#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
FAM213B	127281	hgsc.bcm.edu	37	1	2520399	2520399	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:2520399C>G	ENST00000378425.5	+	6	575	c.499C>G	c.(499-501)Cca>Gca	p.P167A	FAM213B_ENST00000444521.2_Missense_Mutation_p.P185A|FAM213B_ENST00000378424.4_Missense_Mutation_p.P204R|FAM213B_ENST00000419916.2_Missense_Mutation_p.P197A|FAM213B_ENST00000537325.1_Missense_Mutation_p.P160A|FAM213B_ENST00000484099.1_3'UTR			Q8TBF2	PGFS_HUMAN	family with sequence similarity 213, member B	167					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|myelin sheath (GO:0043209)	oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)|prostaglandin-F synthase activity (GO:0047017)	p.P167T(1)									CCAGAAGTCCCCAGGCGACTA	0.652																																					p.P215A		Atlas-SNP	.											C1orf93,caecum,carcinoma,0,1	.	.	.	1	Substitution - Missense(1)	large_intestine(1)	c.C643G						.						62.0	62.0	62.0					1																	2520399		2203	4300	6503	SO:0001583	missense	127281	exon6			AAGTCCCCAGGCG	AK075273	CCDS44.1, CCDS44.2, CCDS55564.1, CCDS72690.1, CCDS72691.1	1p36.32	2011-12-08	2011-11-24	2011-11-24	ENSG00000157870	ENSG00000157870	1.11.1.20		28390	protein-coding gene	gene with protein product	"""prostamide/prostaglandin F synthase"""		"""chromosome 1 open reading frame 93"""	C1orf93		18006499	Standard	NM_152371		Approved	MGC26818	uc001ajv.2	Q8TBF2	OTTHUMG00000000847	ENST00000378425.5:c.499C>G	chr1.hg19:g.2520399C>G	ENSP00000367682:p.Pro167Ala	108.0	0.0		88.0	41.0	NM_001195736	A8K793|B3KPY3|B4DQR9|B4E0S5|B7ZAC8|B9DI90|B9DI92|J3KQD0|Q8N2H0	Missense_Mutation	SNP	ENST00000378425.5	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.352|6.352	0.433117|0.433117	0.12045|0.12045	.|.	.|.	ENSG00000157870|ENSG00000157870	ENST00000419916;ENST00000537325;ENST00000378425;ENST00000444521|ENST00000378424	T;T;T;T|T	0.50548|0.50548	0.99;0.74;1.01;0.89|0.74	4.44|4.44	4.44|4.44	0.53790|0.53790	.|.	1.149570|1.149570	0.06726|0.06726	N|N	0.775697|0.775697	T|T	0.42381|0.42381	0.1200|0.1200	.|.	.|.	.|.	0.50632|0.50632	D|D	0.99988|0.99988	D;D;D;D;P|P	0.89917|0.36837	1.0;0.982;0.98;0.98;0.929|0.571	D;P;P;P;B|B	0.91635|0.33254	0.999;0.831;0.79;0.838;0.408|0.16	T|T	0.33033|0.33033	-0.9884|-0.9884	9|9	0.15952|0.56958	T|D	0.53|0.05	-3.3791|-3.3791	12.413|12.413	0.55478|0.55478	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	160;131;193;185;167|156	Q8TBF2-5;Q8TBF2-4;Q8TBF2-6;Q8TBF2-3;Q8TBF2|Q8TBF2-2	.;.;.;.;PGFS_HUMAN|.	A|R	197;160;167;185|204	ENSP00000394405:P197A;ENSP00000443605:P160A;ENSP00000367682:P167A;ENSP00000413218:P185A|ENSP00000367681:P204R	ENSP00000367682:P167A|ENSP00000367681:P204R	P|P	+|+	1|2	0|0	C1orf93|C1orf93	2510259|2510259	0.975000|0.975000	0.34042|0.34042	0.701000|0.701000	0.30321|0.30321	0.011000|0.011000	0.07611|0.07611	5.228000|5.228000	0.65310|0.65310	2.301000|2.301000	0.77427|0.77427	0.313000|0.313000	0.20887|0.20887	CCA|CCC	.	.		0.652	FAM213B-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_152371	
MEGF6	1953	hgsc.bcm.edu	37	1	3428670	3428670	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:3428670C>A	ENST00000356575.4	-	8	1102	c.876G>T	c.(874-876)ggG>ggT	p.G292G	MEGF6_ENST00000294599.4_Silent_p.G187G	NM_001409.3	NP_001400.3	O75095	MEGF6_HUMAN	multiple EGF-like-domains 6	292	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			cervix(2)|endometrium(3)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_cancers(77;0.00681)|all_epithelial(69;0.00301)|Ovarian(185;0.0634)|Lung NSC(156;0.0969)|all_lung(157;0.105)	all_epithelial(116;7.41e-22)|all_lung(118;8.3e-09)|Lung NSC(185;3.55e-06)|Breast(487;0.000659)|Renal(390;0.00121)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Lung SC(97;0.0262)|Ovarian(437;0.0308)|Medulloblastoma(700;0.211)		Epithelial(90;3.78e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.86e-22)|GBM - Glioblastoma multiforme(42;1.96e-12)|Colorectal(212;6.15e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000448)|BRCA - Breast invasive adenocarcinoma(365;0.000779)|KIRC - Kidney renal clear cell carcinoma(229;0.00645)|STAD - Stomach adenocarcinoma(132;0.00669)|Lung(427;0.213)		ACTGGGCCAGCCCTGCGGCAC	0.647																																					p.G292G	Ovarian(73;978 3658)	Atlas-SNP	.											.	MEGF6	91	.	0			c.G876T						.						56.0	66.0	62.0					1																	3428670		2122	4218	6340	SO:0001819	synonymous_variant	1953	exon8			GGCCAGCCCTGCG	AB011539	CCDS41237.1	1p36.3	2008-02-05	2006-03-31	2006-03-31	ENSG00000162591	ENSG00000162591			3232	protein-coding gene	gene with protein product		604266	"""EGF-like-domain, multiple 3"""	EGFL3		9693030	Standard	NM_001409		Approved		uc001akl.3	O75095	OTTHUMG00000000611	ENST00000356575.4:c.876G>T	chr1.hg19:g.3428670C>A		174.0	0.0		177.0	65.0	NM_001409	Q4AC86|Q5VV39	Silent	SNP	ENST00000356575.4	hg19	CCDS41237.1																																																																																			.	.		0.647	MEGF6-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354866.1	NM_001409	
SYF2	25949	hgsc.bcm.edu	37	1	25558651	25558651	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:25558651C>A	ENST00000236273.4	-	2	101	c.76G>T	c.(76-78)Gcc>Tcc	p.A26S	SYF2_ENST00000476231.1_5'UTR|SYF2_ENST00000354361.3_Missense_Mutation_p.A26S	NM_015484.4	NP_056299.1	O95926	SYF2_HUMAN	SYF2 pre-mRNA-splicing factor	26					embryonic organ development (GO:0048568)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|mitotic G2 DNA damage checkpoint (GO:0007095)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(4)	6		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0416)|OV - Ovarian serous cystadenocarcinoma(117;1.5e-26)|Colorectal(126;2.54e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000455)|STAD - Stomach adenocarcinoma(196;0.000766)|KIRC - Kidney renal clear cell carcinoma(1967;0.00145)|GBM - Glioblastoma multiforme(114;0.00443)|READ - Rectum adenocarcinoma(331;0.0936)|Lung(427;0.201)		TTCTGAGCGGCCAGCTCCGCC	0.647																																					p.A26S		Atlas-SNP	.											.	SYF2	13	.	0			c.G76T						.						21.0	25.0	24.0					1																	25558651		2203	4300	6503	SO:0001583	missense	25949	exon2			GAGCGGCCAGCTC	AF273089	CCDS258.1, CCDS259.1	1p36.11	2013-08-21	2013-08-21	2005-09-14	ENSG00000117614	ENSG00000117614			19824	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 29"""	607090	"""CCNDBP1 interactor"", ""SYF2 homolog, RNA splicing factor (S. cerevisiae)"""	CBPIN		11118353	Standard	NM_207170		Approved	p29, DKFZp564O2082, NTC31, fSAP29	uc001bjt.1	O95926	OTTHUMG00000043610	ENST00000236273.4:c.76G>T	chr1.hg19:g.25558651C>A	ENSP00000236273:p.Ala26Ser	80.0	0.0		90.0	41.0	NM_207170	Q5TH73	Missense_Mutation	SNP	ENST00000236273.4	hg19	CCDS259.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.204648	0.79127	.	.	ENSG00000117614	ENST00000236273;ENST00000354361	T;T	0.47869	0.88;0.83	5.42	3.54	0.40534	.	0.104346	0.64402	N	0.000002	T	0.33847	0.0877	L	0.41236	1.265	0.54753	D	0.99998	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.001	T	0.08330	-1.0727	10	0.13470	T	0.59	-11.5655	9.2119	0.37324	0.146:0.7773:0.0:0.0768	.	26;26;26	B4E0Y8;B2RBX8;O95926	.;.;SYF2_HUMAN	S	26	ENSP00000236273:A26S;ENSP00000346330:A26S	ENSP00000236273:A26S	A	-	1	0	SYF2	25431238	1.000000	0.71417	0.992000	0.48379	0.806000	0.45545	2.272000	0.43373	0.651000	0.30788	0.561000	0.74099	GCC	.	.		0.647	SYF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101962.1	NM_015484	
DNAJC8	22826	hgsc.bcm.edu	37	1	28536505	28536505	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:28536505C>A	ENST00000263697.4	-	5	403	c.377G>T	c.(376-378)gGa>gTa	p.G126V	DNAJC8_ENST00000489277.1_5'UTR	NM_014280.2	NP_055095.2	O75937	DNJC8_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 8	126					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)				kidney(1)|large_intestine(3)|lung(2)	6		Colorectal(325;3.46e-05)|Lung NSC(340;4.08e-05)|all_lung(284;4.29e-05)|Renal(390;0.00121)|Breast(348;0.00345)|Ovarian(437;0.0105)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)		OV - Ovarian serous cystadenocarcinoma(117;2.81e-22)|Colorectal(126;2.99e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00275)|BRCA - Breast invasive adenocarcinoma(304;0.0059)|STAD - Stomach adenocarcinoma(196;0.00671)|READ - Rectum adenocarcinoma(331;0.0649)		GTATTCTTTTCCTGCCTGAAT	0.418																																					p.G126V		Atlas-SNP	.											.	DNAJC8	13	.	0			c.G377T						.						128.0	111.0	116.0					1																	28536505		1894	4110	6004	SO:0001583	missense	22826	exon5			TCTTTTCCTGCCT	AF083190	CCDS41292.1	1p35	2011-09-02			ENSG00000126698	ENSG00000126698		"""Heat shock proteins / DNAJ (HSP40)"""	15470	protein-coding gene	gene with protein product						11147971	Standard	NM_014280		Approved	SPF31	uc001bpn.3	O75937	OTTHUMG00000003538	ENST00000263697.4:c.377G>T	chr1.hg19:g.28536505C>A	ENSP00000263697:p.Gly126Val	145.0	0.0		104.0	52.0	NM_014280	B4DUU4|D3DPM0|Q6IBA4|Q8N4Z5|Q9P051|Q9P067	Missense_Mutation	SNP	ENST00000263697.4	hg19	CCDS41292.1	.	.	.	.	.	.	.	.	.	.	C	27.4	4.825055	0.90955	.	.	ENSG00000126698	ENST00000263697	T	0.66638	-0.22	6.05	6.05	0.98169	Heat shock protein DnaJ, N-terminal (1);	0.100125	0.64402	D	0.000002	T	0.71341	0.3328	L	0.60455	1.87	0.80722	D	1	P	0.47910	0.902	P	0.45856	0.495	T	0.73855	-0.3851	10	0.87932	D	0	-12.2956	20.5934	0.99428	0.0:1.0:0.0:0.0	.	126	O75937	DNJC8_HUMAN	V	126	ENSP00000263697:G126V	ENSP00000263697:G126V	G	-	2	0	DNAJC8	28409092	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.396000	0.79891	2.872000	0.98467	0.650000	0.86243	GGA	.	.		0.418	DNAJC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009860.1	NM_014280	
PHACTR4	65979	hgsc.bcm.edu	37	1	28800595	28800595	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:28800595C>G	ENST00000373839.3	+	7	1614	c.1353C>G	c.(1351-1353)agC>agG	p.S451R	PHACTR4_ENST00000493669.1_3'UTR|PHACTR4_ENST00000373836.3_Missense_Mutation_p.S461R	NM_001048183.1	NP_001041648.1	Q8IZ21	PHAR4_HUMAN	phosphatase and actin regulator 4	451					actin cytoskeleton organization (GO:0030036)|closure of optic fissure (GO:0061386)|enteric nervous system development (GO:0048484)|negative regulation of integrin-mediated signaling pathway (GO:2001045)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|positive regulation of catalytic activity (GO:0043085)|regulation of cell cycle (GO:0051726)|Rho protein signal transduction (GO:0007266)	cytoplasm (GO:0005737)|lamellipodium (GO:0030027)	actin binding (GO:0003779)|protein phosphatase 1 binding (GO:0008157)|protein phosphatase type 1 activator activity (GO:0071862)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Lung NSC(340;4.37e-05)|all_lung(284;7.01e-05)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.0208)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)		OV - Ovarian serous cystadenocarcinoma(117;1.35e-21)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00273)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0144)|READ - Rectum adenocarcinoma(331;0.0649)		ACAGTGACAGCTTTTCTGAGG	0.468																																					p.S461R		Atlas-SNP	.											.	PHACTR4	64	.	0			c.C1383G						.						120.0	121.0	121.0					1																	28800595		1970	4162	6132	SO:0001583	missense	65979	exon6			TGACAGCTTTTCT	AF130081	CCDS41293.1, CCDS41294.1	1p35.2	2014-06-13			ENSG00000204138	ENSG00000204138		"""Phosphatase and actin regulators"""	25793	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 124"""	608726				11483580, 15107502	Standard	NM_023923		Approved	FLJ13171, PPP1R124	uc001bpy.3	Q8IZ21	OTTHUMG00000003541	ENST00000373839.3:c.1353C>G	chr1.hg19:g.28800595C>G	ENSP00000362945:p.Ser451Arg	149.0	0.0		134.0	59.0	NM_023923	A2APK6|B9ZVW0|D3DPM3|Q68DD4|Q6NUN6|Q8N384|Q9H395|Q9H6X0|Q9H8W6	Missense_Mutation	SNP	ENST00000373839.3	hg19	CCDS41293.1	.	.	.	.	.	.	.	.	.	.	C	1.196	-0.633920	0.03584	.	.	ENSG00000204138	ENST00000373839;ENST00000373836;ENST00000373838	T;T	0.23348	1.91;1.91	5.75	4.83	0.62350	.	1.347100	0.04068	N	0.307570	T	0.20659	0.0497	N	0.25647	0.755	0.19575	N	0.999967	B;B	0.31383	0.321;0.112	B;B	0.32465	0.146;0.068	T	0.29243	-1.0018	10	0.16420	T	0.52	-0.0126	7.5436	0.27753	0.0:0.7135:0.1374:0.1491	.	461;451	Q8IZ21-2;Q8IZ21	.;PHAR4_HUMAN	R	451;461;450	ENSP00000362945:S451R;ENSP00000362942:S461R	ENSP00000362942:S461R	S	+	3	2	PHACTR4	28673182	0.332000	0.24722	0.921000	0.36526	0.059000	0.15707	0.877000	0.28106	1.424000	0.47217	0.655000	0.94253	AGC	.	.		0.468	PHACTR4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000009868.4	NM_023923	
CLDN19	149461	hgsc.bcm.edu	37	1	43201511	43201511	+	Intron	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:43201511G>T	ENST00000296387.1	-	4	817				CLDN19_ENST00000539749.1_Missense_Mutation_p.H193Q|CLDN19_ENST00000372539.3_3'UTR	NM_001123395.1|NM_148960.2	NP_001116867.1|NP_683763.2	Q8N6F1	CLD19_HUMAN	claudin 19						apical junction assembly (GO:0043297)|calcium-independent cell-cell adhesion (GO:0016338)|neuronal action potential propagation (GO:0019227)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	apical junction complex (GO:0043296)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(2)|large_intestine(1)|lung(2)|skin(1)	6	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GGGCCACTGGGTGGGGGGCTG	0.682																																					p.H193Q		Atlas-SNP	.											.	CLDN19	21	.	0			c.C579A						.						13.0	14.0	14.0					1																	43201511		2165	4223	6388	SO:0001627	intron_variant	149461	exon3			CACTGGGTGGGGG	AK096063	CCDS471.1, CCDS44125.1, CCDS53306.1	1p34.2	2008-05-14			ENSG00000164007	ENSG00000164007		"""Claudins"""	2040	protein-coding gene	gene with protein product		610036					Standard	NM_148960		Approved		uc001cht.1	Q8N6F1	OTTHUMG00000007524	ENST00000296387.1:c.626+37C>A	chr1.hg19:g.43201511G>T		72.0	0.0		73.0	24.0	NM_001185117	B7Z5I2|F5H5P9|Q5QT57|Q8N8X0	Missense_Mutation	SNP	ENST00000296387.1	hg19	CCDS471.1	.	.	.	.	.	.	.	.	.	.	g	3.560	-0.089945	0.07053	.	.	ENSG00000164007	ENST00000539749	D	0.84660	-1.88	2.79	1.85	0.25348	.	.	.	.	.	T	0.67468	0.2896	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53114	-0.8484	9	0.21014	T	0.42	.	7.6324	0.28247	0.0:0.3179:0.6821:0.0	.	193	F5H5P9	.	Q	193	ENSP00000443229:H193Q	ENSP00000443229:H193Q	H	-	3	2	CLDN19	42974098	0.130000	0.22417	0.005000	0.12908	0.016000	0.09150	0.458000	0.21892	0.713000	0.32060	0.306000	0.20318	CAC	.	.		0.682	CLDN19-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000019788.1	NM_148960	
LRRC53	100144878	hgsc.bcm.edu	37	1	74957805	74957805	+	Intron	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:74957805A>T	ENST00000294635.4	-	2	89				TNNI3K_ENST00000370891.2_Missense_Mutation_p.S837C|TNNI3K_ENST00000326637.3_Missense_Mutation_p.S736C|FPGT-TNNI3K_ENST00000557284.2_Missense_Mutation_p.S850C			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53							integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						ATCAAGTAACAGCAGTGGGTC	0.453																																					p.S837C		Atlas-SNP	.											.	.	.	.	0			c.A2509T						.						201.0	202.0	202.0					1																	74957805		2203	4300	6503	SO:0001627	intron_variant	100526835	exon25			AGTAACAGCAGTG			1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.26-8746T>A	chr1.hg19:g.74957805A>T		284.0	0.0		92.0	16.0	NM_001112808		Missense_Mutation	SNP	ENST00000294635.4	hg19		.	.	.	.	.	.	.	.	.	.	A	26.5	4.741355	0.89573	.	.	ENSG00000259030;ENSG00000116783;ENSG00000116783	ENST00000557284;ENST00000370891;ENST00000326637	T;T;T	0.76060	-0.99;-0.99;-0.98	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.72637	0.3485	N	0.19112	0.55	0.58432	D	0.999997	D;D	0.89917	0.999;1.0	D;D	0.85130	0.993;0.997	T	0.79339	-0.1844	10	0.72032	D	0.01	.	15.9579	0.79902	1.0:0.0:0.0:0.0	.	736;837	Q59H18;Q59H18-1	TNI3K_HUMAN;.	C	837;837;736	ENSP00000450895:S837C;ENSP00000359928:S837C;ENSP00000322251:S736C	ENSP00000322251:S736C	S	+	1	0	RP11-653A5.2;AC093158.1	74730393	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	8.464000	0.90380	2.178000	0.69098	0.533000	0.62120	AGC	.	.		0.453	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000026515.2		
SNX7	51375	hgsc.bcm.edu	37	1	99203828	99203828	+	Silent	SNP	G	G	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:99203828G>C	ENST00000306121.3	+	8	1170	c.1161G>C	c.(1159-1161)gtG>gtC	p.V387V	SNX7_ENST00000529992.1_Silent_p.V332V|SNX7_ENST00000370189.5_Intron	NM_015976.4	NP_057060.2	Q9UNH6	SNX7_HUMAN	sorting nexin 7	323					apoptotic process (GO:0006915)|intracellular protein transport (GO:0006886)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	13		all_epithelial(167;7.64e-07)|all_lung(203;0.0006)|Lung NSC(277;0.00137)		Epithelial(280;0.0521)|all cancers(265;0.0687)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.207)|Colorectal(170;0.234)		AAGATAAAGTGGAATGTGCTA	0.353																																					p.V387V		Atlas-SNP	.											.	SNX7	76	.	0			c.G1161C						.						124.0	125.0	125.0					1																	99203828		2203	4299	6502	SO:0001819	synonymous_variant	51375	exon8			TAAAGTGGAATGT	AF121857	CCDS755.2, CCDS756.1, CCDS756.2	1p21	2008-05-22			ENSG00000162627	ENSG00000162627		"""Sorting nexins"""	14971	protein-coding gene	gene with protein product		614904					Standard	NM_015976		Approved		uc010ouc.2	Q9UNH6	OTTHUMG00000010723	ENST00000306121.3:c.1161G>C	chr1.hg19:g.99203828G>C		114.0	0.0		84.0	32.0	NM_015976	A8KAF3|D3DT50|Q53FQ3|Q5VT09|Q5VT10|Q86U82|Q8WVD4|Q96FW9|Q9Y3Z7	Silent	SNP	ENST00000306121.3	hg19	CCDS755.2																																																																																			.	.		0.353	SNX7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029609.2		
LRIG2	9860	hgsc.bcm.edu	37	1	113658968	113658968	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:113658968G>T	ENST00000361127.5	+	16	2788	c.2590G>T	c.(2590-2592)Gag>Tag	p.E864*	LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2	864					innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		AACGCTGTCTGAGCCACAGGA	0.483																																					p.E864X		Atlas-SNP	.											.	LRIG2	67	.	0			c.G2590T						.						85.0	78.0	80.0					1																	113658968		2203	4300	6503	SO:0001587	stop_gained	9860	exon16			CTGTCTGAGCCAC	AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.2590G>T	chr1.hg19:g.113658968G>T	ENSP00000355396:p.Glu864*	192.0	0.0		162.0	66.0	NM_014813	Q9NSN2	Nonsense_Mutation	SNP	ENST00000361127.5	hg19	CCDS30808.1	.	.	.	.	.	.	.	.	.	.	G	42	9.602370	0.99216	.	.	ENSG00000198799	ENST00000361127	.	.	.	5.92	5.02	0.67125	.	0.048832	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	17.3631	0.87356	0.0:0.125:0.875:0.0	.	.	.	.	X	864	.	ENSP00000355396:E864X	E	+	1	0	LRIG2	113460491	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.033000	0.88852	1.533000	0.49186	-0.217000	0.12591	GAG	.	.		0.483	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033549.2	NM_014813	
DENND4B	9909	hgsc.bcm.edu	37	1	153913916	153913916	+	Splice_Site	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:153913916C>G	ENST00000361217.4	-	7	1474	c.1056G>C	c.(1054-1056)gcG>gcC	p.A352A		NM_014856.2	NP_055671.2	O75064	DEN4B_HUMAN	DENN/MADD domain containing 4B	352	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab protein signal transduction (GO:0032483)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	36	all_lung(78;2.89e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			GGGAGATGTGCCTGGGGGACA	0.557																																					p.A352A		Atlas-SNP	.											.	DENND4B	210	.	0			c.G1056C						.						85.0	94.0	91.0					1																	153913916		2035	4183	6218	SO:0001630	splice_region_variant	9909	exon7			GATGTGCCTGGGG	AB007945	CCDS44228.1	1q21.3	2012-10-03	2006-01-27	2006-01-27	ENSG00000198837	ENSG00000198837		"""DENN/MADD domain containing"""	29044	protein-coding gene	gene with protein product			"""KIAA0476"""	KIAA0476		9455484, 12906859	Standard	NM_014856		Approved		uc001fdd.1	O75064	OTTHUMG00000037157	ENST00000361217.4:c.1056-1G>C	chr1.hg19:g.153913916C>G		73.0	0.0		88.0	45.0	NM_014856	Q5T4K0	Silent	SNP	ENST00000361217.4	hg19	CCDS44228.1																																																																																			.	.		0.557	DENND4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090278.2	XM_375806	Silent
COPA	1314	hgsc.bcm.edu	37	1	160305090	160305090	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:160305090C>A	ENST00000241704.7	-	4	480	c.251G>T	c.(250-252)cGc>cTc	p.R84L	COPA_ENST00000368069.3_Missense_Mutation_p.R84L	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	84					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAAAAGACAGCGCCGAAGCTT	0.378																																					p.R84L		Atlas-SNP	.											.	COPA	181	.	0			c.G251T						.						63.0	57.0	59.0					1																	160305090		2203	4300	6503	SO:0001583	missense	1314	exon4			AGACAGCGCCGAA	U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.251G>T	chr1.hg19:g.160305090C>A	ENSP00000241704:p.Arg84Leu	349.0	0.0		439.0	131.0	NM_001098398	Q5T201|Q8IXZ9	Missense_Mutation	SNP	ENST00000241704.7	hg19	CCDS1202.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663848	0.88251	.	.	ENSG00000122218	ENST00000368069;ENST00000241704	T;T	0.59638	0.25;0.25	4.98	4.07	0.47477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.056807	0.64402	D	0.000001	T	0.58380	0.2118	L	0.42245	1.32	0.80722	D	1	D;D	0.71674	0.998;0.989	D;D	0.78314	0.991;0.951	T	0.64618	-0.6365	10	0.87932	D	0	-9.4559	12.1766	0.54188	0.0:0.9165:0.0:0.0835	.	84;84	P53621;P53621-2	COPA_HUMAN;.	L	84	ENSP00000357048:R84L;ENSP00000241704:R84L	ENSP00000241704:R84L	R	-	2	0	COPA	158571714	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	6.988000	0.76212	1.105000	0.41606	0.655000	0.94253	CGC	.	.		0.378	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080638.1	NM_004371	
COLGALT2	23127	hgsc.bcm.edu	37	1	183938536	183938536	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:183938536G>T	ENST00000361927.4	-	5	1070	c.699C>A	c.(697-699)ccC>ccA	p.P233P	COLGALT2_ENST00000546159.1_Silent_p.P233P	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	233					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										AGTGGACCATGGGGACGGGGA	0.527																																					p.P233P		Atlas-SNP	.											.	.	.	.	0			c.C699A						.						124.0	118.0	120.0					1																	183938536		2203	4300	6503	SO:0001819	synonymous_variant	23127	exon5			GACCATGGGGACG	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.699C>A	chr1.hg19:g.183938536G>T		156.0	0.0		145.0	85.0	NM_015101	O60327|Q9BZR0	Silent	SNP	ENST00000361927.4	hg19	CCDS1360.1																																																																																			.	.		0.527	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
COLGALT2	23127	hgsc.bcm.edu	37	1	183938539	183938539	+	Silent	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:183938539G>T	ENST00000361927.4	-	5	1067	c.696C>A	c.(694-696)gtC>gtA	p.V232V	COLGALT2_ENST00000546159.1_Silent_p.V232V	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	232					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										GGACCATGGGGACGGGGAAGC	0.522																																					p.V232V		Atlas-SNP	.											.	.	.	.	0			c.C696A						.						123.0	117.0	119.0					1																	183938539		2203	4300	6503	SO:0001819	synonymous_variant	23127	exon5			CATGGGGACGGGG	AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.696C>A	chr1.hg19:g.183938539G>T		157.0	0.0		148.0	86.0	NM_015101	O60327|Q9BZR0	Silent	SNP	ENST00000361927.4	hg19	CCDS1360.1																																																																																			.	.		0.522	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086128.1	NM_015101	
KIF21B	23046	hgsc.bcm.edu	37	1	200946358	200946358	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:200946358C>A	ENST00000422435.2	-	31	4623	c.4307G>T	c.(4306-4308)cGc>cTc	p.R1436L	KIF21B_ENST00000360529.5_Missense_Mutation_p.R1423L|KIF21B_ENST00000461742.2_Missense_Mutation_p.R1436L|KIF21B_ENST00000332129.2_Missense_Mutation_p.R1423L	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	1436					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						CTCCCAGATGCGGACGGCATT	0.642																																					p.R1436L		Atlas-SNP	.											KIF21B,NS,carcinoma,0,1	KIF21B	208	.	0			c.G4307T						.						114.0	107.0	110.0					1																	200946358		2203	4300	6503	SO:0001583	missense	23046	exon31			CAGATGCGGACGG	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.4307G>T	chr1.hg19:g.200946358C>A	ENSP00000411831:p.Arg1436Leu	53.0	0.0		63.0	23.0	NM_001252102	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	ENST00000422435.2	hg19	CCDS58056.1	.	.	.	.	.	.	.	.	.	.	C	18.47	3.630802	0.67015	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.07567	3.18;3.18;3.18;3.18	4.88	4.88	0.63580	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	M	0.86953	2.85	0.58432	D	0.999999	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;D	0.91635	0.997;0.999;0.997;0.994	T	0.41448	-0.9508	10	0.87932	D	0	.	18.0342	0.89294	0.0:1.0:0.0:0.0	.	1423;1436;1436;1423	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	L	1423;1423;1436;1436;1436	ENSP00000328494:R1423L;ENSP00000353724:R1423L;ENSP00000433808:R1436L;ENSP00000411831:R1436L	ENSP00000328494:R1423L	R	-	2	0	KIF21B	199212981	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	5.761000	0.68801	2.249000	0.74217	0.561000	0.74099	CGC	.	.		0.642	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
KDM5B	10765	hgsc.bcm.edu	37	1	202702803	202702803	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:202702803C>A	ENST00000367265.3	-	23	4799	c.3635G>T	c.(3634-3636)gGc>gTc	p.G1212V	KDM5B_ENST00000367264.2_Missense_Mutation_p.G1248V	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	1212					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GATTCGCAGGCCCTGTGAAAT	0.542																																					p.G1212V		Atlas-SNP	.											.	KDM5B	166	.	0			c.G3635T						.						52.0	53.0	52.0					1																	202702803		2203	4300	6503	SO:0001583	missense	10765	exon23			CGCAGGCCCTGTG	AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.3635G>T	chr1.hg19:g.202702803C>A	ENSP00000356234:p.Gly1212Val	79.0	0.0		72.0	28.0	NM_006618	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	ENST00000367265.3	hg19	CCDS30974.1	.	.	.	.	.	.	.	.	.	.	C	9.110	1.006216	0.19199	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.87966	-2.32;-2.32;-2.32	6.09	4.01	0.46588	Zinc finger, PHD-finger (2);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type, conserved site (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.449783	0.28871	N	0.013866	D	0.84826	0.5558	M	0.77486	2.375	0.47778	D	0.999517	B;B	0.27853	0.191;0.075	B;B	0.23275	0.045;0.039	T	0.79245	-0.1883	10	0.33141	T	0.24	-5.713	9.5632	0.39383	0.0:0.7531:0.0:0.2469	.	1248;1212	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	V	1212;1054;1248;1054	ENSP00000356234:G1212V;ENSP00000356233:G1248V;ENSP00000235790:G1054V	ENSP00000235790:G1054V	G	-	2	0	KDM5B	200969426	0.422000	0.25473	0.008000	0.14137	0.792000	0.44763	0.865000	0.27940	0.717000	0.32145	0.643000	0.83706	GGC	.	.		0.542	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099184.2	NM_006618	
ADIPOR1	51094	hgsc.bcm.edu	37	1	202917500	202917500	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:202917500C>A	ENST00000340990.5	-	3	488	c.190G>T	c.(190-192)Gtg>Ttg	p.V64L	ADIPOR1_ENST00000436244.1_Missense_Mutation_p.V64L|ADIPOR1_ENST00000367254.3_Missense_Mutation_p.V64L	NM_015999.4	NP_057083.2	Q96A54	ADR1_HUMAN	adiponectin receptor 1	64					adiponectin-activated signaling pathway (GO:0033211)|fatty acid oxidation (GO:0019395)|hormone-mediated signaling pathway (GO:0009755)|leptin-mediated signaling pathway (GO:0033210)|negative regulation of cell growth (GO:0030308)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of JAK-STAT cascade (GO:0046427)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	hormone binding (GO:0042562)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(75;0.141)			AGTACCCGCACCTCCTCCTCT	0.522																																					p.V64L		Atlas-SNP	.											.	ADIPOR1	32	.	0			c.G190T						.						123.0	104.0	111.0					1																	202917500		2203	4300	6503	SO:0001583	missense	51094	exon3			CCCGCACCTCCTC		CCDS1430.1	1q32.1	2012-08-22			ENSG00000159346	ENSG00000159346		"""GPCR / Unclassified : Adiponectin receptors"""	24040	protein-coding gene	gene with protein product		607945				12802337	Standard	XM_006711360		Approved	PAQR1, ACDCR1	uc001gyq.5	Q96A54	OTTHUMG00000041391	ENST00000340990.5:c.190G>T	chr1.hg19:g.202917500C>A	ENSP00000341785:p.Val64Leu	112.0	0.0		143.0	79.0	NM_015999	B3KMB0|Q53HS7|Q53YY6|Q9Y360	Missense_Mutation	SNP	ENST00000340990.5	hg19	CCDS1430.1	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258016	0.39896	.	.	ENSG00000159346	ENST00000340990;ENST00000436244;ENST00000417068;ENST00000367254;ENST00000426229	D;D;D;D;D	0.96774	-4.12;-4.12;-4.12;-4.12;-4.12	5.85	4.93	0.64822	.	0.322267	0.33496	N	0.004841	D	0.90995	0.7168	N	0.16368	0.405	0.37180	D	0.903461	B	0.02656	0.0	B	0.01281	0.0	D	0.87943	0.2718	10	0.12430	T	0.62	.	15.0724	0.72049	0.1431:0.8569:0.0:0.0	.	64	Q96A54	ADR1_HUMAN	L	64	ENSP00000341785:V64L;ENSP00000395469:V64L;ENSP00000402178:V64L;ENSP00000356223:V64L;ENSP00000392946:V64L	ENSP00000341785:V64L	V	-	1	0	ADIPOR1	201184123	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	5.364000	0.66110	1.461000	0.47929	-0.182000	0.12963	GTG	.	.		0.522	ADIPOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000099160.2	NM_015999	
OBSCN	84033	hgsc.bcm.edu	37	1	228474710	228474710	+	Missense_Mutation	SNP	G	G	T	rs558072959		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:228474710G>T	ENST00000422127.1	+	35	9558	c.9514G>T	c.(9514-9516)Gcc>Tcc	p.A3172S	OBSCN_ENST00000570156.2_Missense_Mutation_p.A3601S|OBSCN_ENST00000366709.4_Missense_Mutation_p.A291S|OBSCN_ENST00000366707.4_Missense_Mutation_p.A291S|OBSCN_ENST00000284548.11_Missense_Mutation_p.A3172S|OBSCN_ENST00000359599.6_Missense_Mutation_p.A2019S	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	3172	Ig-like 31.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCTGGGGGCGCCTGCAGCAG	0.662																																					p.A3601S		Atlas-SNP	.											.	OBSCN	2142	.	0			c.G10801T						.						10.0	12.0	12.0					1																	228474710		2006	4171	6177	SO:0001583	missense	84033	exon40			GGGGGCGCCTGCA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.9514G>T	chr1.hg19:g.228474710G>T	ENSP00000409493:p.Ala3172Ser	71.0	0.0		62.0	48.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	G	14.19	2.462369	0.43736	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709;ENST00000359599	T;T;T;T;T	0.05382	3.45;3.45;3.45;3.45;3.45	5.09	1.06	0.20224	Immunoglobulin subtype 2 (1);	0.367653	0.26467	N	0.024211	T	0.08447	0.0210	L	0.39147	1.195	0.09310	N	1	B;D	0.64830	0.13;0.994	B;P	0.58172	0.173;0.834	T	0.21415	-1.0246	10	0.09590	T	0.72	.	5.6767	0.17753	0.1333:0.0:0.4468:0.4199	.	3172;3172	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	S	3172;3172;291;291;2019	ENSP00000284548:A3172S;ENSP00000409493:A3172S;ENSP00000355668:A291S;ENSP00000355670:A291S;ENSP00000352613:A2019S	ENSP00000284548:A3172S	A	+	1	0	OBSCN	226541333	0.000000	0.05858	0.224000	0.23877	0.043000	0.13939	-0.225000	0.09151	0.034000	0.15491	0.561000	0.74099	GCC	.	.		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
ZBTB18	10472	hgsc.bcm.edu	37	1	244218434	244218434	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:244218434G>T	ENST00000358704.4	+	2	1507	c.1358G>T	c.(1357-1359)gGc>gTc	p.G453V		NM_001278196.1|NM_006352.4|NM_205768.2	NP_001265125.1|NP_006343.2|NP_991331.1	Q99592	ZBT18_HUMAN	zinc finger and BTB domain containing 18	444					cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|hippocampus development (GO:0021766)|homeostasis of number of cells (GO:0048872)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron development (GO:0048666)|regulation of cell division (GO:0051302)|skeletal muscle tissue development (GO:0007519)|transcription, DNA-templated (GO:0006351)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACCCAGTGCGGCAAGAGCTTC	0.622																																					p.G453V		Atlas-SNP	.											.	.	.	.	0			c.G1358T						.						56.0	58.0	58.0					1																	244218434		2203	4300	6503	SO:0001583	missense	10472	exon2			AGTGCGGCAAGAG	U38896	CCDS1622.1	1q44	2013-09-19	2013-01-09	2013-01-09	ENSG00000179456	ENSG00000179456		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	13030	protein-coding gene	gene with protein product		608433	"""zinc finger protein 238"""	ZNF238		9568537, 9013868	Standard	NM_205768		Approved	C2H2-171, TAZ-1, RP58	uc031psv.1	Q99592	OTTHUMG00000040013	ENST00000358704.4:c.1358G>T	chr1.hg19:g.244218434G>T	ENSP00000351539:p.Gly453Val	83.0	0.0		105.0	86.0	NM_205768	A8K5U3|Q13397|Q5VU40|Q8N463|Q9UD99	Missense_Mutation	SNP	ENST00000358704.4	hg19	CCDS1622.1	.	.	.	.	.	.	.	.	.	.	G	16.72	3.201224	0.58234	.	.	ENSG00000179456	ENST00000366538;ENST00000358704	T	0.07444	3.19	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.40645	0.1125	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	T	0.48091	-0.9065	10	0.72032	D	0.01	.	19.7964	0.96487	0.0:0.0:1.0:0.0	.	444;453	Q99592;Q99592-2	ZN238_HUMAN;.	V	453	ENSP00000351539:G453V	ENSP00000351539:G453V	G	+	2	0	ZNF238	242285057	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	9.869000	0.99810	2.702000	0.92279	0.655000	0.94253	GGC	.	.		0.622	ZBTB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096513.2	NM_205768	
OR2G2	81470	hgsc.bcm.edu	37	1	247751752	247751752	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr1:247751752T>G	ENST00000320065.1	+	1	91	c.91T>G	c.(91-93)Ttt>Gtt	p.F31V	RP11-978I15.10_ENST00000446347.1_RNA|RP11-978I15.10_ENST00000435333.1_RNA	NM_001001915.1	NP_001001915.1	Q8NGZ5	OR2G2_HUMAN	olfactory receptor, family 2, subfamily G, member 2	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(4)|large_intestine(3)|lung(30)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.017)			GAAGGTTCTATTTGTGCTCAT	0.393																																					p.F31V		Atlas-SNP	.											.	OR2G2	88	.	0			c.T91G						.						214.0	205.0	208.0					1																	247751752		2203	4300	6503	SO:0001583	missense	81470	exon1			GTTCTATTTGTGC	BK004472	CCDS31092.1	1q44	2012-08-09	2008-05-23		ENSG00000177489	ENSG00000177489		"""GPCR / Class A : Olfactory receptors"""	15007	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily G, member 2"", ""olfactory receptor, family 2, subfamily G, member 2 pseudogene"""				Standard	NM_001001915		Approved		uc010pyy.2	Q8NGZ5	OTTHUMG00000040575	ENST00000320065.1:c.91T>G	chr1.hg19:g.247751752T>G	ENSP00000326349:p.Phe31Val	632.0	0.0		474.0	141.0	NM_001001915	Q5JQT2|Q6IEZ0	Missense_Mutation	SNP	ENST00000320065.1	hg19	CCDS31092.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306108	0.60305	.	.	ENSG00000177489	ENST00000320065	T	0.04551	3.6	3.73	3.73	0.42828	.	0.000000	0.34338	U	0.004054	T	0.26048	0.0635	M	0.92833	3.35	0.09310	N	0.999999	D	0.89917	1.0	D	0.87578	0.998	T	0.10636	-1.0621	10	0.87932	D	0	.	10.4648	0.44600	0.0:0.0:0.0:1.0	.	31	Q8NGZ5	OR2G2_HUMAN	V	31	ENSP00000326349:F31V	ENSP00000326349:F31V	F	+	1	0	OR2G2	245818375	0.975000	0.34042	0.048000	0.18961	0.888000	0.51559	3.914000	0.56401	1.535000	0.49220	0.481000	0.45027	TTT	.	.		0.393	OR2G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097623.1		
C2orf71	388939	hgsc.bcm.edu	37	2	29294437	29294437	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:29294437G>A	ENST00000331664.5	-	1	2690	c.2691C>T	c.(2689-2691)acC>acT	p.T897T		NM_001029883.2	NP_001025054.1	A6NGG8	CB071_HUMAN	chromosome 2 open reading frame 71	897					response to stimulus (GO:0050896)|visual perception (GO:0007601)	primary cilium (GO:0072372)				NS(2)|breast(5)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(20)|ovary(2)|prostate(6)|skin(3)|stomach(1)	60						TCAGGCTGGCGGTGCTCTTGC	0.682																																					p.T897T		Atlas-SNP	.											.	C2orf71	146	.	0			c.C2691T						.						22.0	25.0	24.0					2																	29294437		1970	4147	6117	SO:0001819	synonymous_variant	388939	exon1			GCTGGCGGTGCTC		CCDS42669.1	2p23.2	2014-01-28			ENSG00000179270	ENSG00000179270			34383	protein-coding gene	gene with protein product		613425				20398886	Standard	NM_001029883		Approved	FLJ34931, RP54	uc002rmt.2	A6NGG8	OTTHUMG00000152024	ENST00000331664.5:c.2691C>T	chr2.hg19:g.29294437G>A		40.0	0.0		47.0	12.0	NM_001029883		Silent	SNP	ENST00000331664.5	hg19	CCDS42669.1																																																																																			.	.		0.682	C2orf71-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324924.3	NM_001029883	
TGFBRAP1	9392	hgsc.bcm.edu	37	2	105924415	105924415	+	Missense_Mutation	SNP	C	C	A	rs369840873		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:105924415C>A	ENST00000393359.2	-	2	770	c.344G>T	c.(343-345)cGc>cTc	p.R115L	TGFBRAP1_ENST00000258449.1_Missense_Mutation_p.R115L			Q8WUH2	TGFA1_HUMAN	transforming growth factor, beta receptor associated protein 1	115	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|membrane (GO:0016020)	SMAD binding (GO:0046332)|small GTPase regulator activity (GO:0005083)|transforming growth factor beta receptor binding (GO:0005160)			central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	31						CCCCTTGATGCGGGCCCCCGA	0.582																																					p.R115L	Esophageal Squamous(183;794 2019 9730 21801 48859)	Atlas-SNP	.											.	TGFBRAP1	70	.	0			c.G344T						.						57.0	63.0	61.0					2																	105924415		2203	4300	6503	SO:0001583	missense	9392	exon2			TTGATGCGGGCCC	AF022795	CCDS2067.1	2q12.1	2008-02-05			ENSG00000135966	ENSG00000135966			16836	protein-coding gene	gene with protein product		606237				9545258, 11278302	Standard	NM_001142621		Approved	TRAP-1, TRAP1	uc002tcr.4	Q8WUH2	OTTHUMG00000130809	ENST00000393359.2:c.344G>T	chr2.hg19:g.105924415C>A	ENSP00000377027:p.Arg115Leu	48.0	0.0		45.0	23.0	NM_004257	A8K5R7|D3DVJ8|O60466	Missense_Mutation	SNP	ENST00000393359.2	hg19	CCDS2067.1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.168629	0.78339	.	.	ENSG00000135966	ENST00000393359;ENST00000258449	T;T	0.04706	3.57;3.57	5.02	5.02	0.67125	Citron-like (2);	0.055423	0.64402	D	0.000001	T	0.05456	0.0144	L	0.44542	1.39	0.45930	D	0.998766	B	0.34214	0.442	B	0.31614	0.133	T	0.40813	-0.9543	10	0.36615	T	0.2	-30.6776	12.2513	0.54599	0.0:0.9224:0.0:0.0776	.	115	Q8WUH2	TGFA1_HUMAN	L	115	ENSP00000377027:R115L;ENSP00000258449:R115L	ENSP00000258449:R115L	R	-	2	0	TGFBRAP1	105290847	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	4.578000	0.60929	2.760000	0.94817	0.655000	0.94253	CGC	.	.		0.582	TGFBRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253354.2	NM_004257	
RANBP2	5903	hgsc.bcm.edu	37	2	109380318	109380318	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:109380318G>T	ENST00000283195.6	+	20	3449	c.3323G>T	c.(3322-3324)gGa>gTa	p.G1108V		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	1108					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AATGTGTCTGGAATTTCATTT	0.423																																					p.G1108V		Atlas-SNP	.											.	RANBP2	488	.	0			c.G3323T						.						53.0	57.0	56.0					2																	109380318		2202	4299	6501	SO:0001583	missense	5903	exon20			TGTCTGGAATTTC	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.3323G>T	chr2.hg19:g.109380318G>T	ENSP00000283195:p.Gly1108Val	214.0	0.0		118.0	45.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	G	6.438	0.448940	0.12223	.	.	ENSG00000153201	ENST00000283195	T	0.28069	1.63	5.52	-0.104	0.13605	.	.	.	.	.	T	0.26048	0.0635	M	0.62723	1.935	0.09310	N	0.999999	B	0.15473	0.013	B	0.14023	0.01	T	0.36383	-0.9750	9	0.66056	D	0.02	-5.9935	2.5502	0.04747	0.2776:0.1974:0.4212:0.1038	.	1108	P49792	RBP2_HUMAN	V	1108	ENSP00000283195:G1108V	ENSP00000283195:G1108V	G	+	2	0	RANBP2	108746750	0.999000	0.42202	0.928000	0.36995	0.018000	0.09664	1.335000	0.33839	0.034000	0.15491	0.557000	0.71058	GGA	.	.		0.423	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
ARL6IP6	151188	hgsc.bcm.edu	37	2	153573934	153573934	+	5'Flank	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:153573934C>A	ENST00000326446.5	+	0	0				PRPF40A_ENST00000410080.1_Missense_Mutation_p.R7L|PRPF40A_ENST00000486100.1_5'UTR	NM_152522.5	NP_689735.1	Q8N6S5	AR6P6_HUMAN	ADP-ribosylation factor-like 6 interacting protein 6							integral component of membrane (GO:0016021)				kidney(1)|large_intestine(1)|lung(2)|pancreas(1)	5						GCTCCGCCGGCGGCCACTGCC	0.647																																					p.R7L		Atlas-SNP	.											.	PRPF40A	149	.	0			c.G20T						.						30.0	37.0	35.0					2																	153573934		1934	4137	6071	SO:0001631	upstream_gene_variant	55660	exon1			CGCCGGCGGCCAC	AK023109	CCDS2197.1	2q23	2014-05-12	2014-05-12		ENSG00000177917	ENSG00000177917			24048	protein-coding gene	gene with protein product							Standard	NM_152522		Approved	MGC33864	uc002tyn.3	Q8N6S5	OTTHUMG00000131901		chr2.hg19:g.153573934C>A	Exception_encountered	87.0	0.0		84.0	30.0	NM_017892	B2RDS6|Q7Z4G7	Missense_Mutation	SNP	ENST00000326446.5	hg19	CCDS2197.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344018	0.61073	.	.	ENSG00000196504	ENST00000410080;ENST00000359961;ENST00000448428	T	0.34859	1.34	4.87	4.87	0.63330	.	.	.	.	.	T	0.19846	0.0477	N	0.08118	0	0.25132	N	0.990568	B	0.11235	0.004	B	0.06405	0.002	T	0.07731	-1.0757	9	0.14656	T	0.56	.	13.3945	0.60843	0.0:1.0:0.0:0.0	.	7	E9PFS0	.	L	7;7;13	ENSP00000386458:R7L	ENSP00000353046:R7L	R	-	2	0	PRPF40A	153282180	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.309000	0.51903	2.518000	0.84900	0.655000	0.94253	CGC	.	.		0.647	ARL6IP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254852.3	NM_152522	
TRAK2	66008	hgsc.bcm.edu	37	2	202251196	202251196	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:202251196G>A	ENST00000332624.3	-	14	2136	c.1708C>T	c.(1708-1710)Ctg>Ttg	p.L570L		NM_015049.2	NP_055864.2	O60296	TRAK2_HUMAN	trafficking protein, kinesin binding 2	570					protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|endosome (GO:0005768)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GABA receptor binding (GO:0050811)|receptor binding (GO:0005102)	p.L570M(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	23						CAGTGATACAGAGTTTGTGAT	0.423																																					p.L570L		Atlas-SNP	.											.	TRAK2	62	.	1	Substitution - Missense(1)	lung(1)	c.C1708T						.						91.0	97.0	95.0					2																	202251196		2203	4300	6503	SO:0001819	synonymous_variant	66008	exon14			GATACAGAGTTTG	AB038951	CCDS2347.1	2q33.1	2012-03-05	2005-12-13	2005-12-13	ENSG00000115993	ENSG00000115993			13206	protein-coding gene	gene with protein product	"""gamma-aminobutyric acid(A) receptor-interacting factor"", ""milton homolog 2 (Drosophila)"", ""O-linked N-acetylglucosamine transferase interacting protein 98"""	607334	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 3"""	ALS2CR3		11161814, 16380713, 20230862	Standard	NM_015049		Approved	CALS-C, KIAA0549, GRIF-1, OIP98, MILT2	uc002uyb.4	O60296	OTTHUMG00000132822	ENST00000332624.3:c.1708C>T	chr2.hg19:g.202251196G>A		121.0	0.0		54.0	19.0	NM_015049	E7EV21|Q8WVH7|Q96NS2|Q9C0K5|Q9C0K6	Silent	SNP	ENST00000332624.3	hg19	CCDS2347.1																																																																																			.	.		0.423	TRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256284.3	NM_015049	
ABCB6	10058	hgsc.bcm.edu	37	2	220079777	220079777	+	Silent	SNP	C	C	A	rs548516506		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:220079777C>A	ENST00000265316.3	-	6	1498	c.1182G>T	c.(1180-1182)acG>acT	p.T394T	ABCB6_ENST00000439002.2_Silent_p.T348T	NM_005689.2	NP_005680.1	Q9NP58	ABCB6_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 6 (Langereis blood group)	394	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				brain development (GO:0007420)|cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|porphyrin-containing compound biosynthetic process (GO:0006779)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of mitochondrial outer membrane (GO:0031307)|mitochondrial envelope (GO:0005740)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|efflux transmembrane transporter activity (GO:0015562)|heme binding (GO:0020037)|heme transporter activity (GO:0015232)|heme-transporting ATPase activity (GO:0015439)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	34		Renal(207;0.0474)		Epithelial(149;1.22e-06)|all cancers(144;0.000201)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGTCGGCCAGCGTGGGGATGA	0.507																																					p.T394T		Atlas-SNP	.											.	ABCB6	76	.	0			c.G1182T						.						195.0	151.0	166.0					2																	220079777		2203	4300	6503	SO:0001819	synonymous_variant	10058	exon6			GGCCAGCGTGGGG	AF070598	CCDS2436.1	2q36	2014-08-27	2014-08-27		ENSG00000115657	ENSG00000115657		"""ATP binding cassette transporters / subfamily B"""	47	protein-coding gene	gene with protein product	"""ATP-binding cassette half-transporter"""	605452	"""ATP-binding cassette, sub-family B (MDR/TAP), member 6"""			8894702, 9110174	Standard	NM_005689		Approved	EST45597, umat, MTABC3	uc002vkc.2	Q9NP58	OTTHUMG00000133131	ENST00000265316.3:c.1182G>T	chr2.hg19:g.220079777C>A		110.0	0.0		102.0	22.0	NM_005689	O75542|Q49A66|Q59GQ5|Q6ZME6|Q96ME8|Q9HAQ6|Q9HAQ7	Silent	SNP	ENST00000265316.3	hg19	CCDS2436.1	.	.	.	.	.	.	.	.	.	.	C	6.018	0.371776	0.11409	.	.	ENSG00000115657	ENST00000295750	.	.	.	5.44	-7.71	0.01254	.	.	.	.	.	T	0.44477	0.1295	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48703	-0.9012	4	.	.	.	-13.0275	6.026	0.19656	0.0733:0.1189:0.4318:0.376	.	.	.	.	L	242	.	.	R	-	2	0	ABCB6	219788021	0.028000	0.19301	0.630000	0.29268	0.544000	0.35116	-0.928000	0.03980	-1.414000	0.02025	-0.894000	0.02916	CGC	.	.		0.507	ABCB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256820.2	NM_005689	
TRIP12	9320	hgsc.bcm.edu	37	2	230667054	230667054	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:230667054G>A	ENST00000283943.5	-	20	3073	c.2895C>T	c.(2893-2895)gcC>gcT	p.A965A	TRIP12_ENST00000389044.4_Silent_p.A1013A|TRIP12_ENST00000389045.3_Silent_p.A695A|TRIP12_ENST00000543084.1_Intron	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	965					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGGCAGCTGTGGCTGTCCCAC	0.502																																					p.A965A		Atlas-SNP	.											.	TRIP12	207	.	0			c.C2895T						.						66.0	57.0	60.0					2																	230667054		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon20			AGCTGTGGCTGTC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2895C>T	chr2.hg19:g.230667054G>A		111.0	0.0		73.0	18.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.502	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	chr3.hg19:g.41266110A>C	ENSP00000344456:p.His36Pro	252.0	0.0		134.0	54.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
ROBO2	6092	hgsc.bcm.edu	37	3	77651546	77651546	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:77651546G>A	ENST00000461745.1	+	20	3940	c.3040G>A	c.(3040-3042)Gat>Aat	p.D1014N	ROBO2_ENST00000487694.3_Missense_Mutation_p.D1030N|ROBO2_ENST00000332191.8_Missense_Mutation_p.D1014N	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1014					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		ATTGGCTGTCGATCTGCCTGA	0.423																																					p.D1014N		Atlas-SNP	.											ROBO2_ENST00000487694,NS,carcinoma,0,6	ROBO2	527	.	0			c.G3040A						.						116.0	108.0	110.0					3																	77651546		1964	4162	6126	SO:0001583	missense	6092	exon20			GCTGTCGATCTGC	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3040G>A	chr3.hg19:g.77651546G>A	ENSP00000417164:p.Asp1014Asn	238.0	0.0		282.0	115.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.8|29.8	5.040614|5.040614	0.93630|0.93630	.|.	.|.	ENSG00000185008|ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191|ENST00000471893	T;T;T|.	0.64991|.	-0.13;-0.09;-0.08|.	5.84|5.84	5.84|5.84	0.93424|0.93424	.|.	0.000000|.	0.47455|.	D|.	0.000232|.	T|T	0.69178|0.69178	0.3082|0.3082	L|L	0.42245|0.42245	1.32|1.32	0.29415|.	N|.	0.860951|.	D;D;D|.	0.76494|.	0.998;0.999;0.997|.	P;P;P|.	0.62184|.	0.825;0.899;0.649|.	T|T	0.62756|0.62756	-0.6787|-0.6787	9|4	0.48119|.	T|.	0.1|.	.|.	20.1432|20.1432	0.98067|0.98067	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1030;1014;1014|.	Q19AB5;F8W703;Q9HCK4|.	.;.;ROBO2_HUMAN|.	N|Q	1030;1030;1034;1014;1014|88	ENSP00000417335:D1030N;ENSP00000417164:D1014N;ENSP00000327536:D1014N|.	ENSP00000327536:D1014N|.	D|R	+|+	1|2	0|0	ROBO2|ROBO2	77734236|77734236	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.476000|9.476000	0.97823|0.97823	2.769000|2.769000	0.95229|0.95229	0.561000|0.561000	0.74099|0.74099	GAT|CGA	.	.		0.423	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
PLXND1	23129	hgsc.bcm.edu	37	3	129279234	129279234	+	Missense_Mutation	SNP	C	C	T	rs201100072		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:129279234C>T	ENST00000324093.4	-	31	5250	c.5072G>A	c.(5071-5073)cGg>cAg	p.R1691Q	PLXND1_ENST00000393239.1_Missense_Mutation_p.R1691Q	NM_015103.2	NP_055918	Q9Y4D7	PLXD1_HUMAN	plexin D1	1691					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell migration (GO:0043542)|outflow tract morphogenesis (GO:0003151)|patterning of blood vessels (GO:0001569)|positive regulation of protein binding (GO:0032092)|regulation of angiogenesis (GO:0045765)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|synapse assembly (GO:0007416)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)		PLXND1/TMCC1(4)	NS(1)|breast(1)|endometrium(4)|kidney(5)|large_intestine(17)|lung(28)|prostate(10)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	72						ATGGCTCTGCCGGTGAGACTT	0.662																																					p.R1691Q	Ovarian(97;366 1484 3738 22084 39045)	Atlas-SNP	.											.	PLXND1	149	.	0			c.G5072A						.						80.0	66.0	71.0					3																	129279234		2203	4299	6502	SO:0001583	missense	23129	exon31			CTCTGCCGGTGAG	AY116661	CCDS33854.1	3q21.3	2007-05-16			ENSG00000004399	ENSG00000004399		"""Plexins"""	9107	protein-coding gene	gene with protein product		604282				12412018	Standard	NM_015103		Approved	KIAA0620	uc003emx.2	Q9Y4D7	OTTHUMG00000159547	ENST00000324093.4:c.5072G>A	chr3.hg19:g.129279234C>T	ENSP00000317128:p.Arg1691Gln	158.0	0.0		152.0	62.0	NM_015103	A7E2C6|C9JPZ6|Q6PJS9|Q8IZJ2|Q9BTQ2	Missense_Mutation	SNP	ENST00000324093.4	hg19	CCDS33854.1	.	.	.	.	.	.	.	.	.	.	C	18.77	3.695342	0.68386	.	.	ENSG00000004399	ENST00000324093;ENST00000393239	T;T	0.15139	2.45;2.45	5.0	3.99	0.46301	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.066671	0.56097	D	0.000029	T	0.21590	0.0520	L	0.52126	1.63	0.48236	D	0.999611	P;D	0.64830	0.826;0.994	B;P	0.47864	0.185;0.559	T	0.01382	-1.1369	10	0.72032	D	0.01	.	11.9499	0.52948	0.0:0.8809:0.0:0.1191	.	286;1691	B4DRU3;Q9Y4D7	.;PLXD1_HUMAN	Q	1691	ENSP00000317128:R1691Q;ENSP00000376931:R1691Q	ENSP00000317128:R1691Q	R	-	2	0	PLXND1	130761924	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	3.723000	0.54955	2.326000	0.78906	0.462000	0.41574	CGG	.	C|1.000;G|0.000		0.662	PLXND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356132.4	NM_015103	
CLSTN2	64084	hgsc.bcm.edu	37	3	140281020	140281020	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr3:140281020A>T	ENST00000458420.3	+	13	2272	c.2082A>T	c.(2080-2082)ttA>ttT	p.L694F		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	694					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						TTCATAACTTAGATTTCTGTG	0.498										HNSCC(16;0.037)																											p.L694F	GBM(45;858 913 3709 36904 37282)	Atlas-SNP	.											.	CLSTN2	190	.	0			c.A2082T						.						102.0	98.0	99.0					3																	140281020		2203	4300	6503	SO:0001583	missense	64084	exon13			TAACTTAGATTTC	AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.2082A>T	chr3.hg19:g.140281020A>T	ENSP00000402460:p.Leu694Phe	90.0	0.0		95.0	40.0	NM_022131	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	ENST00000458420.3	hg19	CCDS3112.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.228156	0.79576	.	.	ENSG00000158258	ENST00000458420	T	0.34072	1.38	5.43	-1.16	0.09678	.	0.000000	0.85682	D	0.000000	T	0.54806	0.1881	M	0.85630	2.765	0.46774	D	0.999195	D	0.76494	0.999	D	0.85130	0.997	T	0.54516	-0.8282	9	.	.	.	-32.6169	6.295	0.21081	0.2692:0.0:0.5783:0.1525	.	694	Q9H4D0	CSTN2_HUMAN	F	694	ENSP00000402460:L694F	.	L	+	3	2	CLSTN2	141763710	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	2.414000	0.44627	0.125000	0.18397	0.533000	0.62120	TTA	.	.		0.498	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359393.3	NM_022131	
BOD1L1	259282	hgsc.bcm.edu	37	4	13617012	13617012	+	Silent	SNP	C	C	A	rs56295497	byFrequency	TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr4:13617012C>A	ENST00000040738.5	-	3	618	c.483G>T	c.(481-483)acG>acT	p.T161T		NM_148894.2	NP_683692.2	Q8NFC6	BD1L1_HUMAN	biorientation of chromosomes in cell division 1-like 1	161						nucleus (GO:0005634)	DNA binding (GO:0003677)										TGTGATTTAGCGTGGCCAAAA	0.448																																					p.T161T		Atlas-SNP	.											.	.	.	.	0			c.G483T						.						232.0	223.0	226.0					4																	13617012		2203	4300	6503	SO:0001819	synonymous_variant	259282	exon3			ATTTAGCGTGGCC	AF528529	CCDS3411.2	4p16.1	2012-04-10	2012-04-10	2012-04-10	ENSG00000038219	ENSG00000038219			31792	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member A"", ""biorientation of chromosomes in cell division 1-like"""	FAM44A, BOD1L			Standard	XM_005248150		Approved	FLJ33215, KIAA1327	uc003gmz.1	Q8NFC6	OTTHUMG00000090659	ENST00000040738.5:c.483G>T	chr4.hg19:g.13617012C>A		342.0	1.0		166.0	73.0	NM_148894	Q6P0M8|Q96AL1|Q9H6G0|Q9NTD6|Q9P2L9	Silent	SNP	ENST00000040738.5	hg19	CCDS3411.2																																																																																			.	C|0.988;T|0.012		0.448	BOD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207321.1	NM_148894	
KCTD8	386617	hgsc.bcm.edu	37	4	44177219	44177219	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr4:44177219T>C	ENST00000360029.3	-	2	1293	c.1010A>G	c.(1009-1011)aAa>aGa	p.K337R		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	337					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						TTTGTCATGTTTCCTATCTTC	0.408										HNSCC(17;0.042)																											p.K337R		Atlas-SNP	.											.	KCTD8	96	.	0			c.A1010G						.						119.0	112.0	114.0					4																	44177219		2203	4300	6503	SO:0001583	missense	386617	exon2			TCATGTTTCCTAT	AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1010A>G	chr4.hg19:g.44177219T>C	ENSP00000353129:p.Lys337Arg	149.0	0.0		106.0	40.0	NM_198353	A2RU39	Missense_Mutation	SNP	ENST00000360029.3	hg19	CCDS3467.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.13|18.13	3.556000|3.556000	0.65425|0.65425	.|.	.|.	ENSG00000183783|ENSG00000183783	ENST00000360029|ENST00000515268	T|.	0.39787|.	1.06|.	4.65|4.65	4.65|4.65	0.58169|0.58169	.|.	0.000000|.	0.51477|.	D|.	0.000081|.	T|T	0.44540|0.44540	0.1298|0.1298	N|N	0.19112|0.19112	0.55|0.55	0.37078|0.37078	D|D	0.898854|0.898854	B|.	0.33739|.	0.422|.	B|.	0.29598|.	0.104|.	T|T	0.48801|0.48801	-0.9003|-0.9003	10|5	0.72032|.	D|.	0.01|.	.|.	13.6861|13.6861	0.62517|0.62517	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	337|.	Q6ZWB6|.	KCTD8_HUMAN|.	R|D	337|73	ENSP00000353129:K337R|.	ENSP00000353129:K337R|.	K|N	-|-	2|1	0|0	KCTD8|KCTD8	43871976|43871976	1.000000|1.000000	0.71417|0.71417	0.992000|0.992000	0.48379|0.48379	0.945000|0.945000	0.59286|0.59286	6.590000|6.590000	0.74085|0.74085	2.078000|2.078000	0.62432|0.62432	0.477000|0.477000	0.44152|0.44152	AAA|AAC	.	.		0.408	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216868.1		
CTNND2	1501	hgsc.bcm.edu	37	5	11082847	11082847	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:11082847G>A	ENST00000304623.8	-	16	2938	c.2749C>T	c.(2749-2751)Cgg>Tgg	p.R917W	CTNND2_ENST00000458100.2_Missense_Mutation_p.R484W|CTNND2_ENST00000503622.1_Missense_Mutation_p.R580W|CTNND2_ENST00000359640.2_Missense_Mutation_p.R859W|CTNND2_ENST00000495388.2_5'UTR|CTNND2_ENST00000511377.1_Missense_Mutation_p.R826W	NM_001332.2	NP_001323.1	Q9UQB3	CTND2_HUMAN	catenin (cadherin-associated protein), delta 2	917					cell adhesion (GO:0007155)|learning (GO:0007612)|morphogenesis of a branching structure (GO:0001763)|multicellular organismal development (GO:0007275)|regulation of synaptic plasticity (GO:0048167)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(29)|liver(1)|lung(71)|ovary(4)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	136						GCCATGTTCCGCAGCGCAGTG	0.522																																					p.R917W		Atlas-SNP	.											CTNND2,NS,carcinoma,0,1	CTNND2	289	.	0			c.C2749T						.						133.0	116.0	121.0					5																	11082847		2203	4300	6503	SO:0001583	missense	1501	exon16			TGTTCCGCAGCGC	U52828	CCDS3881.1, CCDS75227.1, CCDS75228.1	5p15.2	2013-02-14	2012-08-15		ENSG00000169862	ENSG00000169862		"""Armadillo repeat containing"""	2516	protein-coding gene	gene with protein product	"""neural plakophilin-related arm-repeat protein"""	604275	"""catenin (cadherin-associated protein), delta 2 (neural plakophilin-related arm-repeat protein)"""			9342840, 9223106	Standard	XM_005248251		Approved	NPRAP, GT24	uc003jfa.1	Q9UQB3	OTTHUMG00000090511	ENST00000304623.8:c.2749C>T	chr5.hg19:g.11082847G>A	ENSP00000307134:p.Arg917Trp	172.0	0.0		115.0	44.0	NM_001332	B0FTZ7|O00379|O15390|O43206|O43840|Q13589|Q9UM66|Q9UPM3	Missense_Mutation	SNP	ENST00000304623.8	hg19	CCDS3881.1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281706	0.80692	.	.	ENSG00000169862	ENST00000304623;ENST00000359640;ENST00000511377;ENST00000538638;ENST00000458100;ENST00000503622	T;T;T;T;T	0.70516	-0.49;-0.49;-0.49;-0.49;-0.49	5.04	5.04	0.67666	Armadillo-like helical (1);Armadillo-type fold (1);	0.209202	0.40554	N	0.001070	D	0.87485	0.6189	M	0.90542	3.125	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.997	D	0.90094	0.4179	10	0.87932	D	0	-22.3756	18.7557	0.91832	0.0:0.0:1.0:0.0	.	580;509;917	B4DRK2;B4DG58;Q9UQB3	.;.;CTND2_HUMAN	W	917;859;826;12;484;580	ENSP00000307134:R917W;ENSP00000352661:R859W;ENSP00000426510:R826W;ENSP00000391155:R484W;ENSP00000426887:R580W	ENSP00000307134:R917W	R	-	1	2	CTNND2	11135847	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	3.392000	0.52537	2.505000	0.84491	0.563000	0.77884	CGG	.	.		0.522	CTNND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206999.1	NM_001332	
CCDC152	100129792	hgsc.bcm.edu	37	5	42804757	42804757	+	IGR	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:42804757C>A	ENST00000361970.5	+	0	3431				SEPP1_ENST00000506577.1_Splice_Site|SEPP1_ENST00000511224.1_Splice_Site|SEPP1_ENST00000509276.1_Splice_Site|SEPP1_ENST00000507920.1_Intron|CTD-2325A15.5_ENST00000606056.1_RNA|SEPP1_ENST00000514985.1_Splice_Site	NM_001134848.1	NP_001128320.1	Q4G0S7	CC152_HUMAN	coiled-coil domain containing 152											endometrium(1)	1						CAGAAAAATACCGTGAGAGAG	0.343																																					.		Atlas-SNP	.											.	SEPP1	33	.	0			c.534+1G>T						.						86.0	82.0	83.0					5																	42804757		1800	4072	5872	SO:0001628	intergenic_variant	6414	exon5			AAAATACCGTGAG		CCDS47203.1	5p12	2008-07-14			ENSG00000198865	ENSG00000198865			34438	protein-coding gene	gene with protein product							Standard	NM_001134848		Approved	LOC100129792	uc003jmx.3	Q4G0S7	OTTHUMG00000162141		chr5.hg19:g.42804757C>A		304.0	1.0		314.0	106.0	NM_005410	B3KXI4|B4E0P7|Q5BLP6	Splice_Site	SNP	ENST00000361970.5	hg19	CCDS47203.1	.	.	.	.	.	.	.	.	.	.	C	18.21	3.572417	0.65765	.	.	ENSG00000250722	ENST00000514985;ENST00000511224;ENST00000506577;ENST00000514218;ENST00000510965	.	.	.	5.53	4.64	0.57946	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2261	0.82293	0.0:0.8668:0.1332:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SEPP1	42840514	1.000000	0.71417	0.696000	0.30242	0.986000	0.74619	6.174000	0.71943	1.276000	0.44395	0.557000	0.71058	.	.	.		0.343	CCDC152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367497.1	XM_001717416	
REEP5	7905	hgsc.bcm.edu	37	5	112238112	112238112	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:112238112A>G	ENST00000379638.4	-	3	664	c.316T>C	c.(316-318)Ttc>Ctc	p.F106L	REEP5_ENST00000545426.1_Missense_Mutation_p.F106L|REEP5_ENST00000504247.1_Intron|REEP5_ENST00000513339.1_Missense_Mutation_p.F106L|REEP5_ENST00000474542.2_5'UTR	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	106						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		CATGACAGGAAGATATCAGAG	0.418																																					p.F106L		Atlas-SNP	.											.	REEP5	12	.	0			c.T316C						.						162.0	141.0	148.0					5																	112238112		2202	4300	6502	SO:0001583	missense	7905	exon3			ACAGGAAGATATC	BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.316T>C	chr5.hg19:g.112238112A>G	ENSP00000368959:p.Phe106Leu	142.0	0.0		128.0	60.0	NM_005669	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	ENST00000379638.4	hg19	CCDS4109.2	.	.	.	.	.	.	.	.	.	.	A	9.689	1.151291	0.21371	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000261482	D;D;D;D	0.91686	-2.89;-2.89;-2.89;-2.89	5.73	5.73	0.89815	.	0.043741	0.85682	D	0.000000	T	0.80270	0.4592	N	0.03948	-0.315	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.13407	0.009;0.009;0.006	T	0.76206	-0.3044	10	0.02654	T	1	-14.5387	16.0233	0.80516	1.0:0.0:0.0:0.0	.	106;79;106	B7Z510;B7Z2A3;Q00765	.;.;REEP5_HUMAN	L	106;106;106;97	ENSP00000368959:F106L;ENSP00000425901:F106L;ENSP00000442940:F106L;ENSP00000261482:F97L	ENSP00000261482:F97L	F	-	1	0	REEP5	112266011	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.401000	0.79962	2.186000	0.69663	0.533000	0.62120	TTC	.	.		0.418	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250739.2	NM_005669	
PCDHGB7	56099	hgsc.bcm.edu	37	5	140798829	140798829	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr5:140798829G>A	ENST00000398594.2	+	1	1403	c.1403G>A	c.(1402-1404)gGt>gAt	p.G468D	PCDHGB2_ENST00000522605.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	468	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AACCAGCCGGGTGCCTCCATA	0.572																																					p.G468D		Atlas-SNP	.											.	PCDHGB7	117	.	0			c.G1403A						.						79.0	92.0	88.0					5																	140798829		2123	4244	6367	SO:0001583	missense	56099	exon1			AGCCGGGTGCCTC	AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1403G>A	chr5.hg19:g.140798829G>A	ENSP00000381594:p.Gly468Asp	147.0	0.0		129.0	29.0	NM_018927	Q9UN63	Missense_Mutation	SNP	ENST00000398594.2	hg19	CCDS47293.1	.	.	.	.	.	.	.	.	.	.	g	19.66	3.869744	0.72065	.	.	ENSG00000254122	ENST00000398594	T	0.68624	-0.34	5.19	5.19	0.71726	Cadherin (3);Cadherin-like (1);	0.000000	0.32836	U	0.005596	D	0.83681	0.5307	M	0.82323	2.585	0.44123	D	0.9969	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.86331	0.1698	10	0.87932	D	0	.	18.3236	0.90246	0.0:0.0:1.0:0.0	.	468;468	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	D	468	ENSP00000381594:G468D	ENSP00000381594:G468D	G	+	2	0	PCDHGB7	140779013	1.000000	0.71417	0.083000	0.20561	0.903000	0.53119	5.657000	0.67996	2.410000	0.81850	0.491000	0.48974	GGT	.	.		0.572	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376973.1	NM_018927	
KIF13A	63971	hgsc.bcm.edu	37	6	17764367	17764367	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:17764367C>A	ENST00000259711.6	-	39	5497	c.5392G>T	c.(5392-5394)Gcc>Tcc	p.A1798S	KIF13A_ENST00000378826.2_Missense_Mutation_p.A1763S|KIF13A_ENST00000378816.5_Missense_Mutation_p.A1763S|KIF13A_ENST00000378843.2_Missense_Mutation_p.A1750S|KIF13A_ENST00000378814.5_Intron	NM_022113.5	NP_071396.4	Q9H1H9	KI13A_HUMAN	kinesin family member 13A	1798					ATP catabolic process (GO:0006200)|cargo loading into vesicle (GO:0035459)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|Golgi to plasma membrane protein transport (GO:0043001)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)	centrosome (GO:0005813)|endosome membrane (GO:0010008)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|midbody (GO:0030496)|trans-Golgi network membrane (GO:0032588)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	64	Breast(50;0.0107)|Ovarian(93;0.016)	all_hematologic(90;0.125)	all cancers(50;0.0865)|Epithelial(50;0.0974)			ACCCAAAAGGCTGCCTCTGGA	0.488																																					p.A1798S		Atlas-SNP	.											.	KIF13A	276	.	0			c.G5392T						.						46.0	48.0	47.0					6																	17764367		1958	4138	6096	SO:0001583	missense	63971	exon39			AAAAGGCTGCCTC	AJ291578	CCDS47380.1, CCDS47381.1, CCDS54967.1, CCDS54968.1, CCDS58998.1	6p23	2008-10-21			ENSG00000137177	ENSG00000137177		"""Kinesins"""	14566	protein-coding gene	gene with protein product		605433				11106728	Standard	NM_022113		Approved	bA500C11.2	uc003ncg.4	Q9H1H9	OTTHUMG00000014313	ENST00000259711.6:c.5392G>T	chr6.hg19:g.17764367C>A	ENSP00000259711:p.Ala1798Ser	149.0	0.0		134.0	55.0	NM_022113	A0JP21|A0JP22|F2Z382|Q5THQ2|Q5THQ3|Q9H193|Q9H194|Q9H1H8	Missense_Mutation	SNP	ENST00000259711.6	hg19	CCDS47381.1	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265412	0.40095	.	.	ENSG00000137177	ENST00000259711;ENST00000378826;ENST00000378843;ENST00000378816	T;T;T;T	0.72394	-0.57;-0.65;-0.65;-0.65	5.78	1.77	0.24775	.	1.640970	0.03369	N	0.198705	T	0.26011	0.0634	N	0.14661	0.345	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.17433	0.018;0.008;0.008	T	0.09751	-1.0660	10	0.15066	T	0.55	.	2.8817	0.05649	0.1414:0.5369:0.1208:0.201	.	1750;1763;1798	Q9H1H9-4;Q9H1H9-2;Q9H1H9	.;.;KI13A_HUMAN	S	1798;1763;1750;1763	ENSP00000259711:A1798S;ENSP00000368103:A1763S;ENSP00000368120:A1750S;ENSP00000368093:A1763S	ENSP00000259711:A1798S	A	-	1	0	KIF13A	17872346	0.012000	0.17670	0.035000	0.18076	0.245000	0.25701	0.020000	0.13466	0.373000	0.24621	0.591000	0.81541	GCC	.	.		0.488	KIF13A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000039954.4		
COL11A2	1302	hgsc.bcm.edu	37	6	33144991	33144991	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:33144991C>A	ENST00000374708.4	-	22	1983	c.1725G>T	c.(1723-1725)ggG>ggT	p.G575G	COL11A2_ENST00000341947.2_Silent_p.G661G|COL11A2_ENST00000374714.1_Silent_p.G635G|COL11A2_ENST00000477772.1_5'UTR|COL11A2_ENST00000357486.1_Silent_p.G640G|COL11A2_ENST00000395197.1_Silent_p.G601G|COL11A2_ENST00000361917.1_Silent_p.G554G|COL11A2_ENST00000374713.1_Silent_p.G614G|COL11A2_ENST00000374712.1_Silent_p.G580G	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	661	Collagen-like 3.|Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CACCCTGGGGCCCGGGAAGAC	0.557																																					p.G661G	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.G1983T						.						48.0	56.0	53.0					6																	33144991		1508	2707	4215	SO:0001819	synonymous_variant	1302	exon24			CTGGGGCCCGGGA	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.1725G>T	chr6.hg19:g.33144991C>A		65.0	0.0		63.0	16.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	hg19	CCDS43452.1	.	.	.	.	.	.	.	.	.	.	C	5.857	0.342341	0.11069	.	.	ENSG00000204248	ENST00000395196	.	.	.	4.16	1.0	0.19881	.	0.000000	0.85682	D	0.000000	T	0.26376	0.0644	.	.	.	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17837	-1.0356	8	0.87932	D	0	.	4.8495	0.13530	0.0:0.5753:0.1849:0.2398	.	67	A2ABA7	.	V	41	.	ENSP00000378622:G41V	G	-	2	0	COL11A2	33252969	0.000000	0.05858	0.980000	0.43619	0.534000	0.34807	-2.266000	0.01171	0.381000	0.24851	0.643000	0.83706	GGC	.	.		0.557	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
DNAH8	1769	hgsc.bcm.edu	37	6	38747836	38747836	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:38747836A>T	ENST00000359357.3	+	13	1737	c.1483A>T	c.(1483-1485)Aag>Tag	p.K495*	DNAH8_ENST00000449981.2_Nonsense_Mutation_p.K712*|DNAH8_ENST00000441566.1_Nonsense_Mutation_p.K495*			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	495					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						TGATGCTACTAAGAAGGCAAG	0.343																																					p.K712X		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A2134T						.						103.0	97.0	99.0					6																	38747836		2203	4300	6503	SO:0001587	stop_gained	1769	exon15			GCTACTAAGAAGG	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.1483A>T	chr6.hg19:g.38747836A>T	ENSP00000352312:p.Lys495*	115.0	0.0		97.0	29.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Nonsense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	41	8.606517	0.98881	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	.	.	.	5.54	5.54	0.83059	.	0.062950	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.548	0.68047	1.0:0.0:0.0:0.0	.	.	.	.	X	700;700;495;495	.	ENSP00000333363:K700X	K	+	1	0	DNAH8	38855814	1.000000	0.71417	0.994000	0.49952	0.620000	0.37586	5.498000	0.66931	2.243000	0.73865	0.482000	0.46254	AAG	.	.		0.343	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
NT5DC1	221294	hgsc.bcm.edu	37	6	116542390	116542390	+	Splice_Site	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:116542390G>A	ENST00000319550.4	+	7	785	c.703G>A	c.(703-705)Ggg>Agg	p.G235R		NM_152729.2	NP_689942.2	Q5TFE4	NT5D1_HUMAN	5'-nucleotidase domain containing 1	235							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|prostate(2)|skin(1)|stomach(1)	8		all_cancers(87;0.00367)|all_epithelial(87;0.00449)|Colorectal(196;0.0469)		all cancers(137;0.0327)|OV - Ovarian serous cystadenocarcinoma(136;0.0445)|GBM - Glioblastoma multiforme(226;0.0719)|Epithelial(106;0.112)		ATATATTCTTGGGTGAGTGAT	0.358																																					p.G235R	Colon(128;1440 1664 38087 41475 42869)	Atlas-SNP	.											.	NT5DC1	32	.	0			c.G703A						.						81.0	82.0	81.0					6																	116542390		2203	4300	6503	SO:0001630	splice_region_variant	221294	exon7			ATTCTTGGGTGAG	BC015138	CCDS5104.1	6q22.31	2008-02-05	2006-01-27	2006-01-27	ENSG00000178425	ENSG00000178425			21556	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic II-like 1"""	NT5C2L1			Standard	NM_152729		Approved	dJ486I3.1, MGC24302	uc003pwj.3	Q5TFE4	OTTHUMG00000015428	ENST00000319550.4:c.704+1G>A	chr6.hg19:g.116542390G>A		370.0	0.0		188.0	63.0	NM_152729	B2RND9|B3KR35|Q6XYD5	Missense_Mutation	SNP	ENST00000319550.4	hg19	CCDS5104.1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.827017	0.90955	.	.	ENSG00000178425	ENST00000319550	T	0.23552	1.9	5.62	5.62	0.85841	HAD-like domain (2);	0.000000	0.85682	D	0.000000	T	0.53658	0.1810	M	0.88842	2.985	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.61257	-0.7099	10	0.66056	D	0.02	-13.0406	18.6578	0.91460	0.0:0.0:1.0:0.0	.	185;235;235	B3KR35;A8K2Z3;Q5TFE4	.;.;NT5D1_HUMAN	R	235	ENSP00000326858:G235R	ENSP00000326858:G235R	G	+	1	0	NT5DC1	116649083	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.145000	0.94634	2.665000	0.90641	0.585000	0.79938	GGG	.	.		0.358	NT5DC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041931.3	NM_152729	Missense_Mutation
UNC93A	54346	hgsc.bcm.edu	37	6	167708073	167708073	+	Silent	SNP	G	G	A	rs558415122		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr6:167708073G>A	ENST00000230256.3	+	2	331	c.156G>A	c.(154-156)ctG>ctA	p.L52L	UNC93A_ENST00000366830.2_3'UTR|UNC93A_ENST00000366829.2_Silent_p.L52L	NM_018974.3	NP_061847.2	Q86WB7	UN93A_HUMAN	unc-93 homolog A (C. elegans)	52						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	40		Breast(66;7.62e-05)|Ovarian(120;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.22e-20)|BRCA - Breast invasive adenocarcinoma(81;6.17e-07)|GBM - Glioblastoma multiforme(31;0.00492)		GCATGCTCCTGTCCTCCATGT	0.617																																					p.L52L		Atlas-SNP	.											.	UNC93A	66	.	0			c.G156A						.						253.0	210.0	224.0					6																	167708073		2203	4300	6503	SO:0001819	synonymous_variant	54346	exon2			GCTCCTGTCCTCC	AJ508812	CCDS5300.1, CCDS47515.1	6q27	2014-05-16	2001-11-28		ENSG00000112494	ENSG00000112494			12570	protein-coding gene	gene with protein product		607995	"""unc93 (C.elegans) homolog A"""			12381271	Standard	NM_001143947		Approved	dJ366N23.2, dJ366N23.1	uc003qvq.3	Q86WB7	OTTHUMG00000016021	ENST00000230256.3:c.156G>A	chr6.hg19:g.167708073G>A		101.0	0.0		115.0	43.0	NM_018974	B3KRP5|Q4QQJ4|Q5JZD6	Silent	SNP	ENST00000230256.3	hg19	CCDS5300.1																																																																																			.	.		0.617	UNC93A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043125.2	NM_018974	
IQUB	154865	hgsc.bcm.edu	37	7	123143008	123143008	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:123143008C>T	ENST00000466202.1	-	5	1433	c.857G>A	c.(856-858)aGg>aAg	p.R286K	IQUB_ENST00000488987.1_5'UTR|IQUB_ENST00000434450.1_Missense_Mutation_p.R286K|IQUB_ENST00000324698.6_Missense_Mutation_p.R286K	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	286					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						CTGCGTATCCCTACAAAATAT	0.343																																					p.R286K		Atlas-SNP	.											.	IQUB	117	.	0			c.G857A						.						111.0	109.0	109.0					7																	123143008		2203	4300	6503	SO:0001583	missense	154865	exon5			GTATCCCTACAAA	AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.857G>A	chr7.hg19:g.123143008C>T	ENSP00000417769:p.Arg286Lys	176.0	1.0		77.0	48.0	NM_178827	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	ENST00000466202.1	hg19	CCDS5787.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785395	0.90282	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.62788	1.07;1.07;0.0	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.82637	0.5080	M	0.87758	2.905	0.52099	D	0.99994	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.973	D	0.84288	0.0498	10	0.56958	D	0.05	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	286;286	Q8NA54-2;Q8NA54	.;IQUB_HUMAN	K	286	ENSP00000417769:R286K;ENSP00000324882:R286K;ENSP00000388498:R286K	ENSP00000324882:R286K	R	-	2	0	IQUB	122930244	0.995000	0.38212	1.000000	0.80357	0.783000	0.44284	2.517000	0.45529	2.725000	0.93324	0.655000	0.94253	AGG	.	.		0.343	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348529.1	NM_178827	
AGBL3	340351	hgsc.bcm.edu	37	7	134717660	134717660	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:134717660G>A	ENST00000436302.2	+	6	737	c.484G>A	c.(484-486)Gtg>Atg	p.V162M	AGBL3_ENST00000435976.2_Missense_Mutation_p.V162M|AGBL3_ENST00000458078.1_Missense_Mutation_p.V136M	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	162						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						GAAGCAGCCTGTGGATTACCG	0.398																																					p.V162M		Atlas-SNP	.											.	AGBL3	45	.	0			c.G484A						.						143.0	133.0	136.0					7																	134717660		692	1591	2283	SO:0001583	missense	340351	exon6			CAGCCTGTGGATT	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.484G>A	chr7.hg19:g.134717660G>A	ENSP00000388275:p.Val162Met	195.0	0.0		82.0	44.0	NM_178563	B7Z827|Q9H965	Missense_Mutation	SNP	ENST00000436302.2	hg19	CCDS47718.1	.	.	.	.	.	.	.	.	.	.	G	5.466	0.271005	0.10349	.	.	ENSG00000146856	ENST00000436302;ENST00000458078;ENST00000435976	T;T;T	0.43688	0.94;0.94;0.94	5.16	0.0744	0.14395	.	0.175957	0.27535	N	0.018921	T	0.19725	0.0474	N	0.19112	0.55	0.09310	N	1	B	0.21821	0.061	B	0.19666	0.026	T	0.07083	-1.0791	10	0.28530	T	0.3	-1.0515	1.7495	0.02969	0.2426:0.104:0.4553:0.1981	.	162	Q8NEM8-4	.	M	162;136;162	ENSP00000388275:V162M;ENSP00000395969:V136M;ENSP00000401220:V162M	ENSP00000275763:V162M	V	+	1	0	AGBL3	134368200	0.000000	0.05858	0.772000	0.31596	0.366000	0.29705	0.030000	0.13688	0.086000	0.17137	-0.691000	0.03719	GTG	.	.		0.398	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
ADAM28	10863	hgsc.bcm.edu	37	8	24193031	24193031	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr8:24193031T>C	ENST00000265769.4	+	14	1554	c.1444T>C	c.(1444-1446)Tct>Cct	p.S482P	RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000540823.1_Missense_Mutation_p.S249P|ADAM28_ENST00000437154.2_Missense_Mutation_p.S482P|ADAM28_ENST00000397649.3_Missense_Mutation_p.S229P	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	482	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.		S -> F (in a cutaneous metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:21618342}.		spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TAATGGTAAATCTGGTAATTG	0.468																																					p.S482P	NSCLC(193;488 2149 22258 34798 40734)	Atlas-SNP	.											.	ADAM28	100	.	0			c.T1444C						.						138.0	129.0	132.0					8																	24193031		2203	4300	6503	SO:0001583	missense	10863	exon14			GGTAAATCTGGTA	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1444T>C	chr8.hg19:g.24193031T>C	ENSP00000265769:p.Ser482Pro	230.0	0.0		122.0	8.0	NM_014265	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	hg19	CCDS34865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.97|14.97	2.693711|2.693711	0.48202|0.48202	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000521629|ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	.|T;T;T;T	.|0.15017	.|2.46;2.46;2.46;2.46	5.8|5.8	3.36|3.36	0.38483|0.38483	.|Blood coagulation inhibitor, Disintegrin (6);	.|.	.|.	.|.	.|.	T|T	0.54711|0.54711	0.1875|0.1875	H|H	0.97918|0.97918	4.105|4.105	0.58432|0.58432	D|D	0.999996|0.999996	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.999;1.0	T|T	0.63492|0.63492	-0.6625|-0.6625	5|9	.|0.87932	.|D	.|0	.|.	9.6176|9.6176	0.39701|0.39701	0.2791:0.0:0.0:0.7209|0.2791:0.0:0.0:0.7209	.|.	.|249;482;482;482	.|B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.|.;.;ADA28_HUMAN;.	T|P	114|482;229;249;482	.|ENSP00000265769:S482P;ENSP00000380770:S229P;ENSP00000443743:S249P;ENSP00000393699:S482P	.|ENSP00000265769:S482P	I|S	+|+	2|1	0|0	ADAM28|ADAM28	24248976|24248976	1.000000|1.000000	0.71417|0.71417	0.777000|0.777000	0.31699|0.31699	0.169000|0.169000	0.22640|0.22640	4.082000|4.082000	0.57635|0.57635	0.421000|0.421000	0.25980|0.25980	0.528000|0.528000	0.53228|0.53228	ATC|TCT	.	.		0.468	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
SMC2	10592	hgsc.bcm.edu	37	9	106894408	106894408	+	Splice_Site	SNP	T	T	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:106894408T>G	ENST00000286398.7	+	22	3396		c.e22+2		SMC2_ENST00000374793.3_Splice_Site|SMC2_ENST00000374787.3_Splice_Site|SMC2_ENST00000303219.8_Splice_Site	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2						kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TGGCAAAAGGTACTTTTTATG	0.303																																					.		Atlas-SNP	.											.	SMC2	127	.	0			c.3108+2T>G						.						67.0	72.0	70.0					9																	106894408		2203	4294	6497	SO:0001630	splice_region_variant	10592	exon22			AAAAGGTACTTTT	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3108+2T>G	chr9.hg19:g.106894408T>G		503.0	0.0		287.0	123.0	NM_001042551	Q6IEE0|Q9P1P2	Splice_Site	SNP	ENST00000286398.7	hg19	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.106937	0.77096	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1896	0.65630	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMC2	105934229	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.971000	0.88012	2.222000	0.72286	0.533000	0.62120	.	.	.		0.303	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		Intron
CACNA1B	774	hgsc.bcm.edu	37	9	140953173	140953173	+	Silent	SNP	G	G	C	rs199714779		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr9:140953173G>C	ENST00000371372.1	+	29	4606	c.4461G>C	c.(4459-4461)gtG>gtC	p.V1487V	CACNA1B_ENST00000371355.4_Silent_p.V1488V|CACNA1B_ENST00000371357.1_Silent_p.V1488V|CACNA1B_ENST00000277549.5_Silent_p.V683V|CACNA1B_ENST00000277551.2_Silent_p.V1487V|CACNA1B_ENST00000371363.1_Silent_p.V1487V	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1487					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	ACACTGTGGTGCTGATGATGA	0.557																																					p.V1487V		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G4461C						.						53.0	49.0	50.0					9																	140953173		2050	4207	6257	SO:0001819	synonymous_variant	774	exon29			TGTGGTGCTGATG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.4461G>C	chr9.hg19:g.140953173G>C		96.0	0.0		107.0	38.0	NM_001243812	B1AQK5	Silent	SNP	ENST00000371372.1	hg19	CCDS59522.1																																																																																			.	.		0.557	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
ASAH2	56624	hgsc.bcm.edu	37	10	52005051	52005051	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr10:52005051C>A	ENST00000395526.4	-	2	290	c.291G>T	c.(289-291)caG>caT	p.Q97H	ASAH2_ENST00000329428.6_Missense_Mutation_p.Q78H|ASAH2_ENST00000447815.1_Missense_Mutation_p.Q97H	NM_019893.2	NP_063946.2	Q9NR71	ASAH2_HUMAN	N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2	97					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ceramidase activity (GO:0017040)			large_intestine(1)|lung(9)|urinary_tract(1)	11						CACTGAAGTTCTGAAATAGAG	0.512																																					p.Q97H		Atlas-SNP	.											.	ASAH2	69	.	0			c.G291T						.						180.0	185.0	183.0					10																	52005051		2203	4300	6503	SO:0001583	missense	56624	exon2			GAAGTTCTGAAAT	AF250847	CCDS7239.2, CCDS44398.1	10q11.23	2008-08-11			ENSG00000188611	ENSG00000188611			18860	protein-coding gene	gene with protein product		611202				10781606	Standard	NM_019893		Approved		uc001jjd.3	Q9NR71	OTTHUMG00000018223	ENST00000395526.4:c.291G>T	chr10.hg19:g.52005051C>A	ENSP00000378897:p.Gln97His	361.0	0.0		339.0	178.0	NM_019893	Q3KNU1|Q5SNT7|Q5SZP6|Q5SZP7|Q5T1D5|Q71ME6	Missense_Mutation	SNP	ENST00000395526.4	hg19	CCDS7239.2	.	.	.	.	.	.	.	.	.	.	C	17.52	3.409294	0.62399	.	.	ENSG00000188611	ENST00000395526;ENST00000447815;ENST00000329428	T;T;T	0.32753	1.45;1.44;1.44	5.67	4.75	0.60458	.	0.276251	0.32952	N	0.005460	T	0.27629	0.0679	N	0.22421	0.69	0.80722	D	1	P;P	0.48503	0.911;0.906	P;B	0.47941	0.562;0.428	T	0.01561	-1.1324	10	0.46703	T	0.11	.	12.8939	0.58087	0.0:0.919:0.0:0.081	.	97;97	Q9NR71-2;Q9NR71	.;ASAH2_HUMAN	H	97;97;78	ENSP00000378897:Q97H;ENSP00000388206:Q97H;ENSP00000329886:Q78H	ENSP00000329886:Q78H	Q	-	3	2	ASAH2	51675057	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	2.840000	0.48215	2.649000	0.89929	0.655000	0.94253	CAG	.	.		0.512	ASAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048061.3	NM_019893	
DCHS1	8642	hgsc.bcm.edu	37	11	6643329	6643329	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:6643329C>A	ENST00000299441.3	-	21	9989	c.9578G>T	c.(9577-9579)tGt>tTt	p.C3193F	TPP1_ENST00000528657.1_5'Flank|RP11-732A19.5_ENST00000526456.1_RNA|TPP1_ENST00000299427.6_5'Flank|TPP1_ENST00000534644.1_5'Flank|TPP1_ENST00000533371.1_5'Flank|RP11-732A19.9_ENST00000545572.1_RNA	NM_003737.2	NP_003728.1	Q96JQ0	PCD16_HUMAN	dachsous cadherin-related 1	3193					branching involved in ureteric bud morphogenesis (GO:0001658)|calcium-dependent cell-cell adhesion (GO:0016339)|cochlea development (GO:0090102)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|neural tube development (GO:0021915)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|post-anal tail morphogenesis (GO:0036342)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(16)|liver(1)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(4)	103		Medulloblastoma(188;0.00263)|all_neural(188;0.026)		Epithelial(150;6.35e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		AGCTGGGGGACATGGCCGAGC	0.617																																					p.C3193F		Atlas-SNP	.											.	DCHS1	277	.	0			c.G9578T						.						43.0	49.0	47.0					11																	6643329		2201	4296	6497	SO:0001583	missense	8642	exon21			GGGGGACATGGCC	AB000895	CCDS7771.1	11p15.4	2013-10-04	2013-10-04	2004-09-03	ENSG00000166341	ENSG00000166341		"""Cadherins / Cadherin-related"""	13681	protein-coding gene	gene with protein product	"""cadherin-related family member 6"""	603057	"""protocadherin 16"", ""dachsous 1 (Drosophila)"""	CDH25, PCDH16		9199196	Standard	XM_005253207		Approved	FIB1, KIAA1773, FLJ11790, CDHR6	uc001mem.1	Q96JQ0	OTTHUMG00000133398	ENST00000299441.3:c.9578G>T	chr11.hg19:g.6643329C>A	ENSP00000299441:p.Cys3193Phe	112.0	0.0		86.0	30.0	NM_003737	O15098	Missense_Mutation	SNP	ENST00000299441.3	hg19	CCDS7771.1	.	.	.	.	.	.	.	.	.	.	C	8.080	0.772134	0.16051	.	.	ENSG00000166341	ENST00000299441	T	0.53423	0.62	4.88	4.88	0.63580	.	0.000000	0.46145	D	0.000314	T	0.38268	0.1034	N	0.22421	0.69	0.34786	D	0.735252	D	0.56521	0.976	P	0.44518	0.452	T	0.48948	-0.8989	10	0.31617	T	0.26	.	16.7719	0.85539	0.0:1.0:0.0:0.0	.	3193	Q96JQ0	PCD16_HUMAN	F	3193	ENSP00000299441:C3193F	ENSP00000299441:C3193F	C	-	2	0	DCHS1	6599905	0.999000	0.42202	0.990000	0.47175	0.865000	0.49528	3.651000	0.54431	2.531000	0.85337	0.313000	0.20887	TGT	.	.		0.617	DCHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257258.1	NM_003737	
OR5D14	219436	hgsc.bcm.edu	37	11	55563794	55563795	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:55563794_55563795GG>TT	ENST00000335605.1	+	1	763_764	c.763_764GG>TT	c.(763-765)GGg>TTg	p.G255L		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CATCTTCCATGGGACCATCCTT	0.465																																					p.G255W|p.G255V		Atlas-SNP	.											.	OR5D14	116	.	0			c.G763T|c.G764T						.																																			SO:0001583	missense	219436	exon1			TTCCATGGGACCA|TCCATGGGACCAT	AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	Exception_encountered	chr11.hg19:g.55563794_55563795delinsTT	ENSP00000334456:p.Gly255Leu	289.0|284.0	0.0|1.0		123.0|124.0	53.0	NM_001004735	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	ENST00000335605.1	hg19	CCDS31508.1																																																																																			.	.		0.465	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391513.1	NM_001004735	
ESRRA	2101	hgsc.bcm.edu	37	11	64082291	64082291	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr11:64082291G>T	ENST00000405666.1	+	5	884	c.650G>T	c.(649-651)gGc>gTc	p.G217V	ESRRA_ENST00000406310.1_Missense_Mutation_p.G216V|ESRRA_ENST00000000442.6_Missense_Mutation_p.G217V	NM_001282450.1	NP_001269379.1	P11474	ERR1_HUMAN	estrogen-related receptor alpha	217	Ligand binding domain.				cartilage development (GO:0051216)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						GACCCCGCAGGCCCTGATGGG	0.577																																					p.G217V		Atlas-SNP	.											.	ESRRA	56	.	0			c.G650T						.						62.0	63.0	62.0					11																	64082291		2060	4218	6278	SO:0001583	missense	2101	exon5			CCGCAGGCCCTGA	X51416, L38487	CCDS41667.1, CCDS60830.1	11q12	2013-01-16			ENSG00000173153	ENSG00000173153		"""Nuclear hormone receptors"""	3471	protein-coding gene	gene with protein product		601998		ESRL1		3267207	Standard	NM_004451		Approved	ERR1, ERRalpha, NR3B1, ERRa	uc001nzq.1	P11474	OTTHUMG00000150641	ENST00000405666.1:c.650G>T	chr11.hg19:g.64082291G>T	ENSP00000384851:p.Gly217Val	59.0	0.0		60.0	31.0	NM_004451	Q14514	Missense_Mutation	SNP	ENST00000405666.1	hg19	CCDS41667.1	.	.	.	.	.	.	.	.	.	.	G	1.675	-0.507963	0.04231	.	.	ENSG00000173153	ENST00000406310;ENST00000000442;ENST00000539594;ENST00000405666	T;T;T;T	0.34472	1.36;1.36;1.36;1.36	3.99	3.99	0.46301	Nuclear hormone receptor, ligand-binding (2);	0.279419	0.37348	N	0.002138	T	0.14485	0.0350	N	0.02539	-0.55	0.48511	D	0.999663	B;B	0.16802	0.019;0.002	B;B	0.20955	0.032;0.0	T	0.09487	-1.0672	10	0.24483	T	0.36	.	9.2555	0.37581	0.0:0.0:0.7845:0.2155	.	216;217	P11474-2;P11474	.;ERR1_HUMAN	V	216;217;74;217	ENSP00000385971:G216V;ENSP00000000442:G217V;ENSP00000439896:G74V;ENSP00000384851:G217V	ENSP00000000442:G217V	G	+	2	0	ESRRA	63838867	1.000000	0.71417	0.994000	0.49952	0.716000	0.41182	2.988000	0.49386	2.232000	0.73038	0.462000	0.41574	GGC	.	.		0.577	ESRRA-003	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319304.1	NM_004451	
TENC1	23371	hgsc.bcm.edu	37	12	53446269	53446269	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:53446269A>T	ENST00000314250.6	+	3	505	c.215A>T	c.(214-216)gAa>gTa	p.E72V	TENC1_ENST00000314276.3_Missense_Mutation_p.E82V|RP11-983P16.4_ENST00000551890.1_RNA|TENC1_ENST00000451358.1_Missense_Mutation_p.E72V|TENC1_ENST00000552570.1_Missense_Mutation_p.E72V|RP11-983P16.4_ENST00000550601.1_RNA|TENC1_ENST00000549700.1_Missense_Mutation_p.E72V|TENC1_ENST00000546602.1_Missense_Mutation_p.E72V|TENC1_ENST00000379902.3_De_novo_Start_OutOfFrame|RP11-983P16.4_ENST00000546793.1_RNA	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	72					cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						AGAAAATGTGAAGCAAAGGTG	0.567																																					p.E82V		Atlas-SNP	.											.	TENC1	148	.	0			c.A245T						.						227.0	213.0	218.0					12																	53446269		2203	4300	6503	SO:0001583	missense	23371	exon3			AATGTGAAGCAAA	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.215A>T	chr12.hg19:g.53446269A>T	ENSP00000319684:p.Glu72Val	100.0	0.0		111.0	43.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	hg19	CCDS8843.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503466	0.85176	.	.	ENSG00000111077	ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73;-1.73;-1.73	5.55	4.41	0.53225	Protein kinase C-like, phorbol ester/diacylglycerol binding (3);	0.000000	0.64402	D	0.000003	D	0.87966	0.6311	L	0.61218	1.895	0.40401	D	0.979645	D;D;D;D	0.89917	1.0;0.975;1.0;0.997	D;P;D;D	0.80764	0.963;0.668;0.983;0.994	D	0.88702	0.3216	10	0.87932	D	0	-3.8027	9.2442	0.37515	0.9148:0.0:0.0852:0.0	.	72;72;82;49	Q63HR2;F8W661;Q63HR2-4;Q6ZMJ1	TENC1_HUMAN;.;.;.	V	82;72;72;72;72;72;72	ENSP00000319756:E82V;ENSP00000319684:E72V;ENSP00000393362:E72V;ENSP00000449363:E72V;ENSP00000447021:E72V;ENSP00000449361:E72V	ENSP00000319684:E72V	E	+	2	0	TENC1	51732536	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.667000	0.54547	2.251000	0.74343	0.482000	0.46254	GAA	.	.		0.567	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
PPFIA2	8499	hgsc.bcm.edu	37	12	81746949	81746949	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:81746949G>T	ENST00000549396.1	-	17	2103	c.1943C>A	c.(1942-1944)aCg>aAg	p.T648K	PPFIA2_ENST00000548586.1_Missense_Mutation_p.T648K|PPFIA2_ENST00000550584.2_Missense_Mutation_p.T648K|PPFIA2_ENST00000333447.7_Missense_Mutation_p.T630K|PPFIA2_ENST00000443686.3_Missense_Mutation_p.T549K|PPFIA2_ENST00000552948.1_Missense_Mutation_p.T648K|PPFIA2_ENST00000550359.2_Missense_Mutation_p.T495K|PPFIA2_ENST00000549325.1_Missense_Mutation_p.T630K|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000541017.1_5'UTR|PPFIA2_ENST00000407050.4_Missense_Mutation_p.T574K|PPFIA2_ENST00000541570.2_Missense_Mutation_p.T215K	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	648					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						CATGGCTAGCGTCTGGGCATC	0.383																																					p.T648K		Atlas-SNP	.											.	PPFIA2	207	.	0			c.C1943A						.						148.0	142.0	144.0					12																	81746949		1952	4174	6126	SO:0001583	missense	8499	exon16			GCTAGCGTCTGGG	AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.1943C>A	chr12.hg19:g.81746949G>T	ENSP00000450337:p.Thr648Lys	198.0	0.0		116.0	52.0	NM_001220476	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	ENST00000549396.1	hg19	CCDS55857.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.043873	0.93685	.	.	ENSG00000139220	ENST00000549396;ENST00000549325;ENST00000541570;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948;ENST00000553058	T;T;T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.56863	0.2014	M	0.83312	2.635	0.80722	D	1	D	0.63880	0.993	D	0.74023	0.982	T	0.61811	-0.6986	10	0.66056	D	0.02	-17.3587	19.2605	0.93966	0.0:0.0:1.0:0.0	.	648	O75334	LIPA2_HUMAN	K	648;630;215;574;659;630;648;549;648;229	ENSP00000450337:T648K;ENSP00000450298:T630K;ENSP00000438337:T215K;ENSP00000385093:T574K;ENSP00000327416:T630K;ENSP00000449338:T648K;ENSP00000388373:T549K;ENSP00000447868:T648K;ENSP00000448941:T229K	ENSP00000327416:T630K	T	-	2	0	PPFIA2	80271080	1.000000	0.71417	0.958000	0.39756	0.960000	0.62799	9.799000	0.99117	2.534000	0.85438	0.585000	0.79938	ACG	.	.		0.383	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000408030.1		
DNAH10	196385	hgsc.bcm.edu	37	12	124305198	124305198	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr12:124305198G>T	ENST00000409039.3	+	23	3743	c.3718G>T	c.(3718-3720)Gct>Tct	p.A1240S		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1240	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		ACTGGCTAACGCTGAGAAACT	0.428																																					p.A1240S		Atlas-SNP	.											.	DNAH10	888	.	0			c.G3718T						.						123.0	125.0	125.0					12																	124305198		1907	4132	6039	SO:0001583	missense	196385	exon23			GCTAACGCTGAGA	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3718G>T	chr12.hg19:g.124305198G>T	ENSP00000386770:p.Ala1240Ser	155.0	0.0		133.0	66.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622632	0.46840	.	.	ENSG00000197653	ENST00000409039	T	0.22539	1.95	5.18	5.18	0.71444	.	.	.	.	.	T	0.39572	0.1083	M	0.72479	2.2	0.53688	D	0.999971	D	0.53745	0.962	P	0.58013	0.831	T	0.19976	-1.0289	9	0.09843	T	0.71	.	18.6962	0.91601	0.0:0.0:1.0:0.0	.	1240	Q8IVF4	DYH10_HUMAN	S	1240	ENSP00000386770:A1240S	ENSP00000386770:A1240S	A	+	1	0	DNAH10	122871151	1.000000	0.71417	0.819000	0.32651	0.092000	0.18411	5.607000	0.67648	2.409000	0.81822	0.555000	0.69702	GCT	.	.		0.428	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
DMXL2	23312	hgsc.bcm.edu	37	15	51791589	51791589	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:51791589C>G	ENST00000251076.5	-	18	4119	c.3832G>C	c.(3832-3834)Gtc>Ctc	p.V1278L	DMXL2_ENST00000449909.3_Intron|DMXL2_ENST00000543779.2_Missense_Mutation_p.V1278L|RP11-707P17.1_ENST00000561007.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1278						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		CCAAATTTGACAGCATGCTTC	0.413																																					p.V1278L		Atlas-SNP	.											.	DMXL2	262	.	0			c.G3832C						.						183.0	178.0	180.0					15																	51791589		2195	4293	6488	SO:0001583	missense	23312	exon18			ATTTGACAGCATG	AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.3832G>C	chr15.hg19:g.51791589C>G	ENSP00000251076:p.Val1278Leu	140.0	0.0		86.0	51.0	NM_001174116	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	ENST00000251076.5	hg19	CCDS10141.1	.	.	.	.	.	.	.	.	.	.	C	1.984	-0.433474	0.04669	.	.	ENSG00000104093	ENST00000251076;ENST00000543779	T;T	0.20738	2.05;2.05	5.66	4.73	0.59995	.	0.164769	0.53938	D	0.000051	T	0.13970	0.0338	N	0.25647	0.755	0.80722	D	1	B;B	0.18741	0.03;0.017	B;B	0.17433	0.018;0.011	T	0.07404	-1.0774	10	0.27785	T	0.31	.	9.6847	0.40091	0.0:0.7935:0.0:0.2065	.	1278;1278	F5GWF1;Q8TDJ6	.;DMXL2_HUMAN	L	1278	ENSP00000251076:V1278L;ENSP00000441858:V1278L	ENSP00000251076:V1278L	V	-	1	0	DMXL2	49578881	0.999000	0.42202	1.000000	0.80357	0.901000	0.52897	1.791000	0.38744	2.669000	0.90835	0.591000	0.81541	GTC	.	.		0.413	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254671.2	NM_015263	
STOML1	9399	hgsc.bcm.edu	37	15	74277722	74277722	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:74277722C>A	ENST00000316900.5	-	5	851	c.727G>T	c.(727-729)Gcc>Tcc	p.A243S	STOML1_ENST00000564777.1_Missense_Mutation_p.A193S|STOML1_ENST00000541638.1_Missense_Mutation_p.A201S|STOML1_ENST00000316911.6_Missense_Mutation_p.A193S|STOML1_ENST00000561656.1_Missense_Mutation_p.A156S|STOML1_ENST00000359750.4_Missense_Mutation_p.A243S	NM_001256672.1|NM_001256675.1|NM_001256677.1|NM_004809.4	NP_001243601.1|NP_001243604.1|NP_001243606.1|NP_004800.2	Q9UBI4	STML1_HUMAN	stomatin (EPB72)-like 1	243						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	8						AAGTGCAGGGCCAGCTGCTGG	0.692																																					p.A243S		Atlas-SNP	.											.	STOML1	22	.	0			c.G727T						.						21.0	19.0	20.0					15																	74277722		2198	4297	6495	SO:0001583	missense	9399	exon5			GCAGGGCCAGCTG	Y16522	CCDS10254.1, CCDS58381.1, CCDS58382.1, CCDS58383.1, CCDS58384.1, CCDS58385.1	15q24-q25	2008-07-18			ENSG00000067221	ENSG00000067221			14560	protein-coding gene	gene with protein product	"""stomatin-like 1"", ""stomatin (EBP72)-like 1"""	608326				9931417	Standard	NM_004809		Approved	hUNC-24, SLP-1, STORP, FLJ36370	uc002awe.4	Q9UBI4	OTTHUMG00000137608	ENST00000316900.5:c.727G>T	chr15.hg19:g.74277722C>A	ENSP00000319323:p.Ala243Ser	94.0	0.0		38.0	10.0	NM_001256672	B3KQN0|B4DUU5|B4DXM9|E7ESC0|H3BRP3|O95675|Q4PNR4|Q6FGL8|Q8WYI7|Q9UMB9|Q9UMC0|Q9Y6H9	Missense_Mutation	SNP	ENST00000316900.5	hg19	CCDS10254.1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.455809	0.63401	.	.	ENSG00000067221	ENST00000316900;ENST00000316911;ENST00000541638;ENST00000359750	D;D;D;D	0.98221	-3.13;-2.71;-3.1;-4.8	5.22	4.31	0.51392	.	0.107947	0.64402	D	0.000006	D	0.96433	0.8836	L	0.29908	0.895	0.51482	D	0.999928	P;P;P;P;P;P	0.45827	0.791;0.666;0.867;0.666;0.578;0.791	P;B;P;B;B;B	0.50314	0.535;0.194;0.637;0.194;0.272;0.389	D	0.94849	0.8012	10	0.34782	T	0.22	-14.6048	10.6367	0.45569	0.0:0.9109:0.0:0.0891	.	201;243;193;243;243;243	B4DUU5;E7ESC0;Q9UBI4-2;Q4PNR4;Q53HB6;Q9UBI4	.;.;.;.;.;STML1_HUMAN	S	243;193;201;243	ENSP00000319323:A243S;ENSP00000319384:A193S;ENSP00000442478:A201S;ENSP00000352788:A243S	ENSP00000319323:A243S	A	-	1	0	STOML1	72064775	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.057000	0.49931	1.201000	0.43203	0.655000	0.94253	GCC	.	.		0.692	STOML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269022.1	NM_004809	
TTC23	64927	hgsc.bcm.edu	37	15	99759189	99759189	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:99759189C>A	ENST00000394132.2	-	7	1186	c.369G>T	c.(367-369)gtG>gtT	p.V123V	TTC23_ENST00000394136.1_Silent_p.V123V|TTC23_ENST00000394135.3_Silent_p.V123V|TTC23_ENST00000394129.2_Silent_p.V123V|TTC23_ENST00000394130.1_Silent_p.V123V|TTC23_ENST00000262074.4_Silent_p.V123V|TTC23_ENST00000558663.1_Silent_p.V123V|TTC23_ENST00000558613.1_Silent_p.V123V			Q5W5X9	TTC23_HUMAN	tetratricopeptide repeat domain 23	123										endometrium(2)|large_intestine(3)|lung(9)|urinary_tract(2)	16	all_cancers(4;1.49e-13)|Lung NSC(78;0.000545)|all_lung(78;0.00121)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		all cancers(5;8.11e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00215)			TATAGGGAGGCACAATGGAGT	0.423																																					p.V123V		Atlas-SNP	.											.	TTC23	33	.	0			c.G369T						.						220.0	212.0	215.0					15																	99759189		2197	4297	6494	SO:0001819	synonymous_variant	64927	exon5			GGGAGGCACAATG		CCDS10379.2	15q26.3	2013-01-11			ENSG00000103852	ENSG00000103852		"""Tetratricopeptide (TTC) repeat domain containing"""	25730	protein-coding gene	gene with protein product						12477932	Standard	NM_001288615		Approved	FLJ12572, HCC-8	uc002bux.3	Q5W5X9	OTTHUMG00000147344	ENST00000394132.2:c.369G>T	chr15.hg19:g.99759189C>A		382.0	0.0		166.0	98.0	NM_001040657	A8K6M5|Q53HK0|Q96BC9|Q9H8W9|Q9H9S7	Silent	SNP	ENST00000394132.2	hg19	CCDS10379.2																																																																																			.	.		0.423	TTC23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303953.2	NM_022905	
SNRPA1	6627	hgsc.bcm.edu	37	15	101827889	101827889	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr15:101827889C>A	ENST00000254193.6	-	4	400	c.328G>T	c.(328-330)Gca>Tca	p.A110S	SNRPA1_ENST00000560856.1_5'UTR	NM_003090.2	NP_003081.2	P09661	RU2A_HUMAN	small nuclear ribonucleoprotein polypeptide A'	110					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U2 snRNP (GO:0005686)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	Lung NSC(78;0.00156)|all_lung(78;0.00195)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00113)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTGAGAGATGCCAGAGGGTCC	0.408																																					p.A110S		Atlas-SNP	.											.	SNRPA1	11	.	0			c.G328T						.						113.0	102.0	106.0					15																	101827889		2203	4300	6503	SO:0001583	missense	6627	exon4			GAGATGCCAGAGG	AJ130971	CCDS10391.1	15q26.3	2011-10-11			ENSG00000131876	ENSG00000131876			11152	protein-coding gene	gene with protein product		603521				2928112	Standard	NM_003090		Approved	Lea1	uc002bww.3	P09661	OTTHUMG00000149871	ENST00000254193.6:c.328G>T	chr15.hg19:g.101827889C>A	ENSP00000254193:p.Ala110Ser	196.0	1.0		99.0	66.0	NM_003090	B2R5I6|Q8TBD2	Missense_Mutation	SNP	ENST00000254193.6	hg19	CCDS10391.1	.	.	.	.	.	.	.	.	.	.	C	13.97	2.396426	0.42512	.	.	ENSG00000131876	ENST00000254193	T	0.61274	0.12	5.82	4.89	0.63831	.	0.236329	0.43919	D	0.000519	T	0.45196	0.1330	L	0.38175	1.15	0.51767	D	0.999939	B	0.02656	0.0	B	0.06405	0.002	T	0.31833	-0.9929	10	0.15066	T	0.55	-11.4739	12.6983	0.57016	0.4164:0.5836:0.0:0.0	.	110	P09661	RU2A_HUMAN	S	110	ENSP00000254193:A110S	ENSP00000254193:A110S	A	-	1	0	SNRPA1	99645412	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	1.724000	0.38064	1.433000	0.47394	-0.181000	0.13052	GCA	.	.		0.408	SNRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313621.2	NM_003090	
ZNF423	23090	hgsc.bcm.edu	37	16	49671299	49671299	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr16:49671299G>T	ENST00000561648.1	-	4	1817	c.1764C>A	c.(1762-1764)caC>caA	p.H588Q	ZNF423_ENST00000562520.1_Missense_Mutation_p.H528Q|ZNF423_ENST00000563137.2_Missense_Mutation_p.H528Q|ZNF423_ENST00000262383.2_Missense_Mutation_p.H588Q|ZNF423_ENST00000535559.1_Missense_Mutation_p.H471Q|ZNF423_ENST00000567169.1_Missense_Mutation_p.H471Q|ZNF423_ENST00000562871.1_Missense_Mutation_p.H528Q	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	588					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				GAATGTTCTTGTGGTTCTCCT	0.577																																					p.H588Q		Atlas-SNP	.											.	ZNF423	463	.	0			c.C1764A						.						136.0	111.0	119.0					16																	49671299		2198	4300	6498	SO:0001583	missense	23090	exon4			GTTCTTGTGGTTC	AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1764C>A	chr16.hg19:g.49671299G>T	ENSP00000455426:p.His588Gln	517.0	0.0		447.0	160.0	NM_015069	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	ENST00000561648.1	hg19	CCDS32445.1	.	.	.	.	.	.	.	.	.	.	G	16.36	3.102786	0.56183	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.13420	2.59;2.7	4.99	4.99	0.66335	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.27967	0.0689	L	0.32530	0.975	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.01834	-1.1264	9	.	.	.	-29.4823	18.2967	0.90148	0.0:0.0:1.0:0.0	.	588	Q2M1K9	ZN423_HUMAN	Q	588;471	ENSP00000262383:H588Q;ENSP00000442321:H471Q	.	H	-	3	2	ZNF423	48228800	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.379000	0.73154	2.320000	0.78422	0.561000	0.74099	CAC	.	.		0.577	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000423258.1	NM_015069	
TP53	7157	hgsc.bcm.edu	37	17	7578449	7578449	+	Missense_Mutation	SNP	C	C	A	rs193920817		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:7578449C>A	ENST00000269305.4	-	5	670	c.481G>T	c.(481-483)Gcc>Tcc	p.A161S	TP53_ENST00000445888.2_Missense_Mutation_p.A161S|TP53_ENST00000359597.4_Missense_Mutation_p.A161S|TP53_ENST00000455263.2_Missense_Mutation_p.A161S|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.A161S|TP53_ENST00000420246.2_Missense_Mutation_p.A161S	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	161	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		A -> D (in sporadic cancers; somatic mutation).|A -> F (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|A -> G (in sporadic cancers; somatic mutation).|A -> P (in sporadic cancers; somatic mutation).|A -> S (in sporadic cancers; somatic mutation).|A -> T (in sporadic cancers; somatic mutation).|A -> V (in sporadic cancers; somatic mutation).|MA -> IP (in a sporadic cancer; somatic mutation).|MA -> IS (in sporadic cancers; somatic mutation).|MA -> IT (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.A161T(54)|p.0?(8)|p.A68T(3)|p.A29T(3)|p.A161fs*9(3)|p.R156_I162delRVRAMAI(2)|p.M160fs*10(2)|p.V157_C176del20(1)|p.A161fs*19(1)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.R156fs*18(1)|p.A161fs*10(1)|p.R156_A161del(1)|p.V157fs*9(1)|p.A161fs*20(1)|p.M160_A161>IS(1)|p.A161fs*8(1)|p.S149fs*72(1)|p.A161fs*7(1)|p.T155_A161delTRVRAMA(1)|p.R156fs*20(1)|p.A161S(1)|p.A161P(1)|p.V157_I162delVRAMAI(1)|p.A161F(1)|p.A159_Q167delAMAIYKQSQ(1)|p.R158fs*8(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTGTAGATGGCCATGGCGCGG	0.632		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.A161S	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,NS,lymphoid_neoplasm,0,1	TP53	33396	.	96	Substitution - Missense(63)|Deletion - Frameshift(10)|Deletion - In frame(9)|Whole gene deletion(8)|Complex - frameshift(3)|Insertion - Frameshift(2)|Complex - compound substitution(1)	lung(15)|large_intestine(13)|urinary_tract(8)|stomach(7)|central_nervous_system(7)|upper_aerodigestive_tract(6)|oesophagus(6)|pancreas(6)|haematopoietic_and_lymphoid_tissue(5)|endometrium(5)|bone(4)|liver(4)|breast(3)|ovary(3)|thyroid(1)|meninges(1)|peritoneum(1)|skin(1)	c.G481T						.						52.0	53.0	53.0					17																	7578449		2203	4300	6503	SO:0001583	missense	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AGATGGCCATGGC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.481G>T	chr17.hg19:g.7578449C>A	ENSP00000269305:p.Ala161Ser	98.0	0.0		56.0	36.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	C	15.43	2.832703	0.50845	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	D;D;D;D;D;D;D;D;D	0.99811	-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87;-6.87	5.59	4.62	0.57501	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99711	0.9889	M	0.79805	2.47	0.48696	D	0.999696	D;P;D;D;D;D;D	0.89917	0.998;0.951;0.976;0.998;0.961;0.999;1.0	D;D;D;D;D;D;D	0.97110	0.998;0.989;0.981;0.998;0.994;1.0;1.0	D	0.97397	0.9993	10	0.59425	D	0.04	-25.6622	14.7187	0.69289	0.0:0.8543:0.1457:0.0	.	122;161;161;68;161;161;161	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	S	161;161;161;161;161;161;150;68;29;68;29;161	ENSP00000410739:A161S;ENSP00000352610:A161S;ENSP00000269305:A161S;ENSP00000398846:A161S;ENSP00000391127:A161S;ENSP00000391478:A161S;ENSP00000425104:A29S;ENSP00000423862:A68S;ENSP00000424104:A161S	ENSP00000269305:A161S	A	-	1	0	TP53	7519174	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	1.014000	0.29950	1.498000	0.48600	0.655000	0.94253	GCC	.	.		0.632	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
PCGF2	7703	hgsc.bcm.edu	37	17	36891702	36891702	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:36891702G>A	ENST00000580830.1	-	12	1510	c.809C>T	c.(808-810)cCa>cTa	p.P270L	PCGF2_ENST00000360797.2_Missense_Mutation_p.P270L|PCGF2_ENST00000579882.1_3'UTR|PCGF2_ENST00000581345.1_Missense_Mutation_p.P270L|PCGF2_ENST00000585100.1_3'UTR|PCGF2_ENST00000578109.1_3'UTR			P35227	PCGF2_HUMAN	polycomb group ring finger 2	270	Pro/Ser-rich.				anterior/posterior pattern specification (GO:0009952)|cellular response to hydrogen peroxide (GO:0070301)|embryonic skeletal system morphogenesis (GO:0048704)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10	Breast(7;9.07e-22)					GGAGGTGGCTGGCAGGGTGGC	0.701											OREG0024367	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P270L		Atlas-SNP	.											.	PCGF2	24	.	0			c.C809T						.						19.0	16.0	17.0					17																	36891702		2189	4288	6477	SO:0001583	missense	7703	exon11			GTGGCTGGCAGGG	D13969	CCDS32638.1	17q12	2013-01-09	2005-01-17	2005-01-19		ENSG00000277258		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	12929	protein-coding gene	gene with protein product		600346	"""ring finger protein 110"""	ZNF144, RNF110		8325509	Standard	NM_007144		Approved	MEL-18	uc002hqp.1	P35227		ENST00000580830.1:c.809C>T	chr17.hg19:g.36891702G>A	ENSP00000461961:p.Pro270Leu	148.0	0.0	866	111.0	52.0	NM_007144	A6NGD8	Missense_Mutation	SNP	ENST00000580830.1	hg19	CCDS32638.1	.	.	.	.	.	.	.	.	.	.	G	20.3	3.965701	0.74131	.	.	ENSG00000056661	ENST00000360797	T	0.37411	1.2	4.92	3.95	0.45737	.	0.214785	0.40554	N	0.001080	T	0.30916	0.0780	L	0.46157	1.445	0.54753	D	0.999989	B	0.06786	0.001	B	0.08055	0.003	T	0.09058	-1.0692	10	0.40728	T	0.16	-15.7345	11.2214	0.48857	0.0894:0.0:0.9106:0.0	.	270	P35227	PCGF2_HUMAN	L	270	ENSP00000354033:P270L	ENSP00000354033:P270L	P	-	2	0	PCGF2	34145228	1.000000	0.71417	0.996000	0.52242	0.943000	0.58893	7.211000	0.77933	1.304000	0.44892	0.561000	0.74099	CCA	.	.		0.701	PCGF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442246.2	NM_007144	
KRTAP3-3	85293	hgsc.bcm.edu	37	17	39150290	39150290	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:39150290G>T	ENST00000391586.1	-	1	95	c.60C>A	c.(58-60)tgC>tgA	p.C20*		NM_033185.2	NP_149441.1	Q9BYR6	KRA33_HUMAN	keratin associated protein 3-3	20	3 X 5 AA repeats of C-C-X(3).					keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			lung(2)|prostate(2)	4		Breast(137;0.00043)				TGTCAGAGGAGCAGATGGTGG	0.567																																					p.C20X		Atlas-SNP	.											.	KRTAP3-3	11	.	0			c.C60A						.						93.0	92.0	92.0					17																	39150290		2203	4296	6499	SO:0001587	stop_gained	85293	exon1			AGAGGAGCAGATG	AJ406933	CCDS32643.1	17q21.2	2013-06-25			ENSG00000212899	ENSG00000212899		"""Keratin associated proteins"""	18890	protein-coding gene	gene with protein product						11279113	Standard	NM_033185		Approved	KAP3.3	uc002hvr.1	Q9BYR6	OTTHUMG00000133591	ENST00000391586.1:c.60C>A	chr17.hg19:g.39150290G>T	ENSP00000375428:p.Cys20*	350.0	0.0		248.0	90.0	NM_033185	Q52LP0|Q6NTD4	Nonsense_Mutation	SNP	ENST00000391586.1	hg19	CCDS32643.1	.	.	.	.	.	.	.	.	.	.	G	15.86	2.957773	0.53400	.	.	ENSG00000212899	ENST00000391586	.	.	.	5.62	4.65	0.58169	.	0.000000	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.41	0.44287	0.0894:0.0:0.9106:0.0	.	.	.	.	X	20	.	ENSP00000375428:C20X	C	-	3	2	KRTAP3-3	36403816	1.000000	0.71417	0.998000	0.56505	0.210000	0.24377	2.963000	0.49184	1.380000	0.46344	0.650000	0.86243	TGC	.	.		0.567	KRTAP3-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257695.1		
ATP6V0A1	535	hgsc.bcm.edu	37	17	40652840	40652840	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:40652840G>T	ENST00000343619.4	+	16	1918	c.1795G>T	c.(1795-1797)Gct>Tct	p.A599S	ATP6V0A1_ENST00000585525.1_Missense_Mutation_p.A556S|ATP6V0A1_ENST00000546249.1_Missense_Mutation_p.A599S|ATP6V0A1_ENST00000537728.1_Missense_Mutation_p.A556S|ATP6V0A1_ENST00000264649.6_Missense_Mutation_p.A606S|ATP6V0A1_ENST00000544137.1_Missense_Mutation_p.A245S|ATP6V0A1_ENST00000393829.2_Missense_Mutation_p.A599S	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	599					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GGCCTATGATGCTCATACCTC	0.378																																					p.A606S		Atlas-SNP	.											.	ATP6V0A1	67	.	0			c.G1816T						.						215.0	195.0	202.0					17																	40652840		2203	4300	6503	SO:0001583	missense	535	exon16			TATGATGCTCATA	U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1795G>T	chr17.hg19:g.40652840G>T	ENSP00000342951:p.Ala599Ser	772.0	0.0		717.0	273.0	NM_001130020	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	ENST00000343619.4	hg19	CCDS45684.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.083018	0.76642	.	.	ENSG00000033627	ENST00000343619;ENST00000546249;ENST00000393829;ENST00000264649;ENST00000537728;ENST00000544137	D;D;D;D;D;D	0.86769	-2.17;-2.17;-2.17;-2.17;-2.17;-2.17	4.91	4.91	0.64330	.	0.147766	0.64402	D	0.000010	D	0.90031	0.6887	L	0.60455	1.87	0.80722	D	1	B;B;B;P;B	0.46512	0.086;0.004;0.078;0.879;0.052	B;B;B;P;B	0.52823	0.156;0.02;0.063;0.71;0.056	D	0.89406	0.3699	10	0.44086	T	0.13	-9.9702	18.6406	0.91394	0.0:0.0:1.0:0.0	.	556;556;606;599;599	B7Z641;B7Z2A9;B7Z3B7;Q93050;Q93050-1	.;.;.;VPP1_HUMAN;.	S	599;599;599;606;556;245	ENSP00000342951:A599S;ENSP00000444676:A599S;ENSP00000377415:A599S;ENSP00000264649:A606S;ENSP00000443991:A556S;ENSP00000446377:A245S	ENSP00000264649:A606S	A	+	1	0	ATP6V0A1	37906366	1.000000	0.71417	0.874000	0.34290	0.993000	0.82548	9.601000	0.98297	2.716000	0.92895	0.561000	0.74099	GCT	.	.		0.378	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450364.1	NM_001130020	
RUNDC1	146923	hgsc.bcm.edu	37	17	41143400	41143400	+	Silent	SNP	T	T	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:41143400T>A	ENST00000361677.1	+	5	1521	c.1509T>A	c.(1507-1509)ccT>ccA	p.P503P		NM_173079.2	NP_775102	Q96C34	RUND1_HUMAN	RUN domain containing 1	503	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.									breast(1)|large_intestine(2)|lung(4)|prostate(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.161)		TCGCCCTTCCTGTTACGGGAG	0.557																																					p.P503P		Atlas-SNP	.											.	RUNDC1	25	.	0			c.T1509A						.						67.0	66.0	66.0					17																	41143400		2203	4300	6503	SO:0001819	synonymous_variant	146923	exon5			CCTTCCTGTTACG	AL831813	CCDS11448.1	17q21.31	2004-02-27				ENSG00000198863			25418	protein-coding gene	gene with protein product						12477932	Standard	NM_173079		Approved	DKFZp761H0421	uc002ici.1	Q96C34		ENST00000361677.1:c.1509T>A	chr17.hg19:g.41143400T>A		122.0	0.0		106.0	36.0	NM_173079	Q6Y2K8|Q8IXT9|Q8N3W1	Silent	SNP	ENST00000361677.1	hg19	CCDS11448.1																																																																																			.	.		0.557	RUNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452464.1	NM_173079	
CCDC43	124808	hgsc.bcm.edu	37	17	42756228	42756228	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:42756228C>G	ENST00000315286.8	-	5	679	c.671G>C	c.(670-672)cGa>cCa	p.R224P	CCDC43_ENST00000457422.2_3'UTR|C17orf104_ENST00000588805.1_Intron|RP11-1072C15.4_ENST00000591628.1_RNA|CCDC43_ENST00000588210.1_Missense_Mutation_p.R227P	NM_144609.2	NP_653210.2	Q96MW1	CCD43_HUMAN	coiled-coil domain containing 43	224										lung(2)	2		Prostate(33;0.0322)				CCAAGGTTATCGCTTTCGCTC	0.453																																					p.R224P		Atlas-SNP	.											.	CCDC43	34	.	0			c.G671C						.						78.0	81.0	80.0					17																	42756228		1914	4123	6037	SO:0001583	missense	124808	exon5			GGTTATCGCTTTC	AK056357	CCDS45704.1, CCDS45705.1	17q21.31	2005-12-16							26472	protein-coding gene	gene with protein product						12477932	Standard	NM_001099225		Approved	FLJ31795	uc002ihc.2	Q96MW1		ENST00000315286.8:c.671G>C	chr17.hg19:g.42756228C>G	ENSP00000323782:p.Arg224Pro	465.0	0.0		400.0	157.0	NM_144609	C9JVK9	Missense_Mutation	SNP	ENST00000315286.8	hg19	CCDS45704.1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.058141	0.76074	.	.	ENSG00000180329	ENST00000315286	.	.	.	6.16	6.16	0.99307	.	0.120163	0.56097	D	0.000024	T	0.79499	0.4456	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.79215	-0.1895	9	0.87932	D	0	.	19.6313	0.95704	0.0:1.0:0.0:0.0	.	224	Q96MW1	CCD43_HUMAN	P	224	.	ENSP00000323782:R224P	R	-	2	0	CCDC43	40111754	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.802000	0.75175	2.937000	0.99478	0.650000	0.86243	CGA	.	.		0.453	CCDC43-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000457812.1	NM_144609	
SP6	80320	hgsc.bcm.edu	37	17	45925714	45925714	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:45925714G>T	ENST00000536300.1	-	2	413	c.82C>A	c.(82-84)Cct>Act	p.P28T	SP6_ENST00000342234.2_Missense_Mutation_p.P28T	NM_001258248.1	NP_001245177.1	Q3SY56	SP6_HUMAN	Sp6 transcription factor	28					positive regulation of cell proliferation (GO:0008284)|regulation of odontogenesis (GO:0042481)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(5)|prostate(1)|skin(1)	8						GTTTGGAGAGGCTGCAGGTCG	0.716																																					p.P28T		Atlas-SNP	.											.	SP6	26	.	0			c.C82A						.						8.0	10.0	9.0					17																	45925714		2174	4232	6406	SO:0001583	missense	80320	exon2			GGAGAGGCTGCAG		CCDS11520.1	17q21.32	2013-01-08			ENSG00000189120	ENSG00000189120		"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	14530	protein-coding gene	gene with protein product	"""epiprofin"""	608613				11087666, 14551215	Standard	NM_001258248		Approved	KLF14, Epfn	uc002img.2	Q3SY56	OTTHUMG00000132067	ENST00000536300.1:c.82C>A	chr17.hg19:g.45925714G>T	ENSP00000438209:p.Pro28Thr	42.0	0.0		52.0	21.0	NM_001258248	B3KXS4	Missense_Mutation	SNP	ENST00000536300.1	hg19	CCDS11520.1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195352	0.58126	.	.	ENSG00000189120	ENST00000342234;ENST00000536300	T;T	0.12774	2.65;2.65	4.44	4.44	0.53790	.	0.000000	0.43260	D	0.000581	T	0.07007	0.0178	N	0.08118	0	0.33950	D	0.644355	P	0.37233	0.588	B	0.36244	0.22	T	0.23261	-1.0193	10	0.37606	T	0.19	.	9.725	0.40326	0.0971:0.0:0.9029:0.0	.	28	Q3SY56	SP6_HUMAN	T	28	ENSP00000340799:P28T;ENSP00000438209:P28T	ENSP00000340799:P28T	P	-	1	0	SP6	43280713	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	2.972000	0.49256	2.288000	0.76882	0.462000	0.41574	CCT	.	.		0.716	SP6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441395.1	NM_199262	
CSH1	1442	hgsc.bcm.edu	37	17	61972411	61972411	+	Missense_Mutation	SNP	G	G	T	rs61764004		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:61972411G>T	ENST00000316193.8	-	5	766	c.625C>A	c.(625-627)Cgc>Agc	p.R209S	CSH1_ENST00000453363.3_Missense_Mutation_p.R114S|CSH1_ENST00000329882.8_3'UTR	NM_001317.5	NP_001308.1	P0DML2	CSH1_HUMAN	chorionic somatomammotropin hormone 1 (placental lactogen)	209						extracellular region (GO:0005576)	metal ion binding (GO:0046872)	p.R209C(1)		central_nervous_system(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	8						TCCACAGAGCGGCACTGCACC	0.607									Russell-Silver syndrome																												p.R209S		Atlas-SNP	.											CSH1,brain,atypical_teratoid-rhabdoid_tumour,0,1	CSH1	18	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.C625A						.						105.0	94.0	98.0					17																	61972411		2198	4299	6497	SO:0001583	missense	1442	exon5	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism	CAGAGCGGCACTG	J00118	CCDS11649.1	17q22-q24	2008-07-18				ENSG00000136488			2440	protein-coding gene	gene with protein product	"""chorionic somatomammotropin A"", ""placental lactogen"", ""choriomammotropin"""	150200				6208192	Standard	NM_001317		Approved	hCS-A, CSA, PL, CSMT, FLJ75407	uc002jcs.2	P0DML2		ENST00000316193.8:c.625C>A	chr17.hg19:g.61972411G>T	ENSP00000316416:p.Arg209Ser	270.0	0.0		185.0	85.0	NM_001317	P01243|Q0VDB1|Q14407	Missense_Mutation	SNP	ENST00000316193.8	hg19	CCDS11649.1	.	.	.	.	.	.	.	.	.	.	g	10.94	1.491692	0.26774	.	.	ENSG00000136488	ENST00000316193;ENST00000453363	D;D	0.92911	-3.13;-3.13	2.56	1.57	0.23409	.	.	.	.	.	D	0.95319	0.8481	M	0.86651	2.83	0.43114	D	0.994825	D;D	0.71674	0.989;0.998	D;D	0.71414	0.973;0.955	D	0.93904	0.7191	9	0.72032	D	0.01	.	8.4239	0.32718	0.1261:0.0:0.8739:0.0	rs61764004	114;209	B1A4H2;Q6PF11	.;.	S	209;114	ENSP00000316416:R209S;ENSP00000402517:R114S	ENSP00000316416:R209S	R	-	1	0	CSH1	59326143	1.000000	0.71417	0.996000	0.52242	0.012000	0.07955	6.449000	0.73473	0.405000	0.25532	-0.671000	0.03813	CGC	.	G|0.993;T|0.007		0.607	CSH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416040.1	NM_001317	
PCYT2	5833	hgsc.bcm.edu	37	17	79864760	79864760	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:79864760C>A	ENST00000538936.2	-	7	660	c.552G>T	c.(550-552)cgG>cgT	p.R184R	PCYT2_ENST00000570388.1_Silent_p.R106R|PCYT2_ENST00000571105.1_Silent_p.R184R|PCYT2_ENST00000331285.3_Silent_p.R106R|PCYT2_ENST00000570391.1_Silent_p.R152R|PCYT2_ENST00000538721.2_Silent_p.R202R	NM_001256435.1|NM_002861.3	NP_001243364.1|NP_002852.1	Q99447	PCY2_HUMAN	phosphate cytidylyltransferase 2, ethanolamine	184					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)	ethanolamine-phosphate cytidylyltransferase activity (GO:0004306)			breast(2)|endometrium(1)|lung(4)|ovary(1)	8	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)		Lamivudine(DB00709)	TCCAGGGGTTCCGCCCACCAG	0.617																																					p.R202R		Atlas-SNP	.											.	PCYT2	23	.	0			c.G606T						.						48.0	50.0	49.0					17																	79864760		2203	4298	6501	SO:0001819	synonymous_variant	5833	exon8			GGGGTTCCGCCCA	D84307	CCDS11791.1, CCDS54178.1, CCDS58610.1, CCDS62364.1	17q25.3	2008-07-18				ENSG00000185813			8756	protein-coding gene	gene with protein product		602679				9083101	Standard	XM_005256386		Approved	ET	uc002kch.2	Q99447		ENST00000538936.2:c.552G>T	chr17.hg19:g.79864760C>A		53.0	0.0		69.0	31.0	NM_001184917	B7Z7A5|B7ZAS0|F5H8B1|Q6IBM3|Q96G08	Silent	SNP	ENST00000538936.2	hg19	CCDS11791.1																																																																																			.	.		0.617	PCYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439939.1	NM_002861	
MYADML2	255275	hgsc.bcm.edu	37	17	79899539	79899539	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr17:79899539C>T	ENST00000409745.2	-	3	433	c.79G>A	c.(79-81)Gtg>Atg	p.V27M	MYADML2_ENST00000330655.3_Missense_Mutation_p.V27M|AC137723.5_ENST00000415556.1_RNA	NM_001145113.2	NP_001138585.2	A6NDP7	MADL2_HUMAN	myeloid-associated differentiation marker-like 2	27	MARVEL 1. {ECO:0000255|PROSITE- ProRule:PRU00581}.					cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)	1						AGCTGCAGCACGCGGGCTGTG	0.692																																					p.V27M		Atlas-SNP	.											.	MYADML2	11	.	0			c.G79A						.						10.0	16.0	14.0					17																	79899539		688	1582	2270	SO:0001583	missense	255275	exon3			GCAGCACGCGGGC	AC137723, BC029306	CCDS45815.1	17q25.3	2008-10-15			ENSG00000185105	ENSG00000185105			34548	protein-coding gene	gene with protein product							Standard	NM_001145113		Approved	LOC255275	uc010wvf.1	A6NDP7	OTTHUMG00000154388	ENST00000409745.2:c.79G>A	chr17.hg19:g.79899539C>T	ENSP00000386702:p.Val27Met	46.0	0.0		51.0	23.0	NM_001145113		Missense_Mutation	SNP	ENST00000409745.2	hg19	CCDS45815.1	.	.	.	.	.	.	.	.	.	.	C	3.094	-0.186261	0.06340	.	.	ENSG00000185105	ENST00000409745;ENST00000330655	T;T	0.28895	1.59;1.59	4.85	0.45	0.16624	Marvel (1);MARVEL-like domain (1);	0.352986	0.32258	N	0.006358	T	0.07908	0.0198	N	0.01576	-0.805	0.09310	N	0.999994	B	0.11235	0.004	B	0.10450	0.005	T	0.17048	-1.0382	10	0.33940	T	0.23	.	0.0388	0.00008	0.2737:0.2405:0.1978:0.288	.	27	A6NDP7	MADL2_HUMAN	M	27	ENSP00000386702:V27M;ENSP00000327718:V27M	ENSP00000327718:V27M	V	-	1	0	MYADML2	77492830	0.000000	0.05858	0.791000	0.31998	0.210000	0.24377	-0.522000	0.06237	0.237000	0.21200	-0.333000	0.08304	GTG	.	.		0.692	MYADML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335008.2	XR_041347	
LRG1	116844	hgsc.bcm.edu	37	19	4538450	4538450	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:4538450C>A	ENST00000306390.6	-	2	1006	c.546G>T	c.(544-546)ggG>ggT	p.G182G	LRG1_ENST00000586883.1_5'Flank|CTB-50L17.14_ENST00000586020.1_Intron	NM_052972.2	NP_443204.1	P02750	A2GL_HUMAN	leucine-rich alpha-2-glycoprotein 1	182					brown fat cell differentiation (GO:0050873)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				NS(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGCCAGCAGCCCGGGGGGCA	0.622																																					p.G182G		Atlas-SNP	.											.	LRG1	25	.	0			c.G546T						.						93.0	106.0	102.0					19																	4538450		2203	4300	6503	SO:0001819	synonymous_variant	116844	exon2			CAGCAGCCCGGGG		CCDS12130.1	19p13.3	2013-09-20			ENSG00000171236	ENSG00000171236			29480	protein-coding gene	gene with protein product	"""leucine rich alpha 2 glycoprotein"""	611289				3856868, 12223515	Standard	NM_052972		Approved	LRG	uc002mau.3	P02750	OTTHUMG00000182010	ENST00000306390.6:c.546G>T	chr19.hg19:g.4538450C>A		40.0	0.0		24.0	16.0	NM_052972	Q8N4F5|Q96QZ4	Silent	SNP	ENST00000306390.6	hg19	CCDS12130.1																																																																																			.	.		0.622	LRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458654.2	NM_052972	
KEAP1	9817	hgsc.bcm.edu	37	19	10602767	10602767	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:10602767C>A	ENST00000171111.5	-	3	1358	c.811G>T	c.(811-813)Gtg>Ttg	p.V271L	KEAP1_ENST00000588024.1_5'UTR|CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000393623.2_Missense_Mutation_p.V271L	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	271	BACK.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	TGGCAGCGCACGGCCCGCAGC	0.617																																					p.V271L		Atlas-SNP	.											KEAP1,right_upper_lobe,carcinoma,0,1	KEAP1	182	.	0			c.G811T						.						57.0	57.0	57.0					19																	10602767		2203	4300	6503	SO:0001583	missense	9817	exon3			AGCGCACGGCCCG	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.811G>T	chr19.hg19:g.10602767C>A	ENSP00000171111:p.Val271Leu	68.0	0.0		45.0	35.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Missense_Mutation	SNP	ENST00000171111.5	hg19	CCDS12239.1	.	.	.	.	.	.	.	.	.	.	C	33	5.208480	0.95069	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	T;T	0.76316	-1.01;-1.01	5.61	5.61	0.85477	BTB/Kelch-associated (2);	0.056422	0.64402	N	0.000001	D	0.84897	0.5574	M	0.82630	2.6	0.80722	D	1	P	0.52170	0.951	P	0.50270	0.636	D	0.87391	0.2363	10	0.87932	D	0	.	17.1459	0.86766	0.0:1.0:0.0:0.0	.	271	Q14145	KEAP1_HUMAN	L	271	ENSP00000171111:V271L;ENSP00000377245:V271L	ENSP00000171111:V271L	V	-	1	0	KEAP1	10463767	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.874000	0.69652	2.656000	0.90262	0.561000	0.74099	GTG	.	.		0.617	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
HPN	3249	hgsc.bcm.edu	37	19	35556780	35556780	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:35556780C>T	ENST00000262626.2	+	12	1884	c.1059C>T	c.(1057-1059)agC>agT	p.S353S	HPN_ENST00000597419.1_Silent_p.S195S|HPN-AS1_ENST00000392227.2_RNA|HPN_ENST00000392226.1_Silent_p.S353S	NM_182983.2	NP_892028.1	P05981	HEPS_HUMAN	hepsin	353	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				basement membrane disassembly (GO:0034769)|cholesterol homeostasis (GO:0042632)|cochlea morphogenesis (GO:0090103)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|epithelium development (GO:0060429)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pilomotor reflex (GO:0097195)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|positive regulation of gene expression (GO:0010628)|positive regulation of hepatocyte proliferation (GO:2000347)|positive regulation of plasminogen activation (GO:0010756)|positive regulation of thyroid hormone generation (GO:2000611)|potassium ion transmembrane transport (GO:0071805)|proteolysis (GO:0006508)|regulation of cell shape (GO:0008360)|response to thyroid hormone (GO:0097066)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)|serine-type peptidase activity (GO:0008236)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|upper_aerodigestive_tract(2)	19	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)		Coagulation factor VIIa(DB00036)	AGGGCGACAGCGGTGGTCCCT	0.657																																					p.S353S		Atlas-SNP	.											.	HPN	45	.	0			c.C1059T						.						78.0	78.0	78.0					19																	35556780		2203	4300	6503	SO:0001819	synonymous_variant	3249	exon12			CGACAGCGGTGGT		CCDS32993.1	19q13.12	2013-04-25	2008-12-08		ENSG00000105707	ENSG00000105707		"""Serine peptidases / Transmembrane"""	5155	protein-coding gene	gene with protein product	"""transmembrane protease, serine 1"""	142440				2835076	Standard	NM_182983		Approved	TMPRSS1	uc002nxq.2	P05981	OTTHUMG00000182474	ENST00000262626.2:c.1059C>T	chr19.hg19:g.35556780C>T		105.0	0.0		111.0	53.0	NM_182983	B2RDS4	Silent	SNP	ENST00000262626.2	hg19	CCDS32993.1																																																																																			.	.		0.657	HPN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461573.1	NM_002151	
GAPDHS	26330	hgsc.bcm.edu	37	19	36033250	36033250	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:36033250C>A	ENST00000222286.4	+	5	595	c.479C>A	c.(478-480)gCt>gAt	p.A160D	AD000090.2_ENST00000590125.1_RNA|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000444728.1_RNA|AD000090.2_ENST00000588286.1_RNA	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	160					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CCCTGGAGGGCTGTCGGGAGC	0.617																																					p.A160D		Atlas-SNP	.											.	GAPDHS	34	.	0			c.C479A						.						50.0	49.0	50.0					19																	36033250		2203	4300	6503	SO:0001583	missense	26330	exon5			GGAGGGCTGTCGG	AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.479C>A	chr19.hg19:g.36033250C>A	ENSP00000222286:p.Ala160Asp	76.0	0.0		64.0	29.0	NM_014364	B2RC82|O60823|Q6JTT9|Q9HCU6	Missense_Mutation	SNP	ENST00000222286.4	hg19	CCDS12465.1	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.516631	0.00151	.	.	ENSG00000105679	ENST00000222286	T	0.38077	1.16	5.0	-1.92	0.07618	Glyceraldehyde 3-phosphate dehydrogenase, NAD(P) binding domain (2);NAD(P)-binding domain (1);	1.245240	0.05109	N	0.488559	T	0.13884	0.0336	N	0.02765	-0.5	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.30621	-0.9972	10	0.02654	T	1	-0.1971	9.8314	0.40944	0.4736:0.4112:0.1152:0.0	.	160	O14556	G3PT_HUMAN	D	160	ENSP00000222286:A160D	ENSP00000222286:A160D	A	+	2	0	GAPDHS	40725090	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	1.012000	0.29924	-0.284000	0.09102	-2.780000	0.00118	GCT	.	.		0.617	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460423.1	NM_014364	
NPHS1	4868	hgsc.bcm.edu	37	19	36340537	36340537	+	Silent	SNP	T	T	A	rs111277506		TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:36340537T>A	ENST00000378910.5	-	6	626	c.627A>T	c.(625-627)tcA>tcT	p.S209S	NPHS1_ENST00000591817.1_5'Flank|NPHS1_ENST00000353632.6_Silent_p.S209S	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	209	Ig-like C2-type 2.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCTATTATCTGAGCTCCGGG	0.537																																					p.S209S		Atlas-SNP	.											.	NPHS1	165	.	0			c.A627T						.						68.0	67.0	68.0					19																	36340537		2203	4300	6503	SO:0001819	synonymous_variant	4868	exon6			ATTATCTGAGCTC		CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.627A>T	chr19.hg19:g.36340537T>A		72.0	0.0		59.0	17.0	NM_004646	A6NDH2|C3RX61	Silent	SNP	ENST00000378910.5	hg19	CCDS32996.1																																																																																			.	T|0.500;C|0.500		0.537	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452553.1		
CGB2	114336	hgsc.bcm.edu	37	19	49536324	49536324	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:49536324G>A	ENST00000359342.6	+	3	456	c.338G>A	c.(337-339)cGc>cAc	p.R113H	CTB-60B18.6_ENST00000591656.1_Intron	NM_033378.1	NP_203696.2	Q6NT52	CGB2_HUMAN	chorionic gonadotropin, beta polypeptide 2	145						extracellular region (GO:0005576)				large_intestine(1)|lung(1)|stomach(1)	3		all_epithelial(76;9.62e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000371)|OV - Ovarian serous cystadenocarcinoma(262;0.000503)|GBM - Glioblastoma multiforme(486;0.00518)|Epithelial(262;0.0427)		CTCTGCCGCCGCAGCACCACT	0.677																																					p.R113H		Atlas-SNP	.											CGB2,NS,carcinoma,0,1	CGB2	6	.	0			c.G338A						.						3.0	4.0	3.0					19																	49536324		1144	2702	3846	SO:0001583	missense	114336	exon3			GCCGCCGCAGCAC	K03184	CCDS12750.2	19q13.32	2008-02-05			ENSG00000104818	ENSG00000104818			16722	protein-coding gene	gene with protein product		608824				6194155	Standard	NM_033378		Approved		uc002plw.3	Q6NT52	OTTHUMG00000150185	ENST00000359342.6:c.338G>A	chr19.hg19:g.49536324G>A	ENSP00000352295:p.Arg113His	200.0	0.0		142.0	46.0	NM_033378	B9ZVM5	Missense_Mutation	SNP	ENST00000359342.6	hg19	CCDS12750.2	.	.	.	.	.	.	.	.	.	.	g	11.31	1.601514	0.28534	.	.	ENSG00000104818	ENST00000538959;ENST00000359342	T	0.57752	0.38	1.79	0.703	0.18116	Cystine knot (2);Gonadotropin, beta subunit, conserved site (2);	0.297707	0.34178	N	0.004191	T	0.62085	0.2399	M	0.68317	2.08	0.09310	N	0.999995	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.72625	0.913;0.913;0.978	T	0.51332	-0.8719	10	0.72032	D	0.01	-14.5685	4.6264	0.12481	0.0:0.0:0.3529:0.6471	.	145;115;131	Q6NT52;P01233;P01233-2	CGB2_HUMAN;CGHB_HUMAN;.	H	113	ENSP00000352295:R113H	ENSP00000352295:R113H	R	+	2	0	CGB2	54228136	1.000000	0.71417	0.242000	0.24170	0.154000	0.21943	1.208000	0.32345	0.148000	0.19059	0.184000	0.17185	CGC	.	.		0.677	CGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316745.1	NM_033378	
SIGLEC7	27036	hgsc.bcm.edu	37	19	51645632	51645632	+	Silent	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:51645632G>A	ENST00000317643.6	+	1	75	c.6G>A	c.(4-6)ctG>ctA	p.L2L	SIGLEC7_ENST00000305628.7_Silent_p.L2L|SIGLEC7_ENST00000600577.1_Silent_p.L2L	NM_014385.2	NP_055200.1	Q9Y286	SIGL7_HUMAN	sialic acid binding Ig-like lectin 7	2					cell adhesion (GO:0007155)	integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(11)|skin(2)|stomach(1)	29		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000836)|OV - Ovarian serous cystadenocarcinoma(262;0.00297)		CAGATAtgctgctgctgctgc	0.597																																					p.L2L		Atlas-SNP	.											.	SIGLEC7	74	.	0			c.G6A						.						34.0	28.0	30.0					19																	51645632		2203	4300	6503	SO:0001819	synonymous_variant	27036	exon1			TATGCTGCTGCTG	AF170485	CCDS12826.1, CCDS42601.1, CCDS62771.1	19q13.41	2014-03-20			ENSG00000168995	ENSG00000168995		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10876	protein-coding gene	gene with protein product		604410	"""sialic acid binding Ig-like lectin 19, pseudogene"", ""sialic acid binding Ig-like lectin, pseudogene 2"""	SIGLEC19P, SIGLECP2		10567377	Standard	NM_001277201		Approved	SIGLEC-7, p75/AIRM1, QA79, CD328	uc002pvv.1	Q9Y286	OTTHUMG00000182895	ENST00000317643.6:c.6G>A	chr19.hg19:g.51645632G>A		43.0	0.0		31.0	14.0	NM_016543	Q9NZQ1|Q9UJ86|Q9UJ87|Q9Y502	Silent	SNP	ENST00000317643.6	hg19	CCDS12826.1																																																																																			.	.		0.597	SIGLEC7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464226.2	NM_016543	
BPIFB4	149954	hgsc.bcm.edu	37	20	31672752	31672752	+	Silent	SNP	C	C	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:31672752C>T	ENST00000375483.3	+	4	732	c.732C>T	c.(730-732)ggC>ggT	p.G244G		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	244						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										TCCTGCCCGGCGTGGGTGTCT	0.667																																					p.G244G		Atlas-SNP	.											.	.	.	.	0			c.C732T						.						54.0	43.0	46.0					20																	31672752		2203	4300	6503	SO:0001819	synonymous_variant	149954	exon4			GCCCGGCGTGGGT	AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.732C>T	chr20.hg19:g.31672752C>T		60.0	0.0		51.0	18.0	NM_182519	Q5TDX6	Silent	SNP	ENST00000375483.3	hg19	CCDS13213.2																																																																																			.	.		0.667	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078655.5	NM_182519	
OSER1	51526	hgsc.bcm.edu	37	20	42826208	42826208	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:42826208C>A	ENST00000372970.2	-	6	543	c.363G>T	c.(361-363)ctG>ctT	p.L121L	OSER1_ENST00000255174.2_Silent_p.L121L			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	121					cellular response to hydrogen peroxide (GO:0070301)												ATGAAATTCCCAGCCCACTGC	0.473																																					p.L121L		Atlas-SNP	.											.	C20orf111	28	.	0			c.G363T						.						99.0	101.0	100.0					20																	42826208		2203	4300	6503	SO:0001819	synonymous_variant	51526	exon4			AATTCCCAGCCCA	AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.363G>T	chr20.hg19:g.42826208C>A		108.0	0.0		102.0	38.0	NM_016470	B2RCK4|O95912|Q9NZ84|Q9P0R8	Silent	SNP	ENST00000372970.2	hg19	CCDS13327.1																																																																																			.	.		0.473	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079334.2	NM_016470	
TAF4	6874	hgsc.bcm.edu	37	20	60578221	60578221	+	Silent	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:60578221C>A	ENST00000252996.4	-	9	2480	c.2481G>T	c.(2479-2481)tcG>tcT	p.S827S		NM_003185.3	NP_003176.2	O00268	TAF4_HUMAN	TAF4 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 135kDa	827					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(26;1e-08)		BRCA - Breast invasive adenocarcinoma(19;3.1e-07)			CTTACCGAAACGAACCTCCCC	0.572																																					p.S827S		Atlas-SNP	.											.	TAF4	84	.	0			c.G2481T						.						103.0	89.0	94.0					20																	60578221		2203	4300	6503	SO:0001819	synonymous_variant	6874	exon9			CCGAAACGAACCT	Y11354	CCDS33500.1	20q13.33	2010-02-26	2002-08-29	2002-01-18	ENSG00000130699	ENSG00000130699			11537	protein-coding gene	gene with protein product		601796	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, C1, 130kD"""	TAF4A, TAF2C1, TAF2C		8942982, 9192867	Standard	NM_003185		Approved	TAFII130, TAFII135	uc002ybs.3	O00268	OTTHUMG00000032893	ENST00000252996.4:c.2481G>T	chr20.hg19:g.60578221C>A		105.0	0.0		103.0	46.0	NM_003185	A6NGD9|Q5TBP6|Q99721|Q9BR40|Q9BX42	Silent	SNP	ENST00000252996.4	hg19	CCDS33500.1																																																																																			.	.		0.572	TAF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079968.2	NM_003185	
CHRNA4	1137	hgsc.bcm.edu	37	20	61981117	61981117	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr20:61981117C>G	ENST00000370263.4	-	5	1867	c.1646G>C	c.(1645-1647)cGc>cCc	p.R549P	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	549					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TTTGGTGCTGCGGGTCTTGAC	0.682																																					p.R549P		Atlas-SNP	.											.	CHRNA4	98	.	0			c.G1646C						.						35.0	40.0	39.0					20																	61981117		2200	4298	6498	SO:0001583	missense	1137	exon5			GTGCTGCGGGTCT		CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.1646G>C	chr20.hg19:g.61981117C>G	ENSP00000359285:p.Arg549Pro	43.0	0.0		30.0	15.0	NM_000744	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	ENST00000370263.4	hg19	CCDS13517.1	.	.	.	.	.	.	.	.	.	.	C	0.287	-0.982264	0.02180	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.85702	-2.02	3.7	-2.82	0.05787	Neurotransmitter-gated ion-channel transmembrane domain (2);	6.549360	0.00610	N	0.000406	T	0.79522	0.4460	L	0.39898	1.24	0.09310	N	1	P;B	0.46142	0.873;0.002	P;B	0.46172	0.506;0.005	T	0.66324	-0.5952	10	0.30078	T	0.28	.	1.2964	0.02070	0.2231:0.197:0.1213:0.4586	.	478;549	Q4VAQ5;P43681	.;ACHA4_HUMAN	P	455;549;478	ENSP00000359285:R549P	ENSP00000359280:R455P	R	-	2	0	CHRNA4	61451561	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.591000	0.02100	-1.087000	0.03081	-0.339000	0.08088	CGC	.	.		0.682	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080508.3		
AMER1	139285	hgsc.bcm.edu	37	X	63410708	63410708	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:63410708C>A	ENST00000330258.3	-	2	2731	c.2459G>T	c.(2458-2460)gGc>gTc	p.G820V	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	820					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									TTCACACTTGCCTTCCCCATC	0.502																																					p.G820V		Atlas-SNP	.											.	.	.	.	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)	c.G2459T						.						45.0	43.0	43.0					X																	63410708		2200	4296	6496	SO:0001583	missense	139285	exon2			CACTTGCCTTCCC	AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.2459G>T	chrX.hg19:g.63410708C>A	ENSP00000329117:p.Gly820Val	56.0	0.0		62.0	58.0	NM_152424	A2IB86|Q8N885	Missense_Mutation	SNP	ENST00000330258.3	hg19	CCDS14377.2	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507616	0.64410	.	.	ENSG00000184675	ENST00000330258	T	0.75367	-0.93	5.0	5.0	0.66597	.	.	.	.	.	T	0.76786	0.4036	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.75542	-0.3281	8	.	.	.	0.4471	16.219	0.82244	0.0:1.0:0.0:0.0	.	820	Q5JTC6	F123B_HUMAN	V	820	ENSP00000329117:G820V	.	G	-	2	0	FAM123B	63327433	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.660000	0.74417	2.484000	0.83849	0.529000	0.55759	GGC	.	.		0.502	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316584.1	NM_152424	
ARHGEF6	9459	hgsc.bcm.edu	37	X	135757211	135757211	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrX:135757211C>G	ENST00000250617.6	-	19	3195	c.1990G>C	c.(1990-1992)Gaa>Caa	p.E664Q	ARHGEF6_ENST00000370620.1_Missense_Mutation_p.E510Q|ARHGEF6_ENST00000535227.1_Missense_Mutation_p.E537Q|ARHGEF6_ENST00000370622.1_Missense_Mutation_p.E510Q	NM_004840.2	NP_004831.1	Q15052	ARHG6_HUMAN	Rac/Cdc42 guanine nucleotide exchange factor (GEF) 6	664					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell junction assembly (GO:0034329)|JNK cascade (GO:0007254)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|intracellular (GO:0005622)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(1)|lung(14)|prostate(1)	38	Acute lymphoblastic leukemia(192;0.000127)					CAGTAGGCTTCGATCACTTTA	0.413																																					p.E664Q		Atlas-SNP	.											.	ARHGEF6	111	.	0			c.G1990C						.						162.0	137.0	145.0					X																	135757211		2203	4300	6503	SO:0001583	missense	9459	exon19			AGGCTTCGATCAC	D13631	CCDS14660.1	Xq26	2013-01-10	2002-05-23		ENSG00000129675	ENSG00000129675		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	685	protein-coding gene	gene with protein product	"""Rac/Cdc42 guanine exchange factor (GEF) 6"", ""PAK-interacting exchange factor, alpha"", ""rho guanine nucleotide exchange factor 6"""	300267	"""mental retardation, X-linked 46"""	MRX46		7584048, 9659915	Standard	NM_004840		Approved	alphaPIX, Cool-2, KIAA0006, alpha-PIX, Cool2	uc004fab.3	Q15052	OTTHUMG00000022518	ENST00000250617.6:c.1990G>C	chrX.hg19:g.135757211C>G	ENSP00000250617:p.Glu664Gln	126.0	1.0		118.0	100.0	NM_004840	A6NMW9|A8K6S7|B1AL37|Q15396|Q5JQ66|Q7Z3W1|Q86XH0	Missense_Mutation	SNP	ENST00000250617.6	hg19	CCDS14660.1	.	.	.	.	.	.	.	.	.	.	C	17.96	3.515693	0.64634	.	.	ENSG00000129675	ENST00000250617;ENST00000370620;ENST00000370622;ENST00000535736;ENST00000535227	T;T;T;T	0.69926	-0.35;-0.23;-0.23;-0.44	5.59	5.59	0.84812	.	0.045466	0.85682	D	0.000000	D	0.83945	0.5364	M	0.82323	2.585	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.86296	0.1677	10	0.87932	D	0	.	18.6464	0.91411	0.0:1.0:0.0:0.0	.	537;664	B7Z3C7;Q15052	.;ARHG6_HUMAN	Q	664;510;510;510;537	ENSP00000250617:E664Q;ENSP00000359654:E510Q;ENSP00000359656:E510Q;ENSP00000439483:E537Q	ENSP00000250617:E664Q	E	-	1	0	ARHGEF6	135584877	1.000000	0.71417	0.925000	0.36789	0.224000	0.24922	7.153000	0.77428	2.347000	0.79759	0.600000	0.82982	GAA	.	.		0.413	ARHGEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058511.2	NM_004840	
MT-ND5	4540	hgsc.bcm.edu	37	M	13916	13916	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chrM:13916G>A	ENST00000361567.2	+	1	1580	c.1580G>A	c.(1579-1581)gGa>gAa	p.G527E	MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	527					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CAACATACTCGGATTCTACCC	0.443																																					p.G527E		Atlas-SNP	.											.	.	.	.	0			c.G1580A						.																																			SO:0001583	missense	0	exon1			TACTCGGATTCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1580G>A	chrM.hg19:g.13916G>A	ENSP00000354813:p.Gly527Glu	263.0	0.0		518.0	67.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.443	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
AGBL3	340351	hgsc.bcm.edu	37	7	134717658	134717659	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr7:134717658_134717659insT	ENST00000436302.2	+	6	735_736	c.482_483insT	c.(481-486)cctgtgfs	p.V162fs	AGBL3_ENST00000435976.2_Frame_Shift_Ins_p.V162fs|AGBL3_ENST00000458078.1_Frame_Shift_Ins_p.V136fs	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	162						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TTGAAGCAGCCTGTGGATTACC	0.391																																					p.P161fs		Atlas-INDEL	.											.	AGBL3	45	.	0			c.482_483insT						.																																			SO:0001589	frameshift_variant	340351	exon6			.	BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.483dupT	chr7.hg19:g.134717659_134717659dupT	ENSP00000388275:p.Val162fs	193.0	0.0		83.0	43.0	NM_178563	B7Z827|Q9H965	Frame_Shift_Ins	INS	ENST00000436302.2	hg19	CCDS47718.1																																																																																			.	.		0.391	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376655.1	NM_178563	
DQX1	165545	hgsc.bcm.edu	37	2	74755115	74755115	+	5'Flank	DEL	A	A	-			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr2:74755115delA	ENST00000404568.3	-	0	0				AUP1_ENST00000377526.3_Frame_Shift_Del_p.H230fs|HTRA2_ENST00000258080.3_5'Flank|HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CTAGTTGGCGATGAACAGGAC	0.567																																					p.R231fs		Atlas-Indel,Pindel	.											.	AUP1	29	.	0			c.691delC						.						123.0	128.0	126.0					2																	74755115		1986	4170	6156	SO:0001631	upstream_gene_variant	550	exon7			.	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		chr2.hg19:g.74755115delA	Exception_encountered	154.0	0.0		127.0	27.0	NM_181575	Q6B017|Q8NAM8	Frame_Shift_Del	DEL	ENST00000404568.3	hg19	CCDS1949.2																																																																																			.	.		0.567	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
C19orf33	64073	hgsc.bcm.edu	37	19	38795575	38795576	+	In_Frame_Ins	INS	-	-	AGGGCAAGAAGGAGA			TCGA-DD-A1EL-01A-11D-A152-10	TCGA-DD-A1EL-10A-01D-A152-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	d252f328-4583-4e97-9a71-bb2885f06f73	b43d641d-f1b1-474e-9475-a1f2e81835b8	g.chr19:38795575_38795576insAGGGCAAGAAGGAGA	ENST00000301246.5	+	4	393_394	c.292_293insAGGGCAAGAAGGAGA	c.(292-294)aag>aAGGGCAAGAAGGAGAag	p.98_98K>KGKKEK	C19orf33_ENST00000588605.1_3'UTR	NM_033520.1	NP_277055.1	Q9GZP8	IMUP_HUMAN	chromosome 19 open reading frame 33	98						nucleus (GO:0005634)						all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			caagaaggagaagggcaagaag	0.599																																					p.K98delinsKGKKEK		Pindel	.											.	C19orf33	9	.	0			c.292_293insAGGGCAAGAAGGAGA						.																																			SO:0001652	inframe_insertion	64073	exon4			.	AF213678	CCDS12511.1	19q13.2	2012-10-26			ENSG00000167644	ENSG00000167644			16668	protein-coding gene	gene with protein product	"""immortalization-upregulated protein"", ""HAI-2 related small protein"", ""hepatocyte growth factor activator inhibitor type 2-related small protein"""					11080599	Standard	NM_033520		Approved	IMUP-1, IMUP-2, H2RSP, IMUP	uc002ohu.1	Q9GZP8	OTTHUMG00000181894	ENST00000301246.5:c.278_292dupAGGGCAAGAAGGAGA	chr19.hg19:g.38795575_38795576insAGGGCAAGAAGGAGA	ENSP00000301246:p.GlyLysLysGluLys98dup	315.0	0.0		293.0	18.0	NM_033520	Q0P6G2|Q96H58|Q9HCR4	In_Frame_Ins	INS	ENST00000301246.5	hg19	CCDS12511.1																																																																																			.	.		0.599	C19orf33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000458168.1	NM_033520	
