	55182348	55182348	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:55182348T>C	ENST00000371281.3	+	2	274	c.187T>C	c.(187-189)Tgt>Cgt	p.C63R	MROH7-TTC4_ENST00000414150.2_Silent_p.L1298L|TTC4_ENST00000371284.5_3'UTR	NM_004623.4	NP_004614.3	O95801	TTC4_HUMAN	tetratricopeptide repeat domain 4	63										breast(2)|endometrium(3)|kidney(1)|lung(2)|stomach(1)	9						TGACTTGGCTTGTCTCCAGTC	0.388																																					p.C63R		Atlas-SNP	.											.	TTC4	21	.	0			c.T187C						.						98.0	94.0	95.0					1																	55182348		2203	4300	6503	SO:0001583	missense	7268	exon2			TTGGCTTGTCTCC		CCDS596.1	1p32	2013-01-11			ENSG00000243725	ENSG00000243725		"""Tetratricopeptide (TTC) repeat domain containing"""	12394	protein-coding gene	gene with protein product		606753				9933562	Standard	NM_004623		Approved	MGC5097, FLJ41930	uc001cxx.4	O95801	OTTHUMG00000009914	ENST00000371281.3:c.187T>C	chr1.hg19:g.55182348T>C	ENSP00000360329:p.Cys63Arg	75.0	0.0		46.0	5.0	NM_004623	Q53Y95|Q5TA96|Q9H3I2	Missense_Mutation	SNP	ENST00000371281.3	hg19	CCDS596.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.240330	0.79912	.	.	ENSG00000243725	ENST00000371281;ENST00000371284	T	0.13901	2.55	4.92	3.75	0.43078	.	.	.	.	.	T	0.28234	0.0697	M	0.78049	2.395	0.80722	D	1	P;D	0.56035	0.918;0.974	P;P	0.53861	0.451;0.736	T	0.03315	-1.1049	9	0.72032	D	0.01	-3.1047	10.0705	0.42330	0.0:0.0:0.1693:0.8307	.	63;74	O95801;Q5TA95	TTC4_HUMAN;.	R	63;74	ENSP00000360329:C63R	ENSP00000360329:C63R	C	+	1	0	TTC4	54954936	1.000000	0.71417	0.997000	0.53966	0.991000	0.79684	6.593000	0.74100	0.958000	0.37956	0.533000	0.62120	TGT	.	.		0.388	TTC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027432.1	NM_004623	
CLCA1	1179	hgsc.bcm.edu	37	1	86961308	86961308	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:86961308T>C	ENST00000234701.3	+	13	2414	c.2063T>C	c.(2062-2064)gTg>gCg	p.V688A	CLCA1_ENST00000394711.1_Missense_Mutation_p.V688A			A8K7I4	CLCA1_HUMAN	chloride channel accessory 1	688					calcium ion transport (GO:0006816)|cellular response to hypoxia (GO:0071456)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|transport (GO:0006810)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|zymogen granule membrane (GO:0042589)	chloride channel activity (GO:0005254)			NS(1)|breast(3)|endometrium(1)|kidney(3)|large_intestine(9)|lung(14)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Lung NSC(277;0.239)		all cancers(265;0.0249)|Epithelial(280;0.0476)		AGACGGAGAGTGATACCCCAG	0.458																																					p.V688A		Atlas-SNP	.											.	CLCA1	109	.	0			c.T2063C						.						92.0	89.0	90.0					1																	86961308		2203	4300	6503	SO:0001583	missense	1179	exon12			GGAGAGTGATACC		CCDS709.1	1p22.3	2012-02-26	2009-01-29		ENSG00000016490	ENSG00000016490			2015	protein-coding gene	gene with protein product		603906	"""chloride channel, calcium activated, family member 1"", ""chloride channel regulator 1"""			9828122	Standard	NM_001285		Approved	CaCC, CLCRG1	uc001dlt.3	A8K7I4	OTTHUMG00000010254	ENST00000234701.3:c.2063T>C	chr1.hg19:g.86961308T>C	ENSP00000234701:p.Val688Ala	125.0	0.0		91.0	4.0	NM_001285	B2RAV5|O95151|Q5TDF4|Q9UNF6|Q9UPC6	Missense_Mutation	SNP	ENST00000234701.3	hg19	CCDS709.1	.	.	.	.	.	.	.	.	.	.	T	5.685	0.310944	0.10733	.	.	ENSG00000016490	ENST00000234701;ENST00000394711	T;T	0.02763	4.17;4.17	5.45	-10.9	0.00192	.	1.930170	0.02560	N	0.096619	T	0.00300	0.0009	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.48592	-0.9022	10	0.13108	T	0.6	8.9942	1.4137	0.02297	0.1544:0.2764:0.2308:0.3384	.	688	A8K7I4	CLCA1_HUMAN	A	688	ENSP00000234701:V688A;ENSP00000378200:V688A	ENSP00000234701:V688A	V	+	2	0	CLCA1	86733896	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.417000	0.02464	-2.033000	0.00925	-0.798000	0.03219	GTG	.	.		0.458	CLCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028277.1	NM_001285	
ABCD3	5825	hgsc.bcm.edu	37	1	94965076	94965076	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:94965076T>C	ENST00000370214.4	+	20	1670	c.1646T>C	c.(1645-1647)gTc>gCc	p.V549A	ABCD3_ENST00000484213.1_3'UTR|ABCD3_ENST00000536817.1_Missense_Mutation_p.V476A|ABCD3_ENST00000394233.2_Missense_Mutation_p.V439A|ABCD3_ENST00000454898.2_Missense_Mutation_p.V573A	NM_002858.3	NP_002849.1	P28288	ABCD3_HUMAN	ATP-binding cassette, sub-family D (ALD), member 3	549	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|fatty acid beta-oxidation (GO:0006635)|peroxisome organization (GO:0007031)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|liver(2)|lung(10)|ovary(1)|pancreas(1)|skin(2)	26		all_lung(203;0.000434)|Lung NSC(277;0.0019)		all cancers(265;0.0261)|Epithelial(280;0.165)		TTAGACAATGTCCAGTTGGGT	0.373																																					p.V549A		Atlas-SNP	.											.	ABCD3	62	.	0			c.T1646C						.						147.0	125.0	132.0					1																	94965076		2203	4300	6503	SO:0001583	missense	5825	exon20			ACAATGTCCAGTT	M81182	CCDS749.1, CCDS44175.1	1p21.3	2012-05-16			ENSG00000117528	ENSG00000117528		"""ATP binding cassette transporters / subfamily D"""	67	protein-coding gene	gene with protein product		170995		PXMP1		1301993, 8449508	Standard	NM_002858		Approved	PMP70, ZWS2	uc001dqn.4	P28288	OTTHUMG00000010717	ENST00000370214.4:c.1646T>C	chr1.hg19:g.94965076T>C	ENSP00000359233:p.Val549Ala	132.0	0.0		87.0	4.0	NM_002858	D3DT46|Q15271|Q6NUN5|Q96DA3|Q9H529	Missense_Mutation	SNP	ENST00000370214.4	hg19	CCDS749.1	.	.	.	.	.	.	.	.	.	.	T	28.8	4.947829	0.92593	.	.	ENSG00000117528	ENST00000394233;ENST00000454898;ENST00000536817;ENST00000370214	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.98	5.98	0.97165	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.94968	0.8372	L	0.38953	1.18	0.80722	D	1	D;D;D	0.89917	1.0;0.996;1.0	D;D;D	0.97110	1.0;0.987;1.0	D	0.96174	0.9125	10	0.87932	D	0	-15.1185	16.4578	0.84025	0.0:0.0:0.0:1.0	.	573;439;549	E7EUE1;P28288-2;P28288	.;.;ABCD3_HUMAN	A	439;573;476;549	ENSP00000377780:V439A;ENSP00000403357:V573A;ENSP00000440692:V476A;ENSP00000359233:V549A	ENSP00000359233:V549A	V	+	2	0	ABCD3	94737664	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.635000	0.83286	2.288000	0.76882	0.482000	0.46254	GTC	.	.		0.373	ABCD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029597.1	NM_002858	
ALG14	199857	hgsc.bcm.edu	37	1	95448789	95448789	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:95448789T>C	ENST00000370205.5	-	4	540	c.494A>G	c.(493-495)aAg>aGg	p.K165R		NM_144988.3	NP_659425.1	Q96F25	ALG14_HUMAN	ALG14, UDP-N-acetylglucosaminyltransferase subunit	165					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	6		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.0615)|Epithelial(280;0.139)		GATCACTTTCTTTATTCCTAG	0.408																																					p.K165R		Atlas-SNP	.											.	ALG14	13	.	0			c.A494G						.						102.0	89.0	93.0					1																	95448789		2203	4300	6503	SO:0001583	missense	199857	exon4			ACTTTCTTTATTC		CCDS752.1	1p21.3	2013-02-21	2013-02-21		ENSG00000172339	ENSG00000172339			28287	protein-coding gene	gene with protein product		612866	"""asparagine-linked glycosylation 14 homolog (yeast)"", ""asparagine-linked glycosylation 14 homolog (S. cerevisiae)"""			15615718	Standard	NM_144988		Approved	MGC19780	uc001dra.2	Q96F25	OTTHUMG00000010781	ENST00000370205.5:c.494A>G	chr1.hg19:g.95448789T>C	ENSP00000359224:p.Lys165Arg	167.0	0.0		107.0	5.0	NM_144988	A8K030	Missense_Mutation	SNP	ENST00000370205.5	hg19	CCDS752.1	.	.	.	.	.	.	.	.	.	.	T	17.38	3.375919	0.61735	.	.	ENSG00000172339	ENST00000370205	T	0.44482	0.92	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.17874	0.0429	L	0.33485	1.01	0.58432	D	0.999999	B	0.28470	0.213	B	0.30401	0.115	T	0.06552	-1.0820	10	0.09084	T	0.74	-16.3264	16.2473	0.82450	0.0:0.0:0.0:1.0	.	165	Q96F25	ALG14_HUMAN	R	165	ENSP00000359224:K165R	ENSP00000359224:K165R	K	-	2	0	ALG14	95221377	1.000000	0.71417	0.996000	0.52242	0.999000	0.98932	5.790000	0.69038	2.238000	0.73509	0.533000	0.62120	AAG	.	.		0.408	ALG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029699.2	NM_144988	
AHCYL1	10768	hgsc.bcm.edu	37	1	110559004	110559004	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:110559004C>T	ENST00000369799.5	+	8	1188	c.821C>T	c.(820-822)cCg>cTg	p.P274L	AHCYL1_ENST00000393614.4_Missense_Mutation_p.P227L|AHCYL1_ENST00000359172.3_Missense_Mutation_p.P227L	NM_001242673.1|NM_001242674.1|NM_006621.5	NP_001229602.1|NP_001229603.1|NP_006612.2	O43865	SAHH2_HUMAN	adenosylhomocysteinase-like 1	274					mRNA polyadenylation (GO:0006378)|one-carbon metabolic process (GO:0006730)|positive regulation of sodium ion transport (GO:0010765)|protein export from nucleus (GO:0006611)|regulation of anion transport (GO:0044070)|regulation of ion transmembrane transporter activity (GO:0032412)|regulation of mRNA 3'-end processing (GO:0031440)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	adenosylhomocysteinase activity (GO:0004013)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)	18		all_epithelial(167;3.58e-05)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0259)|Colorectal(144;0.123)|all cancers(265;0.134)|Epithelial(280;0.141)|LUSC - Lung squamous cell carcinoma(189;0.143)		CTCTGTGTTCCGGCCATGAAC	0.403																																					p.P274L		Atlas-SNP	.											.	AHCYL1	49	.	0			c.C821T						.						93.0	99.0	97.0					1																	110559004		2203	4300	6503	SO:0001583	missense	10768	exon8			GTGTTCCGGCCAT	U82761	CCDS818.1, CCDS55620.1	1p13	2014-06-12	2009-06-12		ENSG00000168710	ENSG00000168710			344	protein-coding gene	gene with protein product	"""inositol 1,4,5-trisphosphate receptor-binding protein"", ""protein phosphatase 1, regulatory subunit 78"""	607826	"""S-adenosylhomocysteine hydrolase-like 1"""			11904675, 16754674, 12525476	Standard	NM_006621		Approved	XPVKONA, IRBIT, PPP1R78	uc001dyx.3	O43865	OTTHUMG00000011652	ENST00000369799.5:c.821C>T	chr1.hg19:g.110559004C>T	ENSP00000358814:p.Pro274Leu	160.0	0.0		95.0	4.0	NM_006621	B4E168|Q2TAJ6|Q502W8|Q5VSM0|Q6P171|Q96PK4|Q9UG84	Missense_Mutation	SNP	ENST00000369799.5	hg19	CCDS818.1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733762	0.89482	.	.	ENSG00000168710	ENST00000369799;ENST00000359172;ENST00000393614	D;D;D	0.89746	-2.56;-2.56;-2.56	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.97256	0.9103	H	0.98996	4.395	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98336	1.0536	10	0.87932	D	0	-22.0931	20.1649	0.98147	0.0:1.0:0.0:0.0	.	274	O43865	SAHH2_HUMAN	L	274;227;227	ENSP00000358814:P274L;ENSP00000352092:P227L;ENSP00000377238:P227L	ENSP00000352092:P227L	P	+	2	0	AHCYL1	110360527	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	7.818000	0.86416	2.753000	0.94483	0.655000	0.94253	CCG	.	.		0.403	AHCYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032243.1		
CEPT1	10390	hgsc.bcm.edu	37	1	111702071	111702071	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:111702071G>T	ENST00000545121.1	+	3	617	c.409G>T	c.(409-411)Ggg>Tgg	p.G137W	CEPT1_ENST00000357172.4_Missense_Mutation_p.G137W	NM_001007794.1	NP_001007795.1	Q9Y6K0	CEPT1_HUMAN	choline/ethanolamine phosphotransferase 1	137					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	diacylglycerol cholinephosphotransferase activity (GO:0004142)|ethanolaminephosphotransferase activity (GO:0004307)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	8		all_cancers(81;2.27e-05)|all_epithelial(167;7.36e-06)|all_lung(203;0.00018)|Lung NSC(277;0.000359)		Lung(183;0.0173)|Colorectal(144;0.0375)|all cancers(265;0.0701)|LUSC - Lung squamous cell carcinoma(189;0.0888)|Epithelial(280;0.103)|COAD - Colon adenocarcinoma(174;0.141)	Choline(DB00122)	TGCTATTGATGGGAAACAGGC	0.388																																					p.G137W		Atlas-SNP	.											.	CEPT1	25	.	0			c.G409T						.						170.0	171.0	170.0					1																	111702071		2203	4300	6503	SO:0001583	missense	10390	exon3			ATTGATGGGAAAC	AF068302	CCDS830.1	1p13	2010-07-08			ENSG00000134255	ENSG00000134255	2.7.8.1, 2.7.8.2		24289	protein-coding gene	gene with protein product						10191259, 12216837	Standard	XM_005270353		Approved		uc001eah.1	Q9Y6K0	OTTHUMG00000012357	ENST00000545121.1:c.409G>T	chr1.hg19:g.111702071G>T	ENSP00000441980:p.Gly137Trp	345.0	0.0		273.0	11.0	NM_006090	Q69YJ9|Q9P0Y8	Missense_Mutation	SNP	ENST00000545121.1	hg19	CCDS830.1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.516943	0.85495	.	.	ENSG00000134255	ENST00000545121;ENST00000357172	D;D	0.95342	-3.68;-3.68	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.98046	0.9356	H	0.95745	3.715	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99257	1.0889	10	0.87932	D	0	-18.579	16.3671	0.83335	0.0:0.0:1.0:0.0	.	137;137	Q9Y6K0;B3KN25	CEPT1_HUMAN;.	W	137	ENSP00000441980:G137W;ENSP00000349696:G137W	ENSP00000349696:G137W	G	+	1	0	CEPT1	111503594	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.476000	0.97823	2.450000	0.82876	0.655000	0.94253	GGG	.	.		0.388	CEPT1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034462.2	NM_006090	
CHD1L	9557	hgsc.bcm.edu	37	1	146731569	146731569	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:146731569A>G	ENST00000369258.4	+	6	593	c.573A>G	c.(571-573)tcA>tcG	p.S191S	CHD1L_ENST00000369259.3_Intron|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_5'UTR|CHD1L_ENST00000431239.1_Silent_p.S191S	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	191	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AGACCTTGTCAGAGGTAAACT	0.353																																					p.S191S		Atlas-SNP	.											.	CHD1L	72	.	0			c.A573G						.						149.0	155.0	153.0					1																	146731569		2203	4300	6503	SO:0001819	synonymous_variant	9557	exon6			CTTGTCAGAGGTA	AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.573A>G	chr1.hg19:g.146731569A>G		54.0	0.0		40.0	4.0	NM_004284	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Silent	SNP	ENST00000369258.4	hg19	CCDS927.1																																																																																			.	.		0.353	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040377.1	NM_004284	
PGLYRP4	57115	hgsc.bcm.edu	37	1	153317834	153317834	+	Missense_Mutation	SNP	G	G	A	rs200715095		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:153317834G>A	ENST00000359650.5	-	4	228	c.164C>T	c.(163-165)aCg>aTg	p.T55M	PGLYRP4_ENST00000368739.3_Missense_Mutation_p.T51M|PGLYRP4_ENST00000490266.1_5'UTR	NM_020393.2	NP_065126.2	Q96LB8	PGRP4_HUMAN	peptidoglycan recognition protein 4	55					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)	p.T55M(1)		breast(2)|endometrium(1)|large_intestine(4)|lung(10)|ovary(3)|prostate(1)|skin(1)|stomach(1)	23	all_lung(78;2.81e-33)|Lung NSC(65;9.54e-32)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCGAGAGACCGTGGTGGAGAC	0.587																																					p.T55M		Atlas-SNP	.											PGLYRP4,colon,carcinoma,-1,1	PGLYRP4	45	.	1	Substitution - Missense(1)	ovary(1)	c.C164T						.						127.0	98.0	108.0					1																	153317834		2203	4300	6503	SO:0001583	missense	57115	exon4			GAGACCGTGGTGG	AF242518	CCDS30871.1	1q21	2008-02-05			ENSG00000163218	ENSG00000163218			30015	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein I beta precursor"""	608198				11461926	Standard	XR_241090		Approved	SBBI67, PGRPIB, PGLYRPIbeta, PGRP-Ibeta	uc001fbo.3	Q96LB8	OTTHUMG00000037057	ENST00000359650.5:c.164C>T	chr1.hg19:g.153317834G>A	ENSP00000352672:p.Thr55Met	85.0	0.0		45.0	2.0	NM_020393	A8K838|Q3B822|Q3B823|Q5SY63|Q5SY64|Q9HD75	Missense_Mutation	SNP	ENST00000359650.5	hg19	CCDS30871.1	.	.	.	.	.	.	.	.	.	.	G	0.539	-0.854573	0.02630	.	.	ENSG00000163218	ENST00000368739;ENST00000359650	T;T	0.04603	3.61;3.59	3.2	-1.57	0.08506	Peptidoglycan recognition protein family domain, metazoa/bacteria (1);N-acetylmuramoyl-L-alanine amidase domain (2);	.	.	.	.	T	0.00468	0.0015	N	0.01576	-0.805	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.0	T	0.45848	-0.9233	9	0.24483	T	0.36	-17.5147	2.2658	0.04078	0.4913:0.0:0.2841:0.2246	.	51;55	Q96LB8-2;Q96LB8	.;PGRP4_HUMAN	M	51;55	ENSP00000357728:T51M;ENSP00000352672:T55M	ENSP00000352672:T55M	T	-	2	0	PGLYRP4	151584458	0.000000	0.05858	0.204000	0.23530	0.070000	0.16714	0.510000	0.22723	0.026000	0.15269	-0.657000	0.03884	ACG	.	.		0.587	PGLYRP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000089978.1	NM_020393	
ASH1L	55870	hgsc.bcm.edu	37	1	155307890	155307890	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:155307890A>G	ENST00000368346.3	-	27	9447	c.8808T>C	c.(8806-8808)ccT>ccC	p.P2936P	ASH1L_ENST00000392403.3_Silent_p.P2931P			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	2936					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			CATTTTTTCCAGGGATTTTTT	0.418																																					p.P2931P		Atlas-SNP	.											.	ASH1L	279	.	0			c.T8793C						.						90.0	84.0	86.0					1																	155307890		2203	4300	6503	SO:0001819	synonymous_variant	55870	exon27			TTTTCCAGGGATT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.8808T>C	chr1.hg19:g.155307890A>G		146.0	0.0		75.0	4.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	hg19																																																																																				.	.		0.418	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
GPATCH4	54865	hgsc.bcm.edu	37	1	156565484	156565484	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:156565484T>C	ENST00000438976.2	-	8	679	c.649A>G	c.(649-651)Aaa>Gaa	p.K217E	GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000368232.4_Missense_Mutation_p.K212E			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	212							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TCCTCCTCTTTCTGCCTCCTT	0.498																																					p.K217E		Atlas-SNP	.											.	GPATCH4	34	.	0			c.A649G						.						161.0	150.0	154.0					1																	156565484		2203	4300	6503	SO:0001583	missense	54865	exon8			CCTCTTTCTGCCT	BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.649A>G	chr1.hg19:g.156565484T>C	ENSP00000396441:p.Lys217Glu	137.0	0.0		77.0	4.0	NM_015590	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	Missense_Mutation	SNP	ENST00000438976.2	hg19	CCDS44245.1	.	.	.	.	.	.	.	.	.	.	T	8.561	0.877881	0.17395	.	.	ENSG00000160818	ENST00000368232;ENST00000368229;ENST00000438976;ENST00000415314	T;T;T	0.47177	0.85;0.85;0.85	5.8	2.25	0.28309	.	0.426017	0.24620	N	0.036961	T	0.13114	0.0318	N	0.19112	0.55	0.40805	D	0.983374	B;B	0.25521	0.128;0.049	B;B	0.20577	0.03;0.018	T	0.06338	-1.0832	10	0.66056	D	0.02	-24.1852	4.8958	0.13749	0.1271:0.2178:0.0:0.6551	.	217;212	E9PAV9;Q5T3I0	.;GPTC4_HUMAN	E	212;212;217;183	ENSP00000357215:K212E;ENSP00000396441:K217E;ENSP00000412620:K183E	ENSP00000357212:K212E	K	-	1	0	GPATCH4	154832108	0.000000	0.05858	0.961000	0.40146	0.274000	0.26718	0.097000	0.15168	0.137000	0.18759	-0.256000	0.11100	AAA	.	.		0.498	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386947.1	NM_017725	
ILDR2	387597	hgsc.bcm.edu	37	1	166891985	166891985	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:166891985A>G	ENST00000271417.3	-	8	1111	c.1056T>C	c.(1054-1056)tcT>tcC	p.S352S	ILDR2_ENST00000528703.1_Silent_p.S293S|ILDR2_ENST00000525740.1_Silent_p.S225S|ILDR2_ENST00000469934.2_Silent_p.S352S|ILDR2_ENST00000526687.1_Silent_p.S244S|ILDR2_ENST00000529071.1_Silent_p.S333S|ILDR2_ENST00000529387.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	352					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						TCTGATGGAAAGACTGGCGGA	0.507																																					p.S352S		Atlas-SNP	.											.	ILDR2	79	.	0			c.T1056C						.						160.0	151.0	154.0					1																	166891985		2203	4300	6503	SO:0001819	synonymous_variant	387597	exon8			ATGGAAAGACTGG	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1056T>C	chr1.hg19:g.166891985A>G		148.0	0.0		95.0	4.0	NM_199351		Silent	SNP	ENST00000271417.3	hg19	CCDS1256.1																																																																																			.	.		0.507	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
GPR161	23432	hgsc.bcm.edu	37	1	168066409	168066409	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:168066409T>C	ENST00000367838.1	-	5	749	c.436A>G	c.(436-438)Atg>Gtg	p.M146V	GPR161_ENST00000271357.5_Missense_Mutation_p.M146V|GPR161_ENST00000361697.2_Missense_Mutation_p.M146V|GPR161_ENST00000537209.1_Missense_Mutation_p.M166V|GPR161_ENST00000367835.1_Missense_Mutation_p.M146V|GPR161_ENST00000367836.1_Missense_Mutation_p.M14V|GPR161_ENST00000539777.1_Missense_Mutation_p.M68V|GPR161_ENST00000546300.1_Missense_Mutation_p.M32V	NM_001267611.1|NM_153832.2	NP_001254540.1|NP_722561.1	Q8N6U8	GP161_HUMAN	G protein-coupled receptor 161	146					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|positive regulation of cAMP biosynthetic process (GO:0030819)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)|recycling endosome (GO:0055037)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(3)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	all_hematologic(923;0.215)					ACAAGTGCCATCACAGCCCGG	0.532																																					p.M166V		Atlas-SNP	.											.	GPR161	56	.	0			c.A496G						.						82.0	69.0	74.0					1																	168066409		2203	4300	6503	SO:0001583	missense	23432	exon4			GTGCCATCACAGC	AF091890	CCDS1268.1, CCDS58042.1, CCDS58043.1, CCDS58044.1, CCDS58045.1, CCDS72978.1	1q23.3	2012-08-21			ENSG00000143147	ENSG00000143147		"""GPCR / Class A : Orphans"""	23694	protein-coding gene	gene with protein product		612250				11959142	Standard	NM_153832		Approved	RE2	uc009wvo.4	Q8N6U8	OTTHUMG00000034651	ENST00000367838.1:c.436A>G	chr1.hg19:g.168066409T>C	ENSP00000356812:p.Met146Val	102.0	0.0		72.0	4.0	NM_001267609	B3KV34|B7Z5D7|B7Z5E8|B7Z5Z6|F5GXD6|F5H6J7|O75963|Q5TGK0|Q5TGK1|Q5TGK2	Missense_Mutation	SNP	ENST00000367838.1	hg19	CCDS1268.1	.	.	.	.	.	.	.	.	.	.	T	7.511	0.654590	0.14580	.	.	ENSG00000143147	ENST00000367838;ENST00000271357;ENST00000367836;ENST00000367835;ENST00000546300;ENST00000539777;ENST00000537209;ENST00000361697	T;T;T;T;T;T;T;T	0.69040	-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37;-0.37	4.92	0.165	0.14995	GPCR, rhodopsin-like superfamily (1);	0.292632	0.37530	N	0.002045	T	0.14830	0.0358	N	0.03071	-0.42	0.28415	N	0.91801	B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.06405	0.002;0.001;0.001;0.0;0.0;0.001	T	0.10109	-1.0644	9	0.19147	T	0.46	-29.3646	6.4485	0.21890	0.0:0.2759:0.4948:0.2293	.	166;32;68;166;146;146	F5GXD6;B7Z5E8;F5H6J7;B7Z5Z6;Q8N6U8-2;Q8N6U8	.;.;.;.;.;GP161_HUMAN	V	146;146;14;146;32;68;166;146	ENSP00000356812:M146V;ENSP00000271357:M146V;ENSP00000356810:M14V;ENSP00000356809:M146V;ENSP00000444348:M32V;ENSP00000437576:M68V;ENSP00000441039:M166V;ENSP00000355194:M146V	ENSP00000271357:M146V	M	-	1	0	GPR161	166333033	0.188000	0.23250	0.710000	0.30468	0.960000	0.62799	0.109000	0.15417	0.210000	0.20664	0.459000	0.35465	ATG	.	.		0.532	GPR161-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083829.1	NM_007369	
CEP350	9857	hgsc.bcm.edu	37	1	180062484	180062484	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:180062484A>G	ENST00000367607.3	+	34	7662	c.7244A>G	c.(7243-7245)aAg>aGg	p.K2415R	CEP350_ENST00000490141.1_3'UTR	NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2415					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						TGCAGAGATAAGCCACAGCCA	0.418																																					p.K2415R		Atlas-SNP	.											.	CEP350	418	.	0			c.A7244G						.						30.0	28.0	29.0					1																	180062484		2203	4300	6503	SO:0001583	missense	9857	exon34			GAGATAAGCCACA	AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.7244A>G	chr1.hg19:g.180062484A>G	ENSP00000356579:p.Lys2415Arg	214.0	0.0		149.0	6.0	NM_014810	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	ENST00000367607.3	hg19	CCDS1336.1	.	.	.	.	.	.	.	.	.	.	A	7.515	0.655519	0.14580	.	.	ENSG00000135837	ENST00000367607	T	0.57752	0.38	5.38	3.01	0.34805	.	0.304180	0.23105	N	0.051869	T	0.38108	0.1028	L	0.36672	1.1	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.20371	-1.0277	9	.	.	.	.	8.4496	0.32862	0.845:0.0:0.155:0.0	.	2415;2415	E7EU22;Q5VT06	.;CE350_HUMAN	R	2415	ENSP00000356579:K2415R	.	K	+	2	0	CEP350	178329107	1.000000	0.71417	0.712000	0.30502	0.761000	0.43186	2.011000	0.40922	0.341000	0.23771	0.528000	0.53228	AAG	.	.		0.418	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085315.2	NM_014810	
CACNA1E	777	hgsc.bcm.edu	37	1	181759582	181759582	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:181759582A>G	ENST00000367573.2	+	44	5788	c.5788A>G	c.(5788-5790)Agt>Ggt	p.S1930G	CACNA1E_ENST00000367570.1_Splice_Site_p.S1930G|CACNA1E_ENST00000360108.3_Splice_Site_p.S1911G|CACNA1E_ENST00000526775.1_Splice_Site_p.S1911G|CACNA1E_ENST00000357570.5_Splice_Site_p.S1881G|CACNA1E_ENST00000358338.5_Splice_Site_p.S1862G|CACNA1E_ENST00000367567.4_Splice_Site_p.S1537G	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1930					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GCTTTTCAGGAGTGGCCGGAG	0.532																																					p.S1930G		Atlas-SNP	.											.	CACNA1E	778	.	0			c.A5788G						.						73.0	81.0	78.0					1																	181759582		1966	4148	6114	SO:0001630	splice_region_variant	777	exon44			TTCAGGAGTGGCC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.5787-1A>G	chr1.hg19:g.181759582A>G		143.0	0.0		95.0	4.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	A	13.81	2.348531	0.41599	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96300	-3.92;-3.92;-3.94;-3.91;-3.97;-3.95;-3.94	5.54	4.4	0.53042	.	0.648009	0.17406	N	0.175366	D	0.91047	0.7183	N	0.19112	0.55	0.44852	D	0.997869	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	D	0.85512	0.1198	10	0.38643	T	0.18	.	8.6952	0.34291	0.9072:0.0:0.0928:0.0	.	1911;1930	Q15878-2;Q15878-3	.;.	G	1930;1911;1881;1862;1537;1911;1930	ENSP00000356542:S1930G;ENSP00000434814:S1911G;ENSP00000350183:S1881G;ENSP00000351101:S1862G;ENSP00000356539:S1537G;ENSP00000353222:S1911G;ENSP00000356545:S1930G	ENSP00000350183:S1881G	S	+	1	0	CACNA1E	180026205	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.239000	0.51360	0.919000	0.36945	0.533000	0.62120	AGT	.	.		0.532	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	Missense_Mutation
KIF14	9928	hgsc.bcm.edu	37	1	200572973	200572973	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:200572973T>C	ENST00000367350.4	-	9	2295	c.1857A>G	c.(1855-1857)cgA>cgG	p.R619R		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	619	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TTACCTTTAGTCGATCTCCAT	0.398																																					p.R619R		Atlas-SNP	.											.	KIF14	156	.	0			c.A1857G						.						117.0	106.0	110.0					1																	200572973		2203	4300	6503	SO:0001819	synonymous_variant	9928	exon9			CTTTAGTCGATCT	D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.1857A>G	chr1.hg19:g.200572973T>C		148.0	0.0		94.0	4.0	NM_014875	Q14CI8|Q4G0A5|Q5T1W3	Silent	SNP	ENST00000367350.4	hg19	CCDS30963.1																																																																																			.	.		0.398	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086878.1	NM_014875	
C1orf131	128061	hgsc.bcm.edu	37	1	231360124	231360124	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:231360124T>C	ENST00000366649.2	-	7	808	c.783A>G	c.(781-783)tcA>tcG	p.S261S	C1orf131_ENST00000366651.3_Silent_p.S260S|C1orf131_ENST00000318906.2_3'UTR			Q8NDD1	CA131_HUMAN	chromosome 1 open reading frame 131	262							poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	8	Breast(184;0.0871)	all_cancers(173;0.2)|Prostate(94;0.183)				TCCGTCCATTTGACAAAATAC	0.373																																					p.S261S		Atlas-SNP	.											.	C1orf131	30	.	0			c.A783G						.						78.0	77.0	77.0					1																	231360124		2203	4300	6503	SO:0001819	synonymous_variant	128061	exon7			TCCATTTGACAAA	BC062353	CCDS1591.2, CCDS73049.1	1q42.2	2012-06-27			ENSG00000143633	ENSG00000143633			25332	protein-coding gene	gene with protein product						12975309	Standard	XM_005273051		Approved	DKFZp547B1713	uc001hul.3	Q8NDD1	OTTHUMG00000038023	ENST00000366649.2:c.783A>G	chr1.hg19:g.231360124T>C		220.0	0.0		165.0	9.0	NM_152379	Q5TBI0|Q5TBI1|Q6P6B4|Q7Z6H5|Q8N432|Q96NM6	Silent	SNP	ENST00000366649.2	hg19	CCDS1591.2																																																																																			.	.		0.373	C1orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092864.1	NM_152379	
NTPCR	84284	hgsc.bcm.edu	37	1	233105712	233105712	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:233105712A>G	ENST00000366628.5	+	4	439	c.352A>G	c.(352-354)Atg>Gtg	p.M118V	NTPCR_ENST00000490098.1_3'UTR|NTPCR_ENST00000366627.4_Missense_Mutation_p.M118V	NM_032324.1	NP_115700.1	Q9BSD7	NTPCR_HUMAN	nucleoside-triphosphatase, cancer-related	118						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	ATP binding (GO:0005524)|nucleoside-triphosphatase activity (GO:0017111)|nucleotide phosphatase activity, acting on free nucleotides (GO:0098519)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(1)|ovary(1)	4						GATTGGGAAGATGGAGCTCTT	0.502																																					p.M118V		Atlas-SNP	.											.	NTPCR	15	.	0			c.A352G						.						150.0	132.0	138.0					1																	233105712		2203	4300	6503	SO:0001583	missense	84284	exon4			GGGAAGATGGAGC	BC005102	CCDS1597.1	1q42.2	2010-12-20	2010-12-20	2010-12-20	ENSG00000135778	ENSG00000135778	3.6.1.15		28204	protein-coding gene	gene with protein product	"""human cancer-related NTPase"""		"""chromosome 1 open reading frame 57"""	C1orf57		17291528	Standard	NM_032324		Approved	MGC13186, HCR-NTPase	uc001hvj.1	Q9BSD7	OTTHUMG00000037822	ENST00000366628.5:c.352A>G	chr1.hg19:g.233105712A>G	ENSP00000355587:p.Met118Val	130.0	0.0		73.0	4.0	NM_032324		Missense_Mutation	SNP	ENST00000366628.5	hg19	CCDS1597.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.385276	0.82792	.	.	ENSG00000135778	ENST00000366628;ENST00000366627	T;T	0.60171	0.21;0.21	4.59	4.59	0.56863	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.82724	0.5099	H	0.96080	3.765	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.81914	0.995;0.994	D	0.88473	0.3063	10	0.87932	D	0	5.5874	14.4307	0.67249	1.0:0.0:0.0:0.0	.	118;118	Q9BSD7;Q5TDF0	NTPCR_HUMAN;.	V	118	ENSP00000355587:M118V;ENSP00000355586:M118V	ENSP00000355586:M118V	M	+	1	0	NTPCR	231172335	1.000000	0.71417	0.989000	0.46669	0.988000	0.76386	9.136000	0.94489	2.055000	0.61198	0.533000	0.62120	ATG	.	.		0.502	NTPCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092324.2	NM_032324	
RYR2	6262	hgsc.bcm.edu	37	1	237789001	237789001	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:237789001T>C	ENST00000366574.2	+	40	6380	c.6063T>C	c.(6061-6063)agT>agC	p.S2021S	RYR2_ENST00000542537.1_Silent_p.S2005S|RYR2_ENST00000360064.6_Silent_p.S2019S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2021	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATGGAAACAGTGATTTAACAA	0.378																																					p.S2021S		Atlas-SNP	.											.	RYR2	1273	.	0			c.T6063C						.						130.0	121.0	124.0					1																	237789001		1836	4091	5927	SO:0001819	synonymous_variant	6262	exon40			AAACAGTGATTTA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.6063T>C	chr1.hg19:g.237789001T>C		179.0	0.0		114.0	5.0	NM_001035	Q15411|Q546N8|Q5T3P2	Silent	SNP	ENST00000366574.2	hg19	CCDS55691.1																																																																																			.	.		0.378	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
NLRP3	114548	hgsc.bcm.edu	37	1	247588783	247588783	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr1:247588783T>C	ENST00000336119.3	+	3	2784	c.2038T>C	c.(2038-2040)Tcc>Ccc	p.S680P	NLRP3_ENST00000391828.3_Missense_Mutation_p.S680P|NLRP3_ENST00000391827.2_Missense_Mutation_p.S680P|NLRP3_ENST00000366497.2_Missense_Mutation_p.S680P|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366496.2_Missense_Mutation_p.S680P|NLRP3_ENST00000348069.2_Missense_Mutation_p.S680P	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	680					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGAGTCACTGTCCCTGGGGTT	0.502																																					p.S680P		Atlas-SNP	.											.	NLRP3	286	.	0			c.T2038C						.						95.0	84.0	88.0					1																	247588783		2203	4300	6503	SO:0001583	missense	114548	exon3			TCACTGTCCCTGG	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2038T>C	chr1.hg19:g.247588783T>C	ENSP00000337383:p.Ser680Pro	136.0	0.0		85.0	4.0	NM_183395	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	hg19	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	T	12.15	1.850912	0.32699	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;T;D;T	0.89343	-2.5;-2.5;-2.5;0.51;-2.5;0.51	3.96	3.96	0.45880	.	0.000000	0.48767	D	0.000177	D	0.92120	0.7502	M	0.72894	2.215	0.33278	D	0.561852	D;D;D;D;D	0.76494	0.987;0.999;0.998;0.958;0.979	P;D;D;P;P	0.71184	0.732;0.972;0.947;0.815;0.658	D	0.92446	0.5966	10	0.34782	T	0.22	.	9.5208	0.39133	0.0:0.0:0.0:1.0	.	680;680;680;680;680	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	P	680	ENSP00000375704:S680P;ENSP00000355453:S680P;ENSP00000337383:S680P;ENSP00000294752:S680P;ENSP00000355452:S680P;ENSP00000375703:S680P	ENSP00000337383:S680P	S	+	1	0	NLRP3	245655406	0.000000	0.05858	0.974000	0.42286	0.353000	0.29299	0.378000	0.20569	2.024000	0.59613	0.533000	0.62120	TCC	.	.		0.502	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
MFSD2B	388931	hgsc.bcm.edu	37	2	24236185	24236185	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:24236185A>G	ENST00000406420.3	+	2	143	c.127A>G	c.(127-129)Aca>Gca	p.T43A	MFSD2B_ENST00000338315.4_Missense_Mutation_p.T43A	NM_001080473.1	NP_001073942.1	A6NFX1	MFS2B_HUMAN	major facilitator superfamily domain containing 2B	43					transport (GO:0006810)	integral component of membrane (GO:0016021)				cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(2)	10						CTCATTCTGTACAAAGGTGTG	0.542																																					p.T43A		Atlas-SNP	.											.	MFSD2B	45	.	0			c.A127G						.						59.0	59.0	59.0					2																	24236185		1948	4148	6096	SO:0001583	missense	388931	exon2			TTCTGTACAAAGG		CCDS46228.1	2p23.3	2010-05-11			ENSG00000205639	ENSG00000205639			37207	protein-coding gene	gene with protein product						18694395	Standard	NM_001080473		Approved		uc002reo.2	A6NFX1	OTTHUMG00000090819	ENST00000406420.3:c.127A>G	chr2.hg19:g.24236185A>G	ENSP00000385527:p.Thr43Ala	75.0	0.0		41.0	4.0	NM_001080473	B5MC32	Missense_Mutation	SNP	ENST00000406420.3	hg19	CCDS46228.1	.	.	.	.	.	.	.	.	.	.	A	15.95	2.984662	0.53934	.	.	ENSG00000205639	ENST00000406420;ENST00000338315	T;T	0.18502	2.21;2.21	5.49	4.27	0.50696	Major facilitator superfamily domain, general substrate transporter (1);	0.466367	0.23137	U	0.051510	T	0.16171	0.0389	L	0.44542	1.39	0.31522	N	0.662257	B	0.28258	0.205	B	0.32393	0.145	T	0.06427	-1.0827	10	0.35671	T	0.21	-4.5516	10.6471	0.45626	0.8564:0.0:0.0:0.1436	.	43	A6NFX1	MFS2B_HUMAN	A	43	ENSP00000385527:T43A;ENSP00000342501:T43A	ENSP00000342501:T43A	T	+	1	0	MFSD2B	24089689	0.998000	0.40836	0.857000	0.33713	0.695000	0.40330	3.599000	0.54045	2.225000	0.72522	0.379000	0.24179	ACA	.	.		0.542	MFSD2B-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000324307.1	NM_001080473	
ABHD1	84696	hgsc.bcm.edu	37	2	27351823	27351823	+	Missense_Mutation	SNP	C	C	A	rs370556895		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:27351823C>A	ENST00000316470.4	+	3	400	c.286C>A	c.(286-288)Caa>Aaa	p.Q96K		NM_032604.3	NP_115993	Q96SE0	ABHD1_HUMAN	abhydrolase domain containing 1	96						integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			endometrium(1)|kidney(1)|lung(3)	5	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACATCCTCCAAACACCAGA	0.517																																					p.Q96K		Atlas-SNP	.											.	ABHD1	18	.	0			c.C286A						.						85.0	84.0	84.0					2																	27351823		2203	4300	6503	SO:0001583	missense	84696	exon3			ATCCTCCAAACAC	AK093447	CCDS1736.1	2p23.3	2011-01-21			ENSG00000143994	ENSG00000143994		"""Abhydrolase domain containing"""	17553	protein-coding gene	gene with protein product		612195				11922611	Standard	NM_032604		Approved	LABH1, FLJ36128	uc002rit.3	Q96SE0	OTTHUMG00000097072	ENST00000316470.4:c.286C>A	chr2.hg19:g.27351823C>A	ENSP00000326491:p.Gln96Lys	103.0	0.0		71.0	8.0	NM_032604	B3KSF6|E9PDR9|Q05BY3|Q53SZ1|Q8IXQ7	Missense_Mutation	SNP	ENST00000316470.4	hg19	CCDS1736.1	.	.	.	.	.	.	.	.	.	.	C	0.681	-0.798159	0.02862	.	.	ENSG00000143994	ENST00000316470;ENST00000416071	T;T	0.41758	3.11;0.99	4.82	3.93	0.45458	.	0.644473	0.15463	N	0.261009	T	0.30510	0.0767	L	0.38175	1.15	0.28692	N	0.904561	B	0.09022	0.002	B	0.09377	0.004	T	0.19549	-1.0302	10	0.12766	T	0.61	8.6033	11.0174	0.47698	0.0:0.7959:0.2041:0.0	.	96	Q96SE0	ABHD1_HUMAN	K	96;33	ENSP00000326491:Q96K;ENSP00000397522:Q33K	ENSP00000326491:Q96K	Q	+	1	0	ABHD1	27205327	0.019000	0.18553	0.972000	0.41901	0.497000	0.33675	0.433000	0.21477	1.221000	0.43506	0.561000	0.74099	CAA	.	.		0.517	ABHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214188.1	NM_032604	
CAPN14	440854	hgsc.bcm.edu	37	2	31425080	31425080	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:31425080A>G	ENST00000403897.3	-	4	475	c.334T>C	c.(334-336)Ttg>Ctg	p.L112L	CAPN14_ENST00000444918.2_Silent_p.L112L	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	112	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						TCCTGGTGCAAGGCCAGAGCT	0.522																																					p.L112L		Atlas-SNP	.											.	CAPN14	36	.	0			c.T334C						.						63.0	69.0	67.0					2																	31425080		692	1591	2283	SO:0001819	synonymous_variant	440854	exon4			GGTGCAAGGCCAG	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.334T>C	chr2.hg19:g.31425080A>G		164.0	0.0		118.0	5.0	NM_001145122	B3KRU9	Silent	SNP	ENST00000403897.3	hg19	CCDS46254.1																																																																																			.	.		0.522	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
PROKR1	10887	hgsc.bcm.edu	37	2	68873336	68873336	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:68873336T>C	ENST00000303786.3	+	2	803	c.383T>C	c.(382-384)cTc>cCc	p.L128P	PROKR1_ENST00000394342.2_Missense_Mutation_p.L128P			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	128					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						GTGCGCCAGCTCTCCTGGGAG	0.582																																					p.L128P		Atlas-SNP	.											.	PROKR1	69	.	0			c.T383C						.						157.0	140.0	145.0					2																	68873336		2203	4300	6503	SO:0001583	missense	10887	exon1			GCCAGCTCTCCTG	AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.383T>C	chr2.hg19:g.68873336T>C	ENSP00000303775:p.Leu128Pro	230.0	0.0		119.0	5.0	NM_138964	A5JUU2|Q53QT9|Q8NFJ7	Missense_Mutation	SNP	ENST00000303786.3	hg19	CCDS1889.1	.	.	.	.	.	.	.	.	.	.	T	16.98	3.270980	0.59540	.	.	ENSG00000169618	ENST00000303786;ENST00000394342	T;T	0.71934	-0.61;-0.61	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.058640	0.64402	D	0.000001	T	0.76666	0.4019	L	0.42008	1.315	0.80722	D	1	D	0.69078	0.997	D	0.67725	0.953	T	0.74954	-0.3488	10	0.35671	T	0.21	.	13.3807	0.60766	0.0:0.0:0.0:1.0	.	128	Q8TCW9	PKR1_HUMAN	P	128	ENSP00000303775:L128P;ENSP00000377874:L128P	ENSP00000303775:L128P	L	+	2	0	PROKR1	68726840	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.753000	0.68736	2.330000	0.79161	0.528000	0.53228	CTC	.	.		0.582	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251760.2		
C2orf78	388960	hgsc.bcm.edu	37	2	74042293	74042293	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:74042293T>C	ENST00000409561.1	+	3	1064	c.943T>C	c.(943-945)Ttc>Ctc	p.F315L		NM_001080474.1	NP_001073943.1	A6NCI8	CB078_HUMAN	chromosome 2 open reading frame 78	315										cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|soft_tissue(1)|urinary_tract(1)	34						CTCCAAGTCCTTCAGTAGCAG	0.463																																					p.F315L		Atlas-SNP	.											.	C2orf78	150	.	0			c.T943C						.						89.0	83.0	84.0					2																	74042293		1865	4106	5971	SO:0001583	missense	388960	exon3			AAGTCCTTCAGTA	AC092653, AC136006, AK125975	CCDS46338.1	2p13.2	2008-07-18			ENSG00000187833	ENSG00000187833			34349	protein-coding gene	gene with protein product							Standard	NM_001080474		Approved	FLJ43987, hCG1989538, COG5373	uc002sjr.1	A6NCI8	OTTHUMG00000152819	ENST00000409561.1:c.943T>C	chr2.hg19:g.74042293T>C	ENSP00000387124:p.Phe315Leu	141.0	0.0		86.0	4.0	NM_001080474		Missense_Mutation	SNP	ENST00000409561.1	hg19	CCDS46338.1	.	.	.	.	.	.	.	.	.	.	T	8.104	0.777320	0.16120	.	.	ENSG00000187833	ENST00000409561;ENST00000342345	.	.	.	5.47	4.28	0.50868	.	0.248011	0.28641	N	0.014623	T	0.25754	0.0627	N	0.14661	0.345	0.09310	N	1	B	0.19935	0.04	B	0.17722	0.019	T	0.17289	-1.0374	9	0.49607	T	0.09	-3.2008	9.6473	0.39875	0.0:0.0:0.1754:0.8246	.	315	A6NCI8	CB078_HUMAN	L	315	.	ENSP00000340692:F315L	F	+	1	0	C2orf78	73895801	0.090000	0.21635	0.003000	0.11579	0.009000	0.06853	0.306000	0.19279	0.979000	0.38497	0.528000	0.53228	TTC	.	.		0.463	C2orf78-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000328083.1	NM_001080474	
DQX1	165545	hgsc.bcm.edu	37	2	74751206	74751206	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:74751206A>G	ENST00000404568.3	-	4	879	c.660T>C	c.(658-660)ccT>ccC	p.P220P	DQX1_ENST00000495597.1_5'UTR|DQX1_ENST00000393951.2_Silent_p.P220P	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	220	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TATGCACAATAGGAGGATTGC	0.562																																					p.P220P		Atlas-SNP	.											.	DQX1	95	.	0			c.T660C						.						79.0	79.0	79.0					2																	74751206		2203	4300	6503	SO:0001819	synonymous_variant	165545	exon4			CACAATAGGAGGA	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.660T>C	chr2.hg19:g.74751206A>G		166.0	0.0		81.0	4.0	NM_133637	Q6B017|Q8NAM8	Silent	SNP	ENST00000404568.3	hg19	CCDS1949.2																																																																																			.	.		0.562	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
ZNF2	7549	hgsc.bcm.edu	37	2	95843262	95843262	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:95843262T>C	ENST00000340539.5	+	3	530	c.68T>C	c.(67-69)tTc>tCc	p.F23S	ZNF2_ENST00000453539.2_Missense_Mutation_p.F23S|ZNF2_ENST00000425369.1_5'UTR|ZNF2_ENST00000295210.6_Missense_Mutation_p.F23S|ZNF2_ENST00000398107.2_5'UTR	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		GCCGTGGTTTTCACAGATGAA	0.453																																					p.F23S		Atlas-SNP	.											.	ZNF2	21	.	0			c.T68C						.						167.0	164.0	165.0					2																	95843262		1998	4193	6191	SO:0001583	missense	7549	exon3			TGGTTTTCACAGA	X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.68T>C	chr2.hg19:g.95843262T>C	ENSP00000345392:p.Phe23Ser	153.0	0.0		80.0	5.0	NM_021088	A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	ENST00000340539.5	hg19	CCDS42712.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.345149	0.82022	.	.	ENSG00000163067	ENST00000340539;ENST00000295210;ENST00000453539	T;T;T	0.14766	2.48;2.48;2.48	5.07	5.07	0.68467	Krueppel-associated box (4);	0.000000	0.49916	D	0.000135	T	0.50888	0.1642	H	0.97077	3.935	0.37024	D	0.896359	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.71649	-0.4529	10	0.87932	D	0	-18.5907	12.8268	0.57725	0.0:0.0:0.0:1.0	.	23;23	B4DIR4;Q9BSG1	.;ZNF2_HUMAN	S	23	ENSP00000345392:F23S;ENSP00000295210:F23S;ENSP00000411051:F23S	ENSP00000295210:F23S	F	+	2	0	ZNF2	95206989	1.000000	0.71417	0.993000	0.49108	0.921000	0.55340	4.955000	0.63638	2.120000	0.65058	0.496000	0.49642	TTC	.	.		0.453	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338595.2	NM_021088	
SNRNP200	23020	hgsc.bcm.edu	37	2	96949561	96949561	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:96949561A>G	ENST00000323853.5	-	32	4651	c.4574T>C	c.(4573-4575)cTg>cCg	p.L1525P	SNRNP200_ENST00000349783.5_Intron	NM_014014.4	NP_054733.2	O75643	U520_HUMAN	small nuclear ribonucleoprotein 200kDa (U5)	1525					ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|lung(37)|ovary(7)|prostate(4)|skin(5)|stomach(1)|urinary_tract(1)	90						CTGGATGTGCAGCTCCAAGGG	0.572																																					p.L1525P		Atlas-SNP	.											.	SNRNP200	195	.	0			c.T4574C						.						61.0	55.0	57.0					2																	96949561		2203	4300	6503	SO:0001583	missense	23020	exon32			ATGTGCAGCTCCA	AL831994	CCDS2020.1	2q11.2	2013-05-13	2008-10-29	2008-10-29	ENSG00000144028	ENSG00000144028			30859	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 200 KD"""	601664	"""activating signal cointegrator 1 complex subunit 3-like 1"", ""retinitis pigmentosa 33 (autosomal dominant)"""	ASCC3L1, RP33		9872452, 8670905, 9774689, 9539711, 16612614, 19878916	Standard	NM_014014		Approved	U5-200KD, HELIC2, KIAA0788, BRR2	uc002svu.3	O75643	OTTHUMG00000130455	ENST00000323853.5:c.4574T>C	chr2.hg19:g.96949561A>G	ENSP00000317123:p.Leu1525Pro	132.0	0.0		95.0	4.0	NM_014014	O94884|Q6NZY0|Q6PX59|Q8NBE6|Q96IF2|Q9H7S0	Missense_Mutation	SNP	ENST00000323853.5	hg19	CCDS2020.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.189244	0.78789	.	.	ENSG00000144028	ENST00000323853;ENST00000543553	D	0.92965	-3.14	4.69	4.69	0.59074	DEAD-like helicase (1);ATPase, AAA+ type, core (1);	0.000000	0.64402	D	0.000004	D	0.96244	0.8775	M	0.91818	3.245	0.80722	D	1	D;D	0.63880	0.993;0.989	D;P	0.63033	0.91;0.862	D	0.97012	0.9737	10	0.87932	D	0	-12.3455	13.5638	0.61806	1.0:0.0:0.0:0.0	.	1276;1525	A4FU77;O75643	.;U520_HUMAN	P	1525;108	ENSP00000317123:L1525P	ENSP00000317123:L1525P	L	-	2	0	SNRNP200	96313288	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.651000	0.91078	2.111000	0.64477	0.533000	0.62120	CTG	.	.		0.572	SNRNP200-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252846.2	NM_014014	
COA5	493753	hgsc.bcm.edu	37	2	99217252	99217252	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:99217252T>C	ENST00000328709.3	-	3	274	c.188A>G	c.(187-189)gAt>gGt	p.D63G	COA5_ENST00000483527.1_5'UTR	NM_001008215.2	NP_001008216.1	Q86WW8	COA5_HUMAN	cytochrome c oxidase assembly factor 5	63						mitochondrion (GO:0005739)											TGCCCTGTTATCCAACTGAAA	0.318																																					p.D63G		Atlas-SNP	.											.	.	.	.	0			c.A188G						.						89.0	79.0	82.0					2																	99217252		2200	4297	6497	SO:0001583	missense	493753	exon3			CTGTTATCCAACT		CCDS33257.1	2q11.2	2012-10-15	2012-10-15	2011-07-19	ENSG00000183513	ENSG00000183513		"""Mitochondrial respiratory chain complex assembly factors"""	33848	protein-coding gene	gene with protein product		613920	"""chromosome 2 open reading frame 64"""	C2orf64		21457908	Standard	NM_001008215		Approved	MGC52110, FLJ27524, Pet191	uc002syz.3	Q86WW8	OTTHUMG00000153101	ENST00000328709.3:c.188A>G	chr2.hg19:g.99217252T>C	ENSP00000330730:p.Asp63Gly	120.0	0.0		81.0	4.0	NM_001008215		Missense_Mutation	SNP	ENST00000328709.3	hg19	CCDS33257.1	.	.	.	.	.	.	.	.	.	.	T	19.66	3.868991	0.72065	.	.	ENSG00000183513	ENST00000328709	D	0.82803	-1.65	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.87124	0.6099	.	.	.	0.80722	D	1	P	0.43938	0.822	P	0.51055	0.657	D	0.88748	0.3248	9	0.87932	D	0	-15.5939	14.3354	0.66586	0.0:0.0:0.0:1.0	.	63	Q86WW8	COA5_HUMAN	G	63	ENSP00000330730:D63G	ENSP00000330730:D63G	D	-	2	0	COA5	98583684	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	5.629000	0.67798	2.173000	0.68751	0.533000	0.62120	GAT	.	.		0.318	COA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329529.2	NM_001008215	
ZSWIM2	151112	hgsc.bcm.edu	37	2	187693106	187693106	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:187693106C>A	ENST00000295131.2	-	9	1546	c.1507G>T	c.(1507-1509)Gtg>Ttg	p.V503L		NM_182521.2	NP_872327.2	Q8NEG5	ZSWM2_HUMAN	zinc finger, SWIM-type containing 2	503					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|protein polyubiquitination (GO:0000209)		ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(28)|ovary(2)|prostate(4)|skin(6)|urinary_tract(1)	52			OV - Ovarian serous cystadenocarcinoma(117;0.0274)|Epithelial(96;0.164)			CCAAATGACACAGTGGGTAAA	0.338																																					p.V503L		Atlas-SNP	.											.	ZSWIM2	119	.	0			c.G1507T						.						63.0	63.0	63.0					2																	187693106		2203	4300	6503	SO:0001583	missense	151112	exon9			ATGACACAGTGGG	AK128006	CCDS33348.1	2q32.2	2008-02-05			ENSG00000163012	ENSG00000163012		"""Zinc fingers, SWIM-type"", ""Zinc fingers, ZZ-type"""	30990	protein-coding gene	gene with protein product						12477932	Standard	NM_182521		Approved	MGC33890, ZZZ2	uc002upu.1	Q8NEG5	OTTHUMG00000154259	ENST00000295131.2:c.1507G>T	chr2.hg19:g.187693106C>A	ENSP00000295131:p.Val503Leu	238.0	0.0		188.0	25.0	NM_182521	B3KXV6|Q53SI3|Q57ZY3	Missense_Mutation	SNP	ENST00000295131.2	hg19	CCDS33348.1	.	.	.	.	.	.	.	.	.	.	C	0.438	-0.900198	0.02472	.	.	ENSG00000163012	ENST00000295131	T	0.22336	1.96	5.6	-2.76	0.05896	.	1.923360	0.02246	N	0.066233	T	0.10895	0.0266	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25222	-1.0138	10	0.31617	T	0.26	1.1578	6.8641	0.24084	0.1214:0.3205:0.0:0.5581	.	503	Q8NEG5	ZSWM2_HUMAN	L	503	ENSP00000295131:V503L	ENSP00000295131:V503L	V	-	1	0	ZSWIM2	187401351	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.799000	0.04560	-0.434000	0.07275	-0.907000	0.02831	GTG	.	.		0.338	ZSWIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334565.1	NM_182521	
INHA	3623	hgsc.bcm.edu	37	2	220439447	220439447	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:220439447A>G	ENST00000243786.2	+	2	480	c.300A>G	c.(298-300)agA>agG	p.R100R	INHA_ENST00000489456.1_3'UTR|OBSL1_ENST00000491370.1_5'Flank	NM_002191.3	NP_002182.1	P05111	INHA_HUMAN	inhibin, alpha	100					cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|erythrocyte differentiation (GO:0030218)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|ovarian follicle development (GO:0001541)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|regulation of cell cycle (GO:0051726)|regulation of cell proliferation (GO:0042127)|response to external stimulus (GO:0009605)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|inhibin A complex (GO:0043512)|inhibin-betaglycan-ActRII complex (GO:0034673)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	10		Renal(207;0.0183)		Epithelial(149;4.58e-07)|all cancers(144;4.31e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00802)		CAGCTGCCAGAGGGCTGGCCC	0.622																																					p.R100R		Atlas-SNP	.											.	INHA	30	.	0			c.A300G						.						18.0	20.0	19.0					2																	220439447		2200	4299	6499	SO:0001819	synonymous_variant	3623	exon2			TGCCAGAGGGCTG		CCDS2444.1	2q35	2013-09-19			ENSG00000123999	ENSG00000123999			6065	protein-coding gene	gene with protein product		147380				3345731	Standard	NM_002191		Approved		uc002vmk.2	P05111	OTTHUMG00000059237	ENST00000243786.2:c.300A>G	chr2.hg19:g.220439447A>G		113.0	0.0		78.0	4.0	NM_002191	A8K8H5	Silent	SNP	ENST00000243786.2	hg19	CCDS2444.1																																																																																			.	.		0.622	INHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131425.1		
PAX3	5077	hgsc.bcm.edu	37	2	223086014	223086014	+	Silent	SNP	A	A	G	rs199847426		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:223086014A>G	ENST00000350526.4	-	6	1021	c.885T>C	c.(883-885)ccT>ccC	p.P295P	PAX3_ENST00000392069.2_Silent_p.P295P|PAX3_ENST00000392070.2_Silent_p.P295P|PAX3_ENST00000409551.3_Silent_p.P294P|PAX3_ENST00000344493.4_Silent_p.P295P|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000336840.6_Silent_p.P295P	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	295					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGGCAGTGGGAGGGAACCCCC	0.547			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.P295P		Atlas-SNP	.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3	106	.	0			c.T885C						.						172.0	179.0	177.0					2																	223086014		2203	4300	6503	SO:0001819	synonymous_variant	5077	exon6			AGTGGGAGGGAAC		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.885T>C	chr2.hg19:g.223086014A>G		127.0	0.0		110.0	7.0	NM_181457	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Silent	SNP	ENST00000350526.4	hg19	CCDS42826.1																																																																																			.	.		0.547	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
PID1	55022	hgsc.bcm.edu	37	2	229890580	229890580	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:229890580T>C	ENST00000354069.6	-	3	551	c.521A>G	c.(520-522)aAc>aGc	p.N174S	PID1_ENST00000409462.1_Missense_Mutation_p.N92S|PID1_ENST00000392055.3_Missense_Mutation_p.N141S|PID1_ENST00000392054.3_Missense_Mutation_p.N172S|PID1_ENST00000482518.2_Intron			Q7Z2X4	PCLI1_HUMAN	phosphotyrosine interaction domain containing 1	174	PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to cytokine stimulus (GO:0071345)|cellular response to fatty acid (GO:0071398)|cellular response to interleukin-6 (GO:0071354)|cellular response to leptin stimulus (GO:0044320)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|mitochondrion morphogenesis (GO:0070584)|negative regulation of ATP biosynthetic process (GO:2001170)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of mitochondrial DNA replication (GO:0090298)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of fat cell proliferation (GO:0070346)|positive regulation of gene expression (GO:0010628)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of mitochondrial fusion (GO:0010635)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(4)|endometrium(3)|large_intestine(5)|lung(8)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	26		Renal(207;0.0112)|all_lung(227;0.0191)|Lung NSC(271;0.0851)|all_hematologic(139;0.104)|Acute lymphoblastic leukemia(138;0.171)		Epithelial(121;3.08e-11)|all cancers(144;2.28e-08)|LUSC - Lung squamous cell carcinoma(224;0.0145)|Lung(261;0.0189)		GGGGCTCACGTTGTGGTCGGC	0.587																																					p.N172S		Atlas-SNP	.											.	PID1	43	.	0			c.A515G						.						149.0	133.0	138.0					2																	229890580		2203	4300	6503	SO:0001583	missense	55022	exon4			CTCACGTTGTGGT	AK096636	CCDS2471.1, CCDS42830.1	2q36.3	2007-02-02			ENSG00000153823	ENSG00000153823			26084	protein-coding gene	gene with protein product		612930				17124247, 16815647, 15221005	Standard	NM_001100818		Approved	NYGGF4, FLJ20701	uc002vps.4	Q7Z2X4	OTTHUMG00000133191	ENST00000354069.6:c.521A>G	chr2.hg19:g.229890580T>C	ENSP00000283937:p.Asn174Ser	208.0	0.0		99.0	4.0	NM_017933	B3KU82|Q68CJ2|Q6ZUS3|Q8IXL0|Q9NWP6	Missense_Mutation	SNP	ENST00000354069.6	hg19		.	.	.	.	.	.	.	.	.	.	T	11.59	1.682572	0.29872	.	.	ENSG00000153823	ENST00000392054;ENST00000409462;ENST00000392055;ENST00000542363;ENST00000354069	.	.	.	5.85	4.72	0.59763	Phosphotyrosine interaction domain (2);Pleckstrin homology-type (1);	0.229457	0.52532	D	0.000073	T	0.38427	0.1040	N	0.14661	0.345	0.37010	D	0.895689	B;B;B;B	0.10296	0.0;0.0;0.003;0.003	B;B;B;B	0.10450	0.001;0.0;0.005;0.004	T	0.28933	-1.0028	8	.	.	.	-39.7963	12.161	0.54103	0.0:0.0:0.1601:0.8399	.	92;141;172;174	Q7Z2X4-3;Q7Z2X4-4;Q7Z2X4-2;Q7Z2X4	.;.;.;PCLI1_HUMAN	S	172;92;141;174;174	.	.	N	-	2	0	PID1	229598824	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	4.669000	0.61575	1.068000	0.40764	0.533000	0.62120	AAC	.	.		0.587	PID1-005	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000331810.2	NM_017933	
IQCA1	79781	hgsc.bcm.edu	37	2	237405864	237405864	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr2:237405864A>G	ENST00000409907.3	-	2	552	c.278T>C	c.(277-279)cTg>cCg	p.L93P	IQCA1_ENST00000309507.5_Missense_Mutation_p.L89P|IQCA1_ENST00000431676.2_Missense_Mutation_p.L93P	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	93							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						CGTGAGTTCCAGCTCCACCAT	0.493																																					p.L100P		Atlas-SNP	.											.	IQCA1	170	.	0			c.T299C						.						43.0	43.0	43.0					2																	237405864		1953	4141	6094	SO:0001583	missense	79781	exon2			AGTTCCAGCTCCA	AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.278T>C	chr2.hg19:g.237405864A>G	ENSP00000387347:p.Leu93Pro	159.0	0.0		104.0	5.0	NM_001270585	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	ENST00000409907.3	hg19	CCDS46549.1	.	.	.	.	.	.	.	.	.	.	A	14.88	2.667448	0.47677	.	.	ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437	D;D;D	0.95069	-3.46;-3.47;-3.6	5.51	5.51	0.81932	.	0.000000	0.47852	D	0.000217	D	0.97105	0.9054	M	0.83953	2.67	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.68943	0.947;0.961;0.947	D	0.97337	0.9954	10	0.52906	T	0.07	.	15.6604	0.77182	1.0:0.0:0.0:0.0	.	93;100;93	E7EWQ0;E9PH78;Q86XH1	.;.;IQCA1_HUMAN	P	93;100;89;93;89	ENSP00000387347:L93P;ENSP00000311951:L89P;ENSP00000407213:L93P	ENSP00000254653:L93P	L	-	2	0	IQCA1	237070603	0.993000	0.37304	0.867000	0.34043	0.375000	0.29983	3.832000	0.55783	2.095000	0.63458	0.528000	0.53228	CTG	.	.		0.493	IQCA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329266.1	NM_024726	
THUMPD3	25917	hgsc.bcm.edu	37	3	9425958	9425958	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:9425958T>C	ENST00000345094.3	+	9	1632	c.1298T>C	c.(1297-1299)gTc>gCc	p.V433A	SETD5-AS1_ENST00000520629.1_RNA|SETD5-AS1_ENST00000468186.1_RNA|SETD5-AS1_ENST00000521609.1_RNA|THUMPD3_ENST00000515662.2_Missense_Mutation_p.V433A|SETD5-AS1_ENST00000523354.1_RNA|SETD5-AS1_ENST00000519043.1_RNA|THUMPD3_ENST00000452837.2_Missense_Mutation_p.V433A	NM_001114092.1|NM_015453.2	NP_001107564.1|NP_056268.2	Q9BV44	THUM3_HUMAN	THUMP domain containing 3	433						cytoplasm (GO:0005737)|nucleolus (GO:0005730)	methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	19	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.101)		ATGAGCCGTGTCTGCACACCT	0.458																																					p.V433A		Atlas-SNP	.											.	THUMPD3	46	.	0			c.T1298C						.						195.0	201.0	199.0					3																	9425958		2203	4300	6503	SO:0001583	missense	25917	exon9			GCCGTGTCTGCAC	AL117483	CCDS2573.1	3p25.3	2004-06-04			ENSG00000134077	ENSG00000134077			24493	protein-coding gene	gene with protein product						12477932	Standard	NM_015453		Approved	DKFZP434F091	uc003brn.4	Q9BV44	OTTHUMG00000097031	ENST00000345094.3:c.1298T>C	chr3.hg19:g.9425958T>C	ENSP00000339532:p.Val433Ala	145.0	0.0		82.0	4.0	NM_001114092	Q9H8V6|Q9NVC1|Q9UFS3	Missense_Mutation	SNP	ENST00000345094.3	hg19	CCDS2573.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.506860	0.85282	.	.	ENSG00000134077	ENST00000452837;ENST00000345094;ENST00000515662	T;T;T	0.34072	1.38;1.38;1.38	5.66	5.66	0.87406	Putative RNA methylase (1);	0.107605	0.64402	D	0.000007	T	0.64929	0.2643	M	0.86573	2.825	0.58432	D	0.999994	D	0.65815	0.995	D	0.68765	0.96	T	0.71718	-0.4508	10	0.72032	D	0.01	-8.377	15.5607	0.76244	0.0:0.0:0.0:1.0	.	433	Q9BV44	THUM3_HUMAN	A	433	ENSP00000395893:V433A;ENSP00000339532:V433A;ENSP00000424064:V433A	ENSP00000339532:V433A	V	+	2	0	THUMPD3	9400958	1.000000	0.71417	0.961000	0.40146	0.690000	0.40134	7.856000	0.86956	2.175000	0.68902	0.528000	0.53228	GTC	.	.		0.458	THUMPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214127.1	NM_015453	
SLC6A1	6529	hgsc.bcm.edu	37	3	11072874	11072874	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:11072874T>C	ENST00000287766.4	+	13	1756	c.1335T>C	c.(1333-1335)taT>taC	p.Y445Y	SLC6A1_ENST00000536032.1_Silent_p.Y267Y	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	445					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	GGGGTATTTATGTCTTCAAAC	0.493																																					p.Y445Y		Atlas-SNP	.											.	SLC6A1	88	.	0			c.T1335C						.						272.0	252.0	259.0					3																	11072874		2203	4300	6503	SO:0001819	synonymous_variant	6529	exon13			TATTTATGTCTTC		CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.1335T>C	chr3.hg19:g.11072874T>C		144.0	0.0		92.0	5.0	NM_003042	Q8N4K8	Silent	SNP	ENST00000287766.4	hg19	CCDS2603.1																																																																																			.	.		0.493	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102767.2	NM_003042	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266610	41266610	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:41266610T>C	ENST00000349496.5	+	4	687	c.407T>C	c.(406-408)gTt>gCt	p.V136A	CTNNB1_ENST00000396185.3_Missense_Mutation_p.V136A|CTNNB1_ENST00000453024.1_Missense_Mutation_p.V129A|CTNNB1_ENST00000396183.3_Missense_Mutation_p.V136A|CTNNB1_ENST00000405570.1_Missense_Mutation_p.V136A	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	136					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_Q143del(7)|p.W25_I140del(3)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.M5_N141>D(2)|p.M1_V173del(1)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.I35_K170del(1)|p.E15_I140>V(1)|p.A20_N141del(1)|p.D11_Y142>H(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		AAACATGCAGTTGTAAACTTG	0.448		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.V136A	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	.	CTNNB1	4904	.	23	Deletion - In frame(16)|Complex - deletion inframe(7)	liver(22)|skin(1)	c.T407C						.						147.0	128.0	134.0					3																	41266610		2203	4300	6503	SO:0001583	missense	1499	exon4	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ATGCAGTTGTAAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.407T>C	chr3.hg19:g.41266610T>C	ENSP00000344456:p.Val136Ala	77.0	0.0		69.0	12.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	19.12	3.766195	0.69878	.	.	ENSG00000168036	ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T;T	0.66638	-0.22;0.96;-0.22;-0.22;-0.22;-0.22	5.4	5.4	0.78164	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70919	0.3279	L	0.58810	1.83	0.80722	D	1	B;B	0.32425	0.171;0.371	B;P	0.44447	0.202;0.45	T	0.67086	-0.5759	10	0.24483	T	0.36	-2.7182	15.7251	0.77751	0.0:0.0:0.0:1.0	.	64;136	B4DSW9;P35222	.;CTNB1_HUMAN	A	136;136;136;136;129;136	ENSP00000385604:V136A;ENSP00000412219:V136A;ENSP00000379486:V136A;ENSP00000344456:V136A;ENSP00000411226:V129A;ENSP00000379488:V136A	ENSP00000344456:V136A	V	+	2	0	CTNNB1	41241614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.175000	0.68902	0.533000	0.62120	GTT	.	.		0.448	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
SACM1L	22908	hgsc.bcm.edu	37	3	45744960	45744960	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:45744960A>G	ENST00000389061.5	+	2	267	c.63A>G	c.(61-63)gaA>gaG	p.E21E	SACM1L_ENST00000541314.1_Missense_Mutation_p.K3R|SACM1L_ENST00000418611.1_5'UTR|SACM1L_ENST00000464524.1_3'UTR	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	21					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TTTATGTGGAAGCTTGTGATG	0.358																																					p.E21E		Atlas-SNP	.											.	SACM1L	38	.	0			c.A63G						.						127.0	125.0	125.0					3																	45744960		2203	4300	6503	SO:0001819	synonymous_variant	22908	exon2			TGTGGAAGCTTGT	AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.63A>G	chr3.hg19:g.45744960A>G		137.0	0.0		81.0	4.0	NM_014016	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Silent	SNP	ENST00000389061.5	hg19	CCDS33745.1	.	.	.	.	.	.	.	.	.	.	A	16.66	3.185734	0.57909	.	.	ENSG00000211456	ENST00000438671;ENST00000541314	T	0.44881	0.91	5.33	2.5	0.30297	.	.	.	.	.	T	0.46776	0.1410	.	.	.	0.21740	N	0.99956	.	.	.	.	.	.	T	0.40534	-0.9558	6	0.87932	D	0	-14.8707	10.7129	0.45995	0.8459:0.0:0.1541:0.0	.	.	.	.	R	3	ENSP00000443373:K3R	ENSP00000411966:K3R	K	+	2	0	SACM1L	45719964	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.370000	0.44240	0.817000	0.34445	0.482000	0.46254	AAG	.	.		0.358	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345065.2	NM_014016	
APEH	327	hgsc.bcm.edu	37	3	49712710	49712710	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:49712710A>G	ENST00000296456.5	+	3	640	c.240A>G	c.(238-240)ggA>ggG	p.G80G	APEH_ENST00000438011.1_Silent_p.G80G	NM_001640.3	NP_001631.3	P13798	ACPH_HUMAN	acylaminoacyl-peptide hydrolase	80					beta-amyloid metabolic process (GO:0050435)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)	omega peptidase activity (GO:0008242)|poly(A) RNA binding (GO:0044822)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|stomach(2)|urinary_tract(1)	15				BRCA - Breast invasive adenocarcinoma(193;4.53e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		TGTTTGCAGGACCTGCAGGCA	0.567																																					p.G80G		Atlas-SNP	.											.	APEH	45	.	0			c.A240G						.						97.0	83.0	88.0					3																	49712710		2203	4300	6503	SO:0001819	synonymous_variant	327	exon3			TGCAGGACCTGCA	D38441	CCDS2801.1	3p21	2013-05-29	2013-05-29		ENSG00000164062	ENSG00000164062	3.4.19.1		586	protein-coding gene	gene with protein product	"""acylaminoacyl-peptidase"""	102645	"""N-acylaminoacyl-peptide hydrolase"""	D3F15S2, DNF15S2, D3S48E		2392324	Standard	NM_001640		Approved		uc003cxf.3	P13798	OTTHUMG00000156882	ENST00000296456.5:c.240A>G	chr3.hg19:g.49712710A>G		129.0	0.0		71.0	4.0	NM_001640	Q9BQ33|Q9P0Y2	Silent	SNP	ENST00000296456.5	hg19	CCDS2801.1																																																																																			.	.		0.567	APEH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346415.2		
ARF4	378	hgsc.bcm.edu	37	3	57563094	57563094	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:57563094A>G	ENST00000303436.6	-	4	546	c.279T>C	c.(277-279)gaT>gaC	p.D93D	ARF4_ENST00000496292.1_Silent_p.D66D|ARF4_ENST00000489843.1_5'UTR	NM_001660.3	NP_001651.1	P18085	ARF4_HUMAN	ADP-ribosylation factor 4	93					activation of phospholipase D activity (GO:0031584)|brain development (GO:0007420)|cell migration (GO:0016477)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ADP-ribosylation (GO:0006471)|protein transport (GO:0015031)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to axon injury (GO:0048678)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	epidermal growth factor receptor binding (GO:0005154)|GTP binding (GO:0005525)			large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0449)|Kidney(284;0.0561)		GATCGTTGCTATCTACCACAA	0.353																																					p.D93D		Atlas-SNP	.											.	ARF4	14	.	0			c.T279C						.						114.0	129.0	124.0					3																	57563094		2203	4300	6503	SO:0001819	synonymous_variant	378	exon4			GTTGCTATCTACC	M36341	CCDS2884.1	3p21.2-p21.1	2007-03-19			ENSG00000168374	ENSG00000168374		"""ADP-ribosylation factors"""	655	protein-coding gene	gene with protein product		601177	"""ADP-ribosylation factor 2"""	ARF2		2107548	Standard	NM_001660		Approved		uc003dix.4	P18085	OTTHUMG00000158601	ENST00000303436.6:c.279T>C	chr3.hg19:g.57563094A>G		175.0	0.0		90.0	4.0	NM_001660	B2R7J7|P21371	Silent	SNP	ENST00000303436.6	hg19	CCDS2884.1																																																																																			.	.		0.353	ARF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351443.1	NM_001660	
PTPRG	5793	hgsc.bcm.edu	37	3	62278152	62278152	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:62278152T>C	ENST00000474889.1	+	29	4489	c.4112T>C	c.(4111-4113)cTg>cCg	p.L1371P	PTPRG-AS1_ENST00000466893.1_RNA|PTPRG-AS1_ENST00000498655.1_RNA|PTPRG-AS1_ENST00000474795.1_RNA|PTPRG-AS1_ENST00000479018.1_RNA|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG_ENST00000295874.10_Missense_Mutation_p.L1342P|PTPRG-AS1_ENST00000462497.1_RNA|PTPRG-AS1_ENST00000490916.1_RNA|PTPRG-AS1_ENST00000475371.1_RNA	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	1371	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TCCCAGCAACTGGAGAATGAA	0.418																																					p.L1371P		Atlas-SNP	.											.	PTPRG	153	.	0			c.T4112C						.						143.0	140.0	141.0					3																	62278152		2203	4300	6503	SO:0001583	missense	5793	exon29			AGCAACTGGAGAA	L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.4112T>C	chr3.hg19:g.62278152T>C	ENSP00000418112:p.Leu1371Pro	121.0	0.0		75.0	4.0	NM_002841	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	ENST00000474889.1	hg19	CCDS2895.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.160427	0.78226	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	D;D	0.85955	-2.05;-2.05	4.76	4.76	0.60689	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.64402	D	0.000001	D	0.94430	0.8208	H	0.95645	3.7	0.80722	D	1	D;D;D	0.89917	0.998;0.999;1.0	D;D;D	0.91635	0.967;0.995;0.999	D	0.95937	0.8943	10	0.87932	D	0	.	14.4326	0.67261	0.0:0.0:0.0:1.0	.	617;1342;1371	B7Z3T1;P23470-2;P23470	.;.;PTPRG_HUMAN	P	1371;1342	ENSP00000418112:L1371P;ENSP00000295874:L1342P	ENSP00000295874:L1342P	L	+	2	0	PTPRG	62253192	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.868000	0.87116	2.006000	0.58801	0.477000	0.44152	CTG	.	.		0.418	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351674.1	NM_002841	
EPHA3	2042	hgsc.bcm.edu	37	3	89499441	89499441	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:89499441T>C	ENST00000336596.2	+	15	2836	c.2611T>C	c.(2611-2613)Ttt>Ctt	p.F871L	EPHA3_ENST00000494014.1_Missense_Mutation_p.F871L	NM_005233.5	NP_005224.2	P29320	EPHA3_HUMAN	EPH receptor A3	871	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|ephrin receptor signaling pathway (GO:0048013)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|positive regulation of neuron projection development (GO:0010976)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of epithelial to mesenchymal transition (GO:0010717)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rho GTPase activity (GO:0032319)	early endosome (GO:0005769)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|GPI-linked ephrin receptor activity (GO:0005004)	p.F871V(1)		NS(1)|breast(4)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(26)|liver(3)|lung(67)|ovary(7)|pancreas(1)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)	139	all_cancers(8;0.0406)|Melanoma(1;0.00142)|all_epithelial(1;0.0612)	Lung NSC(201;0.0782)		LUSC - Lung squamous cell carcinoma(29;0.00344)|Lung(72;0.00942)		CAGACCCAAGTTTGAGCAGAT	0.512										TSP Lung(6;0.00050)																											p.F871L		Atlas-SNP	.											EPHA3,NS,carcinoma,0,1	EPHA3	501	.	1	Substitution - Missense(1)	ovary(1)	c.T2611C						.						94.0	83.0	87.0					3																	89499441		2203	4300	6503	SO:0001583	missense	2042	exon15			CCCAAGTTTGAGC	M83941	CCDS2922.1, CCDS46875.1	3p11.2	2013-02-11	2004-10-28		ENSG00000044524	ENSG00000044524	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3387	protein-coding gene	gene with protein product		179611	"""EphA3"""	ETK, ETK1, TYRO4		1737782, 1311845	Standard	NM_005233		Approved	HEK, HEK4	uc003dqy.3	P29320	OTTHUMG00000159040	ENST00000336596.2:c.2611T>C	chr3.hg19:g.89499441T>C	ENSP00000337451:p.Phe871Leu	218.0	1.0		104.0	5.0	NM_005233	Q9H2V3|Q9H2V4	Missense_Mutation	SNP	ENST00000336596.2	hg19	CCDS2922.1	.	.	.	.	.	.	.	.	.	.	T	32	5.115970	0.94339	.	.	ENSG00000044524	ENST00000336596;ENST00000494014	D;D	0.87103	-2.21;-2.21	5.66	5.66	0.87406	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.94112	0.8112	M	0.87617	2.895	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.94720	0.7900	9	.	.	.	.	15.9043	0.79412	0.0:0.0:0.0:1.0	.	871	P29320	EPHA3_HUMAN	L	871	ENSP00000337451:F871L;ENSP00000419190:F871L	.	F	+	1	0	EPHA3	89582131	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	8.040000	0.89188	2.160000	0.67779	0.528000	0.53228	TTT	.	.		0.512	EPHA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352995.1	NM_005233	
CEP97	79598	hgsc.bcm.edu	37	3	101445525	101445525	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:101445525A>G	ENST00000341893.3	+	2	883	c.131A>G	c.(130-132)gAt>gGt	p.D44G	CEP97_ENST00000494050.1_Missense_Mutation_p.D44G|CEP97_ENST00000327230.4_Missense_Mutation_p.D44G			Q8IW35	CEP97_HUMAN	centrosomal protein 97kDa	44					cell projection organization (GO:0030030)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)				cervix(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	29						TTGATTCTGGATAAAAATCAG	0.348																																					p.D44G		Atlas-SNP	.											.	CEP97	122	.	0			c.A131G						.						65.0	68.0	67.0					3																	101445525		2203	4300	6503	SO:0001583	missense	79598	exon2			TTCTGGATAAAAA	AL833269	CCDS2944.1	3q12.3	2014-02-20	2008-01-08	2008-01-08	ENSG00000182504	ENSG00000182504			26244	protein-coding gene	gene with protein product		615864	"""leucine-rich repeats and IQ motif containing 2"""	LRRIQ2		17719545, 18068367	Standard	NM_024548		Approved	FLJ23047	uc003dvk.1	Q8IW35	OTTHUMG00000159162	ENST00000341893.3:c.131A>G	chr3.hg19:g.101445525A>G	ENSP00000342510:p.Asp44Gly	95.0	0.0		73.0	4.0	NM_024548	B5MDY8|Q8NA71|Q9H5T9	Missense_Mutation	SNP	ENST00000341893.3	hg19	CCDS2944.1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.195015	0.78902	.	.	ENSG00000182504	ENST00000341893;ENST00000327230;ENST00000494050	T;T;T	0.24350	1.86;1.86;2.26	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.38295	0.1035	N	0.25992	0.78	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.992;0.996;0.987	T	0.31503	-0.9941	10	0.72032	D	0.01	-20.1694	14.7073	0.69200	1.0:0.0:0.0:0.0	.	44;44;44	E9PG22;Q8IW35-2;Q8IW35	.;.;CEP97_HUMAN	G	44	ENSP00000342510:D44G;ENSP00000325881:D44G;ENSP00000418185:D44G	ENSP00000325881:D44G	D	+	2	0	CEP97	102928215	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.056000	0.89455	1.928000	0.55862	0.533000	0.62120	GAT	.	.		0.348	CEP97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353597.2	NM_024548	
PARP9	83666	hgsc.bcm.edu	37	3	122274538	122274538	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:122274538A>G	ENST00000360356.2	-	4	812	c.585T>C	c.(583-585)caT>caC	p.H195H	PARP9_ENST00000462315.1_Silent_p.H160H|PARP9_ENST00000492382.1_Intron|PARP9_ENST00000471785.1_Silent_p.H160H|PARP9_ENST00000477522.2_Silent_p.H160H	NM_001146102.1|NM_031458.2	NP_001139574.1|NP_113646.2	Q8IXQ6	PARP9_HUMAN	poly (ADP-ribose) polymerase family, member 9	195	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				cell migration (GO:0016477)|double-strand break repair (GO:0006302)|regulation of response to interferon-gamma (GO:0060330)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(3)	34				GBM - Glioblastoma multiforme(114;0.0519)		GCCCAACAGCATGGATGATCT	0.458																																					p.H195H		Atlas-SNP	.											.	PARP9	72	.	0			c.T585C						.						65.0	61.0	62.0					3																	122274538		2203	4300	6503	SO:0001819	synonymous_variant	83666	exon4			AACAGCATGGATG	AF307339	CCDS3014.1, CCDS54633.1, CCDS54634.1	3q13-q21	2010-02-16			ENSG00000138496	ENSG00000138496		"""Poly (ADP-ribose) polymerases"""	24118	protein-coding gene	gene with protein product		612065				11110709	Standard	NM_031458		Approved	BAL, BAL1	uc003efi.3	Q8IXQ6	OTTHUMG00000159522	ENST00000360356.2:c.585T>C	chr3.hg19:g.122274538A>G		125.0	0.0		84.0	4.0	NM_031458	A8KA94|B2R8S9|E9PFM7|Q8TCP3|Q9BZL8|Q9BZL9	Silent	SNP	ENST00000360356.2	hg19	CCDS3014.1																																																																																			.	.		0.458	PARP9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355957.1	NM_031458	
TMCC1	23023	hgsc.bcm.edu	37	3	129370465	129370465	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:129370465T>C	ENST00000393238.3	-	6	2161	c.1821A>G	c.(1819-1821)gtA>gtG	p.V607V	TMCC1_ENST00000426664.2_Silent_p.V493V|TMCC1_ENST00000432054.2_Silent_p.V283V|TMCC1_ENST00000329333.5_Silent_p.V428V	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	607						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						CACAGTTGGCTACAGTGGAGA	0.522																																					p.V607V		Atlas-SNP	.											.	TMCC1	105	.	0			c.A1821G						.						162.0	143.0	150.0					3																	129370465		2203	4300	6503	SO:0001819	synonymous_variant	23023	exon6			GTTGGCTACAGTG	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1821A>G	chr3.hg19:g.129370465T>C		197.0	0.0		97.0	4.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Silent	SNP	ENST00000393238.3	hg19	CCDS33855.1																																																																																			.	.		0.522	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
TMCC1	23023	hgsc.bcm.edu	37	3	129546875	129546875	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:129546875T>C	ENST00000393238.3	-	3	687	c.347A>G	c.(346-348)aAg>aGg	p.K116R	TMCC1_ENST00000426664.2_Missense_Mutation_p.K2R	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	116						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TGTCCCTCTCTTCATCTTGGG	0.552																																					p.K116R		Atlas-SNP	.											.	TMCC1	105	.	0			c.A347G						.						95.0	89.0	91.0					3																	129546875		2203	4300	6503	SO:0001583	missense	23023	exon3			CCTCTCTTCATCT	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.347A>G	chr3.hg19:g.129546875T>C	ENSP00000376930:p.Lys116Arg	144.0	0.0		77.0	4.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	hg19	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	T	25.3	4.620336	0.87460	.	.	ENSG00000172765	ENST00000393238;ENST00000426664;ENST00000505616;ENST00000513411	T;T;T	0.61274	0.66;0.9;0.12	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.73140	0.3549	L	0.61218	1.895	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	T	0.75202	-0.3401	10	0.62326	D	0.03	-25.8093	16.2237	0.82280	0.0:0.0:0.0:1.0	.	116	O94876	TMCC1_HUMAN	R	116;2;2;2	ENSP00000376930:K116R;ENSP00000389892:K2R;ENSP00000422544:K2R	ENSP00000376930:K116R	K	-	2	0	TMCC1	131029565	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.610000	0.82949	2.289000	0.77006	0.482000	0.46254	AAG	.	.		0.552	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
ASTE1	28990	hgsc.bcm.edu	37	3	130733158	130733158	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:130733158T>C	ENST00000264992.3	-	6	2224	c.1783A>G	c.(1783-1785)Agc>Ggc	p.S595G	ATP2C1_ENST00000504381.1_Intron|ASTE1_ENST00000514044.1_Missense_Mutation_p.S620G|ATP2C1_ENST00000513801.1_Intron|ATP2C1_ENST00000393221.4_Intron|ATP2C1_ENST00000533801.2_Intron|ATP2C1_ENST00000328560.8_Intron|ATP2C1_ENST00000359644.3_Intron|ATP2C1_ENST00000507488.2_Intron|ATP2C1_ENST00000422190.2_Intron	NM_014065.2	NP_054784.2	Q2TB18	ASTE1_HUMAN	asteroid homolog 1 (Drosophila)	595					DNA repair (GO:0006281)		nuclease activity (GO:0004518)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	22						GGACATATGCTCAGGAGACTT	0.433																																					p.S595G		Atlas-SNP	.											.	ASTE1	67	.	0			c.A1783G						.						79.0	80.0	80.0					3																	130733158		2203	4300	6503	SO:0001583	missense	28990	exon6			ATATGCTCAGGAG	AF113539	CCDS3068.1, CCDS75007.1	3q21.3	2005-11-17			ENSG00000034533	ENSG00000034533			25021	protein-coding gene	gene with protein product							Standard	NM_014065		Approved	HT001	uc003env.1	Q2TB18	OTTHUMG00000159644	ENST00000264992.3:c.1783A>G	chr3.hg19:g.130733158T>C	ENSP00000264992:p.Ser595Gly	225.0	0.0		121.0	5.0	NM_014065	B4DFL9|Q3MIB6|Q8N6G4|Q96JY1|Q9UHX6	Missense_Mutation	SNP	ENST00000264992.3	hg19	CCDS3068.1	.	.	.	.	.	.	.	.	.	.	T	9.905	1.207903	0.22205	.	.	ENSG00000034533	ENST00000514044;ENST00000264992	.	.	.	5.81	3.46	0.39613	.	0.332927	0.38778	N	0.001564	T	0.41673	0.1169	L	0.50333	1.59	0.32860	D	0.507849	B;B	0.28713	0.22;0.1	B;B	0.22386	0.039;0.024	T	0.49437	-0.8940	9	0.48119	T	0.1	-2.2679	6.87	0.24115	0.0:0.0796:0.1627:0.7578	.	620;595	D6RG30;Q2TB18	.;ASTE1_HUMAN	G	620;595	.	ENSP00000264992:S595G	S	-	1	0	ASTE1	132215848	0.000000	0.05858	0.713000	0.30519	0.288000	0.27193	0.044000	0.13992	0.485000	0.27652	0.455000	0.32223	AGC	.	.		0.433	ASTE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356659.1	NM_014065	
CEP63	80254	hgsc.bcm.edu	37	3	134270832	134270832	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:134270832A>G	ENST00000337090.3	+	12	1618	c.1445A>G	c.(1444-1446)aAa>aGa	p.K482R	CEP63_ENST00000383229.3_Missense_Mutation_p.K482R|CEP63_ENST00000332047.5_Missense_Mutation_p.K436R|CEP63_ENST00000513612.2_Missense_Mutation_p.K482R|CEP63_ENST00000354446.3_Missense_Mutation_p.K436R|CEP63_ENST00000606977.1_Missense_Mutation_p.K482R			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	482					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ATGGTGATGAAATTGGAATTG	0.289																																					p.K482R		Atlas-SNP	.											.	CEP63	56	.	0			c.A1445G						.						77.0	88.0	84.0					3																	134270832		2203	4295	6498	SO:0001583	missense	80254	exon13			TGATGAAATTGGA	AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1445A>G	chr3.hg19:g.134270832A>G	ENSP00000336524:p.Lys482Arg	90.0	0.0		56.0	4.0	NM_025180	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	ENST00000337090.3	hg19	CCDS3086.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.10|12.10	1.836635|1.836635	0.32421|0.32421	.|.	.|.	ENSG00000182923|ENSG00000182923	ENST00000332047;ENST00000354446;ENST00000337090;ENST00000383229;ENST00000513612;ENST00000514678|ENST00000504929	T;T;T;T;T;T|.	0.33438|.	1.48;1.89;2.22;1.49;2.22;1.41|.	4.94|4.94	3.74|3.74	0.42951|0.42951	.|.	0.247017|.	0.38778|.	N|.	0.001575|.	T|T	0.47002|0.47002	0.1422|0.1422	L|L	0.45581|0.45581	1.43|1.43	0.29859|0.29859	N|N	0.827813|0.827813	D;B;B;P|.	0.65815|.	0.995;0.114;0.136;0.844|.	P;B;B;P|.	0.61477|.	0.889;0.084;0.05;0.503|.	T|T	0.44221|0.44221	-0.9342|-0.9342	10|5	0.30854|.	T|.	0.27|.	-18.0577|-18.0577	10.7337|10.7337	0.46111|0.46111	0.8403:0.1597:0.0:0.0|0.8403:0.1597:0.0:0.0	.|.	482;482;436;436|.	Q96MT8;Q96MT8-2;Q96MT8-4;Q96MT8-3|.	CEP63_HUMAN;.;.;.|.	R|D	436;436;482;482;482;155|171	ENSP00000328382:K436R;ENSP00000346432:K436R;ENSP00000336524:K482R;ENSP00000372716:K482R;ENSP00000426129:K482R;ENSP00000427526:K155R|.	ENSP00000328382:K436R|.	K|N	+|+	2|1	0|0	CEP63|CEP63	135753522|135753522	0.997000|0.997000	0.39634|0.39634	0.821000|0.821000	0.32701|0.32701	0.749000|0.749000	0.42624|0.42624	4.001000|4.001000	0.57046|0.57046	0.976000|0.976000	0.38417|0.38417	0.477000|0.477000	0.44152|0.44152	AAA|AAT	.	.		0.289	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000470139.1	NM_025180	
SLC7A14	57709	hgsc.bcm.edu	37	3	170198199	170198199	+	Silent	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:170198199C>T	ENST00000231706.5	-	7	2187	c.1872G>A	c.(1870-1872)aaG>aaA	p.K624K	CLDN11_ENST00000486975.1_Intron|CLDN11_ENST00000451576.1_Intron	NM_020949.2	NP_066000.2	Q8TBB6	S7A14_HUMAN	solute carrier family 7, member 14	624					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)|lysosome (GO:0005764)	amino acid transmembrane transporter activity (GO:0015171)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(23)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(4)	53	all_cancers(22;2.41e-22)|all_epithelial(15;4.2e-27)|all_lung(20;1.17e-16)|Lung NSC(18;4.91e-16)|Ovarian(172;0.000902)|Breast(254;0.137)		Lung(28;6.23e-13)|LUSC - Lung squamous cell carcinoma(14;1.48e-12)			TGTAGGGCAGCTTCTTGGGGT	0.557																																					p.K624K		Atlas-SNP	.											.	SLC7A14	110	.	0			c.G1872A						.						112.0	116.0	115.0					3																	170198199		2203	4300	6503	SO:0001819	synonymous_variant	57709	exon7			GGGCAGCTTCTTG	BC022968	CCDS33892.1	3q26.2	2014-06-13	2013-07-19		ENSG00000013293	ENSG00000013293		"""Solute carriers"""	29326	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 142"""	615720					Standard	NM_020949		Approved	KIAA1613, PPP1R142	uc003fgz.2	Q8TBB6	OTTHUMG00000158941	ENST00000231706.5:c.1872G>A	chr3.hg19:g.170198199C>T		93.0	0.0		76.0	4.0	NM_020949	B3KV33|Q9HCF9	Silent	SNP	ENST00000231706.5	hg19	CCDS33892.1																																																																																			.	.		0.557	SLC7A14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352598.2	NM_020949	
PIK3CA	5290	hgsc.bcm.edu	37	3	178943817	178943817	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:178943817T>C	ENST00000263967.3	+	17	2641	c.2484T>C	c.(2482-2484)ggT>ggC	p.G828G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	828	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AAAATCAAGGTCTTGATCTTC	0.308		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.G828G	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA	8460	.	0			c.T2484C						.						94.0	88.0	90.0					3																	178943817		1841	4090	5931	SO:0001819	synonymous_variant	5290	exon17			TCAAGGTCTTGAT		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2484T>C	chr3.hg19:g.178943817T>C		142.0	0.0		75.0	4.0	NM_006218	Q14CW1|Q99762	Silent	SNP	ENST00000263967.3	hg19	CCDS43171.1																																																																																			.	.		0.308	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
ZNF639	51193	hgsc.bcm.edu	37	3	179051221	179051221	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:179051221A>G	ENST00000326361.3	+	7	914	c.469A>G	c.(469-471)Aac>Gac	p.N157D	ZNF639_ENST00000484866.1_Missense_Mutation_p.N157D|ZNF639_ENST00000466663.1_3'UTR|ZNF639_ENST00000496856.1_Missense_Mutation_p.N157D	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	157					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			AGAGACAGAAAACAATTCCTC	0.418																																					p.N157D		Atlas-SNP	.											.	ZNF639	45	.	0			c.A469G						.						69.0	70.0	70.0					3																	179051221		2203	4300	6503	SO:0001583	missense	51193	exon7			ACAGAAAACAATT	BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.469A>G	chr3.hg19:g.179051221A>G	ENSP00000325634:p.Asn157Asp	230.0	0.0		152.0	7.0	NM_016331	A9X3Z9|D3DNR3	Missense_Mutation	SNP	ENST00000326361.3	hg19	CCDS3227.1	.	.	.	.	.	.	.	.	.	.	A	18.85	3.712109	0.68730	.	.	ENSG00000121864	ENST00000496856;ENST00000491818;ENST00000326361;ENST00000466264;ENST00000484866	T;T;T;T	0.03689	3.84;3.84;4.47;3.84	5.87	5.87	0.94306	.	0.191571	0.46442	N	0.000292	T	0.09379	0.0231	L	0.29908	0.895	0.29633	N	0.845314	D	0.63880	0.993	D	0.70935	0.971	T	0.04268	-1.0964	10	0.56958	D	0.05	.	10.8542	0.46789	0.9299:0.0:0.0701:0.0	.	157	Q9UID6	ZN639_HUMAN	D	157	ENSP00000417740:N157D;ENSP00000325634:N157D;ENSP00000419650:N157D;ENSP00000418766:N157D	ENSP00000325634:N157D	N	+	1	0	ZNF639	180533915	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.603000	0.61105	2.371000	0.80710	0.533000	0.62120	AAC	.	.		0.418	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348855.1	NM_016331	
TNK2	10188	hgsc.bcm.edu	37	3	195611685	195611685	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr3:195611685T>C	ENST00000333602.6	-	4	1071	c.454A>G	c.(454-456)Acg>Gcg	p.T152A	TNK2_ENST00000316664.3_Missense_Mutation_p.T152A|TNK2_ENST00000392400.1_Missense_Mutation_p.T152A|TNK2_ENST00000381916.2_Missense_Mutation_p.T215A|TNK2_ENST00000468819.1_5'UTR|TNK2_ENST00000428187.1_Missense_Mutation_p.T184A	NM_005781.4	NP_005772.3	Q07912	ACK1_HUMAN	tyrosine kinase, non-receptor, 2	152	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		T -> M (in dbSNP:rs56161912). {ECO:0000269|PubMed:17344846}.		cell surface receptor signaling pathway (GO:0007166)|endocytosis (GO:0006897)|negative regulation of catalytic activity (GO:0043086)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of clathrin-mediated endocytosis (GO:2000369)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|endosome (GO:0005768)|Grb2-EGFR complex (GO:0070436)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|WW domain binding (GO:0050699)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(11)|ovary(3)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	29	all_cancers(143;6.48e-09)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;1.46e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.3e-19)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;0.000757)	Adenosine triphosphate(DB00171)	GAGCTCACCGTCTTCCCTGAG	0.657																																					p.T215A		Atlas-SNP	.											.	TNK2	246	.	0			c.A643G						.						25.0	25.0	25.0					3																	195611685		2200	4298	6498	SO:0001583	missense	10188	exon4			TCACCGTCTTCCC	L13738	CCDS33927.1, CCDS33928.1	3q29	2013-09-02			ENSG00000061938	ENSG00000061938			19297	protein-coding gene	gene with protein product	"""activated Cdc42-associated kinase 1"""	606994				8497321, 14506255	Standard	XM_006713460		Approved	p21cdc42Hs, ACK, ACK1	uc003fvt.1	Q07912	OTTHUMG00000155737	ENST00000333602.6:c.454A>G	chr3.hg19:g.195611685T>C	ENSP00000329425:p.Thr152Ala	143.0	0.0		62.0	4.0	NM_001010938	Q6ZMQ0|Q8N6U7|Q96H59	Missense_Mutation	SNP	ENST00000333602.6	hg19	CCDS33928.1	.	.	.	.	.	.	.	.	.	.	T	8.760	0.923378	0.18056	.	.	ENSG00000061938	ENST00000333602;ENST00000381916;ENST00000428187;ENST00000392400;ENST00000316664	D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61	5.12	2.72	0.32119	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.531595	0.20189	N	0.097348	T	0.65365	0.2684	N	0.26092	0.79	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.49093	-0.8975	10	0.08179	T	0.78	.	4.1861	0.10398	0.149:0.1653:0.0:0.6857	.	152;152;215;184	Q07912-2;Q07912;Q07912-3;C9J1X3	.;ACK1_HUMAN;.;.	A	152;215;184;152;152	ENSP00000329425:T152A;ENSP00000371341:T215A;ENSP00000392546:T184A;ENSP00000376201:T152A;ENSP00000323216:T152A	ENSP00000323216:T152A	T	-	1	0	TNK2	197096082	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	3.432000	0.52824	0.376000	0.24707	-0.473000	0.04963	ACG	.	.		0.657	TNK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341437.3	NM_005781	
PDE6B	5158	hgsc.bcm.edu	37	4	629718	629718	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:629718A>G	ENST00000496514.1	+	3	692	c.671A>G	c.(670-672)cAc>cGc	p.H224R	PDE6B_ENST00000255622.6_Missense_Mutation_p.H224R			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	224					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	AAGATCTATCACCTGAGCTAC	0.537																																					p.H224R	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.A671G						.						128.0	117.0	121.0					4																	629718		2203	4300	6503	SO:0001583	missense	5158	exon3			TCTATCACCTGAG	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.671A>G	chr4.hg19:g.629718A>G	ENSP00000420295:p.His224Arg	124.0	0.0		90.0	5.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	hg19	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	A	15.47	2.844052	0.51164	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.64438	-0.1;-0.1	4.25	4.25	0.50352	GAF (1);	0.000000	0.85682	D	0.000000	T	0.62998	0.2474	M	0.67397	2.05	0.80722	D	1	B;B	0.29481	0.159;0.245	B;B	0.36335	0.111;0.222	T	0.65932	-0.6048	10	0.56958	D	0.05	.	11.5849	0.50912	1.0:0.0:0.0:0.0	.	224;224	P35913;P35913-2	PDE6B_HUMAN;.	R	224	ENSP00000255622:H224R;ENSP00000420295:H224R	ENSP00000255622:H224R	H	+	2	0	PDE6B	619718	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.389000	0.90172	1.694000	0.51137	0.402000	0.26972	CAC	.	.		0.537	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
BEND4	389206	hgsc.bcm.edu	37	4	42119674	42119674	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:42119674T>C	ENST00000502486.1	-	6	2045	c.1466A>G	c.(1465-1467)gAc>gGc	p.D489G	BEND4_ENST00000504360.1_3'UTR	NM_207406.3	NP_997289.2	Q6ZU67	BEND4_HUMAN	BEN domain containing 4	489	BEN. {ECO:0000255|PROSITE- ProRule:PRU00784}.									NS(2)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26						ACCGACAGCGTCGCTGAACAC	0.522																																					p.D489G		Atlas-SNP	.											.	BEND4	67	.	0			c.A1466G						.						36.0	36.0	36.0					4																	42119674		1852	4091	5943	SO:0001583	missense	389206	exon6			ACAGCGTCGCTGA	AK092951	CCDS47048.1	4p13	2012-11-22	2008-10-03	2008-10-03	ENSG00000188848	ENSG00000188848		"""BEN domain containing"""	23815	protein-coding gene	gene with protein product			"""coiled-coil domain containing 4"""	CCDC4			Standard	NM_207406		Approved	FLJ35632, FLJ43965	uc003gwn.3	Q6ZU67	OTTHUMG00000160531	ENST00000502486.1:c.1466A>G	chr4.hg19:g.42119674T>C	ENSP00000421169:p.Asp489Gly	143.0	0.0		100.0	4.0	NM_207406	A1A5D6|A1A5D7|C9JQZ5|Q58A26|Q58A27	Missense_Mutation	SNP	ENST00000502486.1	hg19	CCDS47048.1	.	.	.	.	.	.	.	.	.	.	T	27.9	4.872737	0.91587	.	.	ENSG00000188848	ENST00000411720;ENST00000502486	T	0.43688	0.94	5.41	5.41	0.78517	BEN domain (2);	0.053177	0.64402	D	0.000001	T	0.40932	0.1137	N	0.08118	0	0.80722	D	1	P	0.49783	0.928	P	0.56916	0.809	T	0.52419	-0.8578	10	0.87932	D	0	-12.636	15.7384	0.77866	0.0:0.0:0.0:1.0	.	489	Q6ZU67	BEND4_HUMAN	G	360;489	ENSP00000421169:D489G	ENSP00000412495:D360G	D	-	2	0	BEND4	41814431	1.000000	0.71417	0.956000	0.39512	0.880000	0.50808	7.655000	0.83696	2.174000	0.68829	0.459000	0.35465	GAC	.	.		0.522	BEND4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360975.2	NM_207406	
FIP1L1	81608	hgsc.bcm.edu	37	4	54265995	54265995	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:54265995T>C	ENST00000337488.6	+	10	998	c.804T>C	c.(802-804)ctT>ctC	p.L268L	FIP1L1_ENST00000507166.1_Silent_p.L268L|FIP1L1_ENST00000306932.6_Silent_p.L230L|FIP1L1_ENST00000358575.5_Silent_p.L253L|FIP1L1_ENST00000507922.1_Silent_p.L253L	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	268	Necessary for stimulating PAPOLA activity.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			AGACTGGGCTTCCACCGAGCA	0.388			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.L268L		Atlas-SNP	.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	60	.	0			c.T804C						.						145.0	140.0	142.0					4																	54265995		2203	4300	6503	SO:0001819	synonymous_variant	81608	exon10			TGGGCTTCCACCG	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.804T>C	chr4.hg19:g.54265995T>C		139.0	0.0		102.0	5.0	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Silent	SNP	ENST00000337488.6	hg19	CCDS3491.1																																																																																			.	.		0.388	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
SULT1E1	6783	hgsc.bcm.edu	37	4	70719946	70719946	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:70719946T>C	ENST00000226444.3	-	4	470	c.358A>G	c.(358-360)Aag>Gag	p.K120E		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	120					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	TTACAATCCTTTTCCCAAAAT	0.338																																					p.K120E		Atlas-SNP	.											.	SULT1E1	44	.	0			c.A358G						.						94.0	91.0	92.0					4																	70719946		2203	4300	6503	SO:0001583	missense	6783	exon4			AATCCTTTTCCCA	BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.358A>G	chr4.hg19:g.70719946T>C	ENSP00000226444:p.Lys120Glu	167.0	0.0		91.0	4.0	NM_005420	Q8N6X5	Missense_Mutation	SNP	ENST00000226444.3	hg19	CCDS3531.1	.	.	.	.	.	.	.	.	.	.	T	8.025	0.760428	0.15914	.	.	ENSG00000109193	ENST00000226444	T	0.01787	4.64	4.7	3.51	0.40186	Sulfotransferase domain (1);	0.146210	0.46442	D	0.000292	T	0.02119	0.0066	L	0.58925	1.835	0.24431	N	0.994578	B;B	0.30179	0.271;0.271	B;B	0.30105	0.111;0.111	T	0.42899	-0.9424	10	0.22109	T	0.4	.	5.0602	0.14553	0.0:0.0946:0.1836:0.7218	.	120;120	Q53X91;P49888	.;ST1E1_HUMAN	E	120	ENSP00000226444:K120E	ENSP00000226444:K120E	K	-	1	0	SULT1E1	70754535	0.987000	0.35691	0.777000	0.31699	0.799000	0.45148	0.741000	0.26202	0.940000	0.37473	0.533000	0.62120	AAG	.	.		0.338	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251559.1	NM_005420	
PPEF2	5470	hgsc.bcm.edu	37	4	76797575	76797575	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:76797575T>C	ENST00000286719.7	-	11	1541	c.1185A>G	c.(1183-1185)gaA>gaG	p.E395E		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	395	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTAGCTCCAGTTCCACGGAGC	0.662																																					p.E395E	NSCLC(105;1359 1603 15961 44567 47947)	Atlas-SNP	.											.	PPEF2	108	.	0			c.A1185G						.						27.0	29.0	29.0					4																	76797575		2203	4299	6502	SO:0001819	synonymous_variant	5470	exon11			CTCCAGTTCCACG	AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1185A>G	chr4.hg19:g.76797575T>C		70.0	0.0		62.0	5.0	NM_006239	O14831	Silent	SNP	ENST00000286719.7	hg19	CCDS34013.1																																																																																			.	.		0.662	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362929.1	NM_006239	
INPP4B	8821	hgsc.bcm.edu	37	4	143045901	143045901	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:143045901T>C	ENST00000513000.1	-	20	2166	c.1733A>G	c.(1732-1734)gAa>gGa	p.E578G	INPP4B_ENST00000308502.4_Missense_Mutation_p.E578G|INPP4B_ENST00000508116.1_Missense_Mutation_p.E578G|INPP4B_ENST00000509777.1_Missense_Mutation_p.E578G|INPP4B_ENST00000262992.4_Missense_Mutation_p.E578G	NM_003866.2	NP_003857.2	O15327	INP4B_HUMAN	inositol polyphosphate-4-phosphatase, type II, 105kDa	578					cellular calcium ion homeostasis (GO:0006874)|inositol phosphate metabolic process (GO:0043647)|negative regulation of osteoclast differentiation (GO:0045671)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of bone remodeling (GO:0046850)|regulation of nucleocytoplasmic transport (GO:0046822)|regulation of protein kinase B signaling (GO:0051896)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	lipid binding (GO:0008289)|phosphatidylinositol trisphosphate phosphatase activity (GO:0034594)|phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(29)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	58	all_hematologic(180;0.158)					ATACAACTGTTCATACCAGTC	0.468																																					p.E578G		Atlas-SNP	.											.	INPP4B	132	.	0			c.A1733G						.						55.0	43.0	47.0					4																	143045901		2203	4300	6503	SO:0001583	missense	8821	exon20			AACTGTTCATACC	U96922	CCDS3757.1	4q31.1	2008-02-05	2002-08-29			ENSG00000109452			6075	protein-coding gene	gene with protein product		607494	"""inositol polyphosphate-4-phosphatase, type II, 105kD"""			9295334	Standard	NM_003866		Approved		uc003iiw.4	O15327		ENST00000513000.1:c.1733A>G	chr4.hg19:g.143045901T>C	ENSP00000425487:p.Glu578Gly	102.0	0.0		94.0	4.0	NM_003866	Q2TAI2|Q5XLE7|Q6IN59|Q6PJB4	Missense_Mutation	SNP	ENST00000513000.1	hg19	CCDS3757.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185880	0.78789	.	.	ENSG00000109452	ENST00000513000;ENST00000262992;ENST00000308502;ENST00000543161;ENST00000508116;ENST00000509777;ENST00000511838;ENST00000542702;ENST00000510812;ENST00000514525	T;T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.79	4.58	0.56647	.	0.052908	0.64402	D	0.000001	T	0.64091	0.2567	M	0.65975	2.015	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.983	T	0.61217	-0.7107	10	0.29301	T	0.29	.	12.9879	0.58602	0.0:0.0:0.135:0.865	.	449;578	B7Z6T2;O15327	.;INP4B_HUMAN	G	578;578;578;449;578;578;393;393;578;449	ENSP00000425487:E578G;ENSP00000262992:E578G;ENSP00000308441:E578G;ENSP00000423954:E578G;ENSP00000422793:E578G;ENSP00000426207:E393G;ENSP00000427250:E578G;ENSP00000421065:E449G	ENSP00000262992:E578G	E	-	2	0	INPP4B	143265351	1.000000	0.71417	0.524000	0.27887	0.980000	0.70556	5.961000	0.70356	0.984000	0.38629	0.533000	0.62120	GAA	.	.		0.468	INPP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364587.1	NM_003866	
HHIP	64399	hgsc.bcm.edu	37	4	145636456	145636456	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:145636456T>C	ENST00000296575.3	+	10	2207	c.1552T>C	c.(1552-1554)Ttc>Ctc	p.F518L		NM_022475.2	NP_071920.1	Q96QV1	HHIP_HUMAN	hedgehog interacting protein	518					carbohydrate metabolic process (GO:0005975)|dorsal/ventral pattern formation (GO:0009953)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|negative regulation of signal transduction (GO:0009968)|negative regulation of smoothened signaling pathway (GO:0045879)|neuroblast proliferation (GO:0007405)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|skeletal system morphogenesis (GO:0048705)|smoothened signaling pathway (GO:0007224)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	hedgehog family protein binding (GO:0097108)|oxidoreductase activity, acting on the CH-OH group of donors, quinone or similar compound as acceptor (GO:0016901)|quinone binding (GO:0048038)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0185)		TTGTAGGAATTTCCTAACTCT	0.373																																					p.F518L		Atlas-SNP	.											.	HHIP	100	.	0			c.T1552C						.						91.0	87.0	88.0					4																	145636456		2203	4300	6503	SO:0001583	missense	64399	exon10			AGGAATTTCCTAA	AK024645	CCDS3762.1	4q31.21-q31.3	2008-08-29	2001-11-29		ENSG00000164161	ENSG00000164161			14866	protein-coding gene	gene with protein product		606178	"""hedgehog-interacting protein"""			11435703, 11731473	Standard	NM_022475		Approved	HIP, FLJ20992	uc003ijs.2	Q96QV1	OTTHUMG00000161428	ENST00000296575.3:c.1552T>C	chr4.hg19:g.145636456T>C	ENSP00000296575:p.Phe518Leu	131.0	0.0		95.0	5.0	NM_022475	Q6PK09|Q8NCI7|Q9BXK3|Q9H1J4|Q9H7E7	Missense_Mutation	SNP	ENST00000296575.3	hg19	CCDS3762.1	.	.	.	.	.	.	.	.	.	.	T	8.653	0.898663	0.17686	.	.	ENSG00000164161	ENST00000296575	T	0.04406	3.63	6.06	6.06	0.98353	Six-bladed beta-propeller, TolB-like (1);	0.049365	0.85682	D	0.000000	T	0.02418	0.0074	N	0.02854	-0.475	0.80722	D	1	B	0.13145	0.007	B	0.08055	0.003	T	0.36866	-0.9730	10	0.02654	T	1	-22.1949	16.6127	0.84892	0.0:0.0:0.0:1.0	.	518	Q96QV1	HHIP_HUMAN	L	518	ENSP00000296575:F518L	ENSP00000296575:F518L	F	+	1	0	HHIP	145855906	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	3.305000	0.51873	2.322000	0.78497	0.528000	0.53228	TTC	.	.		0.373	HHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364887.2		
ABCE1	6059	hgsc.bcm.edu	37	4	146030345	146030345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:146030345T>C	ENST00000296577.4	+	5	864	c.349T>C	c.(349-351)Tca>Cca	p.S117P	OTUD4_ENST00000455611.2_5'Flank|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	117	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					TATTGGAAAGTCAACTGCTTT	0.328																																					p.S117P		Atlas-SNP	.											.	ABCE1	47	.	0			c.T349C						.						107.0	108.0	108.0					4																	146030345		2203	4300	6503	SO:0001583	missense	6059	exon5			GGAAAGTCAACTG	X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.349T>C	chr4.hg19:g.146030345T>C	ENSP00000296577:p.Ser117Pro	109.0	0.0		57.0	4.0	NM_002940	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	ENST00000296577.4	hg19	CCDS34071.1	.	.	.	.	.	.	.	.	.	.	T	32	5.113348	0.94339	.	.	ENSG00000164163	ENST00000296577;ENST00000502586	D;D	0.97870	-4.31;-4.58	5.86	5.86	0.93980	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.99369	0.9778	H	0.99312	4.51	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98325	1.0530	10	0.87932	D	0	-33.4121	16.5602	0.84551	0.0:0.0:0.0:1.0	.	117	P61221	ABCE1_HUMAN	P	117	ENSP00000296577:S117P;ENSP00000421250:S117P	ENSP00000296577:S117P	S	+	1	0	ABCE1	146249795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.832000	0.86757	2.367000	0.80283	0.528000	0.53228	TCA	.	.		0.328	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365104.1	NM_002940	
LRBA	987	hgsc.bcm.edu	37	4	151773447	151773447	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:151773447A>G	ENST00000357115.3	-	23	3658	c.3415T>C	c.(3415-3417)Tct>Cct	p.S1139P	LRBA_ENST00000507224.1_Missense_Mutation_p.S1139P|LRBA_ENST00000535741.1_Missense_Mutation_p.S1139P|LRBA_ENST00000510413.1_Missense_Mutation_p.S1139P	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	1139						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CCGGCTTCAGATGCAGCTGGA	0.398																																					p.S1139P		Atlas-SNP	.											.	LRBA	253	.	0			c.T3415C						.						97.0	95.0	96.0					4																	151773447		2203	4300	6503	SO:0001583	missense	987	exon23			CTTCAGATGCAGC	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.3415T>C	chr4.hg19:g.151773447A>G	ENSP00000349629:p.Ser1139Pro	186.0	0.0		141.0	6.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	A	10.48	1.361289	0.24684	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.57752	0.8;0.95;0.8;0.38	5.87	1.99	0.26369	.	0.562244	0.17496	N	0.172173	T	0.32041	0.0816	L	0.27053	0.805	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.14035	-1.0487	10	0.40728	T	0.16	.	2.1804	0.03873	0.5606:0.1258:0.1896:0.1239	.	1139;1139	P50851;P50851-2	LRBA_HUMAN;.	P	1139	ENSP00000446299:S1139P;ENSP00000421552:S1139P;ENSP00000349629:S1139P;ENSP00000422180:S1139P	ENSP00000349629:S1139P	S	-	1	0	LRBA	151992897	0.001000	0.12720	0.801000	0.32222	0.463000	0.32649	0.092000	0.15066	0.517000	0.28361	0.533000	0.62120	TCT	.	.		0.398	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
SFRP2	6423	hgsc.bcm.edu	37	4	154709740	154709740	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:154709740A>G	ENST00000274063.4	-	1	532	c.248T>C	c.(247-249)gTc>gCc	p.V83A		NM_003013.2	NP_003004.1	Q96HF1	SFRP2_HUMAN	secreted frizzled-related protein 2	83	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				bone morphogenesis (GO:0060349)|brain development (GO:0007420)|cardiac left ventricle morphogenesis (GO:0003214)|cell-cell signaling (GO:0007267)|cellular response to extracellular stimulus (GO:0031668)|cellular response to X-ray (GO:0071481)|chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|convergent extension involved in axis elongation (GO:0060028)|digestive tract morphogenesis (GO:0048546)|embryonic digit morphogenesis (GO:0042733)|gonad development (GO:0008406)|hematopoietic stem cell proliferation (GO:0071425)|male gonad development (GO:0008584)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dermatome development (GO:0061185)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of gene expression (GO:0010629)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of mesodermal cell fate specification (GO:0042662)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of planar cell polarity pathway involved in axis elongation (GO:2000041)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-anal tail morphogenesis (GO:0036342)|regulation of stem cell division (GO:2000035)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|sclerotome development (GO:0061056)|vasculature development (GO:0001944)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase activator activity (GO:0061133)|fibronectin binding (GO:0001968)|integrin binding (GO:0005178)|metalloenzyme activator activity (GO:0010577)|PDZ domain binding (GO:0030165)|receptor agonist activity (GO:0048018)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)	p.V83A(2)		breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(1)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	16	all_hematologic(180;0.093)	Renal(120;0.117)				CTGCTTCATGACCAGCGGGAT	0.627																																					p.V83A		Atlas-SNP	.											SFRP2,NS,carcinoma,0,1	SFRP2	45	.	2	Substitution - Missense(2)	prostate(2)	c.T248C						.						98.0	109.0	106.0					4																	154709740		2203	4300	6503	SO:0001583	missense	6423	exon1			TTCATGACCAGCG	AF017986	CCDS34082.1	4q31.3	2008-08-29			ENSG00000145423	ENSG00000145423		"""Secreted frizzled-related proteins"""	10777	protein-coding gene	gene with protein product		604157				9391078	Standard	NM_003013		Approved	SARP1, SDF-5, FRP-2	uc003inv.1	Q96HF1	OTTHUMG00000161559	ENST00000274063.4:c.248T>C	chr4.hg19:g.154709740A>G	ENSP00000274063:p.Val83Ala	131.0	0.0		78.0	5.0	NM_003013	B3KQR2|O14778|Q9HAP5	Missense_Mutation	SNP	ENST00000274063.4	hg19	CCDS34082.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405560	0.83230	.	.	ENSG00000145423	ENST00000274063	T	0.56444	0.46	4.77	3.53	0.40419	Frizzled domain (5);	0.111099	0.64402	D	0.000010	T	0.51398	0.1672	L	0.48986	1.54	0.58432	D	0.999998	B	0.33379	0.41	B	0.41135	0.348	T	0.51505	-0.8697	10	0.56958	D	0.05	.	10.6521	0.45655	0.8561:0.0:0.0:0.1439	.	83	Q96HF1	SFRP2_HUMAN	A	83	ENSP00000274063:V83A	ENSP00000274063:V83A	V	-	2	0	SFRP2	154929190	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.177000	0.94849	0.715000	0.32103	0.533000	0.62120	GTC	.	.		0.627	SFRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365296.1		
ADAM29	11086	hgsc.bcm.edu	37	4	175898801	175898801	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:175898801G>A	ENST00000359240.3	+	5	2795	c.2125G>A	c.(2125-2127)Gat>Aat	p.D709N	RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000514159.1_Missense_Mutation_p.D709N|ADAM29_ENST00000404450.4_Missense_Mutation_p.D709N|ADAM29_ENST00000445694.1_Missense_Mutation_p.D709N	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	709					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		AAAGCAGCAAGATGTTCAAAC	0.363																																					p.D709N	Ovarian(140;1727 1835 21805 25838 41440)	Atlas-SNP	.											.	ADAM29	262	.	0			c.G2125A						.						53.0	55.0	54.0					4																	175898801		2203	4300	6503	SO:0001583	missense	11086	exon4			CAGCAAGATGTTC	AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.2125G>A	chr4.hg19:g.175898801G>A	ENSP00000352177:p.Asp709Asn	97.0	0.0		55.0	4.0	NM_001130703	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	ENST00000359240.3	hg19	CCDS3823.1	.	.	.	.	.	.	.	.	.	.	G	3.572	-0.087491	0.07097	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.01821	4.62;4.62;4.62;4.62	2.46	-3.86	0.04230	.	.	.	.	.	T	0.01061	0.0035	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47724	-0.9095	8	.	.	.	.	5.4277	0.16436	0.2376:0.2036:0.5588:0.0	.	709	Q9UKF5	ADA29_HUMAN	N	709	ENSP00000352177:D709N;ENSP00000414544:D709N;ENSP00000384229:D709N;ENSP00000423517:D709N	.	D	+	1	0	ADAM29	176135376	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.018000	0.13422	-0.901000	0.03891	-0.323000	0.08544	GAT	.	.		0.363	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding			
WWC2	80014	hgsc.bcm.edu	37	4	184129212	184129212	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:184129212A>G	ENST00000403733.3	+	3	547	c.348A>G	c.(346-348)gaA>gaG	p.E116E	WWC2_ENST00000513834.1_Silent_p.E116E|WWC2_ENST00000378925.3_Silent_p.E18E|WWC2_ENST00000504005.1_5'Flank|WWC2_ENST00000448232.2_Silent_p.E116E	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2	116					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		CACAGAAGGAACTGTACCATG	0.502																																					p.E116E		Atlas-SNP	.											.	WWC2	78	.	0			c.A348G						.						65.0	71.0	69.0					4																	184129212		2091	4229	6320	SO:0001819	synonymous_variant	80014	exon3			GAAGGAACTGTAC	BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685	ENST00000403733.3:c.348A>G	chr4.hg19:g.184129212A>G		89.0	0.0		57.0	4.0	NM_024949	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	Silent	SNP	ENST00000403733.3	hg19	CCDS34109.2																																																																																			.	.		0.502	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319608.1	NM_024949	
SLC25A4	291	hgsc.bcm.edu	37	4	186066951	186066951	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr4:186066951A>G	ENST00000281456.6	+	3	769	c.637A>G	c.(637-639)Agc>Ggc	p.S213G		NM_001151.3	NP_001142.2	P12235	ADT1_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4	213					adenine transport (GO:0015853)|apoptotic mitochondrial changes (GO:0008637)|energy reserve metabolic process (GO:0006112)|generation of precursor metabolites and energy (GO:0006091)|mitochondrial genome maintenance (GO:0000002)|negative regulation of necroptotic process (GO:0060546)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)|viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	adenine transmembrane transporter activity (GO:0015207)			endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)	10		all_lung(41;1.19e-13)|Lung NSC(41;3.16e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00872)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		OV - Ovarian serous cystadenocarcinoma(60;4.48e-44)|Epithelial(43;2.1e-41)|all cancers(43;1.37e-36)|Colorectal(24;4.79e-05)|BRCA - Breast invasive adenocarcinoma(30;7.72e-05)|GBM - Glioblastoma multiforme(59;0.000274)|COAD - Colon adenocarcinoma(29;0.000362)|STAD - Stomach adenocarcinoma(60;0.000756)|LUSC - Lung squamous cell carcinoma(40;0.00902)|READ - Rectum adenocarcinoma(43;0.155)	Adenosine triphosphate(DB00171)|Clodronate(DB00720)	CATTTTTGTGAGCTGGATGAT	0.562																																					p.S213G		Atlas-SNP	.											.	SLC25A4	27	.	0			c.A637G						.						110.0	86.0	94.0					4																	186066951		2203	4300	6503	SO:0001583	missense	291	exon3			TTTGTGAGCTGGA	BC008664	CCDS34114.1	4q35	2014-09-17			ENSG00000151729	ENSG00000151729		"""Solute carriers"""	10990	protein-coding gene	gene with protein product		103220		PEO3, PEO2, ANT1		1582253	Standard	NM_001151		Approved	T1	uc003ixd.3	P12235	OTTHUMG00000134299	ENST00000281456.6:c.637A>G	chr4.hg19:g.186066951A>G	ENSP00000281456:p.Ser213Gly	130.0	0.0		79.0	4.0	NM_001151	D3DP59	Missense_Mutation	SNP	ENST00000281456.6	hg19	CCDS34114.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.069903	0.76301	.	.	ENSG00000151729	ENST00000281456	T	0.80304	-1.36	5.54	5.54	0.83059	Mitochondrial carrier domain (2);	0.037658	0.85682	D	0.000000	D	0.84759	0.5543	M	0.88704	2.975	0.80722	D	1	B	0.21688	0.059	B	0.26202	0.067	D	0.84106	0.0398	10	0.87932	D	0	-11.4116	15.8465	0.78895	1.0:0.0:0.0:0.0	.	213	P12235	ADT1_HUMAN	G	213	ENSP00000281456:S213G	ENSP00000281456:S213G	S	+	1	0	SLC25A4	186303945	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.123000	0.94387	2.326000	0.78906	0.533000	0.62120	AGC	.	.		0.562	SLC25A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259170.3	NM_001151	
CLPTM1L	81037	hgsc.bcm.edu	37	5	1341797	1341797	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:1341797A>G	ENST00000320895.5	-	3	699	c.442T>C	c.(442-444)Tct>Cct	p.S148P	CLPTM1L_ENST00000507807.1_Missense_Mutation_p.S15P|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.S148P	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	148					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		TGTGTATCAGACTCCCCGGTG	0.572																																					p.S148P		Atlas-SNP	.											.	CLPTM1L	60	.	0			c.T442C						.						113.0	103.0	107.0					5																	1341797		2203	4300	6503	SO:0001583	missense	81037	exon3			TATCAGACTCCCC	AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.442T>C	chr5.hg19:g.1341797A>G	ENSP00000313854:p.Ser148Pro	134.0	0.0		95.0	5.0	NM_030782	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	ENST00000320895.5	hg19	CCDS3862.1	.	.	.	.	.	.	.	.	.	.	A	9.927	1.213881	0.22289	.	.	ENSG00000049656	ENST00000320895;ENST00000507807;ENST00000320927	T;T;T	0.48201	0.85;0.87;0.82	5.03	-2.0	0.07433	.	0.516798	0.22188	N	0.063410	T	0.21761	0.0524	N	0.17345	0.48	0.09310	N	0.999997	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.05084	-1.0907	10	0.33940	T	0.23	-3.9941	1.852	0.03171	0.4432:0.1301:0.3013:0.1255	.	148;15	Q96KA5;G5E9Z2	CLP1L_HUMAN;.	P	148;15;148	ENSP00000313854:S148P;ENSP00000423321:S15P;ENSP00000315196:S148P	ENSP00000313854:S148P	S	-	1	0	CLPTM1L	1394797	0.308000	0.24509	0.000000	0.03702	0.003000	0.03518	1.031000	0.30165	-0.530000	0.06349	-0.408000	0.06270	TCT	.	.		0.572	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253649.2	NM_030782	
ADAMTS16	170690	hgsc.bcm.edu	37	5	5303777	5303777	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:5303777T>C	ENST00000274181.7	+	20	3222	c.3084T>C	c.(3082-3084)gcT>gcC	p.A1028A		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	1028	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						TGCCCGACGCTGTCTGCACCT	0.652																																					p.A1028A		Atlas-SNP	.											.	ADAMTS16	543	.	0			c.T3084C						.						37.0	45.0	42.0					5																	5303777		2145	4264	6409	SO:0001819	synonymous_variant	170690	exon20			CGACGCTGTCTGC	AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.3084T>C	chr5.hg19:g.5303777T>C		110.0	0.0		94.0	4.0	NM_139056	C6G490|Q8IVE2	Silent	SNP	ENST00000274181.7	hg19	CCDS43299.1																																																																																			.	.		0.652	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365657.1	NM_139056	
CARD6	84674	hgsc.bcm.edu	37	5	40843572	40843572	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:40843572A>G	ENST00000254691.5	+	2	801	c.602A>G	c.(601-603)gAg>gGg	p.E201G	CARD6_ENST00000381677.3_Missense_Mutation_p.E201G	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	201	Asp/Glu-rich.				apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CAGAGATATGAGGAGCTAGAT	0.378																																					p.E201G		Atlas-SNP	.											CARD6,NS,carcinoma,0,1	CARD6	141	.	0			c.A602G						.						43.0	47.0	45.0					5																	40843572		2203	4300	6503	SO:0001583	missense	84674	exon2			GATATGAGGAGCT	AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.602A>G	chr5.hg19:g.40843572A>G	ENSP00000254691:p.Glu201Gly	75.0	0.0		73.0	3.0	NM_032587	Q52LR2	Missense_Mutation	SNP	ENST00000254691.5	hg19	CCDS3935.1	.	.	.	.	.	.	.	.	.	.	A	19.16	3.774576	0.70107	.	.	ENSG00000132357	ENST00000254691;ENST00000381677;ENST00000444789;ENST00000509771	T;T	0.54675	1.81;0.56	5.23	5.23	0.72850	.	0.255180	0.27831	N	0.017670	T	0.56232	0.1971	L	0.36672	1.1	0.33773	D	0.623322	D	0.60160	0.987	P	0.56865	0.808	T	0.69439	-0.5145	10	0.72032	D	0.01	-7.3434	11.4306	0.50038	1.0:0.0:0.0:0.0	.	201	Q9BX69	CARD6_HUMAN	G	201	ENSP00000254691:E201G;ENSP00000371093:E201G	ENSP00000254691:E201G	E	+	2	0	CARD6	40879329	0.812000	0.29077	0.998000	0.56505	0.948000	0.59901	2.439000	0.44846	2.197000	0.70478	0.533000	0.62120	GAG	.	.		0.378	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211584.3		
MOCS2	4338	hgsc.bcm.edu	37	5	52402917	52402917	+	Nonsense_Mutation	SNP	C	C	A	rs34034664		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:52402917C>A	ENST00000396954.3	-	3	765	c.88G>T	c.(88-90)Gag>Tag	p.E30*	MOCS2_ENST00000508922.1_3'UTR|MOCS2_ENST00000527216.1_3'UTR|CTD-2366F13.1_ENST00000502171.2_RNA|MOCS2_ENST00000361377.4_3'UTR|CTD-2366F13.1_ENST00000499459.2_RNA|MOCS2_ENST00000584946.1_3'UTR|MOCS2_ENST00000582677.1_3'UTR|CTD-2366F13.1_ENST00000512301.1_RNA|MOCS2_ENST00000450852.3_3'UTR|MOCS2_ENST00000510818.2_3'UTR	NM_004531.3	NP_004522.1			molybdenum cofactor synthesis 2											endometrium(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	5		Lung NSC(810;3.08e-05)|Breast(144;0.0848)				CTAGATGGCTCAAAAGCACTA	0.433																																					p.E30X		Atlas-SNP	.											.	MOCS2	28	.	0			c.G88T						.						96.0	82.0	87.0					5																	52402917		2203	4300	6503	SO:0001587	stop_gained	4338	exon3			ATGGCTCAAAAGC	AF117815	CCDS3958.1, CCDS47205.1	5q11	2008-02-05			ENSG00000164172	ENSG00000164172			7193	protein-coding gene	gene with protein product		603708				10053004, 9889283	Standard	NM_004531		Approved	MOCO1	uc003joz.3	O96007	OTTHUMG00000096981	ENST00000396954.3:c.88G>T	chr5.hg19:g.52402917C>A	ENSP00000380157:p.Glu30*	91.0	0.0		58.0	12.0	NM_004531		Nonsense_Mutation	SNP	ENST00000396954.3	hg19	CCDS3958.1	.	.	.	.	.	.	.	.	.	.	C	41	8.846833	0.98976	.	.	ENSG00000164172	ENST00000396954;ENST00000527216	.	.	.	5.92	4.1	0.47936	.	0.624751	0.16259	N	0.222307	.	.	.	.	.	.	0.20307	N	0.999912	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-13.4529	10.2954	0.43620	0.0:0.6788:0.2524:0.0688	.	.	.	.	X	30	.	ENSP00000380157:E30X	E	-	1	0	MOCS2	52438674	0.001000	0.12720	0.004000	0.12327	0.178000	0.23041	0.690000	0.25451	0.803000	0.34113	0.655000	0.94253	GAG	.	.		0.433	MOCS2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214053.3	NM_183418	
SV2C	22987	hgsc.bcm.edu	37	5	75587051	75587051	+	Silent	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:75587051C>T	ENST00000502798.2	+	7	1585	c.1143C>T	c.(1141-1143)aaC>aaT	p.N381N	SV2C_ENST00000322285.7_Silent_p.N381N|RP11-466P24.6_ENST00000502589.1_RNA	NM_014979.1	NP_055794.1	Q496J9	SV2C_HUMAN	synaptic vesicle glycoprotein 2C	381					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	transmembrane transporter activity (GO:0022857)			NS(1)|breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		all_lung(232;0.007)|Lung NSC(167;0.0148)|Ovarian(174;0.0798)|Prostate(461;0.184)		OV - Ovarian serous cystadenocarcinoma(47;1.16e-50)|all cancers(79;7.25e-40)		TACAGGTAAACAAAATAAAAA	0.398																																					p.N381N		Atlas-SNP	.											.	SV2C	97	.	0			c.C1143T						.						88.0	88.0	88.0					5																	75587051		2022	4226	6248	SO:0001819	synonymous_variant	22987	exon7			GGTAAACAAAATA	AB028977	CCDS43331.1, CCDS75261.1	5q13	2008-02-05			ENSG00000122012	ENSG00000122012			30670	protein-coding gene	gene with protein product		610291				10470851, 9801366	Standard	XM_005248470		Approved		uc003kei.1	Q496J9	OTTHUMG00000162384	ENST00000502798.2:c.1143C>T	chr5.hg19:g.75587051C>T		152.0	0.0		113.0	5.0	NM_014979	Q496K1|Q9UPU8	Silent	SNP	ENST00000502798.2	hg19	CCDS43331.1																																																																																			.	.		0.398	SV2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368700.4		
POU5F2	134187	hgsc.bcm.edu	37	5	93076777	93076777	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:93076777A>C	ENST00000510627.4	-	1	566	c.493T>G	c.(493-495)Tgc>Ggc	p.C165G	FAM172A_ENST00000509163.1_Intron|FAM172A_ENST00000395965.3_Intron|FAM172A_ENST00000509739.1_Intron|RP11-185E12.2_ENST00000606528.1_RNA|FAM172A_ENST00000505869.1_Intron|POU5F2_ENST00000606183.1_5'UTR	NM_153216.1	NP_694948.1	Q8N7G0	PO5F2_HUMAN	POU domain class 5, transcription factor 2	165	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)						all_cancers(142;3.87e-05)|all_epithelial(76;4.59e-07)|all_lung(232;0.0126)|Lung NSC(167;0.0155)|Ovarian(174;0.0218)|Prostate(281;0.173)|Colorectal(57;0.19)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0415)|all cancers(79;2.03e-19)		TCGAAGCGGCAGATGGTCGTC	0.582																																					p.C165G		Atlas-SNP	.											.	POU5F2	10	.	0			c.T493G						.						88.0	92.0	91.0					5																	93076777		2169	4284	6453	SO:0001583	missense	134187	exon1			AGCGGCAGATGGT		CCDS59489.1	5q15	2011-06-20				ENSG00000248483		"""Homeoboxes / POU class"""	26367	protein-coding gene	gene with protein product						7908264	Standard	NM_153216		Approved	SPRM-1, FLJ25680	uc003kkl.1	Q8N7G0		ENST00000510627.4:c.493T>G	chr5.hg19:g.93076777A>C	ENSP00000464890:p.Cys165Gly	71.0	0.0		45.0	7.0	NM_153216	Q15169|Q6MZL7|Q8N748	Missense_Mutation	SNP	ENST00000510627.4	hg19	CCDS59489.1																																																																																			.	.		0.582	POU5F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369873.5	NM_153216	
ANKRD32	84250	hgsc.bcm.edu	37	5	93964624	93964624	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:93964624A>G	ENST00000265140.5	+	2	528	c.109A>G	c.(109-111)Agt>Ggt	p.S37G		NM_032290.3	NP_115666.2	Q9BQI6	ANR32_HUMAN	ankyrin repeat domain 32	37	BRCT 1.					centrosome (GO:0005813)|nucleus (GO:0005634)				NS(1)|breast(2)|endometrium(2)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	13		all_cancers(142;1.51e-09)|all_epithelial(76;4.68e-12)|all_lung(232;5.94e-05)|Ovarian(174;0.000953)|Lung NSC(167;0.00105)|Colorectal(57;0.122)|Lung SC(612;0.152)		all cancers(79;3.88e-18)		TTTTATTAAGAGTGAGGTAAG	0.303																																					p.S37G		Atlas-SNP	.											.	ANKRD32	117	.	0			c.A109G						.						94.0	84.0	87.0					5																	93964624		692	1588	2280	SO:0001583	missense	84250	exon2			ATTAAGAGTGAGG	AL136560	CCDS4071.2	5q15	2013-01-10			ENSG00000133302	ENSG00000133302		"""Ankyrin repeat domain containing"""	25408	protein-coding gene	gene with protein product			"""BRCT domain containing 1"""	BRCTD1			Standard	NM_032290		Approved	DKFZp761C121, DKFZp564C0469	uc003kkr.4	Q9BQI6	OTTHUMG00000121133	ENST00000265140.5:c.109A>G	chr5.hg19:g.93964624A>G	ENSP00000265140:p.Ser37Gly	103.0	0.0		83.0	4.0	NM_032290	B4DMG4|Q3B7K4|Q6NSA5|Q6PHW9|Q9Y402	Missense_Mutation	SNP	ENST00000265140.5	hg19	CCDS4071.2	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126518	0.56721	.	.	ENSG00000133302	ENST00000265140;ENST00000504099	T;T	0.66815	-0.23;-0.23	5.47	5.47	0.80525	BRCT (2);	0.757107	0.11780	N	0.530310	T	0.61035	0.2315	L	0.42245	1.32	0.32350	N	0.558555	P	0.44006	0.824	B	0.37015	0.239	T	0.70525	-0.4848	10	0.72032	D	0.01	.	15.5395	0.76031	1.0:0.0:0.0:0.0	.	37	Q9BQI6	ANR32_HUMAN	G	37	ENSP00000265140:S37G;ENSP00000425022:S37G	ENSP00000265140:S37G	S	+	1	0	ANKRD32	93990380	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.188000	0.72045	2.089000	0.63090	0.533000	0.62120	AGT	.	.		0.303	ANKRD32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241610.1	NM_032290	
FBN2	2201	hgsc.bcm.edu	37	5	127712455	127712455	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:127712455A>G	ENST00000508053.1	-	20	2915	c.1941T>C	c.(1939-1941)ttT>ttC	p.F647F	FBN2_ENST00000508989.1_Silent_p.F614F|FBN2_ENST00000262464.4_Silent_p.F647F|FBN2_ENST00000511489.1_5'UTR			P35556	FBN2_HUMAN	fibrillin 2	647	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GAGCCAAGACAAATCCTGGTT	0.413																																					p.F647F		Atlas-SNP	.											.	FBN2	858	.	0			c.T1941C						.						248.0	211.0	223.0					5																	127712455		2203	4300	6503	SO:0001819	synonymous_variant	2201	exon14			CAAGACAAATCCT	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.1941T>C	chr5.hg19:g.127712455A>G		160.0	0.0		85.0	4.0	NM_001999	B4DU01|Q59ES6	Silent	SNP	ENST00000508053.1	hg19	CCDS34222.1																																																																																			.	.		0.413	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
RAPGEF6	51735	hgsc.bcm.edu	37	5	130769307	130769307	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:130769307A>G	ENST00000509018.1	-	25	3995	c.3790T>C	c.(3790-3792)Tcc>Ccc	p.S1264P	RAPGEF6_ENST00000507093.1_Missense_Mutation_p.S1272P|CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.S1314P|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.S1272P|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.S1277P	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	1264	Ser-rich.				positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CTATGGCTGGAGTCAGACAAG	0.453																																					p.S1277P	Melanoma(168;435 1955 13113 13877 23213)	Atlas-SNP	.											.	RAPGEF6	361	.	0			c.T3829C						.						109.0	100.0	103.0					5																	130769307		2203	4300	6503	SO:0001583	missense	51735	exon27			GGCTGGAGTCAGA	AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.3790T>C	chr5.hg19:g.130769307A>G	ENSP00000421684:p.Ser1264Pro	101.0	0.0		74.0	4.0	NM_001164387	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	ENST00000509018.1	hg19	CCDS34225.1	.	.	.	.	.	.	.	.	.	.	A	27.3	4.823101	0.90873	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000514667	T;T;T;T;T	0.33865	1.49;1.39;1.41;1.49;1.59	5.83	5.83	0.93111	.	0.110074	0.64402	D	0.000005	T	0.61438	0.2347	M	0.74258	2.255	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;0.999	D;D;D;D;D	0.91635	0.998;0.979;0.979;0.999;0.979	T	0.63440	-0.6637	10	0.52906	T	0.07	.	16.214	0.82191	1.0:0.0:0.0:0.0	.	1272;1272;1314;1277;1264	A3KN82;B7ZML2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;RPGF6_HUMAN	P	1264;1277;1272;1272;1277;1314	ENSP00000421684:S1264P;ENSP00000309298:S1277P;ENSP00000426081:S1272P;ENSP00000296859:S1272P;ENSP00000426948:S1314P	ENSP00000426948:S1314P	S	-	1	0	RAPGEF6;FNIP1	130797206	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.330000	0.90019	2.224000	0.72417	0.528000	0.53228	TCC	.	.		0.453	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370059.1	NM_016340	
AFF4	27125	hgsc.bcm.edu	37	5	132222022	132222022	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:132222022T>C	ENST00000265343.5	-	18	3458	c.3079A>G	c.(3079-3081)Aca>Gca	p.T1027A		NM_014423.3	NP_055238.1	Q9UHB7	AFF4_HUMAN	AF4/FMR2 family, member 4	1027					spermatid development (GO:0007286)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	sequence-specific DNA binding transcription factor activity (GO:0003700)		SEPT8/AFF4(2)	breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(7)|lung(11)|ovary(3)|pancreas(1)|prostate(3)|skin(2)	43		all_cancers(142;0.145)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			TCTGTCAGTGTCTTTGAGTAC	0.478																																					p.T1027A	Ovarian(126;889 1733 2942 10745 11605)	Atlas-SNP	.											.	AFF4	120	.	0			c.A3079G						.						167.0	153.0	158.0					5																	132222022		2203	4300	6503	SO:0001583	missense	27125	exon18			TCAGTGTCTTTGA	AF197927	CCDS4164.1	5q31	2006-04-28			ENSG00000072364	ENSG00000072364			17869	protein-coding gene	gene with protein product	"""ALL1 fused gene from 5q31"""	604417				10588740	Standard	XM_005271963		Approved	AF5Q31, MCEF	uc003kyd.3	Q9UHB7	OTTHUMG00000059838	ENST00000265343.5:c.3079A>G	chr5.hg19:g.132222022T>C	ENSP00000265343:p.Thr1027Ala	224.0	0.0		118.0	5.0	NM_014423	B2RP19|B7WPD2|Q498B2|Q59FB3|Q6P592|Q8TDR1|Q9P0E4	Missense_Mutation	SNP	ENST00000265343.5	hg19	CCDS4164.1	.	.	.	.	.	.	.	.	.	.	T	16.35	3.098562	0.56183	.	.	ENSG00000072364	ENST00000265343	T	0.65916	-0.18	5.48	4.3	0.51218	.	0.102374	0.64402	D	0.000002	T	0.50326	0.1609	L	0.35644	1.08	0.80722	D	1	B	0.23650	0.089	B	0.28638	0.092	T	0.35968	-0.9767	10	0.13853	T	0.58	-4.6048	12.0849	0.53691	0.129:0.0:0.0:0.871	.	1027	Q9UHB7	AFF4_HUMAN	A	1027	ENSP00000265343:T1027A	ENSP00000265343:T1027A	T	-	1	0	AFF4	132249921	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.006000	0.57083	1.005000	0.39183	0.528000	0.53228	ACA	.	.		0.478	AFF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000133049.1	NM_014423	
JAKMIP2	9832	hgsc.bcm.edu	37	5	147040867	147040867	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:147040867T>C	ENST00000265272.5	-	3	738	c.271A>G	c.(271-273)Aac>Gac	p.N91D	JAKMIP2_ENST00000333010.6_Missense_Mutation_p.N49D|JAKMIP2_ENST00000507386.1_Missense_Mutation_p.N91D	NM_001270941.1|NM_014790.4	NP_001257870.1|NP_055605.2	Q96AA8	JKIP2_HUMAN	janus kinase and microtubule interacting protein 2	91						Golgi apparatus (GO:0005794)				NS(1)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(22)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)	64			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGATAAGGTTCTCCCTCACA	0.557																																					p.N91D		Atlas-SNP	.											.	JAKMIP2	154	.	0			c.A271G						.						190.0	174.0	180.0					5																	147040867		2203	4300	6503	SO:0001583	missense	9832	exon3			TAAGGTTCTCCCT	AB011127	CCDS4285.1, CCDS59495.1, CCDS64284.1, CCDS75352.1	5q32	2009-08-13	2009-08-13		ENSG00000176049	ENSG00000176049			29067	protein-coding gene	gene with protein product		611197				9628581	Standard	NM_001270941		Approved	JAMIP2, KIAA0555	uc010jgo.2	Q96AA8	OTTHUMG00000129731	ENST00000265272.5:c.271A>G	chr5.hg19:g.147040867T>C	ENSP00000265272:p.Asn91Asp	163.0	0.0		100.0	4.0	NM_001270941	A4ZZA7|A8K5G5|B4DSG0|G5E9Y0|O60302|Q548S1	Missense_Mutation	SNP	ENST00000265272.5	hg19	CCDS4285.1	.	.	.	.	.	.	.	.	.	.	T	8.356	0.831957	0.16820	.	.	ENSG00000176049	ENST00000507386;ENST00000265272;ENST00000333010;ENST00000539401	T;T;T	0.08102	3.13;3.13;3.13	4.67	4.67	0.58626	.	0.209202	0.47852	D	0.000205	T	0.07773	0.0195	L	0.50333	1.59	0.40265	D	0.978223	P;B;B;B	0.35872	0.525;0.058;0.058;0.058	B;B;B;B	0.27608	0.081;0.025;0.025;0.025	T	0.27773	-1.0064	10	0.11794	T	0.64	.	14.8123	0.70006	0.0:0.0:0.0:1.0	.	49;91;91;91	B4DSG0;Q96AA8-3;G5E9Y0;Q96AA8	.;.;.;JKIP2_HUMAN	D	91;91;49;91	ENSP00000421398:N91D;ENSP00000265272:N91D;ENSP00000328989:N49D	ENSP00000265272:N91D	N	-	1	0	JAKMIP2	147021060	1.000000	0.71417	0.985000	0.45067	0.623000	0.37688	3.128000	0.50492	2.046000	0.60703	0.460000	0.39030	AAC	.	.		0.557	JAKMIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251941.1	NM_014790	
LMAN2	10960	hgsc.bcm.edu	37	5	176778206	176778206	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:176778206G>A	ENST00000303127.7	-	2	487	c.283C>T	c.(283-285)Cgc>Tgc	p.R95C	LMAN2_ENST00000506310.1_5'UTR|LMAN2_ENST00000515209.1_Missense_Mutation_p.R95C	NM_006816.2	NP_006807.1	Q12907	LMAN2_HUMAN	lectin, mannose-binding 2	95	L-type lectin-like. {ECO:0000255|PROSITE- ProRule:PRU00658}.				positive regulation of phagocytosis (GO:0050766)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|heat shock protein binding (GO:0031072)|mannose binding (GO:0005537)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	16	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCTTTGCTGCGCTCGTCAGGG	0.602																																					p.R95C		Atlas-SNP	.											.	LMAN2	35	.	0			c.C283T						.						124.0	114.0	117.0					5																	176778206		2203	4300	6503	SO:0001583	missense	10960	exon2			TGCTGCGCTCGTC	U10362	CCDS4417.1	5q35	2008-02-05		2003-07-04	ENSG00000169223	ENSG00000169223			16986	protein-coding gene	gene with protein product		609551	"""chromosome 5 open reading frame 8"""	C5orf8		12609988	Standard	NM_006816		Approved	GP36B, VIP36	uc003mge.3	Q12907	OTTHUMG00000130860	ENST00000303127.7:c.283C>T	chr5.hg19:g.176778206G>A	ENSP00000303366:p.Arg95Cys	106.0	0.0		49.0	4.0	NM_006816	Q53HH1	Missense_Mutation	SNP	ENST00000303127.7	hg19	CCDS4417.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365489	0.82463	.	.	ENSG00000169223	ENST00000303127;ENST00000539488;ENST00000515209;ENST00000514458;ENST00000502560;ENST00000513877	T;T;T;T;T	0.66280	-0.2;-0.2;-0.2;-0.2;-0.2	5.67	5.67	0.87782	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.101632	0.64402	D	0.000010	T	0.76133	0.3945	M	0.80616	2.505	0.80722	D	1	D;D	0.76494	0.997;0.999	P;P	0.58660	0.765;0.843	T	0.79291	-0.1864	10	0.72032	D	0.01	-16.7678	13.5517	0.61736	0.0:0.0:0.8441:0.1559	.	95;95	Q12907;D6RBV2	LMAN2_HUMAN;.	C	95;24;95;95;95;24	ENSP00000303366:R95C;ENSP00000423998:R95C;ENSP00000424132:R95C;ENSP00000425229:R95C;ENSP00000427377:R24C	ENSP00000303366:R95C	R	-	1	0	LMAN2	176710812	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.802000	0.62539	2.685000	0.91497	0.644000	0.83932	CGC	.	.		0.602	LMAN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253434.1	NM_006816	
F12	2161	hgsc.bcm.edu	37	5	176829426	176829426	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:176829426T>C	ENST00000253496.3	-	14	1763	c.1715A>G	c.(1714-1716)cAa>cGa	p.Q572R	PFN3_ENST00000358571.2_5'Flank|F12_ENST00000514943.1_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	572	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	CTCTGCAGCTTGGTCCTCACA	0.637									Hereditary Angioedema																												p.Q572R		Atlas-SNP	.											F12,NS,carcinoma,0,1	F12	35	.	0			c.A1715G						.						44.0	38.0	40.0					5																	176829426		2203	4300	6503	SO:0001583	missense	2161	exon14	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	GCAGCTTGGTCCT	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1715A>G	chr5.hg19:g.176829426T>C	ENSP00000253496:p.Gln572Arg	75.0	0.0		42.0	2.0	NM_000505	P78339	Missense_Mutation	SNP	ENST00000253496.3	hg19	CCDS34302.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.390570	0.25118	.	.	ENSG00000131187	ENST00000253496	D	0.88896	-2.44	4.03	0.376	0.16193	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	1.242130	0.05783	N	0.608976	T	0.79695	0.4490	N	0.16130	0.375	0.09310	N	1	B	0.27416	0.178	B	0.28385	0.089	T	0.67585	-0.5633	10	0.49607	T	0.09	.	6.5787	0.22581	0.0:0.3635:0.0:0.6365	.	572	P00748	FA12_HUMAN	R	572	ENSP00000253496:Q572R	ENSP00000253496:Q572R	Q	-	2	0	F12	176762032	0.000000	0.05858	0.000000	0.03702	0.742000	0.42306	-0.325000	0.07976	0.065000	0.16485	0.459000	0.35465	CAA	.	.		0.637	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373217.1		
RIPK1	8737	hgsc.bcm.edu	37	6	3105913	3105913	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:3105913A>G	ENST00000259808.4	+	9	1502	c.1204A>G	c.(1204-1206)Aat>Gat	p.N402D	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.N402D|RIPK1_ENST00000541791.1_Missense_Mutation_p.N356D			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	402	Interaction with SQSTM1.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GCCCAGACAGAATGTGGCTTA	0.502																																					p.N402D		Atlas-SNP	.											.	RIPK1	56	.	0			c.A1204G						.						69.0	73.0	72.0					6																	3105913		2203	4300	6503	SO:0001583	missense	8737	exon8			AGACAGAATGTGG	U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.1204A>G	chr6.hg19:g.3105913A>G	ENSP00000259808:p.Asn402Asp	171.0	0.0		114.0	5.0	NM_003804	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	ENST00000259808.4	hg19	CCDS4482.1	.	.	.	.	.	.	.	.	.	.	A	12.42	1.934090	0.34096	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409	T;T;T	0.77098	-1.07;-0.56;-1.07	5.6	0.295	0.15752	.	1.461890	0.03202	N	0.174871	T	0.51449	0.1675	L	0.53249	1.67	0.09310	N	1	P;P	0.36535	0.557;0.514	B;B	0.31101	0.124;0.039	T	0.43360	-0.9396	10	0.44086	T	0.13	-2.7032	5.528	0.16968	0.6328:0.1354:0.2318:0.0	.	356;402	Q13546-2;Q13546	.;RIPK1_HUMAN	D	402;356;402	ENSP00000259808:N402D;ENSP00000442294:N356D;ENSP00000369773:N402D	ENSP00000259808:N402D	N	+	1	0	RIPK1	3050912	0.000000	0.05858	0.000000	0.03702	0.912000	0.54170	0.066000	0.14489	0.077000	0.16863	0.533000	0.62120	AAT	.	.		0.502	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039659.2	NM_003804	
GFOD1	54438	hgsc.bcm.edu	37	6	13487004	13487004	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:13487004T>C	ENST00000379287.3	-	1	783	c.119A>G	c.(118-120)gAg>gGg	p.E40G	GFOD1-AS1_ENST00000446001.1_RNA|GFOD1_ENST00000379278.3_5'Flank|AL583828.1_ENST00000558378.1_5'Flank|GFOD1_ENST00000603223.1_Missense_Mutation_p.E40G	NM_018988.3	NP_061861.1	Q9NXC2	GFOD1_HUMAN	glucose-fructose oxidoreductase domain containing 1	40						extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)	18	Breast(50;0.0296)|Ovarian(93;0.0454)	all_hematologic(90;0.135)	Epithelial(50;0.0348)|BRCA - Breast invasive adenocarcinoma(129;0.1)|all cancers(50;0.108)			GGCCAGCTCCTCCGCTTCTTC	0.622																																					p.E40G		Atlas-SNP	.											.	GFOD1	38	.	0			c.A119G						.						153.0	124.0	134.0					6																	13487004		2203	4300	6503	SO:0001583	missense	54438	exon1			AGCTCCTCCGCTT	AK000337	CCDS4524.1, CCDS56397.1, CCDS64351.1	6p24.1-p23	2013-09-19			ENSG00000145990	ENSG00000145990			21096	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 114"""	C6orf114			Standard	NM_018988		Approved	FLJ20330, ADG-90	uc003nat.2	Q9NXC2	OTTHUMG00000014276	ENST00000379287.3:c.119A>G	chr6.hg19:g.13487004T>C	ENSP00000368589:p.Glu40Gly	83.0	0.0		78.0	4.0	NM_018988	A8E4L6|Q5T058|Q96JD4|Q9H5K2	Missense_Mutation	SNP	ENST00000379287.3	hg19	CCDS4524.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862194	0.71949	.	.	ENSG00000145990	ENST00000379287	T	0.25749	1.78	4.39	4.39	0.52855	Oxidoreductase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.18045	0.0433	M	0.64997	1.995	0.80722	D	1	B	0.22276	0.067	B	0.30646	0.118	T	0.06972	-1.0797	10	0.56958	D	0.05	-0.6489	12.9312	0.58288	0.0:0.0:0.0:1.0	.	40	Q9NXC2	GFOD1_HUMAN	G	40	ENSP00000368589:E40G	ENSP00000368589:E40G	E	-	2	0	GFOD1	13594983	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.706000	0.84615	1.841000	0.53522	0.438000	0.28831	GAG	.	.		0.622	GFOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039902.1	NM_018988	
PRRC2A	7916	hgsc.bcm.edu	37	6	31603241	31603241	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:31603241A>G	ENST00000376033.2	+	23	5606	c.5372A>G	c.(5371-5373)gAg>gGg	p.E1791G	PRRC2A_ENST00000376007.4_Splice_Site_p.E1791G	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1791	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						TCAGTCACTGAGGTAAGTGGG	0.522																																					p.E1791G		Atlas-SNP	.											.	PRRC2A	152	.	0			c.A5372G						.						113.0	111.0	112.0					6																	31603241		1511	2709	4220	SO:0001630	splice_region_variant	7916	exon23			TCACTGAGGTAAG	M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.5373+1A>G	chr6.hg19:g.31603241A>G		168.0	0.0		98.0	4.0	NM_004638	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	ENST00000376033.2	hg19	CCDS4708.1	.	.	.	.	.	.	.	.	.	.	A	11.06	1.527599	0.27299	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01981	4.52;4.52	4.94	2.36	0.29203	.	0.207947	0.34268	N	0.004101	T	0.00496	0.0016	N	0.08118	0	0.35216	D	0.775561	B	0.02656	0.0	B	0.04013	0.001	T	0.46898	-0.9158	10	0.87932	D	0	-6.4453	2.8996	0.05701	0.6118:0.0:0.2061:0.1822	.	1791	P48634	PRC2A_HUMAN	G	1785;1774;1791;1791;1016	ENSP00000365175:E1791G;ENSP00000365201:E1791G	ENSP00000365175:E1791G	E	+	2	0	PRRC2A	31711220	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	2.076000	0.41548	1.008000	0.39264	0.459000	0.35465	GAG	.	.		0.522	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259319.1	NM_080686	Missense_Mutation
RIMS1	22999	hgsc.bcm.edu	37	6	72960073	72960073	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:72960073T>C	ENST00000521978.1	+	13	2282	c.2282T>C	c.(2281-2283)gTa>gCa	p.V761A	RIMS1_ENST00000401910.3_Missense_Mutation_p.V235A|RIMS1_ENST00000522291.1_Missense_Mutation_p.V761A|RIMS1_ENST00000523963.1_Missense_Mutation_p.V235A|RIMS1_ENST00000425662.2_Missense_Mutation_p.V154A|RIMS1_ENST00000491071.2_Missense_Mutation_p.V761A|RIMS1_ENST00000520567.1_Missense_Mutation_p.V761A|RIMS1_ENST00000517960.1_Missense_Mutation_p.V761A|RIMS1_ENST00000538414.1_5'Flank|RIMS1_ENST00000264839.7_Missense_Mutation_p.V761A|RIMS1_ENST00000348717.5_Missense_Mutation_p.V761A|RIMS1_ENST00000518273.1_Missense_Mutation_p.V761A|RIMS1_ENST00000517827.1_Missense_Mutation_p.V220A	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	761	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				CAGCTGATTGTAAATGTTCTG	0.368																																					p.V761A		Atlas-SNP	.											.	RIMS1	278	.	0			c.T2282C						.						83.0	81.0	82.0					6																	72960073		1857	4101	5958	SO:0001583	missense	22999	exon13			TGATTGTAAATGT	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.2282T>C	chr6.hg19:g.72960073T>C	ENSP00000428417:p.Val761Ala	174.0	0.0		95.0	4.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.342893	0.82022	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978;ENST00000401910;ENST00000523963;ENST00000425662;ENST00000453976;ENST00000517827	D;D;D;D;D;D;D;D;D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82	5.28	4.07	0.47477	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.093937	0.44902	D	0.000419	D	0.91818	0.7411	M	0.91972	3.26	0.80722	D	1	D;B;D;D;D;D;D	0.89917	0.982;0.028;0.995;0.995;1.0;0.997;0.995	D;B;D;D;D;D;D	0.97110	0.995;0.215;0.998;0.998;1.0;0.998;0.998	D	0.93054	0.6468	10	0.87932	D	0	-15.1989	12.354	0.55165	0.0:0.0:0.1412:0.8588	.	220;235;761;220;235;761;761	B7Z3S3;E9PHF5;E9PHR1;B7Z9Z3;E9PF48;C9JNW6;Q86UR5	.;.;.;.;.;.;RIMS1_HUMAN	A	761;761;761;761;761;761;761;761;761;761;761;761;235;235;154;154;220	ENSP00000430101:V761A;ENSP00000275037:V761A;ENSP00000264839:V761A;ENSP00000429959:V761A;ENSP00000430408:V761A;ENSP00000430502:V761A;ENSP00000430932:V761A;ENSP00000428417:V761A;ENSP00000385649:V235A;ENSP00000428328:V235A;ENSP00000411235:V154A;ENSP00000389503:V154A;ENSP00000428367:V220A	ENSP00000264839:V761A	V	+	2	0	RIMS1	73016794	1.000000	0.71417	0.996000	0.52242	0.990000	0.78478	7.993000	0.88291	0.889000	0.36185	0.477000	0.44152	GTA	.	.		0.368	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
MMS22L	253714	hgsc.bcm.edu	37	6	97627437	97627437	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:97627437T>C	ENST00000275053.4	-	17	2650		c.e17-2		MMS22L_ENST00000369251.2_Splice_Site	NM_198468.2	NP_940870.2	Q6ZRQ5	MMS22_HUMAN	MMS22-like, DNA repair protein						double-strand break repair via homologous recombination (GO:0000724)|replication fork processing (GO:0031297)	nuclear replication fork (GO:0043596)				breast(1)|endometrium(9)|kidney(2)|large_intestine(12)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	50						CATAATGTGCTGTAGAAACAA	0.318																																					.		Atlas-SNP	.											.	MMS22L	102	.	0			c.2385-2A>G						.						44.0	43.0	43.0					6																	97627437		2203	4299	6502	SO:0001630	splice_region_variant	253714	exon18			ATGTGCTGTAGAA		CCDS5039.1	6q16.3	2010-11-11	2010-11-11	2010-11-11	ENSG00000146263	ENSG00000146263			21475	protein-coding gene	gene with protein product		615614	"""chromosome 6 open reading frame 167"""	C6orf167		21055983, 21055984	Standard	NM_198468		Approved	dJ39B17.2	uc003ppb.3	Q6ZRQ5	OTTHUMG00000015248	ENST00000275053.4:c.2385-2A>G	chr6.hg19:g.97627437T>C		61.0	0.0		55.0	4.0	NM_198468	D6R9Y8|D6RBQ4|E1P529|Q5THT2|Q68CQ6|Q68D32	Splice_Site	SNP	ENST00000275053.4	hg19	CCDS5039.1	.	.	.	.	.	.	.	.	.	.	T	21.1	4.094512	0.76870	.	.	ENSG00000146263	ENST00000275053;ENST00000369251	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9664	0.71198	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	MMS22L	97734158	1.000000	0.71417	0.999000	0.59377	0.907000	0.53573	4.896000	0.63222	2.272000	0.75746	0.524000	0.50904	.	.	.		0.318	MMS22L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041573.3	NM_198468	Intron
ROS1	6098	hgsc.bcm.edu	37	6	117718268	117718268	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr6:117718268C>T	ENST00000368508.3	-	7	787	c.589G>A	c.(589-591)Gca>Aca	p.A197T	GOPC_ENST00000467125.1_Intron|ROS1_ENST00000368507.3_Missense_Mutation_p.A206T	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	197	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		ATCAAAGGTGCAGTTTCAGGA	0.383			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																p.A197T		Atlas-SNP	.		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	.	ROS1	728	.	0			c.G589A						.						77.0	77.0	77.0					6																	117718268		2203	4300	6503	SO:0001583	missense	6098	exon7			AAGGTGCAGTTTC	M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.589G>A	chr6.hg19:g.117718268C>T	ENSP00000357494:p.Ala197Thr	158.0	0.0		96.0	4.0	NM_002944	Q15368|Q5TDB5	Missense_Mutation	SNP	ENST00000368508.3	hg19	CCDS5116.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.203963	0.79127	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.56776	0.44;0.44	5.54	5.54	0.83059	.	0.000000	0.64402	D	0.000003	T	0.68063	0.2960	M	0.71296	2.17	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67260	-0.5715	10	0.51188	T	0.08	.	18.8227	0.92103	0.0:1.0:0.0:0.0	.	197	P08922	ROS1_HUMAN	T	197;206	ENSP00000357494:A197T;ENSP00000357493:A206T	ENSP00000357493:A206T	A	-	1	0	ROS1	117824961	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	2.223000	0.42936	2.762000	0.94881	0.650000	0.86243	GCA	.	.		0.383	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000043464.1		
AIMP2	7965	hgsc.bcm.edu	37	7	6063115	6063115	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:6063115A>G	ENST00000223029.3	+	4	875	c.756A>G	c.(754-756)aaA>aaG	p.K252K	EIF2AK1_ENST00000199389.6_3'UTR|AIMP2_ENST00000400479.2_Silent_p.K174K|AIMP2_ENST00000395236.2_Silent_p.K183K	NM_006303.3	NP_006294.2	Q13155	AIMP2_HUMAN	aminoacyl tRNA synthetase complex-interacting multifunctional protein 2	252	GST C-terminal.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|tRNA aminoacylation for protein translation (GO:0006418)|Type II pneumocyte differentiation (GO:0060510)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						GTAAAGAAAAAGCCGCTGTTT	0.488																																					p.K252K		Atlas-SNP	.											.	AIMP2	32	.	0			c.A756G						.						81.0	77.0	79.0					7																	6063115		2203	4300	6503	SO:0001819	synonymous_variant	7965	exon4			AGAAAAAGCCGCT	U24169	CCDS5344.1	7p22.1	2009-05-29			ENSG00000106305	ENSG00000106305			20609	protein-coding gene	gene with protein product		600859				8666379, 18695251	Standard	NM_006303		Approved	p38, PRO0992, JTV-1, JTV1	uc003spo.3	Q13155	OTTHUMG00000122077	ENST00000223029.3:c.756A>G	chr7.hg19:g.6063115A>G		174.0	0.0		94.0	6.0	NM_006303	Q75MR1|Q96CZ5|Q9P1L2	Silent	SNP	ENST00000223029.3	hg19	CCDS5344.1																																																																																			.	.		0.488	AIMP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242834.2	NM_006303	
OSBPL3	26031	hgsc.bcm.edu	37	7	24849448	24849448	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:24849448A>G	ENST00000313367.2	-	20	2746	c.2295T>C	c.(2293-2295)tcT>tcC	p.S765S	OSBPL3_ENST00000487020.1_5'UTR|OSBPL3_ENST00000396429.1_Silent_p.S729S|OSBPL3_ENST00000353930.1_Silent_p.S729S|OSBPL3_ENST00000396431.1_Silent_p.S734S|OSBPL3_ENST00000352860.1_Silent_p.S734S|OSBPL3_ENST00000409069.1_Silent_p.S698S|OSBPL3_ENST00000431825.2_Silent_p.S698S	NM_015550.2	NP_056365.1	Q9H4L5	OSBL3_HUMAN	oxysterol binding protein-like 3	765					lipid transport (GO:0006869)	cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(19)|prostate(1)|skin(3)|urinary_tract(1)	43						CACAGGCAGAAGAGGAGCCGC	0.547																																					p.S765S		Atlas-SNP	.											.	OSBPL3	100	.	0			c.T2295C						.						90.0	80.0	83.0					7																	24849448		2203	4300	6503	SO:0001819	synonymous_variant	26031	exon20			GGCAGAAGAGGAG	AB014604	CCDS5390.1, CCDS5391.1, CCDS5392.1, CCDS47564.1	7p15.3	2013-01-10			ENSG00000070882	ENSG00000070882		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16370	protein-coding gene	gene with protein product		606732		OSBP3		9734811	Standard	XM_005249698		Approved	ORP-3, ORP3, KIAA0704	uc003sxf.3	Q9H4L5	OTTHUMG00000023277	ENST00000313367.2:c.2295T>C	chr7.hg19:g.24849448A>G		125.0	0.0		70.0	4.0	NM_015550	A4D167|A4D168|A4D169|A4D170|A4D171|A4D172|B8ZZ79|B8ZZP0|O14591|O43357|O43358|Q8N702|Q8N703|Q8N704|Q8NFH0|Q8NFH1|Q8NI12|Q8NI13|Q9BZF4|Q9UED6	Silent	SNP	ENST00000313367.2	hg19	CCDS5390.1																																																																																			.	.		0.547	OSBPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214085.2		
CCDC129	223075	hgsc.bcm.edu	37	7	31683097	31683097	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:31683097T>C	ENST00000407970.3	+	11	2151	c.2113T>C	c.(2113-2115)Tcc>Ccc	p.S705P	CCDC129_ENST00000319386.3_Missense_Mutation_p.S557P|CCDC129_ENST00000409210.1_Missense_Mutation_p.S613P|CCDC129_ENST00000451887.2_Missense_Mutation_p.S731P	NM_001257967.1|NM_194300.3	NP_001244896.1|NP_919276.2	Q6ZRS4	CC129_HUMAN	coiled-coil domain containing 129	705										cervix(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(31)	44						TACTGGCAGCTCCAGGTCTGT	0.537																																					p.S731P		Atlas-SNP	.											.	CCDC129	127	.	0			c.T2191C						.						60.0	62.0	61.0					7																	31683097		2203	4300	6503	SO:0001583	missense	223075	exon11			GGCAGCTCCAGGT	AK128026	CCDS5435.2, CCDS59050.1, CCDS75577.1	7p14.3	2006-08-21			ENSG00000180347	ENSG00000180347			27363	protein-coding gene	gene with protein product						14702039	Standard	NM_001257967		Approved	FLJ38344	uc011kad.1	Q6ZRS4	OTTHUMG00000128611	ENST00000407970.3:c.2113T>C	chr7.hg19:g.31683097T>C	ENSP00000384416:p.Ser705Pro	149.0	0.0		98.0	5.0	NM_001257968	A2RU17|B3KTI9|B4DHB0|B4E2R1|F5H3V5	Missense_Mutation	SNP	ENST00000407970.3	hg19	CCDS5435.2	.	.	.	.	.	.	.	.	.	.	T	15.88	2.963296	0.53507	.	.	ENSG00000180347	ENST00000319386;ENST00000407970;ENST00000451887;ENST00000538406;ENST00000409210	T;T;T;T	0.24538	1.85;2.13;2.12;1.86	5.81	0.31	0.15825	.	0.376195	0.23307	N	0.049620	T	0.34366	0.0895	M	0.64997	1.995	0.09310	N	1	D;D;D;D	0.63880	0.993;0.985;0.985;0.985	P;P;P;P	0.62298	0.9;0.838;0.838;0.838	T	0.12400	-1.0549	10	0.51188	T	0.08	-0.1602	2.2277	0.03988	0.151:0.0836:0.3134:0.4519	.	731;715;705;557	F5H3V5;F5H2J8;Q6ZRS4;Q6ZRS4-2	.;.;CC129_HUMAN;.	P	557;705;731;715;613	ENSP00000313062:S557P;ENSP00000384416:S705P;ENSP00000395835:S731P;ENSP00000387214:S613P	ENSP00000313062:S557P	S	+	1	0	CCDC129	31649622	0.046000	0.20272	0.000000	0.03702	0.016000	0.09150	0.318000	0.19504	0.104000	0.17725	0.533000	0.62120	TCC	.	.		0.537	CCDC129-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318975.1	NM_194300	
CAMK2B	816	hgsc.bcm.edu	37	7	44279251	44279251	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:44279251T>C	ENST00000395749.2	-	13	1034	c.958A>G	c.(958-960)Acc>Gcc	p.T320A	CAMK2B_ENST00000502837.2_Missense_Mutation_p.T191A|CAMK2B_ENST00000395747.2_Intron|CAMK2B_ENST00000440254.2_Missense_Mutation_p.T320A|CAMK2B_ENST00000346990.4_Intron|CAMK2B_ENST00000350811.3_Missense_Mutation_p.T320A|CAMK2B_ENST00000457475.1_Intron|CAMK2B_ENST00000358707.3_Intron|CAMK2B_ENST00000353625.4_Intron|CAMK2B_ENST00000347193.4_Missense_Mutation_p.T320A|CAMK2B_ENST00000258682.6_Intron	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	320					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						GGAGCGGTGGTCTGTCTGCCC	0.647																																					p.T320A		Atlas-SNP	.											.	CAMK2B	56	.	0			c.A958G						.						63.0	44.0	50.0					7																	44279251		1878	3632	5510	SO:0001583	missense	816	exon13			CGGTGGTCTGTCT	U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.958A>G	chr7.hg19:g.44279251T>C	ENSP00000379098:p.Thr320Ala	69.0	0.0		35.0	4.0	NM_172082	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	ENST00000395749.2	hg19	CCDS5483.1	.	.	.	.	.	.	.	.	.	.	T	13.98	2.398827	0.42512	.	.	ENSG00000058404	ENST00000350811;ENST00000395749;ENST00000502837;ENST00000440254;ENST00000347193	T;T;T;T;T	0.66280	-0.18;-0.2;0.53;-0.18;-0.19	4.68	4.68	0.58851	Protein kinase-like domain (1);	.	.	.	.	T	0.67636	0.2914	L	0.43152	1.355	0.51482	D	0.99992	D;P;B	0.56035	0.974;0.905;0.001	D;B;B	0.67725	0.953;0.202;0.001	T	0.62062	-0.6933	9	0.11182	T	0.66	.	13.2445	0.60016	0.0:0.0:0.0:1.0	.	320;320;320	Q13554-6;Q13554;Q13554-2	.;KCC2B_HUMAN;.	A	320;320;191;320;320	ENSP00000326375:T320A;ENSP00000379098:T320A;ENSP00000422416:T191A;ENSP00000397937:T320A;ENSP00000326544:T320A	ENSP00000326544:T320A	T	-	1	0	CAMK2B	44245776	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.902000	0.75699	1.982000	0.57802	0.455000	0.32223	ACC	.	.		0.647	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000251138.2	NM_172084	
EGFR	1956	hgsc.bcm.edu	37	7	55249014	55249014	+	Missense_Mutation	SNP	A	A	G	rs397517113|rs121913445		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:55249014A>G	ENST00000275493.2	+	20	2489	c.2312A>G	c.(2311-2313)aAc>aGc	p.N771S	EGFR_ENST00000442591.1_Intron|EGFR_ENST00000455089.1_Missense_Mutation_p.N726S|EGFR-AS1_ENST00000442411.1_RNA|EGFR_ENST00000454757.2_Missense_Mutation_p.N718S	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	771	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)	p.D770_N771insSVD(7)|p.N771_P772>SVDNR(1)|p.N771_P772insRH(1)|p.N771>TH(1)|p.D770_N771>AGG(1)|p.N771>SH(1)|p.N771>GF(1)|p.D770_N771insMATP(1)|p.D770_P772>ASVDNR(1)		NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	AGCGTGGACAACCCCCACGTG	0.647		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.N771S		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.,3	EGFR	20426	.	15	Insertion - In frame(9)|Complex - insertion inframe(6)	lung(15)	c.A2312G						.						105.0	96.0	99.0					7																	55249014		2203	4300	6503	SO:0001583	missense	1956	exon20	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	TGGACAACCCCCA		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.2312A>G	chr7.hg19:g.55249014A>G	ENSP00000275493:p.Asn771Ser	76.0	0.0		48.0	3.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Missense_Mutation	SNP	ENST00000275493.2	hg19	CCDS5514.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.498959	0.64298	.	.	ENSG00000146648	ENST00000455089;ENST00000395504;ENST00000275493;ENST00000454757	T;T;T	0.61510	0.1;0.1;0.1	5.85	4.7	0.59300	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.085206	0.85682	D	0.000000	T	0.35480	0.0933	N	0.12831	0.26	0.47584	D	0.999469	B;B	0.27791	0.189;0.169	B;B	0.22601	0.003;0.04	T	0.11542	-1.0583	10	0.19590	T	0.45	.	10.9301	0.47213	0.9258:0.0:0.0742:0.0	.	726;771	Q504U8;P00533	.;EGFR_HUMAN	S	726;641;771;718	ENSP00000415559:N726S;ENSP00000275493:N771S;ENSP00000395243:N718S	ENSP00000275493:N771S	N	+	2	0	EGFR	55216508	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	6.264000	0.72527	1.030000	0.39839	0.533000	0.62120	AAC	.	.		0.647	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
WBSCR17	64409	hgsc.bcm.edu	37	7	71142270	71142270	+	Silent	SNP	G	G	A	rs145007893		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:71142270G>A	ENST00000333538.5	+	9	2113	c.1479G>A	c.(1477-1479)ccG>ccA	p.P493P	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	493	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				TATTGTATCCGTGCCATGGCT	0.537																																					p.P493P		Atlas-SNP	.											WBSCR17,rectum,carcinoma,+2,1	WBSCR17	208	.	0			c.G1479A						.	G		1,4405	2.1+/-5.4	0,1,2202	181.0	180.0	180.0		1479	-7.2	0.8	7	dbSNP_134	180	0,8600		0,0,4300	no	coding-synonymous	WBSCR17	NM_022479.1		0,1,6502	AA,AG,GG		0.0,0.0227,0.0077		493/599	71142270	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	64409	exon9			GTATCCGTGCCAT	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1479G>A	chr7.hg19:g.71142270G>A		77.0	0.0		50.0	3.0	NM_022479	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	hg19	CCDS5540.1																																																																																			.	G|1.000;A|0.000		0.537	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
CCL24	6369	hgsc.bcm.edu	37	7	75442715	75442715	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:75442715A>G	ENST00000416943.1	-	3	193	c.100T>C	c.(100-102)Tgc>Cgc	p.C34R	CCL24_ENST00000222902.2_Missense_Mutation_p.C34R	NM_002991.2	NP_002982.2	O00175	CCL24_HUMAN	chemokine (C-C motif) ligand 24	34					cell-cell signaling (GO:0007267)|chemotaxis (GO:0006935)|cytoskeleton organization (GO:0007010)|eosinophil chemotaxis (GO:0048245)|immune response (GO:0006955)|inflammatory response (GO:0006954)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of eosinophil migration (GO:2000418)|positive regulation of inflammatory response (GO:0050729)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	chemokine activity (GO:0008009)			endometrium(1)|lung(2)	3						AAGAACATGCAGCAGGGAGAG	0.552																																					p.C34R		Atlas-SNP	.											.	CCL24	11	.	0			c.T100C						.						69.0	71.0	70.0					7																	75442715		2203	4300	6503	SO:0001583	missense	6369	exon2			ACATGCAGCAGGG	U85768	CCDS34670.1	7q11.23	2013-02-25	2002-08-22	2002-08-23	ENSG00000106178	ENSG00000106178		"""Chemokine ligands"", ""Endogenous ligands"""	10623	protein-coding gene	gene with protein product	"""CK-beta-6"", ""myeloid progenitor inhibitory factor 2"", ""eotaxin-2"""	602495	"""small inducible cytokine subfamily A (Cys-Cys), member 24"""	SCYA24		9104803, 9598329	Standard	NM_002991		Approved	Ckb-6, MPIF-2, eotaxin-2, MPIF2	uc011kga.2	O00175	OTTHUMG00000156635	ENST00000416943.1:c.100T>C	chr7.hg19:g.75442715A>G	ENSP00000400533:p.Cys34Arg	55.0	0.0		31.0	4.0	NM_002991	B2R5K2	Missense_Mutation	SNP	ENST00000416943.1	hg19	CCDS34670.1	.	.	.	.	.	.	.	.	.	.	.	12.79	2.044754	0.36085	.	.	ENSG00000106178	ENST00000222902;ENST00000416943	D;D	0.85556	-2.0;-2.0	4.14	4.14	0.48551	Chemokine interleukin-8-like domain (3);	0.000000	0.53938	D	0.000054	D	0.94565	0.8249	H	0.98027	4.13	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95008	0.8149	10	0.87932	D	0	.	9.7462	0.40448	1.0:0.0:0.0:0.0	.	34	O00175	CCL24_HUMAN	R	34	ENSP00000222902:C34R;ENSP00000400533:C34R	ENSP00000222902:C34R	C	-	1	0	CCL24	75280651	0.999000	0.42202	0.997000	0.53966	0.187000	0.23431	3.605000	0.54088	1.868000	0.54150	0.533000	0.62120	TGC	.	.		0.552	CCL24-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344886.1	NM_002991	
SEMA3A	10371	hgsc.bcm.edu	37	7	83610694	83610694	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:83610694T>C	ENST00000265362.4	-	14	1909	c.1595A>G	c.(1594-1596)gAc>gGc	p.D532G	SEMA3A_ENST00000436949.1_Missense_Mutation_p.D532G	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	532					apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						ACAGTAAGGGTCTCGGGCGAG	0.453																																					p.D532G		Atlas-SNP	.											.	SEMA3A	121	.	0			c.A1595G						.						77.0	70.0	73.0					7																	83610694		2203	4300	6503	SO:0001583	missense	10371	exon14			TAAGGGTCTCGGG	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.1595A>G	chr7.hg19:g.83610694T>C	ENSP00000265362:p.Asp532Gly	120.0	0.0		88.0	5.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	T	19.21	3.784242	0.70222	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.52057	0.68;0.68	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.69296	0.3095	H	0.94771	3.58	0.80722	D	1	P	0.50617	0.937	P	0.49301	0.606	T	0.79928	-0.1596	10	0.87932	D	0	.	15.9869	0.80160	0.0:0.0:0.0:1.0	.	532	Q14563	SEM3A_HUMAN	G	532	ENSP00000265362:D532G;ENSP00000415260:D532G	ENSP00000265362:D532G	D	-	2	0	SEMA3A	83448630	1.000000	0.71417	0.998000	0.56505	0.235000	0.25334	7.991000	0.88244	2.171000	0.68590	0.533000	0.62120	GAC	.	.		0.453	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
RINT1	60561	hgsc.bcm.edu	37	7	105205724	105205724	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:105205724A>G	ENST00000257700.2	+	13	2118	c.1887A>G	c.(1885-1887)agA>agG	p.R629R	EFCAB10_ENST00000480514.1_3'UTR|EFCAB10_ENST00000485614.1_3'UTR|EFCAB10_ENST00000490493.1_5'Flank	NM_021930.4	NP_068749.3	Q6NUQ1	RINT1_HUMAN	RAD50 interactor 1	629	RINT1/TIP20. {ECO:0000255|PROSITE- ProRule:PRU00717}.				G2 DNA damage checkpoint (GO:0031572)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						TTTTTTCCAGATGGTTGTCCT	0.403																																					p.R629R		Atlas-SNP	.											.	RINT1	65	.	0			c.A1887G						.						77.0	71.0	73.0					7																	105205724		2203	4300	6503	SO:0001630	splice_region_variant	60561	exon13			TTCCAGATGGTTG	AF317622	CCDS34726.1	7q22.2	2007-05-03			ENSG00000135249	ENSG00000135249			21876	protein-coding gene	gene with protein product		610089				11096100, 15029241	Standard	NM_021930		Approved	FLJ11785, RINT-1	uc003vda.1	Q6NUQ1	OTTHUMG00000157400	ENST00000257700.2:c.1887-1A>G	chr7.hg19:g.105205724A>G		126.0	0.0		101.0	5.0	NM_021930	Q75MG9|Q75MH0|Q96IW8|Q9H229|Q9HAD9	Silent	SNP	ENST00000257700.2	hg19	CCDS34726.1																																																																																			.	.		0.403	RINT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348686.1	NM_021930	Silent
HBP1	26959	hgsc.bcm.edu	37	7	106836396	106836396	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:106836396A>G	ENST00000222574.4	+	9	1371	c.1185A>G	c.(1183-1185)ggA>ggG	p.G395G	CTA-363E19.2_ENST00000607036.1_RNA|HBP1_ENST00000485846.1_Silent_p.G395G|HBP1_ENST00000468410.1_Silent_p.G395G|HBP1_ENST00000461963.1_3'UTR	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	395					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						CAAGATCTGGATTCAGTAAAA	0.463																																					p.G405G		Atlas-SNP	.											.	HBP1	31	.	0			c.A1215G						.						133.0	125.0	128.0					7																	106836396		2203	4300	6503	SO:0001819	synonymous_variant	26959	exon9			ATCTGGATTCAGT	BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.1185A>G	chr7.hg19:g.106836396A>G		186.0	0.0		123.0	5.0	NM_001244262	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Silent	SNP	ENST00000222574.4	hg19	CCDS5741.1																																																																																			.	.		0.463	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349297.1	NM_012257	
STRIP2	57464	hgsc.bcm.edu	37	7	129079892	129079892	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:129079892T>C	ENST00000249344.2	+	2	199	c.159T>C	c.(157-159)ttT>ttC	p.F53F	STRIP2_ENST00000435494.2_Silent_p.F53F	NM_020704.2	NP_065755.1	Q9ULQ0	STRP2_HUMAN	striatin interacting protein 2	53					cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)											CTCTGGAGTTTGAGTATGGAG	0.517																																					p.F53F		Atlas-SNP	.											.	.	.	.	0			c.T159C						.						119.0	109.0	112.0					7																	129079892		2203	4300	6503	SO:0001819	synonymous_variant	57464	exon2			GGAGTTTGAGTAT	AB032996	CCDS34752.1, CCDS47709.1	7q32.3	2012-11-05	2012-11-05	2012-11-05	ENSG00000128578	ENSG00000128578			22209	protein-coding gene	gene with protein product	"""FAR11 factor arrest 11 homolog B (yeast)"""		"""family with sequence similarity 40, member B"""	FAM40B		22782902, 22298706, 18782753	Standard	NM_020704		Approved	KIAA1170, FAR11B	uc011koy.2	Q9ULQ0	OTTHUMG00000157695	ENST00000249344.2:c.159T>C	chr7.hg19:g.129079892T>C		267.0	0.0		169.0	7.0	NM_020704	Q8WUZ4	Silent	SNP	ENST00000249344.2	hg19	CCDS34752.1																																																																																			.	.		0.517	STRIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349418.1	NM_001134336	
EZH2	2146	hgsc.bcm.edu	37	7	148507486	148507486	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:148507486A>G	ENST00000460911.1	-	17	2041	c.1953T>C	c.(1951-1953)gcT>gcC	p.A651A	EZH2_ENST00000483967.1_Silent_p.A642A|EZH2_ENST00000320356.2_Silent_p.A656A|EZH2_ENST00000350995.2_Silent_p.A612A|EZH2_ENST00000476773.1_Silent_p.A600A|EZH2_ENST00000541220.1_Silent_p.A600A|EZH2_ENST00000478654.1_Silent_p.A600A			Q15910	EZH2_HUMAN	enhancer of zeste 2 polycomb repressive complex 2 subunit	651	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				cellular response to hydrogen peroxide (GO:0070301)|cerebellar cortex development (GO:0021695)|chromatin organization (GO:0006325)|DNA methylation (GO:0006306)|G1 to G0 transition (GO:0070314)|histone H3-K27 methylation (GO:0070734)|negative regulation of epidermal cell differentiation (GO:0045605)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of striated muscle cell differentiation (GO:0051154)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|protein localization to chromatin (GO:0071168)|regulation of cell proliferation (GO:0042127)|regulation of circadian rhythm (GO:0042752)|regulation of gliogenesis (GO:0014013)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(313)|kidney(3)|large_intestine(8)|liver(1)|lung(23)|parathyroid(2)|skin(3)|upper_aerodigestive_tract(3)	359	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00239)			CTCTTCTGTCAGCTTCATCTT	0.403			Mis		DLBCL																																p.A656A		Atlas-SNP	.		Rec?	yes		7	7q35-q36	2146	enhancer of zeste homolog 2		L	EZH2_ENST00000350995,colon,carcinoma,0,2	EZH2	823	.	0			c.T1968C						.						85.0	74.0	78.0					7																	148507486		2202	4300	6502	SO:0001819	synonymous_variant	2146	exon17			TCTGTCAGCTTCA		CCDS5891.1, CCDS5892.1, CCDS56516.1, CCDS56517.1, CCDS56518.1	7q35-q36	2014-09-17	2014-05-28		ENSG00000106462	ENSG00000106462		"""Chromatin-modifying enzymes / K-methyltransferases"""	3527	protein-coding gene	gene with protein product		601573	"""enhancer of zeste (Drosophila) homolog 2"", ""enhancer of zeste homolog 2 (Drosophila)"""			8954776, 17172412	Standard	NM_152998		Approved	EZH1, ENX-1, KMT6, KMT6A	uc003wfb.2	Q15910	OTTHUMG00000158973	ENST00000460911.1:c.1953T>C	chr7.hg19:g.148507486A>G		53.0	0.0		42.0	2.0	NM_004456	B2RAQ1|B3KS30|B7Z1D6|B7Z7L6|Q15755|Q75MG3|Q92857|Q96FI6	Silent	SNP	ENST00000460911.1	hg19	CCDS56516.1																																																																																			.	.		0.403	EZH2-008	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352744.1	NM_004456	
SSPO	23145	hgsc.bcm.edu	37	7	149500388	149500388	+	RNA	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:149500388C>T	ENST00000378016.2	+	0	7914							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			GCCCACCCTCCTGCCTGGATC	0.652																																					p.S2638S		Atlas-SNP	.											.	.	.	.	0			c.C7914T						.						40.0	51.0	47.0					7																	149500388		2110	4235	6345			23145	exon53			ACCCTCCTGCCTG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149500388C>T		48.0	0.0		39.0	5.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.652	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
ASIC3	9311	hgsc.bcm.edu	37	7	150748946	150748946	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr7:150748946A>G	ENST00000349064.5	+	7	1462	c.1264A>G	c.(1264-1266)Acc>Gcc	p.T422A	ASIC3_ENST00000297512.8_Missense_Mutation_p.T422A|ASIC3_ENST00000357922.4_Missense_Mutation_p.T422A	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	422					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										CAACTATGAGACCGTGGAGCA	0.607																																					p.T422A		Atlas-SNP	.											.	.	.	.	0			c.A1264G						.						111.0	101.0	105.0					7																	150748946		2203	4300	6503	SO:0001583	missense	9311	exon7			TATGAGACCGTGG	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.1264A>G	chr7.hg19:g.150748946A>G	ENSP00000344838:p.Thr422Ala	144.0	0.0		89.0	5.0	NM_020322	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	hg19	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	a	10.90	1.482432	0.26598	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512;ENST00000490540	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	4.7	0.683	0.17998	.	0.435766	0.16264	N	0.222087	T	0.45296	0.1335	L	0.39514	1.22	0.09310	N	1	B;B;B	0.11235	0.003;0.004;0.002	B;B;B	0.21708	0.036;0.007;0.011	T	0.27872	-1.0061	10	0.34782	T	0.22	-2.0045	2.1938	0.03906	0.5923:0.1603:0.0928:0.1545	.	422;422;422	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	A	422;422;422;53	ENSP00000350600:T422A;ENSP00000344838:T422A;ENSP00000297512:T422A;ENSP00000418361:T53A	ENSP00000297512:T422A	T	+	1	0	ACCN3	150379879	0.046000	0.20272	0.020000	0.16555	0.685000	0.39939	0.715000	0.25822	0.179000	0.19938	0.478000	0.44815	ACC	.	.		0.607	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	
ANGPT2	285	hgsc.bcm.edu	37	8	6420324	6420324	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:6420324A>G	ENST00000325203.5	-	1	606	c.132T>C	c.(130-132)acT>acC	p.T44T	MCPH1_ENST00000344683.5_Intron|ANGPT2_ENST00000338312.6_Silent_p.T44T|ANGPT2_ENST00000523120.1_Silent_p.T44T|ANGPT2_ENST00000415216.1_Silent_p.T44T			O15123	ANGP2_HUMAN	angiopoietin 2	44					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to growth factor stimulus (GO:0071363)|germ cell development (GO:0007281)|glomerulus vasculature development (GO:0072012)|leukocyte migration (GO:0050900)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of positive chemotaxis (GO:0050928)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|response to activity (GO:0014823)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to organic cyclic compound (GO:0014070)|response to radiation (GO:0009314)|signal transduction (GO:0007165)|Tie signaling pathway (GO:0048014)	cell projection (GO:0042995)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	17		Hepatocellular(245;0.0663)		Colorectal(4;0.0142)|READ - Rectum adenocarcinoma(4;0.19)|COAD - Colon adenocarcinoma(4;0.226)		GCAGGAGGAAAGTGTAGCTGC	0.552																																					p.T44T		Atlas-SNP	.											.	ANGPT2	126	.	0			c.T132C						.						127.0	102.0	111.0					8																	6420324		2203	4300	6503	SO:0001819	synonymous_variant	285	exon1			GAGGAAAGTGTAG	AF004327	CCDS5958.1, CCDS47761.1	8p23	2013-02-06			ENSG00000091879	ENSG00000091879		"""Fibrinogen C domain containing"""	485	protein-coding gene	gene with protein product		601922				9545648	Standard	NM_001147		Approved	Ang2	uc003wqj.4	O15123	OTTHUMG00000090365	ENST00000325203.5:c.132T>C	chr8.hg19:g.6420324A>G		195.0	0.0		92.0	4.0	NM_001118888	A0AV38|A8K205|B7ZLM7|Q9NRR7|Q9P2Y7	Silent	SNP	ENST00000325203.5	hg19	CCDS5958.1																																																																																			.	.		0.552	ANGPT2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206737.1	NM_001147	
MTUS1	57509	hgsc.bcm.edu	37	8	17579296	17579296	+	Intron	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:17579296A>G	ENST00000262102.6	-	4	2674				MTUS1_ENST00000381861.3_Silent_p.L39L|MTUS1_ENST00000381869.3_Intron|MTUS1_ENST00000544260.1_Intron|MTUS1_ENST00000519263.1_Intron	NM_001001924.2	NP_001001924.1	Q9ULD2	MTUS1_HUMAN	microtubule associated tumor suppressor 1						cellular response to peptide hormone stimulus (GO:0071375)|regulation of macrophage chemotaxis (GO:0010758)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(14)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	36				Colorectal(111;0.0778)		AGTGTCAATAAGGTAGCATCA	0.418																																					p.L39L		Atlas-SNP	.											.	MTUS1	144	.	0			c.T115C						.						85.0	84.0	84.0					8																	17579296		1904	4109	6013	SO:0001627	intron_variant	57509	exon1			TCAATAAGGTAGC	AL096842	CCDS43716.1, CCDS43717.1, CCDS43718.1, CCDS43719.1, CCDS55204.1	8p22	2013-01-17	2009-10-20		ENSG00000129422	ENSG00000129422			29789	protein-coding gene	gene with protein product	"""AT2 receptor-interacting protein"", ""AT2R binding protein"", ""mitochondrial tumor suppressor gene 1"""	609589	"""mitochondrial tumor suppressor 1"""			10574462, 12692079	Standard	NM_001001931		Approved	MTSG1, KIAA1288, DKFZp586D1519, FLJ14295, ATIP1, MP44, ATBP, ICIS	uc003wxv.3	Q9ULD2	OTTHUMG00000163756	ENST00000262102.6:c.2449+1884T>C	chr8.hg19:g.17579296A>G		168.0	0.0		97.0	4.0	NM_001001931	A8K135|B2RBJ6|B3KWJ9|B4DH03|B9EGA1|D3DSP8|Q63HJ6|Q659F4|Q6PK49|Q6URW7|Q8N4M6|Q8WTT9|Q9H7T2	Silent	SNP	ENST00000262102.6	hg19	CCDS43717.1																																																																																			.	.		0.418	MTUS1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000375247.1	XM_372031	
SLC39A14	23516	hgsc.bcm.edu	37	8	22273319	22273319	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:22273319T>C	ENST00000381237.1	+	6	907	c.788T>C	c.(787-789)cTt>cCt	p.L263P	SLC39A14_ENST00000240095.6_Missense_Mutation_p.L263P|SLC39A14_ENST00000359741.5_Missense_Mutation_p.L263P|SLC39A14_ENST00000289952.5_Missense_Mutation_p.L263P	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	263					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		TCTGAGTCGCTTCCCTCCAAG	0.557																																					p.L263P		Atlas-SNP	.											.	SLC39A14	59	.	0			c.T788C						.						79.0	66.0	70.0					8																	22273319		2203	4300	6503	SO:0001583	missense	23516	exon6			AGTCGCTTCCCTC	D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.788T>C	chr8.hg19:g.22273319T>C	ENSP00000370635:p.Leu263Pro	66.0	0.0		58.0	4.0	NM_001135153	A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	ENST00000381237.1	hg19	CCDS47823.1	.	.	.	.	.	.	.	.	.	.	T	10.58	1.389319	0.25118	.	.	ENSG00000104635	ENST00000359741;ENST00000240095;ENST00000381237;ENST00000289952;ENST00000517370	T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84	5.75	3.31	0.37934	.	0.910923	0.09683	N	0.769478	T	0.41026	0.1141	L	0.28556	0.865	0.37406	D	0.91306	P;B;P	0.43788	0.817;0.003;0.753	P;B;B	0.45343	0.477;0.014;0.442	T	0.10613	-1.0622	10	0.29301	T	0.29	-10.9615	9.5118	0.39082	0.2731:0.0:0.0:0.7269	.	263;263;263	Q15043-2;Q15043;B6EU88	.;S39AE_HUMAN;.	P	263;263;263;263;86	ENSP00000352779:L263P;ENSP00000240095:L263P;ENSP00000370635:L263P;ENSP00000289952:L263P;ENSP00000427981:L86P	ENSP00000240095:L263P	L	+	2	0	SLC39A14	22329264	0.492000	0.26027	0.008000	0.14137	0.181000	0.23173	2.369000	0.44231	0.397000	0.25310	0.460000	0.39030	CTT	.	.		0.557	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215039.2	XM_046677	
LRRCC1	85444	hgsc.bcm.edu	37	8	86022370	86022370	+	Silent	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:86022370C>T	ENST00000360375.3	+	3	480	c.331C>T	c.(331-333)Ctg>Ttg	p.L111L	LRRCC1_ENST00000414626.2_Silent_p.L91L	NM_033402.4	NP_208325.3	Q9C099	LRCC1_HUMAN	leucine rich repeat and coiled-coil centrosomal protein 1	111					mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(4)|kidney(9)|large_intestine(7)|lung(16)|skin(1)|upper_aerodigestive_tract(2)	43						ACTAATTAATCTGACTAGACT	0.249																																					p.L111L		Atlas-SNP	.											.	LRRCC1	212	.	0			c.C331T						.						95.0	86.0	89.0					8																	86022370		1808	4064	5872	SO:0001819	synonymous_variant	85444	exon3			ATTAATCTGACTA	BC030701	CCDS43750.1	8q21.2	2012-04-10	2012-04-10		ENSG00000133739	ENSG00000133739			29373	protein-coding gene	gene with protein product	"""centrosomal leucine-rich repeat and coiled-coil containing protein"", ""variable number of flagella 1 homolog (Chlamydomonas)"""		"""leucine rich repeat and coiled-coil domain containing 1"""			11214970, 18728398	Standard	NM_033402		Approved	KIAA1764, CLERC, VFL1	uc003ycw.3	Q9C099	OTTHUMG00000164784	ENST00000360375.3:c.331C>T	chr8.hg19:g.86022370C>T		123.0	0.0		107.0	22.0	NM_033402	B4DYX6|B5RI11|Q8N768|Q96DK7|Q96N01	Silent	SNP	ENST00000360375.3	hg19	CCDS43750.1																																																																																			.	.		0.249	LRRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380267.1	NM_033402	
TSPYL5	85453	hgsc.bcm.edu	37	8	98288873	98288873	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:98288873A>G	ENST00000322128.3	-	1	1303	c.1200T>C	c.(1198-1200)ggT>ggC	p.G400G		NM_033512.2	NP_277047.2	Q86VY4	TSYL5_HUMAN	TSPY-like 5	400					cellular response to gamma radiation (GO:0071480)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein ubiquitination (GO:0031398)|regulation of growth (GO:0040008)	nucleus (GO:0005634)				cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	20	Breast(36;2.56e-06)					GCTTTCCTGGACCTTGCCTGC	0.517																																					p.G400G		Atlas-SNP	.											.	TSPYL5	48	.	0			c.T1200C						.						180.0	181.0	181.0					8																	98288873		2203	4300	6503	SO:0001819	synonymous_variant	85453	exon1			TCCTGGACCTTGC	AB051537	CCDS34927.1	8q22.1	2011-05-24			ENSG00000180543	ENSG00000180543			29367	protein-coding gene	gene with protein product		614721				11214970	Standard	NM_033512		Approved	KIAA1750	uc003yhy.3	Q86VY4	OTTHUMG00000164857	ENST00000322128.3:c.1200T>C	chr8.hg19:g.98288873A>G		219.0	0.0		157.0	7.0	NM_033512	B3KRF0|Q9C0B3	Silent	SNP	ENST00000322128.3	hg19	CCDS34927.1																																																																																			.	.		0.517	TSPYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380611.1	NM_033512	
FER1L6	654463	hgsc.bcm.edu	37	8	125094661	125094661	+	Silent	SNP	A	A	G	rs540398915		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr8:125094661A>G	ENST00000522917.1	+	33	4559	c.4353A>G	c.(4351-4353)aaA>aaG	p.K1451K	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Silent_p.K1451K	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1451						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			TCTACAGCAAACACCGAGCCA	0.502													A|||	1	0.000199681	0.0	0.0014	5008	,	,		21004	0.0		0.0	False		,,,				2504	0.0				p.K1451K		Atlas-SNP	.											.	FER1L6	268	.	0			c.A4353G						.						172.0	184.0	180.0					8																	125094661		2203	4300	6503	SO:0001819	synonymous_variant	654463	exon33			CAGCAAACACCGA	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4353A>G	chr8.hg19:g.125094661A>G		100.0	0.0		71.0	4.0	NM_001039112		Silent	SNP	ENST00000522917.1	hg19	CCDS43767.1																																																																																			.	.		0.502	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
SPATA6L	55064	hgsc.bcm.edu	37	9	4604223	4604223	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:4604223T>C	ENST00000454239.2	-	12	1381	c.1136A>G	c.(1135-1137)tAc>tGc	p.Y379C	SPATA6L_ENST00000381895.5_Missense_Mutation_p.Y256C|SPATA6L_ENST00000475086.1_Missense_Mutation_p.Y321C|SPATA6L_ENST00000381890.5_Intron			Q8N4H0	SPA6L_HUMAN	spermatogenesis associated 6-like	379																	CTTCAGAGGGTAGCTTGGTCT	0.338																																					p.Y321C		Atlas-SNP	.											.	SPATA6L	3	.	0			c.A962G						.						145.0	136.0	139.0					9																	4604223		1813	4084	5897	SO:0001583	missense	55064	exon10			AGAGGGTAGCTTG	AK000920	CCDS43785.1, CCDS43785.2	9p24.2	2012-03-15	2012-03-15	2012-03-15	ENSG00000106686	ENSG00000106686			25472	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 68"""	C9orf68			Standard	NM_001039395		Approved	FLJ10058	uc011llz.2	Q8N4H0	OTTHUMG00000019469	ENST00000454239.2:c.1136A>G	chr9.hg19:g.4604223T>C	ENSP00000404277:p.Tyr379Cys	155.0	0.0		111.0	6.0	NM_001039395	B4DIY4|Q5JVJ5|Q8IY90	Missense_Mutation	SNP	ENST00000454239.2	hg19		.	.	.	.	.	.	.	.	.	.	T	0.739	-0.777003	0.02929	.	.	ENSG00000106686	ENST00000454239;ENST00000475086;ENST00000381895	T;T;T	0.25579	1.87;1.85;1.79	4.99	-7.07	0.01563	.	.	.	.	.	T	0.14141	0.0342	L	0.29908	0.895	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.08055	0.0;0.0;0.003	T	0.31971	-0.9924	9	0.41790	T	0.15	-7.8174	6.9088	0.24323	0.0:0.388:0.227:0.3851	.	321;256;379	B4DIY4;E7ENB5;Q8N4H0	.;.;CI068_HUMAN	C	379;321;256	ENSP00000404277:Y379C;ENSP00000417063:Y321C;ENSP00000371319:Y256C	ENSP00000371319:Y256C	Y	-	2	0	C9orf68	4594223	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-0.240000	0.08952	-1.072000	0.03141	-2.352000	0.00242	TAC	.	.		0.338	SPATA6L-202	KNOWN	basic	protein_coding	protein_coding		NM_017985	
MPDZ	8777	hgsc.bcm.edu	37	9	13150535	13150535	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:13150535A>G	ENST00000319217.7	-	25	3852	c.3605T>C	c.(3604-3606)tTg>tCg	p.L1202S	MPDZ_ENST00000447879.1_Missense_Mutation_p.L1202S|MPDZ_ENST00000381015.4_Missense_Mutation_p.L1202S|MPDZ_ENST00000546205.1_Missense_Mutation_p.L1216S|MPDZ_ENST00000536827.1_Missense_Mutation_p.L1202S|MPDZ_ENST00000381022.2_Missense_Mutation_p.L1202S|MPDZ_ENST00000541718.1_Missense_Mutation_p.L1202S|MPDZ_ENST00000538841.1_Missense_Mutation_p.L94S	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1202	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TCCAGGTTTCAAGGTTCCATT	0.383																																					p.L1202S		Atlas-SNP	.											.	MPDZ	324	.	0			c.T3605C						.						164.0	162.0	163.0					9																	13150535		1848	4092	5940	SO:0001583	missense	8777	exon25			GGTTTCAAGGTTC	AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3605T>C	chr9.hg19:g.13150535A>G	ENSP00000320006:p.Leu1202Ser	157.0	0.0		89.0	5.0	NM_003829	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	ENST00000319217.7	hg19		.	.	.	.	.	.	.	.	.	.	A	16.39	3.109717	0.56398	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359;ENST00000542239	T;T;T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.95	5.95	0.96441	.	0.000000	0.36591	N	0.002513	T	0.80497	0.4634	H	0.97291	3.975	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.87530	0.2452	10	0.87932	D	0	.	16.4159	0.83738	1.0:0.0:0.0:0.0	.	1202;94;1202;1152;1202	B7ZMI4;B7ZB24;O75970-3;E7EPZ1;O75970-2	.;.;.;.;.	S	1202;1202;1202;208;94;1202;1202;1202;1152;1216;94;94	ENSP00000320006:L1202S;ENSP00000439807:L1202S;ENSP00000370410:L1202S;ENSP00000444230:L208S;ENSP00000444717:L94S;ENSP00000444151:L1202S;ENSP00000415208:L1202S;ENSP00000370403:L1202S;ENSP00000446358:L1216S;ENSP00000389705:L94S;ENSP00000443672:L94S	ENSP00000320006:L1202S	L	-	2	0	MPDZ	13140535	1.000000	0.71417	1.000000	0.80357	0.115000	0.19883	8.962000	0.93254	2.279000	0.76181	0.533000	0.62120	TTG	.	.		0.383	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000055485.2	NM_003829	
TMC1	117531	hgsc.bcm.edu	37	9	75403363	75403363	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:75403363A>G	ENST00000297784.5	+	14	1533	c.993A>G	c.(991-993)gcA>gcG	p.A331A	TMC1_ENST00000340019.3_Silent_p.A331A|TMC1_ENST00000396237.3_Silent_p.A331A	NM_138691.2	NP_619636.2	Q8TDI8	TMC1_HUMAN	transmembrane channel-like 1	331					auditory receptor cell development (GO:0060117)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|vestibular reflex (GO:0060005)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|stereocilium bundle tip (GO:0032426)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(21)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	36						CTGAAACAGCAGACAACAAAT	0.398																																					p.A331A	Pancreas(75;173 1345 14232 34245 43413)	Atlas-SNP	.											.	TMC1	87	.	0			c.A993G						.						79.0	74.0	76.0					9																	75403363		2203	4300	6503	SO:0001819	synonymous_variant	117531	exon14			AACAGCAGACAAC	AF417578	CCDS6643.1	9q21	2014-01-28			ENSG00000165091	ENSG00000165091			16513	protein-coding gene	gene with protein product		606706	"""transmembrane, cochlear expressed, 1"""	DFNA36, DFNB7, DFNB11		11850618, 11850623	Standard	NM_138691		Approved		uc004aiz.1	Q8TDI8	OTTHUMG00000020014	ENST00000297784.5:c.993A>G	chr9.hg19:g.75403363A>G		122.0	0.0		90.0	4.0	NM_138691	A8MVZ2|B1AM91	Silent	SNP	ENST00000297784.5	hg19	CCDS6643.1																																																																																			.	.		0.398	TMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052655.1		
PHF2	5253	hgsc.bcm.edu	37	9	96429513	96429513	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:96429513A>G	ENST00000359246.4	+	17	2706	c.2339A>G	c.(2338-2340)aAc>aGc	p.N780S	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	780					liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		CTGGAGTACAACCCCAGCAGG	0.692																																					p.N780S		Atlas-SNP	.											.	PHF2	113	.	0			c.A2339G						.						29.0	29.0	29.0					9																	96429513		2199	4298	6497	SO:0001583	missense	5253	exon17			AGTACAACCCCAG	AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.2339A>G	chr9.hg19:g.96429513A>G	ENSP00000352185:p.Asn780Ser	80.0	0.0		46.0	5.0	NM_005392	Q4VXG0|Q8N3K2|Q9Y6N4	Missense_Mutation	SNP	ENST00000359246.4	hg19	CCDS35069.1	.	.	.	.	.	.	.	.	.	.	a	3.179	-0.168250	0.06461	.	.	ENSG00000197724	ENST00000359246	T	0.16597	2.33	4.99	3.81	0.43845	.	0.099233	0.64402	D	0.000002	T	0.20700	0.0498	N	0.16903	0.455	0.80722	D	1	D;B	0.71674	0.998;0.15	D;B	0.76071	0.987;0.027	T	0.03483	-1.1032	10	0.09338	T	0.73	-34.6457	11.745	0.51815	0.8523:0.1477:0.0:0.0	.	199;780	Q8N359;O75151	.;PHF2_HUMAN	S	780	ENSP00000352185:N780S	ENSP00000352185:N780S	N	+	2	0	PHF2	95469334	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	3.574000	0.53863	0.702000	0.31825	0.248000	0.18094	AAC	.	.		0.692	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053162.1	NM_005392	
KIAA0368	23392	hgsc.bcm.edu	37	9	114184313	114184313	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:114184313T>C	ENST00000338205.5	-	14	1562	c.1343A>G	c.(1342-1344)gAg>gGg	p.E448G	KIAA0368_ENST00000259335.4_Missense_Mutation_p.E626G			Q5VYK3	ECM29_HUMAN	KIAA0368	454					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						AAGTCGAGTCTCAGGCTCTTC	0.453																																					p.E626G		Atlas-SNP	.											.	KIAA0368	144	.	0			c.A1877G						.						86.0	79.0	81.0					9																	114184313		1864	4102	5966	SO:0001583	missense	23392	exon16			CGAGTCTCAGGCT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.1343A>G	chr9.hg19:g.114184313T>C	ENSP00000339889:p.Glu448Gly	113.0	0.0		79.0	4.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	hg19		.	.	.	.	.	.	.	.	.	.	T	19.14	3.770297	0.69992	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.47869	0.83	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.053115	0.64402	D	0.000001	T	0.43456	0.1248	L	0.43923	1.385	0.80722	D	1	B	0.22541	0.071	B	0.19391	0.025	T	0.31475	-0.9942	10	0.51188	T	0.08	.	16.021	0.80493	0.0:0.0:0.0:1.0	.	454	Q5VYK3	ECM29_HUMAN	G	448;626	ENSP00000259335:E626G	ENSP00000259335:E626G	E	-	2	0	KIAA0368	113224134	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.655000	0.83696	2.240000	0.73641	0.533000	0.62120	GAG	.	.		0.453	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
FKBP15	23307	hgsc.bcm.edu	37	9	115931901	115931901	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:115931901A>G	ENST00000238256.3	-	26	3205	c.3088T>C	c.(3088-3090)Tct>Cct	p.S1030P		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	1030					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GGGATGCAAGACAGTTCGGGT	0.552																																					p.S1030P		Atlas-SNP	.											.	FKBP15	128	.	0			c.T3088C						.						91.0	98.0	96.0					9																	115931901		1966	4152	6118	SO:0001583	missense	23307	exon26			TGCAAGACAGTTC	AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.3088T>C	chr9.hg19:g.115931901A>G	ENSP00000238256:p.Ser1030Pro	155.0	0.0		82.0	4.0	NM_015258	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	ENST00000238256.3	hg19	CCDS48007.1	.	.	.	.	.	.	.	.	.	.	A	4.004	-0.001983	0.07819	.	.	ENSG00000119321	ENST00000446284;ENST00000238256	T;T	0.23950	1.88;1.9	5.08	-2.19	0.07015	.	.	.	.	.	T	0.13500	0.0327	L	0.29908	0.895	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31503	-0.9941	9	0.48119	T	0.1	-0.664	0.1722	0.00114	0.2797:0.2777:0.1856:0.2569	.	611;1030	B4DVS2;Q5T1M5	.;FKB15_HUMAN	P	1055;1030	ENSP00000416158:S1055P;ENSP00000238256:S1030P	ENSP00000238256:S1030P	S	-	1	0	FKBP15	114971722	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.925000	0.03992	-0.422000	0.07405	-1.464000	0.01018	TCT	.	.		0.552	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015258	
PRPF4	9128	hgsc.bcm.edu	37	9	116053283	116053283	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:116053283T>C	ENST00000374198.4	+	13	1464	c.1362T>C	c.(1360-1362)ggT>ggC	p.G454G	PRPF4_ENST00000374199.4_Silent_p.G453G	NM_001244926.1|NM_004697.4	NP_001231855.1|NP_004688.2	O43172	PRP4_HUMAN	pre-mRNA processing factor 4	454					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 snRNP (GO:0071001)				NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)	23						TAGTGACTGGTGTCAAGTTTG	0.493																																					p.G454G		Atlas-SNP	.											.	PRPF4	56	.	0			c.T1362C						.						211.0	173.0	186.0					9																	116053283		2203	4300	6503	SO:0001819	synonymous_variant	9128	exon13			GACTGGTGTCAAG	AF001687	CCDS6791.1, CCDS59142.1	9q31-q33	2013-10-03	2013-10-03		ENSG00000136875	ENSG00000136875		"""WD repeat domain containing"""	17349	protein-coding gene	gene with protein product	"""PRP4/STK/WD splicing factor"", ""U4/U6 small nuclear ribonucleoprotein Prp4"""	607795	"""PRP4 pre-mRNA processing factor 4 homolog (yeast)"""			9257651, 9404889	Standard	NM_004697		Approved	Prp4p, HPRP4, HPRP4P, PRP4, SNRNP60	uc004bgx.3	O43172	OTTHUMG00000020517	ENST00000374198.4:c.1362T>C	chr9.hg19:g.116053283T>C		170.0	0.0		89.0	4.0	NM_004697	O43445|O43864|Q5T1M8|Q96DG2|Q96IK4	Silent	SNP	ENST00000374198.4	hg19	CCDS6791.1																																																																																			.	.		0.493	PRPF4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000053708.2	NM_004697	
ASTN2	23245	hgsc.bcm.edu	37	9	119625906	119625906	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:119625906A>G	ENST00000313400.4	-	11	2096	c.1996T>C	c.(1996-1998)Ttc>Ctc	p.F666L	ASTN2_ENST00000373996.3_Missense_Mutation_p.F662L|ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000361209.2_Missense_Mutation_p.F615L			O75129	ASTN2_HUMAN	astrotactin 2	666	EGF-like 2.				negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						ACACACTTGAAGTTGCGAGTG	0.577																																					p.F615L		Atlas-SNP	.											.	ASTN2	307	.	0			c.T1843C						.						120.0	101.0	107.0					9																	119625906		2203	4300	6503	SO:0001583	missense	23245	exon10			ACTTGAAGTTGCG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1996T>C	chr9.hg19:g.119625906A>G	ENSP00000314038:p.Phe666Leu	119.0	0.0		82.0	6.0	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	hg19		.	.	.	.	.	.	.	.	.	.	A	24.4	4.527409	0.85706	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.13901	2.71;2.71;2.55;2.75	5.71	5.71	0.89125	.	0.142736	0.50627	D	0.000108	T	0.26955	0.0660	L	0.32530	0.975	0.80722	D	1	D;D;D	0.71674	0.998;0.982;0.997	D;D;D	0.76071	0.987;0.952;0.978	T	0.01390	-1.1367	9	.	.	.	-27.9909	15.966	0.79970	1.0:0.0:0.0:0.0	.	615;666;662	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	L	666;662;389;615	ENSP00000314038:F666L;ENSP00000363108:F662L;ENSP00000363098:F389L;ENSP00000354504:F615L	.	F	-	1	0	ASTN2	118665727	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	8.918000	0.92759	2.172000	0.68678	0.533000	0.62120	TTC	.	.		0.577	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
CNTRL	11064	hgsc.bcm.edu	37	9	123874744	123874744	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:123874744A>G	ENST00000373855.1	+	9	1270	c.1010A>G	c.(1009-1011)cAg>cGg	p.Q337R	CNTRL_ENST00000373865.2_Missense_Mutation_p.Q337R|CNTRL_ENST00000238341.5_Missense_Mutation_p.Q337R			Q7Z7A1	CNTRL_HUMAN	centriolin	337					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TAGCTAAAACAGAAGACCATA	0.338																																					p.Q337R		Atlas-SNP	.											.	CNTRL	161	.	0			c.A1010G						.						104.0	98.0	100.0					9																	123874744		2203	4300	6503	SO:0001583	missense	11064	exon7			TAAAACAGAAGAC	AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.1010A>G	chr9.hg19:g.123874744A>G	ENSP00000362962:p.Gln337Arg	133.0	0.0		76.0	4.0	NM_007018	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	ENST00000373855.1	hg19	CCDS35118.1	.	.	.	.	.	.	.	.	.	.	A	12.89	2.072744	0.36566	.	.	ENSG00000119397	ENST00000373865;ENST00000373855;ENST00000238341;ENST00000454238	T;T	0.26223	1.75;1.75	5.78	4.65	0.58169	.	.	.	.	.	T	0.22360	0.0539	L	0.47716	1.5	0.34699	D	0.726492	B	0.10296	0.003	B	0.06405	0.002	T	0.15407	-1.0438	9	0.35671	T	0.21	.	9.2543	0.37573	0.918:0.0:0.082:0.0	.	337	Q7Z7A1	CNTRL_HUMAN	R	337	ENSP00000362962:Q337R;ENSP00000238341:Q337R	ENSP00000238341:Q337R	Q	+	2	0	CNTRL	122914565	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	4.452000	0.60054	1.028000	0.39785	0.460000	0.39030	CAG	.	.		0.338	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250216.1	NM_007018	
ASS1	445	hgsc.bcm.edu	37	9	133364729	133364729	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:133364729A>G	ENST00000372394.1	+	13	1329	c.848A>G	c.(847-849)gAg>gGg	p.E283G	ASS1_ENST00000352480.5_Missense_Mutation_p.E283G|ASS1_ENST00000493984.2_3'UTR|ASS1_ENST00000372393.3_Missense_Mutation_p.E283G			P00966	ASSY_HUMAN	argininosuccinate synthase 1	283			E -> K (in CTLN1). {ECO:0000269|PubMed:12815590, ECO:0000269|PubMed:16475226}.		acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	GGTATCTACGAGACCCCAGCA	0.453																																					p.E283G		Atlas-SNP	.											.	ASS1	37	.	0			c.A848G						.						88.0	95.0	93.0					9																	133364729		2203	4300	6503	SO:0001583	missense	445	exon12			TCTACGAGACCCC	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.848A>G	chr9.hg19:g.133364729A>G	ENSP00000361471:p.Glu283Gly	104.0	0.0		59.0	5.0	NM_054012	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	hg19	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	A	19.03	3.747165	0.69418	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393;ENST00000372386	D;D;D;D	0.99574	-6.2;-6.2;-6.2;-5.87	4.5	4.5	0.54988	Argininosuccinate synthetase, catalytic/multimerisation domain body (1);	0.000000	0.85682	U	0.000000	D	0.99597	0.9854	H	0.95470	3.675	0.80722	D	1	P;D;D;P;P	0.56746	0.724;0.977;0.977;0.724;0.724	P;P;P;P;P	0.55112	0.578;0.769;0.769;0.578;0.578	D	0.97864	1.0282	10	0.87932	D	0	.	13.3017	0.60328	1.0:0.0:0.0:0.0	.	283;166;166;283;283	A8KAP9;B4E395;E9PDT0;Q5T6L4;P00966	.;.;.;.;ASSY_HUMAN	G	283;283;283;283;40	ENSP00000253004:E283G;ENSP00000361471:E283G;ENSP00000361469:E283G;ENSP00000361461:E40G	ENSP00000361470:E283G	E	+	2	0	ASS1	132354550	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.684000	0.91242	1.802000	0.52723	0.379000	0.24179	GAG	.	.		0.453	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050	
NUP214	8021	hgsc.bcm.edu	37	9	134020110	134020110	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:134020110A>G	ENST00000359428.5	+	12	1882	c.1738A>G	c.(1738-1740)Acc>Gcc	p.T580A	RP11-544A12.4_ENST00000590461.1_RNA|RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|NUP214_ENST00000451030.1_Missense_Mutation_p.T580A|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|NUP214_ENST00000411637.2_Missense_Mutation_p.T580A|RP11-544A12.4_ENST00000589540.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	580	11 X 5 AA approximate repeats.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		CCCACCCTCAACCTCTGCTGT	0.418			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																p.T580A	Pancreas(4;24 48 25510 30394 32571)	Atlas-SNP	.		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	.	NUP214	166	.	0			c.A1738G						.						50.0	47.0	48.0					9																	134020110		2203	4299	6502	SO:0001583	missense	8021	exon12			CCCTCAACCTCTG	X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.1738A>G	chr9.hg19:g.134020110A>G	ENSP00000352400:p.Thr580Ala	201.0	0.0		99.0	5.0	NM_005085	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Missense_Mutation	SNP	ENST00000359428.5	hg19	CCDS6940.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.294|0.294	-0.977970|-0.977970	0.02197|0.02197	.|.	.|.	ENSG00000126883|ENSG00000126883	ENST00000530863|ENST00000359428;ENST00000411637;ENST00000451030;ENST00000541375;ENST00000540899;ENST00000438605	.|T;T;T	.|0.30182	.|1.69;1.54;1.66	5.56|5.56	-2.91|-2.91	0.05631|0.05631	.|.	.|0.932418	.|0.08874	.|N	.|0.881118	T|T	0.09949|0.09949	0.0244|0.0244	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.04013	.|0.001;0.001;0.001	T|T	0.32877|0.32877	-0.9890|-0.9890	5|10	.|0.06494	.|T	.|0.89	-2.224|-2.224	2.0126|2.0126	0.03491|0.03491	0.2388:0.1002:0.4363:0.2247|0.2388:0.1002:0.4363:0.2247	.|.	.|173;580;580	.|Q5JUP9;P35658-4;P35658	.|.;.;NU214_HUMAN	S|A	155|580;580;580;580;173;9	.|ENSP00000352400:T580A;ENSP00000396576:T580A;ENSP00000405014:T580A	.|ENSP00000352400:T580A	N|T	+|+	2|1	0|0	NUP214|NUP214	133009931|133009931	0.044000|0.044000	0.20184|0.20184	0.004000|0.004000	0.12327|0.12327	0.616000|0.616000	0.37450|0.37450	0.367000|0.367000	0.20382|0.20382	-0.337000|-0.337000	0.08426|0.08426	-1.317000|-1.317000	0.01298|0.01298	AAC|ACC	.	.		0.418	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000054694.2	NM_005085	
NDOR1	27158	hgsc.bcm.edu	37	9	140110580	140110580	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr9:140110580A>G	ENST00000344894.5	+	13	1672	c.1589A>G	c.(1588-1590)gAg>gGg	p.E530G	NDOR1_ENST00000458322.2_Missense_Mutation_p.E523G|NDOR1_ENST00000371521.4_Missense_Mutation_p.E539G|NDOR1_ENST00000427047.2_Missense_Mutation_p.E496G	NM_001144028.1|NM_014434.2	NP_001137500.1|NP_055249.1			NADPH dependent diflavin oxidoreductase 1											breast(1)|endometrium(5)|large_intestine(1)|lung(5)|prostate(1)|skin(1)|urinary_tract(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.00057)		CGGCTCCGGGAGCTGGGGTCG	0.657																																					p.E539G		Atlas-SNP	.											.	NDOR1	71	.	0			c.A1616G						.						49.0	54.0	53.0					9																	140110580		2203	4300	6503	SO:0001583	missense	27158	exon13			TCCGGGAGCTGGG	BC015735	CCDS7036.1, CCDS48061.1, CCDS48062.1, CCDS48063.1	9q34.3	2008-02-05			ENSG00000188566	ENSG00000188566			29838	protein-coding gene	gene with protein product	"""NADPH dependent FMN and FAD containing oxidoreductase"""	606073				10625700, 12631275	Standard	XM_005266066		Approved	NR1, bA350O14.9	uc004clx.3	Q9UHB4	OTTHUMG00000020986	ENST00000344894.5:c.1589A>G	chr9.hg19:g.140110580A>G	ENSP00000343344:p.Glu530Gly	95.0	0.0		53.0	4.0	NM_001144026		Missense_Mutation	SNP	ENST00000344894.5	hg19	CCDS7036.1	.	.	.	.	.	.	.	.	.	.	A	17.10	3.303276	0.60195	.	.	ENSG00000188566	ENST00000458322;ENST00000427047;ENST00000371521;ENST00000344894	D;D;D;D	0.87966	-2.32;-2.32;-2.32;-2.32	4.06	4.06	0.47325	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.93370	0.7886	M	0.92367	3.3	0.80722	D	1	D;B;P;B	0.53312	0.959;0.226;0.949;0.125	P;B;P;B	0.59825	0.864;0.213;0.786;0.32	D	0.94255	0.7497	10	0.87932	D	0	-9.9853	10.9983	0.47589	1.0:0.0:0.0:0.0	.	523;496;539;530	D3YTG6;D3YTH9;Q9UHB4-2;Q9UHB4	.;.;.;NDOR1_HUMAN	G	523;496;539;530	ENSP00000389905:E523G;ENSP00000394309:E496G;ENSP00000360576:E539G;ENSP00000343344:E530G	ENSP00000343344:E530G	E	+	2	0	NDOR1	139230401	1.000000	0.71417	0.960000	0.40013	0.624000	0.37722	3.698000	0.54771	1.713000	0.51359	0.459000	0.35465	GAG	.	.		0.657	NDOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254704.1	NM_014434	
KLF6	1316	hgsc.bcm.edu	37	10	3824046	3824046	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:3824046T>C	ENST00000497571.1	-	2	723	c.463A>G	c.(463-465)Agc>Ggc	p.S155G	KLF6_ENST00000469435.1_Missense_Mutation_p.S155G|KLF6_ENST00000542957.1_Missense_Mutation_p.S155G|KLF6_ENST00000173785.4_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	155			S -> R (found in gastric cancer samples; somatic mutation). {ECO:0000269|PubMed:15824733}.		B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GGTTCCCTGCTCAGTTCCGGA	0.607											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S155G		Atlas-SNP	.											.	KLF6	38	.	0			c.A463G						.						69.0	68.0	69.0					10																	3824046		2203	4300	6503	SO:0001583	missense	1316	exon2			CCCTGCTCAGTTC	U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.463A>G	chr10.hg19:g.3824046T>C	ENSP00000419923:p.Ser155Gly	87.0	0.0	614	68.0	4.0	NM_001160125	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Missense_Mutation	SNP	ENST00000497571.1	hg19	CCDS7060.1	.	.	.	.	.	.	.	.	.	.	T	8.735	0.917524	0.17982	.	.	ENSG00000067082	ENST00000497571;ENST00000542957;ENST00000469435	T;T;T	0.53640	3.18;0.61;0.84	4.99	2.29	0.28610	.	0.470516	0.26213	N	0.025679	T	0.22820	0.0551	N	0.05259	-0.085	0.27472	N	0.952831	B;B;B;B	0.06786	0.0;0.0;0.001;0.0	B;B;B;B	0.09377	0.0;0.002;0.004;0.0	T	0.15321	-1.0441	10	0.22109	T	0.4	.	9.2466	0.37529	0.0:0.1777:0.0:0.8223	.	155;155;155;155	D3GC14;F5H3M5;Q99612-2;Q99612	.;.;.;KLF6_HUMAN	G	155	ENSP00000419923:S155G;ENSP00000445301:S155G;ENSP00000419079:S155G	ENSP00000419079:S155G	S	-	1	0	KLF6	3814046	0.998000	0.40836	0.998000	0.56505	0.956000	0.61745	0.801000	0.27055	0.758000	0.33059	0.459000	0.35465	AGC	.	.		0.607	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046495.1		
BEND7	222389	hgsc.bcm.edu	37	10	13541881	13541881	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:13541881A>G	ENST00000396900.2	-	3	344	c.345T>C	c.(343-345)ggT>ggC	p.G115G	BEND7_ENST00000378605.3_Silent_p.G63G|BEND7_ENST00000396898.2_Silent_p.G115G|BEND7_ENST00000341083.3_Silent_p.G63G			Q8N7W2	BEND7_HUMAN	BEN domain containing 7	115						extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						CATTCCACACACCACGTGAAG	0.572																																					p.G63G		Atlas-SNP	.											.	BEND7	85	.	0			c.T189C						.						79.0	81.0	80.0					10																	13541881		2203	4300	6503	SO:0001819	synonymous_variant	222389	exon2			CCACACACCACGT	BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.345T>C	chr10.hg19:g.13541881A>G		188.0	0.0		118.0	7.0	NM_001100912	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	Silent	SNP	ENST00000396900.2	hg19																																																																																				.	.		0.572	BEND7-202	KNOWN	basic	protein_coding	protein_coding		NM_152751	
CUBN	8029	hgsc.bcm.edu	37	10	17024537	17024537	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:17024537A>G	ENST00000377833.4	-	31	4706	c.4641T>C	c.(4639-4641)cgT>cgC	p.R1547R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1547	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	TCAAGAGAACACGATGATTTC	0.433																																					p.R1547R		Atlas-SNP	.											.	CUBN	515	.	0			c.T4641C						.						131.0	107.0	115.0					10																	17024537		2203	4300	6503	SO:0001819	synonymous_variant	8029	exon31			GAGAACACGATGA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4641T>C	chr10.hg19:g.17024537A>G		87.0	0.0		58.0	7.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Silent	SNP	ENST00000377833.4	hg19	CCDS7113.1																																																																																			.	.		0.433	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
CUBN	8029	hgsc.bcm.edu	37	10	17153015	17153015	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:17153015G>C	ENST00000377833.4	-	9	983	c.918C>G	c.(916-918)atC>atG	p.I306M		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	306	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CACATTCATTGATATCTTCGC	0.453																																					p.I306M		Atlas-SNP	.											.	CUBN	515	.	0			c.C918G						.						104.0	100.0	101.0					10																	17153015		2203	4300	6503	SO:0001583	missense	8029	exon9			TTCATTGATATCT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.918C>G	chr10.hg19:g.17153015G>C	ENSP00000367064:p.Ile306Met	109.0	0.0		65.0	11.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	G	15.31	2.795638	0.50208	.	.	ENSG00000107611	ENST00000377833	D	0.93547	-3.24	5.83	2.74	0.32292	Growth factor, receptor (1);EGF-like calcium-binding (1);	0.289804	0.24640	N	0.036817	D	0.92355	0.7574	M	0.79614	2.46	0.80722	D	1	P	0.39717	0.684	P	0.45099	0.469	D	0.89301	0.3626	10	0.51188	T	0.08	.	3.7944	0.08733	0.4027:0.1787:0.4186:0.0	.	306	O60494	CUBN_HUMAN	M	306	ENSP00000367064:I306M	ENSP00000367064:I306M	I	-	3	3	CUBN	17193021	0.966000	0.33281	0.981000	0.43875	0.794000	0.44872	0.900000	0.28431	0.767000	0.33267	0.650000	0.86243	ATC	.	.		0.453	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
WDFY4	57705	hgsc.bcm.edu	37	10	50149852	50149852	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:50149852A>G	ENST00000325239.5	+	47	7615	c.7588A>G	c.(7588-7590)Aga>Gga	p.R2530G	WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2530	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						GTCCCACAGGAGATACCCCGG	0.552																																					p.R2530G		Atlas-SNP	.											.	WDFY4	205	.	0			c.A7588G						.						89.0	87.0	88.0					10																	50149852		692	1591	2283	SO:0001630	splice_region_variant	57705	exon48			CACAGGAGATACC	AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.7587-1A>G	chr10.hg19:g.50149852A>G		143.0	0.0		94.0	4.0	NM_020945	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	ENST00000325239.5	hg19	CCDS44385.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.40|14.40	2.525398|2.525398	0.44969|0.44969	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000426033;ENST00000325239	.|T	.|0.58210	.|0.35	5.61|5.61	4.46|4.46	0.54185|0.54185	.|BEACH domain (2);	.|0.579188	.|0.18322	.|N	.|0.144777	T|T	0.41119|0.41119	0.1145|0.1145	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	.|B	.|0.20459	.|0.045	.|B	.|0.21546	.|0.035	T|T	0.15378|0.15378	-1.0439|-1.0439	5|9	.|.	.|.	.|.	.|.	10.0273|10.0273	0.42079|0.42079	0.8304:0.1696:0.0:0.0|0.8304:0.1696:0.0:0.0	.|.	.|2530	.|Q6ZS81	.|WDFY4_HUMAN	G|G	1620|2530	.|ENSP00000320563:R2530G	.|.	E|R	+|+	2|1	0|2	WDFY4|WDFY4	49819858|49819858	0.963000|0.963000	0.33076|0.33076	0.813000|0.813000	0.32504|0.32504	0.902000|0.902000	0.53008|0.53008	1.984000|1.984000	0.40658|0.40658	1.048000|1.048000	0.40298|0.40298	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.	.		0.552	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		XM_033379	Missense_Mutation
C10orf71	118461	hgsc.bcm.edu	37	10	50530756	50530756	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:50530756T>C	ENST00000374144.3	+	3	454	c.166T>C	c.(166-168)Tcc>Ccc	p.S56P	C10orf71_ENST00000323868.4_Missense_Mutation_p.S56P			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	56										endometrium(1)	1						TCTGGCTGTGTCCCCGGATAT	0.557																																					p.S56P		Atlas-SNP	.											.	C10orf71	179	.	0			c.T166C						.						48.0	51.0	50.0					10																	50530756		2050	4187	6237	SO:0001583	missense	118461	exon3			GCTGTGTCCCCGG	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.166T>C	chr10.hg19:g.50530756T>C	ENSP00000363259:p.Ser56Pro	135.0	0.0		94.0	4.0	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	hg19	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	T	14.64	2.596257	0.46318	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.27720	1.65;2.85	5.13	5.13	0.70059	.	0.000000	0.48767	D	0.000171	T	0.43853	0.1266	M	0.70275	2.135	0.39751	D	0.971895	D	0.56521	0.976	P	0.53006	0.715	T	0.51044	-0.8755	10	0.87932	D	0	.	10.2112	0.43141	0.0:0.0783:0.0:0.9217	.	56	Q711Q0-3	.	P	56	ENSP00000318713:S56P;ENSP00000363259:S56P	ENSP00000318713:S56P	S	+	1	0	C10orf71	50200762	0.997000	0.39634	1.000000	0.80357	0.086000	0.17979	2.596000	0.46205	1.940000	0.56252	0.455000	0.32223	TCC	.	.		0.557	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
NCOA4	8031	hgsc.bcm.edu	37	10	51582886	51582886	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:51582886A>G	ENST00000443446.1	+	7	890	c.661A>G	c.(661-663)Agc>Ggc	p.S221G	NCOA4_ENST00000374082.1_Missense_Mutation_p.S221G|NCOA4_ENST00000438493.1_Missense_Mutation_p.S237G|NCOA4_ENST00000374087.4_Missense_Mutation_p.S221G|NCOA4_ENST00000414907.2_Missense_Mutation_p.S55G|NCOA4_ENST00000344348.6_Missense_Mutation_p.S221G|NCOA4_ENST00000498586.1_3'UTR|NCOA4_ENST00000452682.1_Missense_Mutation_p.S237G|NCOA4_ENST00000430396.2_Missense_Mutation_p.S121G	NM_001145262.1	NP_001138734.1	Q13772	NCOA4_HUMAN	nuclear receptor coactivator 4	221					androgen receptor signaling pathway (GO:0030521)|male gonad development (GO:0008584)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|transcription coactivator activity (GO:0003713)	p.S237G(1)		NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|skin(1)	5						TTACATACCCAGCACCGACCC	0.493			T	RET	papillary thyroid																																p.S237G		Atlas-SNP	.		Dom	yes		10	10q11.2	8031	nuclear receptor coactivator 4 - PTC3 (ELE1)		E	NCOA4_ENST00000452682,brain,primitive_neuroectodermal_tumour-medulloblastoma,0,1	NCOA4	58	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.A709G						.						82.0	73.0	76.0					10																	51582886		2203	4300	6503	SO:0001583	missense	8031	exon8			ATACCCAGCACCG	L49399	CCDS73092.1, CCDS73093.1, CCDS73094.1	10q11.2	2014-04-10			ENSG00000138293	ENSG00000266412			7671	protein-coding gene	gene with protein product	"""RET-activating gene ELE1"""	601984				8290261, 8643607, 24695223	Standard	NM_001145260		Approved	ARA70, RFG, ELE1, PTC3, DKFZp762E1112	uc009xon.3	Q13772	OTTHUMG00000188314	ENST00000443446.1:c.661A>G	chr10.hg19:g.51582886A>G	ENSP00000390713:p.Ser221Gly	96.0	0.0		47.0	2.0	NM_001145261	A8K8W5|B4E260|E9PAV7|J3KQN8|Q14239	Missense_Mutation	SNP	ENST00000443446.1	hg19	CCDS7237.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.10|17.10	3.302602|3.302602	0.60195|0.60195	.|.	.|.	ENSG00000138293|ENSG00000138293	ENST00000431200|ENST00000438493;ENST00000452682;ENST00000430396;ENST00000374087;ENST00000330923;ENST00000414907;ENST00000344348;ENST00000374082;ENST00000443446	.|T;T;T;T;T;T;T;T	.|0.39229	.|1.09;1.09;1.09;1.09;1.09;1.09;1.09;1.09	5.93|5.93	5.93|5.93	0.95920|0.95920	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66636|0.66636	0.2809|0.2809	M|M	0.78801|0.78801	2.425|2.425	0.51233|0.51233	D|D	0.999911|0.999911	.|D;D;D;D	.|0.89917	.|0.999;0.999;0.999;1.0	.|D;D;D;D	.|0.87578	.|0.997;0.997;0.997;0.998	T|T	0.70193|0.70193	-0.4939|-0.4939	5|10	.|0.66056	.|D	.|0.02	-14.98|-14.98	16.0574|16.0574	0.80816|0.80816	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|121;237;237;221	.|B4DF87;B4E260;E9PAV7;Q13772	.|.;.;.;NCOA4_HUMAN	R|G	136|237;237;121;221;221;55;221;221;221	.|ENSP00000405146:S237G;ENSP00000395465:S237G;ENSP00000393053:S121G;ENSP00000363200:S221G;ENSP00000411018:S55G;ENSP00000344552:S221G;ENSP00000363195:S221G;ENSP00000390713:S221G	.|ENSP00000332421:S221G	Q|S	+|+	2|1	0|0	NCOA4|NCOA4	51252892|51252892	1.000000|1.000000	0.71417|0.71417	0.929000|0.929000	0.37066|0.37066	0.030000|0.030000	0.12068|0.12068	6.865000|6.865000	0.75500|0.75500	2.258000|2.258000	0.74832|0.74832	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.	.		0.493	NCOA4-204	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048052.1	NM_005437	
SGMS1	259230	hgsc.bcm.edu	37	10	52071024	52071024	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:52071024T>C	ENST00000361781.2	-	9	1852	c.893A>G	c.(892-894)gAg>gGg	p.E298G	SGMS1_ENST00000429490.1_Missense_Mutation_p.E129G	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	304					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						AGACTTACACTCTTTGATAAA	0.443																																					p.E298G		Atlas-SNP	.											.	SGMS1	40	.	0			c.A893G						.						118.0	104.0	109.0					10																	52071024		2203	4300	6503	SO:0001583	missense	259230	exon9			TTACACTCTTTGA	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.893A>G	chr10.hg19:g.52071024T>C	ENSP00000354829:p.Glu298Gly	89.0	0.0		57.0	4.0	NM_147156	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	ENST00000361781.2	hg19	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.807270	0.90623	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T;T	0.75260	0.56;-0.92	5.87	5.87	0.94306	.	0.046562	0.85682	D	0.000000	D	0.88793	0.6533	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91012	0.4850	10	0.87932	D	0	-14.2433	14.5226	0.67863	0.0:0.0:0.0:1.0	.	129;304	B4DJU2;Q86VZ5	.;SMS1_HUMAN	G	98;298;129	ENSP00000354829:E298G;ENSP00000406795:E129G	ENSP00000354829:E298G	E	-	2	0	SGMS1	51741030	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.975000	0.88055	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.443	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
HK1	3098	hgsc.bcm.edu	37	10	71144583	71144583	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:71144583A>G	ENST00000359426.6	+	12	1855	c.1751A>G	c.(1750-1752)gAc>gGc	p.D584G	HK1_ENST00000404387.2_Missense_Mutation_p.D588G|HK1_ENST00000360289.2_Missense_Mutation_p.D572G|HK1_ENST00000298649.3_Missense_Mutation_p.D583G|HK1_ENST00000494253.1_3'UTR|HK1_ENST00000448642.2_Missense_Mutation_p.D619G	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	584	Catalytic.|Hexokinase type-1 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						TGCATCTCTGACTTCTTGGAC	0.512																																					p.D588G		Atlas-SNP	.											.	HK1	170	.	0			c.A1763G						.						229.0	230.0	230.0					10																	71144583		2203	4300	6503	SO:0001583	missense	3098	exon15			TCTCTGACTTCTT	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.1751A>G	chr10.hg19:g.71144583A>G	ENSP00000352398:p.Asp584Gly	144.0	0.0		78.0	4.0	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Missense_Mutation	SNP	ENST00000359426.6	hg19	CCDS7292.1	.	.	.	.	.	.	.	.	.	.	A	29.4	5.001403	0.93227	.	.	ENSG00000156515	ENST00000360289;ENST00000448642;ENST00000404387;ENST00000298649;ENST00000359426;ENST00000405407	D;D;D;D;D	0.99014	-5.33;-5.33;-5.33;-5.33;-5.33	5.68	5.68	0.88126	Hexokinase, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99193	0.9720	M	0.76938	2.355	0.80722	D	1	P;P;P;D;D;D	0.76494	0.756;0.918;0.935;0.99;0.988;0.999	P;P;P;D;D;D	0.78314	0.611;0.907;0.87;0.982;0.928;0.991	D	0.99585	1.0974	10	0.72032	D	0.01	.	15.5796	0.76422	1.0:0.0:0.0:0.0	.	584;584;583;619;588;572	A8K7J7;P19367;P19367-2;E7ENR4;P19367-3;P19367-4	.;HXK1_HUMAN;.;.;.;.	G	572;619;588;583;584;584	ENSP00000353433:D572G;ENSP00000402103:D619G;ENSP00000384774:D588G;ENSP00000298649:D583G;ENSP00000352398:D584G	ENSP00000298649:D583G	D	+	2	0	HK1	70814589	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.168000	0.68352	0.482000	0.46254	GAC	.	.		0.512	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
TSPAN15	23555	hgsc.bcm.edu	37	10	71255355	71255355	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:71255355T>C	ENST00000373290.2	+	4	485	c.363T>C	c.(361-363)atT>atC	p.I121I	TSPAN15_ENST00000459981.1_3'UTR	NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	121					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						AATAGACCATTGACTTCCTGA	0.428																																					p.I121I		Atlas-SNP	.											.	TSPAN15	22	.	0			c.T363C						.						121.0	111.0	114.0					10																	71255355		2203	4300	6503	SO:0001819	synonymous_variant	23555	exon4			GACCATTGACTTC	AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.363T>C	chr10.hg19:g.71255355T>C		152.0	0.0		86.0	4.0	NM_012339	Q6UW79	Silent	SNP	ENST00000373290.2	hg19	CCDS7294.1																																																																																			.	.		0.428	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048444.1	NM_012339	
CDH23	64072	hgsc.bcm.edu	37	10	73375278	73375278	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:73375278T>C	ENST00000224721.6	+	9	870	c.865T>C	c.(865-867)Ttt>Ctt	p.F289L	CDH23_ENST00000398842.3_Missense_Mutation_p.F284L|CDH23_ENST00000398809.4_Missense_Mutation_p.F284L|CDH23_ENST00000461841.3_Missense_Mutation_p.F329L|CDH23_ENST00000299366.7_Missense_Mutation_p.F329L	NM_022124.5	NP_071407.4	Q9H251	CAD23_HUMAN	cadherin-related 23	284	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium ion transport (GO:0006816)|calcium-dependent cell-cell adhesion (GO:0016339)|cytosolic calcium ion homeostasis (GO:0051480)|equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(6)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(27)|lung(49)|ovary(3)|pancreas(1)|prostate(7)|stomach(7)|upper_aerodigestive_tract(3)	133						CAACAGCATCTTTGCCCTGGA	0.602																																					p.F284L		Atlas-SNP	.											.	CDH23	365	.	0			c.T850C						.						84.0	86.0	85.0					10																	73375278		2029	4175	6204	SO:0001583	missense	64072	exon10			AGCATCTTTGCCC	AY010111	CCDS53540.1, CCDS73146.1	10q22.1	2014-08-08	2010-01-25		ENSG00000107736	ENSG00000107736		"""Cadherins / Cadherin-related"""	13733	protein-coding gene	gene with protein product	"""cadherin-related family member 23"""	605516	"""cadherin related 23"", ""cadherin-like 23"""	DFNB12, USH1D		11090341	Standard	NM_022124		Approved	CDHR23	uc001jrx.4	Q9H251	OTTHUMG00000019347	ENST00000224721.6:c.865T>C	chr10.hg19:g.73375278T>C	ENSP00000224721:p.Phe289Leu	117.0	0.0		72.0	4.0	NM_052836	C4IXS9|F6U049|Q5QGS1|Q5QGS2|Q5QGS5|Q5QGS6|Q5XKN2|Q6UWW1|Q96JL3|Q9H4K9	Missense_Mutation	SNP	ENST00000224721.6	hg19		.	.	.	.	.	.	.	.	.	.	T	24.0	4.487407	0.84854	.	.	ENSG00000107736	ENST00000398860;ENST00000398855;ENST00000398828;ENST00000398809;ENST00000398842;ENST00000299366;ENST00000224721;ENST00000416060	T;T	0.70749	-0.51;-0.51	4.22	4.22	0.49857	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000002	D	0.84991	0.5595	M	0.86343	2.81	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.974	D;D;D	0.97110	1.0;0.994;0.969	D	0.87498	0.2431	10	0.62326	D	0.03	.	13.4567	0.61204	0.0:0.0:0.0:1.0	.	284;284;284	A5D6V9;Q9H251;Q9H251-5	.;CAD23_HUMAN;.	L	291;284;284;284;284;289;289;201	ENSP00000381789:F284L;ENSP00000381822:F284L	ENSP00000224721:F291L	F	+	1	0	CDH23	73045284	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.431000	0.80335	1.771000	0.52183	0.455000	0.32223	TTT	.	.		0.602	CDH23-001	PUTATIVE	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000051227.4	NM_052836	
BTAF1	9044	hgsc.bcm.edu	37	10	93718881	93718881	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:93718881T>C	ENST00000265990.6	+	9	1268	c.960T>C	c.(958-960)ggT>ggC	p.G320G	BTAF1_ENST00000471217.1_3'UTR	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	320					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GGAAAAGTGGTGGTAAAATGG	0.373																																					p.G320G		Atlas-SNP	.											.	BTAF1	148	.	0			c.T960C						.						152.0	146.0	148.0					10																	93718881		2203	4300	6503	SO:0001819	synonymous_variant	9044	exon9			AAGTGGTGGTAAA	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.960T>C	chr10.hg19:g.93718881T>C		183.0	0.0		90.0	4.0	NM_003972	B4E0W6|O43578	Silent	SNP	ENST00000265990.6	hg19	CCDS7419.1																																																																																			.	.		0.373	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
PLCE1	51196	hgsc.bcm.edu	37	10	96076426	96076426	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:96076426T>C	ENST00000371380.3	+	28	6490	c.6255T>C	c.(6253-6255)ggT>ggC	p.G2085G	RP11-76P2.4_ENST00000609123.1_RNA|PLCE1_ENST00000371385.3_Silent_p.G1777G|PLCE1_ENST00000260766.3_Silent_p.G2085G|PLCE1_ENST00000371375.1_Silent_p.G1777G|NOC3L_ENST00000543788.1_Intron			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	2085	Ras-associating 1. {ECO:0000255|PROSITE- ProRule:PRU00166}.				activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				GAGCCATTGGTCCAGAAGAGG	0.383																																					p.G2085G		Atlas-SNP	.											.	PLCE1	543	.	0			c.T6255C						.						93.0	90.0	91.0					10																	96076426		1854	4091	5945	SO:0001819	synonymous_variant	51196	exon29			CATTGGTCCAGAA		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.6255T>C	chr10.hg19:g.96076426T>C		118.0	0.0		100.0	4.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Silent	SNP	ENST00000371380.3	hg19	CCDS41552.1																																																																																			.	.		0.383	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
DNMBP	23268	hgsc.bcm.edu	37	10	101668878	101668878	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:101668878A>G	ENST00000324109.4	-	5	2377	c.2286T>C	c.(2284-2286)tcT>tcC	p.S762S	DNMBP_ENST00000342239.3_Silent_p.S762S|DNMBP_ENST00000543621.1_Silent_p.S8S	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	762					intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		CCAGTGATGAAGACTGGGAGG	0.507																																					p.S762S		Atlas-SNP	.											.	DNMBP	173	.	0			c.T2286C						.						59.0	54.0	56.0					10																	101668878		2203	4300	6503	SO:0001819	synonymous_variant	23268	exon5			TGATGAAGACTGG	AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.2286T>C	chr10.hg19:g.101668878A>G		121.0	0.0		84.0	4.0	NM_015221	Q8IVY3|Q9Y2L3	Silent	SNP	ENST00000324109.4	hg19	CCDS7485.1																																																																																			.	.		0.507	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049832.2	NM_015221	
CFAP46	54777	hgsc.bcm.edu	37	10	134672635	134672635	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr10:134672635A>G	ENST00000368586.5	-	38	5415	c.5315T>C	c.(5314-5316)aTc>aCc	p.I1772T	TTC40_ENST00000263170.5_5'Flank	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCCACAGTCGATAAACTTTCT	0.512																																					p.I1772T		Atlas-SNP	.											.	TTC40	100	.	0			c.T5315C						.																																			SO:0001583	missense	54777	exon38			CAGTCGATAAACT																												ENST00000368586.5:c.5315T>C	chr10.hg19:g.134672635A>G	ENSP00000357575:p.Ile1772Thr	162.0	0.0		74.0	4.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	a	4.874	0.162386	0.09287	.	.	ENSG00000171811	ENST00000368586	T	0.10382	2.88	4.17	-4.88	0.03113	.	.	.	.	.	T	0.03434	0.0099	N	0.03608	-0.345	0.09310	N	1	.	.	.	.	.	.	T	0.45512	-0.9256	7	0.20046	T	0.44	.	6.8483	0.24000	0.3525:0.1555:0.492:0.0	.	.	.	.	T	1772	ENSP00000357575:I1772T	ENSP00000357575:I1772T	I	-	2	0	C10orf93	134522625	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.167000	0.09940	-1.088000	0.03077	-1.019000	0.02448	ATC	.	.		0.512	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
TRPM5	29850	hgsc.bcm.edu	37	11	2438955	2438955	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:2438955A>G	ENST00000155858.6	-	7	1018		c.e7+1		TRPM5_ENST00000528453.1_Splice_Site|TRPM5_ENST00000452833.1_Splice_Site|TRPM5_ENST00000533060.1_Splice_Site	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		GCCCGCCCTCACCTTTCACCA	0.627																																					.	NSCLC(1;49 61 17205 18850 43201)	Atlas-SNP	.											.	TRPM5	86	.	0			c.1009+2T>C						.						21.0	20.0	21.0					11																	2438955		2190	4293	6483	SO:0001630	splice_region_variant	29850	exon8			GCCCTCACCTTTC	AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.1009+1T>C	chr11.hg19:g.2438955A>G		94.0	0.0		63.0	4.0	NM_014555		Splice_Site	SNP	ENST00000155858.6	hg19	CCDS31340.1	.	.	.	.	.	.	.	.	.	.	A	18.31	3.594831	0.66219	.	.	ENSG00000070985	ENST00000533881;ENST00000155858;ENST00000452833;ENST00000533060;ENST00000528453;ENST00000437542	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.0364	0.47804	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPM5	2395531	1.000000	0.71417	1.000000	0.80357	0.831000	0.47069	8.017000	0.88712	1.608000	0.50180	0.260000	0.18958	.	.	.		0.627	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000027378.1	NM_014555	Intron
CHRNA10	57053	hgsc.bcm.edu	37	11	3687610	3687610	+	Silent	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:3687610G>A	ENST00000250699.2	-	5	1151	c.1080C>T	c.(1078-1080)tcC>tcT	p.S360S	CHRNA10_ENST00000534359.1_3'UTR|Y_RNA_ENST00000363331.1_RNA|Y_RNA_ENST00000364409.1_RNA|CHRNA10_ENST00000493827.2_5'Flank	NM_020402.2	NP_065135.2	Q9GZZ6	ACH10_HUMAN	cholinergic receptor, nicotinic, alpha 10 (neuronal)	360					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell proliferation (GO:0042127)|synaptic transmission, cholinergic (GO:0007271)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perikaryon (GO:0043204)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|lung(3)|ovary(1)	7		Medulloblastoma(188;0.0075)|Breast(177;0.0164)|all_neural(188;0.0577)		BRCA - Breast invasive adenocarcinoma(625;0.0344)|LUSC - Lung squamous cell carcinoma(625;0.192)	Chloroprocaine(DB01161)|Galantamine(DB00674)|Methadone(DB00333)|Nicotine(DB00184)|Pentolinium(DB01090)|Succinylcholine(DB00202)|Trimethaphan(DB01116)	CAGGTGGCCTGGACTGCCCAC	0.701																																					p.S360S	Melanoma(153;17 1869 2949 7120 36888)	Atlas-SNP	.											CHRNA10,colon,carcinoma,0,1	CHRNA10	31	.	0			c.C1080T						.						53.0	56.0	55.0					11																	3687610		2201	4297	6498	SO:0001819	synonymous_variant	57053	exon5			TGGCCTGGACTGC	AF199235	CCDS7745.1	11p15.5	2012-02-11	2012-02-07		ENSG00000129749	ENSG00000129749		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	13800	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 10 (neuronal)"""	606372	"""cholinergic receptor, nicotinic, alpha polypeptide 10"""				Standard	NM_020402		Approved		uc001lyf.3	Q9GZZ6	OTTHUMG00000011844	ENST00000250699.2:c.1080C>T	chr11.hg19:g.3687610G>A		48.0	0.0		32.0	2.0	NM_020402		Silent	SNP	ENST00000250699.2	hg19	CCDS7745.1																																																																																			.	.		0.701	CHRNA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032763.2		
NUP98	4928	hgsc.bcm.edu	37	11	3720345	3720345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:3720345T>C	ENST00000324932.7	-	25	4396	c.3976A>G	c.(3976-3978)Atc>Gtc	p.I1326V	NUP98_ENST00000355260.3_Missense_Mutation_p.I1326V|NUP98_ENST00000359171.4_Missense_Mutation_p.I1326V|NUP98_ENST00000488828.1_5'Flank	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1343					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		GCCTCACTGATCCTTTTGCCT	0.552			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.I1326V		Atlas-SNP	.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	149	.	0			c.A3976G						.						168.0	164.0	165.0					11																	3720345		2201	4298	6499	SO:0001583	missense	4928	exon25			CACTGATCCTTTT	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.3976A>G	chr11.hg19:g.3720345T>C	ENSP00000316032:p.Ile1326Val	139.0	0.0		94.0	8.0	NM_016320	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	hg19	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	19.46|19.46	3.832340|3.832340	0.71258|0.71258	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000429801|ENST00000324932;ENST00000359171;ENST00000355260	.|.	.|.	.|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62925|0.62925	0.2468|0.2468	L|L	0.28776|0.28776	0.89|0.89	0.43364|0.43364	D|D	0.995441|0.995441	.|D;P;D	.|0.69078	.|0.997;0.596;0.991	.|D;P;D	.|0.77557	.|0.99;0.495;0.978	T|T	0.56637|0.56637	-0.7946|-0.7946	5|9	.|0.12430	.|T	.|0.62	-15.952|-15.952	15.3831|15.3831	0.74676|0.74676	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1326;1326;1240	.|P52948-2;P52948-5;P52948-6	.|.;.;.	G|V	278|1326	.|.	.|ENSP00000316032:I1326V	D|I	-|-	2|1	0|0	NUP98|NUP98	3676921|3676921	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	7.201000|7.201000	0.77847|0.77847	2.285000|2.285000	0.76669|0.76669	0.533000|0.533000	0.62120|0.62120	GAT|ATC	.	.		0.552	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
NUP98	4928	hgsc.bcm.edu	37	11	3746442	3746442	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:3746442T>C	ENST00000324932.7	-	15	2158	c.1738A>G	c.(1738-1740)Att>Gtt	p.I580V	NUP98_ENST00000397007.4_Missense_Mutation_p.I597V|NUP98_ENST00000397004.4_Missense_Mutation_p.I580V|NUP98_ENST00000355260.3_Missense_Mutation_p.I580V|NUP98_ENST00000359171.4_Missense_Mutation_p.I580V	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	597					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		AACTTCTTAATGCTCTTCCTA	0.338			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																p.I597V		Atlas-SNP	.		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	.	NUP98	149	.	0			c.A1789G						.						70.0	73.0	72.0					11																	3746442		2200	4293	6493	SO:0001583	missense	4928	exon15			TCTTAATGCTCTT	AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.1738A>G	chr11.hg19:g.3746442T>C	ENSP00000316032:p.Ile580Val	117.0	0.0		88.0	4.0	NM_005387	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Missense_Mutation	SNP	ENST00000324932.7	hg19	CCDS7746.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.34|16.34	3.095892|3.095892	0.56075|0.56075	.|.	.|.	ENSG00000110713|ENSG00000110713	ENST00000527104|ENST00000324932;ENST00000359171;ENST00000355260;ENST00000397004;ENST00000397007	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.64907|0.64907	0.2641|0.2641	L|L	0.39898|0.39898	1.24|1.24	0.48135|0.48135	D|D	0.999592|0.999592	.|D;B;D;D	.|0.69078	.|0.978;0.311;0.993;0.997	.|D;B;D;D	.|0.77557	.|0.968;0.303;0.986;0.99	T|T	0.59096|0.59096	-0.7518|-0.7518	5|9	.|0.10377	.|T	.|0.69	.|.	14.7666|14.7666	0.69642|0.69642	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|597;580;580;580	.|P52948-3;P52948-4;P52948-2;P52948-5	.|.;.;.;.	R|V	199|580;580;580;580;597	.|.	.|ENSP00000316032:I580V	H|I	-|-	2|1	0|0	NUP98|NUP98	3703018|3703018	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	7.412000|7.412000	0.80091|0.80091	2.093000|2.093000	0.63338|0.63338	0.377000|0.377000	0.23210|0.23210	CAT|ATT	.	.		0.338	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032766.3	NM_016320	
ANO3	63982	hgsc.bcm.edu	37	11	26656592	26656592	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:26656592T>C	ENST00000256737.3	+	20	2870	c.2018T>C	c.(2017-2019)cTt>cCt	p.L673P	ANO3_ENST00000537978.1_Missense_Mutation_p.L657P|ANO3_ENST00000525139.1_Missense_Mutation_p.L657P|ANO3_ENST00000531568.1_Missense_Mutation_p.L527P	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	673					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TACAATAAACTTTTTGACCGG	0.458																																					p.L673P		Atlas-SNP	.											.	ANO3	145	.	0			c.T2018C						.						136.0	123.0	127.0					11																	26656592		2203	4299	6502	SO:0001583	missense	63982	exon20			ATAAACTTTTTGA	AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2018T>C	chr11.hg19:g.26656592T>C	ENSP00000256737:p.Leu673Pro	212.0	0.0		112.0	5.0	NM_031418	B7Z3F5	Missense_Mutation	SNP	ENST00000256737.3	hg19	CCDS31447.1	.	.	.	.	.	.	.	.	.	.	T	25.2	4.608922	0.87258	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.74315	-0.82;-0.82;-0.83;-0.71	6.03	6.03	0.97812	.	0.111684	0.64402	D	0.000006	D	0.86628	0.5978	M	0.81802	2.56	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.992;0.996	D	0.87160	0.2214	10	0.49607	T	0.09	.	15.7467	0.77949	0.0:0.0:0.0:1.0	.	575;673	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	P	657;657;673;575;527	ENSP00000440737:L657P;ENSP00000432576:L657P;ENSP00000256737:L673P;ENSP00000432394:L527P	ENSP00000256737:L673P	L	+	2	0	ANO3	26613168	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.928000	0.87587	2.302000	0.77476	0.533000	0.62120	CTT	.	.		0.458	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000387806.1	NM_031418	
OR5M9	390162	hgsc.bcm.edu	37	11	56230291	56230291	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:56230291G>A	ENST00000279791.1	-	1	586	c.587C>T	c.(586-588)aCa>aTa	p.T196I		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	196						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					AACAATCATTGTGATTTCTTT	0.448																																					p.T196I		Atlas-SNP	.											.	OR5M9	75	.	0			c.C587T						.						86.0	90.0	88.0					11																	56230291		2201	4296	6497	SO:0001583	missense	390162	exon1			ATCATTGTGATTT	AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.587C>T	chr11.hg19:g.56230291G>A	ENSP00000279791:p.Thr196Ile	106.0	0.0		79.0	4.0	NM_001004743	Q6IEW5|Q96RB9	Missense_Mutation	SNP	ENST00000279791.1	hg19	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	G	3.241	-0.155326	0.06544	.	.	ENSG00000150269	ENST00000279791	T	0.35605	1.3	4.39	1.25	0.21368	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45606	D	0.000351	T	0.28466	0.0704	N	0.11201	0.11	0.09310	N	1	D	0.54601	0.967	P	0.61592	0.891	T	0.07083	-1.0791	10	0.28530	T	0.3	-15.8863	5.5424	0.17045	0.2025:0.1688:0.6287:0.0	.	196	Q8NGP3	OR5M9_HUMAN	I	196	ENSP00000279791:T196I	ENSP00000279791:T196I	T	-	2	0	OR5M9	55986867	0.000000	0.05858	0.893000	0.35052	0.238000	0.25445	0.286000	0.18902	0.972000	0.38314	0.542000	0.68232	ACA	.	.		0.448	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
OR5B2	390190	hgsc.bcm.edu	37	11	58190477	58190477	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:58190477T>C	ENST00000302581.2	-	1	309	c.258A>G	c.(256-258)ggA>ggG	p.G86G		NM_001005566.2	NP_001005566.1	Q96R09	OR5B2_HUMAN	olfactory receptor, family 5, subfamily B, member 2	86						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				TGACCTTGTCTCCTCTAAGGA	0.493																																					p.G86G		Atlas-SNP	.											.	OR5B2	75	.	0			c.A258G						.						136.0	118.0	124.0					11																	58190477		2201	4295	6496	SO:0001819	synonymous_variant	390190	exon1			CTTGTCTCCTCTA	AB065852	CCDS31550.1	11q12.1	2012-08-09			ENSG00000172365	ENSG00000172365		"""GPCR / Class A : Olfactory receptors"""	8323	protein-coding gene	gene with protein product							Standard	NM_001005566		Approved	OST073	uc010rkg.2	Q96R09	OTTHUMG00000167517	ENST00000302581.2:c.258A>G	chr11.hg19:g.58190477T>C		136.0	0.0		89.0	6.0	NM_001005566	B2RNJ6|B9EGY7|Q6IEV7|Q8NGF5	Silent	SNP	ENST00000302581.2	hg19	CCDS31550.1																																																																																			.	.		0.493	OR5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394887.2	NM_001005566	
METTL12	751071	hgsc.bcm.edu	37	11	62434058	62434058	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:62434058T>C	ENST00000532971.1	+	3	515	c.258T>C	c.(256-258)acT>acC	p.T86T	C11orf48_ENST00000532208.1_Intron|C11orf48_ENST00000354588.3_Intron|C11orf48_ENST00000431002.2_Intron|C11orf48_ENST00000525675.1_5'Flank|RP11-831H9.11_ENST00000528405.1_5'Flank|C11orf48_ENST00000524958.1_5'Flank|METTL12_ENST00000398922.2_3'UTR|SNORA57_ENST00000383870.1_RNA	NM_001043229.1	NP_001036694.1	A8MUP2	MET12_HUMAN	methyltransferase like 12	86						mitochondrion (GO:0005739)	methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|urinary_tract(1)	6						GCTGTGGGACTTCCAGCCTAT	0.582																																					p.T86T		Atlas-SNP	.											.	METTL12	11	.	0			c.T258C						.						57.0	65.0	62.0					11																	62434058		2002	4160	6162	SO:0001819	synonymous_variant	751071	exon3			TGGGACTTCCAGC	BC041359	CCDS41657.1	11q12.3	2013-09-30			ENSG00000214756	ENSG00000214756			33113	protein-coding gene	gene with protein product							Standard	NM_001043229		Approved	U99HG	uc001nuh.3	A8MUP2	OTTHUMG00000167545	ENST00000532971.1:c.258T>C	chr11.hg19:g.62434058T>C		87.0	0.0		77.0	5.0	NM_001043229	B7Z4C1	Silent	SNP	ENST00000532971.1	hg19	CCDS41657.1																																																																																			.	.		0.582	METTL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394990.1	NM_001043229	
SLC25A45	283130	hgsc.bcm.edu	37	11	65147388	65147388	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:65147388T>C	ENST00000527174.1	-	3	158	c.103A>G	c.(103-105)Acc>Gcc	p.T35A	SLC25A45_ENST00000526432.1_Missense_Mutation_p.T35A|SLC25A45_ENST00000398802.1_Missense_Mutation_p.T35A|SLC25A45_ENST00000377152.2_5'UTR|SLC25A45_ENST00000534028.1_Intron|SLC25A45_ENST00000294187.6_5'UTR|SLC25A45_ENST00000360662.3_Intron|SLC25A45_ENST00000417511.2_5'UTR			Q8N413	S2545_HUMAN	solute carrier family 25, member 45	35					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	14						CCCCGGTAGGTGGTCTGGGTC	0.627																																					p.T35A		Atlas-SNP	.											.	SLC25A45	23	.	0			c.A103G						.						60.0	68.0	65.0					11																	65147388		2065	4195	6260	SO:0001583	missense	283130	exon4			GGTAGGTGGTCTG	BC041100	CCDS41670.1, CCDS41671.1, CCDS60850.1	11q13.1	2013-05-22			ENSG00000162241	ENSG00000162241		"""Solute carriers"""	27442	protein-coding gene	gene with protein product		610825				16949250	Standard	XM_006718507		Approved		uc001odr.1	Q8N413	OTTHUMG00000166255	ENST00000527174.1:c.103A>G	chr11.hg19:g.65147388T>C	ENSP00000435489:p.Thr35Ala	102.0	0.0		63.0	4.0	NM_182556	Q6PL49|Q8IW29	Missense_Mutation	SNP	ENST00000527174.1	hg19	CCDS41670.1	.	.	.	.	.	.	.	.	.	.	T	4.906	0.168366	0.09339	.	.	ENSG00000162241	ENST00000527174;ENST00000398802;ENST00000526432;ENST00000530936	T;T;T;T	0.78595	-1.19;-1.19;-1.19;-1.19	4.38	0.541	0.17168	Mitochondrial carrier domain (2);	.	.	.	.	T	0.49983	0.1589	N	0.05280	-0.08	0.09310	N	0.999998	B;B	0.14438	0.01;0.001	B;B	0.12837	0.006;0.008	T	0.34179	-0.9839	9	0.10636	T	0.68	.	4.6237	0.12467	0.0:0.1882:0.1641:0.6477	.	35;35	E9PJQ3;Q8N413	.;S2545_HUMAN	A	35	ENSP00000435489:T35A;ENSP00000381782:T35A;ENSP00000435547:T35A;ENSP00000431642:T35A	ENSP00000381782:T35A	T	-	1	0	SLC25A45	64903964	0.516000	0.26218	0.108000	0.21378	0.842000	0.47809	0.553000	0.23391	0.247000	0.21414	0.459000	0.35465	ACC	.	.		0.627	SLC25A45-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388744.3	NM_182556	
FCHSD2	9873	hgsc.bcm.edu	37	11	72551945	72551945	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:72551945T>C	ENST00000409418.4	-	19	2499	c.2116A>G	c.(2116-2118)Acc>Gcc	p.T706A	FCHSD2_ENST00000458644.2_Missense_Mutation_p.T570A|FCHSD2_ENST00000409263.1_Missense_Mutation_p.T67A|FCHSD2_ENST00000311172.7_Missense_Mutation_p.T650A|ATG16L2_ENST00000534905.1_Intron|FCHSD2_ENST00000409314.1_Missense_Mutation_p.T730A	NM_014824.2	NP_055639.2	O94868	FCSD2_HUMAN	FCH and double SH3 domains 2	706										endometrium(2)|large_intestine(11)|lung(5)|ovary(2)|prostate(1)|skin(1)	22			BRCA - Breast invasive adenocarcinoma(5;3.3e-05)			CCATATGAGGTCTCAGGAGTA	0.418																																					p.T706A		Atlas-SNP	.											.	FCHSD2	106	.	0			c.A2116G						.						115.0	103.0	107.0					11																	72551945		2200	4293	6493	SO:0001583	missense	9873	exon19			ATGAGGTCTCAGG	AB018312	CCDS8218.2	11q13.3	2008-02-05	2004-04-14	2004-04-16	ENSG00000137478	ENSG00000137478			29114	protein-coding gene	gene with protein product			"""SH3 multiple domains 3"""	SH3MD3		9872452, 15067381	Standard	NM_014824		Approved	KIAA0769	uc009ytl.3	O94868	OTTHUMG00000153082	ENST00000409418.4:c.2116A>G	chr11.hg19:g.72551945T>C	ENSP00000386722:p.Thr706Ala	105.0	0.0		61.0	5.0	NM_014824	B4DNI3|Q7L8J9|Q8WVM2|Q96FV7|Q9UF77	Missense_Mutation	SNP	ENST00000409418.4	hg19	CCDS8218.2	.	.	.	.	.	.	.	.	.	.	T	13.87	2.367561	0.42003	.	.	ENSG00000137478	ENST00000311172;ENST00000409314;ENST00000409418;ENST00000409263;ENST00000458644	T;T;T;T	0.14144	2.53;2.65;2.65;2.53	5.3	4.11	0.48088	.	0.426091	0.23863	N	0.043824	T	0.07052	0.0179	N	0.12182	0.205	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20806	-1.0264	10	0.09338	T	0.73	-13.8225	11.7994	0.52118	0.0:0.0:0.1461:0.8539	.	570;706	E7ENZ2;O94868	.;FCSD2_HUMAN	A	650;730;706;67;570	ENSP00000308978:T650A;ENSP00000386987:T730A;ENSP00000386722:T706A;ENSP00000402972:T570A	ENSP00000308978:T650A	T	-	1	0	FCHSD2	72229593	0.999000	0.42202	1.000000	0.80357	0.605000	0.37080	1.692000	0.37731	2.225000	0.72522	0.460000	0.39030	ACC	.	.		0.418	FCHSD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329429.2	NM_014824	
ARHGEF17	9828	hgsc.bcm.edu	37	11	73073127	73073127	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:73073127T>C	ENST00000263674.3	+	13	4887	c.4537T>C	c.(4537-4539)Tcg>Ccg	p.S1513P		NM_014786.3	NP_055601.2	Q96PE2	ARHGH_HUMAN	Rho guanine nucleotide exchange factor (GEF) 17	1513					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|skin(2)	32						CCCGGAGCCCTCGCCTGAGGT	0.662																																					p.S1513P		Atlas-SNP	.											.	ARHGEF17	117	.	0			c.T4537C						.						29.0	31.0	30.0					11																	73073127		2200	4292	6492	SO:0001583	missense	9828	exon13			GAGCCCTCGCCTG	AF378754	CCDS8221.1	11q13.3	2011-11-16			ENSG00000110237	ENSG00000110237		"""Rho guanine nucleotide exchange factors"""	21726	protein-coding gene	gene with protein product	"""Rho-specific guanine-nucleotide exchange factor 164 kDa"", ""tumor endothelial marker 4"""					11559528, 12071859	Standard	NM_014786		Approved	TEM4, KIAA0337, p164-RhoGEF	uc001otu.3	Q96PE2	OTTHUMG00000167971	ENST00000263674.3:c.4537T>C	chr11.hg19:g.73073127T>C	ENSP00000263674:p.Ser1513Pro	113.0	0.0		51.0	5.0	NM_014786	B2RP20|Q86XU2|Q8N2S0|Q9Y4G3	Missense_Mutation	SNP	ENST00000263674.3	hg19	CCDS8221.1	.	.	.	.	.	.	.	.	.	.	T	16.49	3.138391	0.56936	.	.	ENSG00000110237	ENST00000263674	T	0.58506	0.33	5.31	-6.75	0.01738	.	0.848702	0.10855	N	0.626767	T	0.32645	0.0836	N	0.14661	0.345	0.09310	N	1	B	0.27068	0.167	B	0.20384	0.029	T	0.17561	-1.0365	10	0.56958	D	0.05	0.0042	10.1721	0.42915	0.0979:0.0:0.4841:0.4179	.	1513	Q96PE2	ARHGH_HUMAN	P	1513	ENSP00000263674:S1513P	ENSP00000263674:S1513P	S	+	1	0	ARHGEF17	72750775	0.506000	0.26139	0.003000	0.11579	0.940000	0.58332	0.257000	0.18369	-1.177000	0.02744	0.533000	0.62120	TCG	.	.		0.662	ARHGEF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397365.1	NM_014786	
ESAM	90952	hgsc.bcm.edu	37	11	124624658	124624658	+	Splice_Site	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:124624658A>G	ENST00000278927.5	-	5	738	c.609T>C	c.(607-609)gaT>gaC	p.D203D	VSIG2_ENST00000403470.1_5'Flank|ESAM_ENST00000442070.2_Splice_Site_p.D24D|VSIG2_ENST00000326621.5_5'Flank	NM_138961.2	NP_620411.2	Q96AP7	ESAM_HUMAN	endothelial cell adhesion molecule	203	Ig-like C2-type.				blood coagulation (GO:0007596)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)|single organismal cell-cell adhesion (GO:0016337)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(2)|kidney(1)|large_intestine(6)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.022)		CACGGATGACATCTGTGGACA	0.483																																					p.D203D		Atlas-SNP	.											.	ESAM	31	.	0			c.T609C						.						171.0	162.0	165.0					11																	124624658		2201	4299	6500	SO:0001630	splice_region_variant	90952	exon5			GATGACATCTGTG	AK075396	CCDS8453.1	11q24.2	2013-01-29			ENSG00000149564	ENSG00000149564		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17474	protein-coding gene	gene with protein product		614281				11279107, 11906820	Standard	NM_138961		Approved	W117m	uc001qav.4	Q96AP7	OTTHUMG00000151986	ENST00000278927.5:c.608-1T>C	chr11.hg19:g.124624658A>G		124.0	0.0		88.0	5.0	NM_138961	B4DVN8|Q96T50	Silent	SNP	ENST00000278927.5	hg19	CCDS8453.1																																																																																			.	.		0.483	ESAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324686.1	NM_138961	Silent
KIRREL3	84623	hgsc.bcm.edu	37	11	126318909	126318909	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr11:126318909A>G	ENST00000525144.2	-	8	1241	c.992T>C	c.(991-993)gTc>gCc	p.V331A	KIRREL3_ENST00000529097.2_Missense_Mutation_p.V331A|KIRREL3_ENST00000525704.2_Missense_Mutation_p.V331A	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	331					hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		CTCACAGTAGACGTCAACCGT	0.577																																					p.V331A		Atlas-SNP	.											.	KIRREL3	183	.	0			c.T992C						.						60.0	66.0	64.0					11																	126318909		2094	4225	6319	SO:0001583	missense	84623	exon8			CAGTAGACGTCAA	AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.992T>C	chr11.hg19:g.126318909A>G	ENSP00000435466:p.Val331Ala	68.0	0.0		54.0	4.0	NM_032531	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Missense_Mutation	SNP	ENST00000525144.2	hg19	CCDS53723.1	.	.	.	.	.	.	.	.	.	.	A	27.2	4.811738	0.90707	.	.	ENSG00000149571	ENST00000525144;ENST00000529097;ENST00000525704	T;T;T	0.22134	1.97;1.97;1.97	5.32	5.32	0.75619	.	0.000000	0.64402	D	0.000001	T	0.47525	0.1450	M	0.74881	2.28	0.80722	D	1	D;D;D	0.89917	0.996;0.963;1.0	D;D;D	0.85130	0.987;0.973;0.997	T	0.51204	-0.8735	10	0.87932	D	0	.	14.9562	0.71116	1.0:0.0:0.0:0.0	.	331;331;331	Q8IZU9-2;E9PRX9;Q8IZU9	.;.;KIRR3_HUMAN	A	331	ENSP00000435466:V331A;ENSP00000434081:V331A;ENSP00000435094:V331A	ENSP00000435466:V331A	V	-	2	0	KIRREL3	125824119	1.000000	0.71417	0.968000	0.41197	0.951000	0.60555	8.962000	0.93254	2.013000	0.59113	0.523000	0.50628	GTC	.	.		0.577	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386479.2	NM_032531	
NTF3	4908	hgsc.bcm.edu	37	12	5603792	5603792	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:5603792C>T	ENST00000331010.6	+	1	495	c.412C>T	c.(412-414)Cgg>Tgg	p.R138W	NTF3_ENST00000423158.3_Missense_Mutation_p.R151W|NTF3_ENST00000535299.1_Intron	NM_002527.4	NP_002518.1	P20783	NTF3_HUMAN	neurotrophin 3	138					activation of MAPK activity (GO:0000187)|activation of protein kinase B activity (GO:0032148)|activation of Ras GTPase activity (GO:0032856)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell-cell signaling (GO:0007267)|enteric nervous system development (GO:0048484)|epidermis development (GO:0008544)|glial cell fate determination (GO:0007403)|induction of positive chemotaxis (GO:0050930)|mechanoreceptor differentiation (GO:0042490)|myelination (GO:0042552)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuromuscular synaptic transmission (GO:0007274)|peripheral nervous system development (GO:0007422)|positive chemotaxis (GO:0050918)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of synaptic transmission (GO:0050804)|signal transduction (GO:0007165)|smooth muscle cell differentiation (GO:0051145)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasmic membrane-bounded vesicle (GO:0016023)|extracellular region (GO:0005576)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|receptor binding (GO:0005102)	p.R138W(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(3)|upper_aerodigestive_tract(1)	22						ACGGCGGAAACGGTACGCGGA	0.602																																					p.R151W	GBM(194;1104 2182 8339 9578 18493)	Atlas-SNP	.											NTF3,NS,carcinoma,-1,2	NTF3	50	.	1	Substitution - Missense(1)	pancreas(1)	c.C451T						.						90.0	85.0	87.0					12																	5603792		2203	4300	6503	SO:0001583	missense	4908	exon2			CGGAAACGGTACG		CCDS8538.1, CCDS44806.1	12p13	2014-01-30			ENSG00000185652	ENSG00000185652		"""Endogenous ligands"""	8023	protein-coding gene	gene with protein product		162660				1889806	Standard	NM_002527		Approved	NGF2	uc001qnk.4	P20783	OTTHUMG00000168649	ENST00000331010.6:c.412C>T	chr12.hg19:g.5603792C>T	ENSP00000328738:p.Arg138Trp	70.0	0.0		41.0	2.0	NM_001102654	B7Z1T5|Q6FH50	Missense_Mutation	SNP	ENST00000331010.6	hg19	CCDS8538.1	.	.	.	.	.	.	.	.	.	.	C	17.49	3.402300	0.62288	.	.	ENSG00000185652	ENST00000423158;ENST00000331010	T;T	0.71461	-0.57;-0.57	5.52	0.544	0.17185	.	0.000000	0.85682	D	0.000000	D	0.82972	0.5153	M	0.89601	3.045	0.49483	D	0.999797	D;D	0.76494	0.997;0.999	P;P	0.57720	0.826;0.826	D	0.87975	0.2739	10	0.87932	D	0	-11.5385	15.2584	0.73603	0.3181:0.6819:0.0:0.0	.	138;151	P20783;B7Z1T5	NTF3_HUMAN;.	W	151;138	ENSP00000397297:R151W;ENSP00000328738:R138W	ENSP00000328738:R138W	R	+	1	2	NTF3	5474053	1.000000	0.71417	0.995000	0.50966	0.950000	0.60333	2.989000	0.49393	0.516000	0.28340	0.591000	0.81541	CGG	.	.		0.602	NTF3-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000400486.1		
PTPRO	5800	hgsc.bcm.edu	37	12	15654901	15654901	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:15654901T>C	ENST00000281171.4	+	5	1339	c.1009T>C	c.(1009-1011)Tct>Cct	p.S337P	PTPRO_ENST00000348962.2_Missense_Mutation_p.S337P|PTPRO_ENST00000543886.1_Missense_Mutation_p.S337P	NM_030667.2	NP_109592.1	Q16827	PTPRO_HUMAN	protein tyrosine phosphatase, receptor type, O	337	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell morphogenesis (GO:0000902)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|lamellipodium assembly (GO:0030032)|monocyte chemotaxis (GO:0002548)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron projection development (GO:0010977)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of glomerular filtration (GO:0003093)|slit diaphragm assembly (GO:0036060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)|Wnt-protein binding (GO:0017147)			NS(2)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(11)|lung(30)|ovary(2)|prostate(1)|skin(17)|upper_aerodigestive_tract(1)	74		Hepatocellular(102;0.244)				AACATCAGGCTCTTTCTCCTT	0.428																																					p.S337P		Atlas-SNP	.											.	PTPRO	148	.	0			c.T1009C						.						100.0	84.0	90.0					12																	15654901		2203	4300	6503	SO:0001583	missense	5800	exon5			TCAGGCTCTTTCT	U20489	CCDS8674.1, CCDS8675.1, CCDS44837.1, CCDS53754.1	12p13-p12	2013-02-11			ENSG00000151490	ENSG00000151490		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9678	protein-coding gene	gene with protein product	"""osteoclastic transmembrane protein-tyrosine phosphatase"""	600579				7519601, 7665166, 21722858	Standard	NM_030667		Approved	PTPU2, GLEPP1, PTP-U2, PTP-oc, NPHS6	uc001rcv.2	Q16827	OTTHUMG00000168786	ENST00000281171.4:c.1009T>C	chr12.hg19:g.15654901T>C	ENSP00000281171:p.Ser337Pro	129.0	0.0		95.0	4.0	NM_002848	A0AV39|Q13101|Q8IYG3|Q9UBF0|Q9UBT5	Missense_Mutation	SNP	ENST00000281171.4	hg19	CCDS8675.1	.	.	.	.	.	.	.	.	.	.	T	0.288	-0.981860	0.02197	.	.	ENSG00000151490	ENST00000281171;ENST00000543886;ENST00000348962	T;T	0.03772	3.81;3.83	4.29	-0.718	0.11205	Fibronectin, type III (1);	0.443298	0.17231	N	0.181942	T	0.01387	0.0045	N	0.01576	-0.805	0.34781	D	0.734711	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.50118	-0.8865	10	0.02654	T	1	.	8.6781	0.34191	0.0:0.5646:0.0:0.4354	.	337;337;337	Q16827-2;Q16827;Q8IYG3	.;PTPRO_HUMAN;.	P	337	ENSP00000281171:S337P;ENSP00000343434:S337P	ENSP00000281171:S337P	S	+	1	0	PTPRO	15546168	0.028000	0.19301	0.007000	0.13788	0.981000	0.71138	0.341000	0.19909	-0.036000	0.13669	0.533000	0.62120	TCT	.	.		0.428	PTPRO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401079.1		
REP15	387849	hgsc.bcm.edu	37	12	27849605	27849605	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:27849605A>G	ENST00000310791.2	+	1	178	c.110A>G	c.(109-111)gAg>gGg	p.E37G	RP11-1060J15.4_ENST00000542660.1_RNA|RP11-1060J15.4_ENST00000536922.1_RNA|RP11-1060J15.4_ENST00000536317.1_RNA	NM_001029874.1	NP_001025045.1	Q6BDI9	REP15_HUMAN	RAB15 effector protein	37					receptor recycling (GO:0001881)|transferrin transport (GO:0033572)	endosome membrane (GO:0010008)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)				breast(1)|cervix(1)|large_intestine(2)|lung(4)|ovary(1)	9	Lung SC(9;0.0873)					AAACTGAAGGAGTACCTTGGA	0.453																																					p.E37G		Atlas-SNP	.											REP15,right_upper_lobe,carcinoma,0,1	REP15	13	.	0			c.A110G						.						97.0	87.0	90.0					12																	27849605		2203	4300	6503	SO:0001583	missense	387849	exon1			TGAAGGAGTACCT	BC140921	CCDS31762.1	12p11.22	2010-09-02			ENSG00000174236	ENSG00000174236			33748	protein-coding gene	gene with protein product		610848				16195351	Standard	NM_001029874		Approved	RAB15EP	uc001rig.1	Q6BDI9		ENST00000310791.2:c.110A>G	chr12.hg19:g.27849605A>G	ENSP00000310335:p.Glu37Gly	82.0	0.0		73.0	3.0	NM_001029874	B2RU16	Missense_Mutation	SNP	ENST00000310791.2	hg19	CCDS31762.1	.	.	.	.	.	.	.	.	.	.	A	14.76	2.632340	0.46944	.	.	ENSG00000174236	ENST00000310791	T	0.39787	1.06	5.11	2.72	0.32119	.	0.249234	0.31210	N	0.008043	T	0.36496	0.0969	L	0.59436	1.845	0.33875	D	0.635396	B	0.17268	0.021	B	0.16289	0.015	T	0.42899	-0.9424	10	0.72032	D	0.01	-0.5657	7.7418	0.28845	0.7869:0.1398:0.0733:0.0	.	37	Q6BDI9	REP15_HUMAN	G	37	ENSP00000310335:E37G	ENSP00000310335:E37G	E	+	2	0	REP15	27740872	1.000000	0.71417	0.955000	0.39395	0.866000	0.49608	3.367000	0.52350	0.407000	0.25591	0.528000	0.53228	GAG	.	.		0.453	REP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402894.1	NM_001029874	
PDZRN4	29951	hgsc.bcm.edu	37	12	41967381	41967381	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:41967381G>T	ENST00000402685.2	+	10	2808	c.2800G>T	c.(2800-2802)Gag>Tag	p.E934*	PDZRN4_ENST00000298919.7_Nonsense_Mutation_p.E674*|PDZRN4_ENST00000539469.2_Nonsense_Mutation_p.E676*	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	934							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E676K(1)		breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				CACCATGAGCGAGATGAAAAT	0.547																																					p.E934X		Atlas-SNP	.											PDZRN4,colon,carcinoma,0,1	PDZRN4	346	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2800T						.						95.0	90.0	92.0					12																	41967381		2203	4300	6503	SO:0001587	stop_gained	29951	exon10			ATGAGCGAGATGA	AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.2800G>T	chr12.hg19:g.41967381G>T	ENSP00000384197:p.Glu934*	82.0	0.0		44.0	2.0	NM_001164595	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Nonsense_Mutation	SNP	ENST00000402685.2	hg19	CCDS53777.1	.	.	.	.	.	.	.	.	.	.	G	41	8.917515	0.99002	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	.	.	.	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-37.6407	19.7189	0.96135	0.0:0.0:1.0:0.0	.	.	.	.	X	934;676;674	.	ENSP00000298919:E674X	E	+	1	0	PDZRN4	40253648	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.834000	0.97654	0.650000	0.86243	GAG	.	.		0.547	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403701.1	NM_013377	
ADCY6	112	hgsc.bcm.edu	37	12	49177177	49177177	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:49177177T>C	ENST00000307885.4	-	1	735	c.41A>G	c.(40-42)gAa>gGa	p.E14G	ADCY6_ENST00000550422.1_Missense_Mutation_p.E14G|ADCY6_ENST00000357869.3_Missense_Mutation_p.E14G	NM_015270.3	NP_056085.1	O43306	ADCY6_HUMAN	adenylate cyclase 6	14					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|dopamine receptor signaling pathway (GO:0007212)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of neuron projection development (GO:0010977)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(16)|prostate(1)|skin(1)|urinary_tract(1)	29						TGTTTTCCGTTCATCCACTTT	0.552																																					p.E14G		Atlas-SNP	.											.	ADCY6	81	.	0			c.A41G						.						77.0	69.0	71.0					12																	49177177		2203	4300	6503	SO:0001583	missense	112	exon2			TTCCGTTCATCCA		CCDS8767.1, CCDS8768.1	12q12-q13	2013-02-04				ENSG00000174233	4.6.1.1	"""Adenylate cyclases"""	237	protein-coding gene	gene with protein product		600294					Standard	NM_015270		Approved	AC6	uc001rsh.4	O43306		ENST00000307885.4:c.41A>G	chr12.hg19:g.49177177T>C	ENSP00000311405:p.Glu14Gly	113.0	0.0		66.0	4.0	NM_020983	Q9NR75|Q9UDB0	Missense_Mutation	SNP	ENST00000307885.4	hg19	CCDS8767.1	.	.	.	.	.	.	.	.	.	.	T	17.93	3.508973	0.64410	.	.	ENSG00000174233	ENST00000357869;ENST00000550422;ENST00000307885	T;T;T	0.80304	-1.36;-1.36;-1.36	5.09	5.09	0.68999	.	0.260319	0.37857	N	0.001920	T	0.80053	0.4553	L	0.48642	1.525	0.47819	D	0.999523	P;P	0.44139	0.827;0.734	P;B	0.46758	0.526;0.326	T	0.82516	-0.0418	10	0.72032	D	0.01	.	13.9768	0.64277	0.0:0.0:0.0:1.0	.	14;14	O43306-2;O43306	.;ADCY6_HUMAN	G	14	ENSP00000350536:E14G;ENSP00000446730:E14G;ENSP00000311405:E14G	ENSP00000311405:E14G	E	-	2	0	ADCY6	47463444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.300000	0.78841	2.142000	0.66516	0.459000	0.35465	GAA	.	.		0.552	ADCY6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408863.1	NM_020983	
TUBA1B	10376	hgsc.bcm.edu	37	12	49522077	49522077	+	Silent	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:49522077G>A	ENST00000336023.5	-	4	1114	c.1020C>T	c.(1018-1020)agC>agT	p.S340S	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	340				S -> T (in Ref. 1; AAA91576). {ECO:0000305}.	'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						CAAACTGGATGCTGCGCTTGG	0.547																																					p.S340S		Atlas-SNP	.											.	TUBA1B	24	.	0			c.C1020T						.						92.0	80.0	84.0					12																	49522077		2203	4300	6503	SO:0001819	synonymous_variant	10376	exon4			CTGGATGCTGCGC	AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.1020C>T	chr12.hg19:g.49522077G>A		282.0	0.0		182.0	32.0	NM_006082	P04687|P05209|Q27I68|Q8WU19	Silent	SNP	ENST00000336023.5	hg19	CCDS31792.1																																																																																			.	.		0.547	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409005.1	NM_006082	
SCN8A	6334	hgsc.bcm.edu	37	12	52056675	52056675	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:52056675T>G	ENST00000354534.6	+	2	252	c.74T>G	c.(73-75)aTt>aGt	p.I25S	SCN8A_ENST00000550891.1_Missense_Mutation_p.I25S|SCN8A_ENST00000545061.1_Missense_Mutation_p.I25S	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	25					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CTGGCAAACATTGAGAGGCGC	0.562																																					p.I25S		Atlas-SNP	.											.	SCN8A	331	.	0			c.T74G						.						110.0	110.0	110.0					12																	52056675		2027	4202	6229	SO:0001583	missense	6334	exon2			CAAACATTGAGAG	AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.74T>G	chr12.hg19:g.52056675T>G	ENSP00000346534:p.Ile25Ser	66.0	0.0		52.0	4.0	NM_014191	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	ENST00000354534.6	hg19	CCDS44891.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.707309	0.89018	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133	D;D;D;D	0.97850	-4.51;-4.57;-4.54;-4.42	4.97	4.97	0.65823	.	.	.	.	.	D	0.97977	0.9334	H	0.95679	3.705	0.58432	D	0.999999	P	0.39391	0.671	B	0.37943	0.261	D	0.99609	1.0980	9	0.87932	D	0	.	15.1227	0.72457	0.0:0.0:0.0:1.0	.	25	Q9UQD0	SCN8A_HUMAN	S	25	ENSP00000448415:I25S;ENSP00000346534:I25S;ENSP00000440360:I25S;ENSP00000347255:I25S	ENSP00000346534:I25S	I	+	2	0	SCN8A	50342942	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.868000	0.87116	2.228000	0.72767	0.533000	0.62120	ATT	.	.		0.562	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404372.3	NM_014191	
EIF4B	1975	hgsc.bcm.edu	37	12	53413702	53413702	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:53413702A>G	ENST00000262056.9	+	4	695	c.369A>G	c.(367-369)gcA>gcG	p.A123A	EIF4B_ENST00000551527.1_3'UTR|EIF4B_ENST00000416762.3_Intron|RP11-983P16.4_ENST00000552905.1_RNA|EIF4B_ENST00000420463.3_Silent_p.A123A|RP11-983P16.4_ENST00000549388.1_RNA	NM_001417.4	NP_001408.2	P23588	IF4B_HUMAN	eukaryotic translation initiation factor 4B	123	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of translational initiation (GO:0006446)|RNA metabolic process (GO:0016070)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 4F complex (GO:0016281)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation initiation factor activity (GO:0003743)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|stomach(1)|upper_aerodigestive_tract(1)	22						AGATCAGTGCAGTGCGTTTAC	0.428																																					p.A123A		Atlas-SNP	.											.	EIF4B	38	.	0			c.A369G						.						120.0	113.0	115.0					12																	53413702		1861	4107	5968	SO:0001819	synonymous_variant	1975	exon4			CAGTGCAGTGCGT	X55733	CCDS41788.1, CCDS73474.1	12q13.13	2013-02-12			ENSG00000063046	ENSG00000063046		"""RNA binding motif (RRM) containing"""	3285	protein-coding gene	gene with protein product		603928					Standard	XM_005268709		Approved		uc001sbh.4	P23588	OTTHUMG00000169570	ENST00000262056.9:c.369A>G	chr12.hg19:g.53413702A>G		156.0	0.0		97.0	4.0	NM_001417	Q4G0E3|Q53HQ2|Q6GPH5|Q6IB46|Q8WYK5	Silent	SNP	ENST00000262056.9	hg19	CCDS41788.1																																																																																			.	.		0.428	EIF4B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000404852.2	NM_001417	
CD63	967	hgsc.bcm.edu	37	12	56120684	56120684	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:56120684A>G	ENST00000549117.1	-	4	756	c.320T>C	c.(319-321)tTt>tCt	p.F107S	CD63_ENST00000420846.3_Missense_Mutation_p.F107S|CD63_ENST00000257857.4_Missense_Mutation_p.F107S|RP11-644F5.11_ENST00000552576.1_RNA|CD63_ENST00000546939.1_Missense_Mutation_p.F25S|CD63_ENST00000550776.1_Missense_Mutation_p.F25S|CD63_ENST00000548898.1_Missense_Mutation_p.F14S|CD63_ENST00000552067.1_Missense_Mutation_p.F14S|CD63_ENST00000552692.1_Missense_Mutation_p.F107S|CD63_ENST00000548160.1_Missense_Mutation_p.F14S|CD63_ENST00000552754.1_Missense_Mutation_p.F84S	NM_001257389.1	NP_001244318.1	P08962	CD63_HUMAN	CD63 molecule	107					blood coagulation (GO:0007596)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular protein localization (GO:0034613)|endosome to melanosome transport (GO:0035646)|pigment granule maturation (GO:0048757)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|positive regulation of receptor internalization (GO:0002092)|protein transport (GO:0015031)|regulation of rubidium ion transport (GO:2000680)|regulation of vascular endothelial growth factor signaling pathway (GO:1900746)	cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|multivesicular body, internal vesicle (GO:0097487)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)				kidney(1)|large_intestine(3)|lung(2)|ovary(1)	7						CTTATCTCTAAACACATAGCC	0.522																																					p.F107S	Pancreas(123;1459 1747 6717 18841 37380)	Atlas-SNP	.											.	CD63	13	.	0			c.T320C						.						154.0	167.0	162.0					12																	56120684		2203	4300	6503	SO:0001583	missense	967	exon4			TCTCTAAACACAT	M58485	CCDS8890.1, CCDS58242.1, CCDS58243.1	12q12-q13	2013-02-14	2006-03-28					"""CD molecules"", ""Tetraspanins"""	1692	protein-coding gene	gene with protein product		155740	"""CD63 antigen (melanoma 1 antigen)"""	MLA1			Standard	NM_001780		Approved	ME491, TSPAN30	uc031qhv.1	P08962		ENST00000549117.1:c.320T>C	chr12.hg19:g.56120684A>G	ENSP00000447730:p.Phe107Ser	127.0	0.0		91.0	4.0	NM_001257390	F8VZE2|Q5TZP3|Q8N6Z9|Q9UCG6	Missense_Mutation	SNP	ENST00000549117.1	hg19	CCDS8890.1	.	.	.	.	.	.	.	.	.	.	A	19.72	3.880324	0.72294	.	.	ENSG00000135404	ENST00000548898;ENST00000552067;ENST00000420846;ENST00000548160;ENST00000546939;ENST00000552692;ENST00000549117;ENST00000257857;ENST00000552754;ENST00000550776;ENST00000552164;ENST00000551173;ENST00000546457	T;T;T;T;T;T;T;T;T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29;-1.29	5.2	5.2	0.72013	Tetraspanin, EC2 domain (1);	0.173065	0.50627	D	0.000108	D	0.86146	0.5863	M	0.71920	2.185	0.53688	D	0.999973	D;P;P	0.64830	0.994;0.736;0.578	D;P;P	0.63033	0.91;0.718;0.648	D	0.87047	0.2144	10	0.72032	D	0.01	.	8.7558	0.34645	0.8313:0.0:0.0:0.1687	.	84;107;107	Q8N6Z9;C9JV86;P08962	.;.;CD63_HUMAN	S	14;14;107;14;25;107;107;107;84;25;107;107;107	ENSP00000447938:F14S;ENSP00000449684:F14S;ENSP00000393502:F107S;ENSP00000449654:F14S;ENSP00000447356:F25S;ENSP00000449337:F107S;ENSP00000447730:F107S;ENSP00000257857:F107S;ENSP00000446807:F84S;ENSP00000448091:F25S;ENSP00000449281:F107S;ENSP00000446752:F107S;ENSP00000450191:F107S	ENSP00000257857:F107S	F	-	2	0	CD63	54406951	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	3.617000	0.54181	2.113000	0.64589	0.482000	0.46254	TTT	.	.		0.522	CD63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409234.1		
DGKA	1606	hgsc.bcm.edu	37	12	56345833	56345833	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:56345833T>C	ENST00000331886.5	+	19	2056	c.1602T>C	c.(1600-1602)gcT>gcC	p.A534A	DGKA_ENST00000549079.2_3'UTR|DGKA_ENST00000394147.1_Silent_p.A534A|DGKA_ENST00000551156.1_Silent_p.A534A	NM_001345.4	NP_001336.2	P23743	DGKA_HUMAN	diacylglycerol kinase, alpha 80kDa	534					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)|phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|large_intestine(1)|lung(11)|ovary(4)|pancreas(1)|skin(3)|urinary_tract(1)	25					Vitamin E(DB00163)	CCTCTATTGCTCATCGATTCC	0.547																																					p.A534A		Atlas-SNP	.											.	DGKA	70	.	0			c.T1602C						.						106.0	96.0	100.0					12																	56345833		2203	4300	6503	SO:0001819	synonymous_variant	1606	exon19			TATTGCTCATCGA	AF064767	CCDS8896.1	12q13.3	2013-01-10	2002-08-29			ENSG00000065357	2.7.1.107	"""EF-hand domain containing"""	2849	protein-coding gene	gene with protein product		125855	"""diacylglycerol kinase, alpha (80kD)"""	DAGK, DAGK1		8180475, 7959783	Standard	NM_001345		Approved	DGK-alpha	uc001sim.3	P23743		ENST00000331886.5:c.1602T>C	chr12.hg19:g.56345833T>C		121.0	0.0		73.0	5.0	NM_201554	O75481|O75482|O75483|O95217|Q3ZE25|Q8IZ56|Q8N5Q2	Silent	SNP	ENST00000331886.5	hg19	CCDS8896.1																																																																																			.	.		0.547	DGKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407291.1		
PMEL	6490	hgsc.bcm.edu	37	12	56355450	56355450	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:56355450A>G	ENST00000548747.1	-	2	805	c.143T>C	c.(142-144)cTg>cCg	p.L48P	PMEL_ENST00000550464.1_Intron|PMEL_ENST00000550447.1_Intron|PMEL_ENST00000552882.1_Missense_Mutation_p.L48P|PMEL_ENST00000548689.1_5'UTR|PMEL_ENST00000536427.1_Missense_Mutation_p.L48P|PMEL_ENST00000539511.1_Intron|PMEL_ENST00000360714.4_Missense_Mutation_p.L48P|PMEL_ENST00000449260.2_Missense_Mutation_p.L48P|PMEL_ENST00000548493.1_Missense_Mutation_p.L48P			P40967	PMEL_HUMAN	premelanosome protein	48					melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						CTCTGGATACAGCTGCCTGTT	0.532																																					p.L48P		Atlas-SNP	.											.	PMEL	60	.	0			c.T143C						.						121.0	120.0	120.0					12																	56355450		2203	4300	6503	SO:0001583	missense	6490	exon2			GGATACAGCTGCC	AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.143T>C	chr12.hg19:g.56355450A>G	ENSP00000448828:p.Leu48Pro	125.0	0.0		88.0	4.0	NM_001200054	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	ENST00000548747.1	hg19	CCDS8897.1	.	.	.	.	.	.	.	.	.	.	a	17.96	3.515174	0.64634	.	.	ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000548803;ENST00000547137;ENST00000546543;ENST00000549418;ENST00000549233	T;T;T;T;T;T;T;T;T	0.51574	2.39;2.38;2.38;2.38;2.4;2.09;0.7;1.59;2.2	4.74	4.74	0.60224	.	0.000000	0.41097	D	0.000956	T	0.67590	0.2909	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.71590	-0.4547	10	0.66056	D	0.02	-7.2432	12.158	0.54087	1.0:0.0:0.0:0.0	.	48;48	P40967-2;P40967	.;PMEL_HUMAN	P	48;48;48;48;48;48;48;48;48;48;51	ENSP00000402758:L48P;ENSP00000449690:L48P;ENSP00000448828:L48P;ENSP00000447374:L48P;ENSP00000353940:L48P;ENSP00000438695:L48P;ENSP00000447732:L48P;ENSP00000448849:L48P;ENSP00000446662:L48P	ENSP00000353940:L48P	L	-	2	0	PMEL	54641717	0.997000	0.39634	0.969000	0.41365	0.752000	0.42762	4.955000	0.63638	2.124000	0.65301	0.523000	0.50628	CTG	.	.		0.532	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409626.1	NM_006928	
GLI1	2735	hgsc.bcm.edu	37	12	57865654	57865654	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:57865654A>G	ENST00000228682.2	+	12	3222	c.3131A>G	c.(3130-3132)aAc>aGc	p.N1044S	GLI1_ENST00000543426.1_Missense_Mutation_p.N916S|GLI1_ENST00000546141.1_Missense_Mutation_p.N1003S	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	1044	Asp/Glu-rich (acidic).				cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			GATCTTGACAACACTCAGCTG	0.592																																					p.N1044S	Pancreas(157;841 1936 10503 41495 50368)	Atlas-SNP	.											.	GLI1	141	.	0			c.A3131G						.						159.0	151.0	154.0					12																	57865654		2203	4300	6503	SO:0001583	missense	2735	exon12			TTGACAACACTCA		CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.3131A>G	chr12.hg19:g.57865654A>G	ENSP00000228682:p.Asn1044Ser	120.0	0.0		77.0	4.0	NM_005269	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	ENST00000228682.2	hg19	CCDS8940.1	.	.	.	.	.	.	.	.	.	.	A	13.82	2.350417	0.41599	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.26067	1.82;1.76;1.85;1.85	5.04	5.04	0.67666	.	0.000000	0.50627	D	0.000110	T	0.43255	0.1239	L	0.50333	1.59	0.49213	D	0.999764	D	0.76494	0.999	D	0.78314	0.991	T	0.12167	-1.0558	10	0.30078	T	0.28	.	14.2029	0.65716	1.0:0.0:0.0:0.0	.	1044	P08151	GLI1_HUMAN	S	916;1044;1003;1003;512	ENSP00000437607:N916S;ENSP00000228682:N1044S;ENSP00000441006:N1003S;ENSP00000434408:N1003S	ENSP00000228682:N1044S	N	+	2	0	GLI1	56151921	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.195000	0.51013	2.254000	0.74563	0.533000	0.62120	AAC	.	.		0.592	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394197.1	NM_005269	
PTPRB	5787	hgsc.bcm.edu	37	12	71016408	71016408	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:71016408A>G	ENST00000550358.1	-	3	495	c.470T>C	c.(469-471)gTt>gCt	p.V157A	PTPRB_ENST00000551525.1_Missense_Mutation_p.V156A|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000334414.6_Missense_Mutation_p.V157A			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CCTCACCGAAACTTCTGCTCC	0.403																																					p.V157A		Atlas-SNP	.											.	PTPRB	676	.	0			c.T470C						.						29.0	31.0	31.0					12																	71016408		1838	4090	5928	SO:0001583	missense	5787	exon3			ACCGAAACTTCTG	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.470T>C	chr12.hg19:g.71016408A>G	ENSP00000448058:p.Val157Ala	124.0	0.0		85.0	4.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	ENST00000550358.1	hg19		.	.	.	.	.	.	.	.	.	.	A	7.880	0.730041	0.15507	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525	T;T;T	0.04862	4.07;4.04;3.54	5.42	3.02	0.34903	.	.	.	.	.	T	0.03348	0.0097	N	0.14661	0.345	0.80722	D	1	B;B;B;B	0.15141	0.012;0.001;0.003;0.003	B;B;B;B	0.11329	0.006;0.006;0.003;0.003	T	0.42103	-0.9471	9	0.13108	T	0.6	.	6.7107	0.23276	0.7283:0.0:0.2717:0.0	.	157;156;157;157	Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.	A	157;157;157;156	ENSP00000334928:V157A;ENSP00000448058:V157A;ENSP00000448349:V156A	ENSP00000334928:V157A	V	-	2	0	PTPRB	69302675	0.876000	0.30132	0.929000	0.37066	0.438000	0.31896	1.130000	0.31393	0.981000	0.38548	0.533000	0.62120	GTT	.	.		0.403	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000404436.1		
PWP1	11137	hgsc.bcm.edu	37	12	108105903	108105903	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:108105903G>A	ENST00000412830.3	+	15	1580	c.1412G>A	c.(1411-1413)gGa>gAa	p.G471E	PWP1_ENST00000541166.1_Missense_Mutation_p.G409E	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	471					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						GAAGCATTTGGAAGACGAGAG	0.373																																					p.G471E		Atlas-SNP	.											.	PWP1	43	.	0			c.G1412A						.						122.0	122.0	122.0					12																	108105903		2203	4300	6503	SO:0001583	missense	11137	exon15			CATTTGGAAGACG	BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.1412G>A	chr12.hg19:g.108105903G>A	ENSP00000387365:p.Gly471Glu	130.0	0.0		94.0	4.0	NM_007062	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	ENST00000412830.3	hg19	CCDS9114.1	.	.	.	.	.	.	.	.	.	.	G	17.26	3.344645	0.61073	.	.	ENSG00000136045	ENST00000412830;ENST00000541166	T;T	0.70516	-0.49;1.89	5.86	5.86	0.93980	.	0.091121	0.85682	D	0.000000	T	0.70046	0.3179	M	0.62154	1.92	0.80722	D	1	P	0.49961	0.93	B	0.40982	0.345	T	0.68796	-0.5314	10	0.29301	T	0.29	.	20.1581	0.98126	0.0:0.0:1.0:0.0	.	471	Q13610	PWP1_HUMAN	E	471;409	ENSP00000387365:G471E;ENSP00000445249:G409E	ENSP00000387365:G471E	G	+	2	0	PWP1	106630033	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.987000	0.70571	2.937000	0.99478	0.650000	0.86243	GGA	.	.		0.373	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406539.1	NM_007062	
USP30	84749	hgsc.bcm.edu	37	12	109522828	109522828	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:109522828A>G	ENST00000257548.5	+	12	1332	c.1239A>G	c.(1237-1239)ccA>ccG	p.P413P	USP30_ENST00000392784.2_Silent_p.P382P	NM_032663.3	NP_116052.2	Q70CQ3	UBP30_HUMAN	ubiquitin specific peptidase 30	413	USP.				mitochondrial fusion (GO:0008053)|mitochondrion degradation (GO:0000422)|protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(7)|kidney(1)|large_intestine(1)|liver(2)|lung(11)|prostate(1)|skin(3)|stomach(2)	28						CTTTATTGCCAACGCTGTCAG	0.527																																					p.P413P		Atlas-SNP	.											.	USP30	48	.	0			c.A1239G						.						184.0	201.0	195.0					12																	109522828		2203	4300	6503	SO:0001819	synonymous_variant	84749	exon12			ATTGCCAACGCTG	BC022094	CCDS9123.2	12q23.3	2006-01-20	2005-08-08		ENSG00000135093	ENSG00000135093		"""Ubiquitin-specific peptidases"""	20065	protein-coding gene	gene with protein product		612492	"""ubiquitin specific protease 30"""			12838346	Standard	XM_005253962		Approved	MGC10702, FLJ40511	uc010sxi.2	Q70CQ3	OTTHUMG00000133613	ENST00000257548.5:c.1239A>G	chr12.hg19:g.109522828A>G		67.0	0.0		49.0	5.0	NM_032663	Q8WTU7|Q96JX4|Q9BSS3	Silent	SNP	ENST00000257548.5	hg19	CCDS9123.2																																																																																			.	.		0.527	USP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257733.2	NM_032663	
ATP2A2	488	hgsc.bcm.edu	37	12	110784133	110784133	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:110784133A>G	ENST00000539276.2	+	20	3096	c.2987A>G	c.(2986-2988)gAg>gGg	p.E996G	ATP2A2_ENST00000395494.2_Missense_Mutation_p.E969G|ATP2A2_ENST00000308664.6_Intron			P16615	AT2A2_HUMAN	ATPase, Ca++ transporting, cardiac muscle, slow twitch 2	996					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|epidermis development (GO:0008544)|ER-nucleus signaling pathway (GO:0006984)|ion transmembrane transport (GO:0034220)|negative regulation of heart contraction (GO:0045822)|positive regulation of heart rate (GO:0010460)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of the force of heart contraction (GO:0002026)|relaxation of cardiac muscle (GO:0055119)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calcium-transporting ATPase activity involved in regulation of cardiac muscle cell membrane potential (GO:0086039)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|S100 protein binding (GO:0044548)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	38						CCTGGTAAAGAGTGTGTGCAG	0.552																																					p.E996G		Atlas-SNP	.											.	ATP2A2	78	.	0			c.A2987G						.						91.0	73.0	79.0					12																	110784133		2203	4300	6503	SO:0001583	missense	488	exon20			GTAAAGAGTGTGT		CCDS9143.1, CCDS9144.1	12q24.11	2012-10-22			ENSG00000174437	ENSG00000174437	3.6.3.8	"""ATPases / P-type"""	812	protein-coding gene	gene with protein product	"""sarcoplasmic/endoplasmic reticulum calcium ATPase 2"", ""calcium pump 2"""	108740		ATP2B, DAR		10080178	Standard	NM_170665		Approved	SERCA2	uc001tqk.4	P16615	OTTHUMG00000169327	ENST00000539276.2:c.2987A>G	chr12.hg19:g.110784133A>G	ENSP00000440045:p.Glu996Gly	153.0	0.0		80.0	4.0	NM_170665	A6NDN7|B4DF05|P16614|Q86VJ2	Missense_Mutation	SNP	ENST00000539276.2	hg19	CCDS9144.1	.	.	.	.	.	.	.	.	.	.	A	16.34	3.095280	0.56075	.	.	ENSG00000174437	ENST00000395494;ENST00000539276	D;D	0.95001	-3.58;-3.55	6.17	6.17	0.99709	.	0.556756	0.19304	N	0.117568	D	0.88426	0.6433	N	0.11756	0.17	0.53688	D	0.999979	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	D	0.83846	0.0260	9	.	.	.	.	16.8222	0.85835	1.0:0.0:0.0:0.0	.	969;996	P16615-4;P16615	.;AT2A2_HUMAN	G	969;996	ENSP00000378872:E969G;ENSP00000440045:E996G	.	E	+	2	0	ATP2A2	109268516	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.495000	0.81514	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.552	ATP2A2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403539.1	NM_001681	
MED13L	23389	hgsc.bcm.edu	37	12	116413459	116413459	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:116413459C>T	ENST00000281928.3	-	24	5655	c.5449G>A	c.(5449-5451)Ggt>Agt	p.G1817S		NM_015335.4	NP_056150.1	Q71F56	MD13L_HUMAN	mediator complex subunit 13-like	1817						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(2)|breast(1)|endometrium(9)|kidney(3)|large_intestine(18)|lung(34)|ovary(4)|prostate(4)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	85	all_neural(191;0.117)|Medulloblastoma(191;0.163)			BRCA - Breast invasive adenocarcinoma(302;0.0407)		CTCGCCTCACCAAACGTCTCT	0.522																																					p.G1817S		Atlas-SNP	.											.	MED13L	193	.	0			c.G5449A						.						105.0	105.0	105.0					12																	116413459		2203	4300	6503	SO:0001583	missense	23389	exon24			CCTCACCAAACGT	AB028948	CCDS9177.1	12q24.22	2010-07-29	2007-07-30	2007-07-30	ENSG00000123066	ENSG00000123066			22962	protein-coding gene	gene with protein product		608771	"""thyroid hormone receptor associated protein 2"""	THRAP2			Standard	NM_015335		Approved	KIAA1025, TRAP240L	uc001tvw.3	Q71F56	OTTHUMG00000169404	ENST00000281928.3:c.5449G>A	chr12.hg19:g.116413459C>T	ENSP00000281928:p.Gly1817Ser	138.0	0.0		75.0	4.0	NM_015335	A1L469|Q68DN4|Q9H8C0|Q9NSY9|Q9UFD8|Q9UPX5	Missense_Mutation	SNP	ENST00000281928.3	hg19	CCDS9177.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.586455|5.586455	0.96578|0.96578	.|.	.|.	ENSG00000123066|ENSG00000123066	ENST00000281928|ENST00000552447	D|.	0.82081|.	-1.57|.	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	0.049130|.	0.85682|.	D|.	0.000000|.	T|.	0.76227|.	0.3958|.	M|M	0.69358|0.69358	2.11|2.11	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	P|.	0.61070|.	0.883|.	T|.	0.72915|.	-0.4147|.	10|.	0.52906|.	T|.	0.07|.	-16.747|-16.747	20.3473|20.3473	0.98799|0.98799	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1817|.	Q71F56|.	MD13L_HUMAN|.	S|X	1817|9	ENSP00000281928:G1817S|.	ENSP00000281928:G1817S|.	G|W	-|-	1|2	0|0	MED13L|MED13L	114897842|114897842	1.000000|1.000000	0.71417|0.71417	0.907000|0.907000	0.35723|0.35723	0.998000|0.998000	0.95712|0.95712	4.527000|4.527000	0.60573|0.60573	2.884000|2.884000	0.98904|0.98904	0.655000|0.655000	0.94253|0.94253	GGT|TGG	.	.		0.522	MED13L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403879.3		
TMEM132D	121256	hgsc.bcm.edu	37	12	130184598	130184598	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:130184598T>C	ENST00000422113.2	-	2	1051	c.725A>G	c.(724-726)gAa>gGa	p.E242G	RP11-174M13.2_ENST00000544036.1_lincRNA	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	242					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		CCTCGCGTCTTCCCTGACGCA	0.632																																					p.E242G		Atlas-SNP	.											.	TMEM132D	299	.	0			c.A725G						.						90.0	80.0	83.0					12																	130184598		2203	4300	6503	SO:0001583	missense	121256	exon2			GCGTCTTCCCTGA	AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.725A>G	chr12.hg19:g.130184598T>C	ENSP00000408581:p.Glu242Gly	124.0	0.0		93.0	4.0	NM_133448	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	ENST00000422113.2	hg19	CCDS9266.1	.	.	.	.	.	.	.	.	.	.	T	10.22	1.290766	0.23564	.	.	ENSG00000151952	ENST00000422113	T	0.12039	2.72	5.29	-3.75	0.04372	.	1.097200	0.07090	N	0.838620	T	0.08088	0.0202	N	0.25380	0.74	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.41288	-0.9517	9	.	.	.	-1.9471	5.654	0.17633	0.0:0.3141:0.2502:0.4357	.	242	Q14C87	T132D_HUMAN	G	242	ENSP00000408581:E242G	.	E	-	2	0	TMEM132D	128750551	0.854000	0.29725	0.000000	0.03702	0.000000	0.00434	2.051000	0.41307	-1.033000	0.03299	-1.133000	0.01973	GAA	.	.		0.632	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399592.1	NM_133448	
ULK1	8408	hgsc.bcm.edu	37	12	132404542	132404542	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:132404542A>G	ENST00000321867.4	+	26	3173	c.2822A>G	c.(2821-2823)gAg>gGg	p.E941G	ULK1_ENST00000540647.1_Missense_Mutation_p.E186G	NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	941					autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		AGGCTGAATGAGCTGTACAAG	0.647																																					p.E941G		Atlas-SNP	.											.	ULK1	92	.	0			c.A2822G						.						56.0	59.0	58.0					12																	132404542		2203	4299	6502	SO:0001583	missense	8408	exon26			TGAATGAGCTGTA	AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.2822A>G	chr12.hg19:g.132404542A>G	ENSP00000324560:p.Glu941Gly	127.0	0.0		91.0	4.0	NM_003565	Q9UQ28	Missense_Mutation	SNP	ENST00000321867.4	hg19	CCDS9274.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	21.7|21.7	4.182495|4.182495	0.78677|0.78677	.|.	.|.	ENSG00000177169|ENSG00000177169	ENST00000321867;ENST00000540647|ENST00000542419	T;T|.	0.49139|.	0.79;0.79|.	5.13|5.13	3.99|3.99	0.46301|0.46301	Serine/threonine-protein kinase, C-terminal (1);|.	0.062539|.	0.64402|.	D|.	0.000008|.	T|T	0.59729|0.59729	0.2215|0.2215	M|M	0.79475|0.79475	2.455|2.455	0.23546|0.23546	N|N	0.997446|0.997446	P|.	0.46277|.	0.875|.	P|.	0.50378|.	0.639|.	T|T	0.52155|0.52155	-0.8613|-0.8613	10|5	0.72032|.	D|.	0.01|.	-23.676|-23.676	11.8019|11.8019	0.52133|0.52133	0.8396:0.1604:0.0:0.0|0.8396:0.1604:0.0:0.0	.|.	941|.	O75385|.	ULK1_HUMAN|.	G|G	941;186|2	ENSP00000324560:E941G;ENSP00000441794:E186G|.	ENSP00000324560:E941G|.	E|S	+|+	2|1	0|0	ULK1|ULK1	130970495|130970495	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.704000|0.704000	0.40688|0.40688	5.890000|5.890000	0.69774|0.69774	0.788000|0.788000	0.33755|0.33755	0.459000|0.459000	0.35465|0.35465	GAG|AGC	.	.		0.647	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397769.3		
B3GALTL	145173	hgsc.bcm.edu	37	13	31850851	31850851	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:31850851A>G	ENST00000343307.4	+	10	942	c.793A>G	c.(793-795)Aag>Gag	p.K265E	B3GALTL_ENST00000461652.2_3'UTR	NM_194318.3	NP_919299.3	Q6Y288	B3GLT_HUMAN	beta 1,3-galactosyltransferase-like	265					fucose metabolic process (GO:0006004)|protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Lung SC(185;0.0257)		all cancers(112;0.00436)|Epithelial(112;0.0285)|OV - Ovarian serous cystadenocarcinoma(117;0.0512)|GBM - Glioblastoma multiforme(144;0.184)		AAAGCCAGTGAAGAAGAAGGA	0.343																																					p.K265E		Atlas-SNP	.											.	B3GALTL	48	.	0			c.A793G						.						120.0	130.0	127.0					13																	31850851		2203	4300	6503	SO:0001583	missense	145173	exon10			CCAGTGAAGAAGA	AB101481	CCDS9341.1	13q12.3	2014-03-24			ENSG00000187676	ENSG00000187676		"""Beta 3-glycosyltransferases"""	20207	protein-coding gene	gene with protein product		610308				12943678, 16899492, 17032646	Standard	NM_194318		Approved	B3GTL, B3Glc-T	uc010aaz.3	Q6Y288	OTTHUMG00000016688	ENST00000343307.4:c.793A>G	chr13.hg19:g.31850851A>G	ENSP00000343002:p.Lys265Glu	91.0	0.0		62.0	4.0	NM_194318	A8K5F8|Q5W0H2|Q6NUI3	Missense_Mutation	SNP	ENST00000343307.4	hg19	CCDS9341.1	.	.	.	.	.	.	.	.	.	.	A	8.939	0.965388	0.18583	.	.	ENSG00000187676	ENST00000343307	T	0.61274	0.12	5.93	4.77	0.60923	.	0.310682	0.38272	N	0.001742	T	0.33818	0.0876	N	0.12746	0.255	0.47308	D	0.999386	B	0.14012	0.009	B	0.14023	0.01	T	0.18713	-1.0328	10	0.21540	T	0.41	-26.5674	6.7295	0.23375	0.7671:0.155:0.0779:0.0	.	265	Q6Y288	B3GLT_HUMAN	E	265	ENSP00000343002:K265E	ENSP00000343002:K265E	K	+	1	0	B3GALTL	30748851	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	3.232000	0.51302	2.268000	0.75426	0.455000	0.32223	AAG	.	.		0.343	B3GALTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044396.3	NM_194318	
N4BP2L2	10443	hgsc.bcm.edu	37	13	33111159	33111159	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:33111159A>G	ENST00000267068.3	-	2	170	c.6T>C	c.(4-6)tcT>tcC	p.S2S	N4BP2L2_ENST00000399396.3_Silent_p.S2S|N4BP2L2_ENST00000504114.1_Intron|N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000446957.2_Silent_p.S2S	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	2					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TTTCACCATAAGACATCTGAG	0.289																																					p.S2S		Atlas-SNP	.											.	N4BP2L2	90	.	0			c.T6C						.						57.0	53.0	54.0					13																	33111159		2203	4300	6503	SO:0001819	synonymous_variant	10443	exon2			ACCATAAGACATC	U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.6T>C	chr13.hg19:g.33111159A>G		78.0	0.0		50.0	4.0	NM_033111	A3KME8	Silent	SNP	ENST00000267068.3	hg19	CCDS9346.1																																																																																			.	.		0.289	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044421.1	NM_014887	
ALG5	29880	hgsc.bcm.edu	37	13	37524168	37524168	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:37524168A>G	ENST00000239891.3	-	10	952	c.886T>C	c.(886-888)Tgg>Cgg	p.W296R	ALG5_ENST00000443765.1_Missense_Mutation_p.W266R|ALG5_ENST00000413537.2_3'UTR	NM_013338.4	NP_037470.1	Q9Y673	ALG5_HUMAN	ALG5, dolichyl-phosphate beta-glucosyltransferase	296					cellular protein metabolic process (GO:0044267)|determination of left/right symmetry (GO:0007368)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	dolichyl-phosphate beta-glucosyltransferase activity (GO:0004581)|oligosaccharyl transferase activity (GO:0004576)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	11		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)		all cancers(112;5.79e-07)|Epithelial(112;1.81e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00785)|BRCA - Breast invasive adenocarcinoma(63;0.0127)|GBM - Glioblastoma multiforme(144;0.0472)		ATTTGTAGCCAGCTCCAGAAT	0.348																																					p.W296R		Atlas-SNP	.											.	ALG5	28	.	0			c.T886C						.						65.0	64.0	65.0					13																	37524168		2203	4300	6503	SO:0001583	missense	29880	exon10			GTAGCCAGCTCCA	AF088028	CCDS9361.1, CCDS45033.1	13q13.1	2013-02-22	2013-02-21		ENSG00000120697	ENSG00000120697	2.4.1.117	"""Glycosyltransferase family 2 domain containing"""	20266	protein-coding gene	gene with protein product		604565	"""asparagine-linked glycosylation 5 homolog (yeast, dolichyl-phosphate beta-glucosyltransferase)"", ""asparagine-linked glycosylation 5, dolichyl-phosphate beta-glucosyltransferase homolog (S. cerevisiae)"""			10359825	Standard	NM_013338		Approved	bA421P11.2	uc001uvy.3	Q9Y673	OTTHUMG00000016741	ENST00000239891.3:c.886T>C	chr13.hg19:g.37524168A>G	ENSP00000239891:p.Trp296Arg	52.0	0.0		56.0	4.0	NM_013338	B4DR37|Q5TBA6	Missense_Mutation	SNP	ENST00000239891.3	hg19	CCDS9361.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.471282	0.84533	.	.	ENSG00000120697	ENST00000443765;ENST00000239891	T;T	0.54675	0.56;0.56	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	T	0.74306	0.3699	M	0.86953	2.85	0.80722	D	1	D;D	0.65815	0.995;0.992	D;P	0.66847	0.947;0.887	T	0.74411	-0.3674	10	0.25751	T	0.34	.	16.2429	0.82424	1.0:0.0:0.0:0.0	.	266;296	Q9Y673-2;Q9Y673	.;ALG5_HUMAN	R	266;296	ENSP00000390533:W266R;ENSP00000239891:W296R	ENSP00000239891:W296R	W	-	1	0	ALG5	36422168	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.681000	0.91228	2.238000	0.73509	0.533000	0.62120	TGG	.	.		0.348	ALG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044528.2	NM_013338	
SUGT1	10910	hgsc.bcm.edu	37	13	53237230	53237230	+	Splice_Site	SNP	G	G	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:53237230G>C	ENST00000343788.6	+	8	560		c.e8-1		SUGT1_ENST00000483074.1_Splice_Site|SUGT1_ENST00000310528.8_Splice_Site|SUGT1_ENST00000535397.1_Splice_Site	NM_001130912.1	NP_001124384.1	Q9Y2Z0	SUGT1_HUMAN	SGT1, suppressor of G2 allele of SKP1 (S. cerevisiae)						innate immune response (GO:0045087)|mitotic nuclear division (GO:0007067)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				kidney(3)|large_intestine(3)|lung(2)	8		Lung NSC(96;0.00212)|Breast(56;0.00235)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.25e-08)		TGTTTTAATAGGCTCAGAATC	0.303																																					.		Atlas-SNP	.											.	SUGT1	37	.	0			c.479-1G>C						.						114.0	110.0	112.0					13																	53237230		2202	4297	6499	SO:0001630	splice_region_variant	10910	exon8			TTAATAGGCTCAG	AF068289	CCDS9436.1, CCDS45050.1	13q14.3	2014-03-20			ENSG00000165416	ENSG00000165416			16987	protein-coding gene	gene with protein product		604098				10445024	Standard	NM_006704		Approved	SGT1	uc001vhc.2	Q9Y2Z0	OTTHUMG00000016977	ENST00000343788.6:c.479-1G>C	chr13.hg19:g.53237230G>C		278.0	0.0		187.0	16.0	NM_001130912	A2A303|Q5JAK5|Q5TAM6|Q6VXY6	Splice_Site	SNP	ENST00000343788.6	hg19	CCDS45050.1	.	.	.	.	.	.	.	.	.	.	G	16.92	3.254771	0.59212	.	.	ENSG00000165416	ENST00000343788;ENST00000535397;ENST00000310528	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9866	0.64339	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUGT1	52135231	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	4.262000	0.58847	2.438000	0.82558	0.555000	0.69702	.	.	.		0.303	SUGT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000045104.2		Intron
TDRD3	81550	hgsc.bcm.edu	37	13	61102826	61102826	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:61102826T>C	ENST00000196169.3	+	11	1976	c.1188T>C	c.(1186-1188)tcT>tcC	p.S396S	TDRD3_ENST00000535286.1_Silent_p.S489S|TDRD3_ENST00000377881.2_Silent_p.S396S|TDRD3_ENST00000377894.2_Silent_p.S396S	NM_001146071.1|NM_030794.2	NP_001139543.1|NP_110421.1	Q9H7E2	TDRD3_HUMAN	tudor domain containing 3	396					chromatin modification (GO:0016568)|regulation of RNA biosynthetic process (GO:2001141)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(16)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	40		Prostate(109;0.173)|Breast(118;0.174)		GBM - Glioblastoma multiforme(99;0.000291)		CTTTAGGTTCTCAGCATAGTG	0.383																																					p.S489S	Colon(36;164 906 35820 50723)	Atlas-SNP	.											.	TDRD3	123	.	0			c.T1467C						.						77.0	83.0	81.0					13																	61102826		2203	4300	6503	SO:0001819	synonymous_variant	81550	exon11			AGGTTCTCAGCAT	AK023578	CCDS9441.1, CCDS53872.1	13q14.3	2013-01-23			ENSG00000083544	ENSG00000083544		"""Tudor domain containing"""	20612	protein-coding gene	gene with protein product		614392					Standard	NM_030794		Approved	FLJ21007	uc010aeg.3	Q9H7E2	OTTHUMG00000017007	ENST00000196169.3:c.1188T>C	chr13.hg19:g.61102826T>C		115.0	0.0		85.0	4.0	NM_001146070	B2MWP9|Q53XA6|Q6P992	Silent	SNP	ENST00000196169.3	hg19	CCDS9441.1																																																																																			.	.		0.383	TDRD3-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045175.2	NM_030794	
IPO5	3843	hgsc.bcm.edu	37	13	98637853	98637853	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:98637853C>T	ENST00000490680.1	+	3	415	c.350C>T	c.(349-351)gCc>gTc	p.A117V	IPO5_ENST00000539640.1_Intron|IPO5_ENST00000261574.5_Missense_Mutation_p.A135V			O00410	IPO5_HUMAN	importin 5	117					cellular response to amino acid stimulus (GO:0071230)|negative regulation of catalytic activity (GO:0043086)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein import into nucleus (GO:0042307)|ribosomal protein import into nucleus (GO:0006610)|viral process (GO:0016032)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)			breast(2)|endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	27						GCAGAACTGGCCAGGAATTTA	0.373																																					p.A135V		Atlas-SNP	.											.	IPO5	90	.	0			c.C404T						.						93.0	90.0	91.0					13																	98637853		2203	4300	6503	SO:0001583	missense	3843	exon6			AACTGGCCAGGAA	U72761	CCDS31999.1	13q32.2	2012-05-02	2008-04-15	2008-04-15	ENSG00000065150	ENSG00000065150		"""Importins"""	6402	protein-coding gene	gene with protein product		602008	"""karyopherin (importin) beta 3"", ""RAN binding protein 5"""	KPNB3, RANBP5		9114010, 9271386, 17005651	Standard	NM_002271		Approved	IMB3, MGC2068, Pse1	uc001vne.3	O00410	OTTHUMG00000017244	ENST00000490680.1:c.350C>T	chr13.hg19:g.98637853C>T	ENSP00000418393:p.Ala117Val	156.0	0.0		124.0	5.0	NM_002271	B4DZA0|O15257|Q5T578|Q86XC7	Missense_Mutation	SNP	ENST00000490680.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.5|23.5	4.428780|4.428780	0.83667|0.83667	.|.	.|.	ENSG00000065150|ENSG00000065150	ENST00000460070;ENST00000261574;ENST00000357602;ENST00000475420;ENST00000480641;ENST00000490680;ENST00000389591;ENST00000403772;ENST00000473582|ENST00000469360	T;T;T;T;T;T;T;T|.	0.71222|.	-0.55;-0.55;-0.55;-0.55;3.2;-0.55;-0.55;3.2|.	5.74|5.74	4.87|4.87	0.63330|0.63330	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.155685|.	0.56097|.	D|.	0.000024|.	T|T	0.74160|0.74160	0.3680|0.3680	M|M	0.72576|0.72576	2.205|2.205	0.80722|0.80722	D|D	1|1	D;P|.	0.53312|.	0.959;0.891|.	B;P|.	0.48425|.	0.383;0.577|.	T|T	0.74657|0.74657	-0.3592|-0.3592	10|5	0.62326|.	D|.	0.03|.	-1.4843|-1.4843	16.5418|16.5418	0.84386|0.84386	0.0:0.8692:0.1308:0.0|0.0:0.8692:0.1308:0.0	.|.	117;135|.	O00410;O00410-3|.	IPO5_HUMAN;.|.	V|S	135;135;117;117;57;117;90;88;98|119	ENSP00000420284:A135V;ENSP00000261574:A135V;ENSP00000350219:A117V;ENSP00000420079:A117V;ENSP00000419003:A57V;ENSP00000418393:A117V;ENSP00000385938:A88V;ENSP00000420491:A98V|.	ENSP00000261574:A135V|.	A|P	+|+	2|1	0|0	IPO5|IPO5	97435854|97435854	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.630000|5.630000	0.67805|0.67805	1.365000|1.365000	0.46057|0.46057	0.563000|0.563000	0.77884|0.77884	GCC|CCA	.	.		0.373	IPO5-006	NOVEL	alternative_5_UTR|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000354655.1	NM_002271	
FARP1	10160	hgsc.bcm.edu	37	13	99063059	99063059	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:99063059T>C	ENST00000319562.6	+	15	1939	c.1674T>C	c.(1672-1674)gaT>gaC	p.D558D	FARP1_ENST00000595437.1_Silent_p.D558D|FARP1_ENST00000376586.2_Silent_p.D558D	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	558	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			ATCTGAAGGATCTCGAAGTTA	0.433																																					p.D558D		Atlas-SNP	.											.	FARP1	207	.	0			c.T1674C						.						131.0	115.0	120.0					13																	99063059		2202	4299	6501	SO:0001819	synonymous_variant	10160	exon15			GAAGGATCTCGAA	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1674T>C	chr13.hg19:g.99063059T>C		224.0	0.0		148.0	6.0	NM_005766	Q5JVI9|Q6IQ29	Silent	SNP	ENST00000319562.6	hg19	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	6.218	0.408279	0.11754	.	.	ENSG00000152767	ENST00000457029	.	.	.	5.66	-1.08	0.09936	.	.	.	.	.	T	0.65059	0.2655	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61456	-0.7059	4	.	.	.	.	13.382	0.60773	0.0:0.6488:0.0:0.3512	.	.	.	.	T	87	.	.	I	+	2	0	FARP1	97861060	0.988000	0.35896	0.905000	0.35620	0.598000	0.36846	0.253000	0.18296	-0.402000	0.07633	0.460000	0.39030	ATC	.	.		0.433	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
CHAMP1	283489	hgsc.bcm.edu	37	13	115089644	115089644	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr13:115089644T>C	ENST00000361283.1	+	3	636	c.327T>C	c.(325-327)ccT>ccC	p.P109P		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	109	Pro-rich.				attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TGAAAAGCCCTCCTCTTCCTG	0.398																																					p.P109P		Atlas-SNP	.											.	.	.	.	0			c.T327C						.						81.0	84.0	83.0					13																	115089644		2203	4300	6503	SO:0001819	synonymous_variant	283489	exon3			AAGCCCTCCTCTT	AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.327T>C	chr13.hg19:g.115089644T>C		268.0	0.0		158.0	24.0	NM_001164144	B3KU06|Q6P181|Q8NC88|Q9BST0	Silent	SNP	ENST00000361283.1	hg19	CCDS9545.1																																																																																			.	.		0.398	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045977.2	NM_032436	
MYH6	4624	hgsc.bcm.edu	37	14	23862189	23862189	+	Silent	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:23862189C>T	ENST00000356287.3	-	23	3212	c.3183G>A	c.(3181-3183)ctG>ctA	p.L1061L	MYH6_ENST00000405093.3_Silent_p.L1061L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1061					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		GGGTCAGCTTCAGGTCGCCCT	0.527																																					p.L1061L		Atlas-SNP	.											.	MYH6	274	.	0			c.G3183A						.						133.0	116.0	122.0					14																	23862189		2203	4300	6503	SO:0001819	synonymous_variant	4624	exon24			CAGCTTCAGGTCG	D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.3183G>A	chr14.hg19:g.23862189C>T		121.0	0.0		93.0	4.0	NM_002471	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	ENST00000356287.3	hg19	CCDS9600.1																																																																																			.	.		0.527	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071796.3		
EIF2S1	1965	hgsc.bcm.edu	37	14	67841207	67841207	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:67841207A>G	ENST00000256383.4	+	3	725	c.264A>G	c.(262-264)agA>agG	p.R88R	EIF2S1_ENST00000466499.2_Silent_p.R88R	NM_004094.4	NP_004085.1	P05198	IF2A_HUMAN	eukaryotic translation initiation factor 2, subunit 1 alpha, 35kDa	88	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|protein autophosphorylation (GO:0046777)|regulation of translational initiation in response to stress (GO:0043558)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)	poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	9				all cancers(60;0.000683)|OV - Ovarian serous cystadenocarcinoma(108;0.00579)|BRCA - Breast invasive adenocarcinoma(234;0.00937)		TGTCAAAAAGAAGAGTTTCTC	0.333																																					p.R88R		Atlas-SNP	.											.	EIF2S1	17	.	0			c.A264G						.						91.0	94.0	93.0					14																	67841207		2203	4298	6501	SO:0001819	synonymous_variant	1965	exon3			AAAAAGAAGAGTT	J02645	CCDS9781.1	14q21.3	2011-01-07	2002-08-29		ENSG00000134001	ENSG00000134001			3265	protein-coding gene	gene with protein product		603907	"""eukaryotic translation initiation factor 2, subunit 1 (alpha, 35kD )"""	EIF2		2948954	Standard	NM_004094		Approved	EIF-2alpha, EIF2A	uc001xjg.3	P05198	OTTHUMG00000029800	ENST00000256383.4:c.264A>G	chr14.hg19:g.67841207A>G		196.0	0.0		97.0	4.0	NM_004094		Silent	SNP	ENST00000256383.4	hg19	CCDS9781.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.95|10.95	1.494834|1.494834	0.26774|0.26774	.|.	.|.	ENSG00000134001|ENSG00000134001	ENST00000437108|ENST00000555876	.|.	.|.	.|.	6.06|6.06	6.06|6.06	0.98353|0.98353	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63438	.|0.2511	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.62680	.|-0.6803	.|4	.|.	.|.	.|.	.|-14.6773	10.8862|10.8862	0.46968|0.46968	0.9304:0.0:0.0696:0.0|0.9304:0.0:0.0696:0.0	.|.	.|.	.|.	.|.	.|G	-1|45	.|.	.|.	.|E	+|+	.|2	.|0	EIF2S1|EIF2S1	66910960|66910960	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.164000|6.164000	0.71885|0.71885	2.323000|2.323000	0.78572|0.78572	0.528000|0.528000	0.53228|0.53228	.|GAA	.	.		0.333	EIF2S1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000074342.3	NM_004094	
RBM25	58517	hgsc.bcm.edu	37	14	73569996	73569996	+	Silent	SNP	A	A	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:73569996A>C	ENST00000261973.7	+	10	1249	c.964A>C	c.(964-966)Agg>Cgg	p.R322R	RBM25_ENST00000527432.1_Silent_p.R322R	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	322	Arg-rich.|Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		ggaacgagaaaggcgagaacg	0.483																																					p.R322R		Atlas-SNP	.											.	RBM25	81	.	0			c.A964C						.						146.0	119.0	128.0					14																	73569996		2199	4299	6498	SO:0001819	synonymous_variant	58517	exon10			CGAGAAAGGCGAG	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.964A>C	chr14.hg19:g.73569996A>C		194.0	0.0		94.0	4.0	NM_021239	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Silent	SNP	ENST00000261973.7	hg19	CCDS32113.1																																																																																			.	.		0.483	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330	
CPSF2	53981	hgsc.bcm.edu	37	14	92621560	92621560	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:92621560T>C	ENST00000298875.4	+	11	1620	c.1335T>C	c.(1333-1335)ggT>ggC	p.G445G		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	445					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		TGATGAAAGGTGAAGGCAGTC	0.408																																					p.G445G	Ovarian(78;28 1788 18702 44111)	Atlas-SNP	.											.	CPSF2	63	.	0			c.T1335C						.						117.0	106.0	110.0					14																	92621560		2203	4300	6503	SO:0001819	synonymous_variant	53981	exon11			GAAAGGTGAAGGC	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.1335T>C	chr14.hg19:g.92621560T>C		135.0	0.0		117.0	5.0	NM_017437	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	ENST00000298875.4	hg19	CCDS9902.1	.	.	.	.	.	.	.	.	.	.	T	11.42	1.633546	0.29068	.	.	ENSG00000165934	ENST00000555244	.	.	.	5.81	-9.09	0.00717	.	.	.	.	.	T	0.42630	0.1211	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47837	-0.9086	4	.	.	.	.	4.9248	0.13887	0.0862:0.2897:0.4208:0.2034	.	.	.	.	A	13	.	.	V	+	2	0	CPSF2	91691313	0.495000	0.26051	0.725000	0.30721	0.993000	0.82548	-0.336000	0.07863	-1.802000	0.01244	0.379000	0.24179	GTG	.	.		0.408	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		
UNC79	57578	hgsc.bcm.edu	37	14	94038391	94038391	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:94038391T>C	ENST00000393151.2	+	15	1907	c.1907T>C	c.(1906-1908)gTc>gCc	p.V636A	UNC79_ENST00000256339.4_Missense_Mutation_p.V459A|UNC79_ENST00000555664.1_Missense_Mutation_p.V636A|UNC79_ENST00000553484.1_Missense_Mutation_p.V636A			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	636					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						AGAACAGAAGTCCCAGATAAT	0.403																																					p.V459A		Atlas-SNP	.											.	UNC79	366	.	0			c.T1376C						.						62.0	63.0	63.0					14																	94038391		2203	4300	6503	SO:0001583	missense	57578	exon15			CAGAAGTCCCAGA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1907T>C	chr14.hg19:g.94038391T>C	ENSP00000376858:p.Val636Ala	75.0	0.0		46.0	4.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	T	26.0	4.699267	0.88830	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.26373	1.74;1.74;1.74;1.74	5.73	5.73	0.89815	.	0.000000	0.64402	D	0.000002	T	0.46229	0.1382	L	0.49778	1.585	0.54753	D	0.999989	D	0.58268	0.982	D	0.70227	0.968	T	0.41395	-0.9511	10	0.87932	D	0	-7.1544	16.0095	0.80391	0.0:0.0:0.0:1.0	.	636	C9JQL1	.	A	459;636;636;636;636	ENSP00000256339:V459A;ENSP00000450868:V636A;ENSP00000451360:V636A;ENSP00000376858:V636A	ENSP00000256339:V459A	V	+	2	0	KIAA1409	93108144	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.713000	0.84693	2.189000	0.69895	0.528000	0.53228	GTC	.	.		0.403	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
UNC79	57578	hgsc.bcm.edu	37	14	94088335	94088335	+	Missense_Mutation	SNP	A	A	G	rs149602204		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:94088335A>G	ENST00000393151.2	+	30	4756	c.4756A>G	c.(4756-4758)Atg>Gtg	p.M1586V	UNC79_ENST00000256339.4_Missense_Mutation_p.M1409V|UNC79_ENST00000555664.1_Missense_Mutation_p.M1586V|UNC79_ENST00000553484.1_Missense_Mutation_p.M1608V			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1586					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						GTTAAACTGTATGGAGACTTT	0.488																																					p.M1409V		Atlas-SNP	.											UNC79,NS,carcinoma,0,2	UNC79	366	.	0			c.A4225G						.	A	VAL/MET	0,4406		0,0,2203	71.0	75.0	74.0		4225	6.0	1.0	14	dbSNP_134	74	1,8599	1.2+/-3.3	0,1,4299	no	missense	UNC79	NM_020818.3	21	0,1,6502	GG,GA,AA		0.0116,0.0,0.0077	possibly-damaging	1409/2459	94088335	1,13005	2203	4300	6503	SO:0001583	missense	57578	exon30			AACTGTATGGAGA	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.4756A>G	chr14.hg19:g.94088335A>G	ENSP00000376858:p.Met1586Val	165.0	0.0		95.0	4.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	A	13.50	2.255981	0.39896	0.0	1.16E-4	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.23950	1.92;1.88;1.93;1.92	5.98	5.98	0.97165	.	0.036664	0.85682	D	0.000000	T	0.39064	0.1064	L	0.32530	0.975	0.47037	D	0.999293	P	0.48911	0.917	D	0.63488	0.915	T	0.04565	-1.0942	10	0.30078	T	0.28	-21.1065	16.4728	0.84119	1.0:0.0:0.0:0.0	.	1608	C9JQL1	.	V	1409;1586;1608;1586;1608	ENSP00000256339:M1409V;ENSP00000450868:M1586V;ENSP00000451360:M1608V;ENSP00000376858:M1586V	ENSP00000256339:M1409V	M	+	1	0	KIAA1409	93158088	1.000000	0.71417	1.000000	0.80357	0.184000	0.23303	7.166000	0.77553	2.296000	0.77279	0.482000	0.46254	ATG	.	A|1.000;G|0.000		0.488	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
DDX24	57062	hgsc.bcm.edu	37	14	94528810	94528810	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:94528810T>C	ENST00000330836.5	-	3	1007	c.876A>G	c.(874-876)gaA>gaG	p.E292E	DDX24_ENST00000555054.1_Silent_p.E249E|DDX24_ENST00000544005.1_Silent_p.E42E	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	292	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CAGACTCAGCTTCAGCCTTGC	0.547																																					p.E292E		Atlas-SNP	.											.	DDX24	82	.	0			c.A876G						.						137.0	112.0	120.0					14																	94528810		2203	4300	6503	SO:0001819	synonymous_variant	57062	exon3			CTCAGCTTCAGCC	AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.876A>G	chr14.hg19:g.94528810T>C		126.0	0.0		86.0	4.0	NM_020414	E7EMJ4|Q4V9L5	Silent	SNP	ENST00000330836.5	hg19	CCDS9918.1																																																																																			.	.		0.547	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412861.1	NM_020414	
RCOR1	23186	hgsc.bcm.edu	37	14	103173693	103173693	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:103173693T>C	ENST00000570597.1	+	5	495	c.495T>C	c.(493-495)ctT>ctC	p.L165L	RCOR1_ENST00000262241.6_Silent_p.L168L			Q9UKL0	RCOR1_HUMAN	REST corepressor 1	165	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.|Interaction with HDAC1.				blood coagulation (GO:0007596)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	12						TGTAGGCTCTTGGGATGCTCT	0.348																																					p.L168L		Atlas-SNP	.											.	RCOR1	39	.	0			c.T504C						.						106.0	107.0	106.0					14																	103173693		2203	4300	6503	SO:0001819	synonymous_variant	23186	exon5			GGCTCTTGGGATG	AF155595	CCDS9974.1, CCDS9974.2	14q32.33	2004-04-16	2004-04-16	2004-04-16		ENSG00000089902			17441	protein-coding gene	gene with protein product		607675	"""REST corepressor"""	RCOR		10449787	Standard	NM_015156		Approved	COREST, KIAA0071	uc001ymb.4	Q9UKL0		ENST00000570597.1:c.495T>C	chr14.hg19:g.103173693T>C		141.0	0.0		83.0	4.0	NM_015156	Q15044|Q6P2I9|Q86VG5	Silent	SNP	ENST00000570597.1	hg19																																																																																				.	.		0.348	RCOR1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_015156	
CDC42BPB	9578	hgsc.bcm.edu	37	14	103438401	103438401	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:103438401A>G	ENST00000361246.2	-	13	2027	c.1739T>C	c.(1738-1740)cTg>cCg	p.L580P		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		GCGCTCGTTCAGCTCCGAGAA	0.602																																					p.L580P		Atlas-SNP	.											.	CDC42BPB	123	.	0			c.T1739C						.						99.0	92.0	94.0					14																	103438401		2203	4300	6503	SO:0001583	missense	9578	exon13			TCGTTCAGCTCCG	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1739T>C	chr14.hg19:g.103438401A>G	ENSP00000355237:p.Leu580Pro	168.0	0.0		73.0	4.0	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	hg19	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	A	19.50	3.840273	0.71488	.	.	ENSG00000198752	ENST00000361246	D	0.85702	-2.02	5.31	5.31	0.75309	.	0.065036	0.64402	D	0.000005	D	0.91188	0.7224	M	0.77103	2.36	0.80722	D	1	D	0.54964	0.969	P	0.61070	0.883	D	0.92315	0.5861	10	0.72032	D	0.01	.	15.2521	0.73556	1.0:0.0:0.0:0.0	.	580	Q9Y5S2	MRCKB_HUMAN	P	580	ENSP00000355237:L580P	ENSP00000355237:L580P	L	-	2	0	CDC42BPB	102508154	1.000000	0.71417	1.000000	0.80357	0.525000	0.34531	9.262000	0.95591	2.017000	0.59298	0.460000	0.39030	CTG	.	.		0.602	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
CEP170B	283638	hgsc.bcm.edu	37	14	105344813	105344813	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr14:105344813A>G	ENST00000414716.3	+	5	536	c.308A>G	c.(307-309)cAc>cGc	p.H103R	CEP170B_ENST00000453495.1_Missense_Mutation_p.H103R|CEP170B_ENST00000556508.1_Missense_Mutation_p.H33R|CEP170B_ENST00000418279.1_Missense_Mutation_p.H33R	NM_001112726.2	NP_001106197.1	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	103						cytoplasm (GO:0005737)|microtubule (GO:0005874)											CGTGTGCAGCACCGAGTCCCG	0.637																																					p.H103R		Atlas-SNP	.											.	.	.	.	0			c.A308G						.						102.0	111.0	108.0					14																	105344813		2123	4233	6356	SO:0001583	missense	283638	exon5			TGCAGCACCGAGT	AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000414716.3:c.308A>G	chr14.hg19:g.105344813A>G	ENSP00000404151:p.His103Arg	66.0	0.0		51.0	4.0	NM_001112726	Q2KHR7|Q86TI7	Missense_Mutation	SNP	ENST00000414716.3	hg19	CCDS45175.1	.	.	.	.	.	.	.	.	.	.	A	18.92	3.725786	0.69074	.	.	ENSG00000099814	ENST00000556508;ENST00000414716;ENST00000453495;ENST00000418279	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	4.14	4.14	0.48551	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.080156	0.47455	D	0.000228	T	0.44912	0.1316	L	0.49455	1.56	0.45330	D	0.998324	D;B;P	0.53151	0.958;0.296;0.82	P;B;P	0.56163	0.793;0.046;0.502	T	0.24693	-1.0153	10	0.25106	T	0.35	-24.6896	12.9586	0.58444	1.0:0.0:0.0:0.0	.	103;103;33	Q9Y4F5-2;Q9Y4F5;E9PFC1	.;K0284_HUMAN;.	R	33;103;103;33	ENSP00000451249:H33R;ENSP00000404151:H103R;ENSP00000407238:H103R;ENSP00000415006:H33R	ENSP00000404151:H103R	H	+	2	0	KIAA0284	104415858	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	5.082000	0.64450	1.732000	0.51606	0.260000	0.18958	CAC	.	.		0.637	CEP170B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000410289.2	NM_001112726	
RYR3	6263	hgsc.bcm.edu	37	15	34130147	34130147	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:34130147A>G	ENST00000389232.4	+	89	12036	c.11966A>G	c.(11965-11967)gAc>gGc	p.D3989G	RYR3_ENST00000415757.3_Missense_Mutation_p.D3984G	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3989					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCAGCCAAGGACATAGGGTTT	0.448																																					p.D3989G		Atlas-SNP	.											.	RYR3	760	.	0			c.A11966G						.						127.0	126.0	127.0					15																	34130147		1950	4154	6104	SO:0001583	missense	6263	exon89			CCAAGGACATAGG		CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.11966A>G	chr15.hg19:g.34130147A>G	ENSP00000373884:p.Asp3989Gly	184.0	0.0		137.0	6.0	NM_001036	O15175|Q15412	Missense_Mutation	SNP	ENST00000389232.4	hg19	CCDS45210.1	.	.	.	.	.	.	.	.	.	.	A	19.32	3.805558	0.70682	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.97710	-4.5	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.98201	0.9405	M	0.62723	1.935	0.80722	D	1	D;D	0.65815	0.987;0.995	P;D	0.67548	0.882;0.952	D	0.99376	1.0921	10	0.87932	D	0	.	15.5941	0.76566	1.0:0.0:0.0:0.0	.	3984;3989	Q15413-2;Q15413	.;RYR3_HUMAN	G	3989;3985	ENSP00000373884:D3989G	ENSP00000354735:D3985G	D	+	2	0	RYR3	31917439	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.020000	0.93667	2.272000	0.75746	0.450000	0.29827	GAC	.	.		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417514.1		
FBN1	2200	hgsc.bcm.edu	37	15	48712988	48712988	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:48712988T>C	ENST00000316623.5	-	63	8170	c.7715A>G	c.(7714-7716)gAg>gGg	p.E2572G		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2572	EGF-like 45; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GTGGTTACCCTCACACTCGTC	0.542																																					p.E2572G		Atlas-SNP	.											.	FBN1	310	.	0			c.A7715G						.						76.0	66.0	69.0					15																	48712988		2198	4296	6494	SO:0001583	missense	2200	exon63			TTACCCTCACACT	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7715A>G	chr15.hg19:g.48712988T>C	ENSP00000325527:p.Glu2572Gly	46.0	0.0		41.0	4.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922841	0.52653	.	.	ENSG00000166147	ENST00000316623	D	0.92249	-3.0	5.99	5.99	0.97316	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.099912	0.64402	D	0.000003	D	0.87079	0.6088	L	0.31065	0.9	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.82331	-0.0510	10	0.20519	T	0.43	.	16.1557	0.81666	0.0:0.0:0.0:1.0	.	2572	P35555	FBN1_HUMAN	G	2572	ENSP00000325527:E2572G	ENSP00000325527:E2572G	E	-	2	0	FBN1	46500280	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	4.048000	0.57390	2.291000	0.77112	0.533000	0.62120	GAG	.	.		0.542	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
FBN1	2200	hgsc.bcm.edu	37	15	48752514	48752514	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:48752514T>C	ENST00000316623.5	-	43	5680	c.5225A>G	c.(5224-5226)gAt>gGt	p.D1742G		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1742	TB 7.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AGCAAACTCATCTGCAATGAT	0.403																																					p.D1742G		Atlas-SNP	.											.	FBN1	310	.	0			c.A5225G						.						75.0	67.0	70.0					15																	48752514		2198	4296	6494	SO:0001630	splice_region_variant	2200	exon43			AACTCATCTGCAA	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5225-1A>G	chr15.hg19:g.48752514T>C		87.0	0.0		72.0	5.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	ENST00000316623.5	hg19	CCDS32232.1	.	.	.	.	.	.	.	.	.	.	T	11.94	1.787891	0.31593	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.92858	-3.12	6.16	6.16	0.99307	Matrix fibril-associated (3);TGF-beta binding (1);	0.090906	0.85682	D	0.000000	D	0.93507	0.7928	L	0.46614	1.455	0.80722	D	1	D	0.63046	0.992	D	0.72338	0.977	D	0.91451	0.5181	10	0.23302	T	0.38	.	12.3343	0.55058	0.0:0.0:0.1408:0.8592	.	1742	P35555	FBN1_HUMAN	G	1742;310;632	ENSP00000325527:D1742G	ENSP00000325527:D1742G	D	-	2	0	FBN1	46539806	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.989000	0.56958	2.367000	0.80283	0.528000	0.53228	GAT	.	.		0.403	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		Missense_Mutation
USP50	373509	hgsc.bcm.edu	37	15	50833284	50833284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:50833284A>G	ENST00000532404.1	-	4	795	c.622T>C	c.(622-624)Tca>Cca	p.S208P	USP50_ENST00000530218.1_Intron	NM_203494.4	NP_987090.2	Q70EL3	UBP50_HUMAN	ubiquitin specific peptidase 50	213	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(5)	13				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		ATGGGGAGTGAGAAGACAGTG	0.453																																					p.S208P		Atlas-SNP	.											.	USP50	24	.	0			c.T622C						.						132.0	125.0	127.0					15																	50833284		1930	4142	6072	SO:0001583	missense	373509	exon4			GGAGTGAGAAGAC	AI990110	CCDS53944.1	15q21.1	2008-02-05	2005-08-08			ENSG00000170236		"""Ubiquitin-specific peptidases"""	20079	protein-coding gene	gene with protein product			"""ubiquitin specific protease 50"""			12838346	Standard	NM_203494		Approved		uc021sky.1	Q70EL3		ENST00000532404.1:c.622T>C	chr15.hg19:g.50833284A>G	ENSP00000434676:p.Ser208Pro	164.0	0.0		103.0	5.0	NM_203494	E9PP86	Missense_Mutation	SNP	ENST00000532404.1	hg19	CCDS53944.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744512	0.49151	.	.	ENSG00000170236	ENST00000532404	T	0.36699	1.24	5.45	4.32	0.51571	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.068855	0.64402	D	0.000012	T	0.45175	0.1329	M	0.83852	2.665	0.34738	D	0.730491	B	0.24576	0.106	B	0.34385	0.181	T	0.56974	-0.7890	10	0.72032	D	0.01	-8.2452	8.9374	0.35708	0.9144:0.0:0.0856:0.0	.	213	Q70EL3	UBP50_HUMAN	P	208	ENSP00000434676:S208P	ENSP00000434676:S208P	S	-	1	0	USP50	48620576	1.000000	0.71417	0.970000	0.41538	0.854000	0.48673	3.367000	0.52350	0.898000	0.36418	0.459000	0.35465	TCA	.	.		0.453	USP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395249.1		
ICE2	79664	hgsc.bcm.edu	37	15	60742037	60742037	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:60742037A>G	ENST00000261520.4	-	10	1363	c.1129T>C	c.(1129-1131)Tcc>Ccc	p.S377P	NARG2_ENST00000439632.1_Missense_Mutation_p.S240P	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						ACTTCACAGGACATCTTATGT	0.358																																					p.S377P		Atlas-SNP	.											.	NARG2	82	.	0			c.T1129C						.						54.0	58.0	57.0					15																	60742037		2198	4276	6474	SO:0001583	missense	79664	exon10			CACAGGACATCTT																												ENST00000261520.4:c.1129T>C	chr15.hg19:g.60742037A>G	ENSP00000261520:p.Ser377Pro	77.0	0.0		56.0	4.0	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	hg19	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	A	5.055	0.195731	0.09599	.	.	ENSG00000128915	ENST00000261520;ENST00000439632	.	.	.	5.45	-1.17	0.09648	.	0.489229	0.24587	N	0.037252	T	0.19927	0.0479	N	0.17474	0.49	0.09310	N	1	B;B	0.15930	0.015;0.002	B;B	0.11329	0.006;0.001	T	0.12477	-1.0546	9	0.24483	T	0.36	-1.9507	5.7089	0.17923	0.5039:0.0:0.3686:0.1275	.	45;377	B3KXT2;Q659A1	.;NARG2_HUMAN	P	377;240	.	ENSP00000261520:S377P	S	-	1	0	NARG2	58529329	0.021000	0.18746	0.003000	0.11579	0.223000	0.24884	0.197000	0.17197	-0.098000	0.12285	0.477000	0.44152	TCC	.	.		0.358	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
CYP1A2	1544	hgsc.bcm.edu	37	15	75047231	75047231	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:75047231T>C	ENST00000343932.4	+	7	1416	c.1353T>C	c.(1351-1353)ttT>ttC	p.F451F		NM_000761.3	NP_000752.2	P05177	CP1A2_HUMAN	cytochrome P450, family 1, subfamily A, polypeptide 2	451				LF -> MLV (in Ref. 10; AAA52154). {ECO:0000305}.	alkaloid metabolic process (GO:0009820)|arachidonic acid metabolic process (GO:0019369)|cellular respiration (GO:0045333)|cellular response to cadmium ion (GO:0071276)|dibenzo-p-dioxin metabolic process (GO:0018894)|drug catabolic process (GO:0042737)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|heterocycle metabolic process (GO:0046483)|hydrogen peroxide biosynthetic process (GO:0050665)|lung development (GO:0030324)|methylation (GO:0032259)|monocarboxylic acid metabolic process (GO:0032787)|monoterpenoid metabolic process (GO:0016098)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|oxidative deethylation (GO:0071615)|oxidative demethylation (GO:0070989)|porphyrin-containing compound metabolic process (GO:0006778)|post-embryonic development (GO:0009791)|regulation of gene expression (GO:0010468)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|small molecule metabolic process (GO:0044281)|steroid catabolic process (GO:0006706)|toxin biosynthetic process (GO:0009403)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|demethylase activity (GO:0032451)|electron carrier activity (GO:0009055)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33					"""""""Insulin(DB00071)|Acenocoumarol(DB01418)|Acetaminophen(DB00316)|Agomelatine(DB06594)|Albendazole(DB00518)|Alitretinoin(DB00523)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminoglutethimide(DB00357)|Aminophenazone(DB01424)|Aminophylline(DB01223)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Anagrelide(DB00261)|Anastrozole(DB01217)|Antipyrine(DB01435)|Apixaban(DB06605)|Aprepitant(DB00673)|Asenapine(DB06216)|Atropine(DB00572)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzyl alcohol(DB06770)|Betaxolol(DB00195)|Bortezomib(DB00188)|Bromazepam(DB01558)|Bromocriptine(DB01200)|Bupivacaine(DB00297)|Buprenorphine(DB00921)|Bupropion(DB01156)|Caffeine(DB00201)|Carbamazepine(DB00564)|Carmustine(DB00262)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cilostazol(DB01166)|Cimetidine(DB00501)|Cinacalcet(DB01012)|Cinnarizine(DB00568)|Ciprofloxacin(DB00537)|Cisapride(DB00604)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clenbuterol(DB01407)|Clevidipine(DB04920)|Clobetasol propionate(DB01013)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Conjugated Estrogens(DB00286)|Cyclobenzaprine(DB00924)|Dacarbazine(DB00851)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Delavirdine(DB00705)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Diazepam(DB00829)|Diclofenac(DB00586)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Duloxetine(DB00476)|Edetic Acid(DB00974)|Efavirenz(DB00625)|Eltrombopag(DB06210)|Enoxacin(DB00467)|Epinephrine(DB00668)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estrone(DB00655)|Estropipate(DB04574)|Ethanol(DB00898)|Etoposide(DB00773)|Etoricoxib(DB01628)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluorouracil(DB00544)|Fluoxetine(DB00472)|Fluphenazine(DB00623)|Flutamide(DB00499)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Frovatriptan(DB00998)|Gemfibrozil(DB01241)|Griseofulvin(DB00400)|Guanabenz(DB00629)|Haloperidol(DB00502)|Hesperetin(DB01094)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imatinib(DB00619)|Imipramine(DB00458)|Imiquimod(DB00724)|inhaled insulin(DB05278)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketoconazole(DB01026)|Lansoprazole(DB00448)|Leflunomide(DB01097)|Levobupivacaine(DB01002)|Levofloxacin(DB01137)|Lidocaine(DB00281)|Lomefloxacin(DB00978)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Losartan(DB00678)|Lumiracoxib(DB01283)|Malathion(DB00772)|Maprotiline(DB00934)|Meclizine(DB00737)|Melatonin(DB01065)|Menadione(DB00170)|Methadone(DB00333)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxsalen(DB00553)|Methoxyflurane(DB01028)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Mirtazapine(DB00370)|Moclobemide(DB01171)|Modafinil(DB00745)|Nabumetone(DB00461)|Nafcillin(DB00607)|Naproxen(DB00788)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Niclosamide(DB06803)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitric Oxide(DB00435)|Nitroprusside(DB00325)|Norepinephrine(DB00368)|Norfloxacin(DB01059)|Nortriptyline(DB00540)|Ofloxacin(DB01165)|Olanzapine(DB00334)|Omeprazole(DB00338)|Ondansetron(DB00904)|Oxaliplatin(DB00526)|Oxtriphylline(DB01303)|Palonosetron(DB00377)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Pefloxacin(DB00487)|Pentamidine(DB00738)|Pentoxifylline(DB00806)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phentermine(DB00191)|Phenylephrine(DB00388)|Phenylpropanolamine(DB00397)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pomalidomide(DB08910)|Praziquantel(DB01058)|Primaquine(DB01087)|Primidone(DB00794)|Progesterone(DB00396)|Proguanil(DB01131)|Promazine(DB00420)|Propafenone(DB01182)|Propofol(DB00818)|Propranolol(DB00571)|Pyrazinamide(DB00339)|Quinidine(DB00908)|Quinine(DB00468)|Rabeprazole(DB01129)|Ramelteon(DB00980)|Ranitidine(DB00863)|Rasagiline(DB01367)|Rifabutin(DB00615)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Riluzole(DB00740)|Ritonavir(DB00503)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Ropivacaine(DB00296)|Rosiglitazone(DB00412)|Rotigotine(DB05271)|Roxithromycin(DB00778)|Secobarbital(DB00418)|Selegiline(DB01037)|Sertraline(DB01104)|SIMEPREVIR(DB06290)|Sorafenib(DB00398)|Streptozocin(DB00428)|Sulindac(DB00605)|Tamoxifen(DB00675)|Telithromycin(DB00976)|Tenofovir(DB00300)|Terbinafine(DB00857)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiabendazole(DB00730)|Thioridazine(DB00679)|Thiothixene(DB01623)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tizanidine(DB00697)|Tocainide(DB01056)|Toremifene(DB00539)|Tranylcypromine(DB00752)|Triamterene(DB00384)|Trifluoperazine(DB00831)|Valproic Acid(DB00313)|Vemurafenib(DB08881)|Verapamil(DB00661)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zileuton(DB00744)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)|Zolpidem(DB00425)"""	TGATGCTGTTTGGCATGGGCA	0.597																																					p.F451F		Atlas-SNP	.											.	CYP1A2	70	.	0			c.T1353C						.						121.0	108.0	112.0					15																	75047231		2197	4296	6493	SO:0001819	synonymous_variant	1544	exon7			GCTGTTTGGCATG	AF182274	CCDS32293.1	15q24.1	2013-11-11	2003-01-14		ENSG00000140505	ENSG00000140505	1.14.14.1	"""Cytochrome P450s"""	2596	protein-coding gene	gene with protein product		124060	"""cytochrome P450, subfamily I (aromatic compound-inducible), polypeptide 2"""			15128046	Standard	NM_000761		Approved	P3-450, CP12	uc002ayr.1	P05177	OTTHUMG00000172901	ENST00000343932.4:c.1353T>C	chr15.hg19:g.75047231T>C		151.0	0.0		64.0	8.0	NM_000761	Q16754|Q6NWU5|Q9BXX7|Q9UK49	Silent	SNP	ENST00000343932.4	hg19	CCDS32293.1																																																																																			.	.		0.597	CYP1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421263.2	NM_000761	
SNX33	257364	hgsc.bcm.edu	37	15	75941871	75941871	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:75941871T>C	ENST00000308527.5	+	1	1625	c.428T>C	c.(427-429)cTc>cCc	p.L143P	IMP3_ENST00000565349.1_5'Flank|IMP3_ENST00000314852.2_5'Flank	NM_153271.1	NP_695003.1	Q8WV41	SNX33_HUMAN	sorting nexin 33	143					cleavage furrow formation (GO:0036089)|endocytosis (GO:0006897)|endosomal transport (GO:0016197)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|macropinocytosis (GO:0044351)|membrane tubulation (GO:0097320)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|negative regulation of endocytosis (GO:0045806)|negative regulation of protein localization to cell surface (GO:2000009)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein localization to cell surface (GO:2000010)|protein import (GO:0017038)	cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	19						CACCCTCCCCTCAACCTCTCC	0.657																																					p.L143P		Atlas-SNP	.											.	SNX33	43	.	0			c.T428C						.						55.0	55.0	55.0					15																	75941871		2197	4293	6490	SO:0001583	missense	257364	exon1			CTCCCCTCAACCT	AK091291	CCDS10283.1	15q23	2008-04-18	2008-03-25	2008-03-25	ENSG00000173548	ENSG00000173548			28468	protein-coding gene	gene with protein product			"""SH3 and PX domain containing 3"""	SH3PX3		16374509, 16782399, 18353773	Standard	NM_153271		Approved	MGC32065, SH3PXD3C, SNX30	uc002bau.3	Q8WV41	OTTHUMG00000142835	ENST00000308527.5:c.428T>C	chr15.hg19:g.75941871T>C	ENSP00000311427:p.Leu143Pro	104.0	0.0		78.0	6.0	NM_153271	B1NM17	Missense_Mutation	SNP	ENST00000308527.5	hg19	CCDS10283.1	.	.	.	.	.	.	.	.	.	.	T	12.02	1.813817	0.32053	.	.	ENSG00000173548	ENST00000308527	T	0.65364	-0.15	4.83	4.83	0.62350	.	0.639639	0.16138	N	0.227857	T	0.37865	0.1019	N	0.08118	0	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.28138	-1.0053	10	0.35671	T	0.21	-1.7839	5.9195	0.19073	0.0:0.1792:0.0:0.8208	.	143	Q8WV41	SNX33_HUMAN	P	143	ENSP00000311427:L143P	ENSP00000311427:L143P	L	+	2	0	SNX33	73728926	0.965000	0.33210	0.993000	0.49108	0.984000	0.73092	2.496000	0.45346	2.027000	0.59764	0.528000	0.53228	CTC	.	.		0.657	SNX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286471.1	NM_153271	
RASGRF1	5923	hgsc.bcm.edu	37	15	79307690	79307690	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:79307690A>G	ENST00000419573.3	-	13	2079	c.1805T>C	c.(1804-1806)gTc>gCc	p.V602A	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.V602A	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	602					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CGGCACAGTGACCTTGGAATT	0.512																																					p.V602A		Atlas-SNP	.											.	RASGRF1	168	.	0			c.T1805C						.						179.0	146.0	157.0					15																	79307690		2196	4293	6489	SO:0001583	missense	5923	exon13			ACAGTGACCTTGG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.1805T>C	chr15.hg19:g.79307690A>G	ENSP00000405963:p.Val602Ala	124.0	0.0		79.0	6.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.042910	0.75732	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.56776	0.44	3.68	3.68	0.42216	.	0.000000	0.64402	D	0.000006	T	0.65428	0.2690	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.997;0.998;0.998;0.999	D;D;D;D;D	0.81914	0.995;0.935;0.93;0.952;0.978	T	0.64651	-0.6357	10	0.10377	T	0.69	.	10.3632	0.44008	1.0:0.0:0.0:0.0	.	11;602;602;602;602	B7Z6Z6;A8K270;Q8IUU5;Q13972;F8VPA5	.;.;.;RGRF1_HUMAN;.	A	602	ENSP00000405963:V602A	ENSP00000378224:V602A	V	-	2	0	RASGRF1	77094745	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	8.812000	0.91959	1.528000	0.49103	0.397000	0.26171	GTC	.	.		0.512	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
ACAN	176	hgsc.bcm.edu	37	15	89402123	89402123	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:89402123A>G	ENST00000561243.1	+	11	6307	c.6307A>G	c.(6307-6309)Acg>Gcg	p.T2103A	ACAN_ENST00000559004.1_Missense_Mutation_p.T2103A|ACAN_ENST00000439576.2_Missense_Mutation_p.T2103A|ACAN_ENST00000352105.7_Missense_Mutation_p.T2103A			P16112	PGCA_HUMAN	aggrecan	1988	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			TAGCAGTGAGACGTCCGCCTA	0.562																																					p.T2103A		Atlas-SNP	.											AGC1,NS,carcinoma,0,2	ACAN	220	.	0			c.A6307G						.						41.0	42.0	41.0					15																	89402123		1907	4112	6019	SO:0001583	missense	176	exon12			AGTGAGACGTCCG	M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.6307A>G	chr15.hg19:g.89402123A>G	ENSP00000453342:p.Thr2103Ala	62.0	0.0		43.0	3.0	NM_001135	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Missense_Mutation	SNP	ENST00000561243.1	hg19	CCDS53970.1	.	.	.	.	.	.	.	.	.	.	A	11.17	1.560900	0.27827	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	T;T	0.02236	4.61;4.38	5.18	-4.59	0.03400	.	1.118760	0.07130	N	0.845433	T	0.01627	0.0052	L	0.50333	1.59	0.09310	N	1	P;P	0.46220	0.874;0.861	B;B	0.39339	0.297;0.297	T	0.45614	-0.9249	10	0.07175	T	0.84	2.7281	0.4911	0.00564	0.3941:0.2005:0.1471:0.2582	.	2103;2103	E7ENV9;E7EX88	.;.	A	2103;2103;1989	ENSP00000387356:T2103A;ENSP00000341615:T2103A	ENSP00000268134:T1989A	T	+	1	0	ACAN	87203127	0.011000	0.17503	0.001000	0.08648	0.490000	0.33462	0.939000	0.28978	-0.357000	0.08175	0.454000	0.30748	ACG	.	.		0.562	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416267.2	NM_001135	
PLIN1	5346	hgsc.bcm.edu	37	15	90210343	90210343	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:90210343T>C	ENST00000300055.5	-	8	1198	c.1033A>G	c.(1033-1035)Acc>Gcc	p.T345A	PLIN1_ENST00000430628.2_Missense_Mutation_p.T345A	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	345					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						GAGATGGTGGTCTGGAGGGTC	0.657																																					p.T345A		Atlas-SNP	.											.	PLIN1	36	.	0			c.A1033G						.						97.0	86.0	90.0					15																	90210343		2200	4299	6499	SO:0001583	missense	5346	exon8			TGGTGGTCTGGAG	AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.1033A>G	chr15.hg19:g.90210343T>C	ENSP00000300055:p.Thr345Ala	126.0	0.0		97.0	4.0	NM_001145311	Q8N5Y6	Missense_Mutation	SNP	ENST00000300055.5	hg19	CCDS10353.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.498012	0.26861	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.05025	3.51;3.51	5.35	-1.12	0.09808	.	1.732160	0.03257	N	0.182673	T	0.06371	0.0164	L	0.36672	1.1	0.09310	N	1	B	0.20671	0.047	B	0.19391	0.025	T	0.40942	-0.9536	10	0.62326	D	0.03	-5.3931	3.8252	0.08852	0.2822:0.3172:0.0:0.4006	.	345	O60240	PLIN1_HUMAN	A	345	ENSP00000300055:T345A;ENSP00000402167:T345A	ENSP00000300055:T345A	T	-	1	0	PLIN1	88011347	0.000000	0.05858	0.000000	0.03702	0.656000	0.38851	-0.125000	0.10579	-0.487000	0.06735	-0.516000	0.04426	ACC	.	.		0.657	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313424.2	NM_002666	
IDH2	3418	hgsc.bcm.edu	37	15	90628063	90628063	+	Missense_Mutation	SNP	A	A	G	rs554169929		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr15:90628063A>G	ENST00000330062.3	-	10	1369	c.1256T>C	c.(1255-1257)aTt>aCt	p.I419T	RP11-617F23.1_ENST00000558334.1_RNA|IDH2_ENST00000540499.2_Missense_Mutation_p.I367T|IDH2_ENST00000539790.1_Missense_Mutation_p.I289T|IDH2_ENST00000559482.1_Intron	NM_002168.2	NP_002159.2	P48735	IDHP_HUMAN	isocitrate dehydrogenase 2 (NADP+), mitochondrial	419					2-oxoglutarate metabolic process (GO:0006103)|carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|glyoxylate cycle (GO:0006097)|isocitrate metabolic process (GO:0006102)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	isocitrate dehydrogenase (NADP+) activity (GO:0004450)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			biliary_tract(11)|bone(19)|central_nervous_system(107)|endometrium(1)|haematopoietic_and_lymphoid_tissue(953)|large_intestine(8)|lung(5)|skin(5)	1109	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.0146)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.106)			GAGGCCGTGAATGCAGCCCGC	0.627			M		GBM								A|||	1	0.000199681	0.0008	0.0	5008	,	,		19294	0.0		0.0	False		,,,				2504	0.0				p.I419T		Atlas-SNP	.		Dom	yes		15	15q26.1	3418	"""socitrate dehydrogenase 2 (NADP+), mitochondrial """		M	.	IDH2	1372	.	0			c.T1256C						.						105.0	107.0	106.0					15																	90628063		2200	4298	6498	SO:0001583	missense	3418	exon10			CCGTGAATGCAGC		CCDS10359.1	15q26.1	2014-09-17			ENSG00000182054	ENSG00000182054	1.1.1.42		5383	protein-coding gene	gene with protein product		147650					Standard	NM_001289910		Approved		uc002box.3	P48735	OTTHUMG00000149815	ENST00000330062.3:c.1256T>C	chr15.hg19:g.90628063A>G	ENSP00000331897:p.Ile419Thr	87.0	0.0		69.0	4.0	NM_002168	B2R6L6|B4DFL2|Q96GT3	Missense_Mutation	SNP	ENST00000330062.3	hg19	CCDS10359.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.664260	0.47572	.	.	ENSG00000182054	ENST00000330062;ENST00000539790;ENST00000540499	T;T;T	0.77098	-1.07;-1.07;-1.07	5.57	5.57	0.84162	Isopropylmalate dehydrogenase-like domain (2);	0.000000	0.85682	D	0.000000	D	0.82761	0.5107	M	0.62209	1.925	0.80722	D	1	D	0.52996	0.957	P	0.54889	0.763	D	0.84890	0.0836	10	0.87932	D	0	.	13.6826	0.62496	1.0:0.0:0.0:0.0	.	419	P48735	IDHP_HUMAN	T	419;289;367	ENSP00000331897:I419T;ENSP00000438457:I289T;ENSP00000446147:I367T	ENSP00000331897:I419T	I	-	2	0	IDH2	88429067	1.000000	0.71417	1.000000	0.80357	0.269000	0.26545	7.469000	0.80959	2.117000	0.64856	0.459000	0.35465	ATT	.	.		0.627	IDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313426.1		
CACNA1H	8912	hgsc.bcm.edu	37	16	1271981	1271981	+	IGR	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:1271981A>G	ENST00000348261.5	+	0	8084				TPSG1_ENST00000234798.4_Missense_Mutation_p.V258A	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit						aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GTAGGCAGGGACACGAGTGTA	0.672																																					p.V258A		Atlas-SNP	.											.	TPSG1	19	.	0			c.T773C						.						29.0	39.0	36.0					16																	1271981		2196	4297	6493	SO:0001628	intergenic_variant	25823	exon6			GCAGGGACACGAG	AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180			chr16.hg19:g.1271981A>G		146.0	0.0		80.0	7.0	NM_012467	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	ENST00000348261.5	hg19	CCDS45375.1	.	.	.	.	.	.	.	.	.	.	a	16.76	3.211574	0.58343	.	.	ENSG00000116176	ENST00000234798	D	0.96774	-4.12	4.28	3.18	0.36537	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.98002	0.9342	M	0.89904	3.07	0.09310	N	0.999999	D	0.89917	1.0	D	0.91635	0.999	D	0.92688	0.6164	9	0.59425	D	0.04	.	7.9097	0.29782	0.8966:0.0:0.1034:0.0	.	258	Q9NRR2	TRYG1_HUMAN	A	258	ENSP00000234798:V258A	ENSP00000234798:V258A	V	-	2	0	TPSG1	1211982	0.032000	0.19561	0.001000	0.08648	0.003000	0.03518	3.236000	0.51336	0.599000	0.29845	0.524000	0.50904	GTC	.	.		0.672	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000421601.1	NM_001005407	
ABCC6	368	hgsc.bcm.edu	37	16	16308279	16308279	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:16308279G>C	ENST00000205557.7	-	5	531	c.502C>G	c.(502-504)Ctg>Gtg	p.L168V	ABCC6_ENST00000574094.1_5'UTR	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6	168					response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	TAGGTGGACAGGTGGCGGACA	0.572																																					p.L168V		Atlas-SNP	.											.	ABCC6	110	.	0			c.C502G						.						6.0	7.0	6.0					16																	16308279		1961	3880	5841	SO:0001583	missense	368	exon5			TGGACAGGTGGCG	AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967	ENST00000205557.7:c.502C>G	chr16.hg19:g.16308279G>C	ENSP00000205557:p.Leu168Val	277.0	0.0		159.0	7.0	NM_001171	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	Missense_Mutation	SNP	ENST00000205557.7	hg19	CCDS10568.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.992607	0.00439	.	.	ENSG00000091262	ENST00000205557;ENST00000456970;ENST00000546056	T;T	0.49720	0.77;0.77	3.89	2.83	0.33086	.	0.428472	0.16828	U	0.197845	T	0.23370	0.0565	N	0.25890	0.77	0.80722	D	1	P;B	0.35401	0.499;0.298	B;B	0.29440	0.102;0.064	T	0.15838	-1.0423	10	0.02654	T	1	.	6.3836	0.21548	0.0:0.1999:0.5947:0.2054	.	180;168	F5GWQ0;O95255	.;MRP6_HUMAN	V	168;168;180	ENSP00000205557:L168V;ENSP00000405002:L168V	ENSP00000205557:L168V	L	-	1	2	ABCC6	16215780	1.000000	0.71417	1.000000	0.80357	0.185000	0.23345	1.275000	0.33144	1.919000	0.55581	0.306000	0.20318	CTG	.	.		0.572	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252232.2		
TMC5	79838	hgsc.bcm.edu	37	16	19505602	19505602	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:19505602T>C	ENST00000396229.2	+	20	3594	c.2845T>C	c.(2845-2847)Ttc>Ctc	p.F949L	TMC5_ENST00000542583.2_Missense_Mutation_p.F949L|TMC5_ENST00000219821.5_Missense_Mutation_p.F703L|TMC5_ENST00000564959.1_Missense_Mutation_p.F632L|TMC5_ENST00000561503.1_Missense_Mutation_p.F590L|TMC5_ENST00000541464.1_Missense_Mutation_p.F897L|TMC5_ENST00000381414.4_Missense_Mutation_p.F891L	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5	949					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						AGATAAAATGTTCCTGATAGA	0.408																																					p.F949L		Atlas-SNP	.											.	TMC5	169	.	0			c.T2845C						.						119.0	128.0	125.0					16																	19505602		2197	4300	6497	SO:0001583	missense	79838	exon20			AAAATGTTCCTGA	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.2845T>C	chr16.hg19:g.19505602T>C	ENSP00000379531:p.Phe949Leu	194.0	0.0		84.0	5.0	NM_001105248	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	hg19	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843527	0.91197	.	.	ENSG00000103534	ENST00000541464;ENST00000381414;ENST00000396229;ENST00000542583;ENST00000219821;ENST00000440743	T;T;T;T;T	0.79653	-0.97;-1.29;-1.16;-1.16;-1.28	5.57	5.57	0.84162	.	1.702360	0.02414	N	0.082006	D	0.92224	0.7534	M	0.85462	2.755	0.49915	D	0.999834	D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.918;0.999;0.997;0.999	T	0.78863	-0.2036	10	0.49607	T	0.09	-27.6758	14.2507	0.66019	0.0:0.0:0.0:1.0	.	897;632;703;949;891	F5GYU8;E7EU57;Q6UXY8-3;Q6UXY8;Q6UXY8-2	.;.;.;TMC5_HUMAN;.	L	897;891;949;949;703;632	ENSP00000441227:F897L;ENSP00000370822:F891L;ENSP00000379531:F949L;ENSP00000446274:F949L;ENSP00000219821:F703L	ENSP00000219821:F703L	F	+	1	0	TMC5	19413103	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.135000	0.64777	2.243000	0.73865	0.533000	0.62120	TTC	.	.		0.408	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
CCP110	9738	hgsc.bcm.edu	37	16	19556463	19556463	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:19556463T>C	ENST00000381396.5	+	10	2881	c.2634T>C	c.(2632-2634)gaT>gaC	p.D878D	CCP110_ENST00000396208.2_Silent_p.D878D|CCP110_ENST00000396212.2_Silent_p.D878D	NM_001199022.1	NP_001185951	O43303	CP110_HUMAN	centriolar coiled coil protein 110kDa	878					cell projection organization (GO:0030030)|centriole replication (GO:0007099)|centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cytokinesis (GO:0032465)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|stomach(3)|urinary_tract(1)	21						TTGTAATGGATGCAGCTGAAA	0.348																																					p.D878D		Atlas-SNP	.											.	CCP110	57	.	0			c.T2634C						.						134.0	120.0	125.0					16																	19556463		2196	4300	6496	SO:0001819	synonymous_variant	9738	exon10			AATGGATGCAGCT	AB007879	CCDS10579.1, CCDS55992.1	16p12.3	2014-02-20	2011-05-27		ENSG00000103540	ENSG00000103540			24342	protein-coding gene	gene with protein product		609544				9455477, 12361598, 16760425	Standard	NM_014711		Approved	KIAA0419, CP110	uc002dgl.4	O43303	OTTHUMG00000131459	ENST00000381396.5:c.2634T>C	chr16.hg19:g.19556463T>C		118.0	0.0		78.0	4.0	NM_001199022	B7WP23|O43335|Q68DV9|Q8NE13	Silent	SNP	ENST00000381396.5	hg19	CCDS55992.1																																																																																			.	.		0.348	CCP110-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254284.2	NM_014711	
ZNF720	124411	hgsc.bcm.edu	37	16	31734663	31734663	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:31734663C>T	ENST00000316491.9	+	3	414	c.215C>T	c.(214-216)gCc>gTc	p.A72V	ZNF720_ENST00000531864.2_Intron|ZNF720_ENST00000399681.3_5'UTR|ZNF720_ENST00000534369.1_Intron|ZNF720_ENST00000398696.3_Intron|ZNF720_ENST00000539915.1_Intron	NM_001130913.1	NP_001124385.1	Q7Z2F6	ZN720_HUMAN	zinc finger protein 720	72	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(1)|lung(1)|stomach(1)	4						GAGACAGTAGCCATCCAGCCA	0.478																																					p.A72V		Atlas-SNP	.											.	ZNF720	15	.	0			c.C215T						.						81.0	78.0	79.0					16																	31734663		692	1591	2283	SO:0001583	missense	124411	exon3			CAGTAGCCATCCA	AK128671	CCDS45473.1	16p11.2	2013-01-08				ENSG00000197302		"""Zinc fingers, C2H2-type"", ""-"""	26987	protein-coding gene	gene with protein product							Standard	NM_001130913		Approved		uc002ecq.3	Q7Z2F6		ENST00000316491.9:c.215C>T	chr16.hg19:g.31734663C>T	ENSP00000319222:p.Ala72Val	121.0	0.0		77.0	4.0	NM_001130913	Q6ZQX1	Missense_Mutation	SNP	ENST00000316491.9	hg19	CCDS45473.1	.	.	.	.	.	.	.	.	.	.	c	11.11	1.541691	0.27563	.	.	ENSG00000197302	ENST00000316491;ENST00000530881;ENST00000529515	T;T;T	0.00672	5.97;5.89;6.0	1.51	0.182	0.15077	Krueppel-associated box (1);	.	.	.	.	T	0.00845	0.0028	L	0.33245	0.995	0.09310	N	0.999994	P	0.36587	0.559	B	0.40066	0.318	T	0.50566	-0.8813	9	0.59425	D	0.04	.	4.8837	0.13692	0.0:0.6046:0.3954:0.0	.	72	Q7Z2F6	ZN720_HUMAN	V	72;113;72	ENSP00000319222:A72V;ENSP00000435171:A113V;ENSP00000437310:A72V	ENSP00000319222:A72V	A	+	2	0	ZNF720	31642164	0.000000	0.05858	0.102000	0.21198	0.377000	0.30045	-0.209000	0.09358	0.837000	0.34925	0.313000	0.20887	GCC	.	.		0.478	ZNF720-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000394883.3	NM_001004300	
ZNF267	10308	hgsc.bcm.edu	37	16	31926978	31926978	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:31926978A>G	ENST00000300870.10	+	4	1617	c.1408A>G	c.(1408-1410)Agc>Ggc	p.S470G		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	470					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						TAAAGTATGTAGCAAATCTTA	0.343																																					p.S470G		Atlas-SNP	.											.	ZNF267	94	.	0			c.A1408G						.						69.0	77.0	74.0					16																	31926978		2197	4298	6495	SO:0001583	missense	10308	exon4			GTATGTAGCAAAT	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.1408A>G	chr16.hg19:g.31926978A>G	ENSP00000300870:p.Ser470Gly	118.0	0.0		85.0	4.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	hg19	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	3.395	-0.123397	0.06795	.	.	ENSG00000185947	ENST00000300870	T	0.01998	4.51	0.458	-0.707	0.11245	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00580	0.0019	N	0.00450	-1.49	0.80722	D	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46498	-0.9187	9	0.02654	T	1	.	4.3506	0.11153	0.3743:0.0:0.6257:0.0	.	470	Q14586	ZN267_HUMAN	G	470	ENSP00000300870:S470G	ENSP00000300870:S470G	S	+	1	0	ZNF267	31834479	1.000000	0.71417	0.162000	0.22713	0.138000	0.21146	1.453000	0.35167	-0.417000	0.07461	-0.425000	0.05940	AGC	.	.		0.343	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
N4BP1	9683	hgsc.bcm.edu	37	16	48596262	48596262	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:48596262A>G	ENST00000262384.3	-	2	528	c.292T>C	c.(292-294)Ttt>Ctt	p.F98L	RP11-44I10.3_ENST00000563994.1_RNA	NM_153029.3	NP_694574.3	O75113	N4BP1_HUMAN	NEDD4 binding protein 1	98					cellular response to UV (GO:0034644)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein ubiquitination (GO:0031397)	nucleolus (GO:0005730)|PML body (GO:0016605)				breast(3)|kidney(2)|lung(11)|urinary_tract(1)	17		all_cancers(37;0.179)|all_lung(18;0.11)				CTTTTCAGAAACAGGCTCTCT	0.448																																					p.F98L		Atlas-SNP	.											.	N4BP1	121	.	0			c.T292C						.						55.0	56.0	56.0					16																	48596262		1948	4133	6081	SO:0001583	missense	9683	exon2			TCAGAAACAGGCT	AK026937	CCDS45479.1	16q12.1	2008-01-18				ENSG00000102921			29850	protein-coding gene	gene with protein product						9734811, 11717310	Standard	NM_153029		Approved		uc002efp.3	O75113		ENST00000262384.3:c.292T>C	chr16.hg19:g.48596262A>G	ENSP00000262384:p.Phe98Leu	162.0	0.0		99.0	4.0	NM_153029	A7MD49|Q2YDX1	Missense_Mutation	SNP	ENST00000262384.3	hg19	CCDS45479.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.451091	0.84209	.	.	ENSG00000102921	ENST00000262384	T	0.39592	1.07	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.64260	0.2582	M	0.70595	2.14	0.54753	D	0.999989	D	0.76494	0.999	D	0.80764	0.994	T	0.67956	-0.5536	10	0.72032	D	0.01	-22.7416	15.8164	0.78604	1.0:0.0:0.0:0.0	.	98	O75113	N4BP1_HUMAN	L	98	ENSP00000262384:F98L	ENSP00000262384:F98L	F	-	1	0	N4BP1	47153763	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.749000	0.91619	2.195000	0.70347	0.533000	0.62120	TTT	.	.		0.448	N4BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000429920.1	NM_014664	
NUP93	9688	hgsc.bcm.edu	37	16	56852599	56852599	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:56852599A>G	ENST00000308159.5	+	6	634	c.513A>G	c.(511-513)ggA>ggG	p.G171G	NUP93_ENST00000569842.1_Silent_p.G171G|NUP93_ENST00000542526.1_Silent_p.G48G|NUP93_ENST00000564887.1_Silent_p.G48G	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	171					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						GTGATGTGGGACCCCCTGGTC	0.443																																					p.G171G	Colon(33;610 796 1305 1705 38917)	Atlas-SNP	.											.	NUP93	75	.	0			c.A513G						.						128.0	122.0	124.0					16																	56852599		2198	4300	6498	SO:0001819	synonymous_variant	9688	exon6			TGTGGGACCCCCT	D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.513A>G	chr16.hg19:g.56852599A>G		155.0	0.0		86.0	5.0	NM_014669	B3KPQ8|Q14705	Silent	SNP	ENST00000308159.5	hg19	CCDS10769.1																																																																																			.	.		0.443	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257058.4	NM_014669	
CNOT1	23019	hgsc.bcm.edu	37	16	58576414	58576414	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:58576414T>C	ENST00000317147.5	-	32	4825	c.4493A>G	c.(4492-4494)gAc>gGc	p.D1498G	CNOT1_ENST00000569240.1_Missense_Mutation_p.D1493G|CNOT1_ENST00000245138.4_Missense_Mutation_p.D349G	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	1498	Interaction with CNOT6, CNOT6L, CNOT7 and CNOT8.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CTCACAATTGTCCTGAGCTAA	0.458																																					p.D1498G		Atlas-SNP	.											.	CNOT1	359	.	0			c.A4493G						.						183.0	200.0	194.0					16																	58576414		2198	4300	6498	SO:0001583	missense	23019	exon32			CAATTGTCCTGAG	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.4493A>G	chr16.hg19:g.58576414T>C	ENSP00000320949:p.Asp1498Gly	248.0	0.0		125.0	5.0	NM_016284	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.380911	0.82792	.	.	ENSG00000125107	ENST00000317147;ENST00000245138;ENST00000394200	T	0.57107	0.42	5.8	4.7	0.59300	CCR4-Not complex, Not1 subunit, domain of unknown function DUF3819 (1);	0.000000	0.85682	D	0.000000	T	0.75170	0.3813	M	0.88377	2.95	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	P;D;D	0.70227	0.884;0.968;0.946	T	0.79581	-0.1744	10	0.72032	D	0.01	-27.1022	13.1748	0.59619	0.0:0.0:0.1333:0.8667	.	349;1498;1493	B5MDN3;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	G	1498;349;1493	ENSP00000320949:D1498G	ENSP00000245138:D349G	D	-	2	0	CNOT1	57133915	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.273000	0.72581	0.999000	0.39023	0.533000	0.62120	GAC	.	.		0.458	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
COG8	84342	hgsc.bcm.edu	37	16	69368967	69368967	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:69368967A>G	ENST00000306875.4	-	3	984	c.870T>C	c.(868-870)cgT>cgC	p.R290R	COG8_ENST00000562081.1_Silent_p.R290R|RP11-343C2.12_ENST00000562949.1_5'Flank	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	290					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						AGAAGATGGCACGGTACTGGG	0.517																																					p.R290R		Atlas-SNP	.											.	COG8	32	.	0			c.T870C						.						83.0	69.0	74.0					16																	69368967		2198	4300	6498	SO:0001819	synonymous_variant	84342	exon3			GATGGCACGGTAC	AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.870T>C	chr16.hg19:g.69368967A>G		172.0	0.0		96.0	4.0	NM_032382	Q0VAK2|Q8WVV6|Q9H6F8	Silent	SNP	ENST00000306875.4	hg19	CCDS10876.1																																																																																			.	.		0.517	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268948.2	NM_032382	
TXNL4B	54957	hgsc.bcm.edu	37	16	72120695	72120695	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:72120695T>C	ENST00000268483.3	-	4	612	c.291A>G	c.(289-291)ccA>ccG	p.P97P	TXNL4B_ENST00000426362.2_Silent_p.P97P|RP11-384M15.3_ENST00000561827.1_RNA|TXNL4B_ENST00000423037.1_Silent_p.P97P	NM_001142318.1|NM_017853.2	NP_001135790.1|NP_060323.1	Q9NX01	TXN4B_HUMAN	thioredoxin-like 4B	97					mitotic nuclear division (GO:0007067)|mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)				cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(2)	8						TAGTGTGATCTGGAGATCTAG	0.373																																					p.P97P		Atlas-SNP	.											.	TXNL4B	17	.	0			c.A291G						.						69.0	66.0	67.0					16																	72120695		2198	4300	6498	SO:0001819	synonymous_variant	54957	exon4			GTGATCTGGAGAT	BC009646	CCDS10906.1	16q22.2	2012-11-19			ENSG00000140830	ENSG00000140830			26041	protein-coding gene	gene with protein product						15161931	Standard	NM_017853		Approved	FLJ20511, DLP, Dim2	uc010vmn.2	Q9NX01	OTTHUMG00000173453	ENST00000268483.3:c.291A>G	chr16.hg19:g.72120695T>C		157.0	0.0		109.0	5.0	NM_001142318	D3DWS6	Silent	SNP	ENST00000268483.3	hg19	CCDS10906.1																																																																																			.	.		0.373	TXNL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269007.2	NM_017853	
DHX38	9785	hgsc.bcm.edu	37	16	72135463	72135463	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:72135463A>G	ENST00000268482.3	+	11	1960	c.1451A>G	c.(1450-1452)gAg>gGg	p.E484G	DHX38_ENST00000536867.1_Intron	NM_014003.3	NP_054722.2	Q92620	PRP16_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 38	484					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(1)|large_intestine(16)|lung(15)|pancreas(1)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	48		Ovarian(137;0.125)				GTCAAGAAGGAGGAAGAGCCA	0.562																																					p.E484G	Melanoma(97;711 1442 7855 13832 28836)	Atlas-SNP	.											.	DHX38	91	.	0			c.A1451G						.						79.0	55.0	64.0					16																	72135463		2123	4147	6270	SO:0001583	missense	9785	exon11			AGAAGGAGGAAGA	AF038391	CCDS10907.1	16q22	2008-02-05	2003-06-13	2003-06-20	ENSG00000140829	ENSG00000140829		"""DEAH-boxes"""	17211	protein-coding gene	gene with protein product		605584	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 38"""	DDX38		9524131, 9039502	Standard	NM_014003		Approved	PRP16, KIAA0224, hPrp16, PRPF16	uc002fcb.3	Q92620	OTTHUMG00000137596	ENST00000268482.3:c.1451A>G	chr16.hg19:g.72135463A>G	ENSP00000268482:p.Glu484Gly	119.0	0.0		74.0	5.0	NM_014003	B4DVG8|D3DWS7|O75212|Q96HN7	Missense_Mutation	SNP	ENST00000268482.3	hg19	CCDS10907.1	.	.	.	.	.	.	.	.	.	.	A	15.81	2.942821	0.53079	.	.	ENSG00000140829	ENST00000268482	D	0.86030	-2.06	5.06	5.06	0.68205	.	0.120396	0.56097	D	0.000039	D	0.85093	0.5618	M	0.78049	2.395	0.80722	D	1	B	0.29378	0.243	B	0.25987	0.065	D	0.84828	0.0800	10	0.56958	D	0.05	.	14.85	0.70289	1.0:0.0:0.0:0.0	.	484	Q92620	PRP16_HUMAN	G	484	ENSP00000268482:E484G	ENSP00000268482:E484G	E	+	2	0	DHX38	70692964	0.999000	0.42202	1.000000	0.80357	0.817000	0.46193	4.195000	0.58400	1.909000	0.55274	0.533000	0.62120	GAG	.	.		0.562	DHX38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269004.3	NM_014003	
ZC3H18	124245	hgsc.bcm.edu	37	16	88666240	88666240	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr16:88666240T>C	ENST00000301011.5	+	6	1172	c.972T>C	c.(970-972)gaT>gaC	p.D324D	ZC3H18_ENST00000452588.2_Silent_p.D348D	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	324						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		AGGAGCCTGATTTTGAAGAGA	0.413																																					p.D324D	Ovarian(121;375 2276 20373 38669)	Atlas-SNP	.											.	ZC3H18	90	.	0			c.T972C						.						141.0	162.0	155.0					16																	88666240		2198	4300	6498	SO:0001819	synonymous_variant	124245	exon6			GCCTGATTTTGAA	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.972T>C	chr16.hg19:g.88666240T>C		106.0	0.0		64.0	4.0	NM_144604	Q96DG4|Q96MP7	Silent	SNP	ENST00000301011.5	hg19	CCDS10967.1																																																																																			.	.		0.413	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
FBXO39	162517	hgsc.bcm.edu	37	17	6690124	6690124	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:6690124A>G	ENST00000321535.4	+	3	1179	c.1049A>G	c.(1048-1050)aAc>aGc	p.N350S		NM_153230.2	NP_694962.1	Q8N4B4	FBX39_HUMAN	F-box protein 39	350										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	26						TTCAACAACAACCATGAGTCA	0.448																																					p.N350S		Atlas-SNP	.											.	FBXO39	50	.	0			c.A1049G						.						93.0	80.0	85.0					17																	6690124		2203	4300	6503	SO:0001583	missense	162517	exon3			ACAACAACCATGA	BC034782	CCDS11082.1	17p13.2	2014-01-21			ENSG00000177294	ENSG00000177294		"""F-boxes /  ""other"""""	28565	protein-coding gene	gene with protein product		609106				12477932	Standard	NM_153230		Approved	MGC35179, Fbx39, CT144	uc010vtg.2	Q8N4B4	OTTHUMG00000102062	ENST00000321535.4:c.1049A>G	chr17.hg19:g.6690124A>G	ENSP00000321386:p.Asn350Ser	177.0	0.0		114.0	5.0	NM_153230		Missense_Mutation	SNP	ENST00000321535.4	hg19	CCDS11082.1	.	.	.	.	.	.	.	.	.	.	A	11.39	1.625680	0.28889	.	.	ENSG00000177294	ENST00000321535	T	0.52526	0.66	5.36	5.36	0.76844	.	0.082472	0.51477	D	0.000082	T	0.49064	0.1535	N	0.19112	0.55	0.31606	N	0.652053	D	0.63880	0.993	D	0.68192	0.956	T	0.50558	-0.8814	10	0.19590	T	0.45	-28.0565	12.0193	0.53333	1.0:0.0:0.0:0.0	.	350	Q8N4B4	FBX39_HUMAN	S	350	ENSP00000321386:N350S	ENSP00000321386:N350S	N	+	2	0	FBXO39	6630848	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	1.315000	0.33608	2.163000	0.67991	0.528000	0.53228	AAC	.	.		0.448	FBXO39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219866.2	NM_153230	
ALOXE3	59344	hgsc.bcm.edu	37	17	8006758	8006758	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:8006758T>C	ENST00000448843.2	-	15	2179	c.1839A>G	c.(1837-1839)ccA>ccG	p.P613P	ALOXE3_ENST00000380149.1_Silent_p.P769P|ALOXE3_ENST00000318227.3_Silent_p.P745P	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	613	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						TGGTCTGGGGTGGGGGCTGCC	0.577																																					p.P745P		Atlas-SNP	.											.	ALOXE3	145	.	0			c.A2235G						.						104.0	93.0	97.0					17																	8006758		2203	4300	6503	SO:0001819	synonymous_variant	59344	exon15			CTGGGGTGGGGGC	AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1839A>G	chr17.hg19:g.8006758T>C		167.0	0.0		117.0	5.0	NM_001165960	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Silent	SNP	ENST00000448843.2	hg19	CCDS11130.1																																																																																			.	.		0.577	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441475.1		
ULK2	9706	hgsc.bcm.edu	37	17	19705089	19705089	+	Splice_Site	SNP	C	C	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:19705089C>A	ENST00000395544.4	-	16	1941		c.e16+1		ULK2_ENST00000361658.2_Splice_Site|ULK2_ENST00000580130.1_Splice_Site	NM_014683.3	NP_055498.3	Q8IYT8	ULK2_HUMAN	unc-51 like autophagy activating kinase 2						autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|negative regulation of collateral sprouting (GO:0048671)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)|response to starvation (GO:0042594)|signal transduction (GO:0007165)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|pre-autophagosomal structure membrane (GO:0034045)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(1)|skin(4)|stomach(1)	6	all_cancers(12;4.97e-05)|all_epithelial(12;0.00362)|Breast(13;0.186)					ACTCTACTTACCCAAAGGGGA	0.463																																					.		Atlas-SNP	.											.	ULK2	142	.	0			c.1441+1G>T						.						123.0	124.0	124.0					17																	19705089		2203	4300	6503	SO:0001630	splice_region_variant	9706	exon17			TACTTACCCAAAG	AB014523	CCDS11213.1	17p11.2	2014-02-12	2013-07-02		ENSG00000083290	ENSG00000083290	2.7.11.1		13480	protein-coding gene	gene with protein product		608650	"""unc-51 (C. elegans)-like kinase 2"", ""unc-51-like kinase 2 (C. elegans)"""			10557072	Standard	NM_014683		Approved	KIAA0623, Unc51.2, ATG1B	uc002gwn.3	Q8IYT8	OTTHUMG00000059511	ENST00000395544.4:c.1441+1G>T	chr17.hg19:g.19705089C>A		98.0	0.0		71.0	8.0	NM_014683	A8MY69|O75119	Splice_Site	SNP	ENST00000395544.4	hg19	CCDS11213.1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.993195	0.74703	.	.	ENSG00000083290	ENST00000361658;ENST00000395544	.	.	.	5.6	4.62	0.57501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9996	0.71462	0.1434:0.8566:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ULK2	19645681	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.261000	0.78400	1.354000	0.45846	0.655000	0.94253	.	.	.		0.463	ULK2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000132375.2	NM_014683	Intron
EFCAB5	374786	hgsc.bcm.edu	37	17	28378143	28378143	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:28378143T>C	ENST00000394835.3	+	9	1400	c.1208T>C	c.(1207-1209)tTt>tCt	p.F403S	EFCAB5_ENST00000378738.3_Missense_Mutation_p.F403S|EFCAB5_ENST00000536908.2_Missense_Mutation_p.F347S|EFCAB5_ENST00000320856.5_Missense_Mutation_p.F403S|EFCAB5_ENST00000394832.2_Missense_Mutation_p.F403S|EFCAB5_ENST00000541045.1_Missense_Mutation_p.F60S	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	403							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						TAGGTAGGGTTTTTGGATCGG	0.398																																					p.F403S		Atlas-SNP	.											EFCAB5,colon,carcinoma,0,1	EFCAB5	122	.	0			c.T1208C						.						103.0	90.0	94.0					17																	28378143		1862	4093	5955	SO:0001583	missense	374786	exon9			TAGGGTTTTTGGA	AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1208T>C	chr17.hg19:g.28378143T>C	ENSP00000378312:p.Phe403Ser	140.0	0.0		68.0	3.0	NM_198529	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	ENST00000394835.3	hg19	CCDS11254.2	.	.	.	.	.	.	.	.	.	.	T	15.76	2.927781	0.52759	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.47869	0.83;0.83;0.83;0.83;0.83;0.83;0.83	5.48	3.23	0.37069	.	0.933792	0.08894	N	0.878280	T	0.54902	0.1887	M	0.66939	2.045	0.22050	N	0.999396	P;P;D;D;B;P	0.59767	0.842;0.902;0.986;0.986;0.225;0.763	B;B;P;P;B;B	0.53035	0.185;0.342;0.59;0.716;0.048;0.387	T	0.35201	-0.9798	10	0.35671	T	0.21	-1.0477	6.1085	0.20087	0.0:0.088:0.1643:0.7477	.	347;347;403;403;403;403	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	S	347;146;60;403;403;403;403;347;209	ENSP00000440619:F347S;ENSP00000445575:F60S;ENSP00000378312:F403S;ENSP00000322003:F403S;ENSP00000378309:F403S;ENSP00000368012:F403S;ENSP00000417009:F209S	ENSP00000322003:F403S	F	+	2	0	EFCAB5	25402269	1.000000	0.71417	0.507000	0.27676	0.699000	0.40488	2.519000	0.45546	0.364000	0.24374	0.533000	0.62120	TTT	.	.		0.398	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256120.4	NM_198529	
TCAP	8557	hgsc.bcm.edu	37	17	37822111	37822111	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:37822111T>C	ENST00000309889.2	+	2	1426	c.253T>C	c.(253-255)Tac>Cac	p.Y85H	PNMT_ENST00000269582.2_5'Flank|PNMT_ENST00000581428.1_5'Flank|TCAP_ENST00000578283.1_Missense_Mutation_p.Y61H|PNMT_ENST00000394246.1_5'Flank			O15273	TELT_HUMAN	titin-cap	85					adult heart development (GO:0007512)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of mechanical stimulus (GO:0050982)|detection of muscle stretch (GO:0035995)|muscle filament sliding (GO:0030049)|otic vesicle formation (GO:0030916)|protein complex assembly (GO:0006461)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle contraction (GO:0003009)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)	cytosol (GO:0005829)|I band (GO:0031674)|Z disc (GO:0030018)	FATZ binding (GO:0051373)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			kidney(1)|lung(1)	2	all_cancers(6;6.59e-85)|all_epithelial(6;2.89e-103)|Breast(7;1.05e-86)|Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;3.87e-45)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			CCAGCTGCCCTACCAGCGGGT	0.677																																					p.Y85H		Atlas-SNP	.											.	TCAP	12	.	0			c.T253C						.						20.0	20.0	20.0					17																	37822111		2198	4292	6490	SO:0001583	missense	8557	exon2			CTGCCCTACCAGC	AJ000491	CCDS11342.1	17q12	2014-09-17	2012-09-20		ENSG00000173991	ENSG00000173991			11610	protein-coding gene	gene with protein product	"""19 kDa sarcomeric protein"""	604488	"""limb girdle muscular dystrophy 2G (autosomal recessive)"", ""titin-cap (telethonin)"""	LGMD2G		9350988, 9817758	Standard	NM_003673		Approved	T-cap, TELE, telethonin, CMD1N	uc002hsh.3	O15273	OTTHUMG00000133215	ENST00000309889.2:c.253T>C	chr17.hg19:g.37822111T>C	ENSP00000312624:p.Tyr85His	56.0	0.0		43.0	8.0	NM_003673	Q96L27	Missense_Mutation	SNP	ENST00000309889.2	hg19	CCDS11342.1	.	.	.	.	.	.	.	.	.	.	T	13.43	2.234409	0.39498	.	.	ENSG00000173991	ENST00000309889	D	0.88201	-2.35	5.71	5.71	0.89125	.	0.125315	0.53938	D	0.000047	D	0.90817	0.7116	L	0.29908	0.895	0.51482	D	0.999924	D	0.76494	0.999	D	0.72338	0.977	D	0.92096	0.5684	10	0.87932	D	0	-27.7638	14.9524	0.71086	0.0:0.0:0.0:1.0	.	85	O15273	TELT_HUMAN	H	85	ENSP00000312624:Y85H	ENSP00000312624:Y85H	Y	+	1	0	TCAP	35075637	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.142000	0.64820	2.176000	0.68965	0.379000	0.24179	TAC	.	.		0.677	TCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256942.1	NM_003673	
BRCA1	672	hgsc.bcm.edu	37	17	41228506	41228506	+	Splice_Site	SNP	T	T	C	rs80357854		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:41228506T>C	ENST00000357654.3	-	13	4601	c.4483A>G	c.(4483-4485)Agg>Ggg	p.R1495G	BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000352993.3_Splice_Site_p.R353G|BRCA1_ENST00000471181.2_Splice_Site_p.R1516G|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000346315.3_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000354071.3_Intron|BRCA1_ENST00000351666.3_Splice_Site_p.R312G|BRCA1_ENST00000309486.4_Splice_Site_p.R1199G|BRCA1_ENST00000468300.1_Splice_Site_p.R391G|BRCA1_ENST00000493795.1_Splice_Site_p.R1448G|BRCA1_ENST00000491747.2_Splice_Site_p.R391G	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1495			R -> M (in BC; unknown pathological significance). {ECO:0000269|PubMed:17924331}.		androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GTTTCTTACCTTTCCACTCCT	0.353			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.R1516G		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.A4546G	GRCh37	CD984132	BRCA1	D	rs80357854	.						121.0	111.0	114.0					17																	41228506		2202	4300	6502	SO:0001630	splice_region_variant	672	exon14	Familial Cancer Database		CTTACCTTTCCAC	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4484+1A>G	chr17.hg19:g.41228506T>C		161.0	0.0		84.0	4.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	T	9.996	1.232259	0.22626	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000352993;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919	D;D;D;D;D;D;D;D;D;D	0.90324	-2.26;-2.33;-2.47;-2.16;-2.23;-2.65;-2.38;-2.11;-1.88;-2.3	4.97	1.4	0.22301	.	0.486738	0.19146	N	0.121561	D	0.89164	0.6637	L	0.36672	1.1	0.30091	N	0.808308	D;P;B;B;B;B;B;B	0.54601	0.967;0.688;0.024;0.043;0.024;0.024;0.094;0.09	D;B;B;B;B;B;B;B	0.63597	0.916;0.138;0.012;0.021;0.012;0.012;0.049;0.046	T	0.82259	-0.0546	10	0.42905	T	0.14	-0.4238	3.3868	0.07274	0.0:0.2164:0.2066:0.577	.	391;344;390;392;391;1517;1495;1495	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;.;BRCA1_HUMAN;.	G	1495;1516;353;312;1199;391;344;1517;1448;390;391;266;345	ENSP00000350283:R1495G;ENSP00000312236:R353G;ENSP00000338007:R312G;ENSP00000310938:R1199G;ENSP00000417148:R391G;ENSP00000377294:R344G;ENSP00000418775:R1448G;ENSP00000420412:R391G;ENSP00000419481:R266G;ENSP00000418819:R345G	ENSP00000310938:R1199G	R	-	1	2	BRCA1	38482032	0.985000	0.35326	0.941000	0.38009	0.421000	0.31385	0.494000	0.22467	0.366000	0.24427	0.459000	0.35465	AGG	.	.		0.353	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	Missense_Mutation
STXBP4	252983	hgsc.bcm.edu	37	17	53155463	53155463	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:53155463A>G	ENST00000376352.2	+	14	1420	c.1213A>G	c.(1213-1215)Aga>Gga	p.R405G	STXBP4_ENST00000434978.2_Missense_Mutation_p.R383G	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	405					cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						TTTAAAAAAGAGAATCATGGT	0.348																																					p.R405G		Atlas-SNP	.											.	STXBP4	41	.	0			c.A1213G						.						82.0	84.0	83.0					17																	53155463		2203	4300	6503	SO:0001583	missense	252983	exon14			AAAAAGAGAATCA	BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1213A>G	chr17.hg19:g.53155463A>G	ENSP00000365530:p.Arg405Gly	154.0	0.0		121.0	5.0	NM_178509	Q8IVZ5	Missense_Mutation	SNP	ENST00000376352.2	hg19	CCDS11584.2	.	.	.	.	.	.	.	.	.	.	A	21.6	4.166225	0.78339	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.54866	0.55;0.55	5.33	4.24	0.50183	.	0.042741	0.85682	D	0.000000	T	0.72095	0.3418	M	0.80616	2.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.962	T	0.75263	-0.3379	10	0.87932	D	0	-18.8204	12.0609	0.53562	0.8559:0.1441:0.0:0.0	.	383;405	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	G	405;383	ENSP00000365530:R405G;ENSP00000391087:R383G	ENSP00000365530:R405G	R	+	1	2	STXBP4	50510462	1.000000	0.71417	0.998000	0.56505	0.882000	0.50991	6.265000	0.72534	0.948000	0.37687	0.533000	0.62120	AGA	.	.		0.348	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157184.1	NM_178509	
ANKFN1	162282	hgsc.bcm.edu	37	17	54428134	54428134	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:54428134C>T	ENST00000318698.2	+	4	240	c.205C>T	c.(205-207)Cgt>Tgt	p.R69C	ANKFN1_ENST00000566473.2_Missense_Mutation_p.R69C	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	69								p.R69C(1)		NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						TAGGAATTGTCGTGTGAAAAT	0.383																																					p.R69C		Atlas-SNP	.											ANKFN1,rectum,carcinoma,0,1	ANKFN1	115	.	1	Substitution - Missense(1)	large_intestine(1)	c.C205T						.						89.0	89.0	89.0					17																	54428134		2203	4300	6503	SO:0001583	missense	162282	exon4			AATTGTCGTGTGA	AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.205C>T	chr17.hg19:g.54428134C>T	ENSP00000321627:p.Arg69Cys	106.0	0.0		49.0	2.0	NM_153228		Missense_Mutation	SNP	ENST00000318698.2	hg19	CCDS32686.1	.	.	.	.	.	.	.	.	.	.	c	7.864	0.726604	0.15439	.	.	ENSG00000153930	ENST00000318698	T	0.23348	1.91	5.57	-6.12	0.02124	.	1.490830	0.03541	N	0.223895	T	0.19644	0.0472	L	0.29908	0.895	0.27876	N	0.939853	B	0.02656	0.0	B	0.01281	0.0	T	0.20042	-1.0287	10	0.46703	T	0.11	.	12.1817	0.54216	0.0:0.3146:0.0821:0.6034	.	69	Q8N957	ANKF1_HUMAN	C	69	ENSP00000321627:R69C	ENSP00000321627:R69C	R	+	1	0	ANKFN1	51783133	0.000000	0.05858	0.002000	0.10522	0.547000	0.35210	-1.502000	0.02279	-2.206000	0.00741	-1.739000	0.00688	CGT	.	.		0.383	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338043.1	NM_153228	
SEPT4	5414	hgsc.bcm.edu	37	17	56598359	56598359	+	Splice_Site	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:56598359T>C	ENST00000317268.3	-	10	1453	c.1277A>G	c.(1276-1278)aAc>aGc	p.N426S	SEPT4_ENST00000426861.1_3'UTR|SEPT4_ENST00000412945.3_Splice_Site_p.N418S|SEPT4_ENST00000457347.2_Splice_Site_p.N441S|RP11-112H10.4_ENST00000580589.1_RNA|SEPT4_ENST00000579371.1_Splice_Site_p.K327R|SEPT4_ENST00000317256.6_Splice_Site_p.N407S|SEPT4_ENST00000393086.1_Splice_Site_p.N407S|SEPT4_ENST00000583114.1_Splice_Site_p.N279S|SEPT4_ENST00000580844.1_Splice_Site_p.N327S	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4	426					apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CTGGTCATACTTGCGATTCCG	0.557											OREG0024614	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.N441S		Atlas-SNP	.											.	SEPT4	48	.	0			c.A1322G						.						151.0	133.0	139.0					17																	56598359		2203	4300	6503	SO:0001630	splice_region_variant	5414	exon11			TCATACTTGCGAT	AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.1277+1A>G	chr17.hg19:g.56598359T>C		152.0	0.0	1016	94.0	5.0	NM_001256782	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	Missense_Mutation	SNP	ENST00000317268.3	hg19	CCDS11610.1	.	.	.	.	.	.	.	.	.	.	T	11.01	1.513060	0.27123	.	.	ENSG00000108387	ENST00000412945;ENST00000457347;ENST00000317256;ENST00000317268;ENST00000393086	T;T;T;T	0.50548	0.74;0.75;0.74;0.75	5.59	5.59	0.84812	.	0.094954	0.64402	D	0.000001	T	0.38904	0.1058	L	0.33189	0.99	0.58432	D	0.999992	B;P;B;B;B	0.44429	0.002;0.835;0.002;0.003;0.001	B;B;B;B;B	0.41271	0.011;0.352;0.011;0.006;0.005	T	0.17198	-1.0377	9	.	.	.	.	14.0047	0.64456	0.0:0.0:0.0:1.0	.	418;441;407;279;426	O43236-3;O43236-4;O43236-2;O43236-5;O43236	.;.;.;.;SEPT4_HUMAN	S	418;440;407;426;407	ENSP00000414779:N418S;ENSP00000321071:N407S;ENSP00000321674:N426S;ENSP00000376801:N407S	.	N	-	2	0	SEPT4	53953358	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.151000	0.58105	2.231000	0.72958	0.533000	0.62120	AAC	.	.		0.557	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445420.1	NM_080417	Missense_Mutation
SLC39A11	201266	hgsc.bcm.edu	37	17	71027829	71027829	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:71027829A>G	ENST00000542342.2	-	4	260	c.172T>C	c.(172-174)Tct>Cct	p.S58P	SLC39A11_ENST00000255559.3_Missense_Mutation_p.S58P|SLC39A11_ENST00000579732.1_Missense_Mutation_p.S58P	NM_001159770.1	NP_001153242.1	Q8N1S5	S39AB_HUMAN	solute carrier family 39, member 11	58					zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			endometrium(1)|large_intestine(4)|liver(2)|lung(4)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GCCAGAAGAGACCAATAGGAA	0.537																																					p.S58P	NSCLC(95;736 1527 12296 39625 41839)	Atlas-SNP	.											.	SLC39A11	32	.	0			c.T172C						.						125.0	110.0	115.0					17																	71027829		2203	4300	6503	SO:0001583	missense	201266	exon4			GAAGAGACCAATA	AF331643	CCDS11690.1, CCDS54160.1	17q24.3-q25.1	2014-08-12	2013-07-17	2003-10-24	ENSG00000133195	ENSG00000133195		"""Solute carriers"""	14463	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 26"""	C17orf26		11707075	Standard	NM_139177		Approved		uc002jjb.3	Q8N1S5	OTTHUMG00000178306	ENST00000542342.2:c.172T>C	chr17.hg19:g.71027829A>G	ENSP00000445829:p.Ser58Pro	125.0	0.0		64.0	5.0	NM_001159770	B2R8H7|Q8WZ81	Missense_Mutation	SNP	ENST00000542342.2	hg19	CCDS54160.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.572696	0.86542	.	.	ENSG00000133195	ENST00000542342;ENST00000255559	T;T	0.50277	0.75;0.75	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.76471	0.3992	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83588	0.0121	10	0.87932	D	0	.	13.7113	0.62670	1.0:0.0:0.0:0.0	.	58;58	Q8N1S5;Q8N1S5-2	S39AB_HUMAN;.	P	58	ENSP00000445829:S58P;ENSP00000255559:S58P	ENSP00000255559:S58P	S	-	1	0	SLC39A11	68539424	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	8.105000	0.89553	1.923000	0.55706	0.533000	0.62120	TCT	.	.		0.537	SLC39A11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441442.1		
OTOP3	347741	hgsc.bcm.edu	37	17	72939421	72939421	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:72939421T>C	ENST00000328801.4	+	4	668	c.668T>C	c.(667-669)gTc>gCc	p.V223A		NM_178233.1	NP_839947.1	Q7RTS5	OTOP3_HUMAN	otopetrin 3	223						integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_lung(278;0.151)|Lung NSC(278;0.185)					TGTGTTCGGGTCCAGACCAAC	0.597																																					p.V223A		Atlas-SNP	.											.	OTOP3	64	.	0			c.T668C						.						142.0	135.0	137.0					17																	72939421		2203	4300	6503	SO:0001583	missense	347741	exon4			TTCGGGTCCAGAC	BK000568	CCDS11709.1	17q25	2004-01-19				ENSG00000182938			19658	protein-coding gene	gene with protein product		607828				12651873	Standard	NM_178233		Approved		uc010wrr.3	Q7RTS5		ENST00000328801.4:c.668T>C	chr17.hg19:g.72939421T>C	ENSP00000328090:p.Val223Ala	137.0	0.0		100.0	4.0	NM_178233		Missense_Mutation	SNP	ENST00000328801.4	hg19	CCDS11709.1	.	.	.	.	.	.	.	.	.	.	T	14.69	2.609288	0.46527	.	.	ENSG00000182938	ENST00000328801	T	0.08546	3.08	5.27	5.27	0.74061	.	0.508988	0.18406	N	0.142192	T	0.08891	0.0220	L	0.50333	1.59	0.37078	D	0.898867	P	0.40909	0.732	B	0.33846	0.171	T	0.16928	-1.0386	10	0.52906	T	0.07	-7.4115	11.5673	0.50813	0.0:0.0:0.0:1.0	.	223	Q7RTS5	OTOP3_HUMAN	A	223	ENSP00000328090:V223A	ENSP00000328090:V223A	V	+	2	0	OTOP3	70451016	1.000000	0.71417	0.996000	0.52242	0.928000	0.56348	3.577000	0.53885	1.987000	0.57996	0.460000	0.39030	GTC	.	.		0.597	OTOP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445308.1	NM_178233	
UNK	85451	hgsc.bcm.edu	37	17	73820373	73820373	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:73820373C>T	ENST00000589666.1	+	16	2418	c.2308C>T	c.(2308-2310)Ctt>Ttt	p.L770F	UNK_ENST00000293218.3_Missense_Mutation_p.L846F	NM_001080419.2	NP_001073888.2	Q9C0B0	UNK_HUMAN	unkempt family zinc finger	770							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.L846I(1)|p.L770I(1)		cervix(3)|endometrium(8)|kidney(2)|large_intestine(5)|lung(3)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	25			all cancers(21;2.61e-06)|Epithelial(20;7.39e-06)|BRCA - Breast invasive adenocarcinoma(9;0.00194)|LUSC - Lung squamous cell carcinoma(166;0.154)			GGTGAAATGCCTTAAGTGTCA	0.617																																					p.L770F		Atlas-SNP	.											UNK_ENST00000293218,NS,carcinoma,0,2	UNK	87	.	2	Substitution - Missense(2)	endometrium(2)	c.C2308T						.						41.0	42.0	41.0					17																	73820373		2125	4243	6368	SO:0001583	missense	85451	exon16			AAATGCCTTAAGT	AB051540	CCDS45778.1, CCDS45778.2	17q25.3	2013-10-17	2013-10-17	2007-02-06		ENSG00000132478		"""Zinc fingers, CCCH-type domain containing"""	29369	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 5"", ""zinc finger CCCH-type containing 5"", ""unkempt homolog (Drosophila)"""	ZC3HDC5, ZC3H5		11214970	Standard	NM_001080419		Approved	KIAA1753	uc021udd.2	Q9C0B0		ENST00000589666.1:c.2308C>T	chr17.hg19:g.73820373C>T	ENSP00000464893:p.Leu770Phe	54.0	0.0		37.0	3.0	NM_001080419		Missense_Mutation	SNP	ENST00000589666.1	hg19	CCDS45778.2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107085	0.77096	.	.	ENSG00000132478	ENST00000293218	.	.	.	4.91	4.91	0.64330	Zinc finger, RING-type (1);	0.296899	0.31859	N	0.006956	T	0.53948	0.1828	L	0.51422	1.61	0.42428	D	0.992668	P	0.44578	0.838	B	0.38562	0.276	T	0.62609	-0.6818	9	0.59425	D	0.04	-4.3399	18.3073	0.90187	0.0:1.0:0.0:0.0	.	770	Q9C0B0	UNK_HUMAN	F	846	.	ENSP00000293218:L846F	L	+	1	0	UNK	71331968	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.602000	0.54066	2.561000	0.86390	0.563000	0.77884	CTT	.	.		0.617	UNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448835.1	NM_001080419	
TMC8	147138	hgsc.bcm.edu	37	17	76134220	76134220	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:76134220T>C	ENST00000318430.5	+	12	1858	c.1484T>C	c.(1483-1485)cTg>cCg	p.L495P	TMC8_ENST00000589691.1_Missense_Mutation_p.L272P	NM_152468.4	NP_689681.2	Q8IU68	TMC8_HUMAN	transmembrane channel-like 8	495					ion transport (GO:0006811)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|regulation of cell growth (GO:0001558)|regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902041)|zinc ion homeostasis (GO:0055069)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)|OV - Ovarian serous cystadenocarcinoma(97;0.192)			TGCCCCCTGCTGCCCCTGCTG	0.617																																					p.L495P		Atlas-SNP	.											.	TMC8	44	.	0			c.T1484C						.						91.0	91.0	91.0					17																	76134220		2203	4300	6503	SO:0001583	missense	147138	exon12			CCCTGCTGCCCCT	AY057380	CCDS32749.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000167895	ENSG00000167895			20474	protein-coding gene	gene with protein product		605829	"""epidermodysplasia verruciformis 2"""	EVER2		12426567	Standard	NM_152468		Approved	EVIN2	uc002jup.2	Q8IU68		ENST00000318430.5:c.1484T>C	chr17.hg19:g.76134220T>C	ENSP00000325561:p.Leu495Pro	162.0	0.0		112.0	5.0	NM_152468	Q2YDC0|Q8IWU7|Q8N358|Q8NF04	Missense_Mutation	SNP	ENST00000318430.5	hg19	CCDS32749.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.403403	0.83230	.	.	ENSG00000167895	ENST00000318430	T	0.79845	-1.31	4.57	4.57	0.56435	.	0.000000	0.64402	D	0.000001	D	0.90789	0.7108	M	0.89534	3.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92549	0.6048	10	0.87932	D	0	-16.866	13.1778	0.59637	0.0:0.0:0.0:1.0	.	495	Q8IU68	TMC8_HUMAN	P	495	ENSP00000325561:L495P	ENSP00000325561:L495P	L	+	2	0	TMC8	73645815	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.948000	0.75965	1.814000	0.52955	0.460000	0.39030	CTG	.	.		0.617	TMC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436900.3		
LRRC45	201255	hgsc.bcm.edu	37	17	79986334	79986334	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr17:79986334A>G	ENST00000306688.3	+	11	1529	c.1187A>G	c.(1186-1188)gAg>gGg	p.E396G		NM_144999.2	NP_659436.1	Q96CN5	LRC45_HUMAN	leucine rich repeat containing 45	396						centrosome (GO:0005813)				lung(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	5	all_neural(118;0.0878)|Ovarian(332;0.12)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0191)			ACCAGGCAGGAGATGACCAGC	0.662																																					p.E396G		Atlas-SNP	.											.	LRRC45	22	.	0			c.A1187G						.						39.0	42.0	41.0					17																	79986334		2195	4297	6492	SO:0001583	missense	201255	exon11			GGCAGGAGATGAC	BC014109	CCDS11797.1	17q25.3	2005-08-09				ENSG00000169683			28302	protein-coding gene	gene with protein product						12477932	Standard	NM_144999		Approved	MGC20806	uc002kde.3	Q96CN5		ENST00000306688.3:c.1187A>G	chr17.hg19:g.79986334A>G	ENSP00000306760:p.Glu396Gly	148.0	0.0		85.0	4.0	NM_144999		Missense_Mutation	SNP	ENST00000306688.3	hg19	CCDS11797.1	.	.	.	.	.	.	.	.	.	.	A	19.45	3.830009	0.71258	.	.	ENSG00000169683	ENST00000306688	T	0.45668	0.89	3.93	3.93	0.45458	.	0.225630	0.37623	N	0.002019	T	0.45115	0.1326	M	0.71581	2.175	0.51233	D	0.999912	P	0.46395	0.877	B	0.43360	0.417	T	0.49457	-0.8938	9	.	.	.	-23.238	12.9226	0.58241	1.0:0.0:0.0:0.0	.	396	Q96CN5	LRC45_HUMAN	G	396	ENSP00000306760:E396G	.	E	+	2	0	LRRC45	77579623	1.000000	0.71417	1.000000	0.80357	0.582000	0.36321	8.767000	0.91732	1.641000	0.50575	0.459000	0.35465	GAG	.	.		0.662	LRRC45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442058.1	NM_144999	
SMCHD1	23347	hgsc.bcm.edu	37	18	2728556	2728556	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:2728556A>G	ENST00000320876.6	+	23	3213	c.2875A>G	c.(2875-2877)Aac>Gac	p.N959D	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.N959D|SMCHD1_ENST00000609587.1_3'UTR	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	959					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGAATCAGACAACATAACAGC	0.348																																					p.N959D		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A2875G						.						106.0	101.0	103.0					18																	2728556		1858	4098	5956	SO:0001583	missense	23347	exon23			TCAGACAACATAA	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2875A>G	chr18.hg19:g.2728556A>G	ENSP00000326603:p.Asn959Asp	124.0	0.0		81.0	5.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567745	0.86439	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.46451	0.87;0.9	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.62612	0.2442	M	0.63843	1.955	0.38022	D	0.934897	D	0.69078	0.997	D	0.73380	0.98	T	0.68796	-0.5314	10	0.72032	D	0.01	-20.6615	16.226	0.82293	1.0:0.0:0.0:0.0	.	959	A6NHR9	SMHD1_HUMAN	D	959	ENSP00000326603:N959D;ENSP00000261598:N959D	ENSP00000261598:N959D	N	+	1	0	SMCHD1	2718556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.748000	0.74877	2.230000	0.72887	0.528000	0.53228	AAC	.	.		0.348	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
LAMA1	284217	hgsc.bcm.edu	37	18	7016513	7016513	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:7016513G>T	ENST00000389658.3	-	21	3059	c.2966C>A	c.(2965-2967)gCc>gAc	p.A989D		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	989	Laminin EGF-like 10. {ECO:0000255|PROSITE-ProRule:PRU00460}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				ATCCTGGTAGGCGTAGAAGCC	0.542																																					p.A989D		Atlas-SNP	.											.	LAMA1	458	.	0			c.C2966A						.						143.0	99.0	114.0					18																	7016513		2203	4300	6503	SO:0001583	missense	284217	exon21			TGGTAGGCGTAGA	X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.2966C>A	chr18.hg19:g.7016513G>T	ENSP00000374309:p.Ala989Asp	66.0	0.0		56.0	10.0	NM_005559		Missense_Mutation	SNP	ENST00000389658.3	hg19	CCDS32787.1	.	.	.	.	.	.	.	.	.	.	G	4.633	0.117620	0.08881	.	.	ENSG00000101680	ENST00000389658	T	0.61158	0.13	5.8	-0.853	0.10709	EGF-like, laminin (4);	0.296144	0.30732	N	0.008998	T	0.32734	0.0839	N	0.05608	-0.0099999999999999	0.09310	N	1	B	0.32653	0.379	B	0.34536	0.185	T	0.28933	-1.0028	10	0.59425	D	0.04	.	8.7892	0.34841	0.0587:0.4137:0.4202:0.1074	.	989	P25391	LAMA1_HUMAN	D	989	ENSP00000374309:A989D	ENSP00000374309:A989D	A	-	2	0	LAMA1	7006513	0.000000	0.05858	0.000000	0.03702	0.194000	0.23727	0.480000	0.22244	-0.143000	0.11334	-0.149000	0.13747	GCC	.	.		0.542	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257369.1	NM_005559	
MTCL1	23255	hgsc.bcm.edu	37	18	8718551	8718551	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:8718551T>C	ENST00000306329.11	+	2	1183	c.1183T>C	c.(1183-1185)Tac>Cac	p.Y395H	Y_RNA_ENST00000516510.1_RNA|SOGA2_ENST00000400050.3_Missense_Mutation_p.Y35H|SOGA2_ENST00000517570.1_Missense_Mutation_p.Y35H|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000359865.3_Missense_Mutation_p.Y35H																							AATCCTGCAGTACCGTCTTCG	0.512																																					p.Y35H		Atlas-SNP	.											.	.	.	.	0			c.T103C						.						110.0	99.0	102.0					18																	8718551		2203	4300	6503	SO:0001583	missense	23255	exon3			CTGCAGTACCGTC																												ENST00000306329.11:c.1183T>C	chr18.hg19:g.8718551T>C	ENSP00000305027:p.Tyr395His	119.0	0.0		81.0	5.0	NM_015210		Missense_Mutation	SNP	ENST00000306329.11	hg19		.	.	.	.	.	.	.	.	.	.	T	28.7	4.944215	0.92593	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.77620	-1.11;-1.11;-1.11	5.01	5.01	0.66863	.	0.000000	0.43747	D	0.000536	D	0.85243	0.5652	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83306	-0.0025	10	0.27082	T	0.32	-28.2908	14.8775	0.70504	0.0:0.0:0.0:1.0	.	35	Q9Y4B5-3	.	H	56;35;35;35	ENSP00000429556:Y35H;ENSP00000352927:Y35H;ENSP00000382924:Y35H	ENSP00000305027:Y56H	Y	+	1	0	CCDC165	8708551	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.868000	0.87116	2.100000	0.63781	0.460000	0.39030	TAC	.	.		0.512	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000444141.1		
IMPACT	55364	hgsc.bcm.edu	37	18	22029801	22029801	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:22029801G>A	ENST00000284202.4	+	10	919	c.778G>A	c.(778-780)Gtc>Atc	p.V260I		NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	260					negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					TGTGAAGAATGTCATGGTGGT	0.348																																					p.V260I		Atlas-SNP	.											.	IMPACT	37	.	0			c.G778A						.						101.0	91.0	94.0					18																	22029801		2203	4300	6503	SO:0001583	missense	55364	exon10			AAGAATGTCATGG	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.778G>A	chr18.hg19:g.22029801G>A	ENSP00000284202:p.Val260Ile	123.0	0.0		93.0	11.0	NM_018439	A8MXG0|Q49AM0|Q9H2X4	Missense_Mutation	SNP	ENST00000284202.4	hg19	CCDS11886.1	.	.	.	.	.	.	.	.	.	.	G	17.10	3.301790	0.60195	.	.	ENSG00000154059	ENST00000284202	T	0.46063	0.88	5.93	5.93	0.95920	Ribosomal protein S5 domain 2-type fold (1);Impact, N-terminal (2);Uncharacterised protein family UPF0029, Impact, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.53899	0.1825	M	0.62016	1.91	0.80722	D	1	P	0.44877	0.845	P	0.48654	0.585	T	0.53690	-0.8403	10	0.62326	D	0.03	.	19.1136	0.93328	0.0:0.0:1.0:0.0	.	260	Q9P2X3	IMPCT_HUMAN	I	260	ENSP00000284202:V260I	ENSP00000284202:V260I	V	+	1	0	IMPACT	20283799	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.250000	0.95477	2.810000	0.96702	0.655000	0.94253	GTC	.	.		0.348	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254901.1	NM_018439	
DSG3	1830	hgsc.bcm.edu	37	18	29045290	29045290	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:29045290G>C	ENST00000257189.4	+	10	1364	c.1281G>C	c.(1279-1281)atG>atC	p.M427I		NM_001944.2	NP_001935.2	P32926	DSG3_HUMAN	desmoglein 3	427	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(28)|ovary(4)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			GATATGTCATGGGACGTAACG	0.264																																					p.M427I		Atlas-SNP	.											.	DSG3	172	.	0			c.G1281C						.						67.0	73.0	71.0					18																	29045290		2203	4300	6503	SO:0001583	missense	1830	exon10			TGTCATGGGACGT	M76482	CCDS11898.1	18q12.1	2010-06-24	2010-06-24		ENSG00000134757	ENSG00000134757		"""Cadherins / Major cadherins"""	3050	protein-coding gene	gene with protein product	"""pemphigus vulgaris antigen"""	169615	"""desmoglein 3 (pemphigus vulgaris antigen)"""			1601426	Standard	NM_001944		Approved	CDHF6	uc002kws.3	P32926	OTTHUMG00000131985	ENST00000257189.4:c.1281G>C	chr18.hg19:g.29045290G>C	ENSP00000257189:p.Met427Ile	277.0	0.0		179.0	12.0	NM_001944	A8K2V2	Missense_Mutation	SNP	ENST00000257189.4	hg19	CCDS11898.1	.	.	.	.	.	.	.	.	.	.	G	3.256	-0.152135	0.06585	.	.	ENSG00000134757	ENST00000257189	T	0.54479	0.57	5.82	4.94	0.65067	Cadherin (3);Cadherin-like (1);	0.234251	0.29722	N	0.011370	T	0.20861	0.0502	N	0.03000	-0.44	0.26889	N	0.967371	B	0.11235	0.004	B	0.10450	0.005	T	0.31194	-0.9952	10	0.02654	T	1	.	5.5788	0.17238	0.1735:0.1736:0.653:0.0	.	427	P32926	DSG3_HUMAN	I	427	ENSP00000257189:M427I	ENSP00000257189:M427I	M	+	3	0	DSG3	27299288	1.000000	0.71417	0.993000	0.49108	0.033000	0.12548	1.963000	0.40452	1.436000	0.47453	0.467000	0.42956	ATG	.	.		0.264	DSG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254949.1	NM_001944	
ASXL3	80816	hgsc.bcm.edu	37	18	31320168	31320168	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:31320168T>C	ENST00000269197.5	+	11	2800	c.2800T>C	c.(2800-2802)Tta>Cta	p.L934L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	934					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ACAGAGTCGGTTAGAAACCTC	0.393																																					p.L934L		Atlas-SNP	.											ASXL3_ENST00000269197,caecum,carcinoma,0,2	ASXL3	405	.	0			c.T2800C						.						78.0	72.0	74.0					18																	31320168		1860	4096	5956	SO:0001819	synonymous_variant	80816	exon11			AGTCGGTTAGAAA	AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2800T>C	chr18.hg19:g.31320168T>C		137.0	1.0		120.0	6.0	NM_030632	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	ENST00000269197.5	hg19	CCDS45847.1																																																																																			.	.		0.393	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441865.2		
SETBP1	26040	hgsc.bcm.edu	37	18	42281540	42281540	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:42281540A>G	ENST00000282030.5	+	2	525	c.229A>G	c.(229-231)Agt>Ggt	p.S77G	SETBP1_ENST00000426838.4_Missense_Mutation_p.S77G	NM_015559.2	NP_056374.2	Q9Y6X0	SETBP_HUMAN	SET binding protein 1	77						nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|endometrium(9)|kidney(9)|large_intestine(20)|lung(47)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	104				Colorectal(1;0.0622)|COAD - Colon adenocarcinoma(74;0.201)		CAACGCGGACAGTGAGAAATG	0.547									Schinzel-Giedion syndrome																												p.S77G		Atlas-SNP	.											.	SETBP1	577	.	0			c.A229G						.						104.0	91.0	96.0					18																	42281540		2203	4300	6503	SO:0001583	missense	26040	exon2	Familial Cancer Database	SGC, Schinzel-Giedion Midface Retraction syndrome	GCGGACAGTGAGA	AB022660	CCDS11923.2, CCDS45859.1	18q21.1	2008-08-01			ENSG00000152217	ENSG00000152217			15573	protein-coding gene	gene with protein product		611060				11231286	Standard	NM_015559		Approved	SEB, KIAA0437	uc010dni.3	Q9Y6X0	OTTHUMG00000132613	ENST00000282030.5:c.229A>G	chr18.hg19:g.42281540A>G	ENSP00000282030:p.Ser77Gly	183.0	0.0		108.0	5.0	NM_001130110	A6H8W5|Q6P6C3|Q9UEF3	Missense_Mutation	SNP	ENST00000282030.5	hg19	CCDS11923.2	.	.	.	.	.	.	.	.	.	.	A	18.72	3.685010	0.68157	.	.	ENSG00000152217	ENST00000426838;ENST00000282030;ENST00000552979	T	0.69435	-0.4	5.7	5.7	0.88788	.	0.049723	0.85682	D	0.000000	T	0.73984	0.3657	L	0.44542	1.39	0.36532	D	0.870788	P;D	0.69078	0.952;0.997	P;D	0.64042	0.57;0.921	T	0.76266	-0.3022	10	0.31617	T	0.26	.	15.9644	0.79956	1.0:0.0:0.0:0.0	.	77;77	Q9Y6X0;Q9Y6X0-2	SETBP_HUMAN;.	G	77	ENSP00000282030:S77G	ENSP00000282030:S77G	S	+	1	0	SETBP1	40535538	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.280000	0.65603	2.170000	0.68504	0.482000	0.46254	AGT	.	.		0.547	SETBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255854.4	NM_001130110	
PHLPP1	23239	hgsc.bcm.edu	37	18	60625874	60625874	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr18:60625874A>G	ENST00000262719.5	+	13	3571	c.3337A>G	c.(3337-3339)Agc>Ggc	p.S1113G	PHLPP1_ENST00000400316.4_Missense_Mutation_p.S601G			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	1113					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						TGTGGACCTGAGCTGTAATGA	0.453																																					p.S1113G		Atlas-SNP	.											PHLPP1_ENST00000262719,colon,carcinoma,0,3	PHLPP1	164	.	0			c.A3337G						.						142.0	135.0	137.0					18																	60625874		1914	4128	6042	SO:0001583	missense	23239	exon13			GACCTGAGCTGTA	AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.3337A>G	chr18.hg19:g.60625874A>G	ENSP00000262719:p.Ser1113Gly	105.0	0.0		61.0	3.0	NM_194449	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	ENST00000262719.5	hg19	CCDS45881.2	.	.	.	.	.	.	.	.	.	.	A	23.3	4.405207	0.83230	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.21932	1.98;1.98	5.36	5.36	0.76844	.	.	.	.	.	T	0.39091	0.1065	L	0.58101	1.795	0.80722	D	1	D	0.69078	0.997	D	0.70716	0.97	T	0.11108	-1.0601	9	0.12430	T	0.62	-20.9905	15.5239	0.75887	1.0:0.0:0.0:0.0	.	1113	O60346	PHLP1_HUMAN	G	601;1113	ENSP00000383170:S601G;ENSP00000262719:S1113G	ENSP00000262719:S1113G	S	+	1	0	PHLPP1	58776854	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.096000	0.94182	2.259000	0.74868	0.528000	0.53228	AGC	.	.		0.453	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319249.2	NM_194449	
SHD	56961	hgsc.bcm.edu	37	19	4280256	4280256	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:4280256C>T	ENST00000543264.2	+	1	1659	c.196C>T	c.(196-198)Ccc>Tcc	p.P66S	SHD_ENST00000599689.1_Missense_Mutation_p.P66S	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	66										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		CTCCAAGAACCCCGGAGATGC	0.672																																					p.P66S		Atlas-SNP	.											SHD,NS,carcinoma,0,1	SHD	33	.	0			c.C196T						.						18.0	21.0	20.0					19																	4280256		2200	4297	6497	SO:0001583	missense	56961	exon1			AAGAACCCCGGAG	BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.196C>T	chr19.hg19:g.4280256C>T	ENSP00000446058:p.Pro66Ser	71.0	0.0		42.0	2.0	NM_020209	Q96NC2	Missense_Mutation	SNP	ENST00000543264.2	hg19	CCDS12125.1	.	.	.	.	.	.	.	.	.	.	C	0.020	-1.436504	0.01108	.	.	ENSG00000105251	ENST00000543264	T	0.29397	1.57	2.97	0.604	0.17547	.	1.227080	0.05750	N	0.602889	T	0.14056	0.0340	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.20974	-1.0259	10	0.02654	T	1	-0.8873	8.849	0.35188	0.0:0.5465:0.4535:0.0	.	66	Q96IW2	SHD_HUMAN	S	66	ENSP00000446058:P66S	ENSP00000446058:P66S	P	+	1	0	SHD	4231256	0.000000	0.05858	0.013000	0.15412	0.089000	0.18198	0.235000	0.17948	0.085000	0.17107	-0.458000	0.05436	CCC	.	.		0.672	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458082.1	NM_020209	
FEM1A	55527	hgsc.bcm.edu	37	19	4792763	4792763	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:4792763A>G	ENST00000269856.3	+	1	1036	c.897A>G	c.(895-897)gaA>gaG	p.E299E	AC005523.3_ENST00000598782.1_lincRNA|AC005523.2_ENST00000601192.1_RNA|AC005523.2_ENST00000596170.1_RNA	NM_018708.2	NP_061178.1	Q9BSK4	FEM1A_HUMAN	fem-1 homolog a (C. elegans)	299					negative regulation of inflammatory response (GO:0050728)|regulation of ubiquitin-protein transferase activity (GO:0051438)	cytoplasm (GO:0005737)	EP4 subtype prostaglandin E2 receptor binding (GO:0031867)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	17		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0139)		CTGCCGTGGAAGCCTTGGAAT	0.607																																					p.E299E		Atlas-SNP	.											.	FEM1A	41	.	0			c.A897G						.						57.0	61.0	60.0					19																	4792763		2203	4300	6503	SO:0001819	synonymous_variant	55527	exon1			CGTGGAAGCCTTG	BC004988	CCDS12135.1	19p13.3	2013-01-10	2006-11-08		ENSG00000141965	ENSG00000141965		"""Ankyrin repeat domain containing"""	16934	protein-coding gene	gene with protein product		613538				11441184	Standard	NM_018708		Approved		uc002mbf.3	Q9BSK4		ENST00000269856.3:c.897A>G	chr19.hg19:g.4792763A>G		153.0	0.0		71.0	4.0	NM_018708	B2RDI3|Q711P8|Q9NPN7|Q9NPW8	Silent	SNP	ENST00000269856.3	hg19	CCDS12135.1																																																																																			.	.		0.607	FEM1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459000.1		
MUC16	94025	hgsc.bcm.edu	37	19	9048766	9048766	+	Silent	SNP	A	A	G	rs370340214		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:9048766A>G	ENST00000397910.4	-	5	33068	c.32865T>C	c.(32863-32865)tcT>tcC	p.S10955S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10957	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTTCACCAAGAGAAAAAGTCA	0.493																																					p.S10955S		Atlas-SNP	.											.	MUC16	4315	.	0			c.T32865C						.						141.0	130.0	133.0					19																	9048766		1913	4125	6038	SO:0001819	synonymous_variant	94025	exon5			ACCAAGAGAAAAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32865T>C	chr19.hg19:g.9048766A>G		158.0	0.0		93.0	4.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9070574	9070574	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:9070574A>G	ENST00000397910.4	-	3	17075	c.16872T>C	c.(16870-16872)ccT>ccC	p.P5624P		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5626	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TTTCTTCCACAGGGGGAGTTG	0.537																																					p.P5624P		Atlas-SNP	.											.	MUC16	4315	.	0			c.T16872C						.						65.0	65.0	65.0					19																	9070574		1915	4119	6034	SO:0001819	synonymous_variant	94025	exon3			TTCCACAGGGGGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16872T>C	chr19.hg19:g.9070574A>G		111.0	0.0		99.0	4.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.537	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
KLF1	10661	hgsc.bcm.edu	37	19	12995833	12995833	+	Missense_Mutation	SNP	T	T	C	rs397514445		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:12995833T>C	ENST00000264834.4	-	3	995	c.955A>G	c.(955-957)Aga>Gga	p.R319G	CTD-2265O21.7_ENST00000592400.1_RNA	NM_006563.3	NP_006554.1	Q13351	KLF1_HUMAN	Kruppel-like factor 1 (erythroid)	319					cellular response to peptide (GO:1901653)|chromatin remodeling (GO:0006338)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|large_intestine(1)|skin(1)	5		Hepatocellular(1079;0.137)		GBM - Glioblastoma multiforme(1328;0.00016)|Lung(535;0.171)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCGCGAATCTCCAGCCGCAG	0.657																																					p.R319G		Atlas-SNP	.											KLF1,NS,carcinoma,0,1	KLF1	15	.	0			c.A955G	GRCh37	CI084287	KLF1	I		.						36.0	40.0	38.0					19																	12995833		2203	4299	6502	SO:0001583	missense	10661	exon3			CGAATCTCCAGCC	U37106	CCDS12285.1	19p13.2	2014-07-18			ENSG00000105610	ENSG00000105610		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	6345	protein-coding gene	gene with protein product	"""erythroid Kruppel-like factor"""	600599				8924208, 9119377	Standard	NM_006563		Approved	EKLF	uc002mvo.3	Q13351	OTTHUMG00000180536	ENST00000264834.4:c.955A>G	chr19.hg19:g.12995833T>C	ENSP00000264834:p.Arg319Gly	46.0	1.0		30.0	2.0	NM_006563	Q6PIJ5|Q92899	Missense_Mutation	SNP	ENST00000264834.4	hg19	CCDS12285.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.932773	0.92458	.	.	ENSG00000105610	ENST00000264834	T	0.53423	0.62	4.9	2.75	0.32379	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.531595	0.15694	N	0.249297	T	0.42743	0.1216	N	0.05608	-0.01	0.43156	D	0.994938	P	0.47604	0.898	P	0.58620	0.842	T	0.42932	-0.9422	10	0.87932	D	0	.	10.1104	0.42559	0.0:0.0:0.3235:0.6765	.	319	Q13351	KLF1_HUMAN	G	319	ENSP00000264834:R319G	ENSP00000264834:R319G	R	-	1	2	KLF1	12856833	1.000000	0.71417	0.947000	0.38551	0.982000	0.71751	3.265000	0.51561	0.334000	0.23590	0.459000	0.35465	AGA	.	.		0.657	KLF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451794.1	NM_006563	
ZNF493	284443	hgsc.bcm.edu	37	19	21607389	21607389	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:21607389A>G	ENST00000355504.4	+	2	1810	c.1544A>G	c.(1543-1545)cAc>cGc	p.H515R	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Missense_Mutation_p.H643R	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	515					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						CGGTCCTCACACCTCGCTGGG	0.373																																					p.H643R		Atlas-SNP	.											.	ZNF493	178	.	0			c.A1928G						.						44.0	48.0	47.0					19																	21607389		2199	4294	6493	SO:0001583	missense	284443	exon4			CCTCACACCTCGC	AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1544A>G	chr19.hg19:g.21607389A>G	ENSP00000347691:p.His515Arg	154.0	0.0		113.0	5.0	NM_001076678	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Missense_Mutation	SNP	ENST00000355504.4	hg19	CCDS12412.1	.	.	.	.	.	.	.	.	.	.	N	0.024	-1.387956	0.01194	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	T;T	0.12984	2.63;2.63	0.361	-0.721	0.11189	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06735	0.0172	N	0.25094	0.71	0.09310	N	0.999999	B;B	0.31383	0.014;0.321	B;B	0.21917	0.022;0.037	T	0.38415	-0.9662	9	0.23891	T	0.37	.	5.3335	0.15945	0.7069:0.2931:0.0:0.0	.	515;643	Q6ZR52;Q6ZR52-2	ZN493_HUMAN;.	R	643;515	ENSP00000376110:H643R;ENSP00000347691:H515R	ENSP00000347691:H515R	H	+	2	0	ZNF493	21399229	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.581000	0.00906	-0.660000	0.05352	-0.695000	0.03696	CAC	.	.		0.373	ZNF493-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000280563.1	NM_175910	
GPATCH1	55094	hgsc.bcm.edu	37	19	33579153	33579153	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:33579153A>G	ENST00000170564.2	+	2	501	c.187A>G	c.(187-189)Aat>Gat	p.N63D		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	63					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					TGGATACTTCAATACTGTTGG	0.388																																					p.N63D	Pancreas(67;88 1713 4567 18227)	Atlas-SNP	.											.	GPATCH1	79	.	0			c.A187G						.						103.0	107.0	105.0					19																	33579153		2203	4300	6503	SO:0001583	missense	55094	exon2			TACTTCAATACTG	AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.187A>G	chr19.hg19:g.33579153A>G	ENSP00000170564:p.Asn63Asp	200.0	0.0		100.0	4.0	NM_018025	Q8IZV6|Q8N3B7|Q9NW94	Missense_Mutation	SNP	ENST00000170564.2	hg19	CCDS12428.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.196296	0.78902	.	.	ENSG00000076650	ENST00000170564	T	0.44482	0.92	5.43	5.43	0.79202	Domain of unknown function DUF1604 (1);	0.000000	0.85682	D	0.000000	T	0.70701	0.3254	M	0.89658	3.05	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77653	-0.2507	10	0.72032	D	0.01	-30.4861	14.9395	0.70983	1.0:0.0:0.0:0.0	.	63	Q9BRR8	GPTC1_HUMAN	D	63	ENSP00000170564:N63D	ENSP00000170564:N63D	N	+	1	0	GPATCH1	38270993	1.000000	0.71417	0.997000	0.53966	0.548000	0.35241	8.595000	0.90840	2.190000	0.69967	0.533000	0.62120	AAT	.	.		0.388	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450834.1	NM_018025	
KIRREL2	84063	hgsc.bcm.edu	37	19	36350514	36350514	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:36350514T>C	ENST00000360202.5	+	5	852	c.654T>C	c.(652-654)gcT>gcC	p.A218A	KIRREL2_ENST00000262625.7_Silent_p.A218A|KIRREL2_ENST00000592409.1_Silent_p.A218A|NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000347900.6_Silent_p.A168A	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	218	Ig-like C2-type 2.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GAGACACAGCTATCACACTGA	0.622																																					p.A218A		Atlas-SNP	.											.	KIRREL2	170	.	0			c.T654C						.						53.0	52.0	53.0					19																	36350514		2203	4300	6503	SO:0001819	synonymous_variant	84063	exon5			CACAGCTATCACA	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.654T>C	chr19.hg19:g.36350514T>C		40.0	0.0		40.0	4.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Silent	SNP	ENST00000360202.5	hg19	CCDS12481.1																																																																																			.	.		0.622	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
ZNF383	163087	hgsc.bcm.edu	37	19	37733879	37733879	+	Silent	SNP	C	C	T	rs367688274		TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:37733879C>T	ENST00000589413.1	+	8	1324	c.741C>T	c.(739-741)atC>atT	p.I247I	ZNF383_ENST00000352998.3_Silent_p.I247I|ZNF383_ENST00000590503.1_Silent_p.I247I			Q8NA42	ZN383_HUMAN	zinc finger protein 383	247					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I247I(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATCAGAGAATCCATACCGGTA	0.408																																					p.I247I		Atlas-SNP	.											ZNF383,NS,NS,0,1	ZNF383	42	.	1	Substitution - coding silent(1)	NS(1)	c.C741T						.						67.0	65.0	66.0					19																	37733879		2203	4300	6503	SO:0001819	synonymous_variant	163087	exon5			GAGAATCCATACC	AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.741C>T	chr19.hg19:g.37733879C>T		87.0	1.0		66.0	3.0	NM_152604	Q6X2C7	Silent	SNP	ENST00000589413.1	hg19	CCDS12501.1																																																																																			.	.		0.408	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458141.1	NM_152604	
CYP2F1	1572	hgsc.bcm.edu	37	19	41622142	41622142	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:41622142T>C	ENST00000331105.2	+	2	121	c.49T>C	c.(49-51)Tgt>Cgt	p.C17R		NM_000774.3	NP_000765.2	P24903	CP2F1_HUMAN	cytochrome P450, family 2, subfamily F, polypeptide 1	17					naphthalene metabolic process (GO:0018931)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|trichloroethylene metabolic process (GO:0018979)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|liver(2)|lung(11)|ovary(2)|skin(2)	29						GGCTCTCGTCTGTCTGCTCCT	0.577																																					p.C17R		Atlas-SNP	.											.	CYP2F1	60	.	0			c.T49C						.						159.0	140.0	147.0					19																	41622142		2203	4300	6503	SO:0001583	missense	1572	exon2			CTCGTCTGTCTGC	J02906	CCDS12572.1	19q13.1-q13.2	2008-02-05	2003-01-14		ENSG00000197446	ENSG00000197446		"""Cytochrome P450s"""	2632	protein-coding gene	gene with protein product		124070	"""cytochrome P450, subfamily IIF, polypeptide 1"""	CYP2F			Standard	NM_000774		Approved		uc002opu.1	P24903	OTTHUMG00000167412	ENST00000331105.2:c.49T>C	chr19.hg19:g.41622142T>C	ENSP00000333534:p.Cys17Arg	148.0	0.0		76.0	4.0	NM_000774	A7KAU6|A7KAU7|A7KAU8|A7KAU9|A7KAV0|Q32MN5|Q8WWJ2	Missense_Mutation	SNP	ENST00000331105.2	hg19	CCDS12572.1	.	.	.	.	.	.	.	.	.	.	T	14.22	2.471423	0.43942	.	.	ENSG00000197446	ENST00000331105	T	0.69561	-0.41	3.86	3.86	0.44501	.	1.762820	0.02983	U	0.145829	T	0.52741	0.1753	N	0.08118	0	0.35299	D	0.782843	B;B	0.23650	0.089;0.022	B;B	0.19946	0.027;0.015	T	0.39941	-0.9589	10	0.66056	D	0.02	.	11.8244	0.52259	0.0:0.0:0.0:1.0	.	17;17	Q32MN5;P24903	.;CP2F1_HUMAN	R	17	ENSP00000333534:C17R	ENSP00000333534:C17R	C	+	1	0	CYP2F1	46313982	0.011000	0.17503	0.083000	0.20561	0.779000	0.44077	1.626000	0.37039	1.617000	0.50277	0.445000	0.29226	TGT	.	.		0.577	CYP2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394527.2		
CIC	23152	hgsc.bcm.edu	37	19	42793506	42793506	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:42793506T>C	ENST00000575354.2	+	8	1348	c.1308T>C	c.(1306-1308)agT>agC	p.S436S	CIC_ENST00000160740.3_Silent_p.S436S|CIC_ENST00000572681.2_Silent_p.S1345S	NM_015125.3	NP_055940.3	Q96RK0	CIC_HUMAN	capicua transcriptional repressor	436					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			autonomic_ganglia(1)|breast(5)|central_nervous_system(32)|endometrium(10)|kidney(2)|large_intestine(7)|lung(9)|ovary(7)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	82		Prostate(69;0.00682)				ACATGACGAGTGATGAGGAGC	0.637			"""Mis, F, S"""		oligodendroglioma																																p.S436S		Atlas-SNP	.		Rec	yes		19	19q13.2	23152	capicua homolog		O	.	CIC	249	.	0			c.T1308C						.						68.0	54.0	59.0					19																	42793506		2203	4300	6503	SO:0001819	synonymous_variant	23152	exon8			GACGAGTGATGAG	AB002304	CCDS12601.1	19q13.2	2013-03-15	2013-03-15		ENSG00000079432	ENSG00000079432			14214	protein-coding gene	gene with protein product		612082	"""capicua (Drosophila) homolog"", ""capicua homolog (Drosophila)"""			12393275, 15981098	Standard	NM_015125		Approved	KIAA0306	uc002otf.1	Q96RK0		ENST00000575354.2:c.1308T>C	chr19.hg19:g.42793506T>C		143.0	0.0		72.0	4.0	NM_015125	Q7LGI1|Q9UEG5|Q9Y6T1	Silent	SNP	ENST00000575354.2	hg19	CCDS12601.1																																																																																			.	.		0.637	CIC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438532.2		
TMEM145	284339	hgsc.bcm.edu	37	19	42818606	42818606	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:42818606A>G	ENST00000301204.3	+	3	240	c.199A>G	c.(199-201)Aag>Gag	p.K67E	TMEM145_ENST00000598766.1_Missense_Mutation_p.K77E|TMEM145_ENST00000601020.1_3'UTR	NM_173633.2	NP_775904.2	Q8NBT3	TM145_HUMAN	transmembrane protein 145	67					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(11)|prostate(4)|skin(1)|urinary_tract(1)	27		Prostate(69;0.00682)				TCTGCAGGCCAAGTGCTGTCA	0.602																																					p.K67E		Atlas-SNP	.											.	TMEM145	55	.	0			c.A199G						.						157.0	147.0	150.0					19																	42818606		2203	4300	6503	SO:0001583	missense	284339	exon3			CAGGCCAAGTGCT	AK075286	CCDS12603.1	19q13.2	2008-02-05				ENSG00000167619			26912	protein-coding gene	gene with protein product							Standard	NM_173633		Approved	FLJ90805	uc002otk.1	Q8NBT3		ENST00000301204.3:c.199A>G	chr19.hg19:g.42818606A>G	ENSP00000301204:p.Lys67Glu	103.0	0.0		61.0	4.0	NM_173633		Missense_Mutation	SNP	ENST00000301204.3	hg19	CCDS12603.1	.	.	.	.	.	.	.	.	.	.	A	8.315	0.823101	0.16678	.	.	ENSG00000167619	ENST00000301204	T	0.41065	1.01	4.76	4.76	0.60689	.	0.152029	0.43919	D	0.000509	T	0.25232	0.0613	L	0.28274	0.84	0.38794	D	0.95505	B	0.25105	0.118	B	0.17098	0.017	T	0.09596	-1.0667	10	0.02654	T	1	-22.5791	12.535	0.56137	1.0:0.0:0.0:0.0	.	67	Q8NBT3	TM145_HUMAN	E	67	ENSP00000301204:K67E	ENSP00000301204:K67E	K	+	1	0	TMEM145	47510446	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.853000	0.62911	1.930000	0.55929	0.460000	0.39030	AAG	.	.		0.602	TMEM145-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463737.1	NM_173633	
TEX101	83639	hgsc.bcm.edu	37	19	43920572	43920572	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:43920572G>A	ENST00000598265.1	+	4	422	c.256G>A	c.(256-258)Gag>Aag	p.E86K	TEX101_ENST00000601707.1_3'UTR|TEX101_ENST00000253435.7_Missense_Mutation_p.E104K|TEX101_ENST00000602198.1_Missense_Mutation_p.E104K	NM_001130011.1	NP_001123483.1	Q9BY14	TX101_HUMAN	testis expressed 101	86						acrosomal membrane (GO:0002080)|anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				large_intestine(1)|lung(12)|ovary(1)|skin(1)	15		Prostate(69;0.0199)				CCCGGAAGGGGAGGAGGCCAT	0.532																																					p.E104K		Atlas-SNP	.											.	TEX101	28	.	0			c.G310A						.						151.0	140.0	144.0					19																	43920572		2203	4300	6503	SO:0001583	missense	83639	exon7			GAAGGGGAGGAGG	AF241268	CCDS12619.1, CCDS59393.1	19q13.31	2013-06-06	2007-03-13			ENSG00000131126			30722	protein-coding gene	gene with protein product	"""cancer/testis antigen 131"", ""spermatogenesis associated 44"""	612665	"""testis expressed sequence 101"""			16388701, 16516155	Standard	NM_031451		Approved	MGC4766, SGRG, CT131, SPATA44	uc010xwo.2	Q9BY14		ENST00000598265.1:c.256G>A	chr19.hg19:g.43920572G>A	ENSP00000472769:p.Glu86Lys	138.0	0.0		108.0	17.0	NM_031451	Q7L5R2|Q9BPY7	Missense_Mutation	SNP	ENST00000598265.1	hg19	CCDS59393.1	.	.	.	.	.	.	.	.	.	.	G	1.389	-0.581187	0.03854	.	.	ENSG00000131126	ENST00000253435;ENST00000407156	T	0.69685	-0.42	4.26	-6.51	0.01878	.	3.000930	0.00951	N	0.002973	T	0.35740	0.0942	N	0.08118	0	0.09310	N	1	B;B	0.15930	0.009;0.015	B;B	0.20577	0.01;0.03	T	0.44190	-0.9344	10	0.06099	T	0.92	0.5252	1.9355	0.03336	0.2081:0.1253:0.4201:0.2465	.	86;104	Q9BY14;Q9BY14-2	TX101_HUMAN;.	K	104;99	ENSP00000253435:E104K	ENSP00000253435:E104K	E	+	1	0	TEX101	48612412	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.072000	0.03434	-1.574000	0.01657	-1.108000	0.02087	GAG	.	.		0.532	TEX101-004	KNOWN	non_canonical_other|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000463176.1	NM_031451	
RASIP1	54922	hgsc.bcm.edu	37	19	49238547	49238547	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:49238547T>C	ENST00000222145.4	-	4	1289	c.1085A>G	c.(1084-1086)gAc>gGc	p.D362G	RASIP1_ENST00000594232.1_5'UTR	NM_017805.2	NP_060275.2	Q5U651	RAIN_HUMAN	Ras interacting protein 1	362					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|negative regulation of autophagy (GO:0010507)|regulation of Rho GTPase activity (GO:0032319)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	Golgi apparatus (GO:0005794)				central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	21		all_lung(116;4.89e-06)|all_epithelial(76;7.04e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000272)|Epithelial(262;0.0155)|GBM - Glioblastoma multiforme(486;0.0222)		GTCCCCGGGGTCTGCAGTTCC	0.667																																					p.D362G		Atlas-SNP	.											.	RASIP1	80	.	0			c.A1085G						.						42.0	43.0	42.0					19																	49238547		2203	4300	6503	SO:0001583	missense	54922	exon4			CCGGGGTCTGCAG	BC028614	CCDS12731.1	19q13.33	2008-02-05				ENSG00000105538			24716	protein-coding gene	gene with protein product		609623				15031288	Standard	NM_017805		Approved	FLJ20401, RAIN	uc002pki.3	Q5U651		ENST00000222145.4:c.1085A>G	chr19.hg19:g.49238547T>C	ENSP00000222145:p.Asp362Gly	147.0	0.0		115.0	6.0	NM_017805	Q6U676	Missense_Mutation	SNP	ENST00000222145.4	hg19	CCDS12731.1	.	.	.	.	.	.	.	.	.	.	T	17.67	3.446769	0.63178	.	.	ENSG00000105538	ENST00000222145	T	0.08102	3.13	5.27	4.24	0.50183	.	0.329639	0.28736	N	0.014312	T	0.05823	0.0152	N	0.21097	0.63	0.38450	D	0.946925	B	0.10296	0.003	B	0.04013	0.001	T	0.22695	-1.0209	10	0.49607	T	0.09	-0.0601	7.2395	0.26088	0.0:0.098:0.0:0.902	.	362	Q5U651	RAIN_HUMAN	G	362	ENSP00000222145:D362G	ENSP00000222145:D362G	D	-	2	0	RASIP1	53930359	0.998000	0.40836	0.955000	0.39395	0.969000	0.65631	2.107000	0.41844	2.126000	0.65437	0.459000	0.35465	GAC	.	.		0.667	RASIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466185.1	NM_017805	
DHDH	27294	hgsc.bcm.edu	37	19	49442937	49442937	+	Missense_Mutation	SNP	G	G	T	rs35453148	byFrequency	TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:49442937G>T	ENST00000221403.2	+	4	638	c.598G>T	c.(598-600)Gtg>Ttg	p.V200L	DHDH_ENST00000522614.1_Missense_Mutation_p.V200L|DHDH_ENST00000523250.1_Intron	NM_014475.3	NP_055290.1	Q9UQ10	DHDH_HUMAN	dihydrodiol dehydrogenase (dimeric)	200			V -> M (in dbSNP:rs35453148).		carbohydrate metabolic process (GO:0005975)|D-xylose catabolic process (GO:0042843)		D-xylose 1-dehydrogenase (NADP+) activity (GO:0047837)|electron carrier activity (GO:0009055)|NAD(P)+ transhydrogenase activity (GO:0008746)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.V200M(1)		central_nervous_system(1)|large_intestine(3)|lung(3)|ovary(1)|soft_tissue(1)	9		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000158)|all cancers(93;0.000258)|Epithelial(262;0.0173)|GBM - Glioblastoma multiforme(486;0.0179)		GATTTCTGTCGTGGGAAGGCG	0.542																																					p.V200L		Atlas-SNP	.											DHDH,brainstem,primitive_neuroectodermal_tumour-medulloblastoma,0,1	DHDH	35	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.G598T						.						106.0	109.0	108.0					19																	49442937		2203	4300	6503	SO:0001583	missense	27294	exon4			TCTGTCGTGGGAA	AB021933	CCDS12741.1	19q13.3	2008-02-05			ENSG00000104808	ENSG00000104808	1.3.1.20		17887	protein-coding gene	gene with protein product		606377				10477285	Standard	NM_014475		Approved	HUM2DD	uc002ple.1	Q9UQ10	OTTHUMG00000165029	ENST00000221403.2:c.598G>T	chr19.hg19:g.49442937G>T	ENSP00000221403:p.Val200Leu	52.0	0.0		32.0	4.0	NM_014475		Missense_Mutation	SNP	ENST00000221403.2	hg19	CCDS12741.1	.	.	.	.	.	.	.	.	.	.	G	8.545	0.874201	0.17395	.	.	ENSG00000104808	ENST00000221403;ENST00000522614	T;T	0.21191	2.02;2.02	5.12	-1.8	0.07907	.	0.904653	0.09763	N	0.758985	T	0.16896	0.0406	L	0.45581	1.43	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.34153	-0.9840	10	0.24483	T	0.36	-6.9556	9.9213	0.41466	0.461:0.0:0.539:0.0	.	200	Q9UQ10	DHDH_HUMAN	L	200	ENSP00000221403:V200L;ENSP00000428672:V200L	ENSP00000221403:V200L	V	+	1	0	DHDH	54134749	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.091000	0.11146	-0.183000	0.10585	-0.340000	0.08031	GTG	.	G|0.997;A|0.003		0.542	DHDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381477.1	NM_014475	
ZNF320	162967	hgsc.bcm.edu	37	19	53384285	53384285	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:53384285G>A	ENST00000595635.1	-	8	1595	c.1094C>T	c.(1093-1095)gCt>gTt	p.A365V	ZNF320_ENST00000391781.2_Missense_Mutation_p.A365V|ZNF320_ENST00000597909.1_Intron|ZNF320_ENST00000600930.1_Intron	NM_207333.2	NP_997216.2	A2RRD8	ZN320_HUMAN	zinc finger protein 320	365					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(4)|large_intestine(5)|liver(1)|lung(10)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(134;0.0534)		ACTCCGGAAAGCCTTGTCACA	0.408																																					p.A365V		Atlas-SNP	.											.	ZNF320	67	.	0			c.C1094T						.						129.0	122.0	124.0					19																	53384285		2203	4300	6503	SO:0001583	missense	162967	exon4			CGGAAAGCCTTGT	AF086262	CCDS33095.1	19q13.41	2014-09-04			ENSG00000182986	ENSG00000182986		"""Zinc fingers, C2H2-type"", ""-"""	13842	protein-coding gene	gene with protein product		606427				11536051	Standard	XM_006723059		Approved	ZFPL, DKFZp686G16228	uc002qag.3	A2RRD8	OTTHUMG00000182797	ENST00000595635.1:c.1094C>T	chr19.hg19:g.53384285G>A	ENSP00000473091:p.Ala365Val	157.0	0.0		111.0	5.0	NM_207333	Q8NDR6	Missense_Mutation	SNP	ENST00000595635.1	hg19	CCDS33095.1	.	.	.	.	.	.	.	.	.	.	-	0.659	-0.806637	0.02819	.	.	ENSG00000182986	ENST00000391781	T	0.13778	2.56	1.74	-0.844	0.10741	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11750	0.0286	L	0.35249	1.045	0.19300	N	0.99997	P	0.50617	0.937	P	0.49276	0.605	T	0.18840	-1.0324	9	0.33141	T	0.24	.	3.7473	0.08552	0.2968:0.2043:0.4988:0.0	.	365	A2RRD8	ZN320_HUMAN	V	365	ENSP00000375660:A365V	ENSP00000375660:A365V	A	-	2	0	ZNF320	58076097	0.000000	0.05858	0.008000	0.14137	0.208000	0.24298	-2.623000	0.00876	-0.339000	0.08401	0.184000	0.17185	GCT	.	.		0.408	ZNF320-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463771.1	NM_207333	
CACNG7	59284	hgsc.bcm.edu	37	19	54418669	54418669	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:54418669T>C	ENST00000391767.1	+	4	546	c.334T>C	c.(334-336)Ttc>Ctc	p.F112L	CACNG7_ENST00000222212.2_Missense_Mutation_p.F112L|CACNG7_ENST00000468076.1_3'UTR|CACNG7_ENST00000391766.1_Missense_Mutation_p.F112L			P62955	CCG7_HUMAN	calcium channel, voltage-dependent, gamma subunit 7	112					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	23	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0711)		CTTCCTCGTGTTCACGGCCTT	0.602																																					p.F112L		Atlas-SNP	.											CACNG7,NS,carcinoma,0,1	CACNG7	58	.	0			c.T334C						.						107.0	90.0	96.0					19																	54418669		2203	4300	6503	SO:0001583	missense	59284	exon3			CTCGTGTTCACGG	AF288387	CCDS12868.1	19q13.4	2008-05-02			ENSG00000105605	ENSG00000105605		"""Calcium channel subunits"""	13626	protein-coding gene	gene with protein product		606899				11170751	Standard	NM_031896		Approved		uc002qcr.2	P62955	OTTHUMG00000064852	ENST00000391767.1:c.334T>C	chr19.hg19:g.54418669T>C	ENSP00000375647:p.Phe112Leu	185.0	0.0		90.0	4.0	NM_031896	Q52LL8|Q8VBX3|Q8WXS6|Q9BXT1	Missense_Mutation	SNP	ENST00000391767.1	hg19	CCDS12868.1	.	.	.	.	.	.	.	.	.	.	T	12.85	2.061669	0.36373	.	.	ENSG00000105605	ENST00000391767;ENST00000222212;ENST00000391766	D;D;D	0.87966	-2.32;-2.32;-2.32	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	T	0.73521	0.3597	N	0.20845	0.615	0.80722	D	1	B	0.17852	0.024	B	0.18263	0.021	T	0.65615	-0.6125	10	0.02654	T	1	-29.2668	11.1063	0.48205	0.0:0.0:0.0:1.0	.	112	P62955	CCG7_HUMAN	L	112	ENSP00000375647:F112L;ENSP00000222212:F112L;ENSP00000375646:F112L	ENSP00000222212:F112L	F	+	1	0	CACNG7	59110481	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.381000	0.79718	1.928000	0.55862	0.460000	0.39030	TTC	.	.		0.602	CACNG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139240.2		
ZNF471	57573	hgsc.bcm.edu	37	19	57027722	57027722	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr19:57027722T>G	ENST00000308031.5	+	3	245	c.112T>G	c.(112-114)Tta>Gta	p.L38V	ZNF471_ENST00000593197.1_Intron|ZNF471_ENST00000591537.1_Missense_Mutation_p.L38V	NM_020813.2	NP_065864.2	Q9BX82	ZN471_HUMAN	zinc finger protein 471	38	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(8)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Colorectal(82;5.46e-05)|Ovarian(87;0.0822)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0307)		TCAGAAGCGTTTATACAGGAG	0.403																																					p.L38V	Colon(65;957 1402 6678 10163)|Esophageal Squamous(159;2295 2541 15408 21211)	Atlas-SNP	.											.	ZNF471	99	.	0			c.T112G						.						166.0	152.0	157.0					19																	57027722		2203	4300	6503	SO:0001583	missense	57573	exon3			AAGCGTTTATACA	AB037817	CCDS12945.1	19q13.43	2013-01-08				ENSG00000196263		"""Zinc fingers, C2H2-type"", ""-"""	23226	protein-coding gene	gene with protein product						10718198	Standard	NM_020813		Approved	KIAA1396, Z1971	uc002qnh.3	Q9BX82		ENST00000308031.5:c.112T>G	chr19.hg19:g.57027722T>G	ENSP00000309161:p.Leu38Val	255.0	0.0		163.0	16.0	NM_020813	B4DF32|O75260|Q08AD6|Q08AD7|Q8N3V1|Q9P2F1	Missense_Mutation	SNP	ENST00000308031.5	hg19	CCDS12945.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.480783	0.26598	.	.	ENSG00000196263	ENST00000308031	T	0.05081	3.5	3.77	-1.3	0.09259	Krueppel-associated box (4);	.	.	.	.	T	0.28333	0.0700	H	0.94542	3.55	0.09310	N	1	D	0.76494	0.999	D	0.87578	0.998	T	0.03993	-1.0986	9	0.72032	D	0.01	.	5.9946	0.19487	0.0:0.5124:0.1813:0.3063	.	38	Q9BX82	ZN471_HUMAN	V	38	ENSP00000309161:L38V	ENSP00000309161:L38V	L	+	1	2	ZNF471	61719534	0.000000	0.05858	0.009000	0.14445	0.308000	0.27856	-0.447000	0.06828	-0.179000	0.10654	0.528000	0.53228	TTA	.	.		0.403	ZNF471-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458405.1	NM_020813	
EBF4	57593	hgsc.bcm.edu	37	20	2736381	2736381	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr20:2736381T>C	ENST00000609451.1	+	15	1721	c.1649T>C	c.(1648-1650)gTc>gCc	p.V550A	EBF4_ENST00000477287.1_3'UTR|EBF4_ENST00000380648.4_Missense_Mutation_p.V546A			Q9BQW3	COE4_HUMAN	early B-cell factor 4	550					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ATCTCCGCCGTCAAACAGAGG	0.697											OREG0025728	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V546A		Atlas-SNP	.											.	.	.	.	0			c.T1637C						.						32.0	28.0	29.0					20																	2736381		692	1591	2283	SO:0001583	missense	57593	exon16			CCGCCGTCAAACA	BC019106	CCDS46573.1	20p13	2008-10-23			ENSG00000088881	ENSG00000088881			29278	protein-coding gene	gene with protein product		609935				10718198	Standard	NM_001110514		Approved	KIAA1442, COE4, RP5-860F19.3, O/E-4	uc002wgt.4	Q9BQW3	OTTHUMG00000031709	ENST00000609451.1:c.1649T>C	chr20.hg19:g.2736381T>C	ENSP00000477023:p.Val550Ala	129.0	0.0	605	80.0	4.0	NM_001110514	Q1MTP7|Q5JY53|Q9NUB6|Q9P2A6	Missense_Mutation	SNP	ENST00000609451.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.17	3.047182	0.55110	.	.	ENSG00000088881	ENST00000380648;ENST00000342725;ENST00000539912	T;T	0.48836	0.8;0.8	4.44	3.34	0.38264	.	0.937922	0.08528	U	0.932458	T	0.44180	0.1281	L	0.43923	1.385	0.27762	N	0.943793	B	0.32829	0.386	B	0.38106	0.265	T	0.41395	-0.9511	10	0.44086	T	0.13	.	8.008	0.30336	0.0:0.098:0.0:0.902	.	546	E9PEI2	.	A	546;550;132	ENSP00000370022:V546A;ENSP00000345030:V550A	ENSP00000345030:V550A	V	+	2	0	EBF4	2684381	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	7.741000	0.84997	0.756000	0.33013	-0.250000	0.11733	GTC	.	.		0.697	EBF4-011	PUTATIVE	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471930.1	XM_938882	
TPX2	22974	hgsc.bcm.edu	37	20	30365314	30365314	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr20:30365314G>T	ENST00000300403.6	+	9	1283	c.755G>T	c.(754-756)aGc>aTc	p.S252I	TPX2_ENST00000340513.4_Missense_Mutation_p.S252I	NM_012112.4	NP_036244.2	Q9ULW0	TPX2_HUMAN	TPX2, microtubule-associated	252					activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|regulation of mitotic spindle organization (GO:0060236)	axon hillock (GO:0043203)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28			Epithelial(4;0.000771)|Colorectal(19;0.00306)|all cancers(5;0.004)|COAD - Colon adenocarcinoma(19;0.0347)|OV - Ovarian serous cystadenocarcinoma(3;0.0656)			AAATCAGTGAGCCAGGTCACC	0.428																																					p.S252I		Atlas-SNP	.											.	TPX2	61	.	0			c.G755T						.						130.0	114.0	119.0					20																	30365314		2203	4300	6503	SO:0001583	missense	22974	exon9			CAGTGAGCCAGGT	AF098158	CCDS13190.1	20q11.2	2013-07-23	2013-07-23	2003-10-08	ENSG00000088325	ENSG00000088325			1249	protein-coding gene	gene with protein product		605917	"""chromosome 20 open reading frame 1"", ""TPX2, microtubule-associated, homolog (Xenopus laevis)"""	C20orf2, C20orf1		9207457, 10393424	Standard	NM_012112		Approved	p100, DIL-2	uc002wwp.1	Q9ULW0	OTTHUMG00000032190	ENST00000300403.6:c.755G>T	chr20.hg19:g.30365314G>T	ENSP00000300403:p.Ser252Ile	145.0	0.0		81.0	8.0	NM_012112	Q9H1R4|Q9NRA3|Q9UFN9|Q9UL00|Q9Y2M1	Missense_Mutation	SNP	ENST00000300403.6	hg19	CCDS13190.1	.	.	.	.	.	.	.	.	.	.	G	12.40	1.928142	0.34002	.	.	ENSG00000088325	ENST00000300403;ENST00000340513	T	0.32515	1.45	5.36	3.36	0.38483	.	0.319078	0.35151	N	0.003412	T	0.19846	0.0477	N	0.22421	0.69	0.29470	N	0.857132	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.12142	-1.0559	10	0.20046	T	0.44	-0.961	12.8578	0.57894	0.0:0.0:0.5725:0.4275	.	252;252	Q96RR5;Q9ULW0	.;TPX2_HUMAN	I	252	ENSP00000341145:S252I	ENSP00000300403:S252I	S	+	2	0	TPX2	29828975	0.494000	0.26043	1.000000	0.80357	0.993000	0.82548	0.640000	0.24705	0.706000	0.31912	0.655000	0.94253	AGC	.	.		0.428	TPX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078569.2		
PHACTR3	116154	hgsc.bcm.edu	37	20	58342290	58342290	+	Silent	SNP	C	C	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr20:58342290C>A	ENST00000371015.1	+	5	1058	c.591C>A	c.(589-591)ctC>ctA	p.L197L	PHACTR3_ENST00000355648.4_Silent_p.L156L|PHACTR3_ENST00000395639.4_Intron|PHACTR3_ENST00000361300.4_Intron|PHACTR3_ENST00000359926.3_Silent_p.L194L|PHACTR3_ENST00000395636.2_Silent_p.L156L|PHACTR3_ENST00000541461.1_Silent_p.L156L	NM_001281507.1|NM_080672.3	NP_001268436.1|NP_542403.1	Q96KR7	PHAR3_HUMAN	phosphatase and actin regulator 3	197						nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|liver(2)|lung(32)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	59	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;2.76e-09)			CTGGCAGCCTCCTGCCCACCA	0.577																																					p.L197L		Atlas-SNP	.											.	PHACTR3	104	.	0			c.C591A						.						53.0	49.0	51.0					20																	58342290		2203	4300	6503	SO:0001819	synonymous_variant	116154	exon5			CAGCCTCCTGCCC	AJ311122	CCDS13480.1, CCDS13481.1, CCDS42895.1, CCDS56202.1	20q13.32-q13.33	2014-06-13	2004-05-20	2004-05-20	ENSG00000087495	ENSG00000087495		"""Phosphatase and actin regulators"""	15833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 123"""	608725	"""chromosome 20 open reading frame 101"""	C20orf101		15107502	Standard	NM_001199505		Approved	PPP1R123	uc002yau.3	Q96KR7	OTTHUMG00000032869	ENST00000371015.1:c.591C>A	chr20.hg19:g.58342290C>A		145.0	0.0		103.0	7.0	NM_080672	B1AKX0|B1AN68|B1AN69|B2RB46|Q32P33|Q707P6|Q9H4T4	Silent	SNP	ENST00000371015.1	hg19	CCDS13480.1																																																																																			.	.		0.577	PHACTR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079923.3	NM_080672	
OPRL1	4987	hgsc.bcm.edu	37	20	62730031	62730031	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr20:62730031G>A	ENST00000349451.3	+	6	1404	c.992G>A	c.(991-993)cGc>cAc	p.R331H	OPRL1_ENST00000336866.2_Missense_Mutation_p.R331H|OPRL1_ENST00000355631.4_Missense_Mutation_p.R331H	NM_001200019.1	NP_001186948.1	P41146	OPRX_HUMAN	opiate receptor-like 1	331					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavior (GO:0007610)|opioid receptor signaling pathway (GO:0038003)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|nociceptin receptor activity (GO:0001626)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(38;4.74e-11)|all_epithelial(29;1.33e-12)|Lung NSC(23;3.27e-09)|all_lung(23;1.02e-08)					GCCTGCTTCCGCAAGTTCTGC	0.627																																					p.R331H		Atlas-SNP	.											OPRL1,NS,carcinoma,0,1	OPRL1	47	.	0			c.G992A						.						95.0	85.0	88.0					20																	62730031		2202	4297	6499	SO:0001583	missense	4987	exon4			GCTTCCGCAAGTT		CCDS13556.1	20q13.33	2012-08-08			ENSG00000125510	ENSG00000125510		"""GPCR / Class A : Opioid receptors"""	8155	protein-coding gene	gene with protein product	"""LC132 receptor-like"", ""orphanin FQ receptor"", ""kappa3-related opioid receptor"""	602548				8137918	Standard	NM_000913		Approved	NOCIR, ORL1, OOR, KOR-3	uc021wgs.1	P41146	OTTHUMG00000033027	ENST00000349451.3:c.992G>A	chr20.hg19:g.62730031G>A	ENSP00000336764:p.Arg331His	110.0	0.0		64.0	3.0	NM_000913	Q8TD34|Q8WYH9|Q9H4K4	Missense_Mutation	SNP	ENST00000349451.3	hg19	CCDS13556.1	.	.	.	.	.	.	.	.	.	.	G	15.54	2.862400	0.51482	.	.	ENSG00000125510	ENST00000336866;ENST00000355631;ENST00000349451	T;T;T	0.40476	1.03;1.03;1.03	5.05	4.1	0.47936	.	0.168029	0.42053	D	0.000771	T	0.45736	0.1357	L	0.55990	1.75	0.42819	D	0.993987	D;B	0.64830	0.994;0.246	P;B	0.54706	0.759;0.013	T	0.48843	-0.8999	10	0.66056	D	0.02	.	4.8144	0.13360	0.3115:0.0:0.6885:0.0	.	326;331	P41146-2;P41146	.;OPRX_HUMAN	H	331	ENSP00000336843:R331H;ENSP00000347848:R331H;ENSP00000336764:R331H	ENSP00000336843:R331H	R	+	2	0	OPRL1	62200475	1.000000	0.71417	0.967000	0.41034	0.876000	0.50452	2.259000	0.43259	2.346000	0.79739	0.500000	0.49745	CGC	.	.		0.627	OPRL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080295.1	NM_182647	
PIWIL3	440822	hgsc.bcm.edu	37	22	25153964	25153964	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr22:25153964G>A	ENST00000332271.5	-	4	682	c.266C>T	c.(265-267)cCc>cTc	p.P89L	PIWIL3_ENST00000533313.1_5'UTR|PIWIL3_ENST00000527701.1_5'UTR|PIWIL3_ENST00000532537.2_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	89					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						CTCCTGCAAGGGCGCTGTATG	0.443																																					p.P89L		Atlas-SNP	.											.	PIWIL3	115	.	0			c.C266T						.						201.0	209.0	206.0					22																	25153964		2203	4300	6503	SO:0001583	missense	440822	exon4			TGCAAGGGCGCTG	AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.266C>T	chr22.hg19:g.25153964G>A	ENSP00000330031:p.Pro89Leu	177.0	0.0		95.0	20.0	NM_001008496		Missense_Mutation	SNP	ENST00000332271.5	hg19	CCDS33623.1	.	.	.	.	.	.	.	.	.	.	G	0.080	-1.184821	0.01620	.	.	ENSG00000184571	ENST00000332271	T	0.04275	3.66	2.21	1.18	0.20946	.	1.020570	0.07843	U	0.963402	T	0.02807	0.0084	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.46442	-0.9191	10	0.30854	T	0.27	0.0061	6.8309	0.23909	0.1555:0.0:0.8445:0.0	.	89;89	B4DYF7;Q7Z3Z3	.;PIWL3_HUMAN	L	89	ENSP00000330031:P89L	ENSP00000330031:P89L	P	-	2	0	PIWIL3	23483964	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.157000	0.16402	0.504000	0.28082	0.455000	0.32223	CCC	.	.		0.443	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320084.2	NM_001008496	
SLC5A4	6527	hgsc.bcm.edu	37	22	32643496	32643496	+	Missense_Mutation	SNP	T	T	C	rs551408084	byFrequency	TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr22:32643496T>C	ENST00000266086.4	-	5	390	c.379A>G	c.(379-381)Acc>Gcc	p.T127A	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	127					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TCCGGCATGGTCATCACCTGC	0.483													T|||	7	0.00139776	0.0	0.0	5008	,	,		20055	0.0		0.0	False		,,,				2504	0.0072				p.T127A		Atlas-SNP	.											.	SLC5A4	82	.	0			c.A379G						.						92.0	74.0	80.0					22																	32643496		2203	4300	6503	SO:0001583	missense	6527	exon5			GCATGGTCATCAC	U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.379A>G	chr22.hg19:g.32643496T>C	ENSP00000266086:p.Thr127Ala	149.0	0.0		86.0	4.0	NM_014227	O15279	Missense_Mutation	SNP	ENST00000266086.4	hg19	CCDS13903.1	.	.	.	.	.	.	.	.	.	.	T	23.4	4.407566	0.83340	.	.	ENSG00000100191	ENST00000266086	D	0.94966	-3.57	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	H	0.97365	3.99	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.99153	1.0859	10	0.87932	D	0	.	13.0161	0.58757	0.0:0.0:0.0:1.0	.	127	Q9NY91	SC5A4_HUMAN	A	127	ENSP00000266086:T127A	ENSP00000266086:T127A	T	-	1	0	SLC5A4	30973496	1.000000	0.71417	1.000000	0.80357	0.817000	0.46193	7.404000	0.79996	2.174000	0.68829	0.533000	0.62120	ACC	.	.		0.483	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315724.1	NM_014227	
PRKX	5613	hgsc.bcm.edu	37	X	3573330	3573330	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:3573330A>G	ENST00000262848.5	-	3	813	c.459T>C	c.(457-459)tcT>tcC	p.S153S	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	153	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				TGATCTCTGCAGAGTAGAAGA	0.572																																					p.S153S		Atlas-SNP	.											.	PRKX	29	.	0			c.T459C						.						105.0	93.0	97.0					X																	3573330		2203	4300	6503	SO:0001819	synonymous_variant	5613	exon3			CTCTGCAGAGTAG		CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.459T>C	chrX.hg19:g.3573330A>G		119.0	0.0		82.0	4.0	NM_005044		Silent	SNP	ENST00000262848.5	hg19	CCDS14125.1																																																																																			.	.		0.572	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055659.1	NM_005044	
CNKSR2	22866	hgsc.bcm.edu	37	X	21458842	21458842	+	Silent	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:21458842A>G	ENST00000379510.3	+	4	498	c.462A>G	c.(460-462)tcA>tcG	p.S154S	CNKSR2_ENST00000425654.2_Silent_p.S154S|CNKSR2_ENST00000279451.4_Silent_p.S154S|CNKSR2_ENST00000543067.1_Silent_p.S154S	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	154	CRIC. {ECO:0000255|PROSITE- ProRule:PRU00621}.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CAGACTATTCAGTTACAAGAA	0.348																																					p.S154S		Atlas-SNP	.											.	CNKSR2	158	.	0			c.A462G						.						91.0	77.0	82.0					X																	21458842		2203	4299	6502	SO:0001819	synonymous_variant	22866	exon4			CTATTCAGTTACA	AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.462A>G	chrX.hg19:g.21458842A>G		60.0	0.0		55.0	4.0	NM_001168647	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Silent	SNP	ENST00000379510.3	hg19	CCDS14198.1																																																																																			.	.		0.348	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056019.1	NM_014927	
CXorf22	170063	hgsc.bcm.edu	37	X	35966467	35966467	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:35966467T>C	ENST00000297866.5	+	4	620	c.554T>C	c.(553-555)aTc>aCc	p.I185T		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	185										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						CAATTACCCATCCTCATTTTT	0.408																																					p.I185T		Atlas-SNP	.											.	CXorf22	272	.	0			c.T554C						.						207.0	163.0	178.0					X																	35966467		2202	4300	6502	SO:0001583	missense	170063	exon4			TACCCATCCTCAT	BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.554T>C	chrX.hg19:g.35966467T>C	ENSP00000297866:p.Ile185Thr	78.0	0.0		52.0	5.0	NM_152632	Q5JRM8|Q8N6X8	Missense_Mutation	SNP	ENST00000297866.5	hg19	CCDS14237.2	.	.	.	.	.	.	.	.	.	.	T	12.07	1.828867	0.32329	.	.	ENSG00000165164	ENST00000297866	T	0.42900	0.96	4.91	4.91	0.64330	.	0.297149	0.36628	N	0.002483	T	0.53530	0.1802	M	0.70275	2.135	0.09310	N	0.999999	P	0.51240	0.943	P	0.51777	0.679	T	0.53251	-0.8465	10	0.62326	D	0.03	-0.5245	13.0394	0.58891	0.0:0.0:0.0:1.0	.	185	Q6ZTR5	CX022_HUMAN	T	185	ENSP00000297866:I185T	ENSP00000297866:I185T	I	+	2	0	CXorf22	35876388	0.998000	0.40836	0.398000	0.26321	0.084000	0.17831	3.518000	0.53451	1.739000	0.51704	0.433000	0.28618	ATC	.	.		0.408	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056216.2	NM_152632	
SUV39H1	6839	hgsc.bcm.edu	37	X	48558562	48558562	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:48558562T>C	ENST00000376687.3	+	3	436	c.246T>C	c.(244-246)tgT>tgC	p.C82C	SUV39H1_ENST00000453214.2_Missense_Mutation_p.C20R|AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000337852.6_Silent_p.C93C	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)	82	Chromo. {ECO:0000255|PROSITE- ProRule:PRU00053}.|Interaction with SIRT1.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						ATCTCAAGTGTGTGCGTATCC	0.582																																					p.C82C		Atlas-SNP	.											.	SUV39H1	36	.	0			c.T246C						.						28.0	20.0	23.0					X																	48558562		2200	4297	6497	SO:0001819	synonymous_variant	6839	exon3			CAAGTGTGTGCGT	AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.246T>C	chrX.hg19:g.48558562T>C		83.0	0.0		71.0	5.0	NM_003173	B2R6E8|B4DST0|Q53G60|Q6FHK6	Silent	SNP	ENST00000376687.3	hg19	CCDS14304.1	.	.	.	.	.	.	.	.	.	.	T	9.572	1.121393	0.20877	.	.	ENSG00000101945	ENST00000448548;ENST00000453214	.	.	.	4.82	2.45	0.29901	.	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	.	.	.	0.41190	D	0.986292	.	.	.	.	.	.	T	0.08126	-1.0737	6	0.13470	T	0.59	.	6.0384	0.19720	0.0:0.3262:0.0:0.6738	.	.	.	.	R	82;20	.	ENSP00000410043:C82R	C	+	1	0	SUV39H1	48443506	0.001000	0.12720	0.763000	0.31416	0.491000	0.33493	-0.159000	0.10056	0.119000	0.18210	0.409000	0.27619	TGT	.	.		0.582	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058909.1	NM_003173	
TSPYL2	64061	hgsc.bcm.edu	37	X	53114958	53114958	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:53114958T>C	ENST00000375442.4	+	6	1516	c.1384T>C	c.(1384-1386)Ttc>Ctc	p.F462L		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	462					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						CACCGACTACTTCGAGACCAC	0.443																																					p.F462L		Atlas-SNP	.											.	TSPYL2	53	.	0			c.T1384C						.						201.0	161.0	175.0					X																	53114958		2203	4300	6503	SO:0001583	missense	64061	exon6			GACTACTTCGAGA	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1384T>C	chrX.hg19:g.53114958T>C	ENSP00000364591:p.Phe462Leu	94.0	0.0		82.0	4.0	NM_022117	O94799|Q96DG7|Q9BZW6	Missense_Mutation	SNP	ENST00000375442.4	hg19	CCDS14350.1	.	.	.	.	.	.	.	.	.	.	T	12.87	2.068313	0.36470	.	.	ENSG00000184205	ENST00000375442	T	0.30448	1.53	2.63	1.39	0.22231	.	0.000000	0.33854	U	0.004489	T	0.30947	0.0781	L	0.29908	0.895	0.25560	N	0.987002	P;P	0.49447	0.659;0.924	B;P	0.57776	0.32;0.827	T	0.07252	-1.0782	10	0.72032	D	0.01	-4.9966	4.3252	0.11036	0.3033:0.0:0.0:0.6967	.	102;462	Q59GC7;Q9H2G4	.;TSYL2_HUMAN	L	462	ENSP00000364591:F462L	ENSP00000364591:F462L	F	+	1	0	TSPYL2	53131683	1.000000	0.71417	0.970000	0.41538	0.135000	0.20990	1.666000	0.37460	0.279000	0.22186	0.231000	0.17811	TTC	.	.		0.443	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
ATRX	546	hgsc.bcm.edu	37	X	76972657	76972657	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:76972657T>C	ENST00000373344.5	-	2	298	c.84A>G	c.(82-84)gaA>gaG	p.E28E	ATRX_ENST00000395603.3_Silent_p.E28E|ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000373341.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	28					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						TTTCTTCAGATTCTTCTGATG	0.328			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.E28E		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.A84G						.						172.0	159.0	163.0					X																	76972657		2203	4296	6499	SO:0001819	synonymous_variant	546	exon2			TTCAGATTCTTCT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.84A>G	chrX.hg19:g.76972657T>C		84.0	0.0		55.0	7.0	NM_138270	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Silent	SNP	ENST00000373344.5	hg19	CCDS14434.1																																																																																			.	.		0.328	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
PCDH19	57526	hgsc.bcm.edu	37	X	99657571	99657571	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:99657571T>C	ENST00000373034.4	-	3	4242	c.2567A>G	c.(2566-2568)cAg>cGg	p.Q856R	PCDH19_ENST00000255531.7_Missense_Mutation_p.Q809R|PCDH19_ENST00000420881.2_Missense_Mutation_p.Q809R	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	856					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CTGGGGCCCCTGGCTGTTGAA	0.557																																					p.Q856R		Atlas-SNP	.											.	PCDH19	269	.	0			c.A2567G						.						101.0	94.0	96.0					X																	99657571		2022	4170	6192	SO:0001583	missense	57526	exon3			GGCCCCTGGCTGT	AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.2567A>G	chrX.hg19:g.99657571T>C	ENSP00000362125:p.Gln856Arg	139.0	0.0		69.0	4.0	NM_001184880	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	ENST00000373034.4	hg19	CCDS55462.1	.	.	.	.	.	.	.	.	.	.	t	16.77	3.215336	0.58452	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.53640	0.61;0.64;0.61	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.40322	0.1112	L	0.43152	1.355	0.58432	D	0.999999	P;P;B	0.42827	0.791;0.572;0.437	B;B;B	0.38755	0.212;0.281;0.146	T	0.20306	-1.0279	10	0.22706	T	0.39	.	14.8534	0.70316	0.0:0.0:0.0:1.0	.	856;809;809	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	R	809;856;809	ENSP00000400327:Q809R;ENSP00000362125:Q856R;ENSP00000255531:Q809R	ENSP00000255531:Q809R	Q	-	2	0	PCDH19	99544227	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.448000	0.80631	1.889000	0.54706	0.481000	0.45027	CAG	.	.		0.557	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057479.2	NM_020766	
CXorf57	55086	hgsc.bcm.edu	37	X	105876229	105876229	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:105876229A>G	ENST00000372548.4	+	5	1265	c.1156A>G	c.(1156-1158)Agg>Ggg	p.R386G	CXorf57_ENST00000372544.2_Missense_Mutation_p.R386G	NM_018015.5	NP_060485.4	Q6NSI4	CX057_HUMAN	chromosome X open reading frame 57	386							poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	31						TTTTGTAGGAAGGGTCCAGCG	0.294																																					p.R386G		Atlas-SNP	.											.	CXorf57	107	.	0			c.A1156G						.						89.0	91.0	90.0					X																	105876229		2203	4298	6501	SO:0001583	missense	55086	exon5			GTAGGAAGGGTCC	AK024253	CCDS14519.1, CCDS55470.1	Xq22.3	2008-02-05			ENSG00000147231	ENSG00000147231			25486	protein-coding gene	gene with protein product							Standard	NM_018015		Approved	FLJ14191, FLJ10178	uc004emi.4	Q6NSI4	OTTHUMG00000022150	ENST00000372548.4:c.1156A>G	chrX.hg19:g.105876229A>G	ENSP00000361628:p.Arg386Gly	238.0	0.0		186.0	8.0	NM_018015	H7BY89|Q4G0L7|Q5JQS1|Q5JRF9|Q6PHY5|Q6PII9|Q6PJU8|Q9H7W5|Q9NWA6	Missense_Mutation	SNP	ENST00000372548.4	hg19	CCDS14519.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826405	0.50739	.	.	ENSG00000147231	ENST00000372544;ENST00000372548;ENST00000421550	T;T;T	0.66460	-0.21;-0.15;-0.04	4.53	4.53	0.55603	.	0.045750	0.85682	D	0.000000	T	0.78868	0.4351	M	0.66939	2.045	0.38835	D	0.955925	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.998;0.998;0.996	T	0.82151	-0.0599	10	0.66056	D	0.02	-16.1492	12.3285	0.55024	1.0:0.0:0.0:0.0	.	386;386;386	A8K6R5;Q6NSI4;Q6NSI4-2	.;CX057_HUMAN;.	G	386;386;194	ENSP00000361623:R386G;ENSP00000361628:R386G;ENSP00000405866:R194G	ENSP00000361623:R386G	R	+	1	2	CXorf57	105762885	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	4.361000	0.59461	1.746000	0.51805	0.481000	0.45027	AGG	.	.		0.294	CXorf57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057800.2	NM_018015	
LUZP4	51213	hgsc.bcm.edu	37	X	114540807	114540807	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:114540807A>G	ENST00000371920.3	+	4	387	c.380A>G	c.(379-381)aAg>aGg	p.K127R	LUZP4_ENST00000451986.2_Missense_Mutation_p.K45R	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	127						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						CAAGCAGAGAAGAATCAAGGC	0.408																																					p.K127R		Atlas-SNP	.											.	LUZP4	51	.	0			c.A380G						.						71.0	69.0	70.0					X																	114540807		2203	4300	6503	SO:0001583	missense	51213	exon4			CAGAGAAGAATCA	AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.380A>G	chrX.hg19:g.114540807A>G	ENSP00000360988:p.Lys127Arg	157.0	0.0		112.0	5.0	NM_016383	B3KSD6	Missense_Mutation	SNP	ENST00000371920.3	hg19	CCDS14567.1	.	.	.	.	.	.	.	.	.	.	A	10.71	1.428057	0.25726	.	.	ENSG00000102021	ENST00000451986;ENST00000371920	T;T	0.53423	0.62;1.33	3.01	-4.19	0.03835	.	.	.	.	.	T	0.19525	0.0469	N	0.12182	0.205	0.09310	N	1	B;B	0.17038	0.02;0.02	B;B	0.15484	0.008;0.013	T	0.19418	-1.0306	9	0.17832	T	0.49	.	0.7359	0.00965	0.3859:0.1638:0.2857:0.1646	.	45;127	B3KSD6;Q9P127	.;LUZP4_HUMAN	R	45;127	ENSP00000411212:K45R;ENSP00000360988:K127R	ENSP00000360988:K127R	K	+	2	0	LUZP4	114447063	0.000000	0.05858	0.000000	0.03702	0.091000	0.18340	-0.550000	0.06034	-0.912000	0.03837	0.376000	0.23039	AAG	.	.		0.408	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057972.1	NM_016383	
NKRF	55922	hgsc.bcm.edu	37	X	118724383	118724383	+	Silent	SNP	T	T	C			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:118724383T>C	ENST00000371527.1	-	2	1657	c.1005A>G	c.(1003-1005)aaA>aaG	p.K335K	NKRF_ENST00000542113.1_Silent_p.K350K|NKRF_ENST00000304449.5_Silent_p.K335K|NKRF_ENST00000487600.1_Intron	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	335					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TGGTCCAGTGTTTGGCAGAAG	0.413																																					p.K350K		Atlas-SNP	.											.	NKRF	121	.	0			c.A1050G						.						100.0	99.0	99.0					X																	118724383		2203	4300	6503	SO:0001819	synonymous_variant	55922	exon4			CCAGTGTTTGGCA	AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1005A>G	chrX.hg19:g.118724383T>C		123.0	0.0		86.0	4.0	NM_001173487	G3V1N1|Q4VC41|Q9UJ91	Silent	SNP	ENST00000371527.1	hg19	CCDS35375.1																																																																																			.	.		0.413	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058044.1	NM_017544	
STAG2	10735	hgsc.bcm.edu	37	X	123200272	123200272	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chrX:123200272A>G	ENST00000371160.1	+	23	2541	c.2251A>G	c.(2251-2253)Agc>Ggc	p.S751G	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Missense_Mutation_p.S751G|STAG2_ENST00000371157.3_Missense_Mutation_p.S751G|STAG2_ENST00000371144.3_Missense_Mutation_p.S751G|STAG2_ENST00000371145.3_Missense_Mutation_p.S751G|STAG2_ENST00000354548.5_Missense_Mutation_p.S682G	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	751					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						GATAACTGAAAGCAGCTCTAC	0.328																																					p.S751G		Atlas-SNP	.											.	STAG2	309	.	0			c.A2251G						.						90.0	72.0	78.0					X																	123200272		2203	4300	6503	SO:0001583	missense	10735	exon23			ACTGAAAGCAGCT	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.2251A>G	chrX.hg19:g.123200272A>G	ENSP00000360202:p.Ser751Gly	182.0	0.0		93.0	5.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Missense_Mutation	SNP	ENST00000371160.1	hg19	CCDS14607.1	.	.	.	.	.	.	.	.	.	.	A	6.955	0.546148	0.13312	.	.	ENSG00000101972	ENST00000218089;ENST00000354548;ENST00000371160;ENST00000371157;ENST00000371145;ENST00000371144	T;T;T;T;T;T	0.32272	1.46;1.46;1.46;1.46;1.46;1.46	5.32	5.32	0.75619	Armadillo-type fold (1);	0.088399	0.85682	D	0.000000	T	0.11537	0.0281	N	0.01277	-0.915	0.46901	D	0.999248	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.16988	-1.0384	10	0.11794	T	0.64	-17.6528	14.5796	0.68278	1.0:0.0:0.0:0.0	.	751;751	Q8N3U4-2;Q8N3U4	.;STAG2_HUMAN	G	751;682;751;751;751;751	ENSP00000218089:S751G;ENSP00000346555:S682G;ENSP00000360202:S751G;ENSP00000360199:S751G;ENSP00000360187:S751G;ENSP00000360186:S751G	ENSP00000218089:S751G	S	+	1	0	STAG2	123027953	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.218000	0.72224	1.891000	0.54761	0.486000	0.48141	AGC	.	.		0.328	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
DENND5B	160518	hgsc.bcm.edu	37	12	31604973	31604973	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr12:31604973delA	ENST00000389082.5	-	5	1794	c.1530delT	c.(1528-1530)tttfs	p.F510fs	DENND5B_ENST00000306833.6_Frame_Shift_Del_p.F545fs|DENND5B_ENST00000354285.4_Frame_Shift_Del_p.F532fs|DENND5B_ENST00000536562.1_Frame_Shift_Del_p.F545fs|snoU13_ENST00000458765.1_RNA	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	510	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						ACATCTGTGTAAAACGGTTAG	0.453																																					p.T511fs		Atlas-INDEL	.											.	DENND5B	114	.	0			c.1531delA						.						136.0	134.0	135.0					12																	31604973		1924	4145	6069	SO:0001589	frameshift_variant	160518	exon5			.	AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.1530delT	chr12.hg19:g.31604973delA	ENSP00000373734:p.Phe510fs	212.0	0.0		126.0	12.0	NM_144973	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Frame_Shift_Del	DEL	ENST00000389082.5	hg19	CCDS44857.1																																																																																			.	.		0.453	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402040.1	NM_144973	
IL6ST	3572	hgsc.bcm.edu	37	5	55260061	55260075	+	In_Frame_Del	DEL	AATACACAGTAGAAT	AATACACAGTAGAAT	-			TCGA-DD-A1ED-01A-11D-A152-10	TCGA-DD-A1ED-10A-01D-A152-10	AATACACAGTAGAAT	AATACACAGTAGAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4c3eda94-56f4-46d3-8c88-50d476e773f6	09455f77-1bc1-4f4b-9b75-dd79fd3237c3	g.chr5:55260061_55260075delAATACACAGTAGAAT	ENST00000381298.2	-	6	869_883	c.557_571delATTCTACTGTGTATT	c.(556-573)tattctactgtgtatttt>ttt	p.YSTVY186del	IL6ST_ENST00000577363.1_5'UTR|IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000381294.3_In_Frame_Del_p.YSTVY186del|IL6ST_ENST00000396816.1_In_Frame_Del_p.ILLCI44del|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000536319.1_In_Frame_Del_p.YSTVY186del|IL6ST_ENST00000381287.4_In_Frame_Del_p.YSTVY186del|IL6ST_ENST00000522633.2_In_Frame_Del_p.YSTVY186del|IL6ST_ENST00000502326.3_In_Frame_Del_p.YSTVY186del|IL6ST_ENST00000336909.5_In_Frame_Del_p.YSTVY186del	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	186	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)	p.Y186_Y190delYSTVY(1)		breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				ATGTTGACAAAATACACAGTAGAATAATCAACAGT	0.367			O		hepatocellular ca																																p.186_191del		Pindel	.		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	.	IL6ST	75	.	1	Deletion - In frame(1)	liver(1)	c.558_572del						.																																			SO:0001651	inframe_deletion	3572	exon6			.	M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.557_571delATTCTACTGTGTATT	chr5.hg19:g.55260061_55260075delAATACACAGTAGAAT	ENSP00000370698:p.Tyr186_Tyr190del	315.0	0.0		194.0	13.0	NM_002184	A0N0L4|Q5FC04|Q9UQ41	In_Frame_Del	DEL	ENST00000381298.2	hg19	CCDS3971.1																																																																																			.	.		0.367	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000214146.3	NM_002184	
