#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
DHCR24	1718	hgsc.bcm.edu	37	1	55340777	55340777	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:55340777G>A	ENST00000371269.3	-	4	699	c.601C>T	c.(601-603)Cga>Tga	p.R201*	DHCR24_ENST00000537443.1_Nonsense_Mutation_p.R33*|DHCR24_ENST00000535035.1_Nonsense_Mutation_p.R160*	NM_014762.3	NP_055577.1	Q15392	DHC24_HUMAN	24-dehydrocholesterol reductase	201	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				amyloid precursor protein catabolic process (GO:0042987)|apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cholesterol biosynthetic process (GO:0006695)|male genitalia development (GO:0030539)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|oxidation-reduction process (GO:0055114)|plasminogen activation (GO:0031639)|protein localization (GO:0008104)|Ras protein signal transduction (GO:0007265)|regulation of neuron death (GO:1901214)|response to hormone (GO:0009725)|response to oxidative stress (GO:0006979)|skin development (GO:0043588)|small molecule metabolic process (GO:0044281)|tissue development (GO:0009888)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	delta24(24-1) sterol reductase activity (GO:0000246)|delta24-sterol reductase activity (GO:0050614)|enzyme binding (GO:0019899)|flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on the CH-CH group of donors, NAD or NADP as acceptor (GO:0016628)|peptide antigen binding (GO:0042605)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)			large_intestine(2)|liver(1)|lung(1)|pancreas(1)|prostate(1)|skin(1)	7						GGAGTGCATCGCACAAAGCTG	0.562																																					p.R201X	Pancreas(39;516 1021 24601 30715 32780)	Atlas-SNP	.											.	DHCR24	31	.	0			c.C601T						.						153.0	107.0	123.0					1																	55340777		2203	4300	6503	SO:0001587	stop_gained	1718	exon4			TGCATCGCACAAA	AF261758	CCDS600.1	1p32.3	2008-02-05			ENSG00000116133	ENSG00000116133			2859	protein-coding gene	gene with protein product		606418				11519011	Standard	NM_014762		Approved	KIAA0018, seladin-1	uc001cyc.1	Q15392	OTTHUMG00000009989	ENST00000371269.3:c.601C>T	chr1.hg19:g.55340777G>A	ENSP00000360316:p.Arg201*	107.0	0.0		80.0	33.0	NM_014762	B7Z817|D3DQ51|Q9HBA8	Nonsense_Mutation	SNP	ENST00000371269.3	hg19	CCDS600.1	.	.	.	.	.	.	.	.	.	.	G	38	6.689792	0.97764	.	.	ENSG00000116133	ENST00000371269;ENST00000537443;ENST00000535035	.	.	.	5.56	4.63	0.57726	.	0.053029	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6649	13.9681	0.64221	0.0:0.0:0.6703:0.3297	.	.	.	.	X	201;33;160	.	ENSP00000360316:R201X	R	-	1	2	DHCR24	55113365	1.000000	0.71417	0.996000	0.52242	0.925000	0.55904	4.904000	0.63279	1.454000	0.47793	0.609000	0.83330	CGA	.	.		0.562	DHCR24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027680.1	NM_014762	
C1orf43	25912	hgsc.bcm.edu	37	1	154184832	154184832	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:154184832A>G	ENST00000368521.5	-	6	728	c.530T>C	c.(529-531)cTa>cCa	p.L177P	C1orf43_ENST00000368518.1_Missense_Mutation_p.L177P|C1orf43_ENST00000368519.1_Missense_Mutation_p.L159P|C1orf43_ENST00000362076.4_Missense_Mutation_p.L125P|C1orf43_ENST00000368516.1_Missense_Mutation_p.L143P|C1orf43_ENST00000350592.3_Missense_Mutation_p.L143P	NM_001098616.1	NP_001092086.1	Q9BWL3	CA043_HUMAN	chromosome 1 open reading frame 43	177						integral component of membrane (GO:0016021)	coenzyme binding (GO:0050662)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)	10	all_lung(78;1.98e-30)|Lung NSC(65;2.87e-28)|Hepatocellular(266;0.0877)					CTGATAGCGTAGGTACTCATT	0.517																																					p.L177P		Atlas-SNP	.											.	C1orf43	36	.	0			c.T530C						.						145.0	138.0	140.0					1																	154184832		2203	4300	6503	SO:0001583	missense	25912	exon6			TAGCGTAGGTACT	AF077036	CCDS1061.1, CCDS1062.1, CCDS41404.1, CCDS72924.1	1q21.2	2012-06-25			ENSG00000143612	ENSG00000143612			29876	protein-coding gene	gene with protein product						11042152, 11230159	Standard	XM_005245077		Approved	NICE-3, DKFZp586G1722	uc001fei.2	Q9BWL3	OTTHUMG00000035981	ENST00000368521.5:c.530T>C	chr1.hg19:g.154184832A>G	ENSP00000357507:p.Leu177Pro	106.0	0.0		110.0	69.0	NM_001098616	A8K3G8|D3DV72|D3DV74|Q5M801|Q5VU73|Q5VU83|Q96HP7|Q9UFU2|Q9UGL7|Q9UGL8|Q9Y2R6	Missense_Mutation	SNP	ENST00000368521.5	hg19	CCDS41404.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.981191	0.74474	.	.	ENSG00000143612	ENST00000350592;ENST00000368521;ENST00000362076;ENST00000368519;ENST00000368518;ENST00000368516	.	.	.	5.39	5.39	0.77823	Dehydrogenase, multihelical (1);	0.229195	0.38492	N	0.001664	T	0.61664	0.2365	M	0.63843	1.955	0.80722	D	1	D;D;D;D	0.64830	0.98;0.994;0.971;0.984	P;D;P;P	0.69824	0.804;0.966;0.775;0.876	T	0.63093	-0.6714	9	0.37606	T	0.19	-22.5561	10.0457	0.42186	0.85:0.0:0.0:0.15	.	143;177;125;143	Q9BWL3-2;Q9BWL3;Q9BWL3-4;Q09GN0	.;CA043_HUMAN;.;.	P	143;177;125;159;177;143	.	ENSP00000271925:L143P	L	-	2	0	C1orf43	152451456	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.189000	0.65098	2.270000	0.75569	0.477000	0.44152	CTA	.	.		0.517	C1orf43-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087664.2	NM_015449	
PMVK	10654	hgsc.bcm.edu	37	1	154904854	154904854	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:154904854C>T	ENST00000368467.3	-	2	438	c.133G>A	c.(133-135)Ggt>Agt	p.G45S		NM_006556.3	NP_006547.1	Q15126	PMVK_HUMAN	phosphomevalonate kinase	45					cholesterol biosynthetic process (GO:0006695)|isopentenyl diphosphate biosynthetic process, mevalonate pathway (GO:0019287)|response to cholesterol (GO:0070723)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|phosphomevalonate kinase activity (GO:0004631)			endometrium(1)|kidney(1)|large_intestine(1)|lung(3)	6	all_epithelial(22;4.9e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)|all_neural(408;0.142)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			TTGAGTGGACCAGAGAGCCGG	0.572																																					p.G45S		Atlas-SNP	.											.	PMVK	17	.	0			c.G133A						.						106.0	95.0	99.0					1																	154904854		2203	4300	6503	SO:0001583	missense	10654	exon2			GTGGACCAGAGAG	L77213	CCDS1073.1	1q21.3	2012-09-20			ENSG00000163344	ENSG00000163344	2.7.4.2		9141	protein-coding gene	gene with protein product		607622				8663599, 10191291	Standard	NM_006556		Approved	PMK, PMKA, HUMPMKI	uc001ffq.3	Q15126	OTTHUMG00000037415	ENST00000368467.3:c.133G>A	chr1.hg19:g.154904854C>T	ENSP00000357452:p.Gly45Ser	180.0	0.0		235.0	59.0	NM_006556	Q5TZW9	Missense_Mutation	SNP	ENST00000368467.3	hg19	CCDS1073.1	.	.	.	.	.	.	.	.	.	.	C	15.81	2.943002	0.53079	.	.	ENSG00000163344	ENST00000368467	T	0.41400	1.0	4.59	3.68	0.42216	.	0.130764	0.50627	D	0.000106	T	0.24928	0.0605	L	0.56199	1.76	0.24788	N	0.992778	P	0.42584	0.784	P	0.45449	0.481	T	0.04065	-1.0980	10	0.39692	T	0.17	-9.5168	8.7356	0.34525	0.0:0.8966:0.0:0.1034	.	45	Q15126	PMVK_HUMAN	S	45	ENSP00000357452:G45S	ENSP00000357452:G45S	G	-	1	0	PMVK	153171478	0.260000	0.24053	0.228000	0.23943	0.802000	0.45316	2.336000	0.43938	1.284000	0.44531	0.561000	0.74099	GGT	.	.		0.572	PMVK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091088.1	NM_006556	
FMO2	2327	hgsc.bcm.edu	37	1	171174626	171174626	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:171174626G>C	ENST00000209929.7	+	7	1194	c.1036G>C	c.(1036-1038)Gag>Cag	p.E346Q	FMO2_ENST00000529935.1_3'UTR|RP1-127D3.4_ENST00000445909.1_RNA|RP1-127D3.4_ENST00000422841.1_RNA|RP1-127D3.4_ENST00000445290.1_RNA|FMO2_ENST00000441535.1_Missense_Mutation_p.E346Q			P31512	FMO4_HUMAN	flavin containing monooxygenase 2 (non-functional)	345					drug catabolic process (GO:0042737)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	22	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CGTTAAAGTAGAGAATAATAT	0.423																																					p.E346Q		Atlas-SNP	.											.	FMO2	66	.	0			c.G1036C						.						88.0	85.0	86.0					1																	171174626		2203	4300	6503	SO:0001583	missense	2327	exon7			AAAGTAGAGAATA	BC005894	CCDS1293.1	1q24.3	2011-08-04	2006-07-17		ENSG00000094963	ENSG00000094963			3770	protein-coding gene	gene with protein product		603955	"""flavin containing monooxygenase 2"""			1417778, 9804831	Standard	XR_426768		Approved		uc001ghk.1	Q99518	OTTHUMG00000035504	ENST00000209929.7:c.1036G>C	chr1.hg19:g.171174626G>C	ENSP00000209929:p.Glu346Gln	95.0	0.0		119.0	25.0	NM_001460	Q53XR0	Missense_Mutation	SNP	ENST00000209929.7	hg19	CCDS1293.1	.	.	.	.	.	.	.	.	.	.	G	12.31	1.900165	0.33535	.	.	ENSG00000094963	ENST00000209929;ENST00000441535	T;T	0.58060	0.36;0.36	5.85	4.94	0.65067	.	0.270105	0.42548	D	0.000688	T	0.44953	0.1318	M	0.66939	2.045	0.09310	N	1	P	0.47191	0.891	P	0.54889	0.763	T	0.38993	-0.9635	10	0.16896	T	0.51	-21.6784	10.742	0.46158	0.1534:0.0:0.8466:0.0	.	346	Q99518	FMO2_HUMAN	Q	346	ENSP00000209929:E346Q;ENSP00000405905:E346Q	ENSP00000209929:E346Q	E	+	1	0	FMO2	169441250	0.003000	0.15002	0.283000	0.24790	0.855000	0.48748	1.420000	0.34804	1.472000	0.48140	0.655000	0.94253	GAG	.	.		0.423	FMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086216.2	NM_001460	
PPFIA4	8497	hgsc.bcm.edu	37	1	203037705	203037705	+	Silent	SNP	C	C	T	rs200137584		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:203037705C>T	ENST00000447715.2	+	32	3648	c.3207C>T	c.(3205-3207)ttC>ttT	p.F1069F	PPFIA4_ENST00000272198.6_Silent_p.F585F|PPFIA4_ENST00000295706.4_Silent_p.F576F|PPFIA4_ENST00000414050.2_Silent_p.F798F|PPFIA4_ENST00000599966.1_Silent_p.F576F|PPFIA4_ENST00000367240.2_Silent_p.F1070F			O75335	LIPA4_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 4	1069	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(20)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	50						ACGAGAACTTCGACCACAACA	0.557																																					p.F585F		Atlas-SNP	.											.	PPFIA4	139	.	0			c.C1755T						.	C		0,4166		0,0,2083	68.0	69.0	69.0		1755	-2.3	1.0	1		69	4,8404		0,4,4200	no	coding-synonymous	PPFIA4	NM_015053.1		0,4,6283	TT,TC,CC		0.0476,0.0,0.0318		585/702	203037705	4,12570	2083	4204	6287	SO:0001819	synonymous_variant	8497	exon14			GAACTTCGACCAC	AF034801	CCDS44296.1	1q32.1	2013-01-10			ENSG00000143847	ENSG00000143847		"""Sterile alpha motif (SAM) domain containing"""	9248	protein-coding gene	gene with protein product	"""Liprin-alpha4"""	603145				9624153	Standard	XM_005245553		Approved		uc009xaj.3	O75335	OTTHUMG00000042123	ENST00000447715.2:c.3207C>T	chr1.hg19:g.203037705C>T		94.0	0.0		104.0	59.0	NM_015053	A2RUJ5|B1APN8|B1N949|B7ZM43|O94971	Silent	SNP	ENST00000447715.2	hg19																																																																																				.	C|0.998;T|0.002		0.557	PPFIA4-005	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000462949.1	NM_015053	
DNAH14	127602	hgsc.bcm.edu	37	1	225510419	225510419	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:225510419T>C	ENST00000445597.2	+	42	7151	c.7151T>C	c.(7150-7152)aTt>aCt	p.I2384T	DNAH14_ENST00000439375.2_Missense_Mutation_p.I3037T|DNAH14_ENST00000430092.1_Missense_Mutation_p.I3037T			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2384					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GCAGTGTGTATTCTTCTGCAA	0.378																																					p.I3037T		Atlas-SNP	.											.	DNAH14	300	.	0			c.T9110C						.						143.0	120.0	127.0					1																	225510419		692	1591	2283	SO:0001583	missense	127602	exon60			TGTGTATTCTTCT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.7151T>C	chr1.hg19:g.225510419T>C	ENSP00000409472:p.Ile2384Thr	222.0	0.0		247.0	50.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	ENST00000445597.2	hg19		.	.	.	.	.	.	.	.	.	.	T	18.12	3.552100	0.65311	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.77620	-1.11;-1.11;-1.11	5.73	5.73	0.89815	.	.	.	.	.	T	0.81004	0.4733	L	0.28608	0.87	0.80722	D	1	D	0.76494	0.999	D	0.67382	0.951	T	0.81382	-0.0958	9	0.44086	T	0.13	.	15.0108	0.71547	0.0:0.0:0.0:1.0	.	3037	Q0VDD8-4	.	T	2384;3037;3037	ENSP00000409472:I2384T;ENSP00000414402:I3037T;ENSP00000392061:I3037T	ENSP00000414402:I3037T	I	+	2	0	DNAH14	223577042	0.987000	0.35691	0.936000	0.37596	0.962000	0.63368	3.532000	0.53553	2.179000	0.69175	0.491000	0.48974	ATT	.	.		0.378	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
MAP4K3	8491	hgsc.bcm.edu	37	2	39535117	39535117	+	Silent	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:39535117T>C	ENST00000263881.3	-	15	1410	c.1086A>G	c.(1084-1086)tcA>tcG	p.S362S	MAP4K3_ENST00000536018.1_5'UTR|MAP4K3_ENST00000437545.1_Intron|MAP4K3_ENST00000341681.5_Intron	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	362					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				ATATTTCTTCTGAACTGTCCA	0.348																																					p.S362S		Atlas-SNP	.											.	MAP4K3	109	.	0			c.A1086G						.						121.0	116.0	118.0					2																	39535117		2203	4300	6503	SO:0001819	synonymous_variant	8491	exon15			TTCTTCTGAACTG	AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.1086A>G	chr2.hg19:g.39535117T>C		73.0	0.0		52.0	11.0	NM_003618	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Silent	SNP	ENST00000263881.3	hg19	CCDS1803.1																																																																																			.	.		0.348	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219966.2	NM_003618	
ZC3H6	376940	hgsc.bcm.edu	37	2	113067682	113067682	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:113067682G>A	ENST00000409871.1	+	4	958	c.557G>A	c.(556-558)gGg>gAg	p.G186E	ZC3H6_ENST00000343936.4_Missense_Mutation_p.G186E	NM_198581.2	NP_940983.2	P61129	ZC3H6_HUMAN	zinc finger CCCH-type containing 6	186							metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(9)|lung(12)|ovary(4)|prostate(2)	35						ATTGCTTTAGGGTCATCATTT	0.363																																					p.G186E		Atlas-SNP	.											.	ZC3H6	93	.	0			c.G557A						.						65.0	62.0	63.0					2																	113067682		1836	4083	5919	SO:0001583	missense	376940	exon4			CTTTAGGGTCATC	AK123404	CCDS46393.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000188177	ENSG00000188177		"""Zinc fingers, CCCH-type domain containing"""	24762	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 6"""	ZC3HDC6			Standard	NM_198581		Approved	FLJ41410, FLJ45877, KIAA2035	uc002thq.1	P61129	OTTHUMG00000153286	ENST00000409871.1:c.557G>A	chr2.hg19:g.113067682G>A	ENSP00000386764:p.Gly186Glu	112.0	0.0		71.0	31.0	NM_198581	A9JR71|Q6ZW96	Missense_Mutation	SNP	ENST00000409871.1	hg19	CCDS46393.1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699941	0.68501	.	.	ENSG00000188177	ENST00000409871;ENST00000343936;ENST00000542974	T;T	0.15952	2.38;2.38	5.93	5.93	0.95920	.	2.702860	0.01326	N	0.011113	T	0.27384	0.0672	M	0.71581	2.175	0.53688	D	0.999976	P	0.46142	0.873	B	0.39904	0.313	T	0.43327	-0.9398	10	0.49607	T	0.09	-16.3411	10.6499	0.45642	0.1415:0.0:0.8585:0.0	.	186	P61129	ZC3H6_HUMAN	E	186;186;163	ENSP00000386764:G186E;ENSP00000340298:G186E	ENSP00000340298:G186E	G	+	2	0	ZC3H6	112784153	1.000000	0.71417	1.000000	0.80357	0.828000	0.46876	3.732000	0.55021	2.802000	0.96397	0.561000	0.74099	GGG	.	.		0.363	ZC3H6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330551.1	NM_198581	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098799	178098799	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:178098799T>G	ENST00000397062.3	-	2	800	c.246A>C	c.(244-246)gaA>gaC	p.E82D	NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66D|NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66D|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66D|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66D	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82D(8)|p.G81_F83delGEF(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTGGGAGAAATTCACCTGTCT	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82D		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,0,9	NFE2L2	225	.	9	Substitution - Missense(8)|Deletion - In frame(1)	endometrium(3)|liver(2)|upper_aerodigestive_tract(1)|cervix(1)|oesophagus(1)|kidney(1)	c.A246C						.						138.0	137.0	137.0					2																	178098799		1903	4104	6007	SO:0001583	missense	4780	exon2			GAGAAATTCACCT		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.246A>C	chr2.hg19:g.178098799T>G	ENSP00000380252:p.Glu82Asp	180.0	0.0		127.0	52.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706902	0.89018	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.67;1.67;1.53	5.78	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.58395	0.2119	M	0.87180	2.865	0.54753	D	0.999981	D;D;D;D	0.89917	0.999;0.997;1.0;0.999	D;D;D;D	0.83275	0.991;0.978;0.996;0.991	T	0.64976	-0.6280	10	0.72032	D	0.01	.	11.2269	0.48888	0.0:0.0712:0.0:0.9288	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	D	66;82;66;66;66;66	ENSP00000380253:E66D;ENSP00000380252:E82D;ENSP00000411575:E66D;ENSP00000400073:E66D;ENSP00000412191:E66D;ENSP00000410015:E66D	ENSP00000380252:E82D	E	-	3	2	NFE2L2	177807045	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.909000	0.39917	2.210000	0.71456	0.460000	0.39030	GAA	.	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
ANKZF1	55139	hgsc.bcm.edu	37	2	220095010	220095010	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:220095010C>G	ENST00000323348.5	+	2	205	c.31C>G	c.(31-33)Cct>Gct	p.P11A	ANKZF1_ENST00000410034.3_Missense_Mutation_p.P11A|ATG9A_ENST00000409618.1_5'Flank|ATG9A_ENST00000361242.4_5'Flank|ANKZF1_ENST00000409849.1_Intron|ATG9A_ENST00000396761.2_5'Flank|ATG9A_ENST00000409422.1_5'Flank|ATG9A_ENST00000488833.1_5'Flank	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	11						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCCCCGGCTCCTGCGTCGAT	0.622																																					p.P11A		Atlas-SNP	.											.	ANKZF1	45	.	0			c.C31G						.						37.0	39.0	38.0					2																	220095010		1895	4113	6008	SO:0001583	missense	55139	exon2			CCGGCTCCTGCGT	AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.31C>G	chr2.hg19:g.220095010C>G	ENSP00000321617:p.Pro11Ala	218.0	0.0		140.0	38.0	NM_001042410	Q9NVZ4	Missense_Mutation	SNP	ENST00000323348.5	hg19	CCDS42821.1	.	.	.	.	.	.	.	.	.	.	C	9.315	1.056527	0.19907	.	.	ENSG00000163516	ENST00000323348;ENST00000416565;ENST00000410034;ENST00000447157;ENST00000436226	T;T	0.25749	1.78;1.78	5.53	2.81	0.32909	.	0.253994	0.39759	N	0.001265	T	0.23289	0.0563	L	0.55481	1.735	0.09310	N	1	B;B	0.29378	0.229;0.243	B;B	0.30572	0.117;0.079	T	0.13953	-1.0490	10	0.39692	T	0.17	-2.2277	8.7866	0.34825	0.0:0.7987:0.0:0.2013	.	11;11	B4DZT1;Q9H8Y5	.;ANKZ1_HUMAN	A	11	ENSP00000321617:P11A;ENSP00000386337:P11A	ENSP00000321617:P11A	P	+	1	0	ANKZF1	219803254	0.004000	0.15560	0.003000	0.11579	0.076000	0.17211	0.924000	0.28777	0.466000	0.27193	0.655000	0.94253	CCT	.	.		0.622	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335790.1	NM_018089	
PAX3	5077	hgsc.bcm.edu	37	2	223084872	223084872	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:223084872C>T	ENST00000350526.4	-	7	1296	c.1160G>A	c.(1159-1161)gGc>gAc	p.G387D	PAX3_ENST00000336840.6_Missense_Mutation_p.G387D|PAX3_ENST00000409551.3_Missense_Mutation_p.G386D|PAX3_ENST00000392069.2_Missense_Mutation_p.G387D|PAX3_ENST00000464706.1_5'UTR|PAX3_ENST00000344493.4_Missense_Mutation_p.G387D|PAX3_ENST00000392070.2_Missense_Mutation_p.G387D	NM_181457.3	NP_852122.1	P23760	PAX3_HUMAN	paired box 3	387					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|developmental pigmentation (GO:0048066)|heart development (GO:0007507)|mammary gland specification (GO:0060594)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neural tube closure (GO:0001843)|neuron fate commitment (GO:0048663)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of somitogenesis (GO:0014807)|sensory perception of sound (GO:0007605)|spinal cord association neuron differentiation (GO:0021527)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)		PAX3/NCOA2(4)|PAX3/NCOA1(8)|PAX3/FOXO1(749)	NS(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(13)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	38		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;1.85e-07)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGGTGAGAGGCCATTGCCAAT	0.517			T	"""FOXO1A, NCOA1"""	alveolar rhabdomyosarcoma		Waardenburg syndrome; craniofacial-deafness-hand syndrome																														p.G387D		Atlas-SNP	.		Dom	yes		2	2q35	5077	paired box gene 3	yes	M	.	PAX3	106	.	0			c.G1160A						.						79.0	80.0	80.0					2																	223084872		2203	4300	6503	SO:0001583	missense	5077	exon7			GAGAGGCCATTGC		CCDS2449.1, CCDS2450.1, CCDS2451.1, CCDS42825.1, CCDS2448.1, CCDS42826.1, CCDS46522.1, CCDS46523.1	2q36.1	2011-06-20	2007-07-12		ENSG00000135903	ENSG00000135903		"""Paired boxes"", ""Homeoboxes / PRD class"""	8617	protein-coding gene	gene with protein product		606597	"""Waardenburg syndrome 1"", ""paired box gene 3 (Waardenburg syndrome 1)"""	WS1		1347149	Standard	NM_181461		Approved	HUP2	uc002vmt.2	P23760	OTTHUMG00000133157	ENST00000350526.4:c.1160G>A	chr2.hg19:g.223084872C>T	ENSP00000343052:p.Gly387Asp	180.0	0.0		118.0	42.0	NM_181457	G5E9C1|Q16448|Q494Z3|Q494Z4|Q53T90|Q6GSJ9|Q86UQ2|Q86UQ3	Missense_Mutation	SNP	ENST00000350526.4	hg19	CCDS42826.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.633641	0.87660	.	.	ENSG00000135903	ENST00000392069;ENST00000344493;ENST00000350526;ENST00000392070;ENST00000336840;ENST00000409551;ENST00000464706;ENST00000555548	D;D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.68	5.68	0.88126	.	0.049348	0.85682	D	0.000000	D	0.91536	0.7327	L	0.61218	1.895	0.80722	D	1	B;D;D;D;D	0.76494	0.091;0.993;0.998;0.999;0.992	B;D;D;D;P	0.70487	0.168;0.912;0.916;0.969;0.856	D	0.91681	0.5358	10	0.72032	D	0.01	.	19.7917	0.96461	0.0:1.0:0.0:0.0	.	387;386;387;387;387	P23760;Q494Z4;P23760-4;P23760-5;G5E9C1	PAX3_HUMAN;.;.;.;.	D	387;387;387;387;387;386;104;104	ENSP00000375921:G387D;ENSP00000342092:G387D;ENSP00000343052:G387D;ENSP00000375922:G387D;ENSP00000338767:G387D;ENSP00000386750:G386D	ENSP00000338767:G387D	G	-	2	0	PAX3	222793116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.666000	0.68059	2.685000	0.91497	0.650000	0.86243	GGC	.	.		0.517	PAX3-006	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000328670.1		
HJURP	55355	hgsc.bcm.edu	37	2	234749510	234749510	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr2:234749510A>C	ENST00000411486.2	-	8	1981	c.1916T>G	c.(1915-1917)tTg>tGg	p.L639W	HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000432087.1_Missense_Mutation_p.L585W|HJURP_ENST00000441687.1_Missense_Mutation_p.L554W	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	639					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TGATGATGGCAACTTCTGGAA	0.473																																					p.L639W		Atlas-SNP	.											.	HJURP	72	.	0			c.T1916G						.						91.0	95.0	94.0					2																	234749510		2203	4300	6503	SO:0001583	missense	55355	exon8			GATGGCAACTTCT		CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1916T>G	chr2.hg19:g.234749510A>C	ENSP00000414109:p.Leu639Trp	47.0	0.0		30.0	8.0	NM_018410	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	ENST00000411486.2	hg19	CCDS33406.1	.	.	.	.	.	.	.	.	.	.	A	12.49	1.954969	0.34471	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.11063	3.08;3.09;3.09;2.81	3.93	0.304	0.15796	.	1.458390	0.05284	N	0.519905	T	0.10078	0.0247	L	0.42245	1.32	0.09310	N	1	B;B;B	0.11235	0.004;0.004;0.002	B;B;B	0.11329	0.006;0.006;0.003	T	0.40021	-0.9585	10	0.54805	T	0.06	0.1896	3.1067	0.06344	0.4629:0.2482:0.2889:0.0	.	554;585;639	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	W	639;585;554;554	ENSP00000414109:L639W;ENSP00000407208:L585W;ENSP00000401944:L554W;ENSP00000393253:L554W	ENSP00000414109:L639W	L	-	2	0	HJURP	234414249	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.244000	0.08903	0.048000	0.15891	0.460000	0.39030	TTG	.	.		0.473	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000130996.6	NM_018410	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266100	41266100	+	Missense_Mutation	SNP	T	T	C	rs121913416		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr3:41266100T>C	ENST00000349496.5	+	3	377	c.97T>C	c.(97-99)Tct>Cct	p.S33P	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.S33P(47)|p.S33A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.W25_D32del(4)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.D32_S33insS(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33T(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TTACCTGGACTCTGGAATCCA	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1,1	CTNNB1	4904	.	212	Deletion - In frame(115)|Substitution - Missense(70)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(1)	liver(130)|large_intestine(20)|endometrium(14)|stomach(10)|pituitary(9)|pancreas(9)|central_nervous_system(8)|adrenal_gland(2)|small_intestine(2)|biliary_tract(2)|skin(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|ovary(1)|breast(1)	c.T97C						.						93.0	77.0	82.0					3																	41266100		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	CTGGACTCTGGAA	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.97T>C	chr3.hg19:g.41266100T>C	ENSP00000344456:p.Ser33Pro	339.0	0.0		245.0	78.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.395782	0.83011	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74;0.74	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.70281	0.3206	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74509	-0.3642	10	0.87932	D	0	-10.7796	16.0677	0.80897	0.0:0.0:0.0:1.0	.	33	P35222	CTNB1_HUMAN	P	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26P;ENSP00000385604:S33P;ENSP00000412219:S33P;ENSP00000379486:S33P;ENSP00000344456:S33P;ENSP00000411226:S26P;ENSP00000379488:S33P;ENSP00000409302:S33P;ENSP00000401599:S33P	ENSP00000344456:S33P	S	+	1	0	CTNNB1	41241104	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.201000	0.70794	0.533000	0.62120	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
KIAA1257	57501	hgsc.bcm.edu	37	3	128712024	128712024	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr3:128712024T>C	ENST00000265068.5	-	2	291	c.124A>G	c.(124-126)Agg>Ggg	p.R42G	KIAA1257_ENST00000515659.1_5'Flank|KIAA1257_ENST00000511438.1_Missense_Mutation_p.R42G|KIAA1257_ENST00000510149.1_Intron	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	42										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						TCCTGGGCCCTGGCCTTGGCC	0.617																																					p.R42G		Atlas-SNP	.											.	KIAA1257	33	.	0			c.A124G						.						65.0	75.0	72.0					3																	128712024		2161	4262	6423	SO:0001583	missense	57501	exon2			GGGCCCTGGCCTT	AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.124A>G	chr3.hg19:g.128712024T>C	ENSP00000265068:p.Arg42Gly	203.0	0.0		131.0	45.0	NM_020741	Q8IXY7|Q8N5T4	Missense_Mutation	SNP	ENST00000265068.5	hg19	CCDS46905.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.412774	0.42817	.	.	ENSG00000114656	ENST00000511438;ENST00000265068	.	.	.	4.25	-6.08	0.02151	.	.	.	.	.	T	0.09774	0.0240	N	0.08118	0	0.09310	N	0.999999	B;B	0.34161	0.439;0.439	B;B	0.27380	0.079;0.079	T	0.18777	-1.0326	8	0.48119	T	0.1	0.0416	1.3647	0.02199	0.1842:0.1103:0.4926:0.213	.	42;42	Q9ULG3;D6RH05	K1257_HUMAN;.	G	42	.	ENSP00000265068:R42G	R	-	1	2	KIAA1257	130194714	0.000000	0.05858	0.000000	0.03702	0.241000	0.25554	-0.683000	0.05179	-0.807000	0.04393	0.397000	0.26171	AGG	.	.		0.617	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000358430.1	NM_020741	
BFSP2	8419	hgsc.bcm.edu	37	3	133185754	133185754	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr3:133185754C>A	ENST00000302334.2	+	5	1063	c.974C>A	c.(973-975)tCg>tAg	p.S325*	BFSP2_ENST00000511434.1_3'UTR	NM_003571.2	NP_003562.1	Q13515	BFSP2_HUMAN	beaded filament structural protein 2, phakinin	325	Rod.				cell maturation (GO:0048469)|intermediate filament cytoskeleton organization (GO:0045104)|lens fiber cell development (GO:0070307)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)	p.S325L(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|urinary_tract(1)	13						CACAACACTTCGTGCCAAGTC	0.562																																					p.S325X		Atlas-SNP	.											BFSP2,bladder,carcinoma,0,1	BFSP2	48	.	1	Substitution - Missense(1)	urinary_tract(1)	c.C974A						.						85.0	80.0	82.0					3																	133185754		2203	4300	6503	SO:0001587	stop_gained	8419	exon5			ACACTTCGTGCCA	U48224	CCDS33859.1	3q22.1	2013-01-16			ENSG00000170819	ENSG00000170819		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1041	protein-coding gene	gene with protein product		603212					Standard	NM_003571		Approved	CP47, CP49, LIFL-L, phakinin	uc003epn.1	Q13515	OTTHUMG00000159719	ENST00000302334.2:c.974C>A	chr3.hg19:g.133185754C>A	ENSP00000304987:p.Ser325*	241.0	0.0		196.0	20.0	NM_003571	Q14D32|Q9HBW5	Nonsense_Mutation	SNP	ENST00000302334.2	hg19	CCDS33859.1	.	.	.	.	.	.	.	.	.	.	C	37	6.502503	0.97620	.	.	ENSG00000170819	ENST00000302334	.	.	.	5.74	5.74	0.90152	.	0.532920	0.17019	N	0.190217	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-2.63	19.919	0.97077	0.0:1.0:0.0:0.0	.	.	.	.	X	325	.	ENSP00000304987:S325X	S	+	2	0	BFSP2	134668444	0.638000	0.27225	0.020000	0.16555	0.988000	0.76386	4.123000	0.57917	2.712000	0.92718	0.561000	0.74099	TCG	.	.		0.562	BFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357031.1		
HTR3E	285242	hgsc.bcm.edu	37	3	183822009	183822009	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr3:183822009T>A	ENST00000415389.2	+	4	785	c.319T>A	c.(319-321)Tgt>Agt	p.C107S	HTR3E_ENST00000440596.2_Missense_Mutation_p.C107S|HTR3E_ENST00000425359.2_Missense_Mutation_p.C92S|HTR3E-AS1_ENST00000431427.1_RNA|HTR3E_ENST00000436361.2_Missense_Mutation_p.C107S|HTR3E_ENST00000335304.2_Missense_Mutation_p.C122S	NM_001256613.1|NM_198313.2	NP_001243542.1|NP_938055.1	A5X5Y0	5HT3E_HUMAN	5-hydroxytryptamine (serotonin) receptor 3E, ionotropic	107					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	40	all_cancers(143;1.46e-10)|Ovarian(172;0.0303)		Epithelial(37;7.06e-36)|OV - Ovarian serous cystadenocarcinoma(80;3.11e-22)		Ergoloid mesylate(DB01049)	CCCAGAGGAATGTGAGGGCAT	0.468																																					p.C122S	Melanoma(7;227 727 6634 44770)	Atlas-SNP	.											.	HTR3E	65	.	0			c.T364A						.						63.0	54.0	57.0					3																	183822009		2203	4300	6503	SO:0001583	missense	285242	exon3			GAGGAATGTGAGG	AY159813	CCDS3251.1, CCDS58868.1, CCDS58869.1, CCDS58870.1, CCDS58871.1	3q27	2012-05-22	2012-02-03		ENSG00000186038	ENSG00000186038		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24005	protein-coding gene	gene with protein product		610123	"""5-hydroxytryptamine (serotonin) receptor 3, family member E"""			12801637, 15157181	Standard	NM_001256613		Approved		uc010hxr.3	A5X5Y0	OTTHUMG00000156857	ENST00000415389.2:c.319T>A	chr3.hg19:g.183822009T>A	ENSP00000401444:p.Cys107Ser	66.0	0.0		49.0	11.0	NM_182589	A8IKD7|E9PGF1|Q495G1|Q495G3|Q6V706|Q6V707|Q7Z6B2	Missense_Mutation	SNP	ENST00000415389.2	hg19	CCDS58868.1	.	.	.	.	.	.	.	.	.	.	t	13.37	2.217041	0.39201	.	.	ENSG00000186038	ENST00000415389;ENST00000425359;ENST00000335304;ENST00000431041;ENST00000436361;ENST00000440596	T;T;T;T;T;T	0.77489	-1.1;-1.1;-1.1;-1.1;-1.1;-1.1	3.46	3.46	0.39613	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.64402	U	0.000003	D	0.87160	0.6108	M	0.84846	2.72	0.26614	N	0.972772	D;D;D;D;D	0.89917	0.991;1.0;1.0;1.0;1.0	D;D;D;D;D	0.79784	0.954;0.993;0.988;0.988;0.988	T	0.79150	-0.1922	10	0.62326	D	0.03	.	10.2155	0.43166	0.0:0.0:0.0:1.0	.	107;107;107;122;92	E9PGF1;A5X5Y0;A5X5Y0-4;A5X5Y0-3;A5X5Y0-2	.;5HT3E_HUMAN;.;.;.	S	107;92;122;36;107;107	ENSP00000401444:C107S;ENSP00000401900:C92S;ENSP00000335511:C122S;ENSP00000391254:C36S;ENSP00000395833:C107S;ENSP00000406050:C107S	ENSP00000335511:C122S	C	+	1	0	HTR3E	185304703	1.000000	0.71417	0.039000	0.18376	0.273000	0.26683	6.209000	0.72171	1.565000	0.49641	0.528000	0.53228	TGT	.	.		0.468	HTR3E-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000346284.1	NM_182589	
CRYGS	1427	hgsc.bcm.edu	37	3	186256648	186256648	+	Missense_Mutation	SNP	C	C	A	rs570966753		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr3:186256648C>A	ENST00000392499.2	-	4	713	c.374G>T	c.(373-375)cGa>cTa	p.R125L	CRYGS_ENST00000307944.5_Missense_Mutation_p.R125L	NM_017541.2	NP_060011.1	P22914	CRBS_HUMAN	crystallin, gamma S	125	Beta/gamma crystallin 'Greek key' 3. {ECO:0000255|PROSITE-ProRule:PRU00028}.				lens development in camera-type eye (GO:0002088)|morphogenesis of an epithelium (GO:0002009)		structural constituent of eye lens (GO:0005212)			endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	11	all_cancers(143;3.75e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.5e-22)	GBM - Glioblastoma multiforme(93;0.0906)		GTGGATCTCTCGCATGTGAAA	0.488																																					p.R125L		Atlas-SNP	.											.	CRYGS	23	.	0			c.G374T						.						89.0	82.0	84.0					3																	186256648		2203	4300	6503	SO:0001583	missense	1427	exon3			ATCTCTCGCATGT		CCDS3275.1	3q27.3	2013-02-14			ENSG00000213139	ENSG00000213139			2417	protein-coding gene	gene with protein product	"""crystallin, gamma 8"""	123730		CRYG8			Standard	NM_017541		Approved		uc003fqe.3	P22914	OTTHUMG00000156615	ENST00000392499.2:c.374G>T	chr3.hg19:g.186256648C>A	ENSP00000376287:p.Arg125Leu	165.0	0.0		127.0	53.0	NM_017541	B2RAF8	Missense_Mutation	SNP	ENST00000392499.2	hg19	CCDS3275.1	.	.	.	.	.	.	.	.	.	.	C	16.13	3.036824	0.54896	.	.	ENSG00000213139	ENST00000392499;ENST00000307944	T;T	0.76316	-1.01;-1.01	5.95	5.08	0.68730	Beta/gamma crystallin (4);Gamma-crystallin-related (1);	0.000000	0.64402	U	0.000014	D	0.85062	0.5611	M	0.87180	2.865	0.41397	D	0.987655	P	0.49358	0.923	P	0.55112	0.769	D	0.85022	0.0912	10	0.36615	T	0.2	.	9.4977	0.38997	0.0:0.8397:0.0:0.1603	.	125	P22914	CRBS_HUMAN	L	125	ENSP00000376287:R125L;ENSP00000312099:R125L	ENSP00000312099:R125L	R	-	2	0	CRYGS	187739342	1.000000	0.71417	0.912000	0.35992	0.991000	0.79684	4.916000	0.63362	1.518000	0.48934	0.655000	0.94253	CGA	.	.		0.488	CRYGS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344784.1	NM_017541	
FGFR3	2261	hgsc.bcm.edu	37	4	1808893	1808893	+	Silent	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr4:1808893G>A	ENST00000260795.2	+	17	2427	c.2325G>A	c.(2323-2325)caG>caA	p.Q775Q	FGFR3_ENST00000412135.2_Silent_p.Q663Q|FGFR3_ENST00000340107.4_Silent_p.Q777Q|FGFR3_ENST00000440486.2_Silent_p.Q775Q|FGFR3_ENST00000481110.2_Missense_Mutation_p.G753R|FGFR3_ENST00000352904.1_Silent_p.Q663Q			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	775					alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)			NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	CGGGTGGCCAGGACACCCCCA	0.711		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																												p.Q777Q		Atlas-SNP	.		Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	.	FGFR3	3320	.	0			c.G2331A						.						24.0	26.0	25.0					4																	1808893		2192	4296	6488	SO:0001819	synonymous_variant	2261	exon18	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	TGGCCAGGACACC	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.2325G>A	chr4.hg19:g.1808893G>A		204.0	0.0		133.0	43.0	NM_001163213	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	ENST00000260795.2	hg19	CCDS3353.1	.	.	.	.	.	.	.	.	.	.	g	17.10	3.302697	0.60195	.	.	ENSG00000068078	ENST00000481110	D	0.83075	-1.68	4.53	1.77	0.24775	.	.	.	.	.	T	0.77315	0.4112	.	.	.	0.80722	D	1	B	0.22414	0.069	B	0.21708	0.036	T	0.70985	-0.4723	8	0.87932	D	0	.	11.6551	0.51313	0.1322:0.0:0.8678:0.0	.	753	F8W9L4	.	R	753	ENSP00000420533:G753R	ENSP00000420533:G753R	G	+	1	0	FGFR3	1778691	1.000000	0.71417	1.000000	0.80357	0.780000	0.44128	1.636000	0.37144	0.095000	0.17434	0.511000	0.50034	GGA	.	.		0.711	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000241632.2	NM_000142	
PROM1	8842	hgsc.bcm.edu	37	4	16014922	16014922	+	Missense_Mutation	SNP	G	G	T	rs137853006		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr4:16014922G>T	ENST00000510224.1	-	11	1365	c.1117C>A	c.(1117-1119)Cgc>Agc	p.R373S	PROM1_ENST00000505450.1_Missense_Mutation_p.R364S|PROM1_ENST00000447510.2_Missense_Mutation_p.R373S|PROM1_ENST00000543373.1_Missense_Mutation_p.R364S|PROM1_ENST00000540805.1_Missense_Mutation_p.R373S|PROM1_ENST00000539194.1_Missense_Mutation_p.R373S|PROM1_ENST00000508167.1_Missense_Mutation_p.R364S			O43490	PROM1_HUMAN	prominin 1	373			R -> C (in CORD12, STGD4 and MCDR2; affects the interaction with actin). {ECO:0000269|PubMed:18654668}.		camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)			breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						GTGGTTTGGCGTTGTACTCTG	0.388																																					p.R373S		Atlas-SNP	.											.	PROM1	91	.	0			c.C1117A	GRCh37	CM083044	PROM1	M	rs137853006	.						171.0	165.0	167.0					4																	16014922		1904	4133	6037	SO:0001583	missense	8842	exon10			TTTGGCGTTGTAC	AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1117C>A	chr4.hg19:g.16014922G>T	ENSP00000426809:p.Arg373Ser	90.0	0.0		66.0	20.0	NM_006017	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	ENST00000510224.1	hg19	CCDS47029.1	.	.	.	.	.	.	.	.	.	.	G	3.924	-0.017604	0.07681	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.03	-0.568	0.11760	.	0.584607	0.19507	N	0.112589	T	0.18759	0.0450	N	0.08118	0	0.09310	N	1	B;B;B;B;B;B	0.09022	0.002;0.002;0.002;0.002;0.001;0.002	B;B;B;B;B;B	0.04013	0.0;0.0;0.0;0.0;0.0;0.001	T	0.14008	-1.0488	10	0.32370	T	0.25	-3.9024	7.5319	0.27687	0.0:0.0774:0.4186:0.504	.	364;373;364;373;364;373	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	S	373;373;373;364;364;373;364	ENSP00000415481:R373S;ENSP00000438045:R373S;ENSP00000443620:R373S;ENSP00000426090:R364S;ENSP00000427346:R364S;ENSP00000426809:R373S;ENSP00000445526:R364S	ENSP00000415481:R373S	R	-	1	0	PROM1	15624020	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.100000	0.15231	-0.315000	0.08703	-1.532000	0.00920	CGC	.	.		0.388	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359595.2	NM_006017	
TBC1D1	23216	hgsc.bcm.edu	37	4	37962092	37962092	+	Intron	SNP	G	G	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr4:37962092G>T	ENST00000261439.4	+	3	772				TBC1D1_ENST00000508802.1_Intron|PTTG2_ENST00000504686.1_Nonsense_Mutation_p.E13*	NM_001253914.1|NM_001253915.1|NM_015173.3	NP_001240843.1|NP_001240844.1|NP_055988.2	Q86TI0	TBCD1_HUMAN	TBC1 (tre-2/USP6, BUB2, cdc16) domain family, member 1						membrane organization (GO:0061024)|regulation of protein localization (GO:0032880)	cytosol (GO:0005829)|nucleus (GO:0005634)	Rab GTPase activator activity (GO:0005097)			NS(1)|breast(3)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	36						GGAAATTGGAGAACCAGGCAC	0.448																																					p.E13X		Atlas-SNP	.											.	PTTG2	15	.	0			c.G37T						.						61.0	67.0	65.0					4																	37962092		2203	4300	6503	SO:0001627	intron_variant	10744	exon1			ATTGGAGAACCAG	AB029031	CCDS33972.1, CCDS58897.1	4p14	2013-07-09			ENSG00000065882	ENSG00000065882			11578	protein-coding gene	gene with protein product		609850				10965142, 18258599	Standard	NM_015173		Approved	TBC, TBC1, KIAA1108	uc003gtb.3	Q86TI0	OTTHUMG00000150302	ENST00000261439.4:c.418-54038G>T	chr4.hg19:g.37962092G>T		187.0	0.0		164.0	57.0	NM_006607	B7Z3D9|E9PGH8|Q96K82|Q9UPP4	Nonsense_Mutation	SNP	ENST00000261439.4	hg19	CCDS33972.1	.	.	.	.	.	.	.	.	.	.	G	13.13	2.144170	0.37825	.	.	ENSG00000250254	ENST00000504686	.	.	.	1.36	1.36	0.22044	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	6.1977	0.20559	0.0:0.0:1.0:0.0	.	.	.	.	X	13	.	ENSP00000424261:E13X	E	+	1	0	PTTG2	37638487	0.981000	0.34729	0.038000	0.18304	0.042000	0.13812	1.040000	0.30278	1.097000	0.41459	0.558000	0.71614	GAA	.	.		0.448	TBC1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317443.2	NM_015173	
TTC29	83894	hgsc.bcm.edu	37	4	147824847	147824847	+	Silent	SNP	A	A	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr4:147824847A>T	ENST00000325106.4	-	6	661	c.435T>A	c.(433-435)gcT>gcA	p.A145A	TTC29_ENST00000398886.4_Silent_p.A171A|TTC29_ENST00000513335.1_Silent_p.A171A	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	145								p.N142_E154>K(1)		breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					AACAGGCCAGAGCATACAAGT	0.393																																					p.A145A		Atlas-SNP	.											.	TTC29	63	.	1	Complex - deletion inframe(1)	breast(1)	c.T435A						.						62.0	59.0	60.0					4																	147824847		1867	4101	5968	SO:0001819	synonymous_variant	83894	exon6			GGCCAGAGCATAC	AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.435T>A	chr4.hg19:g.147824847A>T		130.0	0.0		95.0	45.0	NM_031956	A4GU95|Q9BXB6	Silent	SNP	ENST00000325106.4	hg19	CCDS47141.1																																																																																			.	.		0.393	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_031956	
FNIP2	57600	hgsc.bcm.edu	37	4	159782775	159782775	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr4:159782775C>G	ENST00000264433.6	+	12	1387	c.1312C>G	c.(1312-1314)Ctg>Gtg	p.L438V	FNIP2_ENST00000379346.3_Missense_Mutation_p.L461V	NM_020840.1	NP_065891.1	Q9P278	FNIP2_HUMAN	folliculin interacting protein 2	438					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)	cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	9	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.00936)		TGCTGCCTTACTGACTGCGGT	0.483																																					p.L438V		Atlas-SNP	.											.	FNIP2	90	.	0			c.C1312G						.						133.0	128.0	129.0					4																	159782775		1984	4162	6146	SO:0001583	missense	57600	exon12			GCCTTACTGACTG	AB040883	CCDS47155.1	4q32.1	2012-10-31			ENSG00000052795	ENSG00000052795			29280	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 1"""	612768				18403135	Standard	NM_020840		Approved	KIAA1450, FNIPL, MAPO1	uc003iqe.4	Q9P278	OTTHUMG00000161983	ENST00000264433.6:c.1312C>G	chr4.hg19:g.159782775C>G	ENSP00000264433:p.Leu438Val	222.0	0.0		170.0	49.0	NM_020840	Q05DC3|Q96I31|Q9H994	Missense_Mutation	SNP	ENST00000264433.6	hg19	CCDS47155.1	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911778	0.52439	.	.	ENSG00000052795	ENST00000264433;ENST00000512986;ENST00000379346	T;T;T	0.34667	1.35;1.35;1.35	5.27	5.27	0.74061	.	.	.	.	.	T	0.42108	0.1188	L	0.51914	1.62	0.46149	D	0.998898	D	0.60575	0.988	P	0.56398	0.797	T	0.30387	-0.9980	8	.	.	.	.	5.6762	0.17749	0.1912:0.6902:0.0:0.1185	.	438	Q9P278	FNIP2_HUMAN	V	438;461;461	ENSP00000264433:L438V;ENSP00000421488:L461V;ENSP00000368651:L461V	.	L	+	1	2	FNIP2	160002225	0.882000	0.30256	1.000000	0.80357	0.982000	0.71751	0.729000	0.26028	2.636000	0.89361	0.467000	0.42956	CTG	.	.		0.483	FNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366602.1	NM_020840	
ADAMTS19	171019	hgsc.bcm.edu	37	5	128958013	128958013	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr5:128958013C>G	ENST00000274487.4	+	10	1869	c.1724C>G	c.(1723-1725)cCa>cGa	p.P575R	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	575	Disintegrin.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTTTTTGGGCCATTGGCTTCT	0.443																																					p.P575R		Atlas-SNP	.											ADAMTS19,right_upper_lobe,carcinoma,0,1	ADAMTS19	216	.	0			c.C1724G						.						142.0	121.0	128.0					5																	128958013		2203	4300	6503	SO:0001583	missense	171019	exon10			TTGGGCCATTGGC	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.1724C>G	chr5.hg19:g.128958013C>G	ENSP00000274487:p.Pro575Arg	247.0	0.0		241.0	55.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	C	11.88	1.769230	0.31320	.	.	ENSG00000145808	ENST00000274487	T	0.65178	-0.14	4.42	3.55	0.40652	.	0.078553	0.51477	D	0.000090	T	0.68007	0.2954	L	0.52759	1.655	0.49299	D	0.999779	D	0.63046	0.992	P	0.56434	0.798	T	0.68700	-0.5339	9	.	.	.	.	14.8773	0.70504	0.1449:0.8551:0.0:0.0	.	575	Q8TE59	ATS19_HUMAN	R	575	ENSP00000274487:P575R	.	P	+	2	0	ADAMTS19	128985912	0.994000	0.37717	0.890000	0.34922	0.299000	0.27559	3.939000	0.56591	1.452000	0.47756	-0.238000	0.12139	CCA	.	.		0.443	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
HAVCR1	26762	hgsc.bcm.edu	37	5	156479625	156479625	+	Silent	SNP	G	G	A	rs566987531		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr5:156479625G>A	ENST00000339252.3	-	3	952	c.420C>T	c.(418-420)acC>acT	p.T140T	HAVCR1_ENST00000522693.1_Silent_p.T140T|HAVCR1_ENST00000544197.1_Silent_p.T140T|HAVCR1_ENST00000523175.1_Silent_p.T140T|HAVCR1_ENST00000425854.1_Silent_p.T140T	NM_012206.2	NP_036338.2	Q96D42	HAVR1_HUMAN	hepatitis A virus cellular receptor 1	0	11 X 6 AA approximate tandem repeats of V-P-T-T-T-T].|Thr-rich.				viral process (GO:0016032)	integral component of membrane (GO:0016021)	virus receptor activity (GO:0001618)	p.T140T(1)		endometrium(3)|large_intestine(2)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.0999)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CAGTCGTGACGGTTGGAACAG	0.468													G|||	1	0.000199681	0.0	0.0	5008	,	,		22690	0.0		0.0	False		,,,				2504	0.001				p.T140T		Atlas-SNP	.											HAVCR1,NS,carcinoma,-1,1	HAVCR1	84	.	1	Substitution - coding silent(1)	lung(1)	c.C420T						.						406.0	402.0	403.0					5																	156479625		2140	4255	6395	SO:0001819	synonymous_variant	26762	exon4			CGTGACGGTTGGA	AF043724	CCDS43392.1	5q33.2	2014-01-14			ENSG00000113249	ENSG00000113249		"""Immunoglobulin superfamily / V-set domain containing"""	17866	protein-coding gene	gene with protein product	"""T-cell immunoglobulin mucin family member 1"""	606518				9658108, 11725301	Standard	NM_012206		Approved	HAVCR-1, TIM-1, TIM1, HAVCR, TIMD1	uc021ygj.1	Q96D42	OTTHUMG00000163466	ENST00000339252.3:c.420C>T	chr5.hg19:g.156479625G>A		308.0	0.0		296.0	21.0	NM_001099414	O43656	Silent	SNP	ENST00000339252.3	hg19	CCDS43392.1																																																																																			.	.		0.468	HAVCR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373698.1		
TULP1	7287	hgsc.bcm.edu	37	6	35471393	35471393	+	Silent	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr6:35471393G>A	ENST00000229771.6	-	13	1345	c.1266C>T	c.(1264-1266)acC>acT	p.T422T	TULP1_ENST00000322263.4_Silent_p.T369T	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	422					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						GAATGATGACGGTCATGCGCC	0.642																																					p.T422T	GBM(55;1027 1091 11115 23439)	Atlas-SNP	.											.	TULP1	51	.	0			c.C1266T						.						23.0	23.0	23.0					6																	35471393		2199	4299	6498	SO:0001819	synonymous_variant	7287	exon13			GATGACGGTCATG	U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.1266C>T	chr6.hg19:g.35471393G>A		81.0	0.0		56.0	13.0	NM_003322	O43536|Q5TGM5|Q8N571	Silent	SNP	ENST00000229771.6	hg19	CCDS4807.1																																																																																			.	.		0.642	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040307.2		
BAI3	577	hgsc.bcm.edu	37	6	69703824	69703824	+	Silent	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr6:69703824A>G	ENST00000370598.1	+	11	2720	c.1899A>G	c.(1897-1899)gcA>gcG	p.A633A		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	633					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				TTAAAAGGGCAAGTTACATCC	0.443																																					p.A633A		Atlas-SNP	.											BAI3,colon,carcinoma,+1,1	BAI3	451	.	0			c.A1899G						.						104.0	103.0	103.0					6																	69703824		2203	4300	6503	SO:0001819	synonymous_variant	577	exon11			AAGGGCAAGTTAC	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1899A>G	chr6.hg19:g.69703824A>G		92.0	0.0		94.0	28.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	ENST00000370598.1	hg19	CCDS4968.1																																																																																			.	.		0.443	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
LCA5	167691	hgsc.bcm.edu	37	6	80196750	80196750	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr6:80196750C>A	ENST00000392959.1	-	9	2676	c.2065G>T	c.(2065-2067)Gat>Tat	p.D689Y	LCA5_ENST00000369846.4_Missense_Mutation_p.D689Y	NM_181714.3	NP_859065.2	Q86VQ0	LCA5_HUMAN	Leber congenital amaurosis 5	689					intraciliary transport (GO:0042073)|photoreceptor cell maintenance (GO:0045494)|protein transport (GO:0015031)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	protein complex binding (GO:0032403)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(15)|prostate(2)|skin(1)	32		all_cancers(76;3.32e-05)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.0176)		BRCA - Breast invasive adenocarcinoma(397;0.0657)		TCAATTTCATCTTCTACAGAA	0.308																																					p.D689Y		Atlas-SNP	.											.	LCA5	71	.	0			c.G2065T						.						46.0	51.0	49.0					6																	80196750		2203	4300	6503	SO:0001583	missense	167691	exon8			TTTCATCTTCTAC		CCDS4990.1	6q14	2014-01-28			ENSG00000135338	ENSG00000135338			31923	protein-coding gene	gene with protein product	"""lebercilin"""	611408	"""chromosome 6 open reading frame 152"""	C6orf152		10631161, 17546029	Standard	NM_181714		Approved		uc003pix.3	Q86VQ0	OTTHUMG00000015080	ENST00000392959.1:c.2065G>T	chr6.hg19:g.80196750C>A	ENSP00000376686:p.Asp689Tyr	128.0	0.0		100.0	39.0	NM_001122769	E1P542|Q9BWX7	Missense_Mutation	SNP	ENST00000392959.1	hg19	CCDS4990.1	.	.	.	.	.	.	.	.	.	.	C	17.47	3.396518	0.62177	.	.	ENSG00000135338	ENST00000369846;ENST00000392959	T;T	0.51325	0.71;0.71	5.57	5.57	0.84162	.	0.371680	0.26463	N	0.024232	T	0.55449	0.1921	L	0.43923	1.385	0.48511	D	0.999661	D	0.76494	0.999	D	0.68483	0.958	T	0.58405	-0.7642	10	0.87932	D	0	-7.9575	18.5368	0.91013	0.0:1.0:0.0:0.0	.	689	Q86VQ0	LCA5_HUMAN	Y	689	ENSP00000358861:D689Y;ENSP00000376686:D689Y	ENSP00000358861:D689Y	D	-	1	0	LCA5	80253469	1.000000	0.71417	1.000000	0.80357	0.650000	0.38633	5.677000	0.68142	2.609000	0.88269	0.591000	0.81541	GAT	.	.		0.308	LCA5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000259269.1	NM_181714	
MOXD1	26002	hgsc.bcm.edu	37	6	132649562	132649562	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr6:132649562C>A	ENST00000367963.3	-	5	953	c.835G>T	c.(835-837)Ggt>Tgt	p.G279C	MOXD1_ENST00000336749.3_Missense_Mutation_p.G211C	NM_015529.2	NP_056344.2	Q6UVY6	MOXD1_HUMAN	monooxygenase, DBH-like 1	279						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(3)|skin(1)	37	Breast(56;0.0495)			OV - Ovarian serous cystadenocarcinoma(155;0.0132)|GBM - Glioblastoma multiforme(226;0.0191)		ACCTCTCCACCAATAGCCCAG	0.438																																					p.G279C		Atlas-SNP	.											.	MOXD1	136	.	0			c.G835T						.						90.0	84.0	86.0					6																	132649562		2203	4300	6503	SO:0001583	missense	26002	exon5			CTCCACCAATAGC	AY007239	CCDS5152.2	6q23.2	2010-09-24			ENSG00000079931	ENSG00000079931			21063	protein-coding gene	gene with protein product		609000				9751809	Standard	XM_006715456		Approved	DKFZP564G202, MOX, dJ248E1.1	uc003qdf.3	Q6UVY6	OTTHUMG00000055853	ENST00000367963.3:c.835G>T	chr6.hg19:g.132649562C>A	ENSP00000356940:p.Gly279Cys	119.0	0.0		102.0	5.0	NM_015529	Q5THU6|Q8NC97|Q8WV49|Q9H4M6|Q9Y4U3	Missense_Mutation	SNP	ENST00000367963.3	hg19	CCDS5152.2	.	.	.	.	.	.	.	.	.	.	C	23.1	4.378714	0.82682	.	.	ENSG00000079931	ENST00000367963;ENST00000336749	T;T	0.66995	-0.24;-0.24	4.82	4.82	0.62117	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.000000	0.85682	D	0.000000	D	0.85995	0.5827	H	0.95645	3.7	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.975	D	0.90421	0.4417	10	0.87932	D	0	-22.6453	18.2459	0.89985	0.0:1.0:0.0:0.0	.	279;211	Q6UVY6;Q6UVY6-2	MOXD1_HUMAN;.	C	279;211	ENSP00000356940:G279C;ENSP00000336998:G211C	ENSP00000336998:G211C	G	-	1	0	MOXD1	132691255	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.470000	0.73558	2.376000	0.81061	0.650000	0.86243	GGT	.	.		0.438	MOXD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000125837.1	NM_015529	
TIAM2	26230	hgsc.bcm.edu	37	6	155498016	155498016	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr6:155498016A>T	ENST00000461783.3	+	12	3701	c.2428A>T	c.(2428-2430)Atc>Ttc	p.I810F	TIAM2_ENST00000367174.2_Missense_Mutation_p.I186F|TIAM2_ENST00000360366.4_Missense_Mutation_p.I834F|TIAM2_ENST00000456877.2_Missense_Mutation_p.I122F|TIAM2_ENST00000529824.2_Missense_Mutation_p.I810F|TIAM2_ENST00000456144.1_Missense_Mutation_p.I810F|TIAM2_ENST00000528391.2_Missense_Mutation_p.I146F|TIAM2_ENST00000318981.5_Missense_Mutation_p.I810F			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	810	RBD. {ECO:0000255|PROSITE- ProRule:PRU00262}.				apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		TGCATGGGAAATCCAGACTTA	0.428																																					p.I810F		Atlas-SNP	.											.	TIAM2	161	.	0			c.A2428T						.						181.0	157.0	165.0					6																	155498016		2203	4300	6503	SO:0001583	missense	26230	exon9			TGGGAAATCCAGA		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.2428A>T	chr6.hg19:g.155498016A>T	ENSP00000437188:p.Ile810Phe	99.0	0.0		71.0	37.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	hg19	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	A	9.712	1.157235	0.21454	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000367174;ENST00000360366;ENST00000529824;ENST00000456877;ENST00000528391	T;T;T;T;T;T;T;T;T	0.05382	3.62;3.52;3.59;3.62;3.46;3.63;3.59;3.45;3.46	5.55	-2.7	0.06004	Raf-like Ras-binding (2);	1.088580	0.06944	N	0.813320	T	0.01092	0.0036	N	0.08118	0	0.09310	N	1	B;B;B;B	0.29432	0.006;0.244;0.113;0.158	B;B;B;B	0.32022	0.139;0.127;0.127;0.06	T	0.49082	-0.8976	10	0.56958	D	0.05	.	6.4663	0.21983	0.4947:0.1313:0.3741:0.0	.	146;810;834;810	E9PKT1;Q8IVF5-2;Q8IVF5-5;Q8IVF5	.;.;.;TIAM2_HUMAN	F	810;1056;810;810;810;186;834;810;122;146	ENSP00000437188:I810F;ENSP00000434901:I810F;ENSP00000407746:I810F;ENSP00000327315:I810F;ENSP00000356142:I186F;ENSP00000353528:I834F;ENSP00000433348:I810F;ENSP00000407183:I122F;ENSP00000435335:I146F	ENSP00000327315:I810F	I	+	1	0	TIAM2	155539708	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.365000	0.20348	-0.644000	0.05465	-0.291000	0.09656	ATC	.	.		0.428	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
HECW1	23072	hgsc.bcm.edu	37	7	43484273	43484273	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr7:43484273A>G	ENST00000395891.2	+	11	2107	c.1502A>G	c.(1501-1503)gAa>gGa	p.E501G	HECW1_ENST00000453890.1_Missense_Mutation_p.E501G	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	501	Glu-rich.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						GGAAGggaagaagaggagaag	0.632																																					p.E501G		Atlas-SNP	.											.	HECW1	540	.	0			c.A1502G						.						21.0	25.0	24.0					7																	43484273		2075	4202	6277	SO:0001583	missense	23072	exon11			GGGAAGAAGAGGA	AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.1502A>G	chr7.hg19:g.43484273A>G	ENSP00000379228:p.Glu501Gly	93.0	0.0		96.0	8.0	NM_015052	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	ENST00000395891.2	hg19	CCDS5469.2	.	.	.	.	.	.	.	.	.	.	A	13.71	2.317151	0.40996	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	T;T	0.33654	1.43;1.4	5.12	-4.16	0.03869	.	2.657370	0.00797	N	0.001399	T	0.17023	0.0409	N	0.08118	0	0.09310	N	1	B;B	0.19817	0.039;0.02	B;B	0.19148	0.014;0.024	T	0.18871	-1.0323	10	0.56958	D	0.05	.	1.5496	0.02572	0.3463:0.0936:0.1435:0.4165	.	501;501	B4DH42;Q76N89	.;HECW1_HUMAN	G	501	ENSP00000379228:E501G;ENSP00000407774:E501G	ENSP00000265522:E501G	E	+	2	0	HECW1	43450798	.	.	0.001000	0.08648	0.130000	0.20726	.	.	-0.304000	0.08843	0.459000	0.35465	GAA	.	.		0.632	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250893.2	NM_015052	
SEMA3D	223117	hgsc.bcm.edu	37	7	84628838	84628838	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr7:84628838T>G	ENST00000284136.6	-	17	2295	c.2252A>C	c.(2251-2253)aAg>aCg	p.K751T	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	751	Arg/Lys-rich (basic).				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CTGCATGTGCTTCCACTTTGG	0.483																																					p.K751T	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.A2252C						.						176.0	145.0	155.0					7																	84628838		2203	4300	6503	SO:0001583	missense	223117	exon17			ATGTGCTTCCACT	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.2252A>C	chr7.hg19:g.84628838T>G	ENSP00000284136:p.Lys751Thr	319.0	0.0		313.0	84.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Missense_Mutation	SNP	ENST00000284136.6	hg19	CCDS34676.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.252452	0.80135	.	.	ENSG00000153993	ENST00000284136	T	0.35605	1.3	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.57388	0.2050	M	0.69823	2.125	0.80722	D	1	D	0.69078	0.997	P	0.60789	0.879	T	0.61038	-0.7143	10	0.72032	D	0.01	.	16.3798	0.83452	0.0:0.0:0.0:1.0	.	751	O95025	SEM3D_HUMAN	T	751	ENSP00000284136:K751T	ENSP00000284136:K751T	K	-	2	0	SEMA3D	84466774	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.718000	0.68455	2.271000	0.75665	0.533000	0.62120	AAG	.	.		0.483	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
ST18	9705	hgsc.bcm.edu	37	8	53085080	53085080	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr8:53085080C>T	ENST00000276480.7	-	10	1024	c.341G>A	c.(340-342)aGg>aAg	p.R114K		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	114					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				GTCTTCCTTCCTACTGGAGTT	0.348																																					p.R114K		Atlas-SNP	.											.	ST18	212	.	0			c.G341A						.						40.0	42.0	41.0					8																	53085080		2201	4299	6500	SO:0001583	missense	9705	exon10			TCCTTCCTACTGG	AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.341G>A	chr8.hg19:g.53085080C>T	ENSP00000276480:p.Arg114Lys	38.0	0.0		66.0	8.0	NM_014682	Q17RY1	Missense_Mutation	SNP	ENST00000276480.7	hg19	CCDS6149.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.509475	0.00984	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.41400	1.01;1.0	5.25	-2.92	0.05615	.	1.019870	0.07799	N	0.956216	T	0.21062	0.0507	L	0.36672	1.1	0.09310	N	1	B	0.14012	0.009	B	0.09377	0.004	T	0.30416	-0.9979	10	0.05959	T	0.93	0.0851	0.058	0.00014	0.2876:0.18:0.209:0.3233	.	114	O60284	ST18_HUMAN	K	114	ENSP00000276480:R114K;ENSP00000428521:R114K	ENSP00000276480:R114K	R	-	2	0	ST18	53247633	0.005000	0.15991	0.005000	0.12908	0.275000	0.26752	-0.078000	0.11375	-0.558000	0.06118	-0.345000	0.07892	AGG	.	.		0.348	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377867.1		
ARHGAP39	80728	hgsc.bcm.edu	37	8	145773562	145773562	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr8:145773562G>A	ENST00000276826.5	-	4	1109	c.908C>T	c.(907-909)tCc>tTc	p.S303F	ARHGAP39_ENST00000528810.1_5'Flank|ARHGAP39_ENST00000540274.1_Missense_Mutation_p.S303F|ARHGAP39_ENST00000377307.2_Missense_Mutation_p.S303F			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	303	Pro-rich.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						ATAGCGCGGGGAGGAGGGCTG	0.682																																					p.S303F		Atlas-SNP	.											ARHGAP39,NS,carcinoma,0,1	ARHGAP39	80	.	0			c.C908T						.						16.0	21.0	19.0					8																	145773562		2184	4270	6454	SO:0001583	missense	80728	exon6			CGCGGGGAGGAGG		CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.908C>T	chr8.hg19:g.145773562G>A	ENSP00000276826:p.Ser303Phe	66.0	0.0		62.0	11.0	NM_025251	B4E1I1	Missense_Mutation	SNP	ENST00000276826.5	hg19		.	.	.	.	.	.	.	.	.	.	G	21.2	4.107293	0.77096	.	.	ENSG00000147799	ENST00000276826;ENST00000377307;ENST00000540274	T;T;T	0.80653	-1.4;-1.13;-1.4	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	D	0.88358	0.6415	L	0.61218	1.895	0.51767	D	0.999931	D;D	0.89917	0.999;1.0	D;D	0.91635	0.997;0.999	D	0.89311	0.3633	10	0.87932	D	0	-5.6595	16.5924	0.84770	0.0:0.0:1.0:0.0	.	303;303	Q9C0H5;Q9C0H5-2	RHG39_HUMAN;.	F	303	ENSP00000276826:S303F;ENSP00000366522:S303F;ENSP00000445075:S303F	ENSP00000276826:S303F	S	-	2	0	ARHGAP39	145744370	1.000000	0.71417	0.996000	0.52242	0.719000	0.41307	9.646000	0.98474	2.513000	0.84729	0.655000	0.94253	TCC	.	.		0.682	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000382509.1		
GLDC	2731	hgsc.bcm.edu	37	9	6592200	6592200	+	Silent	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr9:6592200T>C	ENST00000321612.6	-	11	1575	c.1425A>G	c.(1423-1425)acA>acG	p.T475T		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	475					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	TTTCATTGACTGTTTCATCAA	0.373																																					p.T475T		Atlas-SNP	.											.	GLDC	118	.	0			c.A1425G						.						86.0	79.0	82.0					9																	6592200		2203	4300	6503	SO:0001819	synonymous_variant	2731	exon11			ATTGACTGTTTCA	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1425A>G	chr9.hg19:g.6592200T>C		69.0	0.0		46.0	21.0	NM_000170	Q2M2F8	Silent	SNP	ENST00000321612.6	hg19	CCDS34987.1																																																																																			.	.		0.373	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
ZFAND5	7763	hgsc.bcm.edu	37	9	74970914	74970914	+	Silent	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr9:74970914T>C	ENST00000237937.3	-	6	1154	c.597A>G	c.(595-597)agA>agG	p.R199R	ZFAND5_ENST00000488164.1_5'UTR|ZFAND5_ENST00000343431.2_Silent_p.R199R|ZFAND5_ENST00000376960.4_Silent_p.R199R|ZFAND5_ENST00000376962.5_Silent_p.R199R	NM_001102421.1|NM_001278243.1|NM_001278244.1|NM_001278245.1|NM_006007.2	NP_001095891.1|NP_001265172.1|NP_001265173.1|NP_001265174.1|NP_005998.1	O76080	ZFAN5_HUMAN	zinc finger, AN1-type domain 5	199					face development (GO:0060324)|fibroblast migration (GO:0010761)|in utero embryonic development (GO:0001701)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|respiratory system process (GO:0003016)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			cervix(1)|kidney(2)|lung(2)|prostate(1)	6						GATTCTCTTTTCTGATTTTTG	0.353																																					p.R199R		Atlas-SNP	.											.	ZFAND5	14	.	0			c.A597G						.						66.0	64.0	65.0					9																	74970914		2202	4296	6498	SO:0001819	synonymous_variant	7763	exon6			CTCTTTTCTGATT	AF062072	CCDS6642.1	9q13-q21	2008-05-02	2006-07-07	2006-07-07	ENSG00000107372	ENSG00000107372		"""Zinc fingers, AN1-type domain containing"""	13008	protein-coding gene	gene with protein product		604761	"""zinc finger protein 216"", ""zinc finger, A20 domain containing 2"""	ZNF216, ZA20D2		9758550	Standard	NM_001278243		Approved	ZFAND5A	uc004aiy.2	O76080	OTTHUMG00000020008	ENST00000237937.3:c.597A>G	chr9.hg19:g.74970914T>C		281.0	0.0		161.0	40.0	NM_001102421	A8K484	Silent	SNP	ENST00000237937.3	hg19	CCDS6642.1																																																																																			.	.		0.353	ZFAND5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052644.1		
SWI5	375757	hgsc.bcm.edu	37	9	131038585	131038585	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr9:131038585C>T	ENST00000320188.5	+	1	161	c.161C>T	c.(160-162)cCg>cTg	p.P54L	SWI5_ENST00000418976.1_5'UTR|SWI5_ENST00000419867.2_5'UTR|GOLGA2_ENST00000609374.1_5'Flank|SWI5_ENST00000495313.1_Intron|GOLGA2_ENST00000490628.1_5'Flank|SWI5_ENST00000608796.1_5'UTR|GOLGA2_ENST00000421699.2_5'Flank	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	54					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											GTTCCTGGCCCGGTGCACCTG	0.701																																					p.P54L		Atlas-SNP	.											.	.	.	.	0			c.C161T						.						12.0	16.0	15.0					9																	131038585		1897	4094	5991	SO:0001583	missense	375757	exon1			CTGGCCCGGTGCA	BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.161C>T	chr9.hg19:g.131038585C>T	ENSP00000316609:p.Pro54Leu	134.0	0.0		82.0	29.0	NM_001040011	Q5SYX7|Q5SYX8|Q8N2W6	Missense_Mutation	SNP	ENST00000320188.5	hg19	CCDS43883.1	.	.	.	.	.	.	.	.	.	.	C	8.905	0.957255	0.18507	.	.	ENSG00000175854	ENST00000320188	.	.	.	4.02	-6.8	0.01709	.	4.315320	0.00714	N	0.000843	T	0.17746	0.0426	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31110	-0.9955	9	0.72032	D	0.01	.	5.9106	0.19027	0.0:0.3824:0.2663:0.3513	.	54	Q1ZZU3	SWI5_HUMAN	L	54	.	ENSP00000316609:P54L	P	+	2	0	SWI5	130078406	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.550000	0.00929	-0.855000	0.04125	-1.155000	0.01812	CCG	.	.		0.701	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001040011	
COMMD3	23412	hgsc.bcm.edu	37	10	22606855	22606855	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr10:22606855A>G	ENST00000376836.3	+	2	626	c.182A>G	c.(181-183)cAt>cGt	p.H61R	COMMD3-BMI1_ENST00000602390.1_Missense_Mutation_p.H61R|COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3_ENST00000483684.1_3'UTR	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	61										kidney(2)|lung(2)|ovary(1)	5						GTTTTAAAACATTGTCATGCA	0.353																																					p.H61R		Atlas-SNP	.											.	.	.	.	0			c.A182G						.						88.0	96.0	94.0					10																	22606855		2203	4300	6503	SO:0001583	missense	0	exon2			TAAAACATTGTCA	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.182A>G	chr10.hg19:g.22606855A>G	ENSP00000366032:p.His61Arg	296.0	0.0		193.0	69.0	NM_001204062	D3DRU7|Q5T8Y9	Missense_Mutation	SNP	ENST00000376836.3	hg19	CCDS7137.1	.	.	.	.	.	.	.	.	.	.	A	18.92	3.725088	0.68959	.	.	ENSG00000148444	ENST00000376836;ENST00000376776;ENST00000376787	T	0.09817	2.94	5.9	5.9	0.94986	.	0.101640	0.64402	D	0.000001	T	0.15176	0.0366	L	0.46157	1.445	0.80722	D	1	P;B	0.43231	0.801;0.288	B;B	0.43360	0.417;0.159	T	0.00870	-1.1533	10	0.44086	T	0.13	-23.1962	15.993	0.80220	1.0:0.0:0.0:0.0	.	61;61	Q9UBI1;E9PC68	COMD3_HUMAN;.	R	61	ENSP00000366032:H61R	ENSP00000365968:H61R	H	+	2	0	COMMD3	22646861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.756000	0.74919	2.248000	0.74166	0.459000	0.35465	CAT	.	.		0.353	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
OR51S1	119692	hgsc.bcm.edu	37	11	4869815	4869815	+	Silent	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr11:4869815A>G	ENST00000322101.2	-	1	699	c.624T>C	c.(622-624)ttT>ttC	p.F208F	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		AAAGAACCACAAATAGGCTGT	0.532																																					p.F208F		Atlas-SNP	.											.	OR51S1	83	.	0			c.T624C						.						80.0	85.0	83.0					11																	4869815		2201	4298	6499	SO:0001819	synonymous_variant	119692	exon1			AACCACAAATAGG	AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.624T>C	chr11.hg19:g.4869815A>G		90.0	0.0		46.0	16.0	NM_001004758	B9EGZ1|Q6IFI2	Silent	SNP	ENST00000322101.2	hg19	CCDS31362.1																																																																																			.	.		0.532	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142179.1	NM_001004758	
HOXC9	3225	hgsc.bcm.edu	37	12	54394044	54394044	+	Silent	SNP	A	A	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr12:54394044A>G	ENST00000303450.4	+	1	142	c.72A>G	c.(70-72)ctA>ctG	p.L24L	HOXC-AS1_ENST00000505700.1_RNA|HOXC9_ENST00000504557.1_Intron|HOXC9_ENST00000508190.1_Silent_p.L24L|HOXC-AS1_ENST00000512427.1_RNA|RP11-834C11.12_ENST00000513209.1_Intron	NM_006897.1	NP_008828.1	P31274	HXC9_HUMAN	homeobox C9	24					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(3)|liver(1)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14						AAGACCTCCTAGCGTCCAGGT	0.577																																					p.L24L		Atlas-SNP	.											.	HOXC9	25	.	0			c.A72G						.						54.0	55.0	54.0					12																	54394044		2203	4300	6503	SO:0001819	synonymous_variant	3225	exon1			CCTCCTAGCGTCC		CCDS8869.1	12q13.13	2011-06-20	2005-12-22			ENSG00000180806		"""Homeoboxes / ANTP class : HOXL subclass"""	5130	protein-coding gene	gene with protein product		142971	"""homeo box C9"""	HOX3, HOX3B		1973146	Standard	NM_006897		Approved		uc001seq.3	P31274		ENST00000303450.4:c.72A>G	chr12.hg19:g.54394044A>G		133.0	0.0		110.0	27.0	NM_006897	B2RCN7|Q9H1I0	Silent	SNP	ENST00000303450.4	hg19	CCDS8869.1																																																																																			.	.		0.577	HOXC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358958.1		
NOS1	4842	hgsc.bcm.edu	37	12	117658021	117658022	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr12:117658021_117658022GG>TT	ENST00000338101.4	-	27	4134_4135	c.4130_4131CC>AA	c.(4129-4131)gCC>gAA	p.A1377E	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.A1343E			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GCTCCTTCAGGGCTCGGTACAC	0.604																																					p.A1377A|p.A1377D	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.C4131A|c.C4130A						.																																			SO:0001583	missense	4842	exon28			CTTCAGGGCTCGG|TTCAGGGCTCGGT		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.4130_4131delinsTT	chr12.hg19:g.117658021_117658022delinsTT	ENSP00000337459:p.Ala1377Glu	60.0	0.0		41.0|40.0	11.0	NM_001204218		Silent|Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1																																																																																			.	.		0.604	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
WASF3	10810	hgsc.bcm.edu	37	13	27255234	27255234	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr13:27255234C>T	ENST00000335327.5	+	8	938	c.760C>T	c.(760-762)Ccc>Tcc	p.P254S	WASF3_ENST00000361042.4_Missense_Mutation_p.P251S	NM_006646.5	NP_006637.2	Q9UPY6	WASF3_HUMAN	WAS protein family, member 3	254					actin filament polymerization (GO:0030041)|cytoskeleton organization (GO:0007010)|lamellipodium assembly (GO:0030032)|oligodendrocyte development (GO:0014003)|positive regulation of myelination (GO:0031643)|protein complex assembly (GO:0006461)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)				breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|pancreas(1)|prostate(2)|skin(2)	22	Colorectal(5;0.000247)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.0114)|Epithelial(112;0.046)|OV - Ovarian serous cystadenocarcinoma(117;0.0547)|Lung(94;0.105)|LUSC - Lung squamous cell carcinoma(192;0.155)		CCCGGCTACTCCCAACCATTC	0.522																																					p.P254S		Atlas-SNP	.											.	WASF3	68	.	0			c.C760T						.						89.0	98.0	95.0					13																	27255234		2203	4300	6503	SO:0001583	missense	10810	exon8			GCTACTCCCAACC	AB020707	CCDS9318.1	13q12	2008-06-23			ENSG00000132970	ENSG00000132970			12734	protein-coding gene	gene with protein product		605068				10381382	Standard	NM_006646		Approved	WAVE3, SCAR3, KIAA0900	uc001uqv.3	Q9UPY6	OTTHUMG00000016621	ENST00000335327.5:c.760C>T	chr13.hg19:g.27255234C>T	ENSP00000335055:p.Pro254Ser	209.0	0.0		107.0	32.0	NM_006646	O94974|Q86VQ2	Missense_Mutation	SNP	ENST00000335327.5	hg19	CCDS9318.1	.	.	.	.	.	.	.	.	.	.	C	19.62	3.860878	0.71834	.	.	ENSG00000132970	ENST00000361042;ENST00000335327	T;T	0.46451	0.87;0.88	5.94	5.94	0.96194	.	0.138542	0.64402	D	0.000003	T	0.45756	0.1358	M	0.69358	2.11	0.58432	D	0.999998	B;P	0.37141	0.434;0.584	B;B	0.34242	0.178;0.113	T	0.38499	-0.9658	10	0.37606	T	0.19	-29.0501	20.345	0.98787	0.0:1.0:0.0:0.0	.	251;254	Q86VQ2;Q9UPY6	.;WASF3_HUMAN	S	251;254	ENSP00000354325:P251S;ENSP00000335055:P254S	ENSP00000335055:P254S	P	+	1	0	WASF3	26153234	1.000000	0.71417	0.972000	0.41901	0.909000	0.53808	5.919000	0.70005	2.817000	0.96982	0.555000	0.69702	CCC	.	.		0.522	WASF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044258.1		
SYNE2	23224	hgsc.bcm.edu	37	14	64497758	64497758	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr14:64497758C>T	ENST00000344113.4	+	45	7116	c.6904C>T	c.(6904-6906)Caa>Taa	p.Q2302*	SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Nonsense_Mutation_p.Q2302*|SYNE2_ENST00000358025.3_Nonsense_Mutation_p.Q2302*	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2302					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		ACTCAGTTTACAAGATGGCAC	0.328																																					p.Q2302X		Atlas-SNP	.											.	SYNE2	577	.	0			c.C6904T						.						80.0	78.0	78.0					14																	64497758		1819	4082	5901	SO:0001587	stop_gained	23224	exon45			AGTTTACAAGATG	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6904C>T	chr14.hg19:g.64497758C>T	ENSP00000341781:p.Gln2302*	393.0	1.0		258.0	85.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Nonsense_Mutation	SNP	ENST00000344113.4	hg19	CCDS41963.1	.	.	.	.	.	.	.	.	.	.	C	47	12.964400	0.99709	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	.	.	.	5.1	4.09	0.47781	.	0.468222	0.18438	N	0.141239	.	.	.	.	.	.	0.18873	N	0.999983	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	7.5303	0.27679	0.209:0.7009:0.0:0.0901	.	.	.	.	X	2302	.	ENSP00000261678:Q2302X	Q	+	1	0	SYNE2	63567511	0.968000	0.33430	0.939000	0.37840	0.986000	0.74619	0.565000	0.23578	2.521000	0.84997	0.462000	0.41574	CAA	.	.		0.328	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
ZNF770	54989	hgsc.bcm.edu	37	15	35274530	35274530	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr15:35274530C>T	ENST00000356321.4	-	3	1450	c.1106G>A	c.(1105-1107)tGt>tAt	p.C369Y		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	369					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		AATAAGATCACAATTTCTCAA	0.338																																					p.C369Y		Atlas-SNP	.											.	ZNF770	64	.	0			c.G1106A						.						27.0	30.0	29.0					15																	35274530		2193	4290	6483	SO:0001583	missense	54989	exon3			AGATCACAATTTC	BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1106G>A	chr15.hg19:g.35274530C>T	ENSP00000348673:p.Cys369Tyr	128.0	0.0		77.0	19.0	NM_014106	Q6ZMZ6|Q9NWV2	Missense_Mutation	SNP	ENST00000356321.4	hg19	CCDS10042.1	.	.	.	.	.	.	.	.	.	.	C	0	-2.771374	0.00081	.	.	ENSG00000198146	ENST00000356321	T	0.08984	3.03	5.31	0.274	0.15654	.	0.867998	0.09875	N	0.744450	T	0.05593	0.0147	N	0.19112	0.55	0.09310	N	0.999994	B	0.06786	0.001	B	0.04013	0.001	T	0.39800	-0.9596	10	0.48119	T	0.1	2.3486	6.8583	0.24052	0.0:0.4639:0.1212:0.4149	.	369	Q6IQ21	ZN770_HUMAN	Y	369	ENSP00000348673:C369Y	ENSP00000348673:C369Y	C	-	2	0	ZNF770	33061822	0.000000	0.05858	0.004000	0.12327	0.797000	0.45037	-0.938000	0.03938	-0.082000	0.12640	-0.126000	0.14955	TGT	.	.		0.338	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251896.2	NM_014106	
DUOXA1	90527	hgsc.bcm.edu	37	15	45413291	45413291	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr15:45413291G>C	ENST00000560572.1	-	3	339	c.334C>G	c.(334-336)Ctc>Gtc	p.L112V	DUOXA1_ENST00000267803.4_Missense_Mutation_p.L112V|DUOXA1_ENST00000430224.2_Intron|DUOXA1_ENST00000559014.1_Missense_Mutation_p.L112V|DUOXA1_ENST00000558422.1_Intron|DUOXA1_ENST00000558996.1_Intron	NM_001276266.1	NP_001263195.1	Q1HG43	DOXA1_HUMAN	dual oxidase maturation factor 1	112					hydrogen peroxide metabolic process (GO:0042743)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(109;6.02e-08)|all_epithelial(112;1.83e-06)|Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;3.82e-18)|GBM - Glioblastoma multiforme(94;4.39e-07)|COAD - Colon adenocarcinoma(120;0.0676)|Colorectal(133;0.0686)		TCACCTGTGAGTGTGATGTTG	0.557																																					p.L112V		Atlas-SNP	.											.	DUOXA1	32	.	0			c.C334G						.						100.0	67.0	78.0					15																	45413291		2198	4298	6496	SO:0001583	missense	90527	exon6			CTGTGAGTGTGAT	BC029819	CCDS10119.1, CCDS61619.1, CCDS61620.1, CCDS61621.1	15q21.1	2006-11-29	2006-01-23	2006-07-25	ENSG00000140254	ENSG00000140254			26507	protein-coding gene	gene with protein product		612771				16651268	Standard	NM_144565		Approved	FLJ32334, NUMBIP, NIP, mol	uc010bec.4	Q1HG43	OTTHUMG00000131352	ENST00000560572.1:c.334C>G	chr15.hg19:g.45413291G>C	ENSP00000454084:p.Leu112Val	115.0	0.0		110.0	37.0	NM_144565	Q8N6K9|Q96MI4	Missense_Mutation	SNP	ENST00000560572.1	hg19		.	.	.	.	.	.	.	.	.	.	G	15.98	2.992171	0.54041	.	.	ENSG00000140254	ENST00000267803	T	0.69806	-0.43	5.11	4.18	0.49190	.	0.067850	0.64402	D	0.000010	D	0.83046	0.5169	M	0.87547	2.89	0.45995	D	0.998801	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.85935	0.1454	10	0.62326	D	0.03	-23.9957	13.8867	0.63712	0.0:0.0:0.8349:0.1651	.	112;112	Q1HG43;A8K9Q6	DOXA1_HUMAN;.	V	112	ENSP00000267803:L112V	ENSP00000267803:L112V	L	-	1	0	DUOXA1	43200583	1.000000	0.71417	0.874000	0.34290	0.438000	0.31896	5.000000	0.63940	1.349000	0.45751	-0.284000	0.09977	CTC	.	.		0.557	DUOXA1-005	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000416242.1	NM_144565	
DIS3L	115752	hgsc.bcm.edu	37	15	66604085	66604085	+	Silent	SNP	T	T	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr15:66604085T>A	ENST00000319212.4	+	5	632	c.582T>A	c.(580-582)ccT>ccA	p.P194P	DIS3L_ENST00000319194.5_Silent_p.P111P|DIS3L_ENST00000441424.2_Silent_p.P60P	NM_001143688.1	NP_001137160.1	Q8TF46	DI3L1_HUMAN	DIS3 like exosome 3'-5' exoribonuclease	194					RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)	cytoplasmic exosome (RNase complex) (GO:0000177)	3'-5'-exoribonuclease activity (GO:0000175)|enzyme binding (GO:0019899)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	33						ATTTCTGGCCTGATTTAAAAG	0.453																																					p.P194P		Atlas-SNP	.											.	DIS3L	175	.	0			c.T582A						.						119.0	121.0	120.0					15																	66604085		2201	4299	6500	SO:0001819	synonymous_variant	115752	exon5			CTGGCCTGATTTA		CCDS10214.1, CCDS45286.1	15q22.31	2014-03-05	2014-03-05		ENSG00000166938	ENSG00000166938			28698	protein-coding gene	gene with protein product		614183	"""DIS3 mitotic control homolog (S. cerevisiae)-like"""			20531386	Standard	NM_001143688		Approved	MGC4562, FLJ38088, KIAA1955, DIS3L1	uc010ujm.2	Q8TF46	OTTHUMG00000133181	ENST00000319212.4:c.582T>A	chr15.hg19:g.66604085T>A		63.0	0.0		30.0	12.0	NM_001143688	Q8N1N8|Q8WTU9|Q96CM7	Silent	SNP	ENST00000319212.4	hg19	CCDS45286.1																																																																																			.	.		0.453	DIS3L-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382792.2	NM_133375	
FBXL16	146330	hgsc.bcm.edu	37	16	745857	745857	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr16:745857C>A	ENST00000397621.1	-	3	1031	c.700G>T	c.(700-702)Gcc>Tcc	p.A234S	FBXL16_ENST00000562563.1_Missense_Mutation_p.A22S|FBXL16_ENST00000324361.5_Missense_Mutation_p.A234S|FBXL16_ENST00000562585.1_5'Flank	NM_153350.3	NP_699181.2	Q8N461	FXL16_HUMAN	F-box and leucine-rich repeat protein 16	234										endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|ovary(1)	10		Hepatocellular(780;0.0218)				CACAGCCCGGCCTCGGTGAAG	0.667																																					p.A234S		Atlas-SNP	.											.	FBXL16	25	.	0			c.G700T						.						27.0	27.0	27.0					16																	745857		2199	4288	6487	SO:0001583	missense	146330	exon3			GCCCGGCCTCGGT	BC036680	CCDS10421.1	16p13.3	2011-06-09	2004-06-15	2004-06-16	ENSG00000127585	ENSG00000127585		"""F-boxes / Leucine-rich repeats"""	14150	protein-coding gene	gene with protein product		609082	"""chromosome 16 open reading frame 22"""	C16orf22		11157797	Standard	NM_153350		Approved	MGC33974, Fbl16	uc021taa.1	Q8N461	OTTHUMG00000090420	ENST00000397621.1:c.700G>T	chr16.hg19:g.745857C>A	ENSP00000380746:p.Ala234Ser	195.0	0.0		111.0	47.0	NM_153350	B3KR59|D3DU60|Q2MHR2|Q96S14|Q9UJI0	Missense_Mutation	SNP	ENST00000397621.1	hg19	CCDS10421.1	.	.	.	.	.	.	.	.	.	.	c	16.81	3.225517	0.58668	.	.	ENSG00000127585	ENST00000397621;ENST00000324361	T;T	0.16457	2.34;2.34	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	T	0.35068	0.0919	L	0.56199	1.76	0.58432	D	0.999994	D	0.76494	0.999	D	0.70016	0.967	T	0.01810	-1.1269	10	0.22109	T	0.4	.	16.7252	0.85419	0.0:1.0:0.0:0.0	.	234	Q8N461	FXL16_HUMAN	S	234	ENSP00000380746:A234S;ENSP00000318674:A234S	ENSP00000318674:A234S	A	-	1	0	FBXL16	685858	1.000000	0.71417	0.943000	0.38184	0.962000	0.63368	5.811000	0.69187	2.529000	0.85273	0.561000	0.74099	GCC	.	.		0.667	FBXL16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206851.2	NM_153350	
PDF	64146	hgsc.bcm.edu	37	16	69363005	69363005	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr16:69363005G>T	ENST00000288022.1	-	2	676	c.652C>A	c.(652-654)Cac>Aac	p.H218N	RP11-343C2.12_ENST00000562949.1_Silent_p.T143T|COG8_ENST00000306875.4_3'UTR|COG8_ENST00000564419.1_5'Flank	NM_022341.1	NP_071736.1	Q9HBH1	DEFM_HUMAN	peptide deformylase (mitochondrial)	218					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|positive regulation of cell proliferation (GO:0008284)|translation (GO:0006412)	mitochondrion (GO:0005739)	iron ion binding (GO:0005506)|peptide deformylase activity (GO:0042586)			NS(1)|prostate(1)	2						CCCTGCAGGTGGTCCATCTCG	0.552																																					p.H218N		Atlas-SNP	.											.	PDF	4	.	0			c.C652A						.						93.0	82.0	86.0					16																	69363005		2198	4300	6498	SO:0001583	missense	64146	exon2			GCAGGTGGTCCAT	AF239156	CCDS10875.1	16q22.1	2008-02-05				ENSG00000258429	3.5.1.88		30012	protein-coding gene	gene with protein product						11060042, 15489958	Standard	NM_022341		Approved		uc002ewx.1	Q9HBH1		ENST00000288022.1:c.652C>A	chr16.hg19:g.69363005G>T	ENSP00000288022:p.His218Asn	83.0	0.0		67.0	23.0	NM_022341	Q8WUN6	Missense_Mutation	SNP	ENST00000288022.1	hg19	CCDS10875.1	.	.	.	.	.	.	.	.	.	.	g	28.2	4.900835	0.92035	.	.	ENSG00000258429	ENST00000288022	T	0.75477	-0.94	4.95	3.96	0.45880	Peptide deformylase (3);	0.000000	0.85682	U	0.000000	D	0.91781	0.7400	H	0.99074	4.42	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94588	0.7785	10	0.87932	D	0	.	14.1757	0.65539	0.0:0.0:0.8487:0.1513	.	218	Q9HBH1	DEFM_HUMAN	N	218	ENSP00000288022:H218N	ENSP00000288022:H218N	H	-	1	0	PDF	67920506	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.159000	0.71856	1.126000	0.42016	0.556000	0.70494	CAC	.	.		0.552	PDF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413022.1	NM_022341	
WDR81	124997	hgsc.bcm.edu	37	17	1634133	1634133	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:1634133T>C	ENST00000409644.1	+	3	3860	c.3860T>C	c.(3859-3861)cTg>cCg	p.L1287P	WDR81_ENST00000419248.1_Missense_Mutation_p.L60P|WDR81_ENST00000545662.1_5'UTR|WDR81_ENST00000437219.2_Missense_Mutation_p.L84P|WDR81_ENST00000309182.5_Missense_Mutation_p.L236P|RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000446363.1_5'UTR	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1287					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		AGGCCGGTCCTGGGCGACATC	0.652																																					p.L1287P		Atlas-SNP	.											.	WDR81	180	.	0			c.T3860C						.						56.0	57.0	56.0					17																	1634133		2203	4298	6501	SO:0001583	missense	124997	exon3			CGGTCCTGGGCGA	AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.3860T>C	chr17.hg19:g.1634133T>C	ENSP00000386609:p.Leu1287Pro	119.0	0.0		80.0	29.0	NM_001163809	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Missense_Mutation	SNP	ENST00000409644.1	hg19	CCDS54062.1	.	.	.	.	.	.	.	.	.	.	T	14.13	2.443927	0.43429	.	.	ENSG00000167716	ENST00000455636;ENST00000437219;ENST00000309182;ENST00000419248;ENST00000409644	T;T;T;T	0.54866	2.34;2.31;2.34;0.55	5.52	5.52	0.82312	.	0.303270	0.30519	N	0.009457	T	0.49081	0.1536	L	0.40543	1.245	0.80722	D	1	P;D;P	0.53885	0.681;0.963;0.828	B;P;B	0.46585	0.255;0.521;0.255	T	0.53507	-0.8429	10	0.66056	D	0.02	.	11.6173	0.51096	0.0:0.0:0.1486:0.8514	.	84;414;236	B7Z579;Q8TEL1;Q562E7	.;.;WDR81_HUMAN	P	84;84;236;60;1287	ENSP00000391074:L84P;ENSP00000312074:L236P;ENSP00000407845:L60P;ENSP00000386609:L1287P	ENSP00000312074:L236P	L	+	2	0	WDR81	1580883	1.000000	0.71417	0.853000	0.33588	0.197000	0.23852	4.938000	0.63519	2.099000	0.63709	0.533000	0.62120	CTG	.	.		0.652	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333118.2	NM_152348	
DHX33	56919	hgsc.bcm.edu	37	17	5365670	5365670	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:5365670C>A	ENST00000225296.3	-	3	847	c.647G>T	c.(646-648)aGg>aTg	p.R216M	DHX33_ENST00000433302.3_Intron	NM_001199699.1|NM_020162.3	NP_001186628.1|NP_064547.2	Q9H6R0	DHX33_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 33	216	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				positive regulation of transcription from RNA polymerase I promoter (GO:0045943)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|rDNA binding (GO:0000182)			breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TTCCTTTCTCCTCTTCTGTGC	0.463																																					p.R216M		Atlas-SNP	.											.	DHX33	41	.	0			c.G647T						.						72.0	64.0	66.0					17																	5365670		2203	4300	6503	SO:0001583	missense	56919	exon3			TTTCTCCTCTTCT	AL359945	CCDS11072.1	17p13	2003-06-13	2003-06-13	2003-06-13	ENSG00000005100	ENSG00000005100		"""DEAH-boxes"""	16718	protein-coding gene	gene with protein product		614405	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 33"""	DDX33			Standard	NM_020162		Approved	FLJ21972, DKFZp762F2011	uc002gca.3	Q9H6R0	OTTHUMG00000102041	ENST00000225296.3:c.647G>T	chr17.hg19:g.5365670C>A	ENSP00000225296:p.Arg216Met	202.0	0.0		185.0	57.0	NM_020162	B4DHF9|Q4G149|Q5CZ73|Q9H5M9	Missense_Mutation	SNP	ENST00000225296.3	hg19	CCDS11072.1	.	.	.	.	.	.	.	.	.	.	C	19.15	3.772278	0.69992	.	.	ENSG00000005100	ENST00000225296	T	0.14266	2.52	5.78	3.72	0.42706	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.240452	0.50627	D	0.000115	T	0.27629	0.0679	M	0.82433	2.59	0.80722	D	1	P	0.52463	0.953	P	0.53954	0.738	T	0.03077	-1.1075	10	0.66056	D	0.02	.	5.8526	0.18701	0.0:0.6422:0.0:0.3578	.	216	Q9H6R0	DHX33_HUMAN	M	216	ENSP00000225296:R216M	ENSP00000225296:R216M	R	-	2	0	DHX33	5306394	0.999000	0.42202	0.999000	0.59377	0.983000	0.72400	1.732000	0.38146	1.386000	0.46466	-0.384000	0.06662	AGG	.	.		0.463	DHX33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219826.2	NM_020162	
BRCA1	672	hgsc.bcm.edu	37	17	41203109	41203109	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:41203109C>T	ENST00000357654.3	-	20	5421	c.5303G>A	c.(5302-5304)tGc>tAc	p.C1768Y	BRCA1_ENST00000591534.1_Missense_Mutation_p.C259Y|BRCA1_ENST00000346315.3_Missense_Mutation_p.C1529Y|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000586385.1_Missense_Mutation_p.C78Y|BRCA1_ENST00000493795.1_Missense_Mutation_p.C1721Y|BRCA1_ENST00000309486.4_Missense_Mutation_p.C1472Y|BRCA1_ENST00000468300.1_Missense_Mutation_p.C664Y|BRCA1_ENST00000354071.3_Missense_Mutation_p.C1503Y|BRCA1_ENST00000352993.3_Missense_Mutation_p.C626Y|BRCA1_ENST00000471181.2_Missense_Mutation_p.C1789Y|BRCA1_ENST00000351666.3_Missense_Mutation_p.C585Y|BRCA1_ENST00000491747.2_Missense_Mutation_p.C664Y	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1768	BRCT 2. {ECO:0000255|PROSITE- ProRule:PRU00033}.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		GGGCCCATAGCAACAGATTTC	0.468			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																											p.C1789Y		Atlas-SNP	.	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	.	BRCA1	304	.	0			c.G5366A						.						70.0	69.0	69.0					17																	41203109		2203	4300	6503	SO:0001583	missense	672	exon21	Familial Cancer Database		CCATAGCAACAGA	U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.5303G>A	chr17.hg19:g.41203109C>T	ENSP00000350283:p.Cys1768Tyr	101.0	0.0		59.0	20.0	NM_007300	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	ENST00000357654.3	hg19	CCDS11453.1	.	.	.	.	.	.	.	.	.	.	C	18.57	3.651732	0.67472	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747	T;T;T;T;T;T;D;T;T;T	0.88431	-1.3;-1.3;-1.3;-1.3;-1.3;-1.3;-2.38;-1.3;-1.3;-1.02	5.06	5.06	0.68205	BRCT (4);	0.000000	0.56097	D	0.000025	D	0.93265	0.7854	M	0.66939	2.045	0.38133	D	0.938226	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.984;1.0	D;D;D;D;D;P;D	0.97110	1.0;0.984;1.0;0.999;1.0;0.552;1.0	D	0.94247	0.7490	10	0.87932	D	0	.	14.1279	0.65233	0.0:1.0:0.0:0.0	.	617;78;663;664;1790;1768;1768	B4DES0;C6YB45;E7ETR2;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;BRCA1_HUMAN;.	Y	1768;1789;1503;626;1529;585;1472;664;617;1790;1721;663	ENSP00000350283:C1768Y;ENSP00000326002:C1503Y;ENSP00000312236:C626Y;ENSP00000246907:C1529Y;ENSP00000338007:C585Y;ENSP00000310938:C1472Y;ENSP00000417148:C664Y;ENSP00000377294:C617Y;ENSP00000418775:C1721Y;ENSP00000420705:C663Y	ENSP00000310938:C1472Y	C	-	2	0	BRCA1	38456635	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	4.302000	0.59092	2.793000	0.96121	0.561000	0.74099	TGC	.	.		0.468	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348798.2	NM_007294	
ATXN7L3	56970	hgsc.bcm.edu	37	17	42273177	42273177	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:42273177A>T	ENST00000454077.2	-	7	563	c.564T>A	c.(562-564)gaT>gaA	p.D188E	ATXN7L3_ENST00000593073.1_Intron|ATXN7L3_ENST00000389384.4_Missense_Mutation_p.D181E	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CCTTAAAAGGATCCGAATTGC	0.488																																					p.D188E		Atlas-SNP	.											.	ATXN7L3	31	.	0			c.T564A						.						69.0	70.0	70.0					17																	42273177		1943	4129	6072	SO:0001583	missense	56970	exon7			AAAAGGATCCGAA	AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.564T>A	chr17.hg19:g.42273177A>T	ENSP00000397259:p.Asp188Glu	68.0	0.0		39.0	13.0	NM_020218		Missense_Mutation	SNP	ENST00000454077.2	hg19	CCDS45697.1	.	.	.	.	.	.	.	.	.	.	A	11.25	1.581899	0.28180	.	.	ENSG00000087152	ENST00000454077;ENST00000389384	.	.	.	5.23	3.03	0.35002	.	0.278174	0.33610	N	0.004737	T	0.17789	0.0427	N	0.08118	0	0.30721	N	0.748235	B;B	0.11235	0.002;0.004	B;B	0.06405	0.001;0.002	T	0.21042	-1.0257	9	0.09084	T	0.74	.	7.0771	0.25211	0.749:0.0:0.2509:0.0	.	181;188	Q14CW9;Q14CW9-2	AT7L3_HUMAN;.	E	188;181	.	ENSP00000374035:D181E	D	-	3	2	ATXN7L3	39628703	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	1.507000	0.35758	0.838000	0.34948	0.454000	0.30748	GAT	.	.		0.488	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457724.1		
MRC2	9902	hgsc.bcm.edu	37	17	60767531	60767531	+	Silent	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:60767531C>A	ENST00000303375.5	+	26	4159	c.3757C>A	c.(3757-3759)Cga>Aga	p.R1253R	MRC2_ENST00000446119.2_Silent_p.R119R	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2	1253					collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						CCCTCCTCCCCGAAGAATAAG	0.642																																					p.R1253R		Atlas-SNP	.											.	MRC2	126	.	0			c.C3757A						.						35.0	43.0	40.0					17																	60767531		2203	4300	6503	SO:0001819	synonymous_variant	9902	exon26			CCTCCCCGAAGAA	AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.3757C>A	chr17.hg19:g.60767531C>A		366.0	1.0		252.0	74.0	NM_006039	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Silent	SNP	ENST00000303375.5	hg19	CCDS11634.1																																																																																			.	.		0.642	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445152.1		
ABCA10	10349	hgsc.bcm.edu	37	17	67210857	67210857	+	Nonsense_Mutation	SNP	G	G	A	rs200246933		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:67210857G>A	ENST00000269081.4	-	10	1903	c.994C>T	c.(994-996)Cga>Tga	p.R332*	ABCA10_ENST00000432313.2_Nonsense_Mutation_p.R332*|ABCA10_ENST00000416101.2_Nonsense_Mutation_p.R332*	NM_080282.3	NP_525021.3	Q8WWZ4	ABCAA_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 10	332					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(34)|ovary(2)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(4)	81	Breast(10;6.95e-12)					GGTAAAACTCGCTCAAAATAT	0.279																																					p.R332X		Atlas-SNP	.											.	ABCA10	209	.	0			c.C994T						.						51.0	58.0	56.0					17																	67210857		2202	4288	6490	SO:0001587	stop_gained	10349	exon10			AAACTCGCTCAAA	AY247065	CCDS11684.1	17q24	2012-03-14			ENSG00000154263	ENSG00000154263		"""ATP binding cassette transporters / subfamily A"""	30	protein-coding gene	gene with protein product		612508				12821155, 11435397	Standard	NM_080282		Approved	EST698739	uc010dfa.1	Q8WWZ4	OTTHUMG00000164716	ENST00000269081.4:c.994C>T	chr17.hg19:g.67210857G>A	ENSP00000269081:p.Arg332*	127.0	0.0		95.0	24.0	NM_080282	C9JZH2|C9K035|Q6PIQ6|Q7Z2I9|Q7Z7P7|Q86TD2	Nonsense_Mutation	SNP	ENST00000269081.4	hg19	CCDS11684.1	.	.	.	.	.	.	.	.	.	.	G	42	9.592029	0.99214	.	.	ENSG00000154263	ENST00000269081;ENST00000416101;ENST00000432313	.	.	.	3.34	-4.56	0.03431	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	7.6125	0.28139	0.1097:0.0:0.1764:0.7139	.	.	.	.	X	332	.	ENSP00000269081:R332X	R	-	1	2	ABCA10	64722452	0.000000	0.05858	0.002000	0.10522	0.831000	0.47069	-0.215000	0.09279	-0.507000	0.06549	0.508000	0.49915	CGA	.	G|1.000;C|0.000		0.279	ABCA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379881.4	NM_080282	
SLC26A11	284129	hgsc.bcm.edu	37	17	78222437	78222437	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr17:78222437G>A	ENST00000361193.3	+	15	1766	c.1486G>A	c.(1486-1488)Gct>Act	p.A496T	SLC26A11_ENST00000411502.3_Missense_Mutation_p.A496T|SLC26A11_ENST00000546047.2_Missense_Mutation_p.A496T|SLC26A11_ENST00000572725.1_Missense_Mutation_p.A496T	NM_001166347.1|NM_173626.3	NP_001159819.1|NP_775897.3			solute carrier family 26 (anion exchanger), member 11											central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(7)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	28	all_neural(118;0.0538)		OV - Ovarian serous cystadenocarcinoma(97;0.0344)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			TGCCATGGAGGCTCTGCGGGA	0.687																																					p.A496T		Atlas-SNP	.											.	SLC26A11	60	.	0			c.G1486A						.						21.0	24.0	23.0					17																	78222437		2194	4292	6486	SO:0001583	missense	284129	exon15			ATGGAGGCTCTGC		CCDS11771.2	17q25	2013-07-18	2013-07-18		ENSG00000181045	ENSG00000181045		"""Solute carriers"""	14471	protein-coding gene	gene with protein product		610117	"""solute carrier family 26, member 11"""				Standard	NM_001166347		Approved		uc010dhv.2	Q86WA9	OTTHUMG00000133419	ENST00000361193.3:c.1486G>A	chr17.hg19:g.78222437G>A	ENSP00000355384:p.Ala496Thr	249.0	0.0		186.0	56.0	NM_173626		Missense_Mutation	SNP	ENST00000361193.3	hg19	CCDS11771.2	.	.	.	.	.	.	.	.	.	.	G	6.373	0.436940	0.12104	.	.	ENSG00000181045	ENST00000411502;ENST00000546047;ENST00000361193	D;D;D	0.87887	-2.31;-2.31;-2.31	4.47	-1.4	0.08968	Sulphate transporter/antisigma-factor antagonist STAS (4);	0.521522	0.20560	N	0.089924	T	0.66577	0.2803	N	0.08118	0	0.22171	N	0.999318	B	0.06786	0.001	B	0.11329	0.006	T	0.54636	-0.8264	10	0.45353	T	0.12	-16.4291	1.5866	0.02645	0.3551:0.1344:0.3737:0.1367	.	496	Q86WA9	S2611_HUMAN	T	496	ENSP00000403998:A496T;ENSP00000440724:A496T;ENSP00000355384:A496T	ENSP00000355384:A496T	A	+	1	0	SLC26A11	75837032	0.011000	0.17503	0.040000	0.18447	0.027000	0.11550	-0.424000	0.07025	-0.138000	0.11434	0.467000	0.42956	GCT	.	.		0.687	SLC26A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257281.1		
NOL4	8715	hgsc.bcm.edu	37	18	31685081	31685081	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr18:31685081C>T	ENST00000261592.5	-	3	755	c.458G>A	c.(457-459)cGa>cAa	p.R153Q	NOL4_ENST00000535475.1_5'UTR|NOL4_ENST00000589544.1_Missense_Mutation_p.R153Q|NOL4_ENST00000538587.1_Missense_Mutation_p.R79Q|NOL4_ENST00000269185.4_Missense_Mutation_p.R39Q	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	153						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						CATTAGAAATCGTGTCACCGC	0.383																																					p.R153Q		Atlas-SNP	.											.	NOL4	139	.	0			c.G458A						.						178.0	167.0	171.0					18																	31685081		2203	4299	6502	SO:0001583	missense	8715	exon3			AGAAATCGTGTCA	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.458G>A	chr18.hg19:g.31685081C>T	ENSP00000261592:p.Arg153Gln	180.0	0.0		147.0	56.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	hg19	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	C	32	5.139103	0.94560	.	.	ENSG00000101746	ENST00000261592;ENST00000269185;ENST00000538587	.	.	.	5.38	5.38	0.77491	.	0.114059	0.38663	N	0.001607	T	0.78071	0.4226	L	0.61218	1.895	0.80722	D	1	D;D;D;D	0.89917	1.0;0.997;0.997;0.998	D;D;D;D	0.85130	0.997;0.964;0.964;0.986	T	0.79555	-0.1755	9	0.87932	D	0	-9.9234	18.4847	0.90824	0.0:1.0:0.0:0.0	.	39;79;153;153	B4DLW2;B4DSQ0;O94818;O94818-2	.;.;NOL4_HUMAN;.	Q	153;39;79	.	ENSP00000261592:R153Q	R	-	2	0	NOL4	29939079	1.000000	0.71417	0.985000	0.45067	0.998000	0.95712	7.289000	0.78701	2.677000	0.91161	0.563000	0.77884	CGA	.	.		0.383	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
THEG	51298	hgsc.bcm.edu	37	19	375911	375911	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr19:375911C>A	ENST00000342640.4	-	1	102	c.60G>T	c.(58-60)agG>agT	p.R20S	THEG_ENST00000346878.2_Missense_Mutation_p.R20S	NM_016585.4	NP_057669.1	Q9P2T0	THEG_HUMAN	theg spermatid protein	20					cell differentiation (GO:0030154)|chaperone-mediated protein complex assembly (GO:0051131)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)				NS(1)|breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(2)|soft_tissue(1)	29		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCTTTCCGACCTGCCCGCAG	0.692																																					p.R20S		Atlas-SNP	.											.	THEG	58	.	0			c.G60T						.						37.0	37.0	37.0					19																	375911		2203	4299	6502	SO:0001583	missense	51298	exon1			TTCCGACCTGCCC	AF268610	CCDS12025.1, CCDS12026.1	19p13.3	2012-02-24	2012-02-24		ENSG00000105549	ENSG00000105549			13706	protein-coding gene	gene with protein product	"""cancer/testis antigen 56"""	609503	"""Theg homolog (mouse)"""			11173852	Standard	NM_016585		Approved	CT56, THEG1	uc002lol.3	Q9P2T0	OTTHUMG00000165491	ENST00000342640.4:c.60G>T	chr19.hg19:g.375911C>A	ENSP00000340088:p.Arg20Ser	40.0	0.0		46.0	10.0	NM_016585	A6NMJ8	Missense_Mutation	SNP	ENST00000342640.4	hg19	CCDS12025.1	.	.	.	.	.	.	.	.	.	.	C	8.562	0.877921	0.17395	.	.	ENSG00000105549	ENST00000342640;ENST00000346878	T;T	0.18502	2.21;2.21	3.4	-1.53	0.08611	.	2.627730	0.01505	N	0.017697	T	0.09862	0.0242	N	0.14661	0.345	0.09310	N	1	B;B	0.21452	0.056;0.056	B;B	0.16289	0.015;0.015	T	0.21965	-1.0230	10	0.27082	T	0.32	-24.1828	5.0668	0.14585	0.0:0.4646:0.3269:0.2085	.	20;20	Q9P2T0-2;Q9P2T0	.;THEG_HUMAN	S	20	ENSP00000340088:R20S;ENSP00000264820:R20S	ENSP00000340088:R20S	R	-	3	2	THEG	326911	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.928000	0.03980	-0.168000	0.10853	-0.314000	0.08810	AGG	.	.		0.692	THEG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384431.2		
ZNF77	58492	hgsc.bcm.edu	37	19	2934207	2934207	+	Silent	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr19:2934207G>A	ENST00000314531.4	-	4	1010	c.918C>T	c.(916-918)agC>agT	p.S306S		NM_021217.2	NP_067040.1	Q15935	ZNF77_HUMAN	zinc finger protein 77	306					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(5)|ovary(1)	17				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|GBM - Glioblastoma multiforme(1328;2.11e-07)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.174)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGAGTAACAGCTGAATGATT	0.458																																					p.S306S		Atlas-SNP	.											.	ZNF77	47	.	0			c.C918T						.						192.0	173.0	179.0					19																	2934207		2203	4300	6503	SO:0001819	synonymous_variant	58492	exon4			GTAACAGCTGAAT	X65230	CCDS12099.1	19p13.3	2013-01-08	2006-05-12					"""Zinc fingers, C2H2-type"", ""-"""	13150	protein-coding gene	gene with protein product		194551	"""zinc finger protein 77 (pT1)"""			8478004	Standard	NM_021217		Approved	pT1	uc002lws.4	Q15935		ENST00000314531.4:c.918C>T	chr19.hg19:g.2934207G>A		198.0	0.0		157.0	78.0	NM_021217	Q86XJ3|Q9NPP0	Silent	SNP	ENST00000314531.4	hg19	CCDS12099.1																																																																																			.	.		0.458	ZNF77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451924.1	NM_021217	
QTRT1	81890	hgsc.bcm.edu	37	19	10823446	10823446	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr19:10823446G>T	ENST00000250237.5	+	8	884	c.874G>T	c.(874-876)Gcc>Tcc	p.A292S		NM_031209.2	NP_112486.1	Q9BXR0	TGT_HUMAN	queuine tRNA-ribosyltransferase 1	292					queuosine biosynthetic process (GO:0008616)|tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|queuine tRNA-ribosyltransferase activity (GO:0008479)			large_intestine(2)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	12			Epithelial(33;1.55e-05)|all cancers(31;3.42e-05)			CTTTGGCTCTGCCCTGGTGCC	0.622																																					p.A292S		Atlas-SNP	.											QTRT1,middle_lobe,carcinoma,0,1	QTRT1	25	.	0			c.G874T						.						114.0	108.0	110.0					19																	10823446		2203	4300	6503	SO:0001583	missense	81890	exon8			GGCTCTGCCCTGG	AF302783	CCDS12248.1	19p13.3	2014-06-11	2008-07-31		ENSG00000213339	ENSG00000213339	2.4.2.29		23797	protein-coding gene	gene with protein product	"""tRNA-guanine transglycosylase"""	609615				20354154	Standard	NM_031209		Approved	TGT	uc002mpr.3	Q9BXR0		ENST00000250237.5:c.874G>T	chr19.hg19:g.10823446G>T	ENSP00000250237:p.Ala292Ser	82.0	0.0		103.0	54.0	NM_031209	B4DFM7|Q96BQ4|Q9BXQ9	Missense_Mutation	SNP	ENST00000250237.5	hg19	CCDS12248.1	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765824	0.69878	.	.	ENSG00000213339	ENST00000250237	.	.	.	3.87	3.87	0.44632	.	0.074633	0.52532	U	0.000062	D	0.87120	0.6098	H	0.97732	4.065	0.54753	D	0.999989	D	0.89917	1.0	D	0.97110	1.0	D	0.90943	0.4799	9	0.72032	D	0.01	-5.5173	12.8457	0.57829	0.0:0.0:1.0:0.0	.	292	Q9BXR0	TGT_HUMAN	S	292	.	ENSP00000250237:A292S	A	+	1	0	QTRT1	10684446	1.000000	0.71417	0.994000	0.49952	0.812000	0.45895	6.497000	0.73674	2.005000	0.58758	0.462000	0.41574	GCC	.	.		0.622	QTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452086.1	NM_031209	
GMIP	51291	hgsc.bcm.edu	37	19	19745726	19745726	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr19:19745726C>T	ENST00000203556.4	-	17	1899	c.1762G>A	c.(1762-1764)Gtc>Atc	p.V588I	GMIP_ENST00000587238.1_Missense_Mutation_p.V562I|GMIP_ENST00000445806.2_Missense_Mutation_p.V559I|GMIP_ENST00000586269.1_5'UTR	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	588	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GACCCGCTGACCCGGTAAATG	0.607																																					p.V588I		Atlas-SNP	.											.	GMIP	55	.	0			c.G1762A						.						49.0	55.0	53.0					19																	19745726		2203	4300	6503	SO:0001583	missense	51291	exon17			CGCTGACCCGGTA	AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.1762G>A	chr19.hg19:g.19745726C>T	ENSP00000203556:p.Val588Ile	69.0	0.0		83.0	25.0	NM_016573	A0AVN9|B7ZLZ0	Missense_Mutation	SNP	ENST00000203556.4	hg19	CCDS12408.1	.	.	.	.	.	.	.	.	.	.	C	13.20	2.165659	0.38217	.	.	ENSG00000089639	ENST00000203556;ENST00000445806	T;T	0.20881	2.04;2.04	5.26	1.49	0.22878	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.558531	0.14956	N	0.288632	T	0.15392	0.0371	L	0.43598	1.365	0.28324	N	0.922096	P;B;P	0.34724	0.465;0.096;0.465	B;B;B	0.33392	0.152;0.163;0.152	T	0.12734	-1.0536	10	0.29301	T	0.29	-19.9459	7.5898	0.28015	0.0:0.6185:0.0:0.3815	.	559;562;588	E7ERB7;B7ZLZ0;Q9P107	.;.;GMIP_HUMAN	I	588;559	ENSP00000203556:V588I;ENSP00000397075:V559I	ENSP00000203556:V588I	V	-	1	0	GMIP	19606726	0.511000	0.26179	1.000000	0.80357	0.950000	0.60333	1.086000	0.30853	0.615000	0.30124	0.561000	0.74099	GTC	.	.		0.607	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460551.1	NM_016573	
ZNF577	84765	hgsc.bcm.edu	37	19	52375810	52375810	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr19:52375810T>G	ENST00000301399.5	-	7	1798	c.1433A>C	c.(1432-1434)tAt>tCt	p.Y478S	ZNF577_ENST00000420592.1_Missense_Mutation_p.Y419S|ZNF577_ENST00000451628.2_Missense_Mutation_p.Y419S|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000485702.1_Intron	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	478					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		ATCTGTAAGATACAAGATATA	0.353																																					p.Y478S		Atlas-SNP	.											.	ZNF577	63	.	0			c.A1433C						.						40.0	40.0	40.0					19																	52375810		2202	4300	6502	SO:0001583	missense	84765	exon7			GTAAGATACAAGA	AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1433A>C	chr19.hg19:g.52375810T>G	ENSP00000301399:p.Tyr478Ser	57.0	0.0		69.0	24.0	NM_032679	A8K0B4|A8K6Z7|C9JFB9	Missense_Mutation	SNP	ENST00000301399.5	hg19	CCDS12842.2	.	.	.	.	.	.	.	.	.	.	.	6.263	0.416682	0.11870	.	.	ENSG00000161551	ENST00000301399;ENST00000420592;ENST00000451628;ENST00000458390	T;T;T;T	0.06849	3.25;3.3;3.3;3.26	3.04	0.864	0.19068	.	.	.	.	.	T	0.05273	0.0140	L	0.36672	1.1	0.09310	N	1	B;B	0.26744	0.158;0.102	B;B	0.19391	0.019;0.025	T	0.44159	-0.9346	9	0.19147	T	0.46	.	2.3926	0.04382	0.2122:0.256:0.0:0.5318	.	478;419	Q9BSK1;Q9BSK1-2	ZN577_HUMAN;.	S	478;419;419;478	ENSP00000301399:Y478S;ENSP00000413476:Y419S;ENSP00000389652:Y419S;ENSP00000404509:Y478S	ENSP00000301399:Y478S	Y	-	2	0	ZNF577	57067622	0.000000	0.05858	0.022000	0.16811	0.011000	0.07611	-0.203000	0.09438	-0.007000	0.14345	-0.256000	0.11100	TAT	.	.		0.353	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347243.1	NM_032679	
RALY	22913	hgsc.bcm.edu	37	20	32664868	32664868	+	Silent	SNP	C	C	T			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr20:32664868C>T	ENST00000246194.3	+	8	1195	c.693C>T	c.(691-693)ggC>ggT	p.G231G	RALY_ENST00000375114.3_Silent_p.G215G	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	231	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						gtggcgccggcggcggcggcg	0.667																																					p.G231G		Atlas-SNP	.											.	RALY	44	.	0			c.C693T						.																																			SO:0001819	synonymous_variant	22913	exon8			CGCCGGCGGCGGC	AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.693C>T	chr20.hg19:g.32664868C>T		12.0	0.0		11.0	4.0	NM_016732	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Silent	SNP	ENST00000246194.3	hg19	CCDS13230.1																																																																																			.	.		0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078753.1		
BIRC7	79444	hgsc.bcm.edu	37	20	61870579	61870579	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr20:61870579G>A	ENST00000217169.3	+	5	857	c.643G>A	c.(643-645)Gag>Aag	p.E215K	BIRC7_ENST00000342412.6_Missense_Mutation_p.E215K|MIR3196_ENST00000579556.1_RNA|NKAIN4_ENST00000466885.1_5'Flank|BIRC7_ENST00000395306.1_Missense_Mutation_p.E128K	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	215					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					AAGTGCCCAGGAGCCAGGTGC	0.662																																					p.E215K		Atlas-SNP	.											.	BIRC7	25	.	0			c.G643A						.						46.0	53.0	51.0					20																	61870579		2203	4300	6503	SO:0001583	missense	79444	exon5			GCCCAGGAGCCAG	AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.643G>A	chr20.hg19:g.61870579G>A	ENSP00000217169:p.Glu215Lys	47.0	0.0		48.0	22.0	NM_139317	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	ENST00000217169.3	hg19	CCDS13513.1	.	.	.	.	.	.	.	.	.	.	G	14.92	2.680859	0.47886	.	.	ENSG00000101197	ENST00000342412;ENST00000217169;ENST00000395306	T;T;T	0.50548	0.94;0.74;1.9	4.39	3.41	0.39046	.	0.750751	0.11309	N	0.577366	T	0.48466	0.1501	L	0.32530	0.975	0.35561	D	0.804661	D;P;D	0.69078	0.997;0.9;0.992	P;B;P	0.59889	0.839;0.376;0.865	T	0.41680	-0.9495	10	0.10377	T	0.69	.	10.0443	0.42177	0.0:0.0:0.7977:0.2023	.	215;215;215	Q6R308;Q96CA5;Q96CA5-2	.;BIRC7_HUMAN;.	K	215;215;128	ENSP00000345213:E215K;ENSP00000217169:E215K;ENSP00000378717:E128K	ENSP00000217169:E215K	E	+	1	0	BIRC7	61341024	0.211000	0.23529	0.513000	0.27749	0.190000	0.23558	2.170000	0.42443	1.099000	0.41499	0.563000	0.77884	GAG	.	.		0.662	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080114.2	NM_139317	
ZNRF3	84133	hgsc.bcm.edu	37	22	29438502	29438502	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr22:29438502G>C	ENST00000544604.2	+	3	621	c.446G>C	c.(445-447)cGg>cCg	p.R149P	ZNRF3_ENST00000406323.3_Missense_Mutation_p.R49P|ZNRF3_ENST00000402174.1_Missense_Mutation_p.R49P|ZNRF3_ENST00000332811.4_Missense_Mutation_p.R49P	NM_001206998.1	NP_001193927.1	Q9ULT6	ZNRF3_HUMAN	zinc and ring finger 3	149					canonical Wnt signaling pathway (GO:0060070)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of non-canonical Wnt signaling pathway (GO:2000051)|protein ubiquitination (GO:0016567)|stem cell proliferation (GO:0072089)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	integral component of plasma membrane (GO:0005887)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(4)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	28						GCAGTACAGCGGGGAGCTACT	0.512																																					p.R149P		Atlas-SNP	.											.	ZNRF3	75	.	0			c.G446C						.						78.0	78.0	78.0					22																	29438502		1945	4147	6092	SO:0001583	missense	84133	exon3			TACAGCGGGGAGC	AB051436	CCDS42999.1, CCDS56225.1	22q12.1	2013-01-09			ENSG00000183579	ENSG00000183579		"""RING-type (C3HC4) zinc fingers"""	18126	protein-coding gene	gene with protein product		612062				10574461	Standard	NM_032173		Approved	KIAA1133, BK747E2.3, FLJ22057, RNF203	uc003aeg.3	Q9ULT6	OTTHUMG00000151009	ENST00000544604.2:c.446G>C	chr22.hg19:g.29438502G>C	ENSP00000443824:p.Arg149Pro	72.0	0.0		61.0	12.0	NM_001206998	B3KU18|Q6ICH1|Q6NTF8|Q8WU18	Missense_Mutation	SNP	ENST00000544604.2	hg19	CCDS56225.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482183	0.84747	.	.	ENSG00000183579	ENST00000544604;ENST00000332811;ENST00000402174;ENST00000406323	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.64170	0.2574	L	0.43923	1.385	0.43564	D	0.995884	D	0.89917	1.0	D	0.91635	0.999	T	0.63782	-0.6559	10	0.72032	D	0.01	.	19.3307	0.94285	0.0:0.0:1.0:0.0	.	149	Q9ULT6	ZNRF3_HUMAN	P	149;49;49;49	ENSP00000443824:R149P;ENSP00000328614:R49P;ENSP00000384456:R49P;ENSP00000384553:R49P	ENSP00000328614:R49P	R	+	2	0	ZNRF3	27768502	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	7.058000	0.76676	2.881000	0.98747	0.650000	0.86243	CGG	.	.		0.512	ZNRF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320943.2	XM_290972	
SBF1	6305	hgsc.bcm.edu	37	22	50906873	50906873	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr22:50906873C>A	ENST00000390679.3	-	2	257	c.73G>T	c.(73-75)Ggc>Tgc	p.G25C	SBF1_ENST00000348911.6_Missense_Mutation_p.G25C|SBF1_ENST00000380817.3_Missense_Mutation_p.G25C			O95248	MTMR5_HUMAN	SET binding factor 1	25	UDENN.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		AGAATCTGGCCCTGGCCTTCC	0.642																																					p.G25C		Atlas-SNP	.											.	SBF1	211	.	0			c.G73T						.						44.0	51.0	49.0					22																	50906873		2019	4174	6193	SO:0001583	missense	6305	exon2			TCTGGCCCTGGCC	U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.73G>T	chr22.hg19:g.50906873C>A	ENSP00000375097:p.Gly25Cys	50.0	0.0		52.0	14.0	NM_002972	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	ENST00000390679.3	hg19		.	.	.	.	.	.	.	.	.	.	C	28.0	4.881652	0.91740	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.46819	0.86;0.86;0.86	4.84	4.84	0.62591	.	0.292022	0.31370	N	0.007769	T	0.70815	0.3267	M	0.81942	2.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.75717	-0.3220	10	0.87932	D	0	.	16.8551	0.86004	0.0:1.0:0.0:0.0	.	25;25	G5E933;O95248-4	.;.	C	25;25;35;35;25	ENSP00000370196:G25C;ENSP00000252027:G25C;ENSP00000375097:G25C	ENSP00000336522:G35C	G	-	1	0	SBF1	49253739	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.166000	0.77553	2.500000	0.84329	0.655000	0.94253	GGC	.	.		0.642	SBF1-201	KNOWN	basic	protein_coding	protein_coding			
DCAF8L2	347442	hgsc.bcm.edu	37	X	27765411	27765411	+	Silent	SNP	G	G	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chrX:27765411G>A	ENST00000451261.2	+	5	798	c.399G>A	c.(397-399)gaG>gaA	p.E133E		NM_001136533.1	NP_001130005.1	P0C7V8	DC8L2_HUMAN	DDB1 and CUL4 associated factor 8-like 2	133	Glu-rich.									central_nervous_system(1)|endometrium(9)|kidney(3)|lung(7)|pancreas(1)|skin(3)	24						aggaggaggaggaggaggagg	0.572																																					p.E133E		Atlas-SNP	.											.	DCAF8L2	79	.	0			c.G399A						.						17.0	16.0	16.0					X																	27765411		692	1587	2279	SO:0001819	synonymous_variant	347442	exon1			GGAGGAGGAGGAG		CCDS59162.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17		ENSG00000189186		"""WD repeat domain containing"""	31811	protein-coding gene	gene with protein product			"""WD repeat domain 42C"""	WDR42C			Standard	NM_001136533		Approved		uc011mjy.2	P0C7V8		ENST00000451261.2:c.399G>A	chrX.hg19:g.27765411G>A		17.0	0.0		20.0	6.0	NM_001136533	B2RXH9|J3KT06	Silent	SNP	ENST00000451261.2	hg19	CCDS59162.1																																																																																			.	.		0.572	DCAF8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056143.4	XM_293354	
ARID1A	8289	hgsc.bcm.edu	37	1	27105581	27105582	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:27105581_27105582insA	ENST00000324856.7	+	20	5563_5564	c.5192_5193insA	c.(5191-5196)ttaaagfs	p.LK1731fs	ARID1A_ENST00000374152.2_Frame_Shift_Ins_p.LK1348fs|ARID1A_ENST00000457599.2_Frame_Shift_Ins_p.LK1514fs|ARID1A_ENST00000540690.1_Frame_Shift_Ins_p.LK59fs	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1731					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		TTTGGCATTTTAAAGGAGTATG	0.48			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																p.L1731fs		Atlas-INDEL	.		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	.	ARID1A	842	.	0			c.5192_5193insA						.																																			SO:0001589	frameshift_variant	8289	exon20			.	AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.5195dupA	chr1.hg19:g.27105584_27105584dupA	ENSP00000320485:p.Leu1731fs	222.0	0.0		97.0	53.0	NM_006015	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Frame_Shift_Ins	INS	ENST00000324856.7	hg19	CCDS285.1																																																																																			.	.		0.480	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000011437.2	NM_139135	
CDH18	1016	hgsc.bcm.edu	37	5	19838935	19838944	+	Frame_Shift_Del	DEL	CCCCTTTTGG	CCCCTTTTGG	-	rs200906154		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	CCCCTTTTGG	CCCCTTTTGG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr5:19838935_19838944delCCCCTTTTGG	ENST00000507958.1	-	5	1142_1151	c.152_161delCCAAAAGGGG	c.(151-162)cccaaaaggggafs	p.PKRG51fs	CDH18_ENST00000506372.1_Frame_Shift_Del_p.PKRG51fs|CDH18_ENST00000274170.4_Frame_Shift_Del_p.PKRG51fs|CDH18_ENST00000511273.1_Frame_Shift_Del_p.PKRG51fs|CDH18_ENST00000382275.1_Frame_Shift_Del_p.PKRG51fs|CDH18_ENST00000502796.1_Frame_Shift_Del_p.PKRG51fs			Q13634	CAD18_HUMAN	cadherin 18, type 2	51					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(24)|lung(76)|ovary(5)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)	138	Lung NSC(1;0.00734)|all_lung(1;0.0197)					CCATACCCATCCCCTTTTGGGACGATGATG	0.405																																					p.51_54del		Atlas-Indel,Pindel	.											.	CDH18	561	.	0			c.153_162del						.																																			SO:0001589	frameshift_variant	1016	exon3			.	U59325	CCDS3889.1, CCDS54835.1, CCDS75229.1	5p14.3	2010-01-26			ENSG00000145526	ENSG00000145526		"""Cadherins / Major cadherins"""	1757	protein-coding gene	gene with protein product		603019				9030594, 10191097	Standard	NM_004934		Approved	CDH14, EY-CADHERIN	uc003jgd.3	Q13634	OTTHUMG00000090578	ENST00000507958.1:c.152_161delCCAAAAGGGG	chr5.hg19:g.19838935_19838944delCCCCTTTTGG	ENSP00000425093:p.Pro51fs	144.0	0.0		116.0	38.0	NM_001167667	A8K0I2|B4DHG6|Q8N5Z2	Frame_Shift_Del	DEL	ENST00000507958.1	hg19	CCDS3889.1																																																																																			.	.		0.405	CDH18-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366747.1	NM_004934	
SPTA1	6708	hgsc.bcm.edu	37	1	158651436	158651436	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr1:158651436delG	ENST00000368147.4	-	4	592	c.412delC	c.(412-414)cacfs	p.H138fs		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	138					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCCCACAGGTGGCGTAGCTCC	0.542																																					p.H138fs		Atlas-Indel,Pindel	.											.	SPTA1	720	.	0			c.413delA						.						94.0	96.0	95.0					1																	158651436		1992	4162	6154	SO:0001589	frameshift_variant	6708	exon4			.	M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.412delC	chr1.hg19:g.158651436delG	ENSP00000357129:p.His138fs	184.0	0.0		226.0	70.0	NM_003126	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Frame_Shift_Del	DEL	ENST00000368147.4	hg19	CCDS41423.1																																																																																			.	.		0.542	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051851.3	NM_003126	
IKBIP	121457	hgsc.bcm.edu	37	12	99020519	99020519	+	Intron	DEL	T	T	-	rs375489943		TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr12:99020519delT	ENST00000342502.2	-	2	709				IKBIP_ENST00000299157.4_Frame_Shift_Del_p.Q108fs|IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000393042.3_Intron	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						TGTAGCTTCCTGCAGGATGCT	0.373																																					p.Q108fs		Atlas-Indel,Pindel	.											.	IKBIP	46	.	0			c.324delG						.						79.0	77.0	77.0					12																	99020519		2203	4299	6502	SO:0001627	intron_variant	121457	exon3			.	AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+7554A>-	chr12.hg19:g.99020519delT		96.0	0.0		91.0	22.0	NM_153687	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Frame_Shift_Del	DEL	ENST00000342502.2	hg19	CCDS9067.1																																																																																			.	.		0.373	IKBIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000408003.2	NM_153687	
PCSK1	5122	hgsc.bcm.edu	37	5	95733104	95733104	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A39V-01A-11D-A20W-10	TCGA-DD-A39V-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	b73462a7-17f2-4187-87f1-9eb91590d20d	63c0be5f-ca62-4a05-a22d-9ddb8480fb65	g.chr5:95733104delA	ENST00000311106.3	-	12	1895	c.1658delT	c.(1657-1659)ttcfs	p.F553fs	PCSK1_ENST00000508626.1_Frame_Shift_Del_p.F506fs|CTD-2337A12.1_ENST00000502645.2_RNA|PCSK1_ENST00000513085.1_5'UTR	NM_000439.4|NM_001177876.1	NP_000430.3|NP_001171347.1	P29120	NEC1_HUMAN	proprotein convertase subtilisin/kexin type 1	553					cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|metabolic process (GO:0008152)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)|regulation of insulin secretion (GO:0050796)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			NS(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	36		all_cancers(142;2.67e-06)|all_epithelial(76;6.92e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0112)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;3.44e-16)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AACAGACATGAAGTCCCAATT	0.403																																					p.F553fs		Atlas-Indel,Pindel	.											.	PCSK1	93	.	0			c.1659delC						.						117.0	102.0	107.0					5																	95733104		2203	4300	6503	SO:0001589	frameshift_variant	5122	exon12			.		CCDS4081.1, CCDS54881.1	5q15-q21	2008-07-18			ENSG00000175426	ENSG00000175426			8743	protein-coding gene	gene with protein product	"""prohormone convertase 3"", ""prohormone convertase 1"", ""neuroendocrine convertase 1"", ""proprotein convertase 1"""	162150		NEC1		1765368	Standard	NM_000439		Approved	PC1, PC3, SPC3	uc003kls.2	P29120	OTTHUMG00000122089	ENST00000311106.3:c.1658delT	chr5.hg19:g.95733104delA	ENSP00000308024:p.Phe553fs	158.0	0.0		149.0	39.0	NM_000439	B7Z8T7|E9PHA1|P78478|Q92532	Frame_Shift_Del	DEL	ENST00000311106.3	hg19	CCDS4081.1																																																																																			.	.		0.403	PCSK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000242851.1	NM_000439	
