#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7797597	7797597	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:7797597A>G	ENST00000303635.7	+	15	3832	c.3625A>G	c.(3625-3627)Aag>Gag	p.K1209E	CAMTA1_ENST00000439411.2_Missense_Mutation_p.K1209E	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1209					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		AGAAATACCCAAGGGAGTCAC	0.527			T	WWTR1	epitheliod hemangioendothelioma																																p.K1209E		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.A3625G						.						38.0	38.0	38.0					1																	7797597		2203	4300	6503	SO:0001583	missense	23261	exon15			ATACCCAAGGGAG	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3625A>G	chr1.hg19:g.7797597A>G	ENSP00000306522:p.Lys1209Glu	113.0	0.0		86.0	4.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	hg19	CCDS30576.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.528854	0.64860	.	.	ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646	T;T	0.22134	1.97;1.98	5.91	5.91	0.95273	.	0.103364	0.64402	D	0.000003	T	0.25791	0.0628	L	0.55481	1.735	0.48341	D	0.999631	D;D;P;P	0.56521	0.962;0.976;0.919;0.877	P;P;B;B	0.47603	0.5;0.551;0.3;0.251	T	0.05289	-1.0894	10	0.07813	T	0.8	-14.3216	16.3483	0.83171	1.0:0.0:0.0:0.0	.	1209;296;165;1209	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1	.;.;.;CMTA1_HUMAN	E	1209;1209;296;165	ENSP00000306522:K1209E;ENSP00000402561:K1209E	ENSP00000306522:K1209E	K	+	1	0	CAMTA1	7720184	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.514000	0.90545	2.254000	0.74563	0.533000	0.62120	AAG	.	.		0.527	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
UBE4B	10277	hgsc.bcm.edu	37	1	10179596	10179596	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:10179596A>G	ENST00000253251.8	+	8	1816	c.977A>G	c.(976-978)cAg>cGg	p.Q326R	UBE4B_ENST00000475795.1_3'UTR|UBE4B_ENST00000343090.6_Missense_Mutation_p.Q455R|UBE4B_ENST00000377157.3_Missense_Mutation_p.Q210R					ubiquitination factor E4B											NS(3)|breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(14)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	48		all_lung(284;1.13e-05)|Lung NSC(185;1.74e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0268)|Colorectal(212;1.42e-07)|COAD - Colon adenocarcinoma(227;2.77e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000435)|Kidney(185;0.000482)|KIRC - Kidney renal clear cell carcinoma(229;0.00164)|STAD - Stomach adenocarcinoma(132;0.0117)|READ - Rectum adenocarcinoma(331;0.046)		GCAGTCAGCCAGCTTCTGAGC	0.463																																					p.Q455R		Atlas-SNP	.											.	UBE4B	233	.	0			c.A1364G						.						124.0	103.0	110.0					1																	10179596		2203	4300	6503	SO:0001583	missense	10277	exon9			TCAGCCAGCTTCT	AF091093	CCDS110.1, CCDS41245.1	1p36.1	2013-01-28	2011-05-19		ENSG00000130939	ENSG00000130939		"""U-box domain containing"""	12500	protein-coding gene	gene with protein product		613565	"""ubiquitination factor E4B (homologous to yeast UFD2)"", ""ubiquitination factor E4B (UFD2 homolog, yeast)"""			9734811, 10089879	Standard	NM_006048		Approved	UBOX3, E4, UFD2, KIAA0684	uc001aqs.4	O95155	OTTHUMG00000001797	ENST00000253251.8:c.977A>G	chr1.hg19:g.10179596A>G	ENSP00000253251:p.Gln326Arg	91.0	0.0		74.0	4.0	NM_001105562		Missense_Mutation	SNP	ENST00000253251.8	hg19	CCDS110.1	.	.	.	.	.	.	.	.	.	.	A	17.04	3.287488	0.59976	.	.	ENSG00000130939	ENST00000253251;ENST00000377157;ENST00000343090	T;T;T	0.46819	0.86;0.86;0.86	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.59945	0.2231	L	0.51422	1.61	0.80722	D	1	P;P	0.48294	0.537;0.908	B;P	0.61397	0.102;0.888	T	0.53315	-0.8456	10	0.22706	T	0.39	-22.1223	16.0786	0.80985	1.0:0.0:0.0:0.0	.	455;326	O95155;O95155-2	UBE4B_HUMAN;.	R	326;210;455	ENSP00000253251:Q326R;ENSP00000366362:Q210R;ENSP00000343001:Q455R	ENSP00000253251:Q326R	Q	+	2	0	UBE4B	10102183	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.866000	0.92307	2.254000	0.74563	0.460000	0.39030	CAG	.	.		0.463	UBE4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005017.1	NM_006048	
MTOR	2475	hgsc.bcm.edu	37	1	11301615	11301615	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:11301615T>C	ENST00000361445.4	-	10	1612	c.1536A>G	c.(1534-1536)ggA>ggG	p.G512G		NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	512	Interaction with NBN.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCCACCTTAGTCCCACTGCCA	0.552											OREG0013097	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G512G		Atlas-SNP	.											.	MTOR	327	.	0			c.A1536G						.						61.0	54.0	57.0					1																	11301615		2203	4300	6503	SO:0001819	synonymous_variant	2475	exon10			CCTTAGTCCCACT	L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.1536A>G	chr1.hg19:g.11301615T>C		170.0	0.0	671	133.0	7.0	NM_004958	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Silent	SNP	ENST00000361445.4	hg19	CCDS127.1																																																																																			.	.		0.552	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005558.1	NM_004958	
PADI1	29943	hgsc.bcm.edu	37	1	17550123	17550123	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:17550123T>C	ENST00000375471.4	+	3	373	c.281T>C	c.(280-282)gTc>gCc	p.V94A		NM_013358.2	NP_037490.2	Q9ULC6	PADI1_HUMAN	peptidyl arginine deiminase, type I	94					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	28		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.00054)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00522)|BRCA - Breast invasive adenocarcinoma(304;1.3e-05)|COAD - Colon adenocarcinoma(227;1.31e-05)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(196;0.0069)|READ - Rectum adenocarcinoma(331;0.0681)|Lung(427;0.197)	L-Citrulline(DB00155)	CAGGTGAGGGTCTCCTACTTT	0.587																																					p.V94A	Esophageal Squamous(80;414 1257 4580 27746 50832)	Atlas-SNP	.											.	PADI1	77	.	0			c.T281C						.						118.0	95.0	103.0					1																	17550123		2203	4300	6503	SO:0001583	missense	29943	exon3			TGAGGGTCTCCTA	AB033768	CCDS178.1	1p36.13	2008-07-18			ENSG00000142623	ENSG00000142623	3.5.3.15	"""Peptidyl arginine deiminases"""	18367	protein-coding gene	gene with protein product	"""peptidylarginine deiminase type I"", ""protein-arginine deiminase type-1"", ""hPAD-colony 10"""	607934				12416996	Standard	NM_013358		Approved	HPAD10, PDI1, PDI, PAD1	uc001bah.1	Q9ULC6	OTTHUMG00000002294	ENST00000375471.4:c.281T>C	chr1.hg19:g.17550123T>C	ENSP00000364620:p.Val94Ala	82.0	0.0		67.0	4.0	NM_013358	A1L4K6|Q70SX6	Missense_Mutation	SNP	ENST00000375471.4	hg19	CCDS178.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.420046	0.62622	.	.	ENSG00000142623	ENST00000375471	T	0.12465	2.68	3.71	3.71	0.42584	Cupredoxin (1);Protein-arginine deiminase (PAD) N-terminal (1);	0.196908	0.33040	N	0.005350	T	0.22126	0.0533	M	0.63843	1.955	0.80722	D	1	P	0.45634	0.863	P	0.49252	0.604	T	0.01496	-1.1340	10	0.87932	D	0	-21.5259	10.6528	0.45657	0.0:0.0:0.0:1.0	.	94	Q9ULC6	PADI1_HUMAN	A	94	ENSP00000364620:V94A	ENSP00000364620:V94A	V	+	2	0	PADI1	17422710	1.000000	0.71417	0.958000	0.39756	0.025000	0.11179	4.472000	0.60189	1.464000	0.47987	0.454000	0.30748	GTC	.	.		0.587	PADI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000006621.1	NM_013358	
HSPG2	3339	hgsc.bcm.edu	37	1	22180832	22180832	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:22180832T>C	ENST00000374695.3	-	50	6372	c.6293A>G	c.(6292-6294)cAc>cGc	p.H2098R	HSPG2_ENST00000430507.1_Missense_Mutation_p.H48R	NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	2098	Ig-like C2-type 6.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	ACGGGAGCCGTGCACCTGGGC	0.597																																					p.H2098R		Atlas-SNP	.											.	HSPG2	311	.	0			c.A6293G						.						16.0	14.0	14.0					1																	22180832		2191	4283	6474	SO:0001583	missense	3339	exon50			GAGCCGTGCACCT	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.6293A>G	chr1.hg19:g.22180832T>C	ENSP00000363827:p.His2098Arg	67.0	0.0		62.0	4.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	T	12.27	1.888674	0.33348	.	.	ENSG00000142798	ENST00000374695;ENST00000430507	T;T	0.65732	-0.17;-0.17	5.56	4.44	0.53790	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.182328	0.26156	N	0.026013	T	0.41488	0.1161	N	0.16130	0.375	0.20563	N	0.999884	B;B	0.06786	0.001;0.001	B;B	0.13407	0.005;0.009	T	0.20438	-1.0275	10	0.19590	T	0.45	.	9.6938	0.40145	0.0:0.0824:0.0:0.9176	.	38;2098	Q59EG0;P98160	.;PGBM_HUMAN	R	2098;48	ENSP00000363827:H2098R;ENSP00000416385:H48R	ENSP00000363827:H2098R	H	-	2	0	HSPG2	22053419	0.788000	0.28762	0.589000	0.28718	0.729000	0.41735	1.141000	0.31528	0.950000	0.37743	0.533000	0.62120	CAC	.	.		0.597	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
LUZP1	7798	hgsc.bcm.edu	37	1	23420185	23420185	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:23420185A>G	ENST00000302291.4	-	4	1371	c.570T>C	c.(568-570)acT>acC	p.T190T	LUZP1_ENST00000374623.3_Silent_p.T190T|LUZP1_ENST00000314174.5_Silent_p.T190T|LUZP1_ENST00000418342.1_Silent_p.T190T			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	190					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		CAAAGCTCAGAGTTAATGATT	0.353																																					p.T190T		Atlas-SNP	.											.	LUZP1	83	.	0			c.T570C						.						73.0	73.0	73.0					1																	23420185		2203	4300	6503	SO:0001819	synonymous_variant	7798	exon4			GCTCAGAGTTAAT	BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.570T>C	chr1.hg19:g.23420185A>G		99.0	0.0		74.0	4.0	NM_033631	Q5TH93|Q8N4X3|Q8TEH1	Silent	SNP	ENST00000302291.4	hg19	CCDS30628.1																																																																																			.	.		0.353	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008900.3	NM_033631	
PAQR7	164091	hgsc.bcm.edu	37	1	26189417	26189417	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:26189417T>G	ENST00000374296.3	-	2	1580	c.914A>C	c.(913-915)gAg>gCg	p.E305A	RP1-125I3.2_ENST00000455431.1_RNA	NM_178422.5	NP_848509.1	Q86WK9	MPRA_HUMAN	progestin and adipoQ receptor family member VII	305					multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|response to steroid hormone (GO:0048545)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)			breast(3)|endometrium(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	9		Colorectal(325;3.46e-05)|Lung NSC(340;0.00038)|all_lung(284;0.00051)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0155)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0505)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.16e-25)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000724)|BRCA - Breast invasive adenocarcinoma(304;0.000965)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0136)|READ - Rectum adenocarcinoma(331;0.0649)		GTGCAGAGGCTCATAGATGGG	0.602																																					p.E305A	Esophageal Squamous(111;1206 1556 18433 19151 38418)	Atlas-SNP	.											.	PAQR7	23	.	0			c.A914C						.						68.0	68.0	68.0					1																	26189417		2203	4300	6503	SO:0001583	missense	164091	exon2			AGAGGCTCATAGA		CCDS267.1	1p35.3	2012-08-10			ENSG00000182749	ENSG00000182749			23146	protein-coding gene	gene with protein product	"""membrane progestin receptor alpha"""	607779					Standard	NM_178422		Approved	mSR, MPRA	uc001bkx.3	Q86WK9	OTTHUMG00000007373	ENST00000374296.3:c.914A>C	chr1.hg19:g.26189417T>G	ENSP00000363414:p.Glu305Ala	304.0	0.0		246.0	150.0	NM_178422	A2A2D3|Q5XKF9|Q86VE4	Missense_Mutation	SNP	ENST00000374296.3	hg19	CCDS267.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.618986	0.46736	.	.	ENSG00000182749	ENST00000374296	T	0.23147	1.92	5.07	5.07	0.68467	.	0.216294	0.38111	N	0.001807	T	0.18341	0.0440	L	0.36672	1.1	0.45648	D	0.998571	B	0.28055	0.199	B	0.28991	0.097	T	0.06023	-1.0850	10	0.12766	T	0.61	-11.1793	9.474	0.38860	0.0:0.0:0.2321:0.7678	.	305	Q86WK9	MPRA_HUMAN	A	305	ENSP00000363414:E305A	ENSP00000363414:E305A	E	-	2	0	PAQR7	26062004	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.476000	0.60216	2.117000	0.64856	0.460000	0.39030	GAG	.	.		0.602	PAQR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019312.1	NM_178422	
SLC9A1	6548	hgsc.bcm.edu	37	1	27480593	27480593	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:27480593A>G	ENST00000263980.3	-	1	808	c.233T>C	c.(232-234)gTc>gCc	p.V78A	SLC9A1_ENST00000374086.3_Missense_Mutation_p.V78A|SLC9A1_ENST00000545949.1_5'UTR	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	78					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	ATGATCAGTGACGGAATGATT	0.592																																					p.V78A		Atlas-SNP	.											.	SLC9A1	68	.	0			c.T233C						.						109.0	109.0	109.0					1																	27480593		2203	4300	6503	SO:0001583	missense	6548	exon1			TCAGTGACGGAAT	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.233T>C	chr1.hg19:g.27480593A>G	ENSP00000263980:p.Val78Ala	104.0	0.0		71.0	4.0	NM_003047	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	hg19	CCDS295.1	.	.	.	.	.	.	.	.	.	.	A	3.331	-0.136598	0.06711	.	.	ENSG00000090020	ENST00000263980;ENST00000374086;ENST00000374084	T;T	0.63255	0.99;-0.03	4.68	0.914	0.19360	.	2.503810	0.01272	N	0.009470	T	0.33760	0.0874	N	0.03608	-0.345	0.19945	N	0.999945	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.44003	-0.9356	10	0.05833	T	0.94	.	4.5126	0.11919	0.4806:0.1772:0.0:0.3422	.	78;78	P19634-2;P19634	.;SL9A1_HUMAN	A	78	ENSP00000263980:V78A;ENSP00000363199:V78A	ENSP00000263980:V78A	V	-	2	0	SLC9A1	27353180	0.000000	0.05858	0.006000	0.13384	0.970000	0.65996	-0.056000	0.11787	0.800000	0.34041	0.533000	0.62120	GTC	.	.		0.592	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
KIAA1522	57648	hgsc.bcm.edu	37	1	33235850	33235850	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:33235850A>G	ENST00000373480.1	+	6	996	c.893A>G	c.(892-894)cAt>cGt	p.H298R	KIAA1522_ENST00000401073.2_Missense_Mutation_p.H357R|KIAA1522_ENST00000373481.3_Missense_Mutation_p.H309R|KIAA1522_ENST00000294521.3_Intron	NM_001198972.1	NP_001185901.1	Q9P206	K1522_HUMAN	KIAA1522	298										breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.244)				TTGATTCCACATGCTGTGCTG	0.667																																					p.H357R		Atlas-SNP	.											.	KIAA1522	68	.	0			c.A1070G						.						45.0	47.0	46.0					1																	33235850		2064	4191	6255	SO:0001583	missense	57648	exon6			TTCCACATGCTGT	AL713671	CCDS41298.1, CCDS55588.1, CCDS55589.1	1p35.1	2009-02-18			ENSG00000162522	ENSG00000162522			29301	protein-coding gene	gene with protein product						10819331	Standard	NM_020888		Approved		uc001bvu.1	Q9P206	OTTHUMG00000008088	ENST00000373480.1:c.893A>G	chr1.hg19:g.33235850A>G	ENSP00000362579:p.His298Arg	109.0	0.0		97.0	4.0	NM_020888	B4DQU8|B5MDY0|C9JH84|Q8TCQ0	Missense_Mutation	SNP	ENST00000373480.1	hg19	CCDS55588.1	.	.	.	.	.	.	.	.	.	.	A	16.11	3.028773	0.54790	.	.	ENSG00000162522	ENST00000401073;ENST00000373481;ENST00000373480	T;T;T	0.28069	1.63;1.63;1.63	4.39	4.39	0.52855	.	0.088890	0.45361	D	0.000365	T	0.22781	0.0550	L	0.36672	1.1	0.40453	D	0.980162	B;B;P	0.41265	0.231;0.231;0.744	B;B;B	0.32864	0.109;0.109;0.154	T	0.11470	-1.0586	10	0.59425	D	0.04	-9.7024	13.9093	0.63857	1.0:0.0:0.0:0.0	.	309;298;357	Q9P206-3;Q9P206;Q9P206-2	.;K1522_HUMAN;.	R	357;309;298	ENSP00000383851:H357R;ENSP00000362580:H309R;ENSP00000362579:H298R	ENSP00000362579:H298R	H	+	2	0	KIAA1522	33008437	1.000000	0.71417	0.885000	0.34714	0.984000	0.73092	8.804000	0.91921	1.742000	0.51746	0.402000	0.26972	CAT	.	.		0.667	KIAA1522-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000022130.1		
ZMYM6	9204	hgsc.bcm.edu	37	1	35477608	35477608	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:35477608T>C	ENST00000357182.4	-	8	1174		c.e8-2		ZMYM6_ENST00000373340.2_Splice_Site|ZMYM6_ENST00000487874.1_Splice_Site|ZMYM6_ENST00000493328.1_Splice_Site	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				CCTGGACACCTTGGTGACAAA	0.323																																					.		Atlas-SNP	.											.	ZMYM6	110	.	0			c.947-2A>G						.						93.0	87.0	89.0					1																	35477608		2203	4300	6503	SO:0001630	splice_region_variant	9204	exon9			GACACCTTGGTGA	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.947-2A>G	chr1.hg19:g.35477608T>C		71.0	0.0		74.0	4.0	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Splice_Site	SNP	ENST00000357182.4	hg19	CCDS387.2	.	.	.	.	.	.	.	.	.	.	T	15.93	2.976898	0.53720	.	.	ENSG00000163867	ENST00000373340;ENST00000357182	.	.	.	5.13	4.01	0.46588	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8892	0.46986	0.0:0.0733:0.0:0.9267	.	.	.	.	.	-1	.	.	.	-	.	.	ZMYM6	35250195	1.000000	0.71417	0.994000	0.49952	0.906000	0.53458	5.224000	0.65288	1.091000	0.41335	0.528000	0.53228	.	.	.		0.323	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	Intron
AGO4	192670	hgsc.bcm.edu	37	1	36298069	36298069	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:36298069T>C	ENST00000373210.3	+	11	1522	c.1277T>C	c.(1276-1278)gTc>gCc	p.V426A		NM_017629.3	NP_060099.2	Q9HCK5	AGO4_HUMAN	argonaute RISC catalytic component 4	426					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA catabolic process (GO:0006402)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|micro-ribonucleoprotein complex (GO:0035068)|RISC complex (GO:0016442)	miRNA binding (GO:0035198)										AACCAGGGTGTCTGGGACATG	0.363																																					p.V426A		Atlas-SNP	.											.	.	.	.	0			c.T1277C						.						96.0	96.0	96.0					1																	36298069		2203	4300	6503	SO:0001583	missense	192670	exon11			AGGGTGTCTGGGA	AB046787	CCDS397.1	1p34	2013-02-15	2013-02-15	2013-02-15	ENSG00000134698	ENSG00000134698		"""Argonaute/PIWI family"""	18424	protein-coding gene	gene with protein product	"""argonaute 4"""	607356	"""eukaryotic translation initiation factor 2C, 4"""	EIF2C4		12906857	Standard	NM_017629		Approved	hAGO4, KIAA1567, FLJ20033	uc001bzj.2	Q9HCK5	OTTHUMG00000004243	ENST00000373210.3:c.1277T>C	chr1.hg19:g.36298069T>C	ENSP00000362306:p.Val426Ala	48.0	0.0		86.0	4.0	NM_017629	A7MD27	Missense_Mutation	SNP	ENST00000373210.3	hg19	CCDS397.1	.	.	.	.	.	.	.	.	.	.	T	11.52	1.663613	0.29515	.	.	ENSG00000134698	ENST00000373210	T	0.05447	3.44	5.27	5.27	0.74061	.	0.114509	0.64402	D	0.000014	T	0.07954	0.0199	L	0.55990	1.75	0.58432	D	0.999991	B	0.06786	0.001	B	0.10450	0.005	T	0.13764	-1.0497	10	0.08381	T	0.77	-7.7221	15.2499	0.73536	0.0:0.0:0.0:1.0	.	426	Q9HCK5	AGO4_HUMAN	A	426	ENSP00000362306:V426A	ENSP00000362306:V426A	V	+	2	0	EIF2C4	36070656	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.012000	0.59069	0.529000	0.55759	GTC	.	.		0.363	AGO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012213.3	NM_017629	
MTF1	4520	hgsc.bcm.edu	37	1	38281195	38281195	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:38281195G>A	ENST00000373036.4	-	11	2015	c.1875C>T	c.(1873-1875)atC>atT	p.I625I		NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	625					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				CTTGTTTGATGATGATCACAG	0.577																																					p.I625I		Atlas-SNP	.											.	MTF1	67	.	0			c.C1875T						.						62.0	61.0	61.0					1																	38281195		2203	4300	6503	SO:0001819	synonymous_variant	4520	exon11			TTTGATGATGATC	BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.1875C>T	chr1.hg19:g.38281195G>A		173.0	0.0		235.0	113.0	NM_005955	B2RAK6|Q96CB1	Silent	SNP	ENST00000373036.4	hg19	CCDS30676.1																																																																																			.	.		0.577	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012984.2	NM_005955	
TIE1	7075	hgsc.bcm.edu	37	1	43782874	43782874	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:43782874A>G	ENST00000372476.3	+	15	2493	c.2414A>G	c.(2413-2415)gAg>gGg	p.E805G	TIE1_ENST00000433781.2_Missense_Mutation_p.E450G|TIE1_ENST00000473014.1_3'UTR	NM_001253357.1|NM_005424.4	NP_001240286.1|NP_005415.1	P35590	TIE1_HUMAN	tyrosine kinase with immunoglobulin-like and EGF-like domains 1	805					angiogenesis (GO:0001525)|in utero embryonic development (GO:0001701)|mesoderm development (GO:0007498)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|peptidyl-tyrosine phosphorylation (GO:0018108)|plasma membrane fusion (GO:0045026)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(8)|lung(28)|ovary(3)|prostate(2)|salivary_gland(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	70	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTGAAGGGCGAGGAGACCATC	0.607																																					p.E805G		Atlas-SNP	.											.	TIE1	132	.	0			c.A2414G						.						61.0	58.0	59.0					1																	43782874		2203	4300	6503	SO:0001583	missense	7075	exon15			AGGGCGAGGAGAC	BC038239	CCDS482.1	1p34-p33	2013-02-11	2004-12-13	2004-12-14	ENSG00000066056	ENSG00000066056	2.7.10.1	"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11809	protein-coding gene	gene with protein product		600222	"""tyrosine kinase with immunoglobulin and epidermal growth factor homology domains 1"""	TIE		1312667	Standard	NM_005424		Approved	JTK14	uc001ciu.3	P35590	OTTHUMG00000007282	ENST00000372476.3:c.2414A>G	chr1.hg19:g.43782874A>G	ENSP00000361554:p.Glu805Gly	95.0	0.0		140.0	7.0	NM_005424	B5A949|B5A950	Missense_Mutation	SNP	ENST00000372476.3	hg19	CCDS482.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.759175	0.89843	.	.	ENSG00000066056	ENST00000372476;ENST00000372475;ENST00000536913;ENST00000433781	T;T	0.77877	-1.1;-1.13	5.24	5.24	0.73138	.	0.000000	0.38436	N	0.001688	D	0.82719	0.5098	L	0.49126	1.545	0.80722	D	1	D;B;D	0.65815	0.986;0.217;0.995	P;B;P	0.59703	0.722;0.022;0.862	D	0.83661	0.0161	10	0.51188	T	0.08	.	15.1435	0.72630	1.0:0.0:0.0:0.0	.	760;450;805	B4DTW8;B4DKW0;P35590	.;.;TIE1_HUMAN	G	805;208;88;450	ENSP00000361554:E805G;ENSP00000411728:E450G	ENSP00000361553:E208G	E	+	2	0	TIE1	43555461	1.000000	0.71417	0.990000	0.47175	0.979000	0.70002	8.962000	0.93254	1.983000	0.57843	0.528000	0.53228	GAG	.	.		0.607	TIE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000019011.1	NM_005424	
GPBP1L1	60313	hgsc.bcm.edu	37	1	46120863	46120863	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:46120863T>C	ENST00000290795.3	-	4	1410	c.189A>G	c.(187-189)ggA>ggG	p.G63G	GPBP1L1_ENST00000355105.3_Splice_Site_p.G63G			Q9HC44	GPBL1_HUMAN	GC-rich promoter binding protein 1-like 1	63					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)		GPBP1L1/MAST2_ENST00000361297(2)	breast(1)|endometrium(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|stomach(1)	21	Acute lymphoblastic leukemia(166;0.155)					ATGGCTCACCTCCTGCAGTTC	0.448																																					p.G63G		Atlas-SNP	.											.	GPBP1L1	43	.	0			c.A189G						.						96.0	99.0	98.0					1																	46120863		2203	4300	6503	SO:0001630	splice_region_variant	60313	exon5			CTCACCTCCTGCA		CCDS528.1	1p34.1	2008-02-05			ENSG00000159592	ENSG00000159592			28843	protein-coding gene	gene with protein product						12477932	Standard	NM_021639		Approved	SP192	uc001coq.3	Q9HC44	OTTHUMG00000040990	ENST00000290795.3:c.190+1A>G	chr1.hg19:g.46120863T>C		103.0	0.0		122.0	5.0	NM_021639	D3DQ10|Q9H751	Silent	SNP	ENST00000290795.3	hg19	CCDS528.1																																																																																			.	.		0.448	GPBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098375.1	NM_021639	Silent
MAST2	23139	hgsc.bcm.edu	37	1	46501154	46501154	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:46501154T>C	ENST00000361297.2	+	29	5096	c.4813T>C	c.(4813-4815)Tct>Cct	p.S1605P	MAST2_ENST00000372009.2_Missense_Mutation_p.S1415P	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					CCTAGGTCAGTCTGGAGCCAC	0.617																																					p.S1605P		Atlas-SNP	.											.	MAST2	136	.	0			c.T4813C						.						27.0	30.0	29.0					1																	46501154		2012	4153	6165	SO:0001583	missense	23139	exon29			GGTCAGTCTGGAG	AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.4813T>C	chr1.hg19:g.46501154T>C	ENSP00000354671:p.Ser1605Pro	89.0	0.0		174.0	7.0	NM_015112		Missense_Mutation	SNP	ENST00000361297.2	hg19	CCDS41326.1	.	.	.	.	.	.	.	.	.	.	t	6.142	0.394495	0.11638	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000456625	T;T	0.65549	-0.07;-0.16	5.18	0.0341	0.14182	.	2.498500	0.01356	N	0.012075	T	0.42040	0.1185	N	0.14661	0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21861	-1.0233	10	0.33141	T	0.24	-0.7147	2.0349	0.03538	0.1133:0.1694:0.2054:0.5119	.	1415;1605	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	P	1605;1415;292	ENSP00000354671:S1605P;ENSP00000361079:S1415P	ENSP00000354671:S1605P	S	+	1	0	MAST2	46273741	0.000000	0.05858	0.848000	0.33437	0.100000	0.18952	0.314000	0.19432	0.415000	0.25817	0.454000	0.30748	TCT	.	.		0.617	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021977.1	NM_015112	
LRP8	7804	hgsc.bcm.edu	37	1	53716471	53716471	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:53716471G>T	ENST00000306052.6	-	17	2668	c.2567C>A	c.(2566-2568)aCc>aAc	p.T856N	LRP8_ENST00000354412.3_Missense_Mutation_p.T652N|LRP8_ENST00000371454.2_Missense_Mutation_p.T856N|LRP8_ENST00000465675.1_Missense_Mutation_p.T409N|LRP8_ENST00000347547.2_Missense_Mutation_p.T686N	NM_004631.4	NP_004622.2	Q14114	LRP8_HUMAN	low density lipoprotein receptor-related protein 8, apolipoprotein e receptor	856					ammon gyrus development (GO:0021541)|blood coagulation (GO:0007596)|cellular response to cholesterol (GO:0071397)|cellular response to growth factor stimulus (GO:0071363)|cytokine-mediated signaling pathway (GO:0019221)|endocytosis (GO:0006897)|layer formation in cerebral cortex (GO:0021819)|lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phototransduction, visible light (GO:0007603)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendrite development (GO:1900006)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein tyrosine kinase activity (GO:0061098)|proteolysis (GO:0006508)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|regulation of synaptic transmission (GO:0050804)|response to drug (GO:0042493)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)	caveola (GO:0005901)|dendrite (GO:0030425)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|high-density lipoprotein particle binding (GO:0008035)|reelin receptor activity (GO:0038025)|transmembrane signaling receptor activity (GO:0004888)|very-low-density lipoprotein particle receptor activity (GO:0030229)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(1)	21						CATGCTTTTGGTGTTCTTCCG	0.493																																					p.T856N		Atlas-SNP	.											.	LRP8	58	.	0			c.C2567A						.						302.0	255.0	271.0					1																	53716471		2203	4300	6503	SO:0001583	missense	7804	exon17			CTTTTGGTGTTCT	D50678	CCDS578.1, CCDS579.1, CCDS580.1, CCDS30720.1	1p32.3	2013-05-29			ENSG00000157193	ENSG00000157193		"""Low density lipoprotein receptors"""	6700	protein-coding gene	gene with protein product		602600				8626535, 9079678	Standard	NM_004631		Approved	APOER2, MCI1, LRP-8, HSZ75190	uc001cvi.2	Q14114	OTTHUMG00000008924	ENST00000306052.6:c.2567C>A	chr1.hg19:g.53716471G>T	ENSP00000303634:p.Thr856Asn	199.0	0.0		206.0	111.0	NM_004631	B1AMT6|B1AMT7|B1AMT8|O14968|Q86V27|Q99876|Q9BR78	Missense_Mutation	SNP	ENST00000306052.6	hg19	CCDS578.1	.	.	.	.	.	.	.	.	.	.	G	33	5.285224	0.95517	.	.	ENSG00000157193	ENST00000306052;ENST00000371454;ENST00000465675;ENST00000354412;ENST00000347547	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.42	5.42	0.78866	.	.	.	.	.	T	0.53238	0.1784	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;0.996;0.998;0.999	D;D;D;D;D;D	0.91635	0.979;0.999;0.996;0.99;0.954;0.979	T	0.54873	-0.8228	9	0.66056	D	0.02	.	19.2098	0.93749	0.0:0.0:1.0:0.0	.	409;652;686;856;856;409	B3KU40;Q14114-2;Q14114-4;Q14114-3;Q14114;E9PP15	.;.;.;.;LRP8_HUMAN;.	N	856;856;409;652;686	ENSP00000303634:T856N;ENSP00000360509:T856N;ENSP00000437009:T409N;ENSP00000346391:T652N;ENSP00000334522:T686N	ENSP00000303634:T856N	T	-	2	0	LRP8	53489059	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.855000	0.99526	2.528000	0.85240	0.563000	0.77884	ACC	.	.		0.493	LRP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000024699.1	NM_004631	
INADL	10207	hgsc.bcm.edu	37	1	62456035	62456035	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:62456035A>G	ENST00000371158.2	+	28	3980	c.3866A>G	c.(3865-3867)gAg>gGg	p.E1289G	INADL_ENST00000545929.1_5'UTR|INADL_ENST00000543708.1_Splice_Site_p.E73G|INADL_ENST00000316485.6_Splice_Site_p.E1289G	NM_176877.2	NP_795352	Q8NI35	INADL_HUMAN	InaD-like (Drosophila)	1289	PDZ 7. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|intracellular signal transduction (GO:0035556)|tight junction assembly (GO:0070830)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)				breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(8)|liver(1)|lung(51)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)	103						GAACTCTTAGAGGTGAGAAGC	0.433																																					p.E1289G		Atlas-SNP	.											.	INADL	179	.	0			c.A3866G						.						63.0	61.0	61.0					1																	62456035		2203	4300	6503	SO:0001630	splice_region_variant	10207	exon28			TCTTAGAGGTGAG	AB044807	CCDS617.2	1p31	2008-02-05			ENSG00000132849	ENSG00000132849			28881	protein-coding gene	gene with protein product		603199				9280290, 11374908	Standard	NM_176877		Approved	Cipp, PATJ	uc001dab.3	Q8NI35	OTTHUMG00000008560	ENST00000371158.2:c.3867+1A>G	chr1.hg19:g.62456035A>G		89.0	0.0		120.0	5.0	NM_176877	O15249|O43742|O60833|Q5VUA5|Q5VUA6|Q5VUA7|Q5VUA8|Q5VUA9|Q5VUB0|Q8WU78|Q9H3N9	Missense_Mutation	SNP	ENST00000371158.2	hg19	CCDS617.2	.	.	.	.	.	.	.	.	.	.	A	26.5	4.740262	0.89573	.	.	ENSG00000132849	ENST00000371158;ENST00000316485;ENST00000371156;ENST00000395513;ENST00000307297;ENST00000543708	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.73	5.73	0.89815	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000001	T	0.62122	0.2402	M	0.87617	2.895	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.996;1.0;0.999;1.0;0.999	T	0.69202	-0.5207	10	0.72032	D	0.01	.	16.0234	0.80516	1.0:0.0:0.0:0.0	.	73;748;1289;1289;1289	B4DE90;Q8NI35-5;F8W8T2;Q8NI35;Q8NI35-4	.;.;.;INADL_HUMAN;.	G	1289;1289;1289;1289;73;73	ENSP00000360200:E1289G;ENSP00000326199:E1289G;ENSP00000307496:E73G;ENSP00000445790:E73G	ENSP00000307496:E73G	E	+	2	0	INADL	62228623	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	9.225000	0.95219	2.172000	0.68678	0.533000	0.62120	GAG	.	.		0.433	INADL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000023639.2	NM_170605	Missense_Mutation
SLC35D1	23169	hgsc.bcm.edu	37	1	67518481	67518481	+	Silent	SNP	A	A	G	rs371868604		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:67518481A>G	ENST00000235345.5	-	3	382	c.297T>C	c.(295-297)ccT>ccC	p.P99P	SLC35D1_ENST00000506472.2_Silent_p.P20P	NM_015139.2	NP_055954.1	Q9NTN3	S35D1_HUMAN	solute carrier family 35 (UDP-GlcA/UDP-GalNAc transporter), member D1	99					carbohydrate transport (GO:0008643)|cellular glucuronidation (GO:0052695)|chondroitin sulfate biosynthetic process (GO:0030206)|embryonic skeletal system development (GO:0048706)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|UDP-glucuronate biosynthetic process (GO:0006065)|UDP-glucuronic acid transport (GO:0015787)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	UDP-glucuronic acid transmembrane transporter activity (GO:0005461)			endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	10						TGTCAAGGTCAGGAAACTTGA	0.393																																					p.P99P		Atlas-SNP	.											.	SLC35D1	22	.	0			c.T297C						.	A		1,4405	2.1+/-5.4	0,1,2202	115.0	114.0	114.0		297	2.9	1.0	1		114	0,8600		0,0,4300	no	coding-synonymous	SLC35D1	NM_015139.2		0,1,6502	GG,GA,AA		0.0,0.0227,0.0077		99/356	67518481	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	23169	exon3			AAGGTCAGGAAAC	AB044343	CCDS636.1	1p32-p31	2013-07-17	2013-07-17		ENSG00000116704	ENSG00000116704		"""Solute carriers"""	20800	protein-coding gene	gene with protein product		610804	"""solute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1"""			11322953	Standard	NM_015139		Approved	UGTREL7, KIAA0260	uc001ddk.2	Q9NTN3	OTTHUMG00000009360	ENST00000235345.5:c.297T>C	chr1.hg19:g.67518481A>G		68.0	0.0		124.0	5.0	NM_015139	A8K185|B7Z3X2|Q52LU5|Q92548	Silent	SNP	ENST00000235345.5	hg19	CCDS636.1																																																																																			.	.		0.393	SLC35D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025948.1	NM_015139	
DNTTIP2	30836	hgsc.bcm.edu	37	1	94341250	94341250	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:94341250T>C	ENST00000436063.2	-	3	1814	c.1757A>G	c.(1756-1758)cAg>cGg	p.Q586R	DNTTIP2_ENST00000460191.1_5'UTR	NM_014597.4	NP_055412.2	Q5QJE6	TDIF2_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 2	586	TdBR region; mediates interaction with DNTT.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	38		all_lung(203;0.0111)|Lung NSC(277;0.0347)		all cancers(265;0.00679)|GBM - Glioblastoma multiforme(16;0.0278)|Epithelial(280;0.128)		CTTGTTAGACTGTAGTTTATC	0.363																																					p.Q586R		Atlas-SNP	.											.	DNTTIP2	59	.	0			c.A1757G						.						239.0	206.0	216.0					1																	94341250		1838	4081	5919	SO:0001583	missense	30836	exon3			TTAGACTGTAGTT	AY394925	CCDS44174.1	1p22.1	2008-02-05			ENSG00000067334	ENSG00000067334			24013	protein-coding gene	gene with protein product	"""acidic 82 kDa protein mRNA"""	611199				15047147	Standard	NM_014597		Approved	HSU15552, ERBP, TdIF2	uc001dqf.3	Q5QJE6	OTTHUMG00000010268	ENST00000436063.2:c.1757A>G	chr1.hg19:g.94341250T>C	ENSP00000411010:p.Gln586Arg	90.0	0.0		108.0	5.0	NM_014597	Q12987|Q53H59|Q5TFJ4|Q6TLI0|Q76MJ8|Q86WX9	Missense_Mutation	SNP	ENST00000436063.2	hg19	CCDS44174.1	.	.	.	.	.	.	.	.	.	.	T	15.53	2.862276	0.51482	.	.	ENSG00000067334	ENST00000436063	T	0.14516	2.5	5.93	4.74	0.60224	.	0.343382	0.27986	N	0.017043	T	0.06645	0.0170	M	0.62723	1.935	0.09310	N	1	B	0.19935	0.04	B	0.16289	0.015	T	0.09952	-1.0651	10	0.31617	T	0.26	.	12.0766	0.53647	0.1288:0.0:0.0:0.8712	.	586	Q5QJE6	TDIF2_HUMAN	R	586	ENSP00000411010:Q586R	ENSP00000411010:Q586R	Q	-	2	0	DNTTIP2	94113838	0.999000	0.42202	0.233000	0.24025	0.959000	0.62525	3.577000	0.53885	2.263000	0.75096	0.533000	0.62120	CAG	.	.		0.363	DNTTIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000028317.2	NM_014597	
SASS6	163786	hgsc.bcm.edu	37	1	100571335	100571335	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:100571335A>G	ENST00000287482.5	-	13	1673	c.1533T>C	c.(1531-1533)ccT>ccC	p.P511P	SASS6_ENST00000462159.1_5'UTR|SASS6_ENST00000535161.1_Silent_p.P344P	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	511					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		CATTCAGGTTAGGAGAAATTC	0.368																																					p.P511P		Atlas-SNP	.											.	SASS6	61	.	0			c.T1533C						.						161.0	145.0	150.0					1																	100571335		2203	4300	6503	SO:0001819	synonymous_variant	163786	exon13			CAGGTTAGGAGAA	AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.1533T>C	chr1.hg19:g.100571335A>G		128.0	0.0		141.0	6.0	NM_194292	D3DT55|Q8N3K0	Silent	SNP	ENST00000287482.5	hg19	CCDS764.1																																																																																			.	.		0.368	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029656.2	NM_194292	
ITGA10	8515	hgsc.bcm.edu	37	1	145534216	145534216	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:145534216A>G	ENST00000369304.3	+	14	1896	c.1721A>G	c.(1720-1722)gAa>gGa	p.E574G	ITGA10_ENST00000539363.1_Missense_Mutation_p.E431G|ITGA10_ENST00000538811.1_Missense_Mutation_p.E443G	NM_003637.3	NP_003628.2	O75578	ITA10_HUMAN	integrin, alpha 10	574					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)	integrin alpha10-beta1 complex (GO:0034680)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCGCCTCTGGAAGATGGGCAC	0.587																																					p.E574G		Atlas-SNP	.											.	ITGA10	131	.	0			c.A1721G						.						109.0	114.0	113.0					1																	145534216		2203	4300	6503	SO:0001583	missense	8515	exon14			CTCTGGAAGATGG	AF074015	CCDS72869.1	1q21.1	2010-03-23			ENSG00000143127	ENSG00000143127		"""Integrins"""	6135	protein-coding gene	gene with protein product		604042				9685391, 10702680	Standard	NM_003637		Approved		uc001eoa.3	O75578	OTTHUMG00000013751	ENST00000369304.3:c.1721A>G	chr1.hg19:g.145534216A>G	ENSP00000358310:p.Glu574Gly	154.0	0.0		191.0	50.0	NM_003637	B2RAM4|B2RTV5|Q6UXJ6|Q9UHZ8	Missense_Mutation	SNP	ENST00000369304.3	hg19	CCDS918.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.175848	0.78564	.	.	ENSG00000143127	ENST00000369304;ENST00000543043;ENST00000539363;ENST00000538811	T;T;T	0.60797	0.16;0.16;0.16	5.03	5.03	0.67393	.	0.000000	0.64402	D	0.000001	T	0.67961	0.2949	M	0.70275	2.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.85130	0.997;0.997;0.995;0.994	T	0.73398	-0.3995	10	0.87932	D	0	.	12.9882	0.58604	1.0:0.0:0.0:0.0	.	540;443;431;574	F5H3T9;F5GY13;B2RTV5;O75578	.;.;.;ITA10_HUMAN	G	574;540;431;443	ENSP00000358310:E574G;ENSP00000439894:E431G;ENSP00000440011:E443G	ENSP00000358310:E574G	E	+	2	0	ITGA10	144245573	1.000000	0.71417	1.000000	0.80357	0.647000	0.38526	8.959000	0.93110	2.014000	0.59158	0.533000	0.62120	GAA	.	.		0.587	ITGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038537.2	NM_003637	
FLG	2312	hgsc.bcm.edu	37	1	152277969	152277969	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:152277969A>C	ENST00000368799.1	-	3	9428	c.9393T>G	c.(9391-9393)gaT>gaG	p.D3131E	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	3131	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCCAGAGCTATCTACCGAAT	0.587									Ichthyosis																												p.D3131E		Atlas-SNP	.											.	FLG	900	.	0			c.T9393G						.						69.0	92.0	84.0					1																	152277969		2197	4272	6469	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	AGAGCTATCTACC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.9393T>G	chr1.hg19:g.152277969A>C	ENSP00000357789:p.Asp3131Glu	341.0	0.0		441.0	111.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	A	9.659	1.143502	0.21205	.	.	ENSG00000143631	ENST00000368799	T	0.04234	3.67	2.49	0.55	0.17219	.	.	.	.	.	T	0.04227	0.0117	M	0.79475	2.455	0.09310	N	1	D	0.71674	0.998	D	0.64144	0.922	T	0.20009	-1.0288	9	0.06099	T	0.92	.	4.881	0.13679	0.3146:0.0:0.6854:0.0	.	3131	P20930	FILA_HUMAN	E	3131	ENSP00000357789:D3131E	ENSP00000357789:D3131E	D	-	3	2	FLG	150544593	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.963000	0.03837	0.138000	0.18790	-0.429000	0.05907	GAT	.	.		0.587	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
IQGAP3	128239	hgsc.bcm.edu	37	1	156496391	156496391	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:156496391C>A	ENST00000361170.2	-	38	4793	c.4783G>T	c.(4783-4785)Gat>Tat	p.D1595Y	snoU13_ENST00000458777.1_RNA	NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	1595					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					TGCAGGAGATCCTAGGAGGGA	0.498																																					p.D1595Y		Atlas-SNP	.											IQGAP3,NS,carcinoma,0,2	IQGAP3	146	.	0			c.G4783T						.						71.0	64.0	66.0					1																	156496391		2203	4300	6503	SO:0001630	splice_region_variant	128239	exon38			GGAGATCCTAGGA	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.4783-1G>T	chr1.hg19:g.156496391C>A		69.0	0.0		78.0	21.0	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	hg19	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572555	0.86542	.	.	ENSG00000183856	ENST00000361170	T	0.06849	3.25	4.76	4.76	0.60689	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	M	0.91196	3.185	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.34229	-0.9837	10	0.87932	D	0	-29.8599	16.507	0.84274	0.0:1.0:0.0:0.0	.	1595	Q86VI3	IQGA3_HUMAN	Y	1595	ENSP00000354451:D1595Y	ENSP00000354451:D1595Y	D	-	1	0	IQGAP3	154763015	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.584000	0.82572	2.475000	0.83589	0.561000	0.74099	GAT	.	.		0.498	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	Missense_Mutation
ETV3	2117	hgsc.bcm.edu	37	1	157095521	157095521	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:157095521T>C	ENST00000368192.4	-	5	715	c.651A>G	c.(649-651)ggA>ggG	p.G217G		NM_001145312.1	NP_001138784.1	P41162	ETV3_HUMAN	ets variant 3	217					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)	9	Hepatocellular(266;0.158)	Prostate(1639;0.174)				CAATCCCTCCTCCACCAATGG	0.567																																					p.G217G		Atlas-SNP	.											.	ETV3	50	.	0			c.A651G						.						86.0	82.0	83.0					1																	157095521		692	1591	2283	SO:0001819	synonymous_variant	2117	exon5			CCCTCCTCCACCA	BC022868	CCDS1164.1, CCDS44250.1	1q21-q23	2008-09-12	2008-09-12		ENSG00000117036	ENSG00000117036			3492	protein-coding gene	gene with protein product		164873	"""ets variant gene 3, ETS family transcriptional repressor"", ""ets variant gene 3"""			8020980	Standard	NM_005240		Approved	PE-1	uc001fqr.2	P41162	OTTHUMG00000034298	ENST00000368192.4:c.651A>G	chr1.hg19:g.157095521T>C		84.0	0.0		144.0	6.0	NM_001145312	B4E3M7|Q8TAC8|Q9BX30	Silent	SNP	ENST00000368192.4	hg19	CCDS44250.1																																																																																			.	.		0.567	ETV3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082843.2	NM_005240	
PYHIN1	149628	hgsc.bcm.edu	37	1	158908887	158908887	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:158908887T>A	ENST00000368140.1	+	4	674	c.429T>A	c.(427-429)tcT>tcA	p.S143S	PYHIN1_ENST00000368138.3_Silent_p.S134S|PYHIN1_ENST00000392252.3_Silent_p.S134S|PYHIN1_ENST00000368135.4_Silent_p.S143S|PYHIN1_ENST00000392254.2_Silent_p.S143S	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	143					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					AAAAACCATCTGAAGAAGAGA	0.413																																					p.S143S		Atlas-SNP	.											.	PYHIN1	208	.	0			c.T429A						.						53.0	53.0	53.0					1																	158908887		2203	4300	6503	SO:0001819	synonymous_variant	149628	exon4			ACCATCTGAAGAA	AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.429T>A	chr1.hg19:g.158908887T>A		130.0	0.0		149.0	50.0	NM_152501	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Silent	SNP	ENST00000368140.1	hg19	CCDS1178.1																																																																																			.	.		0.413	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090110.1	NM_152501	
KLHL20	27252	hgsc.bcm.edu	37	1	173754356	173754356	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:173754356A>G	ENST00000209884.4	+	12	1937	c.1801A>G	c.(1801-1803)Atg>Gtg	p.M601V	KLHL20_ENST00000546011.1_Missense_Mutation_p.M412V	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	601					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						AGTTATTAAAATGACACATTG	0.403																																					p.M601V	GBM(159;862 2695 6559 23041)	Atlas-SNP	.											.	KLHL20	54	.	0			c.A1801G						.						111.0	111.0	111.0					1																	173754356		2203	4300	6503	SO:0001583	missense	27252	exon12			ATTAAAATGACAC	AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1801A>G	chr1.hg19:g.173754356A>G	ENSP00000209884:p.Met601Val	81.0	0.0		81.0	4.0	NM_014458	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	ENST00000209884.4	hg19	CCDS1310.1	.	.	.	.	.	.	.	.	.	.	A	15.46	2.840786	0.51057	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.68331	-0.04;-0.32	6.06	6.06	0.98353	.	.	.	.	.	T	0.34454	0.0898	N	0.14661	0.345	0.80722	D	1	B;B	0.24317	0.101;0.05	B;B	0.18871	0.023;0.013	T	0.27400	-1.0075	9	0.26408	T	0.33	.	15.6071	0.76682	1.0:0.0:0.0:0.0	.	412;601	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	V	412;601	ENSP00000443121:M412V;ENSP00000209884:M601V	ENSP00000209884:M601V	M	+	1	0	KLHL20	172020979	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.128000	0.94424	2.323000	0.78572	0.528000	0.53228	ATG	.	.		0.403	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097582.1	NM_014458	
TOR1AIP1	26092	hgsc.bcm.edu	37	1	179887172	179887172	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:179887172A>G	ENST00000606911.2	+	10	1741	c.1550A>G	c.(1549-1551)gAg>gGg	p.E517G	TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.E518G|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.E533G|TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.E396G			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	517	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						TTGGAGGAAGAGACACTTGGA	0.403																																					p.E518G		Atlas-SNP	.											.	TOR1AIP1	58	.	0			c.A1553G						.						89.0	89.0	89.0					1																	179887172		2203	4300	6503	SO:0001583	missense	26092	exon10			AGGAAGAGACACT		CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1550A>G	chr1.hg19:g.179887172A>G	ENSP00000476687:p.Glu517Gly	141.0	0.0		196.0	8.0	NM_001267578	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	ENST00000606911.2	hg19	CCDS1335.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.12|15.12	2.739708|2.739708	0.49045|0.49045	.|.	.|.	ENSG00000143337|ENSG00000143337	ENST00000325993;ENST00000271583;ENST00000435319|ENST00000447964	T;T|.	0.27402|.	1.67;1.67|.	5.96|5.96	4.81|4.81	0.61882|0.61882	.|.	0.697515|.	0.15176|.	N|.	0.276378|.	T|T	0.45458|0.45458	0.1343|0.1343	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	1|1	P|.	0.44521|.	0.837|.	B|.	0.43990|.	0.438|.	T|T	0.30966|0.30966	-0.9960|-0.9960	9|5	.|.	.|.	.|.	-1.6777|-1.6777	11.7058|11.7058	0.51597|0.51597	0.7189:0.2811:0.0:0.0|0.7189:0.2811:0.0:0.0	.|.	517|.	Q5JTV8|.	TOIP1_HUMAN|.	G|G	312;533;517|252	ENSP00000271583:E533G;ENSP00000393292:E517G|.	.|.	E|R	+|+	2|1	0|2	TOR1AIP1|TOR1AIP1	178153795|178153795	1.000000|1.000000	0.71417|0.71417	0.450000|0.450000	0.26969|0.26969	0.967000|0.967000	0.64934|0.64934	5.142000|5.142000	0.64820|0.64820	1.033000|1.033000	0.39918|0.39918	0.533000|0.533000	0.62120|0.62120	GAG|AGA	.	.		0.403	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000100313.4	NM_015602	
LAMC1	3915	hgsc.bcm.edu	37	1	183095398	183095398	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:183095398G>T	ENST00000258341.4	+	16	3201		c.e16+1		LAMC1_ENST00000466964.1_Splice_Site	NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GGCTGCAAACGTAAGGGGTGT	0.532																																					.		Atlas-SNP	.											.	LAMC1	176	.	0			c.2944+1G>T						.						86.0	77.0	80.0					1																	183095398		2203	4300	6503	SO:0001630	splice_region_variant	3915	exon16			GCAAACGTAAGGG	J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2944+1G>T	chr1.hg19:g.183095398G>T		140.0	0.0		284.0	140.0	NM_002293	Q5VYE7	Splice_Site	SNP	ENST00000258341.4	hg19	CCDS1351.1	.	.	.	.	.	.	.	.	.	.	G	27.3	4.814480	0.90790	.	.	ENSG00000135862	ENST00000258341	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6934	0.96010	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMC1	181362021	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.135000	0.94478	2.651000	0.90000	0.655000	0.94253	.	.	.		0.532	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085954.2	NM_002293	Intron
NFASC	23114	hgsc.bcm.edu	37	1	204955096	204955096	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:204955096A>G	ENST00000404076.1	+	21	3004	c.2582A>G	c.(2581-2583)cAg>cGg	p.Q861R	NFASC_ENST00000338515.6_Missense_Mutation_p.Q882R|NFASC_ENST00000539706.1_Missense_Mutation_p.Q878R|NFASC_ENST00000404907.1_Missense_Mutation_p.Q878R|NFASC_ENST00000513543.1_Missense_Mutation_p.Q878R|NFASC_ENST00000367172.4_Missense_Mutation_p.Q882R|NFASC_ENST00000367171.4_Missense_Mutation_p.Q867R|NFASC_ENST00000367170.4_Missense_Mutation_p.Q882R|NFASC_ENST00000401399.1_Intron|NFASC_ENST00000339876.6_Intron|NFASC_ENST00000338586.6_Missense_Mutation_p.Q882R|NFASC_ENST00000367169.4_Intron|NFASC_ENST00000360049.4_Missense_Mutation_p.Q878R			O94856	NFASC_HUMAN	neurofascin	882	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAGAAGAGACAGCAAGCCAGC	0.602																																					p.Q893R		Atlas-SNP	.											.	NFASC	396	.	0			c.A2678G						.						64.0	52.0	56.0					1																	204955096		2203	4300	6503	SO:0001583	missense	23114	exon21			AGAGACAGCAAGC	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000404076.1:c.2582A>G	chr1.hg19:g.204955096A>G	ENSP00000385676:p.Gln861Arg	106.0	0.0		183.0	8.0	NM_001160331	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000404076.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.64	2.595708	0.46318	.	.	ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000404076;ENST00000404907;ENST00000513543;ENST00000430393	T;T;T;T;T;T;T;T;T;T;T	0.57752	0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38;0.38	5.66	5.66	0.87406	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.48767	D	0.000176	T	0.46268	0.1384	L	0.42245	1.32	0.80722	D	1	B;B;B;B;B	0.30973	0.302;0.148;0.051;0.018;0.257	B;B;B;B;B	0.33799	0.115;0.17;0.062;0.032;0.062	T	0.35919	-0.9769	10	0.13470	T	0.59	.	15.5631	0.76266	1.0:0.0:0.0:0.0	.	882;893;878;867;878	O94856;O94856-11;O94856-8;F8W791;O94856-3	NFASC_HUMAN;.;.;.;.	R	882;867;882;882;882;893;878;878;861;878;878;869	ENSP00000356140:Q882R;ENSP00000356139:Q867R;ENSP00000356138:Q882R;ENSP00000342128:Q882R;ENSP00000343509:Q882R;ENSP00000438614:Q878R;ENSP00000353154:Q878R;ENSP00000385676:Q861R;ENSP00000384061:Q878R;ENSP00000425908:Q878R;ENSP00000415031:Q869R	ENSP00000295776:Q893R	Q	+	2	0	NFASC	203221719	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.991000	0.56973	2.153000	0.67306	0.460000	0.39030	CAG	.	.		0.602	NFASC-012	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000131243.1	NM_001005388	
CNTN2	6900	hgsc.bcm.edu	37	1	205031113	205031113	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:205031113A>G	ENST00000331830.4	+	9	1378	c.1094A>G	c.(1093-1095)gAg>gGg	p.E365G	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	365	Ig-like C2-type 4.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CGGAACGGGGAGCCTCTGGCC	0.652											OREG0014144	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.E365G	Melanoma(183;2548 2817 37099 41192)	Atlas-SNP	.											.	CNTN2	116	.	0			c.A1094G						.						16.0	18.0	17.0					1																	205031113		2202	4297	6499	SO:0001583	missense	6900	exon9			ACGGGGAGCCTCT	X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.1094A>G	chr1.hg19:g.205031113A>G	ENSP00000330633:p.Glu365Gly	85.0	0.0	2149	145.0	6.0	NM_005076	P78432|Q5T054	Missense_Mutation	SNP	ENST00000331830.4	hg19	CCDS1449.1	.	.	.	.	.	.	.	.	.	.	A	14.54	2.566387	0.45694	.	.	ENSG00000184144	ENST00000331830	T	0.69040	-0.37	4.94	4.94	0.65067	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.379896	0.22016	N	0.065790	T	0.54679	0.1873	L	0.33137	0.985	0.36963	D	0.893448	B;B;B	0.20052	0.034;0.034;0.041	B;B;B	0.25506	0.061;0.061;0.061	T	0.57556	-0.7791	10	0.37606	T	0.19	.	9.6646	0.39977	0.9158:0.0:0.0842:0.0	.	365;365;256	A1L3A3;Q02246;Q68DA2	.;CNTN2_HUMAN;.	G	365	ENSP00000330633:E365G	ENSP00000330633:E365G	E	+	2	0	CNTN2	203297736	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.753000	0.62183	1.850000	0.53721	0.455000	0.32223	GAG	.	.		0.652	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090080.3	NM_005076	
PLXNA2	5362	hgsc.bcm.edu	37	1	208270080	208270080	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:208270080T>C	ENST00000367033.3	-	7	2637	c.1880A>G	c.(1879-1881)gAt>gGt	p.D627G		NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2	627					axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		CTTACCTTGATCCAGCGGGAT	0.547																																					p.D627G		Atlas-SNP	.											.	PLXNA2	178	.	0			c.A1880G						.						78.0	76.0	77.0					1																	208270080		2203	4300	6503	SO:0001583	missense	5362	exon7			CCTTGATCCAGCG	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.1880A>G	chr1.hg19:g.208270080T>C	ENSP00000356000:p.Asp627Gly	70.0	0.0		123.0	5.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Missense_Mutation	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	5.882	0.346811	0.11126	.	.	ENSG00000076356	ENST00000367033	T	0.00801	5.68	4.92	4.92	0.64577	.	0.100091	0.64402	D	0.000002	T	0.00552	0.0018	N	0.04373	-0.215	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.47861	-0.9084	10	0.02654	T	1	.	10.833	0.46671	0.0:0.0:0.1581:0.8419	.	627	O75051	PLXA2_HUMAN	G	627	ENSP00000356000:D627G	ENSP00000356000:D627G	D	-	2	0	PLXNA2	206336703	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.250000	0.58772	2.072000	0.62099	0.533000	0.62120	GAT	.	.		0.547	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	
INTS7	25896	hgsc.bcm.edu	37	1	212141249	212141249	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:212141249A>G	ENST00000366994.3	-	15	2189	c.2085T>C	c.(2083-2085)gcT>gcC	p.A695A	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Silent_p.A695A|INTS7_ENST00000366993.3_Silent_p.A695A|INTS7_ENST00000440600.2_Silent_p.A646A	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	695					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TTGCTGAGTCAGCATCAAAAG	0.368																																					p.A695A		Atlas-SNP	.											.	INTS7	68	.	0			c.T2085C						.						112.0	115.0	114.0					1																	212141249		2203	4300	6503	SO:0001819	synonymous_variant	25896	exon15			TGAGTCAGCATCA	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.2085T>C	chr1.hg19:g.212141249A>G		45.0	0.0		69.0	4.0	NM_015434	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Silent	SNP	ENST00000366994.3	hg19	CCDS1501.1																																																																																			.	.		0.368	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
RYR2	6262	hgsc.bcm.edu	37	1	237823324	237823324	+	Missense_Mutation	SNP	T	T	C	rs547987180	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:237823324T>C	ENST00000366574.2	+	55	8565	c.8248T>C	c.(8248-8250)Tct>Cct	p.S2750P	RYR2_ENST00000542537.1_Missense_Mutation_p.S2734P|RYR2_ENST00000360064.6_Missense_Mutation_p.S2748P	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2750	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATATTCAGACTCTTCTAAGGT	0.274																																					p.S2750P		Atlas-SNP	.											.	RYR2	1273	.	0			c.T8248C						.						60.0	57.0	58.0					1																	237823324		1803	4058	5861	SO:0001583	missense	6262	exon55			TCAGACTCTTCTA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8248T>C	chr1.hg19:g.237823324T>C	ENSP00000355533:p.Ser2750Pro	90.0	0.0		114.0	6.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	15.93	2.977311	0.53720	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.91792	-2.91;-2.91;-2.91	5.63	5.63	0.86233	Ryanodine receptor Ryr (1);	0.207429	0.33199	N	0.005176	D	0.90184	0.6932	L	0.38175	1.15	0.33503	D	0.590166	P	0.48407	0.91	P	0.47827	0.558	D	0.92876	0.6319	10	0.41790	T	0.15	.	14.4208	0.67183	0.0:0.0:0.0:1.0	.	2750	Q92736	RYR2_HUMAN	P	2750;2748;2734	ENSP00000355533:S2750P;ENSP00000353174:S2748P;ENSP00000443798:S2734P	ENSP00000353174:S2748P	S	+	1	0	RYR2	235889947	0.106000	0.21978	1.000000	0.80357	0.990000	0.78478	0.785000	0.26830	2.142000	0.66516	0.383000	0.25322	TCT	.	.		0.274	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RGS7	6000	hgsc.bcm.edu	37	1	240978079	240978079	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:240978079T>C	ENST00000407727.1	-	11	783		c.e11-2		RGS7_ENST00000446183.2_Splice_Site|RGS7_ENST00000366564.1_Splice_Site|RGS7_ENST00000366565.1_Splice_Site|RGS7_ENST00000331110.7_Splice_Site|RGS7_ENST00000366563.1_Splice_Site|RGS7_ENST00000366562.4_Splice_Site|RGS7_ENST00000348120.2_Splice_Site|RGS7_ENST00000401882.1_Splice_Site			P49802	RGS7_HUMAN	regulator of G-protein signaling 7						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			ATATTTTATCTGAAAAGAGGG	0.323																																					.		Atlas-SNP	.											.	RGS7	308	.	0			c.784-2A>G						.						98.0	105.0	102.0					1																	240978079		2203	4296	6499	SO:0001630	splice_region_variant	6000	exon13			TTTATCTGAAAAG	BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.784-2A>G	chr1.hg19:g.240978079T>C		47.0	0.0		85.0	24.0	NM_002924	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Splice_Site	SNP	ENST00000407727.1	hg19		.	.	.	.	.	.	.	.	.	.	T	24.5	4.535076	0.85812	.	.	ENSG00000182901	ENST00000331110;ENST00000366565;ENST00000366564;ENST00000366563;ENST00000440928;ENST00000348120;ENST00000446183;ENST00000366562;ENST00000407727;ENST00000401882	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7905	0.78357	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RGS7	239044702	1.000000	0.71417	1.000000	0.80357	0.916000	0.54674	7.825000	0.86693	2.324000	0.78689	0.533000	0.62120	.	.	.		0.323	RGS7-204	KNOWN	basic	protein_coding	protein_coding		NM_002924	Intron
TAF1B	9014	hgsc.bcm.edu	37	2	10045015	10045015	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:10045015A>T	ENST00000263663.5	+	9	1023	c.835A>T	c.(835-837)Aaa>Taa	p.K279*	TAF1B_ENST00000396242.3_Nonsense_Mutation_p.K24*	NM_005680.2	NP_005671	Q53T94	TAF1B_HUMAN	TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kDa	279	C-terminal cyclin fold.				gene expression (GO:0010467)|RNA polymerase I transcriptional preinitiation complex assembly at the promoter for the nuclear large rRNA transcript (GO:0001189)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RNA polymerase I core factor complex (GO:0070860)	metal ion binding (GO:0046872)|RNA polymerase I CORE element sequence-specific DNA binding (GO:0001164)|RNA polymerase I CORE element sequence-specific DNA binding transcription factor recruiting transcription factor activity (GO:0001187)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TBP-class protein binding (GO:0017025)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(4)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	14	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					GGACATCTACAAAAAAACAGT	0.328																																					p.K279X		Atlas-SNP	.											TAF1B,NS,carcinoma,0,1	TAF1B	62	.	0			c.A835T						.						75.0	65.0	68.0					2																	10045015		2203	4300	6503	SO:0001587	stop_gained	9014	exon9			ATCTACAAAAAAA	L39061	CCDS33143.1	2p25	2008-06-02	2002-08-29		ENSG00000115750	ENSG00000115750			11533	protein-coding gene	gene with protein product		604904	"""TATA box binding protein (TBP)-associated factor, RNA polymerase I, B, 63kD"""			7801123	Standard	NM_005680		Approved	TAFI63, SL1, RAF1B, RAFI63	uc002qzz.3	Q53T94	OTTHUMG00000151673	ENST00000263663.5:c.835A>T	chr2.hg19:g.10045015A>T	ENSP00000263663:p.Lys279*	58.0	0.0		45.0	0.0	NM_005680	B4DI42|F8WD72|Q15574|Q8WVC3	Nonsense_Mutation	SNP	ENST00000263663.5	hg19	CCDS33143.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.648783	0.87958	.	.	ENSG00000115750	ENST00000263663;ENST00000396242	.	.	.	5.46	0.00658	0.14068	.	0.641420	0.17120	N	0.186264	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.238	2.8251	0.05483	0.6069:0.1237:0.1497:0.1198	.	.	.	.	X	279;24	.	.	K	+	1	0	TAF1B	9962466	0.964000	0.33143	0.630000	0.29268	0.414000	0.31173	0.565000	0.23578	0.355000	0.24131	0.383000	0.25322	AAA	.	.		0.328	TAF1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323426.2	NM_005680	
SMC6	79677	hgsc.bcm.edu	37	2	17898050	17898050	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:17898050T>C	ENST00000448223.2	-	14	1573	c.1304A>G	c.(1303-1305)cAg>cGg	p.Q435R	SMC6_ENST00000402989.1_Missense_Mutation_p.Q435R|SMC6_ENST00000351948.4_Missense_Mutation_p.Q435R|SMC6_ENST00000381272.4_Missense_Mutation_p.Q461R	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	435					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					TATGGCTTGCTGAAACTGTTC	0.308																																					p.Q435R		Atlas-SNP	.											.	SMC6	102	.	0			c.A1304G						.						152.0	145.0	147.0					2																	17898050		2203	4300	6503	SO:0001583	missense	79677	exon14			GCTTGCTGAAACT	AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1304A>G	chr2.hg19:g.17898050T>C	ENSP00000404092:p.Gln435Arg	190.0	0.0		142.0	6.0	NM_001142286	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	ENST00000448223.2	hg19	CCDS1690.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.055288	0.36277	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.73	5.79	4.62	0.57501	RecF/RecN/SMC (1);	0.264860	0.44285	D	0.000465	T	0.27419	0.0673	L	0.59436	1.845	0.39951	D	0.974539	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.13407	0.004;0.005;0.009	T	0.09058	-1.0692	10	0.15066	T	0.55	.	9.7857	0.40675	0.0:0.1389:0.0:0.8611	.	461;461;435	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	R	435;435;461;435;461	ENSP00000404092:Q435R;ENSP00000323439:Q435R;ENSP00000370672:Q461R;ENSP00000384539:Q435R;ENSP00000408644:Q461R	ENSP00000323439:Q435R	Q	-	2	0	SMC6	17761531	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.261000	0.43276	1.012000	0.39366	0.459000	0.35465	CAG	.	.		0.308	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207359.1	NM_024624	
PLB1	151056	hgsc.bcm.edu	37	2	28855824	28855824	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:28855824A>G	ENST00000327757.5	+	56	4060	c.4016A>G	c.(4015-4017)gAc>gGc	p.D1339G	PLB1_ENST00000541605.1_Missense_Mutation_p.D304G|AC074011.2_ENST00000431376.1_RNA|PLB1_ENST00000422425.2_Missense_Mutation_p.D1328G	NM_153021.4	NP_694566.4	Q6P1J6	PLB1_HUMAN	phospholipase B1	1339	4 X 308-326 AA approximate repeats.				glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phospholipid metabolic process (GO:0006644)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	lysophospholipase activity (GO:0004622)|phospholipase A2 activity (GO:0004623)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(31)|ovary(6)|prostate(1)|skin(7)|stomach(2)	69	Acute lymphoblastic leukemia(172;0.155)					GGGGACACTGACCTCACCTTC	0.592																																					p.D1339G		Atlas-SNP	.											.	PLB1	255	.	0			c.A4016G						.						158.0	149.0	152.0					2																	28855824		2203	4300	6503	SO:0001583	missense	151056	exon56			ACACTGACCTCAC		CCDS33168.1, CCDS54340.1	2p23.3	2014-03-14			ENSG00000163803	ENSG00000163803	3.1.1.4, 3.1.1.5		30041	protein-coding gene	gene with protein product		610179				12150957	Standard	NM_153021		Approved	PLB, FLJ30866	uc002rmb.2	Q6P1J6	OTTHUMG00000152014	ENST00000327757.5:c.4016A>G	chr2.hg19:g.28855824A>G	ENSP00000330442:p.Asp1339Gly	125.0	0.0		141.0	7.0	NM_153021	A8KAX2|Q53S03|Q8IUP7|Q96DP9	Missense_Mutation	SNP	ENST00000327757.5	hg19	CCDS33168.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	19.91|19.91|19.91	3.914979|3.914979|3.914979	0.72983|0.72983|0.72983	.|.|.	.|.|.	ENSG00000163803|ENSG00000163803|ENSG00000163803	ENST00000327757;ENST00000422425;ENST00000541605|ENST00000404858|ENST00000436775	T;T;T|.|.	0.14516|.|.	2.5;2.5;2.5|.|.	5.77|5.77|5.77	5.77|5.77|5.77	0.91146|0.91146|0.91146	Esterase, SGNH hydrolase-type (1);Esterase, SGNH hydrolase-type, subgroup (1);Lipase, GDSL (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	D|D|.	0.85414|0.85414|.	0.5691|0.5691|.	H|H|H	0.94183|0.94183|0.94183	3.505|3.505|3.505	0.53688|0.53688|0.53688	D|D|D	0.999973|0.999973|0.999973	D;D|.|.	0.76494|.|.	0.997;0.999|.|.	D;D|.|.	0.69142|.|.	0.962;0.958|.|.	D|D|.	0.89040|0.89040|.	0.3448|0.3448|.	10|5|.	0.54805|.|.	T|.|.	0.06|.|.	-43.4542|-43.4542|-43.4542	12.4895|12.4895|12.4895	0.55891|0.55891|0.55891	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.|.	1328;1339|.|.	Q6P1J6-3;Q6P1J6|.|.	.;PLB1_HUMAN|.|.	G|A|W	1339;1328;304|1327|66	ENSP00000330442:D1339G;ENSP00000416440:D1328G;ENSP00000437426:D304G|.|.	ENSP00000330442:D1339G|.|.	D|T|X	+|+|+	2|1|3	0|0|0	PLB1|PLB1|PLB1	28709328|28709328|28709328	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.984000|0.984000|0.984000	0.44739|0.44739|0.44739	0.845000|0.845000|0.845000	0.48019|0.48019|0.48019	4.827000|4.827000|4.827000	0.62723|0.62723|0.62723	2.215000|2.215000|2.215000	0.71742|0.71742|0.71742	0.459000|0.459000|0.459000	0.35465|0.35465|0.35465	GAC|ACC|TGA	.	.		0.592	PLB1-012	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000353348.2		
BIRC6	57448	hgsc.bcm.edu	37	2	32640568	32640568	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:32640568A>G	ENST00000421745.2	+	10	2343	c.2209A>G	c.(2209-2211)Act>Gct	p.T737A		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	737					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AGACTCAATAACTCCTTGTGC	0.438																																					p.T737A	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.A2209G						.						51.0	50.0	50.0					2																	32640568		2203	4300	6503	SO:0001583	missense	57448	exon10			TCAATAACTCCTT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.2209A>G	chr2.hg19:g.32640568A>G	ENSP00000393596:p.Thr737Ala	96.0	0.0		99.0	4.0	NM_016252	Q9ULD1	Missense_Mutation	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	13.84	2.356660	0.41801	.	.	ENSG00000115760	ENST00000421745	T	0.74632	-0.86	5.46	5.46	0.80206	.	0.057803	0.64402	D	0.000002	T	0.61825	0.2378	N	0.19112	0.55	0.51482	D	0.999926	B	0.29766	0.256	B	0.29077	0.098	T	0.60444	-0.7262	10	0.33141	T	0.24	.	15.825	0.78698	1.0:0.0:0.0:0.0	.	737	Q9NR09	BIRC6_HUMAN	A	737	ENSP00000393596:T737A	ENSP00000393596:T737A	T	+	1	0	BIRC6	32494072	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	8.998000	0.93550	2.198000	0.70561	0.528000	0.53228	ACT	.	.		0.438	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
MSH6	2956	hgsc.bcm.edu	37	2	48010412	48010412	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:48010412T>C	ENST00000234420.5	+	1	192	c.40T>C	c.(40-42)Tct>Cct	p.S14P	MSH6_ENST00000540021.1_Missense_Mutation_p.S14P|MSH6_ENST00000538136.1_5'Flank|RNU6-688P_ENST00000516063.1_RNA	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	14					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			CTTCCCCAAGTCTCCGGCGCT	0.672			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																												p.S14P		Atlas-SNP	.	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	.	MSH6	341	.	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)	c.T40C						.						33.0	31.0	32.0					2																	48010412		2194	4286	6480	SO:0001583	missense	2956	exon1	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	CCCAAGTCTCCGG	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.40T>C	chr2.hg19:g.48010412T>C	ENSP00000234420:p.Ser14Pro	83.0	0.0		93.0	4.0	NM_000179	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	ENST00000234420.5	hg19	CCDS1836.1	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338799	0.60963	.	.	ENSG00000116062	ENST00000234420;ENST00000544857;ENST00000446255;ENST00000540021	D;D	0.87103	-2.04;-2.21	4.64	0.545	0.17190	.	0.280963	0.34676	N	0.003776	T	0.75744	0.3891	L	0.29908	0.895	0.80722	D	1	P;B;P	0.39883	0.567;0.38;0.693	B;B;B	0.38194	0.137;0.07;0.267	T	0.70510	-0.4852	10	0.66056	D	0.02	-10.0552	4.9778	0.14149	0.2736:0.0:0.2141:0.5123	.	14;14;14	B4DF41;P52701;P52701-2	.;MSH6_HUMAN;.	P	14	ENSP00000234420:S14P;ENSP00000446475:S14P	ENSP00000234420:S14P	S	+	1	0	MSH6	47863916	0.975000	0.34042	0.999000	0.59377	0.887000	0.51463	0.482000	0.22276	0.575000	0.29434	0.260000	0.18958	TCT	.	.		0.672	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251180.4	NM_000179	
SPTBN1	6711	hgsc.bcm.edu	37	2	54850714	54850714	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:54850714T>G	ENST00000356805.4	+	10	1444	c.1163T>G	c.(1162-1164)cTc>cGc	p.L388R	SPTBN1_ENST00000333896.5_Missense_Mutation_p.L375R	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	388					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			GAGGGGAAGCTCATCTCTGAC	0.522																																					p.L388R		Atlas-SNP	.											.	SPTBN1	378	.	0			c.T1163G						.						87.0	83.0	85.0					2																	54850714		2203	4300	6503	SO:0001583	missense	6711	exon10			GGAAGCTCATCTC		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.1163T>G	chr2.hg19:g.54850714T>G	ENSP00000349259:p.Leu388Arg	137.0	0.0		126.0	56.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.788548	0.90367	.	.	ENSG00000115306	ENST00000356805;ENST00000389980;ENST00000333896	T;T;T	0.40225	1.04;1.04;1.04	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	T	0.66470	0.2792	M	0.88310	2.945	0.80722	D	1	P;P	0.49253	0.721;0.921	B;P	0.56960	0.414;0.81	T	0.72626	-0.4236	10	0.56958	D	0.05	.	16.0044	0.80349	0.0:0.0:0.0:1.0	.	375;388	Q01082-3;Q01082	.;SPTB2_HUMAN	R	388;388;375	ENSP00000349259:L388R;ENSP00000374630:L388R;ENSP00000334156:L375R	ENSP00000334156:L375R	L	+	2	0	SPTBN1	54704218	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.250000	0.72435	2.191000	0.70037	0.528000	0.53228	CTC	.	.		0.522	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
EML6	400954	hgsc.bcm.edu	37	2	55054765	55054765	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:55054765T>C	ENST00000356458.6	+	5	1108	c.588T>C	c.(586-588)gaT>gaC	p.D196D		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	196						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						AAACAGGGGATCTTCAGACCA	0.423																																					p.D196D		Atlas-SNP	.											.	EML6	85	.	0			c.T588C						.						175.0	148.0	156.0					2																	55054765		692	1591	2283	SO:0001819	synonymous_variant	400954	exon5			AGGGGATCTTCAG		CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.588T>C	chr2.hg19:g.55054765T>C		101.0	0.0		113.0	7.0	NM_001039753	A8MUB5|B6ZDG7	Silent	SNP	ENST00000356458.6	hg19	CCDS46286.1																																																																																			.	.		0.423	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000324997.3	XM_001725002	
EFEMP1	2202	hgsc.bcm.edu	37	2	56149567	56149567	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:56149567T>C	ENST00000394555.2	-	2	444	c.9A>G	c.(7-9)aaA>aaG	p.K3K	EFEMP1_ENST00000355426.3_Silent_p.K3K|EFEMP1_ENST00000424836.2_5'UTR|EFEMP1_ENST00000394554.1_Silent_p.K3K|EFEMP1_ENST00000497698.1_5'UTR	NM_001039348.2|NM_001039349.2	NP_001034437.1|NP_001034438.1	Q12805	FBLN3_HUMAN	EGF containing fibulin-like extracellular matrix protein 1	3					epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|negative regulation of chondrocyte differentiation (GO:0032331)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|epidermal growth factor-activated receptor activity (GO:0005006)			NS(1)|breast(2)|endometrium(4)|large_intestine(6)|lung(5)|ovary(5)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGAAAAGGGCTTTCAACATTG	0.428																																					p.K3K	GBM(92;934 1319 7714 28760 40110)	Atlas-SNP	.											.	EFEMP1	81	.	0			c.A9G						.						144.0	135.0	138.0					2																	56149567		2203	4300	6503	SO:0001819	synonymous_variant	2202	exon2			AAGGGCTTTCAAC	U03877	CCDS1857.1	2p16	2013-01-08	2011-01-25		ENSG00000115380	ENSG00000115380		"""Fibulins"""	3218	protein-coding gene	gene with protein product	"""fibulin 3"""	601548	"""fibrillin-like"", ""EGF-containing fibulin-like extracellular matrix protein 1"""	DHRD, FBNL		8812496, 7799918	Standard	NM_001039348		Approved	S1-5, FBLN3, MTLV	uc002rzi.3	Q12805	OTTHUMG00000129343	ENST00000394555.2:c.9A>G	chr2.hg19:g.56149567T>C		91.0	0.0		124.0	5.0	NM_001039349	A8K3I4|B4DW75|D6W5D2|Q541U7	Silent	SNP	ENST00000394555.2	hg19	CCDS1857.1																																																																																			.	.		0.428	EFEMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251491.2		
EHBP1	23301	hgsc.bcm.edu	37	2	63086343	63086343	+	Missense_Mutation	SNP	A	A	G	rs145562120	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:63086343A>G	ENST00000263991.5	+	9	1261	c.779A>G	c.(778-780)aAg>aGg	p.K260R	EHBP1_ENST00000354487.3_Missense_Mutation_p.K225R|EHBP1_ENST00000405289.1_Missense_Mutation_p.K225R|EHBP1_ENST00000431489.1_Missense_Mutation_p.K225R|AC007098.1_ENST00000452397.1_RNA|EHBP1_ENST00000405015.3_Missense_Mutation_p.K225R	NM_015252.3	NP_056067.2	Q8NDI1	EHBP1_HUMAN	EH domain binding protein 1	260						cytoplasm (GO:0005737)|membrane (GO:0016020)				biliary_tract(1)|breast(3)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(8)|lung(22)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	47	Lung NSC(7;0.0951)|all_lung(7;0.169)		LUSC - Lung squamous cell carcinoma(7;7.74e-05)|Epithelial(17;0.189)			GAAGCAGAAAAGGACTTGGCC	0.363																																					p.K260R		Atlas-SNP	.											.	EHBP1	127	.	0			c.A779G						.						121.0	119.0	120.0					2																	63086343		2203	4300	6503	SO:0001583	missense	23301	exon9			CAGAAAAGGACTT	AL833968	CCDS1872.1, CCDS46299.1, CCDS46300.1	2p15	2008-02-05			ENSG00000115504	ENSG00000115504			29144	protein-coding gene	gene with protein product		609922				10048485	Standard	NM_015252		Approved	KIAA0903, NACSIN	uc002sby.3	Q8NDI1	OTTHUMG00000129453	ENST00000263991.5:c.779A>G	chr2.hg19:g.63086343A>G	ENSP00000263991:p.Lys260Arg	99.0	0.0		89.0	4.0	NM_015252	O94977|Q53TG7|Q53TV6|Q580X2|Q6NX72|Q6PIT3|Q6QNV2|Q9NWI9	Missense_Mutation	SNP	ENST00000263991.5	hg19	CCDS1872.1	.	.	.	.	.	.	.	.	.	.	A	9.631	1.136458	0.21123	.	.	ENSG00000115504	ENST00000405015;ENST00000405482;ENST00000431489;ENST00000263991;ENST00000354487;ENST00000405289	T;T;T;T;T;T	0.73363	-0.71;0.96;-0.71;-0.74;-0.71;-0.71	4.88	4.88	0.63580	.	0.312268	0.32314	N	0.006264	T	0.55862	0.1947	N	0.16478	0.41	0.33647	D	0.607964	B;B;B	0.11235	0.004;0.001;0.001	B;B;B	0.09377	0.004;0.001;0.002	T	0.60016	-0.7345	10	0.27082	T	0.32	.	9.1039	0.36685	0.9173:0.0:0.0827:0.0	.	225;225;260	Q8NDI1-2;Q8NDI1-3;Q8NDI1	.;.;EHBP1_HUMAN	R	225;225;225;260;225;225	ENSP00000384143:K225R;ENSP00000384829:K225R;ENSP00000403783:K225R;ENSP00000263991:K260R;ENSP00000346482:K225R;ENSP00000385524:K225R	ENSP00000263991:K260R	K	+	2	0	EHBP1	62939847	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	4.393000	0.59665	1.835000	0.53391	0.482000	0.46254	AAG	.	A|1.000;C|0.000		0.363	EHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251616.1	NM_015252	
ETAA1	54465	hgsc.bcm.edu	37	2	67632364	67632364	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:67632364A>G	ENST00000272342.5	+	5	2680	c.2550A>G	c.(2548-2550)acA>acG	p.T850T	ETAA1_ENST00000462772.1_3'UTR	NM_019002.3	NP_061875.2	Q9NY74	ETAA1_HUMAN	Ewing tumor-associated antigen 1	850						cytoplasm (GO:0005737)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(3)|prostate(1)|stomach(3)|urinary_tract(1)	33						CCAAAATTACACAGGGTGTGG	0.338																																					p.T850T		Atlas-SNP	.											.	ETAA1	88	.	0			c.A2550G						.						38.0	39.0	39.0					2																	67632364		2199	4292	6491	SO:0001819	synonymous_variant	54465	exon5			AATTACACAGGGT	AJ242682	CCDS1882.1	2p14	2014-02-12	2007-10-04		ENSG00000143971	ENSG00000143971			24648	protein-coding gene	gene with protein product		613196	"""Ewing's tumor-associated antigen 1"""			16003559	Standard	XM_005264374		Approved	ETAA16	uc002sdz.1	Q9NY74	OTTHUMG00000129545	ENST00000272342.5:c.2550A>G	chr2.hg19:g.67632364A>G		125.0	0.0		132.0	7.0	NM_019002	Q05BT7|Q53SC4	Silent	SNP	ENST00000272342.5	hg19	CCDS1882.1																																																																																			.	.		0.338	ETAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251735.1	NM_019002	
NAGK	55577	hgsc.bcm.edu	37	2	71297898	71297898	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:71297898A>G	ENST00000244204.6	+	3	204	c.142A>G	c.(142-144)Agg>Ggg	p.R48G	NAGK_ENST00000455662.2_Missense_Mutation_p.R94G|NAGK_ENST00000428360.2_3'UTR|NAGK_ENST00000418807.3_5'UTR|NAGK_ENST00000443938.2_Missense_Mutation_p.R48G|NAGK_ENST00000443872.2_Intron|RP11-467P9.1_ENST00000608897.1_lincRNA			Q9UJ70	NAGK_HUMAN	N-acetylglucosamine kinase	48					carbohydrate phosphorylation (GO:0046835)|N-acetylglucosamine metabolic process (GO:0006044)|N-acetylmannosamine metabolic process (GO:0006051)|N-acetylneuraminate catabolic process (GO:0019262)	extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|N-acetylglucosamine kinase activity (GO:0045127)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|urinary_tract(1)	18					N-Acetyl-D-glucosamine(DB00141)	GTGTGTGGAGAGGATCAATGA	0.557											OREG0014689	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R94G		Atlas-SNP	.											.	NAGK	34	.	0			c.A280G						.						149.0	138.0	142.0					2																	71297898		2203	4300	6503	SO:0001583	missense	55577	exon3			GTGGAGAGGATCA	AJ242910	CCDS33220.1, CCDS33220.2	2p24.3-p24.1	2008-02-05			ENSG00000124357	ENSG00000124357	2.7.1.59		17174	protein-coding gene	gene with protein product		606828				10824116	Standard	NM_017567		Approved	GNK	uc002shp.4	Q9UJ70	OTTHUMG00000153239	ENST00000244204.6:c.142A>G	chr2.hg19:g.71297898A>G	ENSP00000244204:p.Arg48Gly	100.0	0.0	1128	107.0	5.0	NM_017567	B4DLZ5|Q53HD5|Q6IA84|Q9BS29|Q9BVP0|Q9NV37	Missense_Mutation	SNP	ENST00000244204.6	hg19		.	.	.	.	.	.	.	.	.	.	A	13.81	2.348708	0.41599	.	.	ENSG00000124357	ENST00000244204;ENST00000455662	T;T	0.30981	1.51;1.51	4.95	3.78	0.43462	ATPase, BadF/BadG/BcrA/BcrD type (1);	0.345509	0.32134	N	0.006538	T	0.19248	0.0462	L	0.37561	1.115	0.45378	D	0.998367	B	0.24882	0.113	B	0.20767	0.031	T	0.07328	-1.0778	10	0.21014	T	0.42	-34.1254	4.9744	0.14133	0.7183:0.1888:0.0929:0.0	.	48	Q9UJ70	NAGK_HUMAN	G	48;94	ENSP00000244204:R48G;ENSP00000389087:R94G	ENSP00000244204:R48G	R	+	1	2	NAGK	71151406	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	1.321000	0.33678	0.890000	0.36211	-0.461000	0.05368	AGG	.	.		0.557	NAGK-032	NOVEL	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000471889.1		
DYSF	8291	hgsc.bcm.edu	37	2	71908171	71908171	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:71908171A>G	ENST00000258104.3	+	53	6264	c.5987A>G	c.(5986-5988)gAg>gGg	p.E1996G	DYSF_ENST00000409366.1_Missense_Mutation_p.E2018G|DYSF_ENST00000410041.1_Missense_Mutation_p.E2014G|DYSF_ENST00000410020.3_Missense_Mutation_p.E2035G|DYSF_ENST00000394120.2_Missense_Mutation_p.E1997G|DYSF_ENST00000429174.2_Missense_Mutation_p.E2017G|DYSF_ENST00000409651.1_Missense_Mutation_p.E2028G|DYSF_ENST00000479049.2_3'UTR|DYSF_ENST00000413539.2_Missense_Mutation_p.E2027G|DYSF_ENST00000409762.1_Missense_Mutation_p.E2013G|DYSF_ENST00000409744.1_Missense_Mutation_p.E2004G|DYSF_ENST00000409582.3_Missense_Mutation_p.E2034G	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	1996					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						GCAGAGAGTGAGCATGAGGAG	0.612																																					p.E2035G		Atlas-SNP	.											DYSF_ENST00000410020,colon,carcinoma,0,2	DYSF	536	.	0			c.A6104G						.						62.0	58.0	60.0					2																	71908171		2203	4300	6503	SO:0001583	missense	8291	exon54			AGAGTGAGCATGA	AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.5987A>G	chr2.hg19:g.71908171A>G	ENSP00000258104:p.Glu1996Gly	70.0	0.0		92.0	4.0	NM_001130987	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Missense_Mutation	SNP	ENST00000258104.3	hg19	CCDS1918.1	.	.	.	.	.	.	.	.	.	.	A	29.7	5.026828	0.93518	.	.	ENSG00000135636	ENST00000413539;ENST00000409762;ENST00000409582;ENST00000429174;ENST00000258104;ENST00000409651;ENST00000394120;ENST00000409744;ENST00000409366;ENST00000410020;ENST00000410041	D;D;D;D;D;D;D;D;D;D;D	0.86865	-2.18;-2.17;-2.17;-2.16;-2.17;-2.18;-2.17;-2.16;-2.16;-2.17;-2.17	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	D	0.94673	0.8282	M	0.91612	3.225	0.58432	D	0.999999	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.993;1.0;1.0;1.0;0.999;0.999;0.999;0.999;1.0;1.0;0.999;1.0;0.999;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.964;0.999;0.999;0.999;0.999;0.982;0.991;0.982;0.995;0.999;0.991;0.998;0.999;0.999;0.998	D	0.95565	0.8633	10	0.87932	D	0	-36.0147	14.3168	0.66457	1.0:0.0:0.0:0.0	.	760;2028;2035;2018;1983;2014;2004;2013;2003;2027;2034;2017;1982;1997;1996	B7Z8G4;O75923-8;O75923-13;O75923-10;O75923-9;O75923-11;O75923-12;O75923-5;O75923-6;O75923-2;O75923-7;O75923-4;O75923-3;O75923-14;O75923	.;.;.;.;.;.;.;.;.;.;.;.;.;.;DYSF_HUMAN	G	2027;2013;2034;2017;1996;2028;1997;2004;2018;2035;2014	ENSP00000407046:E2027G;ENSP00000387137:E2013G;ENSP00000386547:E2034G;ENSP00000398305:E2017G;ENSP00000258104:E1996G;ENSP00000386683:E2028G;ENSP00000377678:E1997G;ENSP00000386285:E2004G;ENSP00000386512:E2018G;ENSP00000386881:E2035G;ENSP00000386617:E2014G	ENSP00000258104:E1996G	E	+	2	0	DYSF	71761679	1.000000	0.71417	0.995000	0.50966	0.976000	0.68499	9.253000	0.95501	2.263000	0.75096	0.533000	0.62120	GAG	.	.		0.612	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251970.3	NM_003494	
DCTN1	1639	hgsc.bcm.edu	37	2	74600056	74600056	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:74600056T>C	ENST00000361874.3	-	7	769	c.452A>G	c.(451-453)aAg>aGg	p.K151R	DCTN1_ENST00000409567.3_Intron|DCTN1_ENST00000394003.3_Splice_Site_p.K144R|DCTN1_ENST00000407639.2_Splice_Site_p.K17R|DCTN1_ENST00000409868.1_Splice_Site_p.K134R|DCTN1_ENST00000409438.1_Splice_Site_p.K17R|DCTN1_ENST00000409240.1_Intron	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	151					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						TTTTCTCACCTTGGGTCGCCG	0.517																																					p.K151R		Atlas-SNP	.											.	DCTN1	110	.	0			c.A452G						.						103.0	90.0	94.0					2																	74600056		2203	4300	6503	SO:0001630	splice_region_variant	1639	exon7			CTCACCTTGGGTC		CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.453+1A>G	chr2.hg19:g.74600056T>C		97.0	0.0		90.0	4.0	NM_004082	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Missense_Mutation	SNP	ENST00000361874.3	hg19	CCDS1939.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.821546	0.32237	.	.	ENSG00000204843	ENST00000361874;ENST00000394003;ENST00000407639;ENST00000409438;ENST00000409868;ENST00000458655	T;T;T;T;T;T	0.74632	-0.64;-0.86;-0.72;-0.72;-0.83;-0.57	5.07	5.07	0.68467	.	.	.	.	.	T	0.72598	0.3480	N	0.14661	0.345	0.53005	D	0.999969	P;B;D;D	0.56035	0.956;0.037;0.974;0.974	P;B;D;D	0.67725	0.899;0.005;0.953;0.953	T	0.68903	-0.5286	9	0.17369	T	0.5	.	14.2566	0.66055	0.0:0.0:0.0:1.0	.	151;144;17;17	Q14203;A8MY36;Q14203-2;G5E9H4	DCTN1_HUMAN;.;.;.	R	151;144;17;17;134;158	ENSP00000354791:K151R;ENSP00000377571:K144R;ENSP00000384844:K17R;ENSP00000387270:K17R;ENSP00000387327:K134R;ENSP00000414315:K158R	ENSP00000354791:K151R	K	-	2	0	DCTN1	74453564	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.069000	0.71209	2.261000	0.74972	0.459000	0.35465	AAG	.	.		0.517	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252227.3	NM_004082	Missense_Mutation
DNAH6	1768	hgsc.bcm.edu	37	2	84822906	84822906	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:84822906A>G	ENST00000237449.6	+	17	2869	c.2861A>G	c.(2860-2862)aAa>aGa	p.K954R	DNAH6_ENST00000389394.3_Missense_Mutation_p.K954R|DNAH6_ENST00000398278.2_Missense_Mutation_p.K954R			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	954	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						GAAAAAATGAAAGAAAAGGTA	0.368																																					p.K954R		Atlas-SNP	.											.	DNAH6	194	.	0			c.A2861G						.						100.0	94.0	96.0					2																	84822906		692	1591	2283	SO:0001583	missense	1768	exon18			AAATGAAAGAAAA	U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2861A>G	chr2.hg19:g.84822906A>G	ENSP00000237449:p.Lys954Arg	33.0	0.0		27.0	4.0	NM_001370	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	ENST00000237449.6	hg19	CCDS46348.1	.	.	.	.	.	.	.	.	.	.	A	10.63	1.404845	0.25378	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.64260	-0.09;-0.09;-0.09	5.82	4.68	0.58851	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.40595	0.1123	N	0.10760	0.04	0.32173	N	0.581378	B	0.16603	0.018	B	0.20184	0.028	T	0.44787	-0.9305	9	0.24483	T	0.36	.	10.425	0.44373	0.9227:0.0:0.0773:0.0	.	954	Q9C0G6	DYH6_HUMAN	R	954	ENSP00000374045:K954R;ENSP00000381326:K954R;ENSP00000237449:K954R	ENSP00000237449:K954R	K	+	2	0	DNAH6	84676417	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	2.301000	0.43628	2.215000	0.71742	0.528000	0.53228	AAA	.	.		0.368	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328537.2	NM_001370	
CFAP221	200373	hgsc.bcm.edu	37	2	120366133	120366133	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:120366133G>A	ENST00000413369.3	+	12	1276	c.1189G>A	c.(1189-1191)Gaa>Aaa	p.E397K	PCDP1_ENST00000602047.1_Missense_Mutation_p.E111K|PCDP1_ENST00000597189.1_Intron	NM_001271049.1	NP_001257978																Colorectal(110;0.196)					AGAGCTTACTGAAGAGTGGCA	0.363																																					p.E397K		Atlas-SNP	.											.	.	.	.	0			c.G1189A						.						141.0	153.0	149.0					2																	120366133		2203	4300	6503	SO:0001583	missense	0	exon12			CTTACTGAAGAGT																												ENST00000413369.3:c.1189G>A	chr2.hg19:g.120366133G>A	ENSP00000393222:p.Glu397Lys	84.0	0.0		100.0	4.0	NM_001271049		Missense_Mutation	SNP	ENST00000413369.3	hg19	CCDS33282.2	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530334	0.27387	.	.	ENSG00000163075	ENST00000295220;ENST00000413369	T	0.27104	1.69	4.65	3.76	0.43208	.	0.093605	0.46442	D	0.000282	T	0.15609	0.0376	N	0.16368	0.405	0.38273	D	0.942199	B;B	0.34200	0.441;0.254	B;B	0.33846	0.171;0.055	T	0.10200	-1.0640	10	0.62326	D	0.03	-21.1996	10.2713	0.43485	0.0979:0.0:0.902:0.0	.	241;397	Q4G0U5-3;Q4G0U5	.;PCDP1_HUMAN	K	111;397	ENSP00000393222:E397K	ENSP00000295220:E111K	E	+	1	0	AC069154.2	120082603	1.000000	0.71417	0.473000	0.27253	0.012000	0.07955	3.786000	0.55431	2.558000	0.86282	0.655000	0.94253	GAA	.	.		0.363	PCDP1-006	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464236.1		
MAP3K2	10746	hgsc.bcm.edu	37	2	128075251	128075251	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:128075251T>C	ENST00000409947.1	-	14	1562	c.1280A>G	c.(1279-1281)gAt>gGt	p.D427G	RNU6-1147P_ENST00000363380.1_RNA|MAP3K2_ENST00000344908.5_Missense_Mutation_p.D427G			Q9Y2U5	M3K2_HUMAN	mitogen-activated protein kinase kinase kinase 2	427	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPK activity (GO:0000187)|cellular response to mechanical stimulus (GO:0071260)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|large_intestine(1)|lung(3)|ovary(2)	7	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0706)	Bosutinib(DB06616)	TTCCTGGGGATCCCTCAAACA	0.328																																					p.D427G		Atlas-SNP	.											.	MAP3K2	78	.	0			c.A1280G						.						51.0	48.0	49.0					2																	128075251		1821	4079	5900	SO:0001583	missense	10746	exon13			TGGGGATCCCTCA	AF111105	CCDS46404.1	2q21.1	2011-06-09			ENSG00000169967	ENSG00000169967		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6854	protein-coding gene	gene with protein product	"""MAP/ERK kinase kinase 2"""	609487		MEKK2		8621389, 10085062	Standard	NM_006609		Approved	MEKK2B	uc002toj.2	Q9Y2U5	OTTHUMG00000153397	ENST00000409947.1:c.1280A>G	chr2.hg19:g.128075251T>C	ENSP00000387246:p.Asp427Gly	73.0	0.0		60.0	4.0	NM_006609	B9EG87|Q53QL9|Q53S75|Q59GZ6|Q8NC32|Q9NYK3	Missense_Mutation	SNP	ENST00000409947.1	hg19	CCDS46404.1	.	.	.	.	.	.	.	.	.	.	T	27.3	4.816622	0.90790	.	.	ENSG00000169967	ENST00000409947;ENST00000344908	T;T	0.67345	-0.26;-0.26	5.94	5.94	0.96194	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.041858	0.85682	D	0.000000	T	0.70962	0.3284	L	0.60067	1.865	0.80722	D	1	P	0.37423	0.594	B	0.44224	0.444	T	0.73503	-0.3962	10	0.72032	D	0.01	.	16.3891	0.83525	0.0:0.0:0.0:1.0	.	427	Q9Y2U5	M3K2_HUMAN	G	427	ENSP00000387246:D427G;ENSP00000343463:D427G	ENSP00000343463:D427G	D	-	2	0	MAP3K2	127791721	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.953000	0.87836	2.276000	0.75962	0.397000	0.26171	GAT	.	.		0.328	MAP3K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331014.1	NM_006609	
GPR17	2840	hgsc.bcm.edu	37	2	128408877	128408877	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:128408877T>C	ENST00000272644.3	+	3	726	c.652T>C	c.(652-654)Tcc>Ccc	p.S218P	GPR17_ENST00000486700.1_3'UTR|LIMS2_ENST00000409254.1_5'Flank|GPR17_ENST00000544369.1_Missense_Mutation_p.S218P|LIMS2_ENST00000410011.1_Intron|LIMS2_ENST00000409455.1_Intron|GPR17_ENST00000393018.3_Missense_Mutation_p.S218P|LIMS2_ENST00000545738.2_Intron|LIMS2_ENST00000409808.2_Intron|LIMS2_ENST00000355119.4_Intron|LIMS2_ENST00000324938.5_Intron	NM_001161416.1|NM_001161417.1|NM_005291.2	NP_001154888.1|NP_001154889.1|NP_005282.1	Q13304	GPR17_HUMAN	G protein-coupled receptor 17	218					chemokine-mediated signaling pathway (GO:0070098)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chemokine receptor activity (GO:0004950)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|prostate(2)|urinary_tract(1)	19	Colorectal(110;0.1)	Ovarian(717;0.15)		BRCA - Breast invasive adenocarcinoma(221;0.0677)		GGAGAAGGCCTCCCACCATGC	0.662																																					p.S218P		Atlas-SNP	.											.	GPR17	56	.	0			c.T652C						.						115.0	104.0	108.0					2																	128408877		2203	4300	6503	SO:0001583	missense	2840	exon3			AAGGCCTCCCACC		CCDS2148.1	2q21	2014-01-30			ENSG00000144230	ENSG00000144230		"""GPCR / Class A : Orphans"""	4471	protein-coding gene	gene with protein product		603071				8558062	Standard	NM_001161415		Approved		uc002tpc.3	Q13304	OTTHUMG00000131533	ENST00000272644.3:c.652T>C	chr2.hg19:g.128408877T>C	ENSP00000272644:p.Ser218Pro	77.0	0.0		112.0	5.0	NM_005291	A8K9L0|B2R9X0|Q8N5S7|Q9UDZ6|Q9UE21	Missense_Mutation	SNP	ENST00000272644.3	hg19	CCDS2148.1	.	.	.	.	.	.	.	.	.	.	t	18.51	3.639747	0.67244	.	.	ENSG00000144230	ENST00000544369;ENST00000272644;ENST00000393018	T;T;T	0.37752	1.18;1.18;1.18	5.21	5.21	0.72293	GPCR, rhodopsin-like superfamily (1);	0.105408	0.56097	D	0.000032	T	0.47469	0.1447	L	0.37750	1.13	0.80722	D	1	D	0.69078	0.997	D	0.67548	0.952	T	0.31641	-0.9936	10	0.27082	T	0.32	.	15.0785	0.72096	0.0:0.0:0.0:1.0	.	218	Q13304	GPR17_HUMAN	P	218	ENSP00000442982:S218P;ENSP00000272644:S218P;ENSP00000376741:S218P	ENSP00000272644:S218P	S	+	1	0	GPR17	128125347	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	8.012000	0.88631	1.971000	0.57363	0.379000	0.24179	TCC	.	.		0.662	GPR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254390.1		
LRP1B	53353	hgsc.bcm.edu	37	2	141457981	141457981	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:141457981T>C	ENST00000389484.3	-	41	7608	c.6637A>G	c.(6637-6639)Agg>Ggg	p.R2213G		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2213					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TCATATGGCCTTATTGGGGAA	0.348										TSP Lung(27;0.18)																											p.R2213G	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											.	LRP1B	1315	.	0			c.A6637G						.						123.0	131.0	129.0					2																	141457981		2203	4300	6503	SO:0001583	missense	53353	exon41			ATGGCCTTATTGG	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.6637A>G	chr2.hg19:g.141457981T>C	ENSP00000374135:p.Arg2213Gly	119.0	0.0		93.0	5.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598198	0.46318	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91351	-2.83	4.47	1.77	0.24775	Six-bladed beta-propeller, TolB-like (1);	0.079529	0.51477	U	0.000087	D	0.84678	0.5525	L	0.43152	1.355	0.27563	N	0.950117	B	0.19583	0.037	B	0.16722	0.016	T	0.70579	-0.4833	10	0.20046	T	0.44	.	12.3099	0.54922	0.0:0.0:0.5484:0.4516	.	2213	Q9NZR2	LRP1B_HUMAN	G	2213;2151	ENSP00000374135:R2213G	ENSP00000374135:R2213G	R	-	1	2	LRP1B	141174451	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.516000	0.35856	0.639000	0.30564	0.477000	0.44152	AGG	.	.		0.348	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	
SLC4A10	57282	hgsc.bcm.edu	37	2	162821621	162821621	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:162821621A>G	ENST00000446997.1	+	23	3190	c.3097A>G	c.(3097-3099)Agc>Ggc	p.S1033G	SLC4A10_ENST00000421911.1_Missense_Mutation_p.S1033G|SLC4A10_ENST00000415876.2_Missense_Mutation_p.S1003G|SLC4A10_ENST00000272716.5_Missense_Mutation_p.S1003G|SLC4A10_ENST00000375514.5_Missense_Mutation_p.S1014G	NM_001178015.1	NP_001171486.1	Q6U841	S4A10_HUMAN	solute carrier family 4, sodium bicarbonate transporter, member 10	1033				S -> C (in Ref. 1; BAB18301). {ECO:0000305}.	bicarbonate transport (GO:0015701)|chloride transport (GO:0006821)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|symporter activity (GO:0015293)			endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(9)|lung(35)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60					Sodium bicarbonate(DB01390)	GCGGGAACTCAGCTGGTTGGA	0.338																																					p.S1033G		Atlas-SNP	.											.	SLC4A10	309	.	0			c.A3097G						.						86.0	80.0	82.0					2																	162821621		1816	4090	5906	SO:0001583	missense	57282	exon23			GAACTCAGCTGGT		CCDS46438.1, CCDS54411.1, CCDS54412.1	2q24.2	2013-05-22	2008-09-15		ENSG00000144290	ENSG00000144290		"""Solute carriers"""	13811	protein-coding gene	gene with protein product		605556	"""solute carrier family 4, sodium bicarbonate transporter-like, member 10"""			10964153, 18319254	Standard	NM_022058		Approved	NBCn2, NCBE	uc002ubx.4	Q6U841	OTTHUMG00000153938	ENST00000446997.1:c.3097A>G	chr2.hg19:g.162821621A>G	ENSP00000393066:p.Ser1033Gly	86.0	0.0		88.0	4.0	NM_001178015	B7Z1R0|B7Z2J0|B7ZLC5|B9EG69|F8W675|Q4ZFX6|Q8TCP2|Q9HCQ6	Missense_Mutation	SNP	ENST00000446997.1	hg19	CCDS54411.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.143451	0.77888	.	.	ENSG00000144290	ENST00000375514;ENST00000415876;ENST00000272716;ENST00000449513;ENST00000446997;ENST00000421911;ENST00000415711	T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.85106	0.5621	M	0.90369	3.11	0.80722	D	1	D;D;B	0.89917	1.0;1.0;0.438	D;D;B	0.91635	0.999;0.999;0.302	D	0.87276	0.2289	10	0.52906	T	0.07	.	16.3839	0.83495	1.0:0.0:0.0:0.0	.	1014;1003;1033	F8W675;Q6U841-2;Q6U841	.;.;S4A10_HUMAN	G	1014;1003;1003;1002;1033;1033;1032	ENSP00000364664:S1014G;ENSP00000395797:S1003G;ENSP00000272716:S1003G;ENSP00000393066:S1033G;ENSP00000404486:S1033G	ENSP00000272716:S1003G	S	+	1	0	SLC4A10	162529867	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.339000	0.96797	2.258000	0.74832	0.533000	0.62120	AGC	.	.		0.338	SLC4A10-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333090.1	NM_022058	
XIRP2	129446	hgsc.bcm.edu	37	2	168104144	168104144	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:168104144G>A	ENST00000409195.1	+	9	6331	c.6242G>A	c.(6241-6243)aGa>aAa	p.R2081K	XIRP2_ENST00000409273.1_Missense_Mutation_p.R1859K|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.R2081K|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409605.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1906					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TATATGAGCAGACAATTAACT	0.373																																					p.R2081K		Atlas-SNP	.											.	XIRP2	914	.	0			c.G6242A						.						63.0	57.0	59.0					2																	168104144		1910	4135	6045	SO:0001583	missense	129446	exon9			TGAGCAGACAATT	AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.6242G>A	chr2.hg19:g.168104144G>A	ENSP00000386840:p.Arg2081Lys	155.0	0.0		158.0	71.0	NM_152381	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	ENST00000409195.1	hg19	CCDS42769.1	.	.	.	.	.	.	.	.	.	.	G	5.477	0.273026	0.10349	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.20332	2.08;2.08;2.08	5.92	0.254	0.15557	.	0.894418	0.09823	N	0.751235	T	0.08935	0.0221	N	0.08118	0	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.04013	0.0;0.001;0.001	T	0.37079	-0.9721	10	0.06099	T	0.92	-0.3941	9.7961	0.40735	0.5242:0.0:0.4758:0.0	.	1906;1906;1859	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	K	2081;2081;1859	ENSP00000386840:R2081K;ENSP00000295237:R2081K;ENSP00000387255:R1859K	ENSP00000295237:R2081K	R	+	2	0	XIRP2	167812390	0.002000	0.14202	0.004000	0.12327	0.180000	0.23129	0.460000	0.21924	-0.010000	0.14271	0.650000	0.86243	AGA	.	.		0.373	XIRP2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000333547.1	NM_152381	
OSBPL6	114880	hgsc.bcm.edu	37	2	179197376	179197376	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:179197376A>G	ENST00000190611.4	+	7	757	c.381A>G	c.(379-381)aaA>aaG	p.K127K	OSBPL6_ENST00000359685.3_Silent_p.K127K|OSBPL6_ENST00000392505.2_Silent_p.K127K|OSBPL6_ENST00000357080.4_Silent_p.K127K|OSBPL6_ENST00000409045.3_Silent_p.K127K|OSBPL6_ENST00000477097.1_3'UTR|OSBPL6_ENST00000315022.2_Silent_p.K106K|OSBPL6_ENST00000409631.1_Silent_p.K127K	NM_032523.3	NP_115912.1	Q9BZF3	OSBL6_HUMAN	oxysterol binding protein-like 6	127	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				lipid transport (GO:0006869)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(18)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00578)|Epithelial(96;0.00847)|all cancers(119;0.0335)			AGATTCAGAAAGGAAAGGTCC	0.353																																					p.K127K		Atlas-SNP	.											.	OSBPL6	178	.	0			c.A381G						.						96.0	101.0	99.0					2																	179197376		2203	4300	6503	SO:0001819	synonymous_variant	114880	exon7			TCAGAAAGGAAAG	AF392448	CCDS2277.1, CCDS2278.1, CCDS56150.1, CCDS56151.1, CCDS56152.1	2q32.1	2008-05-27			ENSG00000079156	ENSG00000079156		"""Oxysterol binding proteins"""	16388	protein-coding gene	gene with protein product	"""OSBP-related protein 6"""	606734				11483621	Standard	NM_001201480		Approved	ORP6	uc002uly.3	Q9BZF3	OTTHUMG00000132579	ENST00000190611.4:c.381A>G	chr2.hg19:g.179197376A>G		108.0	0.0		113.0	5.0	NM_001201482	B4DTW1|C4AMC0|C4AME4|D3DPF6|D3DPF7|Q4ZG68|Q53T68|Q59H61|Q7Z4Q1|Q86V84|Q8N9T0|Q96SR1	Silent	SNP	ENST00000190611.4	hg19	CCDS2277.1																																																																																			.	.		0.353	OSBPL6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000334393.2	NM_032523	
ZNF804A	91752	hgsc.bcm.edu	37	2	185800820	185800820	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:185800820T>C	ENST00000302277.6	+	4	1291	c.697T>C	c.(697-699)Ttc>Ctc	p.F233L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	233							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						AGCTGCAGCCTTCTCTGAATA	0.453																																					p.F233L		Atlas-SNP	.											.	ZNF804A	322	.	0			c.T697C						.						78.0	77.0	77.0					2																	185800820		2203	4299	6502	SO:0001583	missense	91752	exon4			GCAGCCTTCTCTG	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.697T>C	chr2.hg19:g.185800820T>C	ENSP00000303252:p.Phe233Leu	115.0	0.0		120.0	5.0	NM_194250	A7E253|Q6ZN26	Missense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.505633	0.85282	.	.	ENSG00000170396	ENST00000302277	T	0.40756	1.02	5.22	5.22	0.72569	.	0.000000	0.56097	D	0.000026	T	0.65417	0.2689	M	0.78456	2.415	0.50632	D	0.999881	D	0.89917	1.0	D	0.83275	0.996	T	0.70513	-0.4851	10	0.87932	D	0	-14.2051	14.2738	0.66167	0.0:0.0:0.0:1.0	.	233	Q7Z570	Z804A_HUMAN	L	233	ENSP00000303252:F233L	ENSP00000303252:F233L	F	+	1	0	ZNF804A	185509065	1.000000	0.71417	0.994000	0.49952	0.820000	0.46376	7.404000	0.79996	1.964000	0.57103	0.482000	0.46254	TTC	.	.		0.453	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
TFPI	7035	hgsc.bcm.edu	37	2	188348910	188348910	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:188348910T>C	ENST00000233156.3	-	6	863	c.569A>G	c.(568-570)cAg>cGg	p.Q190R	TFPI_ENST00000409676.1_Missense_Mutation_p.Q190R|AC007319.1_ENST00000453517.1_RNA|TFPI_ENST00000392365.1_Missense_Mutation_p.Q190R|AC007319.1_ENST00000412276.1_RNA|TFPI_ENST00000339091.4_Missense_Mutation_p.Q190R	NM_006287.4	NP_006278.1	P10646	TFPI1_HUMAN	tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor)	190					blood coagulation (GO:0007596)|blood coagulation, extrinsic pathway (GO:0007598)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0554)		Coagulation factor VIIa(DB00036)|Dalteparin(DB06779)	AGCATTGAGCTGGGTTCCATA	0.383																																					p.Q190R		Atlas-SNP	.											.	TFPI	66	.	0			c.A569G						.						104.0	105.0	105.0					2																	188348910		2203	4300	6503	SO:0001583	missense	7035	exon6			TTGAGCTGGGTTC		CCDS2294.1, CCDS33349.1	2q32	2008-06-02			ENSG00000003436	ENSG00000003436			11760	protein-coding gene	gene with protein product	"""extrinsic pathway inhibitor"""	152310		LACI		1993173	Standard	XM_005246818		Approved	EPI, TFI, TFPI1	uc002upy.3	P10646	OTTHUMG00000132634	ENST00000233156.3:c.569A>G	chr2.hg19:g.188348910T>C	ENSP00000233156:p.Gln190Arg	81.0	0.0		91.0	4.0	NM_001032281	O95103|Q53TS4	Missense_Mutation	SNP	ENST00000233156.3	hg19	CCDS2294.1	.	.	.	.	.	.	.	.	.	.	T	9.193	1.026632	0.19512	.	.	ENSG00000003436	ENST00000392365;ENST00000233156;ENST00000426055;ENST00000435414;ENST00000409676;ENST00000339091	T;T;T;T;T;T	0.63744	0.54;0.54;0.37;-0.06;-0.04;-0.04	5.3	1.16	0.20824	.	1.375500	0.04633	N	0.403955	T	0.53546	0.1803	L	0.54323	1.7	0.09310	N	1	P;B	0.35363	0.497;0.113	B;B	0.28465	0.09;0.033	T	0.31806	-0.9930	10	0.12766	T	0.61	.	10.8865	0.46971	0.0:0.0:0.459:0.541	.	190;190	P10646-2;P10646	.;TFPI1_HUMAN	R	190;190;190;177;190;190	ENSP00000376172:Q190R;ENSP00000233156:Q190R;ENSP00000397248:Q190R;ENSP00000409177:Q177R;ENSP00000386344:Q190R;ENSP00000342306:Q190R	ENSP00000233156:Q190R	Q	-	2	0	TFPI	188057155	0.000000	0.05858	0.002000	0.10522	0.062000	0.15995	-1.460000	0.02368	0.375000	0.24679	0.533000	0.62120	CAG	.	.		0.383	TFPI-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255881.1	NM_006287	
GTF3C3	9330	hgsc.bcm.edu	37	2	197664287	197664287	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:197664287A>G	ENST00000263956.3	-	1	138	c.49T>C	c.(49-51)Tcc>Ccc	p.S17P	GTF3C3_ENST00000409364.3_Missense_Mutation_p.S17P	NM_012086.4	NP_036218.1	Q9Y5Q9	TF3C3_HUMAN	general transcription factor IIIC, polypeptide 3, 102kDa	17					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(4)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TCCTCAAAGGAGATTTTCCCT	0.532																																					p.S17P		Atlas-SNP	.											.	GTF3C3	96	.	0			c.T49C						.						121.0	130.0	127.0					2																	197664287		2203	4300	6503	SO:0001583	missense	9330	exon1			CAAAGGAGATTTT	AF133123	CCDS2316.1, CCDS56153.1	2q33.1	2013-01-10	2002-08-29		ENSG00000119041	ENSG00000119041		"""General transcription factors"", ""Tetratricopeptide (TTC) repeat domain containing"""	4666	protein-coding gene	gene with protein product		604888	"""general transcription factor IIIC, polypeptide 3 (102kD)"""			10373544	Standard	NM_001206774		Approved	TFiiiC2-102, TFIIIC102	uc002uts.3	Q9Y5Q9	OTTHUMG00000154633	ENST00000263956.3:c.49T>C	chr2.hg19:g.197664287A>G	ENSP00000263956:p.Ser17Pro	94.0	0.0		100.0	4.0	NM_001206774	Q4ZG48|Q86XJ8|Q8WX84|Q96B44|Q9H5I8|Q9NT97	Missense_Mutation	SNP	ENST00000263956.3	hg19	CCDS2316.1	.	.	.	.	.	.	.	.	.	.	A	15.29	2.789042	0.49997	.	.	ENSG00000119041	ENST00000263956;ENST00000409364	T;T	0.53857	0.64;0.6	5.36	5.36	0.76844	.	0.064358	0.64402	D	0.000005	T	0.62024	0.2394	L	0.36672	1.1	0.50632	D	0.999885	D;P	0.76494	0.999;0.928	D;B	0.64776	0.929;0.382	T	0.65290	-0.6204	10	0.72032	D	0.01	-11.5443	15.1834	0.72978	1.0:0.0:0.0:0.0	.	17;17	Q9Y5Q9-2;Q9Y5Q9	.;TF3C3_HUMAN	P	17	ENSP00000263956:S17P;ENSP00000386465:S17P	ENSP00000263956:S17P	S	-	1	0	GTF3C3	197372532	0.999000	0.42202	1.000000	0.80357	0.963000	0.63663	3.361000	0.52306	2.250000	0.74265	0.477000	0.44152	TCC	.	.		0.532	GTF3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256104.1		
MPP4	58538	hgsc.bcm.edu	37	2	202514868	202514868	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:202514868T>C	ENST00000409474.3	-	19	1609	c.1402A>G	c.(1402-1404)Agt>Ggt	p.S468G	MPP4_ENST00000428900.2_Missense_Mutation_p.S444G|MPP4_ENST00000447335.2_Missense_Mutation_p.S461G|MPP4_ENST00000315506.7_Missense_Mutation_p.S424G|MPP4_ENST00000359962.5_Missense_Mutation_p.S468G|MPP4_ENST00000409143.1_Missense_Mutation_p.S410G|MPP4_ENST00000396886.3_Missense_Mutation_p.S393G	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	468	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						ATTTCGTAACTCTTTTTAGTA	0.348																																					p.S468G		Atlas-SNP	.											.	MPP4	93	.	0			c.A1402G						.						104.0	91.0	95.0					2																	202514868		1848	4087	5935	SO:0001583	missense	58538	exon19			CGTAACTCTTTTT	AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1402A>G	chr2.hg19:g.202514868T>C	ENSP00000387278:p.Ser468Gly	77.0	0.0		93.0	4.0	NM_033066	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	ENST00000409474.3	hg19	CCDS46491.1	.	.	.	.	.	.	.	.	.	.	T	13.77	2.337673	0.41398	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3	5.51	4.32	0.51571	Guanylate kinase/L-type calcium channel (1);Guanylate kinase, conserved site (1);Guanylate kinase (2);	0.203963	0.52532	D	0.000079	T	0.13329	0.0323	N	0.25789	0.76	0.35709	D	0.816254	B;B;B;B;B;B;B;B	0.17667	0.019;0.012;0.023;0.023;0.019;0.013;0.023;0.019	B;B;B;B;B;B;B;B	0.23275	0.023;0.034;0.039;0.039;0.023;0.039;0.039;0.045	T	0.09773	-1.0659	10	0.52906	T	0.07	.	11.8224	0.52247	0.0:0.0696:0.0:0.9304	.	410;393;444;437;424;461;468;433	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	G	468;424;393;468;433;397;444;410;461	ENSP00000387278:S468G;ENSP00000319363:S424G;ENSP00000353047:S468G;ENSP00000416781:S444G;ENSP00000387293:S410G;ENSP00000406160:S461G	ENSP00000319363:S424G	S	-	1	0	MPP4	202223113	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	2.486000	0.45259	2.317000	0.78254	0.459000	0.35465	AGT	.	.		0.348	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000335748.2		
CPS1	1373	hgsc.bcm.edu	37	2	211523326	211523326	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:211523326A>G	ENST00000233072.5	+	31	3866	c.3670A>G	c.(3670-3672)Aag>Gag	p.K1224E	CPS1_ENST00000451903.2_Missense_Mutation_p.K773E|CPS1_ENST00000430249.2_Missense_Mutation_p.K1230E	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1224	ATP-grasp 2.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	AATTCAGGTGAAGGATGCTAC	0.368																																					p.K1230E		Atlas-SNP	.											.	CPS1	485	.	0			c.A3688G						.						112.0	104.0	107.0					2																	211523326		2203	4300	6503	SO:0001583	missense	1373	exon32			CAGGTGAAGGATG	AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3670A>G	chr2.hg19:g.211523326A>G	ENSP00000233072:p.Lys1224Glu	61.0	0.0		91.0	4.0	NM_001122633	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	ENST00000233072.5	hg19	CCDS2393.1	.	.	.	.	.	.	.	.	.	.	A	14.39	2.519772	0.44866	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97161	-4.27;-4.27;-4.27	5.29	5.29	0.74685	ATP-grasp fold (1);ATP-grasp fold, subdomain 2 (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.000000	0.85682	D	0.000000	D	0.94988	0.8378	L	0.39085	1.19	0.53005	D	0.999962	P;P	0.41673	0.759;0.759	B;B	0.43990	0.438;0.438	D	0.94030	0.7300	10	0.25751	T	0.34	-11.1284	15.2413	0.73471	1.0:0.0:0.0:0.0	.	1234;1224	Q59HF8;P31327	.;CPSM_HUMAN	E	1230;1232;1224;773	ENSP00000402608:K1230E;ENSP00000233072:K1224E;ENSP00000406136:K773E	ENSP00000233072:K1224E	K	+	1	0	CPS1	211231571	1.000000	0.71417	1.000000	0.80357	0.816000	0.46133	8.625000	0.90965	2.001000	0.58596	0.460000	0.39030	AAG	.	.		0.368	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256569.5		
SLC23A3	151295	hgsc.bcm.edu	37	2	220028989	220028989	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:220028989A>G	ENST00000409878.3	-	9	1271	c.1239T>C	c.(1237-1239)gcT>gcC	p.A413A	SLC23A3_ENST00000396775.3_3'UTR|SLC23A3_ENST00000455516.2_Silent_p.A421A|SLC23A3_ENST00000295738.7_Silent_p.A296A	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	413					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TGAGGAGCTGAGCCAACCTGG	0.542																																					p.A421A		Atlas-SNP	.											.	SLC23A3	60	.	0			c.T1263C						.						38.0	40.0	39.0					2																	220028989		2068	4211	6279	SO:0001819	synonymous_variant	151295	exon9			GAGCTGAGCCAAC	BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.1239T>C	chr2.hg19:g.220028989A>G		117.0	0.0		118.0	5.0	NM_001144890	B7Z512|Q2PYN6|Q96NA6	Silent	SNP	ENST00000409878.3	hg19	CCDS46518.1																																																																																			.	.		0.542	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336331.2	NM_144712	
TUBA4A	7277	hgsc.bcm.edu	37	2	220115976	220115976	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:220115976A>G	ENST00000248437.4	-	4	618	c.445T>C	c.(445-447)Ttc>Ctc	p.F149L	TUBA4A_ENST00000498660.1_5'UTR|TUBA4A_ENST00000392088.2_Missense_Mutation_p.F134L|TUBA4B_ENST00000490341.1_RNA	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	149					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	AGTGAGGTGAAGCCAGAGCCA	0.542																																					p.F149L		Atlas-SNP	.											.	TUBA4A	96	.	0			c.T445C						.						46.0	51.0	50.0					2																	220115976		2202	4300	6502	SO:0001583	missense	7277	exon4			AGGTGAAGCCAGA	AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.445T>C	chr2.hg19:g.220115976A>G	ENSP00000248437:p.Phe149Leu	82.0	0.0		82.0	4.0	NM_006000	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	ENST00000248437.4	hg19	CCDS2438.1	.	.	.	.	.	.	.	.	.	.	A	16.16	3.044376	0.55110	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000427737;ENST00000456818;ENST00000447205	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	5.06	5.06	0.68205	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	T	0.54870	0.1885	N	0.13140	0.3	0.80722	D	1	B	0.34313	0.448	P	0.44394	0.448	T	0.59521	-0.7439	10	0.46703	T	0.11	.	14.9694	0.71220	1.0:0.0:0.0:0.0	.	149	P68366	TBA4A_HUMAN	L	149;134;134;172;134	ENSP00000248437:F149L;ENSP00000375938:F134L;ENSP00000408194:F134L;ENSP00000416992:F172L;ENSP00000396061:F134L	ENSP00000248437:F149L	F	-	1	0	TUBA4A	219824220	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.928000	0.92853	2.131000	0.65755	0.533000	0.62120	TTC	.	.		0.542	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256816.3	NM_006000	
GRM7	2917	hgsc.bcm.edu	37	3	7494418	7494418	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:7494418C>T	ENST00000357716.4	+	6	1573	c.1299C>T	c.(1297-1299)taC>taT	p.Y433Y	GRM7_ENST00000486284.1_Silent_p.Y433Y|GRM7_ENST00000389336.4_Silent_p.Y433Y|GRM7_ENST00000403881.1_Silent_p.Y433Y|GRM7_ENST00000458641.2_3'UTR|GRM7_ENST00000402647.2_Silent_p.Y433Y	NM_000844.3	NP_000835.1	Q14831	GRM7_HUMAN	glutamate receptor, metabotropic 7	433			Y -> F (in dbSNP:rs2229902). {ECO:0000269|PubMed:11163549}.		adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|adult behavior (GO:0030534)|conditioned taste aversion (GO:0001661)|multicellular organismal response to stress (GO:0033555)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of glutamate secretion (GO:0014050)|regulation of cyclase activity (GO:0031279)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|short-term memory (GO:0007614)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)	asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	adenylate cyclase inhibitor activity (GO:0010855)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|glutamate binding (GO:0016595)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)|PDZ domain binding (GO:0030165)|serine binding (GO:0070905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(35)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	76						GTGCTGACTACCGGGGTGTCT	0.483																																					p.Y433Y		Atlas-SNP	.											GRM7,NS,carcinoma,0,1	GRM7	223	.	0			c.C1299T						.						86.0	73.0	78.0					3																	7494418		2203	4300	6503	SO:0001819	synonymous_variant	2917	exon6			TGACTACCGGGGT	U92458	CCDS43042.1	3p26-p25	2014-06-12			ENSG00000196277	ENSG00000196277		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 87"""	604101				8288585, 8840028	Standard	NM_000844		Approved	GLUR7, GPRC1G, mGlu7, MGLUR7, PPP1R87	uc003bql.2	Q14831	OTTHUMG00000125549	ENST00000357716.4:c.1299C>T	chr3.hg19:g.7494418C>T		114.0	0.0		109.0	0.0	NM_000844	Q8NFS2|Q8NFS3|Q8NFS4	Silent	SNP	ENST00000357716.4	hg19	CCDS43042.1																																																																																			.	.		0.483	GRM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000246895.3	NM_000844	
IL17RC	84818	hgsc.bcm.edu	37	3	9972089	9972089	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:9972089A>G	ENST00000295981.3	+	15	1715	c.1497A>G	c.(1495-1497)gcA>gcG	p.A499A	IL17RC_ENST00000498214.1_Intron|IL17RC_ENST00000403601.3_Silent_p.A428A|IL17RC_ENST00000383812.4_Silent_p.A413A|IL17RC_ENST00000455057.1_Silent_p.A396A|IL17RC_ENST00000416074.2_Silent_p.A267A|IL17RC_ENST00000413608.1_Silent_p.A428A	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C	499					cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GGCAGAGGGCAGCTCGCCTTG	0.587																																					p.A499A		Atlas-SNP	.											.	IL17RC	55	.	0			c.A1497G						.						56.0	54.0	55.0					3																	9972089		2203	4300	6503	SO:0001819	synonymous_variant	84818	exon15			GAGGGCAGCTCGC	BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.1497A>G	chr3.hg19:g.9972089A>G		153.0	0.0		159.0	7.0	NM_153461	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Silent	SNP	ENST00000295981.3	hg19	CCDS2590.1																																																																																			.	.		0.587	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250526.2	NM_032732	
CAND2	23066	hgsc.bcm.edu	37	3	12875342	12875342	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:12875342T>C	ENST00000456430.2	+	15	3613	c.3572T>C	c.(3571-3573)aTc>aCc	p.I1191T	RP11-767C1.2_ENST00000606447.1_RNA|CAND2_ENST00000295989.5_Missense_Mutation_p.I1074T	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	1191					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						CTGCTGACCATCCCCGAGGTG	0.517																																					p.I1191T	GBM(43;676 868 1633 6395 37496)	Atlas-SNP	.											.	CAND2	138	.	0			c.T3572C						.						91.0	95.0	94.0					3																	12875342		1978	4181	6159	SO:0001583	missense	23066	exon15			TGACCATCCCCGA		CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.3572T>C	chr3.hg19:g.12875342T>C	ENSP00000387641:p.Ile1191Thr	124.0	0.0		140.0	7.0	NM_001162499	B9EGM9|E9KL24	Missense_Mutation	SNP	ENST00000456430.2	hg19	CCDS54554.1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053793	0.55218	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.67171	-0.25;-0.25	4.84	3.65	0.41850	TATA-binding protein interacting (TIP20) (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.136423	0.48767	D	0.000176	T	0.75191	0.3816	M	0.83953	2.67	0.80722	D	1	P;B	0.41188	0.741;0.137	P;B	0.51550	0.673;0.109	T	0.73649	-0.3916	10	0.42905	T	0.14	-19.4285	8.7859	0.34821	0.175:0.0:0.0:0.825	.	1191;1074	O75155;O75155-2	CAND2_HUMAN;.	T	1074;1191	ENSP00000295989:I1074T;ENSP00000387641:I1191T	ENSP00000295989:I1074T	I	+	2	0	CAND2	12850342	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.056000	0.71111	0.828000	0.34709	0.482000	0.46254	ATC	.	.		0.517	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339856.4	XM_371617	
HACL1	26061	hgsc.bcm.edu	37	3	15613278	15613278	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:15613278T>C	ENST00000321169.5	-	12	1361		c.e12-2		HACL1_ENST00000457447.2_Intron|HACL1_ENST00000451445.2_Splice_Site|HACL1_ENST00000456194.2_Splice_Site|HACL1_ENST00000435217.2_Splice_Site	NM_012260.2	NP_036392.2	Q9UJ83	HACL1_HUMAN	2-hydroxyacyl-CoA lyase 1						cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carbon-carbon lyase activity (GO:0016830)|cofactor binding (GO:0048037)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|receptor binding (GO:0005102)|thiamine pyrophosphate binding (GO:0030976)			NS(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|skin(1)	16						CTCTAAAAGCTTAAAAAAAAA	0.323																																					.		Atlas-SNP	.											.,1	HACL1	33	.	0			c.994-2A>G						.						77.0	75.0	76.0					3																	15613278		2203	4300	6503	SO:0001630	splice_region_variant	26061	exon13			AAAAGCTTAAAAA	AJ131753	CCDS2627.1, CCDS68360.1, CCDS68361.1, CCDS68362.1	3p24.3	2009-01-14	2006-05-16	2006-05-16	ENSG00000131373	ENSG00000131373	4.1.-.-		17856	protein-coding gene	gene with protein product		604300	"""2-hydroxyphytanoyl-CoA lyase"""	HPCL		10468558, 15644336	Standard	NM_001284416		Approved	2-HPCL, PHYH2	uc003caf.3	Q9UJ83	OTTHUMG00000129862	ENST00000321169.5:c.994-2A>G	chr3.hg19:g.15613278T>C		31.0	0.0		39.0	3.0	NM_012260	B4DWI1|B4DXI5|E9PEN4|Q9BV42|Q9P0A2	Splice_Site	SNP	ENST00000321169.5	hg19	CCDS2627.1	.	.	.	.	.	.	.	.	.	.	T	12.26	1.885022	0.33255	.	.	ENSG00000131373	ENST00000321169;ENST00000435217;ENST00000451445;ENST00000456194	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.0137	0.71567	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HACL1	15588282	1.000000	0.71417	0.997000	0.53966	0.137000	0.21094	6.518000	0.73764	1.994000	0.58287	0.529000	0.55759	.	.	.		0.323	HACL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252104.3	NM_012260	Intron
OSBPL10	114884	hgsc.bcm.edu	37	3	31712394	31712394	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:31712394G>T	ENST00000396556.2	-	9	1930	c.1808C>A	c.(1807-1809)cCg>cAg	p.P603Q	OSBPL10_ENST00000438237.2_Missense_Mutation_p.P539Q	NM_017784.4	NP_060254.2	Q9BXB5	OSB10_HUMAN	oxysterol binding protein-like 10	603					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.P603L(2)		breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	34				STAD - Stomach adenocarcinoma(1;0.00406)		CTCCACCCACGGGATGGTGAG	0.567																																					p.P603Q		Atlas-SNP	.											OSBPL10_ENST00000396556,extremity,malignant_melanoma,0,6	OSBPL10	160	.	2	Substitution - Missense(2)	skin(2)	c.C1808A						.						131.0	115.0	120.0					3																	31712394		2203	4300	6503	SO:0001583	missense	114884	exon9			ACCCACGGGATGG	AF392451	CCDS2651.1, CCDS54559.1	3p23	2013-01-10			ENSG00000144645	ENSG00000144645		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16395	protein-coding gene	gene with protein product		606738					Standard	NM_001174060		Approved		uc021wuu.1	Q9BXB5	OTTHUMG00000130672	ENST00000396556.2:c.1808C>A	chr3.hg19:g.31712394G>T	ENSP00000379804:p.Pro603Gln	175.0	0.0		176.0	0.0	NM_017784	B4E212|Q9BTU5	Missense_Mutation	SNP	ENST00000396556.2	hg19	CCDS2651.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.72|17.72	3.458058|3.458058	0.63401|0.63401	.|.	.|.	ENSG00000144645|ENSG00000144645	ENST00000396556;ENST00000438237|ENST00000429492	T;T|.	0.32753|.	1.44;1.44|.	5.47|5.47	5.47|5.47	0.80525|0.80525	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.87565|0.87565	0.6209|0.6209	H|H	0.95004|0.95004	3.61|3.61	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	1.0;1.0;1.0|.	D|D	0.90774|0.90774	0.4674|0.4674	10|5	0.72032|.	D|.	0.01|.	-18.8515|-18.8515	19.3207|19.3207	0.94237|0.94237	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	539;603;371|.	B4E212;Q9BXB5;Q59ED9|.	.;OSB10_HUMAN;.|.	Q|S	603;539|372	ENSP00000379804:P603Q;ENSP00000406124:P539Q|.	ENSP00000379804:P603Q|.	P|R	-|-	2|1	0|0	OSBPL10|OSBPL10	31687398|31687398	1.000000|1.000000	0.71417|0.71417	0.841000|0.841000	0.33234|0.33234	0.009000|0.009000	0.06853|0.06853	9.869000|9.869000	0.99810|0.99810	2.550000|2.550000	0.86006|0.86006	0.557000|0.557000	0.71058|0.71058	CCG|CGT	.	.		0.567	OSBPL10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000253165.2		
MAP4	4134	hgsc.bcm.edu	37	3	47960309	47960309	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:47960309A>G	ENST00000360240.6	-	6	1070	c.552T>C	c.(550-552)gcT>gcC	p.A184A	MAP4_ENST00000395734.3_Silent_p.A184A|MAP4_ENST00000383737.4_Silent_p.A184A|MAP4_ENST00000426837.2_Silent_p.A201A	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	184					cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GAGGTACAACAGCTGTGTTGC	0.418																																					p.A184A		Atlas-SNP	.											.	MAP4	176	.	0			c.T552C						.						87.0	81.0	83.0					3																	47960309		2203	4300	6503	SO:0001819	synonymous_variant	4134	exon6			TACAACAGCTGTG		CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.552T>C	chr3.hg19:g.47960309A>G		90.0	0.0		107.0	5.0	NM_001134364	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	ENST00000360240.6	hg19	CCDS33750.1	.	.	.	.	.	.	.	.	.	.	A	2.665	-0.278962	0.05642	.	.	ENSG00000047849	ENST00000423088	.	.	.	4.51	2.06	0.26882	.	.	.	.	.	T	0.24470	0.0593	.	.	.	0.26100	N	0.980838	.	.	.	.	.	.	T	0.21381	-1.0247	4	.	.	.	0.1461	3.8037	0.08768	0.7111:0.0:0.1016:0.1873	.	.	.	.	P	153	.	.	L	-	2	0	MAP4	47935313	0.090000	0.21635	0.122000	0.21767	0.369000	0.29798	1.613000	0.36900	0.325000	0.23359	0.459000	0.35465	CTG	.	.		0.418	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000346085.1	NM_002375	
COL7A1	1294	hgsc.bcm.edu	37	3	48628195	48628195	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:48628195T>C	ENST00000328333.8	-	13	1798	c.1691A>G	c.(1690-1692)gAc>gGc	p.D564G	COL7A1_ENST00000454817.1_Missense_Mutation_p.D564G	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	564	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.|Nonhelical region (NC1).				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		AGCCTGAACGTCATCCAAGTC	0.607																																					p.D564G		Atlas-SNP	.											.	COL7A1	320	.	0			c.A1691G						.						145.0	109.0	121.0					3																	48628195		2203	4300	6503	SO:0001583	missense	1294	exon13			TGAACGTCATCCA	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.1691A>G	chr3.hg19:g.48628195T>C	ENSP00000332371:p.Asp564Gly	108.0	0.0		124.0	5.0	NM_000094	Q14054|Q16507	Missense_Mutation	SNP	ENST00000328333.8	hg19	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	T	11.33	1.606260	0.28623	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	T;T	0.53423	0.62;0.62	5.01	3.87	0.44632	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.269957	0.25789	N	0.028282	T	0.37999	0.1024	N	0.20685	0.6	0.35462	D	0.796603	P	0.50819	0.939	P	0.53360	0.724	T	0.27673	-1.0067	10	0.09084	T	0.74	.	9.6616	0.39958	0.0:0.0838:0.0:0.9162	.	564	Q02388	CO7A1_HUMAN	G	564	ENSP00000332371:D564G;ENSP00000412569:D564G	ENSP00000332371:D564G	D	-	2	0	COL7A1	48603199	1.000000	0.71417	0.930000	0.37139	0.631000	0.37964	3.234000	0.51320	2.249000	0.74217	0.528000	0.53228	GAC	.	.		0.607	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
DCP1A	55802	hgsc.bcm.edu	37	3	53326495	53326495	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:53326495T>A	ENST00000607628.1	-	7	1096	c.987A>T	c.(985-987)gcA>gcT	p.A329A	DCP1A_ENST00000294241.6_Silent_p.A329A|DCP1A_ENST00000480258.1_5'UTR|Y_RNA_ENST00000384175.1_RNA|DCP1A_ENST00000606822.1_Silent_p.A291A	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	329					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGGGAACCTGTGCAGTAGGAG	0.562																																					p.A329A		Atlas-SNP	.											.	DCP1A	30	.	0			c.A987T						.						67.0	74.0	72.0					3																	53326495		2142	4253	6395	SO:0001819	synonymous_variant	55802	exon7			AACCTGTGCAGTA	AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.987A>T	chr3.hg19:g.53326495T>A		464.0	0.0		431.0	164.0	NM_018403	B4DHN9|U3KQM8	Silent	SNP	ENST00000607628.1	hg19																																																																																				.	.		0.562	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_018403	
IL17RB	55540	hgsc.bcm.edu	37	3	53899048	53899048	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:53899048T>C	ENST00000288167.3	+	11	1231	c.1222T>C	c.(1222-1224)Tgt>Cgt	p.C408R		NM_018725.3	NP_061195.2	Q9NRM6	I17RB_HUMAN	interleukin 17 receptor B	408	SEFIR. {ECO:0000255|PROSITE- ProRule:PRU00867}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|regulation of cell growth (GO:0001558)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	cytokine receptor activity (GO:0004896)			breast(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)	13				BRCA - Breast invasive adenocarcinoma(193;0.000158)|KIRC - Kidney renal clear cell carcinoma(284;0.00588)|Kidney(284;0.00673)|OV - Ovarian serous cystadenocarcinoma(275;0.118)		CGATGGTACCTGTGGCAAGAG	0.507																																					p.C408R		Atlas-SNP	.											.	IL17RB	27	.	0			c.T1222C						.						82.0	74.0	77.0					3																	53899048		2203	4300	6503	SO:0001583	missense	55540	exon11			GGTACCTGTGGCA	AF212365	CCDS2874.1	3p21.1	2008-02-05		2003-07-09	ENSG00000056736	ENSG00000056736		"""Interleukins and interleukin receptors"""	18015	protein-coding gene	gene with protein product		605458	"""interleukin 17B receptor"""	IL17BR		10749887, 10815801	Standard	NM_018725		Approved	IL17RH1, EVI27, CRL4	uc003dha.3	Q9NRM6	OTTHUMG00000158280	ENST00000288167.3:c.1222T>C	chr3.hg19:g.53899048T>C	ENSP00000288167:p.Cys408Arg	121.0	0.0		114.0	5.0	NM_018725	Q9BPZ0|Q9NRL4|Q9NRM5	Missense_Mutation	SNP	ENST00000288167.3	hg19	CCDS2874.1	.	.	.	.	.	.	.	.	.	.	T	15.06	2.721627	0.48728	.	.	ENSG00000056736	ENST00000288167	T	0.28895	1.59	5.65	5.65	0.86999	SEFIR (1);	0.150888	0.45867	D	0.000329	T	0.50034	0.1592	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.44697	-0.9311	10	0.13470	T	0.59	-14.1381	13.4094	0.60933	0.0:0.0:0.0:1.0	.	408	Q9NRM6	I17RB_HUMAN	R	408	ENSP00000288167:C408R	ENSP00000288167:C408R	C	+	1	0	IL17RB	53874088	0.999000	0.42202	0.944000	0.38274	0.186000	0.23388	5.102000	0.64572	2.150000	0.67090	0.528000	0.53228	TGT	.	.		0.507	IL17RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350563.1	NM_172234	
FILIP1L	11259	hgsc.bcm.edu	37	3	99567249	99567249	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:99567249G>A	ENST00000354552.3	-	5	3741	c.3271C>T	c.(3271-3273)Cga>Tga	p.R1091*	CMSS1_ENST00000496116.1_Intron|FILIP1L_ENST00000487087.1_Nonsense_Mutation_p.R667*|FILIP1L_ENST00000476723.1_Intron|CMSS1_ENST00000421999.2_Intron|FILIP1L_ENST00000471562.1_Nonsense_Mutation_p.R851*|FILIP1L_ENST00000331335.5_Nonsense_Mutation_p.R1091*|FILIP1L_ENST00000383694.2_Nonsense_Mutation_p.R851*	NM_182909.2	NP_878913.2	Q4L180	FIL1L_HUMAN	filamin A interacting protein 1-like	1091						cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.R1091R(2)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	35						CCTTGAGTTCGGTTATCCTGC	0.463																																					p.R1091X		Atlas-SNP	.											FILIP1L_ENST00000354552,NS,lymphoid_neoplasm,0,2	FILIP1L	154	.	2	Substitution - coding silent(2)	lung(2)	c.C3271T						.						275.0	277.0	276.0					3																	99567249		2029	4191	6220	SO:0001587	stop_gained	11259	exon5			GAGTTCGGTTATC		CCDS43117.1, CCDS43118.1, CCDS43119.1, CCDS63700.1, CCDS74969.1	3q12.1	2011-10-21			ENSG00000168386	ENSG00000168386			24589	protein-coding gene	gene with protein product	"""downregulated in ovarian cancer 1"", ""GPBP-interacting protein of 130 kDa"""	612993				8314147, 15935955, 21832087	Standard	NM_001282793		Approved	DOC-1, GIP130	uc003dtm.3	Q4L180	OTTHUMG00000159055	ENST00000354552.3:c.3271C>T	chr3.hg19:g.99567249G>A	ENSP00000346560:p.Arg1091*	553.0	0.0		502.0	27.0	NM_182909	B2CNV7|B2CNV8|Q13597|Q2YDY5|Q6KFX5|Q6KFX6|Q6KFX7|Q8IUM3|Q8N6Z0	Nonsense_Mutation	SNP	ENST00000354552.3	hg19	CCDS43117.1	.	.	.	.	.	.	.	.	.	.	G	35	5.566464	0.96540	.	.	ENSG00000168386	ENST00000477258;ENST00000354552;ENST00000487087;ENST00000471562;ENST00000331335;ENST00000383694;ENST00000441620	.	.	.	5.79	3.94	0.45596	.	0.000000	0.43110	D	0.000602	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.9685	13.9686	0.64225	0.0:0.0:0.4159:0.5841	.	.	.	.	X	70;1091;667;851;1091;851;837	.	ENSP00000327880:R1091X	R	-	1	2	FILIP1L	101049939	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.592000	0.36676	0.741000	0.32674	0.655000	0.94253	CGA	.	.		0.463	FILIP1L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000353069.1	NM_014890	
ABI3BP	25890	hgsc.bcm.edu	37	3	100569517	100569517	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:100569517T>C	ENST00000284322.5	-	14	1396	c.1287A>G	c.(1285-1287)ccA>ccG	p.P429P	ABI3BP_ENST00000495063.1_Silent_p.P478P|ABI3BP_ENST00000471714.1_Silent_p.P478P	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	429	Pro-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GTGTTGCCCTTGGCTGTTCAA	0.333																																					p.P429P		Atlas-SNP	.											.	ABI3BP	305	.	0			c.A1287G						.						124.0	121.0	122.0					3																	100569517		1805	4070	5875	SO:0001819	synonymous_variant	25890	exon14			TGCCCTTGGCTGT	AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.1287A>G	chr3.hg19:g.100569517T>C		88.0	0.0		77.0	5.0	NM_015429	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Silent	SNP	ENST00000284322.5	hg19	CCDS46880.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.226|9.226	1.034565|1.034565	0.19590|0.19590	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000459682|ENST00000533855	.|.	.|.	.|.	5.87|5.87	5.87|5.87	0.94306|0.94306	.|.	.|.	.|.	.|.	.|.	T|T	0.71643|0.71643	0.3364|0.3364	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.70443|0.70443	-0.4870|-0.4870	4|4	.|.	.|.	.|.	-17.0179|-17.0179	15.1469|15.1469	0.72662|0.72662	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|.	.|.	.|.	E|R	55|107	.|.	.|.	K|Q	-|-	1|2	0|0	ABI3BP|ABI3BP	102052207|102052207	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	4.846000|4.846000	0.62860|0.62860	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	AAG|CAA	.	.		0.333	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353260.1		
TAGLN3	29114	hgsc.bcm.edu	37	3	111718279	111718279	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:111718279A>G	ENST00000393917.2	+	2	562	c.10A>G	c.(10-12)Agg>Ggg	p.R4G	TAGLN3_ENST00000486460.1_5'Flank|TAGLN3_ENST00000273368.4_Missense_Mutation_p.R4G|TAGLN3_ENST00000455401.2_Missense_Mutation_p.R4G|TAGLN3_ENST00000478951.1_Missense_Mutation_p.R4G	NM_013259.2	NP_037391.2	Q9UI15	TAGL3_HUMAN	transgelin 3	4					central nervous system development (GO:0007417)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)				endometrium(2)|lung(5)|urinary_tract(1)	8						GATGGCTAACAGGGGCCCGAG	0.582																																					p.R4G		Atlas-SNP	.											.	TAGLN3	44	.	0			c.A10G						.						47.0	46.0	46.0					3																	111718279		2203	4300	6503	SO:0001583	missense	29114	exon2			GCTAACAGGGGCC	AF303058	CCDS33816.1	3q13.2	2008-02-05			ENSG00000144834	ENSG00000144834			29868	protein-coding gene	gene with protein product		607953				8015377, 11238712	Standard	NM_013259		Approved	NP25, NP22	uc003dyo.3	Q9UI15	OTTHUMG00000159281	ENST00000393917.2:c.10A>G	chr3.hg19:g.111718279A>G	ENSP00000377494:p.Arg4Gly	95.0	0.0		117.0	5.0	NM_001008272	D3DN64|Q96A74	Missense_Mutation	SNP	ENST00000393917.2	hg19	CCDS33816.1	.	.	.	.	.	.	.	.	.	.	A	26.1	4.709334	0.89018	.	.	ENSG00000144834	ENST00000478951;ENST00000393917;ENST00000273368;ENST00000540095;ENST00000455401;ENST00000494932	T;T;T;T;T	0.56776	0.44;0.44;0.44;0.44;0.44	5.38	-7.72	0.01250	.	0.000000	0.85682	D	0.000000	T	0.66771	0.2823	M	0.77616	2.38	0.50632	D	0.999886	D	0.62365	0.991	D	0.63703	0.917	T	0.77305	-0.2637	10	0.87932	D	0	-4.411	20.4015	0.98996	0.251:0.749:0.0:0.0	.	4	Q9UI15	TAGL3_HUMAN	G	4	ENSP00000419105:R4G;ENSP00000377494:R4G;ENSP00000273368:R4G;ENSP00000391160:R4G;ENSP00000420675:R4G	ENSP00000273368:R4G	R	+	1	2	TAGLN3	113200969	0.301000	0.24444	0.959000	0.39883	0.998000	0.95712	-0.209000	0.09358	-1.107000	0.03004	0.533000	0.62120	AGG	.	.		0.582	TAGLN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354331.1	NM_013259	
KIAA1407	57577	hgsc.bcm.edu	37	3	113723571	113723571	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:113723571T>C	ENST00000295878.3	-	11	2037	c.1891A>G	c.(1891-1893)Act>Gct	p.T631A	KIAA1407_ENST00000545063.1_Missense_Mutation_p.T462A	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	631										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						CTGCCTTCAGTCCCAGGGGAA	0.448																																					p.T631A		Atlas-SNP	.											.	KIAA1407	80	.	0			c.A1891G						.						141.0	138.0	139.0					3																	113723571		2203	4300	6503	SO:0001583	missense	57577	exon11			CTTCAGTCCCAGG	AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.1891A>G	chr3.hg19:g.113723571T>C	ENSP00000295878:p.Thr631Ala	73.0	0.0		95.0	4.0	NM_020817	B4DYL1|Q9P2E0	Missense_Mutation	SNP	ENST00000295878.3	hg19	CCDS2977.1	.	.	.	.	.	.	.	.	.	.	T	4.651	0.121024	0.08881	.	.	ENSG00000163617	ENST00000295878;ENST00000545063	T;T	0.42513	1.57;0.97	5.39	0.056	0.14317	.	0.648857	0.16203	N	0.224840	T	0.16514	0.0397	N	0.08118	0	0.09310	N	1	B;B	0.10296	0.003;0.0	B;B	0.09377	0.004;0.002	T	0.15578	-1.0432	10	0.20519	T	0.43	.	2.9719	0.05925	0.3225:0.1756:0.0:0.5019	.	507;631	B4DIZ9;Q8NCU4	.;K1407_HUMAN	A	631;462	ENSP00000295878:T631A;ENSP00000446381:T462A	ENSP00000295878:T631A	T	-	1	0	KIAA1407	115206261	0.005000	0.15991	0.035000	0.18076	0.842000	0.47809	0.356000	0.20181	-0.121000	0.11787	-0.280000	0.10049	ACT	.	.		0.448	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354724.2	NM_020817	
ZNF80	7634	hgsc.bcm.edu	37	3	113955213	113955213	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:113955213T>C	ENST00000482457.2	-	1	1212	c.709A>G	c.(709-711)Agg>Ggg	p.R237G	RP11-553L6.2_ENST00000481773.1_RNA|RP11-553L6.2_ENST00000493033.1_RNA	NM_007136.3	NP_009067.2	P51504	ZNF80_HUMAN	zinc finger protein 80	237					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|urinary_tract(2)	32		Lung NSC(201;0.0233)|all_neural(597;0.0837)				GTGTGACTCCTTGTATGTCGA	0.463																																					p.R237G	GBM(23;986 1114 21716)	Atlas-SNP	.											.	ZNF80	75	.	0			c.A709G						.						104.0	104.0	104.0					3																	113955213		2203	4300	6503	SO:0001583	missense	7634	exon1			GACTCCTTGTATG	X65233	CCDS2979.1	3q13.31	2013-01-08	2006-05-12		ENSG00000174255	ENSG00000174255		"""Zinc fingers, C2H2-type"""	13155	protein-coding gene	gene with protein product		194553	"""zinc finger protein 80 (pT17)"""			8478004	Standard	NM_007136		Approved	pT17	uc010hqo.3	P51504	OTTHUMG00000159332	ENST00000482457.2:c.709A>G	chr3.hg19:g.113955213T>C	ENSP00000417192:p.Arg237Gly	106.0	0.0		97.0	4.0	NM_007136	Q6NSW4|Q6NT14	Missense_Mutation	SNP	ENST00000482457.2	hg19	CCDS2979.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059753	0.36373	.	.	ENSG00000174255	ENST00000482457	T	0.24723	1.84	2.79	-2.76	0.05896	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32852	0.0843	M	0.85099	2.735	0.09310	N	1	B	0.33073	0.396	B	0.40477	0.33	T	0.44190	-0.9344	9	0.62326	D	0.03	.	4.2459	0.10672	0.0:0.2185:0.3359:0.4456	.	237	P51504	ZNF80_HUMAN	G	237	ENSP00000417192:R237G	ENSP00000309812:R237G	R	-	1	2	ZNF80	115437903	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.492000	0.06467	-0.632000	0.05553	0.459000	0.35465	AGG	.	.		0.463	ZNF80-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354696.2	NM_007136	
STXBP5L	9515	hgsc.bcm.edu	37	3	120976155	120976155	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:120976155A>G	ENST00000273666.6	+	17	2078	c.1807A>G	c.(1807-1809)Aca>Gca	p.T603A	STXBP5L_ENST00000497029.1_Missense_Mutation_p.T603A|STXBP5L_ENST00000471454.1_Missense_Mutation_p.T603A|STXBP5L_ENST00000472879.1_Missense_Mutation_p.T603A|STXBP5L_ENST00000492541.1_Missense_Mutation_p.T603A	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	603					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		TGAAGGAGTAACAAAGGACAG	0.383																																					p.T603A		Atlas-SNP	.											.	STXBP5L	159	.	0			c.A1807G						.						101.0	96.0	98.0					3																	120976155		1838	4084	5922	SO:0001583	missense	9515	exon17			GGAGTAACAAAGG	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.1807A>G	chr3.hg19:g.120976155A>G	ENSP00000273666:p.Thr603Ala	94.0	0.0		91.0	4.0	NM_014980	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	ENST00000273666.6	hg19	CCDS43137.1	.	.	.	.	.	.	.	.	.	.	A	4.717	0.133386	0.09032	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000472879;ENST00000497029;ENST00000492541;ENST00000471262	T;T;T;T;T;T	0.34859	2.01;2.0;1.79;1.34;1.82;1.97	5.33	4.16	0.48862	WD40 repeat-like-containing domain (1);	0.607810	0.18179	N	0.149203	T	0.21590	0.0520	L	0.34521	1.04	0.24318	N	0.995055	B;B	0.06786	0.001;0.001	B;B	0.04013	0.0;0.001	T	0.29088	-1.0023	10	0.08599	T	0.76	-23.8525	5.7046	0.17901	0.7101:0.1424:0.1475:0.0	.	603;603	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	A	603	ENSP00000273666:T603A;ENSP00000420019:T603A;ENSP00000419627:T603A;ENSP00000420287:T603A;ENSP00000420666:T603A;ENSP00000420167:T603A	ENSP00000273666:T603A	T	+	1	0	STXBP5L	122458845	0.999000	0.42202	0.998000	0.56505	0.995000	0.86356	2.673000	0.46858	0.950000	0.37743	0.377000	0.23210	ACA	.	.		0.383	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
GOLGB1	2804	hgsc.bcm.edu	37	3	121413392	121413392	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:121413392T>C	ENST00000340645.5	-	13	6088	c.5963A>G	c.(5962-5964)aAg>aGg	p.K1988R	GOLGB1_ENST00000393667.3_Missense_Mutation_p.K1993R	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1988					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.K1988R(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CAAATATTCCTTTCGTATTTC	0.353																																					p.K1993R		Atlas-SNP	.											GOLGB1,NS,carcinoma,0,1	GOLGB1	319	.	1	Substitution - Missense(1)	lung(1)	c.A5978G						.						166.0	176.0	173.0					3																	121413392		2203	4300	6503	SO:0001583	missense	2804	exon13			TATTCCTTTCGTA	X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5963A>G	chr3.hg19:g.121413392T>C	ENSP00000341848:p.Lys1988Arg	88.0	0.0		68.0	3.0	NM_001256486	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	ENST00000340645.5	hg19	CCDS3004.1	.	.	.	.	.	.	.	.	.	.	T	12.99	2.103219	0.37145	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.15139	2.45;2.52	5.2	5.2	0.72013	.	0.000000	0.56097	D	0.000030	T	0.30166	0.0756	L	0.43757	1.38	0.36538	D	0.871104	D;D;P;P	0.71674	0.998;0.998;0.884;0.907	D;D;P;B	0.80764	0.994;0.994;0.509;0.364	T	0.14868	-1.0457	10	0.15952	T	0.53	.	13.0579	0.58990	0.0:0.0:0.0:1.0	.	1913;1993;1993;1988	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	R	1988;1993	ENSP00000341848:K1988R;ENSP00000377275:K1993R	ENSP00000341848:K1988R	K	-	2	0	GOLGB1	122896082	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.450000	0.44943	2.171000	0.68590	0.528000	0.53228	AAG	.	.		0.353	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000355159.1	NM_004487	
SEMA5B	54437	hgsc.bcm.edu	37	3	122642473	122642473	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:122642473G>A	ENST00000357599.3	-	10	1649	c.1263C>T	c.(1261-1263)ccC>ccT	p.P421P	SEMA5B_ENST00000195173.4_Silent_p.P421P|SEMA5B_ENST00000451055.2_Silent_p.P475P	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	421	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CCTGGAAATTGGGGATGGGGT	0.552																																					p.P475P		Atlas-SNP	.											.	SEMA5B	303	.	0			c.C1425T						.						89.0	88.0	88.0					3																	122642473		2203	4300	6503	SO:0001819	synonymous_variant	54437	exon10			GAAATTGGGGATG	AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1263C>T	chr3.hg19:g.122642473G>A		82.0	0.0		93.0	5.0	NM_001256347	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Silent	SNP	ENST00000357599.3	hg19	CCDS35491.1																																																																																			.	.		0.552	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277165.1	NM_001031702	
ZNF148	7707	hgsc.bcm.edu	37	3	124996586	124996586	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:124996586A>G	ENST00000360647.4	-	7	1136	c.651T>C	c.(649-651)caT>caC	p.H217H	ZNF148_ENST00000497929.1_5'UTR|SLC12A8_ENST00000423114.2_Missense_Mutation_p.M41T|ZNF148_ENST00000485866.1_Silent_p.H217H|ZNF148_ENST00000544464.1_Silent_p.H12H|ZNF148_ENST00000484491.1_Silent_p.H217H|ZNF148_ENST00000468369.1_Silent_p.H25H|ZNF148_ENST00000492394.1_Silent_p.H217H	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	217					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						GAATCTTCTCATGTCTCTGAA	0.343																																					p.H217H		Atlas-SNP	.											.	ZNF148	84	.	0			c.T651C						.						112.0	102.0	105.0					3																	124996586		2203	4299	6502	SO:0001819	synonymous_variant	7707	exon7			CTTCTCATGTCTC	U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.651T>C	chr3.hg19:g.124996586A>G		106.0	0.0		96.0	4.0	NM_021964	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Silent	SNP	ENST00000360647.4	hg19	CCDS3031.1	.	.	.	.	.	.	.	.	.	.	A	11.47	1.649150	0.29336	.	.	ENSG00000221955	ENST00000423114	D	0.87256	-2.23	5.04	-1.2	0.09554	.	.	.	.	.	T	0.74884	0.3775	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.56655	-0.7943	8	0.14252	T	0.57	-13.9577	10.1612	0.42853	0.5436:0.0:0.4564:0.0	.	41	A0AV02-2	.	T	41	ENSP00000404243:M41T	ENSP00000404243:M41T	M	-	2	0	SLC12A8	126479276	0.998000	0.40836	0.992000	0.48379	0.997000	0.91878	0.774000	0.26675	-0.360000	0.08138	0.459000	0.35465	ATG	.	.		0.343	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355452.4	NM_021964	
DNAJB8	165721	hgsc.bcm.edu	37	3	128181700	128181700	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:128181700A>G	ENST00000469083.1	-	2	2946	c.389T>C	c.(388-390)cTg>cCg	p.L130P	DNAJB8-AS1_ENST00000471626.1_RNA|DNAJB8_ENST00000319153.3_Missense_Mutation_p.L130P			Q8NHS0	DNJB8_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 8	130					chaperone-mediated protein folding (GO:0061077)|negative regulation of inclusion body assembly (GO:0090084)	cytosol (GO:0005829)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|protein binding involved in protein folding (GO:0044183)|unfolded protein binding (GO:0051082)			kidney(1)|large_intestine(4)|lung(4)|prostate(1)|skin(1)	11				GBM - Glioblastoma multiforme(114;0.177)		GGCCCCCCTCAGGCCATGGCC	0.602																																					p.L130P		Atlas-SNP	.											.	DNAJB8	34	.	0			c.T389C						.						37.0	42.0	40.0					3																	128181700		2203	4300	6503	SO:0001583	missense	165721	exon3			CCCCTCAGGCCAT		CCDS3048.1	3q21.3	2014-01-21			ENSG00000179407	ENSG00000179407		"""Heat shock proteins / DNAJ (HSP40)"""	23699	protein-coding gene	gene with protein product		611337					Standard	NM_153330		Approved	MGC33884, CT156	uc003ekk.2	Q8NHS0	OTTHUMG00000159690	ENST00000469083.1:c.389T>C	chr3.hg19:g.128181700A>G	ENSP00000417418:p.Leu130Pro	70.0	0.0		86.0	4.0	NM_153330	B3KWV7	Missense_Mutation	SNP	ENST00000469083.1	hg19	CCDS3048.1	.	.	.	.	.	.	.	.	.	.	A	0.569	-0.842153	0.02671	.	.	ENSG00000179407	ENST00000469083;ENST00000319153	T;T	0.73897	-0.79;-0.79	4.75	4.75	0.60458	.	1.463120	0.04448	N	0.372090	T	0.66982	0.2845	L	0.33485	1.01	0.22034	N	0.999403	P	0.50943	0.94	B	0.41571	0.36	T	0.55585	-0.8118	10	0.31617	T	0.26	.	9.4475	0.38706	0.7577:0.2423:0.0:0.0	.	130	Q8NHS0	DNJB8_HUMAN	P	130	ENSP00000417418:L130P;ENSP00000316053:L130P	ENSP00000316053:L130P	L	-	2	0	DNAJB8	129664390	0.006000	0.16342	0.059000	0.19551	0.057000	0.15508	1.522000	0.35921	1.772000	0.52199	0.459000	0.35465	CTG	.	.		0.602	DNAJB8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356933.1	NM_153330	
RPN1	6184	hgsc.bcm.edu	37	3	128356928	128356928	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:128356928T>C	ENST00000296255.3	-	3	395	c.347A>G	c.(346-348)aAg>aGg	p.K116R	RPN1_ENST00000497289.1_5'UTR	NM_002950.3	NP_002941.1	P04843	RPN1_HUMAN	ribophorin I	116					cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(2)|stomach(2)	13				GBM - Glioblastoma multiforme(114;0.189)		AACTGGGAGCTTGACTGTGAA	0.453			T	EVI1	AML																																p.K116R		Atlas-SNP	.		Dom	yes		3	3q21.3-q25.2	6184	ribophorin I		L	.	RPN1	39	.	0			c.A347G						.						78.0	71.0	73.0					3																	128356928		2203	4300	6503	SO:0001583	missense	6184	exon3			GGGAGCTTGACTG		CCDS3051.1	3q21.3	2013-03-06			ENSG00000163902	ENSG00000163902			10381	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 1 homolog (S. cerevisiae)"", ""oligosaccharyltransferase complex subunit (non-catalytic)"""	180470					Standard	NM_002950		Approved	OST1	uc003ekr.1	P04843	OTTHUMG00000159691	ENST00000296255.3:c.347A>G	chr3.hg19:g.128356928T>C	ENSP00000296255:p.Lys116Arg	102.0	0.0		97.0	4.0	NM_002950	B2R5Z0|D3DNB6|Q68DT1	Missense_Mutation	SNP	ENST00000296255.3	hg19	CCDS3051.1	.	.	.	.	.	.	.	.	.	.	T	12.28	1.890737	0.33348	.	.	ENSG00000163902	ENST00000296255;ENST00000545956	.	.	.	5.68	1.99	0.26369	.	0.165039	0.56097	N	0.000039	T	0.36936	0.0985	N	0.20685	0.6	0.80722	D	1	B	0.09022	0.002	B	0.11329	0.006	T	0.06679	-1.0813	9	0.21540	T	0.41	-10.8861	8.7744	0.34753	0.0:0.2751:0.0:0.7249	.	116	P04843	RPN1_HUMAN	R	116;90	.	ENSP00000296255:K116R	K	-	2	0	RPN1	129839618	1.000000	0.71417	1.000000	0.80357	0.788000	0.44548	1.543000	0.36147	0.102000	0.17638	-1.205000	0.01647	AAG	.	.		0.453	RPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356934.2	NM_002950	
U2SURP	23350	hgsc.bcm.edu	37	3	142733211	142733211	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:142733211G>A	ENST00000473835.2	+	4	371	c.281G>A	c.(280-282)cGa>cAa	p.R94Q	U2SURP_ENST00000397933.2_5'UTR|U2SURP_ENST00000493598.2_Missense_Mutation_p.R94Q	NM_001080415.1	NP_001073884.1	O15042	SR140_HUMAN	U2 snRNP-associated SURP domain containing	94					RNA processing (GO:0006396)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R94Q(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	31						ACAGCTAAGCGAACTTTAAGT	0.294																																					p.R94Q		Atlas-SNP	.											U2SURP,rectum,carcinoma,0,1	U2SURP	66	.	1	Substitution - Missense(1)	large_intestine(1)	c.G281A						.						53.0	49.0	51.0					3																	142733211		1811	4074	5885	SO:0001583	missense	23350	exon4			CTAAGCGAACTTT	BK000564	CCDS46928.1	3q23	2013-02-12			ENSG00000163714	ENSG00000163714		"""RNA binding motif (RRM) containing"""	30855	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein a"", ""Ser/Arg-rich domain protein, 140 kDa"", ""U2 associated SR140 protein"""					9205841, 12234937	Standard	NM_001080415		Approved	fSAPa, SR140	uc003evh.1	O15042	OTTHUMG00000159323	ENST00000473835.2:c.281G>A	chr3.hg19:g.142733211G>A	ENSP00000418563:p.Arg94Gln	190.0	1.0		173.0	7.0	NM_001080415	A0PJ60|Q0D2M1|Q2NKQ7|Q9BR70	Missense_Mutation	SNP	ENST00000473835.2	hg19	CCDS46928.1	.	.	.	.	.	.	.	.	.	.	G	36	5.670812	0.96754	.	.	ENSG00000163714	ENST00000473835;ENST00000493782;ENST00000319822;ENST00000493598;ENST00000465175	T;T	0.11495	2.77;2.79	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.35038	0.0918	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;P	0.64776	0.929;0.913;0.806	T	0.01961	-1.1239	10	0.48119	T	0.1	-8.5639	19.7727	0.96373	0.0:0.0:1.0:0.0	.	94;94;94	B4DK81;O15042-2;O15042	.;.;SR140_HUMAN	Q	94;94;94;94;64	ENSP00000418563:R94Q;ENSP00000422011:R94Q	ENSP00000322376:R94Q	R	+	2	0	U2SURP	144215901	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.301000	0.96167	2.758000	0.94735	0.563000	0.77884	CGA	.	.		0.294	U2SURP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354603.2	NM_001080415	
PIK3CA	5290	hgsc.bcm.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.H1047R	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	PIK3CA_ENST00000263967,NS,adenocarcinoma,0,2044	PIK3CA	8460	.	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)	c.A3140G						.						99.0	89.0	92.0					3																	178952085		1912	4130	6042	SO:0001583	missense	5290	exon21			ATGCACATCATGG		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	chr3.hg19:g.178952085A>G	ENSP00000263967:p.His1047Arg	122.0	0.0		126.0	47.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	.	.		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
IGF2BP2	10644	hgsc.bcm.edu	37	3	185410534	185410534	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:185410534T>C	ENST00000382199.2	-	5	452	c.357A>G	c.(355-357)gaA>gaG	p.E119E	IGF2BP2_ENST00000457616.2_Silent_p.E125E|IGF2BP2_ENST00000421047.2_Silent_p.E62E|IGF2BP2_ENST00000346192.3_Silent_p.E119E	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	119	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CAACGGCGGTTTCTGTGTCTG	0.358																																					p.E119E		Atlas-SNP	.											.	IGF2BP2	69	.	0			c.A357G						.						127.0	122.0	124.0					3																	185410534		2203	4300	6503	SO:0001819	synonymous_variant	10644	exon5			GGCGGTTTCTGTG	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.357A>G	chr3.hg19:g.185410534T>C		115.0	0.0		113.0	5.0	NM_001007225	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Silent	SNP	ENST00000382199.2	hg19	CCDS3273.2																																																																																			.	.		0.358	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548	
TNIP2	79155	hgsc.bcm.edu	37	4	2746449	2746449	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:2746449T>C	ENST00000315423.7	-	4	967	c.881A>G	c.(880-882)gAg>gGg	p.E294G	TNIP2_ENST00000503235.1_Intron|TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000510267.1_Missense_Mutation_p.E187G	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CTGCACCCGCTCCAACGCAGC	0.612																																					p.E294G		Atlas-SNP	.											.	TNIP2	28	.	0			c.A881G						.						38.0	43.0	42.0					4																	2746449		2203	4300	6503	SO:0001583	missense	79155	exon4			ACCCGCTCCAACG	BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.881A>G	chr4.hg19:g.2746449T>C	ENSP00000321203:p.Glu294Gly	39.0	0.0		60.0	4.0	NM_024309		Missense_Mutation	SNP	ENST00000315423.7	hg19	CCDS3362.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.226462	0.79576	.	.	ENSG00000168884	ENST00000510267;ENST00000315423	T;T	0.48836	0.8;0.8	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.71904	0.3395	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.76173	-0.3056	10	0.56958	D	0.05	-41.3956	15.089	0.72177	0.0:0.0:0.0:1.0	.	294	Q8NFZ5	TNIP2_HUMAN	G	187;294	ENSP00000427613:E187G;ENSP00000321203:E294G	ENSP00000321203:E294G	E	-	2	0	TNIP2	2716247	1.000000	0.71417	1.000000	0.80357	0.420000	0.31355	7.206000	0.77891	2.159000	0.67721	0.454000	0.30748	GAG	.	.		0.612	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206589.5	NM_024309	
SORCS2	57537	hgsc.bcm.edu	37	4	7730078	7730078	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:7730078T>C	ENST00000507866.2	+	22	2980	c.2871T>C	c.(2869-2871)gaT>gaC	p.D957D	SORCS2_ENST00000329016.9_Splice_Site_p.D785D	NM_020777.2	NP_065828.2	Q96PQ0	SORC2_HUMAN	sortilin-related VPS10 domain containing receptor 2	957					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(8)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	42						TCTTTCCAGATCAATTTCAAG	0.607																																					p.D957D		Atlas-SNP	.											.	SORCS2	98	.	0			c.T2871C						.						59.0	63.0	62.0					4																	7730078		1966	4142	6108	SO:0001630	splice_region_variant	57537	exon22			TCCAGATCAATTT	AB037750	CCDS47008.1	4p16.1	2008-02-05			ENSG00000184985	ENSG00000184985			16698	protein-coding gene	gene with protein product		606284				11499680	Standard	NM_020777		Approved	KIAA1329	uc003gkb.4	Q96PQ0	OTTHUMG00000159981	ENST00000507866.2:c.2870-1T>C	chr4.hg19:g.7730078T>C		92.0	0.0		107.0	5.0	NM_020777	Q9P2L7	Silent	SNP	ENST00000507866.2	hg19	CCDS47008.1																																																																																			.	.		0.607	SORCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358685.4	NM_020777	Silent
NCAPG	64151	hgsc.bcm.edu	37	4	17839331	17839331	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:17839331T>C	ENST00000251496.2	+	16	2549	c.2373T>C	c.(2371-2373)gcT>gcC	p.A791A		NM_022346.4	NP_071741.2	Q9BPX3	CND3_HUMAN	non-SMC condensin I complex, subunit G	791					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	27				STAD - Stomach adenocarcinoma(129;0.18)		CTCCTTTAGCTGAAATTGATA	0.408																																					p.A791A		Atlas-SNP	.											.	NCAPG	76	.	0			c.T2373C						.						164.0	161.0	162.0					4																	17839331		2203	4300	6503	SO:0001819	synonymous_variant	64151	exon16			TTTAGCTGAAATT	AF331796	CCDS3424.1	4p15.32	2014-01-15			ENSG00000109805	ENSG00000109805			24304	protein-coding gene	gene with protein product	"""chromosome condensation protein G"""	606280				10910072, 11136719	Standard	NM_022346		Approved	FLJ12450, hCAP-G, CAP-G, YCG1	uc003gpp.4	Q9BPX3	OTTHUMG00000128539	ENST00000251496.2:c.2373T>C	chr4.hg19:g.17839331T>C		68.0	0.0		80.0	4.0	NM_022346	Q3MJE0|Q96SV9|Q9BUR3|Q9BVY1|Q9H914|Q9H9Z6|Q9HBI9	Silent	SNP	ENST00000251496.2	hg19	CCDS3424.1																																																																																			.	.		0.408	NCAPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250375.1	NM_022346	
SLIT2	9353	hgsc.bcm.edu	37	4	20547710	20547710	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:20547710A>G	ENST00000504154.1	+	22	2585	c.2333A>G	c.(2332-2334)cAt>cGt	p.H778R	SLIT2_ENST00000509394.2_3'UTR|SLIT2_ENST00000503823.1_Missense_Mutation_p.H770R|SLIT2_ENST00000503837.1_Missense_Mutation_p.H774R|SLIT2_ENST00000273739.5_Missense_Mutation_p.H782R	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	778					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						AACTACAAACATTTAACACTT	0.363																																					p.H778R		Atlas-SNP	.											.	SLIT2	290	.	0			c.A2333G						.						111.0	103.0	106.0					4																	20547710		2203	4300	6503	SO:0001583	missense	9353	exon22			ACAAACATTTAAC	AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2333A>G	chr4.hg19:g.20547710A>G	ENSP00000422591:p.His778Arg	85.0	0.0		95.0	4.0	NM_004787	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	ENST00000504154.1	hg19	CCDS3426.1	.	.	.	.	.	.	.	.	.	.	A	19.63	3.862963	0.71949	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	T;T;T;T	0.23754	1.89;1.89;1.89;1.89	5.47	5.47	0.80525	.	0.043065	0.85682	D	0.000000	T	0.10423	0.0255	N	0.02120	-0.675	0.80722	D	1	B;B	0.33280	0.405;0.18	B;B	0.26094	0.039;0.066	T	0.28870	-1.0030	10	0.26408	T	0.33	.	15.8443	0.78876	1.0:0.0:0.0:0.0	.	770;778	O94813-3;O94813	.;SLIT2_HUMAN	R	770;778;782;774;774	ENSP00000427548:H770R;ENSP00000422591:H778R;ENSP00000273739:H782R;ENSP00000422261:H774R	ENSP00000273739:H782R	H	+	2	0	SLIT2	20156808	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.204000	0.77872	2.194000	0.70268	0.528000	0.53228	CAT	.	.		0.363	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250396.2		
GPR125	166647	hgsc.bcm.edu	37	4	22425934	22425934	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:22425934C>T	ENST00000334304.5	-	11	1754	c.1485G>A	c.(1483-1485)ttG>ttA	p.L495L	GPR125_ENST00000502482.1_Silent_p.L495L|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000508133.1_Silent_p.L269L	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	495					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				GTTCATCAGCCAACATGATGT	0.483																																					p.L495L		Atlas-SNP	.											.	GPR125	118	.	0			c.G1485A						.						136.0	119.0	125.0					4																	22425934		2203	4300	6503	SO:0001819	synonymous_variant	166647	exon11			ATCAGCCAACATG	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1485G>A	chr4.hg19:g.22425934C>T		239.0	0.0		213.0	88.0	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Silent	SNP	ENST00000334304.5	hg19	CCDS33964.1																																																																																			.	.		0.483	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
GPR125	166647	hgsc.bcm.edu	37	4	22439915	22439915	+	Missense_Mutation	SNP	G	G	C	rs147843055		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:22439915G>C	ENST00000334304.5	-	8	1318	c.1049C>G	c.(1048-1050)cCt>cGt	p.P350R	GPR125_ENST00000502482.1_Missense_Mutation_p.P350R|GPR125_ENST00000282943.5_5'UTR|GPR125_ENST00000508133.1_Missense_Mutation_p.P124R	NM_145290.3	NP_660333.2	Q8IWK6	GP125_HUMAN	G protein-coupled receptor 125	350					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(33)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	56		Breast(46;0.198)				CCTCTCTGGAGGACAGTACTG	0.448																																					p.P350R		Atlas-SNP	.											GPR125,colon,carcinoma,0,2	GPR125	118	.	0			c.C1049G						.						164.0	144.0	150.0					4																	22439915		2203	4300	6503	SO:0001583	missense	166647	exon8			TCTGGAGGACAGT	AK095866	CCDS33964.1	4p15.31	2014-08-08			ENSG00000152990	ENSG00000152990		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"""	13839	protein-coding gene	gene with protein product		612303				12565841	Standard	NM_145290		Approved	FLJ38547, PGR21	uc003gqm.2	Q8IWK6	OTTHUMG00000160926	ENST00000334304.5:c.1049C>G	chr4.hg19:g.22439915G>C	ENSP00000334952:p.Pro350Arg	252.0	0.0		221.0	0.0	NM_145290	Q6UXK9|Q86SQ5|Q8TC55	Missense_Mutation	SNP	ENST00000334304.5	hg19	CCDS33964.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150664	0.78001	.	.	ENSG00000152990	ENST00000334304;ENST00000508133;ENST00000502482;ENST00000514129	T;T;T	0.55413	0.52;0.52;0.52	5.6	5.6	0.85130	GPCR, family 2, extracellular hormone receptor domain (1);	0.054916	0.85682	D	0.000000	T	0.72415	0.3457	M	0.69823	2.125	0.54753	D	0.999983	D;D;D;P	0.65815	0.995;0.983;0.962;0.912	D;P;P;P	0.65443	0.935;0.905;0.605;0.611	T	0.74680	-0.3584	10	0.87932	D	0	-24.3783	19.618	0.95643	0.0:0.0:1.0:0.0	.	225;350;124;350	Q8IWK6-3;Q8IWK6-2;Q8IWK6-4;Q8IWK6	.;.;.;GP125_HUMAN	R	350;124;350;86	ENSP00000334952:P350R;ENSP00000422606:P124R;ENSP00000421006:P350R	ENSP00000334952:P350R	P	-	2	0	GPR125	22049013	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	4.196000	0.58407	2.635000	0.89317	0.650000	0.86243	CCT	.	.		0.448	GPR125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362960.3		
PI4K2B	55300	hgsc.bcm.edu	37	4	25256736	25256736	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:25256736T>C	ENST00000264864.6	+	3	662	c.473T>C	c.(472-474)cTc>cCc	p.L158P	PI4K2B_ENST00000512921.1_Missense_Mutation_p.L62P	NM_018323.3	NP_060793.2	Q8TCG2	P4K2B_HUMAN	phosphatidylinositol 4-kinase type 2 beta	158	PI3K/PI4K.				phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)	p.L158P(1)		endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(3)|skin(3)	15		Breast(46;0.173)				TATGGTCAACTCAATCCAAAA	0.393																																					p.L158P		Atlas-SNP	.											PI4K2B,NS,carcinoma,0,1	PI4K2B	42	.	1	Substitution - Missense(1)	kidney(1)	c.T473C						.						53.0	51.0	52.0					4																	25256736		2203	4300	6503	SO:0001583	missense	55300	exon3			GTCAACTCAATCC	AK001967	CCDS3433.1	4p15.31	2009-05-07			ENSG00000038210	ENSG00000038210			18215	protein-coding gene	gene with protein product		612101				11923287	Standard	NM_018323		Approved	PI4KIIB, FLJ11105, PIK42B	uc003grk.2	Q8TCG2	OTTHUMG00000128564	ENST00000264864.6:c.473T>C	chr4.hg19:g.25256736T>C	ENSP00000264864:p.Leu158Pro	71.0	1.0		94.0	4.0	NM_018323	Q9NUW2	Missense_Mutation	SNP	ENST00000264864.6	hg19	CCDS3433.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.646763	0.87958	.	.	ENSG00000038210	ENST00000512921;ENST00000264864;ENST00000537420	T	0.53640	0.61	6.17	6.17	0.99709	Phosphatidylinositol 3-/4-kinase, catalytic (1);	0.000000	0.85682	D	0.000000	T	0.76343	0.3974	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80158	-0.1499	10	0.44086	T	0.13	-12.1399	16.8222	0.85835	0.0:0.0:0.0:1.0	.	158	Q8TCG2	P4K2B_HUMAN	P	62;158;127	ENSP00000264864:L158P	ENSP00000264864:L158P	L	+	2	0	PI4K2B	24865834	1.000000	0.71417	0.987000	0.45799	0.961000	0.63080	7.997000	0.88414	2.371000	0.80710	0.533000	0.62120	CTC	.	.		0.393	PI4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250415.1	NM_018323	
FIP1L1	81608	hgsc.bcm.edu	37	4	54256722	54256722	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:54256722T>C	ENST00000337488.6	+	7	626	c.432T>C	c.(430-432)ccT>ccC	p.P144P	FIP1L1_ENST00000306932.6_Silent_p.P129P|FIP1L1_ENST00000358575.5_Silent_p.P129P|FIP1L1_ENST00000507922.1_Silent_p.P129P|FIP1L1_ENST00000507166.1_Silent_p.P144P	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	144	Necessary for stimulating PAPOLA activity.|Sufficient for interaction with CPSF4.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TTGATGCACCTGGAAGCATTA	0.363			T	PDGFRA	idiopathic hypereosinophilic syndrome																																p.P144P		Atlas-SNP	.		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	.	FIP1L1	60	.	0			c.T432C						.						114.0	114.0	114.0					4																	54256722		2203	4300	6503	SO:0001819	synonymous_variant	81608	exon7			TGCACCTGGAAGC	AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.432T>C	chr4.hg19:g.54256722T>C		101.0	0.0		88.0	4.0	NM_030917	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Silent	SNP	ENST00000337488.6	hg19	CCDS3491.1																																																																																			.	.		0.363	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250602.1	NM_030917	
KIT	3815	hgsc.bcm.edu	37	4	55565812	55565812	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:55565812T>C	ENST00000288135.5	+	4	733	c.636T>C	c.(634-636)ccT>ccC	p.P212P		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	212	Ig-like C2-type 3.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	AAGCTGTGCCTGTTGTGTCTG	0.388		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																												p.P212P		Atlas-SNP	.	yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	.	KIT	7396	.	0			c.T636C						.						132.0	115.0	121.0					4																	55565812		2203	4300	6503	SO:0001819	synonymous_variant	3815	exon4	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	TGTGCCTGTTGTG	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.636T>C	chr4.hg19:g.55565812T>C		83.0	0.0		104.0	5.0	NM_000222	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Silent	SNP	ENST00000288135.5	hg19	CCDS3496.1																																																																																			.	.		0.388	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250618.1		
ALB	213	hgsc.bcm.edu	37	4	74277806	74277806	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:74277806C>T	ENST00000503124.1	+	5	564	c.357C>T	c.(355-357)tgC>tgT	p.C119C	ALB_ENST00000295897.4_Silent_p.C269C|ALB_ENST00000509063.1_Silent_p.C269C|ALB_ENST00000505649.1_3'UTR|ALB_ENST00000415165.2_Silent_p.C77C|ALB_ENST00000401494.3_Silent_p.C154C			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			ACACGGAATGCTGCCATGGAG	0.458																																					p.C269C		Atlas-SNP	.											.	ALB	132	.	0			c.C807T						.						214.0	191.0	199.0					4																	74277806		2203	4300	6503	SO:0001819	synonymous_variant	213	exon7			GGAATGCTGCCAT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.357C>T	chr4.hg19:g.74277806C>T		109.0	0.0		123.0	5.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Silent	SNP	ENST00000503124.1	hg19																																																																																				.	.		0.458	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
MTHFD2L	441024	hgsc.bcm.edu	37	4	75147266	75147266	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:75147266A>G	ENST00000395759.2	+	7	957	c.930A>G	c.(928-930)gaA>gaG	p.E310E	MTHFD2L_ENST00000325278.6_Splice_Site_p.E252E	NM_001144978.1	NP_001138450.1	Q9H903	MTD2L_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 2-like	310					folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|tetrahydrofolate interconversion (GO:0035999)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NAD+) activity (GO:0004487)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)			central_nervous_system(1)|endometrium(1)|lung(4)|ovary(2)	8			all cancers(17;0.0101)|Lung(101;0.196)			TGGACTTCGAAGGTAATAAAC	0.333																																					p.E310E		Atlas-SNP	.											.	MTHFD2L	41	.	0			c.A930G						.						94.0	94.0	94.0					4																	75147266		2203	4300	6503	SO:0001630	splice_region_variant	441024	exon7			CTTCGAAGGTAAT	BC065771	CCDS47075.1	4q13.3	2011-08-03			ENSG00000163738	ENSG00000163738			31865	protein-coding gene	gene with protein product		614047				21163947	Standard	NM_001144978		Approved	MGC72244	uc011cbk.2	Q9H903	OTTHUMG00000157135	ENST00000395759.2:c.931+1A>G	chr4.hg19:g.75147266A>G		72.0	0.0		84.0	4.0	NM_001144978	Q6P079|Q8N560	Silent	SNP	ENST00000395759.2	hg19	CCDS47075.1																																																																																			.	.		0.333	MTHFD2L-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001004346	Silent
CNOT6L	246175	hgsc.bcm.edu	37	4	78697513	78697513	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:78697513A>G	ENST00000504123.1	-	2	169	c.39T>C	c.(37-39)ccT>ccC	p.P13P	CNOT6L_ENST00000264903.4_Silent_p.P13P|CNOT6L_ENST00000506166.1_5'UTR			Q96LI5	CNO6L_HUMAN	CCR4-NOT transcription complex, subunit 6-like	13	Required for interaction with CNOT1, CNOT3 and CNOT7.				gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA destabilization (GO:0061157)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	9						GAGGATCTGGAGGATCATATT	0.358																																					p.P13P		Atlas-SNP	.											.	CNOT6L	57	.	0			c.T39C						.						84.0	76.0	78.0					4																	78697513		1816	4084	5900	SO:0001819	synonymous_variant	246175	exon2			ATCTGGAGGATCA	AL133112	CCDS68731.1	4q13.3	2014-06-17				ENSG00000138767			18042	protein-coding gene	gene with protein product							Standard	NM_144571		Approved	DKFZp434K098, Ccr4b	uc003hks.3	Q96LI5		ENST00000504123.1:c.39T>C	chr4.hg19:g.78697513A>G		97.0	0.0		125.0	5.0	NM_144571	Q9UF92	Silent	SNP	ENST00000504123.1	hg19		.	.	.	.	.	.	.	.	.	.	A	10.07	1.250433	0.22880	.	.	ENSG00000138767	ENST00000515506	.	.	.	5.72	3.23	0.37069	.	.	.	.	.	T	0.56790	0.2009	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51942	-0.8641	4	.	.	.	-5.2525	8.0722	0.30695	0.8128:0.0:0.0667:0.1205	.	.	.	.	P	42	.	.	S	-	1	0	CNOT6L	78916537	0.991000	0.36638	1.000000	0.80357	0.998000	0.95712	0.471000	0.22100	0.974000	0.38366	0.455000	0.32223	TCC	.	.		0.358	CNOT6L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000362515.1		
HNRNPD	3184	hgsc.bcm.edu	37	4	83280683	83280683	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:83280683T>C	ENST00000313899.7	-	3	677	c.400A>G	c.(400-402)Aca>Gca	p.T134A	HNRNPD_ENST00000353341.4_Missense_Mutation_p.T134A|HNRNPD_ENST00000543098.1_Missense_Mutation_p.T82A|HNRNPD_ENST00000508119.1_5'Flank|HNRNPD_ENST00000541060.1_Intron|HNRNPD_ENST00000352301.4_Missense_Mutation_p.T115A	NM_031370.2	NP_112738.1	Q14103	HNRPD_HUMAN	heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA binding protein 1, 37kDa)	134	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				circadian regulation of translation (GO:0097167)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|regulation of circadian rhythm (GO:0042752)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(1)	7						GATCGCCCTGTGATAGGATCT	0.388																																					p.T134A		Atlas-SNP	.											.	HNRNPD	23	.	0			c.A400G						.						115.0	111.0	112.0					4																	83280683		2203	4300	6503	SO:0001583	missense	3184	exon3			GCCCTGTGATAGG	AF026126	CCDS3590.1, CCDS3591.1, CCDS3592.1	4q21	2013-02-12	2002-08-29	2008-04-18	ENSG00000138668	ENSG00000138668		"""RNA binding motif (RRM) containing"""	5036	protein-coding gene	gene with protein product		601324	"""heterogeneous nuclear ribonucleoprotein D (AU-rich element RNA-binding protein 1, 37kD)"""	AUF1, HNRPD		9615222	Standard	NM_001003810		Approved		uc003hmm.1	Q14103	OTTHUMG00000130290	ENST00000313899.7:c.400A>G	chr4.hg19:g.83280683T>C	ENSP00000313199:p.Thr134Ala	110.0	0.0		100.0	4.0	NM_031370	A8K9J2|P07029|Q01858|Q14100|Q14101|Q14102|Q4W5A1|Q9UCE8|Q9UCE9	Missense_Mutation	SNP	ENST00000313899.7	hg19	CCDS3592.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.7|27.7	4.859151|4.859151	0.91433|0.91433	.|.	.|.	ENSG00000138668|ENSG00000138668	ENST00000514671|ENST00000313899;ENST00000353341;ENST00000352301;ENST00000543098;ENST00000307213;ENST00000509263;ENST00000507010;ENST00000515432;ENST00000503822;ENST00000509107	.|T;T;T;T;T;T;T;T;T	.|0.79554	.|1.97;1.97;1.97;1.97;1.97;1.97;1.97;1.97;-1.28	5.86|5.86	5.86|5.86	0.93980|0.93980	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90266|0.90266	0.6956|0.6956	M|M	0.82433|0.82433	2.59|2.59	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.76494	.|0.987;0.999;0.993;0.995	.|D;D;D;D	.|0.72075	.|0.944;0.976;0.925;0.968	D|D	0.91532|0.91532	0.5243|0.5243	5|10	.|0.87932	.|D	.|0	.|.	16.5602|16.5602	0.84551|0.84551	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|115;134;115;134	.|Q14103-4;Q14103-3;Q14103-2;Q14103	.|.;.;.;HNRPD_HUMAN	R|A	37|134;134;115;82;109;67;134;36;115;88	.|ENSP00000313199:T134A;ENSP00000313327:T134A;ENSP00000305860:T115A;ENSP00000439380:T82A;ENSP00000420926:T67A;ENSP00000421952:T134A;ENSP00000426666:T36A;ENSP00000422615:T115A;ENSP00000425439:T88A	.|ENSP00000307544:T109A	H|T	-|-	2|1	0|0	HNRNPD|HNRNPD	83499707|83499707	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.606000|7.606000	0.82863|0.82863	2.367000|2.367000	0.80283|0.80283	0.528000|0.528000	0.53228|0.53228	CAC|ACA	.	.		0.388	HNRNPD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252630.2	NM_031370	
FAM13A	10144	hgsc.bcm.edu	37	4	89652508	89652508	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:89652508A>C	ENST00000264344.5	-	23	3122	c.2915T>G	c.(2914-2916)tTt>tGt	p.F972C	FAM13A-AS1_ENST00000500765.1_RNA|FAM13A-AS1_ENST00000511543.1_RNA|FAM13A_ENST00000513837.1_Missense_Mutation_p.F618C|FAM13A_ENST00000508369.1_Missense_Mutation_p.F646C|FAM13A_ENST00000511976.1_Missense_Mutation_p.F558C|FAM13A_ENST00000395002.2_Missense_Mutation_p.F618C|FAM13A_ENST00000503556.1_Missense_Mutation_p.F632C	NM_014883.3	NP_055698.2	O94988	FA13A_HUMAN	family with sequence similarity 13, member A	972					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	55						GTTGTCTTCAAAATCCCGAAG	0.483																																					p.F972C		Atlas-SNP	.											.	FAM13A	181	.	0			c.T2915G						.						54.0	58.0	57.0					4																	89652508		2203	4300	6503	SO:0001583	missense	10144	exon23			TCTTCAAAATCCC	AB020721	CCDS34029.1, CCDS43251.1, CCDS58911.1, CCDS58912.1, CCDS58913.1	4q22.1	2011-09-07	2009-01-20	2009-01-20	ENSG00000138640	ENSG00000138640		"""Rho GTPase activating proteins"""	19367	protein-coding gene	gene with protein product		613299	"""family with sequence similarity 13, member A1"""	FAM13A1			Standard	NM_014883		Approved	KIAA0914, ARHGAP48	uc003hse.2	O94988	OTTHUMG00000161006	ENST00000264344.5:c.2915T>G	chr4.hg19:g.89652508A>C	ENSP00000264344:p.Phe972Cys	39.0	0.0		25.0	8.0	NM_014883	B4DLC1|Q24JP0|Q5PR21|Q8NBA3	Missense_Mutation	SNP	ENST00000264344.5	hg19	CCDS34029.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.640699	0.87859	.	.	ENSG00000138640	ENST00000395002;ENST00000264344;ENST00000503556;ENST00000511976;ENST00000508369;ENST00000513837	T;T;T;T;T;T	0.63417	-0.04;0.96;0.27;0.41;0.26;0.27	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.80829	0.4698	M	0.83012	2.62	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.998;0.997;0.999;0.999;0.999	D	0.83885	0.0281	10	0.87932	D	0	.	15.7623	0.78096	1.0:0.0:0.0:0.0	.	618;558;972;618;632;646	O94988-6;E9PGM7;O94988;O94988-3;O94988-5;O94988-1	.;.;FA13A_HUMAN;.;.;.	C	618;972;632;558;646;618	ENSP00000378450:F618C;ENSP00000264344:F972C;ENSP00000427189:F632C;ENSP00000421914:F558C;ENSP00000421562:F646C;ENSP00000423252:F618C	ENSP00000264344:F972C	F	-	2	0	FAM13A	89871531	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.469000	0.73555	2.311000	0.77944	0.533000	0.62120	TTT	.	.		0.483	FAM13A-022	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363371.1		
GPRIN3	285513	hgsc.bcm.edu	37	4	90170622	90170622	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:90170622A>G	ENST00000609438.1	-	2	1158	c.640T>C	c.(640-642)Tct>Cct	p.S214P	GPRIN3_ENST00000333209.4_Missense_Mutation_p.S214P	NM_198281.2	NP_938022.2	Q6ZVF9	GRIN3_HUMAN	GPRIN family member 3	214										breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|prostate(2)|skin(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;5.67e-05)		CCTACAGGAGAGGATGAGTGA	0.507																																					p.S214P		Atlas-SNP	.											.	GPRIN3	90	.	0			c.T640C						.						63.0	61.0	62.0					4																	90170622		2203	4300	6503	SO:0001583	missense	285513	exon2			CAGGAGAGGATGA	AK124616	CCDS34030.1	4q22.1	2006-08-24				ENSG00000185477			27733	protein-coding gene	gene with protein product		611241				15488195	Standard	NM_198281		Approved	GRIN3, FLJ42625	uc003hsm.1	Q6ZVF9		ENST00000609438.1:c.640T>C	chr4.hg19:g.90170622A>G	ENSP00000476603:p.Ser214Pro	73.0	0.0		78.0	5.0	NM_198281	Q8IVE4	Missense_Mutation	SNP	ENST00000609438.1	hg19	CCDS34030.1	.	.	.	.	.	.	.	.	.	.	A	9.662	1.144353	0.21205	.	.	ENSG00000185477	ENST00000333209	T	0.10099	2.91	5.15	-4.64	0.03349	.	0.538685	0.14052	N	0.344654	T	0.04407	0.0121	N	0.24115	0.695	0.09310	N	1	B	0.14438	0.01	B	0.11329	0.006	T	0.36432	-0.9748	10	0.25751	T	0.34	-0.1805	0.8212	0.01111	0.3496:0.1066:0.2706:0.2732	.	214	Q6ZVF9	GRIN3_HUMAN	P	214	ENSP00000328672:S214P	ENSP00000328672:S214P	S	-	1	0	GPRIN3	90389645	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.693000	0.05121	-0.565000	0.06061	0.528000	0.53228	TCT	.	.		0.507	GPRIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363540.2	NM_198281	
RAP1GDS1	5910	hgsc.bcm.edu	37	4	99342470	99342470	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:99342470A>G	ENST00000408927.3	+	12	1478	c.1365A>G	c.(1363-1365)gaA>gaG	p.E455E	RAP1GDS1_ENST00000380158.4_Silent_p.E407E|RAP1GDS1_ENST00000339360.5_Silent_p.E456E|RAP1GDS1_ENST00000408900.3_Silent_p.E406E|RAP1GDS1_ENST00000453712.2_Silent_p.E455E|RAP1GDS1_ENST00000264572.7_Silent_p.E364E	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	455					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AATGGTGTGAAGCCAAAGATC	0.438			T	NUP98	T-ALL																																p.E456E		Atlas-SNP	.		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	.	RAP1GDS1	61	.	0			c.A1368G						.						123.0	124.0	123.0					4																	99342470		1996	4177	6173	SO:0001819	synonymous_variant	5910	exon12			GTGTGAAGCCAAA		CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1365A>G	chr4.hg19:g.99342470A>G		104.0	0.0		96.0	4.0	NM_001100426	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Silent	SNP	ENST00000408927.3	hg19	CCDS43253.1																																																																																			.	.		0.438	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363273.2	NM_001100426	
PPP3CA	5530	hgsc.bcm.edu	37	4	101953446	101953446	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:101953446T>C	ENST00000394854.3	-	12	2000	c.1317A>G	c.(1315-1317)ggA>ggG	p.G439G	PPP3CA_ENST00000323055.6_Silent_p.G397G|PPP3CA_ENST00000507176.1_Silent_p.G341G|PPP3CA_ENST00000523694.2_Silent_p.G372G|PPP3CA_ENST00000512215.1_Silent_p.G207G|PPP3CA_ENST00000394853.4_Silent_p.G439G	NM_000944.4	NP_000935.1	Q08209	PP2BA_HUMAN	protein phosphatase 3, catalytic subunit, alpha isozyme	439					calcineurin-NFAT signaling cascade (GO:0033173)|calcium ion transport (GO:0006816)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|dephosphorylation (GO:0016311)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|multicellular organismal response to stress (GO:0033555)|negative regulation of insulin secretion (GO:0046676)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|protein import into nucleus (GO:0006606)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic transmission (GO:0050804)|response to amphetamine (GO:0001975)|response to calcium ion (GO:0051592)|skeletal muscle fiber development (GO:0048741)|T cell activation (GO:0042110)|transition between fast and slow fiber (GO:0014883)	calcineurin complex (GO:0005955)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein phosphatase activity (GO:0033192)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|protein dimerization activity (GO:0046983)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(123;6.79e-08)		TTTGCTTCCCTCCAGAAAGTA	0.542																																					p.G439G		Atlas-SNP	.											.	PPP3CA	51	.	0			c.A1317G						.						87.0	63.0	71.0					4																	101953446		2203	4300	6503	SO:0001819	synonymous_variant	5530	exon12			CTTCCCTCCAGAA		CCDS34037.1, CCDS47113.1, CCDS47114.1	4q24	2010-03-17	2010-03-05		ENSG00000138814	ENSG00000138814	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9314	protein-coding gene	gene with protein product	"""calcineurin A alpha"", ""protein phosphatase 2B, catalytic subunit, alpha isoform"""	114105	"""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform (calcineurin A alpha)"", ""protein phosphatase 3 (formerly 2B), catalytic subunit, alpha isoform"""	CALN, CALNA		2848250, 1659808	Standard	NM_000944		Approved	CNA1, PPP2B	uc011cen.1	Q08209	OTTHUMG00000133839	ENST00000394854.3:c.1317A>G	chr4.hg19:g.101953446T>C		113.0	0.0		172.0	7.0	NM_000944	A1A441|A8K3B7|A8W6Z7|A8W6Z8|B5BUA2|Q8TAW9	Silent	SNP	ENST00000394854.3	hg19	CCDS34037.1																																																																																			.	.		0.542	PPP3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000258379.2	NM_000944	
BANK1	55024	hgsc.bcm.edu	37	4	102751252	102751252	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:102751252A>G	ENST00000322953.4	+	2	632	c.358A>G	c.(358-360)Agt>Ggt	p.S120G	BANK1_ENST00000444316.2_Missense_Mutation_p.S90G|BANK1_ENST00000428908.1_Intron|BANK1_ENST00000508653.1_Intron|BANK1_ENST00000504592.1_Missense_Mutation_p.S105G	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	120	Interaction with ITPR2.				B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		TGGAGTGAAGAGTTCAGATCA	0.378																																					p.S120G		Atlas-SNP	.											.	BANK1	95	.	0			c.A358G						.						69.0	74.0	72.0					4																	102751252		2203	4300	6503	SO:0001583	missense	55024	exon2			GTGAAGAGTTCAG	AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.358A>G	chr4.hg19:g.102751252A>G	ENSP00000320509:p.Ser120Gly	92.0	0.0		81.0	4.0	NM_017935	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	ENST00000322953.4	hg19	CCDS34038.1	.	.	.	.	.	.	.	.	.	.	A	5.909	0.351884	0.11182	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000444316	T;T;T	0.09445	2.98;2.98;2.98	5.18	3.98	0.46160	.	0.156955	0.38005	N	0.001850	T	0.13628	0.0330	L	0.44542	1.39	0.50813	D	0.999892	P;P	0.49559	0.925;0.925	P;P	0.47162	0.54;0.54	T	0.01621	-1.1310	10	0.45353	T	0.12	.	11.441	0.50096	0.8487:0.1513:0.0:0.0	.	120;105	Q8NDB2;Q8NDB2-2	BANK1_HUMAN;.	G	105;120;90	ENSP00000421443:S105G;ENSP00000320509:S120G;ENSP00000388817:S90G	ENSP00000320509:S120G	S	+	1	0	BANK1	102970275	1.000000	0.71417	0.004000	0.12327	0.006000	0.05464	6.428000	0.73383	0.791000	0.33826	-0.321000	0.08615	AGT	.	.		0.378	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363161.1	NM_017935	
COL25A1	84570	hgsc.bcm.edu	37	4	109895542	109895542	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:109895542T>C	ENST00000399132.1	-	8	1003	c.473A>G	c.(472-474)cAa>cGa	p.Q158R	COL25A1_ENST00000399126.1_Missense_Mutation_p.Q158R|COL25A1_ENST00000399127.1_Missense_Mutation_p.Q158R	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1									p.Q158L(2)		NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		CTGATCACCTTGTTCTCCCTG	0.373																																					p.Q158R		Atlas-SNP	.											COL25A1_ENST00000399126,NS,carcinoma,0,2	COL25A1	178	.	2	Substitution - Missense(2)	lung(2)	c.A473G						.						125.0	117.0	120.0					4																	109895542		1865	4095	5960	SO:0001583	missense	84570	exon7			TCACCTTGTTCTC	AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.473A>G	chr4.hg19:g.109895542T>C	ENSP00000382083:p.Gln158Arg	109.0	0.0		68.0	3.0	NM_198721		Missense_Mutation	SNP	ENST00000399132.1	hg19	CCDS43258.1	.	.	.	.	.	.	.	.	.	.	T	13.57	2.276237	0.40294	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;T;D	0.95035	-3.59;0.88;-3.59	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	D	0.92724	0.7687	N	0.04787	-0.16	0.36613	D	0.875305	D;D	0.59357	0.981;0.985	D;D	0.74023	0.969;0.982	D	0.93430	0.6784	9	.	.	.	-7.2521	14.7834	0.69784	0.0:0.0:0.0:1.0	.	158;158	Q9BXS0-2;Q9BXS0	.;COPA1_HUMAN	R	158;160;154;158;158;160	ENSP00000382083:Q158R;ENSP00000382078:Q158R;ENSP00000382077:Q158R	.	Q	-	2	0	COL25A1	110114991	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.896000	0.63222	2.231000	0.72958	0.455000	0.32223	CAA	.	.		0.373	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000315938.2	NM_032518	
CASP6	839	hgsc.bcm.edu	37	4	110617568	110617568	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:110617568T>C	ENST00000265164.2	-	4	382	c.305A>G	c.(304-306)gAg>gGg	p.E102G	CASP6_ENST00000352981.3_Intron|CASP6_ENST00000510324.1_5'Flank|CASP6_ENST00000505486.1_Intron	NM_001226.3	NP_001217.2	P55212	CASP6_HUMAN	caspase 6, apoptosis-related cysteine peptidase	102					apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|epithelial cell differentiation (GO:0030855)|proteolysis (GO:0006508)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|identical protein binding (GO:0042802)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000171)		CTACCTACCCTCATGAATTTT	0.333																																					p.E102G		Atlas-SNP	.											.	CASP6	25	.	0			c.A305G						.						92.0	86.0	88.0					4																	110617568		2201	4300	6501	SO:0001583	missense	839	exon4			CTACCCTCATGAA	U20536	CCDS3684.1, CCDS3685.1	4q25	2008-02-05	2005-08-17		ENSG00000138794	ENSG00000138794		"""Caspases"""	1507	protein-coding gene	gene with protein product		601532	"""caspase 6, apoptosis-related cysteine protease"""			8780721, 7796396	Standard	XM_005263271		Approved	MCH2	uc003hzn.1	P55212	OTTHUMG00000131914	ENST00000265164.2:c.305A>G	chr4.hg19:g.110617568T>C	ENSP00000265164:p.Glu102Gly	65.0	0.0		54.0	4.0	NM_001226	Q9BQE7	Missense_Mutation	SNP	ENST00000265164.2	hg19	CCDS3684.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.922484	0.52653	.	.	ENSG00000138794	ENST00000265164;ENST00000503684	T;T	0.23348	1.91;1.91	5.68	1.6	0.23607	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.438446	0.27168	N	0.020618	T	0.34193	0.0889	M	0.83953	2.67	0.58432	D	0.999993	P	0.37688	0.605	B	0.42738	0.396	T	0.23762	-1.0179	10	0.54805	T	0.06	.	8.1826	0.31319	0.121:0.0:0.2505:0.6285	.	102	P55212	CASP6_HUMAN	G	102;84	ENSP00000265164:E102G;ENSP00000427669:E84G	ENSP00000265164:E102G	E	-	2	0	CASP6	110837017	0.995000	0.38212	0.999000	0.59377	0.965000	0.64279	2.798000	0.47884	0.947000	0.37659	0.528000	0.53228	GAG	.	.		0.333	CASP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254866.1	NM_001226	
NDST4	64579	hgsc.bcm.edu	37	4	115858629	115858629	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:115858629C>A	ENST00000264363.2	-	5	1930	c.1252G>T	c.(1252-1254)Gct>Tct	p.A418S		NM_022569.1	NP_072091.1	Q9H3R1	NDST4_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 4	418	Heparan sulfate N-deacetylase 4.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(43)|ovary(1)|prostate(7)|skin(11)|upper_aerodigestive_tract(1)|urinary_tract(1)	81		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000562)		GGGGCCACAGCATAGCCCATG	0.453																																					p.A418S		Atlas-SNP	.											.	NDST4	193	.	0			c.G1252T						.						121.0	104.0	110.0					4																	115858629		2203	4300	6503	SO:0001583	missense	64579	exon5			CCACAGCATAGCC	AB036429	CCDS3706.1	4q26	2008-02-05			ENSG00000138653	ENSG00000138653		"""Sulfotransferases, membrane-bound"""	20779	protein-coding gene	gene with protein product		615039				11087757	Standard	NM_022569		Approved		uc003ibu.3	Q9H3R1	OTTHUMG00000132916	ENST00000264363.2:c.1252G>T	chr4.hg19:g.115858629C>A	ENSP00000264363:p.Ala418Ser	254.0	0.0		267.0	96.0	NM_022569	Q2KHM8	Missense_Mutation	SNP	ENST00000264363.2	hg19	CCDS3706.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766399	0.69878	.	.	ENSG00000138653	ENST00000264363	T	0.42513	0.97	5.47	5.47	0.80525	.	0.094770	0.64402	D	0.000001	T	0.50446	0.1616	M	0.63208	1.945	0.80722	D	1	P	0.42556	0.783	P	0.46585	0.521	T	0.34925	-0.9809	10	0.20519	T	0.43	.	19.6922	0.96007	0.0:1.0:0.0:0.0	.	418	Q9H3R1	NDST4_HUMAN	S	418	ENSP00000264363:A418S	ENSP00000264363:A418S	A	-	1	0	NDST4	116078078	1.000000	0.71417	0.997000	0.53966	0.999000	0.98932	7.740000	0.84986	2.704000	0.92352	0.655000	0.94253	GCT	.	.		0.453	NDST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256427.1	NM_022569	
LARP1B	55132	hgsc.bcm.edu	37	4	129028308	129028308	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:129028308C>A	ENST00000326639.6	+	9	1039	c.828C>A	c.(826-828)agC>agA	p.S276R	LARP1B_ENST00000441387.1_Missense_Mutation_p.S276R|LARP1B_ENST00000394288.3_Missense_Mutation_p.S276R|LARP1B_ENST00000427266.1_Missense_Mutation_p.S276R|LARP1B_ENST00000354456.3_5'UTR|LARP1B_ENST00000432347.2_Missense_Mutation_p.S276R|LARP1B_ENST00000512292.1_Missense_Mutation_p.S276R|LARP1B_ENST00000264584.5_Missense_Mutation_p.S229R	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	276	HTH La-type RNA-binding. {ECO:0000255|PROSITE-ProRule:PRU00332}.					nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						TGAAGGATAGCACAGAAGTAG	0.383																																					p.S276R		Atlas-SNP	.											.	LARP1B	120	.	0			c.C828A						.						58.0	62.0	60.0					4																	129028308		2203	4300	6503	SO:0001583	missense	55132	exon9			GGATAGCACAGAA		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.828C>A	chr4.hg19:g.129028308C>A	ENSP00000321997:p.Ser276Arg	123.0	0.0		111.0	47.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	hg19	CCDS3738.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.10|16.10	3.027507|3.027507	0.54683|0.54683	.|.	.|.	ENSG00000138709|ENSG00000138709	ENST00000507377|ENST00000326639;ENST00000512292;ENST00000508819;ENST00000394288;ENST00000432347;ENST00000264584;ENST00000441387;ENST00000427266	.|T;T;T;T;T;T;T;T	.|0.58358	.|0.34;0.34;0.34;0.34;0.34;0.34;0.34;0.34	5.38|5.38	3.51|3.51	0.40186|0.40186	.|Winged helix-turn-helix transcription repressor DNA-binding (1);RNA-binding protein Lupus La (3);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80177|0.80177	0.4575|0.4575	H|H	0.99117|0.99117	4.435|4.435	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0	.|D;D;D;D	.|0.97110	.|1.0;0.999;0.998;0.998	T|T	0.80665|0.80665	-0.1281|-0.1281	5|10	.|0.87932	.|D	.|0	.|.	4.4731|4.4731	0.11722|0.11722	0.0:0.6006:0.0:0.3994|0.0:0.6006:0.0:0.3994	.|.	.|276;276;276;276	.|Q659C4;G3XAJ5;Q659C4-3;G3V0E9	.|LAR1B_HUMAN;.;.;.	N|R	245|276;276;229;276;276;229;276;276	.|ENSP00000321997:S276R;ENSP00000422850:S276R;ENSP00000427281:S229R;ENSP00000377829:S276R;ENSP00000390395:S276R;ENSP00000264584:S229R;ENSP00000396521:S276R;ENSP00000403586:S276R	.|ENSP00000264584:S229R	H|S	+|+	1|3	0|2	LARP1B|LARP1B	129247758|129247758	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	0.813000|0.813000	0.27225|0.27225	1.500000|1.500000	0.48636|0.48636	0.655000|0.655000	0.94253|0.94253	CAC|AGC	.	.		0.383	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
TLL1	7092	hgsc.bcm.edu	37	4	167020635	167020635	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr4:167020635C>G	ENST00000061240.2	+	20	3510	c.2863C>G	c.(2863-2865)Ctt>Gtt	p.L955V	TLL1_ENST00000507499.1_Missense_Mutation_p.L978V	NM_012464.4	NP_036596.3	O43897	TLL1_HUMAN	tolloid-like 1	955	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(21)|lung(26)|ovary(2)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	all_hematologic(180;0.221)	Melanoma(52;0.0315)|Prostate(90;0.0405)		GBM - Glioblastoma multiforme(119;0.103)		CTTTGATGGTCTTGATTCAAC	0.448																																					p.L955V		Atlas-SNP	.											.	TLL1	194	.	0			c.C2863G						.						199.0	203.0	202.0					4																	167020635		2203	4300	6503	SO:0001583	missense	7092	exon20			GATGGTCTTGATT	AF282732	CCDS3811.1, CCDS56342.1	4q32-q33	2008-07-29			ENSG00000038295	ENSG00000038295			11843	protein-coding gene	gene with protein product		606742				10516436	Standard	NM_012464		Approved		uc003irh.2	O43897	OTTHUMG00000161112	ENST00000061240.2:c.2863C>G	chr4.hg19:g.167020635C>G	ENSP00000061240:p.Leu955Val	266.0	0.0		290.0	104.0	NM_012464	B2RMU2|Q96AN3|Q9NQS4	Missense_Mutation	SNP	ENST00000061240.2	hg19	CCDS3811.1	.	.	.	.	.	.	.	.	.	.	C	2.910	-0.225583	0.06022	.	.	ENSG00000038295	ENST00000061240;ENST00000507499	T;T	0.18174	2.23;2.23	5.54	4.7	0.59300	CUB (5);	0.145379	0.47093	U	0.000248	T	0.11367	0.0277	N	0.16602	0.42	0.80722	D	1	B;B	0.24317	0.101;0.081	B;B	0.31442	0.13;0.089	T	0.17899	-1.0354	10	0.17369	T	0.5	.	10.7403	0.46149	0.0:0.8542:0.0:0.1458	.	978;955	E9PD25;O43897	.;TLL1_HUMAN	V	955;978	ENSP00000061240:L955V;ENSP00000426082:L978V	ENSP00000061240:L955V	L	+	1	0	TLL1	167240085	0.021000	0.18746	0.123000	0.21794	0.006000	0.05464	1.892000	0.39748	1.342000	0.45619	-0.244000	0.11960	CTT	.	.		0.448	TLL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363821.1		
MED10	84246	hgsc.bcm.edu	37	5	6374436	6374436	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:6374436C>T	ENST00000255764.3	-	3	420		c.e3+1			NM_032286.2	NP_115662.2	Q9BTT4	MED10_HUMAN	mediator complex subunit 10						gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	RNA polymerase II transcription cofactor activity (GO:0001104)			kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|urinary_tract(1)	5						TAGAGTCTTACCTTCATGGTG	0.418																																					.		Atlas-SNP	.											.	MED10	7	.	0			c.309+1G>A						.						170.0	164.0	166.0					5																	6374436		2203	4300	6503	SO:0001630	splice_region_variant	84246	exon4			GTCTTACCTTCAT		CCDS34134.1	5p15.31	2008-02-05	2007-07-30		ENSG00000133398	ENSG00000133398			28760	protein-coding gene	gene with protein product	"""NUT2 homolog (S. cerevisiae)"""	612382	"""mediator of RNA polymerase II transcription, subunit 10 homolog (NUT2, S. cerevisiae)"""			15657623, 15175163	Standard	NM_032286		Approved	TRG20, L6, MGC5309, NUT2	uc003jdo.3	Q9BTT4	OTTHUMG00000161682	ENST00000255764.3:c.309+1G>A	chr5.hg19:g.6374436C>T		186.0	0.0		264.0	58.0	NM_032286	C6G491	Splice_Site	SNP	ENST00000255764.3	hg19	CCDS34134.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.358031	0.82243	.	.	ENSG00000133398	ENST00000255764	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.7542	0.91826	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MED10	6427436	1.000000	0.71417	0.998000	0.56505	0.914000	0.54420	7.149000	0.77396	2.735000	0.93741	0.655000	0.94253	.	.	.		0.418	MED10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365714.1	NM_032286	Intron
IL7R	3575	hgsc.bcm.edu	37	5	35867499	35867499	+	Missense_Mutation	SNP	A	A	G	rs199742437		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:35867499A>G	ENST00000303115.3	+	3	442	c.313A>G	c.(313-315)Agc>Ggc	p.S105G	IL7R_ENST00000343305.4_Missense_Mutation_p.S105G|IL7R_ENST00000511031.1_3'UTR|IL7R_ENST00000511982.1_Missense_Mutation_p.S105G|IL7R_ENST00000506850.1_Missense_Mutation_p.S105G	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	105					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			GATTGGAAAGAGCAATATATG	0.373			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																														p.S105G		Atlas-SNP	.		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	.	IL7R	200	.	0			c.A313G						.						94.0	96.0	95.0					5																	35867499		2203	4300	6503	SO:0001583	missense	3575	exon3			GGAAAGAGCAATA	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.313A>G	chr5.hg19:g.35867499A>G	ENSP00000306157:p.Ser105Gly	70.0	0.0		100.0	26.0	NM_002185	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	ENST00000303115.3	hg19	CCDS3911.1	.	.	.	.	.	.	.	.	.	.	A	9.228	1.035063	0.19590	.	.	ENSG00000168685	ENST00000303115;ENST00000343305;ENST00000506850;ENST00000511982	T;T;T;T	0.76709	-1.04;-1.04;-1.04;1.39	5.7	3.18	0.36537	.	0.418548	0.28192	N	0.016249	T	0.73916	0.3648	M	0.62723	1.935	0.09310	N	1	B;D	0.71674	0.135;0.998	B;P	0.50162	0.027;0.633	T	0.62718	-0.6795	10	0.23302	T	0.38	-4.551	3.9495	0.09363	0.6719:0.0:0.1001:0.228	.	105;105	D6RGV2;P16871	.;IL7RA_HUMAN	G	105	ENSP00000306157:S105G;ENSP00000345819:S105G;ENSP00000421207:S105G;ENSP00000425309:S105G	ENSP00000306157:S105G	S	+	1	0	IL7R	35903256	0.306000	0.24490	0.073000	0.20177	0.009000	0.06853	1.654000	0.37334	0.983000	0.38602	0.528000	0.53228	AGC	.	.		0.373	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
PLCXD3	345557	hgsc.bcm.edu	37	5	41382499	41382499	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:41382499T>C	ENST00000377801.3	-	2	315	c.241A>G	c.(241-243)Aca>Gca	p.T81A	PLCXD3_ENST00000328457.3_Missense_Mutation_p.T81A			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	81	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						AAATTCATTGTCTGAGTGGCT	0.458																																					p.T81A		Atlas-SNP	.											.	PLCXD3	86	.	0			c.A241G						.						59.0	64.0	62.0					5																	41382499		2203	4300	6503	SO:0001583	missense	345557	exon2			TCATTGTCTGAGT		CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.241A>G	chr5.hg19:g.41382499T>C	ENSP00000367032:p.Thr81Ala	70.0	0.0		121.0	5.0	NM_001005473	A6NL04	Missense_Mutation	SNP	ENST00000377801.3	hg19	CCDS34150.1	.	.	.	.	.	.	.	.	.	.	T	17.95	3.513612	0.64522	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	T;T	0.62364	0.03;0.03	6.07	6.07	0.98685	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	0.044920	0.85682	D	0.000000	T	0.65048	0.2654	N	0.16602	0.42	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.62364	-0.6870	10	0.20519	T	0.43	-10.3218	16.6407	0.85098	0.0:0.0:0.0:1.0	.	81	Q63HM9	PLCX3_HUMAN	A	81	ENSP00000367032:T81A;ENSP00000333751:T81A	ENSP00000333751:T81A	T	-	1	0	PLCXD3	41418256	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	7.665000	0.83852	2.326000	0.78906	0.533000	0.62120	ACA	.	.		0.458	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367109.1	XM_293875	
GHR	2690	hgsc.bcm.edu	37	5	42713594	42713594	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:42713594T>C	ENST00000230882.4	+	8	1038	c.848T>C	c.(847-849)tTt>tCt	p.F283S	GHR_ENST00000537449.1_Missense_Mutation_p.F96S|GHR_ENST00000357703.3_Missense_Mutation_p.F261S	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	283					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	GTGATGCTATTTGTATTCTTA	0.313																																					p.F290S		Atlas-SNP	.											.	GHR	94	.	0			c.T869C						.						177.0	179.0	178.0					5																	42713594		2202	4296	6498	SO:0001583	missense	2690	exon8			TGCTATTTGTATT		CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.848T>C	chr5.hg19:g.42713594T>C	ENSP00000230882:p.Phe283Ser	56.0	0.0		88.0	4.0	NM_001242399	Q9HCX2	Missense_Mutation	SNP	ENST00000230882.4	hg19	CCDS3940.1	.	.	.	.	.	.	.	.	.	.	T	12.84	2.059811	0.36373	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000356276;ENST00000537449	D;D;T	0.84873	-1.91;-1.77;-0.76	5.42	5.42	0.78866	.	0.167630	0.51477	D	0.000089	T	0.82084	0.4960	L	0.46741	1.465	0.32131	N	0.586786	D	0.54397	0.966	P	0.46479	0.518	D	0.85324	0.1086	10	0.49607	T	0.09	-11.7242	9.3428	0.38089	0.0:0.0803:0.0:0.9197	.	283	P10912	GHR_HUMAN	S	283;261;283;96	ENSP00000230882:F283S;ENSP00000350335:F261S;ENSP00000442206:F96S	ENSP00000230882:F283S	F	+	2	0	GHR	42749351	1.000000	0.71417	0.999000	0.59377	0.510000	0.34073	3.865000	0.56033	2.059000	0.61396	0.477000	0.44152	TTT	.	.		0.313	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000211605.2	NM_000163	
CCDC125	202243	hgsc.bcm.edu	37	5	68578778	68578778	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:68578778A>G	ENST00000396496.2	-	12	1421	c.1314T>C	c.(1312-1314)gcT>gcC	p.A438A	CCDC125_ENST00000383374.2_3'UTR|CCDC125_ENST00000511257.1_Silent_p.A313A|CCDC125_ENST00000460090.1_5'UTR|CCDC125_ENST00000396499.1_Silent_p.A438A			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125	438						cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		TCTCGTTTGAAGCAGTGTCTT	0.383																																					p.A438A		Atlas-SNP	.											.	CCDC125	41	.	0			c.T1314C						.						103.0	101.0	102.0					5																	68578778		2203	4300	6503	SO:0001819	synonymous_variant	202243	exon11			GTTTGAAGCAGTG	AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.1314T>C	chr5.hg19:g.68578778A>G		91.0	0.0		117.0	6.0	NM_176816	Q86Z19	Silent	SNP	ENST00000396496.2	hg19	CCDS4000.1																																																																																			.	.		0.383	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254027.4	NM_176816	
DDX46	9879	hgsc.bcm.edu	37	5	134121198	134121198	+	Silent	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:134121198T>A	ENST00000354283.4	+	11	1521	c.1386T>A	c.(1384-1386)acT>acA	p.T462T	DDX46_ENST00000452510.2_Silent_p.T462T|DDX46_ENST00000509178.1_3'UTR			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	462	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.			TKECKKFS -> PKGVRSF (in Ref. 1; AAD43033). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TACAGATTACTAAAGAGTGTA	0.393																																					p.T462T	Colon(13;391 453 4901 21675 24897)	Atlas-SNP	.											.	DDX46	77	.	0			c.T1386A						.						154.0	155.0	155.0					5																	134121198		2203	4300	6503	SO:0001819	synonymous_variant	9879	exon11			GATTACTAAAGAG		CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.1386T>A	chr5.hg19:g.134121198T>A		156.0	0.0		167.0	34.0	NM_014829	O94894|Q96EI0|Q9Y658	Silent	SNP	ENST00000354283.4	hg19	CCDS34240.1																																																																																			.	.		0.393	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371584.1	NM_014829	
PKD2L2	27039	hgsc.bcm.edu	37	5	137257346	137257346	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:137257346T>C	ENST00000508883.1	+	9	1376	c.1350T>C	c.(1348-1350)gtT>gtC	p.V450V	PKD2L2_ENST00000290431.5_Silent_p.V450V|PKD2L2_ENST00000502810.1_Silent_p.V428V|PKD2L2_ENST00000350250.4_Silent_p.V416V|PKD2L2_ENST00000508638.1_Intron			Q9NZM6	PK2L2_HUMAN	polycystic kidney disease 2-like 2	450					calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)	integral component of membrane (GO:0016021)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)			breast(1)|endometrium(7)|kidney(4)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	28			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0109)			TTCGAATTGTTCTTGGAGATT	0.338																																					p.V450V		Atlas-SNP	.											.	PKD2L2	68	.	0			c.T1350C						.						138.0	125.0	129.0					5																	137257346		1798	4069	5867	SO:0001819	synonymous_variant	27039	exon9			AATTGTTCTTGGA	AF118125	CCDS43367.1, CCDS58971.1, CCDS58972.1	5q31	2011-12-16			ENSG00000078795	ENSG00000078795		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9012	protein-coding gene	gene with protein product		604669				10602361	Standard	NM_014386		Approved	TRPP5	uc003lbw.1	Q9NZM6	OTTHUMG00000163306	ENST00000508883.1:c.1350T>C	chr5.hg19:g.137257346T>C		114.0	0.0		121.0	5.0	NM_014386	A6NK98|B4DXD2|E9PC91|E9PDG4|Q86YB4|Q9UNJ0	Silent	SNP	ENST00000508883.1	hg19																																																																																				.	.		0.338	PKD2L2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372521.1	NM_014386	
KDM3B	51780	hgsc.bcm.edu	37	5	137727543	137727543	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:137727543T>C	ENST00000314358.5	+	8	2422	c.2222T>C	c.(2221-2223)cTc>cCc	p.L741P	KDM3B_ENST00000394866.1_Missense_Mutation_p.L397P|KDM3B_ENST00000542866.1_Intron	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	741	Ser-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						ATGCCAACTCTCTCCTCTAGC	0.607																																					p.L741P		Atlas-SNP	.											.	KDM3B	177	.	0			c.T2222C						.						79.0	91.0	87.0					5																	137727543		2202	4300	6502	SO:0001583	missense	51780	exon8			CAACTCTCTCCTC	AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.2222T>C	chr5.hg19:g.137727543T>C	ENSP00000326563:p.Leu741Pro	52.0	0.0		89.0	4.0	NM_016604	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	ENST00000314358.5	hg19	CCDS34242.1	.	.	.	.	.	.	.	.	.	.	T	15.74	2.923032	0.52653	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866	T;T	0.77489	-0.53;-1.1	5.25	5.25	0.73442	.	0.376195	0.27122	N	0.020823	T	0.79811	0.4510	N	0.24115	0.695	0.80722	D	1	D;D	0.69078	0.997;0.995	D;P	0.65010	0.931;0.854	T	0.82141	-0.0604	10	0.56958	D	0.05	-24.5692	15.4446	0.75220	0.0:0.0:0.0:1.0	.	397;741	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	P	741;531;397	ENSP00000326563:L741P;ENSP00000378335:L397P	ENSP00000326563:L741P	L	+	2	0	KDM3B	137755442	0.478000	0.25917	1.000000	0.80357	0.998000	0.95712	2.591000	0.46163	2.111000	0.64477	0.533000	0.62120	CTC	.	.		0.607	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373597.1	NM_016604	
PCDHB15	56121	hgsc.bcm.edu	37	5	140627100	140627100	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:140627100C>T	ENST00000231173.3	+	1	1954	c.1954C>T	c.(1954-1956)Cgc>Tgc	p.R652C		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	652	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGAGCCTCCGCGCTCGGCCAC	0.706																																					p.R652C		Atlas-SNP	.											.	PCDHB15	138	.	0			c.C1954T						.						33.0	36.0	35.0					5																	140627100		2168	4243	6411	SO:0001583	missense	56121	exon1			CCTCCGCGCTCGG	AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1954C>T	chr5.hg19:g.140627100C>T	ENSP00000231173:p.Arg652Cys	65.0	0.0		95.0	4.0	NM_018935	Q8IUX5	Missense_Mutation	SNP	ENST00000231173.3	hg19	CCDS4257.1	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595627	0.28445	.	.	ENSG00000113248	ENST00000231173	T	0.55234	0.53	4.36	3.46	0.39613	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.56761	0.2007	M	0.82323	2.585	0.41476	D	0.988137	B	0.19200	0.034	B	0.19148	0.024	T	0.60667	-0.7218	9	0.62326	D	0.03	.	13.426	0.61026	0.1586:0.8414:0.0:0.0	.	652	Q9Y5E8	PCDBF_HUMAN	C	652	ENSP00000231173:R652C	ENSP00000231173:R652C	R	+	1	0	PCDHB15	140607284	0.019000	0.18553	0.902000	0.35471	0.192000	0.23643	2.843000	0.48238	0.951000	0.37770	0.549000	0.68633	CGC	.	.		0.706	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251804.2	NM_018935	
G3BP1	10146	hgsc.bcm.edu	37	5	151179526	151179526	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:151179526G>A	ENST00000394123.3	+	9	1065	c.920G>A	c.(919-921)cGa>cAa	p.R307Q	G3BP1_ENST00000356245.3_Missense_Mutation_p.R307Q|G3BP1_ENST00000543466.1_Missense_Mutation_p.R125Q			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	307					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)	p.R307Q(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			CGAGAACAACGAATAAATATT	0.463																																					p.R307Q		Atlas-SNP	.											G3BP1,rectum,carcinoma,0,1	G3BP1	53	.	1	Substitution - Missense(1)	large_intestine(1)	c.G920A						.						38.0	40.0	39.0					5																	151179526		2203	4300	6503	SO:0001583	missense	10146	exon9			AACAACGAATAAA	BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.920G>A	chr5.hg19:g.151179526G>A	ENSP00000377681:p.Arg307Gln	105.0	1.0		158.0	9.0	NM_005754	Q5HYE9	Missense_Mutation	SNP	ENST00000394123.3	hg19	CCDS4319.1	.	.	.	.	.	.	.	.	.	.	G	17.44	3.390704	0.62066	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245;ENST00000274596	T;T;T	0.73681	-0.66;-0.77;-0.66	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.70727	0.3257	M	0.80183	2.485	0.58432	D	0.999999	P	0.37997	0.614	B	0.24394	0.053	T	0.72424	-0.4298	10	0.13108	T	0.6	-18.7807	18.4052	0.90533	0.0:0.0:1.0:0.0	.	307	Q13283	G3BP1_HUMAN	Q	307;125;307;149	ENSP00000377681:R307Q;ENSP00000445035:R125Q;ENSP00000348578:R307Q	ENSP00000274596:R149Q	R	+	2	0	G3BP1	151159719	1.000000	0.71417	0.978000	0.43139	0.965000	0.64279	6.851000	0.75425	2.415000	0.81967	0.650000	0.86243	CGA	.	.		0.463	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252431.1	NM_005754	
GABRB2	2561	hgsc.bcm.edu	37	5	160763717	160763717	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:160763717C>T	ENST00000393959.1	-	6	600	c.601G>A	c.(601-603)Gga>Aga	p.G201R	GABRB2_ENST00000517901.1_Missense_Mutation_p.G138R|GABRB2_ENST00000353437.6_Missense_Mutation_p.G201R|GABRB2_ENST00000520240.1_Missense_Mutation_p.G201R|GABRB2_ENST00000274547.2_Missense_Mutation_p.G201R|GABRB2_ENST00000517547.1_Missense_Mutation_p.G41R			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	201					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	TTCGTTACTCCTGTTACTGCA	0.373																																					p.G201R		Atlas-SNP	.											.	GABRB2	161	.	0			c.G601A						.						134.0	132.0	133.0					5																	160763717		2203	4300	6503	SO:0001583	missense	2561	exon7			TTACTCCTGTTAC		CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.601G>A	chr5.hg19:g.160763717C>T	ENSP00000377531:p.Gly201Arg	70.0	0.0		78.0	4.0	NM_021911	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	ENST00000393959.1	hg19	CCDS4355.1	.	.	.	.	.	.	.	.	.	.	C	34	5.294104	0.95546	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901;ENST00000517547	T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.56	5.56	0.83823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.86952	0.6057	M	0.65975	2.015	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.97110	1.0;0.993;0.995;0.997	D	0.83514	0.0082	10	0.25106	T	0.35	.	19.5644	0.95388	0.0:1.0:0.0:0.0	.	41;138;201;201	B7Z279;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	R	201;201;201;201;138;41	ENSP00000377531:G201R;ENSP00000274547:G201R;ENSP00000274546:G201R;ENSP00000429320:G201R;ENSP00000430532:G138R;ENSP00000429750:G41R	ENSP00000274547:G201R	G	-	1	0	GABRB2	160696295	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.639000	0.83342	2.617000	0.88574	0.655000	0.94253	GGA	.	.		0.373	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252704.1		
STC2	8614	hgsc.bcm.edu	37	5	172752906	172752906	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:172752906T>C	ENST00000265087.4	-	2	1568	c.259A>G	c.(259-261)Act>Gct	p.T87A	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	87					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			TGCAGAAAAGTCATGCAAATC	0.463																																					p.T87A		Atlas-SNP	.											.	STC2	59	.	0			c.A259G						.						271.0	295.0	287.0					5																	172752906		2203	4300	6503	SO:0001583	missense	8614	exon2			GAAAAGTCATGCA	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.259A>G	chr5.hg19:g.172752906T>C	ENSP00000265087:p.Thr87Ala	73.0	0.0		131.0	6.0	NM_003714		Missense_Mutation	SNP	ENST00000265087.4	hg19	CCDS4388.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	31|31	5.069789|5.069789	0.93950|0.93950	.|.	.|.	ENSG00000113739|ENSG00000113739	ENST00000520648|ENST00000265087;ENST00000518455	.|.	.|.	.|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	.|0.047193	.|0.85682	.|D	.|0.000000	T|T	0.73628|0.73628	0.3611|0.3611	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.79108	.|0.992	T|T	0.74372|0.74372	-0.3687|-0.3687	5|9	.|0.49607	.|T	.|0.09	-11.5548|-11.5548	15.7961|15.7961	0.78412|0.78412	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|87	.|O76061	.|STC2_HUMAN	G|A	40|87;2	.|.	.|ENSP00000265087:T87A	D|T	-|-	2|1	0|0	STC2|STC2	172685512|172685512	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.698000|7.698000	0.84413|0.84413	2.131000|2.131000	0.65755|0.65755	0.533000|0.533000	0.62120|0.62120	GAC|ACT	.	.		0.463	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
CANX	821	hgsc.bcm.edu	37	5	179133285	179133285	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:179133285A>G	ENST00000247461.4	+	3	398	c.198A>G	c.(196-198)acA>acG	p.T66T	CANX_ENST00000452673.2_Silent_p.T66T|CANX_ENST00000512607.2_5'UTR|CANX_ENST00000504734.1_Silent_p.T66T|CANX_ENST00000415618.2_Silent_p.T101T	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	66					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	CAGTTCCAACAGGGGAAGTAT	0.333																																					p.T66T		Atlas-SNP	.											.	CANX	47	.	0			c.A198G						.						82.0	85.0	84.0					5																	179133285		2203	4300	6503	SO:0001819	synonymous_variant	821	exon3			TCCAACAGGGGAA	L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.198A>G	chr5.hg19:g.179133285A>G		60.0	0.0		64.0	4.0	NM_001746	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Silent	SNP	ENST00000247461.4	hg19	CCDS4447.1	.	.	.	.	.	.	.	.	.	.	A	10.05	1.242880	0.22796	.	.	ENSG00000127022	ENST00000510810	.	.	.	5.38	1.68	0.24146	.	.	.	.	.	T	0.51176	0.1659	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35276	-0.9795	4	.	.	.	-8.1475	4.6583	0.12630	0.6287:0.0:0.2316:0.1397	.	.	.	.	R	35	.	.	Q	+	2	0	CANX	179065891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.924000	0.28777	0.116000	0.18110	0.459000	0.35465	CAG	.	.		0.333	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253500.2	NM_001024649	
MAML1	9794	hgsc.bcm.edu	37	5	179193646	179193646	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:179193646G>T	ENST00000292599.3	+	2	1898	c.1635G>T	c.(1633-1635)caG>caT	p.Q545H	MAML1_ENST00000503050.1_3'UTR	NM_014757.4	NP_055572.1			mastermind-like 1 (Drosophila)											central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	36	all_cancers(89;0.000197)|all_epithelial(37;6.7e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0308)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ATCTTCCCCAGCAGCTGTCCC	0.537																																					p.Q545H		Atlas-SNP	.											.	MAML1	118	.	0			c.G1635T						.						63.0	64.0	64.0					5																	179193646		2203	4300	6503	SO:0001583	missense	9794	exon2			TCCCCAGCAGCTG	D83785	CCDS34315.1	5q35	2008-07-18	2001-11-28			ENSG00000161021			13632	protein-coding gene	gene with protein product	"""mastermind homolog"""	605424	"""mastermind (drosophila)-like 1"""			11101851, 11390662	Standard	NM_014757		Approved	KIAA0200, Mam-1	uc003mkm.3	Q92585		ENST00000292599.3:c.1635G>T	chr5.hg19:g.179193646G>T	ENSP00000292599:p.Gln545His	76.0	0.0		83.0	4.0	NM_014757		Missense_Mutation	SNP	ENST00000292599.3	hg19	CCDS34315.1	.	.	.	.	.	.	.	.	.	.	G	15.11	2.737205	0.49045	.	.	ENSG00000161021	ENST00000292599;ENST00000376951	T	0.30448	1.53	5.15	4.28	0.50868	.	0.000000	0.64402	D	0.000002	T	0.56673	0.2001	M	0.81942	2.565	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.994	T	0.61917	-0.6964	10	0.62326	D	0.03	-13.7616	13.2773	0.60194	0.0769:0.0:0.9231:0.0	.	582;545	Q59GH4;Q92585	.;MAML1_HUMAN	H	545;582	ENSP00000292599:Q545H	ENSP00000292599:Q545H	Q	+	3	2	MAML1	179126252	0.998000	0.40836	1.000000	0.80357	0.652000	0.38707	0.397000	0.20883	1.157000	0.42530	0.563000	0.77884	CAG	.	.		0.537	MAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372316.2	NM_014757	
FAM8A1	51439	hgsc.bcm.edu	37	6	17601073	17601073	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:17601073C>T	ENST00000259963.3	+	1	488	c.433C>T	c.(433-435)Cag>Tag	p.Q145*		NM_016255.2	NP_057339.1	Q9UBU6	FA8A1_HUMAN	family with sequence similarity 8, member A1	145						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(3)	6	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.143)	all cancers(50;0.176)|Epithelial(50;0.204)			CTGCAGCCCCCAGCCCTCCCC	0.701																																					p.Q145X		Atlas-SNP	.											.	FAM8A1	26	.	0			c.C433T						.						11.0	14.0	13.0					6																	17601073		2082	4090	6172	SO:0001587	stop_gained	51439	exon1			AGCCCCCAGCCCT	AF097027	CCDS4540.1	6p23	2010-11-22			ENSG00000137414	ENSG00000137414			16372	protein-coding gene	gene with protein product						11707071	Standard	NM_016255		Approved	AHCP	uc003ncc.3	Q9UBU6	OTTHUMG00000014309	ENST00000259963.3:c.433C>T	chr6.hg19:g.17601073C>T	ENSP00000259963:p.Gln145*	44.0	0.0		70.0	28.0	NM_016255	B2R725	Nonsense_Mutation	SNP	ENST00000259963.3	hg19	CCDS4540.1	.	.	.	.	.	.	.	.	.	.	C	36	5.712685	0.96830	.	.	ENSG00000137414	ENST00000259963	.	.	.	4.11	4.11	0.48088	.	0.585175	0.13297	N	0.398547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	-1.2679	14.4741	0.67535	0.0:1.0:0.0:0.0	.	.	.	.	X	145	.	ENSP00000259963:Q145X	Q	+	1	0	FAM8A1	17709052	0.003000	0.15002	0.862000	0.33874	0.716000	0.41182	1.327000	0.33746	1.986000	0.57962	0.484000	0.47621	CAG	.	.		0.701	FAM8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039950.1		
KDM1B	221656	hgsc.bcm.edu	37	6	18166515	18166515	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:18166515A>G	ENST00000297792.5	+	6	500	c.323A>G	c.(322-324)gAc>gGc	p.D108G	KDM1B_ENST00000397244.1_Missense_Mutation_p.D108G|KDM1B_ENST00000546309.2_Intron|KDM1B_ENST00000388870.2_Missense_Mutation_p.D108G			Q8NB78	KDM1B_HUMAN	lysine (K)-specific demethylase 1B	108					DNA methylation involved in gamete generation (GO:0043046)|histone H3-K4 demethylation (GO:0034720)|multicellular organismal development (GO:0007275)|regulation of DNA methylation (GO:0044030)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|flavin adenine dinucleotide binding (GO:0050660)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-monomethyl-K4 specific) (GO:0034649)|oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|large_intestine(6)|lung(8)|skin(3)|upper_aerodigestive_tract(1)	25						GATGGATATGACAAATATACT	0.373																																					p.D108G		Atlas-SNP	.											.	KDM1B	58	.	0			c.A323G						.						70.0	69.0	69.0					6																	18166515		2203	4300	6503	SO:0001583	missense	221656	exon6			GATATGACAAATA	AK125318	CCDS34343.1	6p22.3	2011-07-01	2009-09-29	2009-09-29	ENSG00000165097	ENSG00000165097		"""Chromatin-modifying enzymes / K-demethylases"""	21577	protein-coding gene	gene with protein product		613081	"""amine oxidase, flavin containing 1"", ""chromosome 6 open reading frame 193"", ""amine oxidase (flavin containing) domain 1"""	C6orf193, AOF1		19407342, 19727073	Standard	NM_153042		Approved	FLJ34109, FLJ33898, dJ298J15.2, bA204B7.3, FLJ43328, LSD2	uc003ncn.1	Q8NB78	OTTHUMG00000014316	ENST00000297792.5:c.323A>G	chr6.hg19:g.18166515A>G	ENSP00000297792:p.Asp108Gly	87.0	0.0		87.0	5.0	NM_153042	A2A2C5|A2A2C6|Q5TGV3|Q6AI15|Q6ZUU4|Q8N258|Q96EL7	Missense_Mutation	SNP	ENST00000297792.5	hg19	CCDS34343.1	.	.	.	.	.	.	.	.	.	.	A	18.52	3.642100	0.67244	.	.	ENSG00000165097	ENST00000388870;ENST00000397244;ENST00000297792;ENST00000388869	T;T;T	0.34667	1.42;1.35;1.35	5.66	5.66	0.87406	.	0.464102	0.26258	N	0.025403	T	0.23532	0.0569	L	0.50333	1.59	0.80722	D	1	B	0.31383	0.321	B	0.29353	0.101	T	0.10965	-1.0607	10	0.87932	D	0	-6.3985	16.2026	0.82095	1.0:0.0:0.0:0.0	.	108	A2A2C6	.	G	108	ENSP00000373522:D108G;ENSP00000380419:D108G;ENSP00000297792:D108G	ENSP00000297792:D108G	D	+	2	0	KDM1B	18274494	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.524000	0.90579	2.285000	0.76669	0.533000	0.62120	GAC	.	.		0.373	KDM1B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000277080.1	NM_153042	
ZNF322	79692	hgsc.bcm.edu	37	6	26638586	26638586	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:26638586T>C	ENST00000415922.2	-	4	841	c.196A>G	c.(196-198)Act>Gct	p.T66A	RP11-457M11.2_ENST00000456172.1_RNA|ZNF322_ENST00000461899.1_5'Flank|ZNF322_ENST00000471278.1_Missense_Mutation_p.T66A	NM_024639.4	NP_078915.2	Q6U7Q0	ZN322_HUMAN	zinc finger protein 322	66					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TTCTCCCCAGTATGGGTTCTC	0.383																																					p.T66A		Atlas-SNP	.											.	.	.	.	0			c.A196G						.						157.0	143.0	148.0					6																	26638586		2202	4298	6500	SO:0001583	missense	79692	exon5			CCCCAGTATGGGT	AY376736	CCDS4617.1	6p22.1	2013-01-08	2011-07-29	2011-07-29	ENSG00000181315	ENSG00000181315		"""Zinc fingers, C2H2-type"""	23640	protein-coding gene	gene with protein product		610847	"""zinc finger protein 489"", ""HLA complex group 12"", ""zinc finger protein 322A"""	ZNF489, ZNF388, HCG12, ZNF322A		15555580	Standard	NM_024639		Approved	bA457M11.3, bA457M11.2	uc021yny.1	Q6U7Q0	OTTHUMG00000014460	ENST00000415922.2:c.196A>G	chr6.hg19:g.26638586T>C	ENSP00000418897:p.Thr66Ala	390.0	0.0		397.0	92.0	NM_001242797	A8K1X3|Q0VDH6|Q6B0G2|Q86W72|Q9H5I9	Missense_Mutation	SNP	ENST00000415922.2	hg19	CCDS4617.1	.	.	.	.	.	.	.	.	.	.	t	10.88	1.476530	0.26511	.	.	ENSG00000181315	ENST00000415922;ENST00000471278	T;T	0.26518	1.73;1.73	4.75	0.888	0.19206	.	0.150080	0.31279	N	0.007940	T	0.06416	0.0165	L	0.38692	1.165	0.31393	N	0.67759	B	0.02656	0.0	B	0.08055	0.003	T	0.16247	-1.0409	10	0.87932	D	0	-5.0444	4.1573	0.10266	0.1514:0.1746:0.0:0.674	.	66	Q6U7Q0	ZN322_HUMAN	A	66	ENSP00000418897:T66A;ENSP00000419728:T66A	ENSP00000418897:T66A	T	-	1	0	ZNF322	26746565	0.003000	0.15002	0.193000	0.23327	0.885000	0.51271	0.400000	0.20932	0.068000	0.16574	0.533000	0.62120	ACT	.	.		0.383	ZNF322-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040126.2	NM_024639	
NOTCH4	4855	hgsc.bcm.edu	37	6	32188846	32188846	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:32188846T>C	ENST00000375023.3	-	4	846	c.708A>G	c.(706-708)ggA>ggG	p.G236G		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	236	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GAGGGCAGGGTCCTGCCCGCA	0.642																																					p.G236G		Atlas-SNP	.											.	NOTCH4	201	.	0			c.A708G						.						63.0	53.0	57.0					6																	32188846		1511	2709	4220	SO:0001819	synonymous_variant	4855	exon4			GCAGGGTCCTGCC		CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.708A>G	chr6.hg19:g.32188846T>C		76.0	0.0		92.0	4.0	NM_004557	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Silent	SNP	ENST00000375023.3	hg19	CCDS34420.1																																																																																			.	.		0.642	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076045.2		
COL11A2	1302	hgsc.bcm.edu	37	6	33141808	33141808	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:33141808G>T	ENST00000374708.4	-	31	2509	c.2251C>A	c.(2251-2253)Cgg>Agg	p.R751R	COL11A2_ENST00000374713.1_Silent_p.R790R|COL11A2_ENST00000374712.1_Silent_p.R756R|COL11A2_ENST00000357486.1_Silent_p.R816R|COL11A2_ENST00000341947.2_Silent_p.R837R|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000361917.1_Silent_p.R730R|COL11A2_ENST00000374714.1_Silent_p.R811R|COL11A2_ENST00000395197.1_Silent_p.R777R	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	837	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						CGTTCTCCCCGAGGCCCTGAC	0.612																																					p.R837R	Melanoma(1;90 116 3946 5341 17093)	Atlas-SNP	.											.	COL11A2	124	.	0			c.C2509A						.						55.0	56.0	56.0					6																	33141808		1511	2709	4220	SO:0001819	synonymous_variant	1302	exon33			CTCCCCGAGGCCC	U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2251C>A	chr6.hg19:g.33141808G>T		158.0	0.0		187.0	67.0	NM_080680	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Silent	SNP	ENST00000374708.4	hg19	CCDS43452.1																																																																																			.	.		0.612	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000076032.2		
C6orf89	221477	hgsc.bcm.edu	37	6	36882066	36882066	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:36882066A>G	ENST00000480824.2	+	5	704	c.410A>G	c.(409-411)gAc>gGc	p.D137G	C6orf89_ENST00000373685.1_Missense_Mutation_p.D137G|C6orf89_ENST00000510325.2_Missense_Mutation_p.D31G|C6orf89_ENST00000359359.2_Missense_Mutation_p.D31G|C6orf89_ENST00000355190.3_Missense_Mutation_p.D144G			Q6UWU4	CF089_HUMAN	chromosome 6 open reading frame 89	137					epithelial cell proliferation (GO:0050673)|positive regulation of cell cycle (GO:0045787)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(2)	15						TCAGACTTTGACCCCTGGTGG	0.483																																					p.D144G		Atlas-SNP	.											.	C6orf89	39	.	0			c.A431G						.						54.0	57.0	56.0					6																	36882066		2203	4300	6503	SO:0001583	missense	221477	exon4			ACTTTGACCCCTG	AK058086	CCDS4827.1, CCDS69100.1, CCDS75444.1	6p21.31	2013-03-14			ENSG00000198663	ENSG00000198663			21114	protein-coding gene	gene with protein product	"""bombesin receptor activated protein"""					21857995, 23460338	Standard	NM_152734		Approved	FLJ25357, BRAP	uc003omw.3	Q6UWU4	OTTHUMG00000014613	ENST00000480824.2:c.410A>G	chr6.hg19:g.36882066A>G	ENSP00000475947:p.Asp137Gly	80.0	0.0		88.0	4.0	NM_152734	B4DTT1|F4NAR0|F4NAR1|Q6ZMG5|Q7Z356|Q8IZ35	Missense_Mutation	SNP	ENST00000480824.2	hg19		.	.	.	.	.	.	.	.	.	.	A	15.50	2.853219	0.51270	.	.	ENSG00000198663	ENST00000359359;ENST00000510325;ENST00000355190;ENST00000373685;ENST00000416621;ENST00000540072	T;T	0.26660	1.72;1.72	5.44	4.3	0.51218	.	0.284847	0.34133	N	0.004239	T	0.14056	0.0340	L	0.56769	1.78	0.28353	N	0.920801	P;P	0.51933	0.867;0.949	B;P	0.49085	0.288;0.6	T	0.06516	-1.0822	10	0.15952	T	0.53	-15.1665	7.2552	0.26173	0.9032:0.0:0.0968:0.0	.	137;144	Q6UWU4;Q6UWU4-2	CF089_HUMAN;.	G	31;31;144;137;144;143	ENSP00000347322:D144G;ENSP00000362789:D137G	ENSP00000347322:D144G	D	+	2	0	C6orf89	36990044	0.939000	0.31865	0.998000	0.56505	0.404000	0.30871	3.036000	0.49767	2.066000	0.61787	0.533000	0.62120	GAC	.	.		0.483	C6orf89-004	KNOWN	alternative_5_UTR|basic	protein_coding	protein_coding	OTTHUMT00000040387.2	NM_152734	
DNAH8	1769	hgsc.bcm.edu	37	6	38874140	38874140	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:38874140A>G	ENST00000359357.3	+	61	8908	c.8654A>G	c.(8653-8655)gAg>gGg	p.E2885G	DNAH8_ENST00000441566.1_Missense_Mutation_p.E2849G|DNAH8_ENST00000449981.2_Missense_Mutation_p.E3102G			Q96JB1	DYH8_HUMAN	dynein, axonemal, heavy chain 8	2885	AAA 4. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(7)|breast(9)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(16)|large_intestine(44)|liver(4)|lung(101)|ovary(7)|pancreas(2)|prostate(8)|skin(28)|stomach(4)|upper_aerodigestive_tract(6)|urinary_tract(4)	260						ATAAAAGATGAGGCATTTCTA	0.333																																					p.E3102G		Atlas-SNP	.											.	DNAH8	1239	.	0			c.A9305G						.						55.0	54.0	54.0					6																	38874140		2203	4300	6503	SO:0001583	missense	1769	exon63			AAGATGAGGCATT	Z83806	CCDS75447.1	6p21.2	2012-04-19	2006-09-04		ENSG00000124721	ENSG00000124721		"""Axonemal dyneins"""	2952	protein-coding gene	gene with protein product		603337	"""dynein, axonemal, heavy polypeptide 8"""			9373155	Standard	NM_001206927		Approved	hdhc9	uc021yzh.1	Q96JB1	OTTHUMG00000016253	ENST00000359357.3:c.8654A>G	chr6.hg19:g.38874140A>G	ENSP00000352312:p.Glu2885Gly	169.0	0.0		147.0	6.0	NM_001206927	O00438|Q5JYI2|Q5T2M3|Q5T2M4|Q5TG00|Q9UEM4	Missense_Mutation	SNP	ENST00000359357.3	hg19		.	.	.	.	.	.	.	.	.	.	A	28.3	4.907281	0.92107	.	.	ENSG00000124721	ENST00000449981;ENST00000327475;ENST00000359357;ENST00000441566	T;T;T	0.56275	0.47;0.47;0.47	5.72	5.72	0.89469	Dynein heavy chain, P-loop containing D4 domain (1);	0.051449	0.85682	D	0.000000	T	0.81588	0.4854	H	0.98802	4.335	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.89439	0.3722	10	0.87932	D	0	.	16.0204	0.80478	1.0:0.0:0.0:0.0	.	2885	Q96JB1	DYH8_HUMAN	G	3090;3090;2885;2849	ENSP00000333363:E3090G;ENSP00000352312:E2885G;ENSP00000402294:E2849G	ENSP00000333363:E3090G	E	+	2	0	DNAH8	38982118	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.253000	0.95501	2.174000	0.68829	0.533000	0.62120	GAG	.	.		0.333	DNAH8-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000043574.1	NM_001206927	
TDRD6	221400	hgsc.bcm.edu	37	6	46661339	46661339	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:46661339A>G	ENST00000316081.6	+	1	5474	c.5474A>G	c.(5473-5475)gAa>gGa	p.E1825G	TDRD6_ENST00000544460.1_Missense_Mutation_p.E1825G	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	1825					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CATGCTAATGAAACAAAGGAG	0.368																																					p.E1825G		Atlas-SNP	.											TDRD6,NS,carcinoma,+1,1	TDRD6	205	.	0			c.A5474G						.						77.0	81.0	80.0					6																	46661339		2203	4300	6503	SO:0001583	missense	221400	exon1			CTAATGAAACAAA	AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.5474A>G	chr6.hg19:g.46661339A>G	ENSP00000346065:p.Glu1825Gly	34.0	0.0		41.0	2.0	NM_001168359	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	ENST00000316081.6	hg19	CCDS34470.1	.	.	.	.	.	.	.	.	.	.	A	15.53	2.861586	0.51482	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.15718	2.4;2.4	5.68	5.68	0.88126	.	0.441828	0.22978	N	0.053350	T	0.12732	0.0309	L	0.56769	1.78	0.09310	N	1	D;P	0.53462	0.96;0.933	P;B	0.50537	0.643;0.441	T	0.21895	-1.0232	10	0.72032	D	0.01	0.3847	6.3877	0.21569	0.7836:0.0:0.0759:0.1406	.	1825;1825	F5H5M3;O60522	.;TDRD6_HUMAN	G	1825	ENSP00000443299:E1825G;ENSP00000346065:E1825G	ENSP00000346065:E1825G	E	+	2	0	TDRD6	46769298	0.056000	0.20664	0.061000	0.19648	0.165000	0.22458	3.088000	0.50175	2.156000	0.67533	0.460000	0.39030	GAA	.	.		0.368	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040800.1	XM_166443	
BAI3	577	hgsc.bcm.edu	37	6	70065719	70065719	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:70065719T>C	ENST00000370598.1	+	28	4383	c.3562T>C	c.(3562-3564)Ttt>Ctt	p.F1188L	BAI3_ENST00000238918.8_Missense_Mutation_p.F394L|BAI3_ENST00000546190.1_Missense_Mutation_p.F152L	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	1188					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ACAGACAGACTTTGAAAAGGA	0.289																																					p.F1188L		Atlas-SNP	.											.	BAI3	451	.	0			c.T3562C						.						115.0	126.0	122.0					6																	70065719		2203	4297	6500	SO:0001583	missense	577	exon28			ACAGACTTTGAAA	AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.3562T>C	chr6.hg19:g.70065719T>C	ENSP00000359630:p.Phe1188Leu	74.0	0.0		60.0	4.0	NM_001704	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	ENST00000370598.1	hg19	CCDS4968.1	.	.	.	.	.	.	.	.	.	.	T	33	5.255188	0.95336	.	.	ENSG00000135298	ENST00000370598;ENST00000238918;ENST00000546190	T;T;T	0.58940	1.76;2.44;0.3	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.70011	0.3175	M	0.70595	2.14	0.58432	D	0.999999	P;D	0.69078	0.924;0.997	P;D	0.75020	0.878;0.985	T	0.74103	-0.3773	10	0.72032	D	0.01	.	16.3426	0.83092	0.0:0.0:0.0:1.0	.	394;1188	B7Z356;O60242	.;BAI3_HUMAN	L	1188;394;152	ENSP00000359630:F1188L;ENSP00000238918:F394L;ENSP00000441821:F152L	ENSP00000238918:F394L	F	+	1	0	BAI3	70122440	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.304000	0.78882	2.317000	0.78254	0.460000	0.39030	TTT	.	.		0.289	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041120.1		
GABRR1	2569	hgsc.bcm.edu	37	6	89890138	89890138	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:89890138T>C	ENST00000454853.2	-	9	1129	c.1019A>G	c.(1018-1020)tAc>tGc	p.Y340C	GABRR1_ENST00000435811.1_Missense_Mutation_p.Y323C|GABRR1_ENST00000369451.3_Missense_Mutation_p.Y253C	NM_001256704.1|NM_002042.4	NP_001243633.1|NP_002033.2	P24046	GBRR1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 1	340					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(7)|lung(16)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	35		all_cancers(76;9.49e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.46e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;0.000114)		BRCA - Breast invasive adenocarcinoma(108;0.00917)	Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	GGCCTTGATGTAGGAGACGCG	0.542																																					p.Y340C		Atlas-SNP	.											.	GABRR1	63	.	0			c.A1019G						.						161.0	128.0	139.0					6																	89890138		2203	4300	6503	SO:0001583	missense	2569	exon9			TTGATGTAGGAGA		CCDS5019.2, CCDS59028.1, CCDS59029.1	6q15	2012-06-22	2012-02-03		ENSG00000146276	ENSG00000146276		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4090	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 1"""	137161	"""gamma-aminobutyric acid (GABA) receptor, rho 1"""			1849271, 1315307	Standard	NM_002042		Approved		uc003pna.2	P24046	OTTHUMG00000015195	ENST00000454853.2:c.1019A>G	chr6.hg19:g.89890138T>C	ENSP00000412673:p.Tyr340Cys	106.0	0.0		93.0	4.0	NM_002042	A1L401|B4DJK8|B4DQT5|B7ZBQ7|Q9BX06	Missense_Mutation	SNP	ENST00000454853.2	hg19	CCDS5019.2	.	.	.	.	.	.	.	.	.	.	T	24.9	4.576836	0.86645	.	.	ENSG00000146276	ENST00000454853;ENST00000435811;ENST00000369451;ENST00000436331	D;D;D	0.87334	-2.24;-2.24;-2.24	5.25	5.25	0.73442	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94185	0.8134	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.995	D	0.95593	0.8656	9	.	.	.	-15.644	15.1818	0.72965	0.0:0.0:0.0:1.0	.	323;340	P24046-2;P24046	.;GBRR1_HUMAN	C	340;323;253;253	ENSP00000412673:Y340C;ENSP00000394687:Y323C;ENSP00000358463:Y253C	.	Y	-	2	0	GABRR1	89946857	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	8.040000	0.89188	1.972000	0.57404	0.455000	0.32223	TAC	.	.		0.542	GABRR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041479.2		
MDN1	23195	hgsc.bcm.edu	37	6	90513153	90513153	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:90513153T>C	ENST00000369393.3	-	2	338	c.223A>G	c.(223-225)Agg>Ggg	p.R75G	MDN1_ENST00000428876.1_Missense_Mutation_p.R75G			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	75					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		TCGGCATTCCTTTCCAGCAAA	0.488																																					p.R75G		Atlas-SNP	.											.	MDN1	478	.	0			c.A223G						.						196.0	172.0	180.0					6																	90513153		2203	4300	6503	SO:0001583	missense	23195	exon2			CATTCCTTTCCAG	AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.223A>G	chr6.hg19:g.90513153T>C	ENSP00000358400:p.Arg75Gly	100.0	0.0		58.0	4.0	NM_014611	O15019|Q5T794	Missense_Mutation	SNP	ENST00000369393.3	hg19	CCDS5024.1	.	.	.	.	.	.	.	.	.	.	T	15.07	2.723436	0.48728	.	.	ENSG00000112159	ENST00000369393;ENST00000428876;ENST00000439638	T;T;T	0.28895	1.59;1.59;1.59	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.44008	0.1273	M	0.72894	2.215	0.44966	D	0.997988	D;D	0.89917	1.0;0.995	D;P	0.87578	0.998;0.791	T	0.47674	-0.9099	10	0.66056	D	0.02	.	11.8462	0.52385	0.0:0.0:0.1458:0.8542	.	75;75	Q6ZVV6;Q9NU22	.;MDN1_HUMAN	G	75	ENSP00000358400:R75G;ENSP00000413970:R75G;ENSP00000409664:R75G	ENSP00000358400:R75G	R	-	1	2	MDN1	90569874	1.000000	0.71417	1.000000	0.80357	0.870000	0.49936	3.125000	0.50469	1.917000	0.55516	0.254000	0.18369	AGG	.	.		0.488	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041514.2		
OSTM1	28962	hgsc.bcm.edu	37	6	108375753	108375753	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:108375753T>C	ENST00000193322.3	-	3	641	c.556A>G	c.(556-558)Aca>Gca	p.T186A		NM_014028.3	NP_054747.2	Q86WC4	OSTM1_HUMAN	osteopetrosis associated transmembrane protein 1	186					ion transmembrane transport (GO:0034220)|osteoclast differentiation (GO:0030316)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)		p.T186S(1)		central_nervous_system(2)|endometrium(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	8		all_cancers(87;3.82e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000195)|Colorectal(196;0.0293)|all_lung(197;0.0938)		BRCA - Breast invasive adenocarcinoma(108;0.0131)|Epithelial(106;0.0438)|OV - Ovarian serous cystadenocarcinoma(136;0.0571)|all cancers(137;0.0581)		AAATATACTGTGCTGTTTGAT	0.264																																					p.T186A	Melanoma(162;1427 1909 3096 17430 21396)	Atlas-SNP	.											OSTM1,NS,carcinoma,0,1	OSTM1	22	.	1	Substitution - Missense(1)	lung(1)	c.A556G						.						100.0	105.0	103.0					6																	108375753		2202	4296	6498	SO:0001583	missense	28962	exon3			ATACTGTGCTGTT	AF533891	CCDS5062.1	6q21	2014-06-17			ENSG00000081087	ENSG00000081087			21652	protein-coding gene	gene with protein product	"""CLCN7 accessory beta subunit"""	607649				12627228, 21527911	Standard	NM_014028		Approved	HSPC019, GL	uc003psd.3	Q86WC4	OTTHUMG00000015317	ENST00000193322.3:c.556A>G	chr6.hg19:g.108375753T>C	ENSP00000193322:p.Thr186Ala	49.0	0.0		30.0	2.0	NM_014028	E1P5E3|Q5R391|Q6PCA7|Q7RTW6|Q8NC29|Q8TC82|Q9Y2S9	Missense_Mutation	SNP	ENST00000193322.3	hg19	CCDS5062.1	.	.	.	.	.	.	.	.	.	.	T	19.51	3.841793	0.71488	.	.	ENSG00000081087	ENST00000193322;ENST00000440575	T	0.55930	0.49	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.68714	0.3031	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74993	-0.3474	10	0.72032	D	0.01	-9.3235	14.1596	0.65438	0.0:0.0:0.0:1.0	.	186	Q86WC4	OSTM1_HUMAN	A	186;39	ENSP00000193322:T186A	ENSP00000193322:T186A	T	-	1	0	OSTM1	108482446	1.000000	0.71417	0.991000	0.47740	0.732000	0.41865	5.580000	0.67464	2.094000	0.63399	0.533000	0.62120	ACA	.	.		0.264	OSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041709.3	NM_014028	
TSPYL4	23270	hgsc.bcm.edu	37	6	116574326	116574326	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:116574326C>T	ENST00000420283.1	-	1	935	c.846G>A	c.(844-846)ttG>ttA	p.L282L	RP3-486I3.7_ENST00000448740.2_lincRNA|DSE_ENST00000540275.1_5'Flank	NM_021648.4	NP_067680.3	Q9UJ04	TSYL4_HUMAN	TSPY-like 4	282					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				endometrium(2)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(2)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.045)|OV - Ovarian serous cystadenocarcinoma(136;0.0666)|GBM - Glioblastoma multiforme(226;0.095)|Epithelial(106;0.125)		CCTCCACCTCCAAATTGATCA	0.488																																					p.L282L		Atlas-SNP	.											.	TSPYL4	18	.	0			c.G846A						.						62.0	63.0	63.0					6																	116574326		1972	4179	6151	SO:0001819	synonymous_variant	23270	exon1			CACCTCCAAATTG		CCDS5106.1	6q22.1	2010-05-12			ENSG00000187189	ENSG00000187189			21559	protein-coding gene	gene with protein product							Standard	NM_021648		Approved	dJ486I3.2, KIAA0721	uc003pwn.3	Q9UJ04	OTTHUMG00000015429	ENST00000420283.1:c.846G>A	chr6.hg19:g.116574326C>T		112.0	0.0		69.0	4.0	NM_021648	B4DYQ2|O94828|Q96GW8	Silent	SNP	ENST00000420283.1	hg19	CCDS5106.1																																																																																			.	.		0.488	TSPYL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041934.2		
TRAPPC3L	100128327	hgsc.bcm.edu	37	6	116818183	116818183	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:116818183A>G	ENST00000368602.3	-	5	575	c.480T>C	c.(478-480)agT>agC	p.S160S	RP11-259P20.1_ENST00000420595.2_RNA|TRAPPC3L_ENST00000356128.4_Silent_p.S76S	NM_001139444.2	NP_001132916.1	Q5T215	TPC3L_HUMAN	trafficking protein particle complex 3-like	160					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)											TTTCTGTCACACTGTCACCTT	0.393																																					p.S160S		Atlas-SNP	.											.	BET3L	18	.	0			c.T480C						.						201.0	163.0	174.0					6																	116818183		692	1591	2283	SO:0001819	synonymous_variant	100128327	exon5			TGTCACACTGTCA	AK002042	CCDS47468.1	6q22.31	2013-05-01	2013-05-01	2013-05-01	ENSG00000173626	ENSG00000173626			21090	protein-coding gene	gene with protein product		614137	"""BET3 like (S. cerevisiae)"""	BET3L		21525244	Standard	NM_001139444		Approved	bA259P20.2, FLJ11180		Q5T215	OTTHUMG00000015440	ENST00000368602.3:c.480T>C	chr6.hg19:g.116818183A>G		127.0	0.0		68.0	4.0	NM_001139444	Q5T213|Q5T214	Silent	SNP	ENST00000368602.3	hg19	CCDS47468.1																																																																																			.	.		0.393	TRAPPC3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000101701.1	XM_166322	
RFX6	222546	hgsc.bcm.edu	37	6	117198525	117198525	+	Silent	SNP	T	T	C	rs368582780		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:117198525T>C	ENST00000332958.2	+	1	103	c.87T>C	c.(85-87)tgT>tgC	p.C29C		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	29					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AAGACTGCTGTGTGCAGCTCC	0.677																																					p.C29C		Atlas-SNP	.											.	RFX6	141	.	0			c.T87C						.	T		0,4406		0,0,2203	20.0	23.0	22.0		87	-10.2	0.0	6		22	1,8599		0,1,4299	no	coding-synonymous	RFX6	NM_173560.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		29/929	117198525	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	222546	exon1			CTGCTGTGTGCAG	BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.87T>C	chr6.hg19:g.117198525T>C		91.0	0.0		91.0	5.0	NM_173560	Q5T6B3	Silent	SNP	ENST00000332958.2	hg19	CCDS5113.1																																																																																			.	.		0.677	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041970.2	NM_173560	
NCOA7	135112	hgsc.bcm.edu	37	6	126203615	126203615	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:126203615T>C	ENST00000368357.3	+	8	969	c.617T>C	c.(616-618)gTc>gCc	p.V206A	NCOA7_ENST00000229634.9_Missense_Mutation_p.V102A|NCOA7_ENST00000392477.2_Missense_Mutation_p.V206A	NM_001199619.1|NM_001199620.1	NP_001186548.1|NP_001186549.1	Q8NI08	NCOA7_HUMAN	nuclear receptor coactivator 7	206					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(6)|lung(16)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(2)	39				UCEC - Uterine corpus endometrioid carcinoma (4;0.0803)|GBM - Glioblastoma multiforme(226;0.0193)|all cancers(137;0.237)		ATTGAAAGAGTCTTATCGTCT	0.338																																					p.V206A		Atlas-SNP	.											.	NCOA7	92	.	0			c.T617C						.						57.0	55.0	55.0					6																	126203615		2203	4300	6503	SO:0001583	missense	135112	exon8			AAAGAGTCTTATC	AJ420542	CCDS5132.1, CCDS56448.1	6q22.33	2013-03-14			ENSG00000111912	ENSG00000111912			21081	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 4"""	609752				11971969	Standard	NM_001199619		Approved	ERAP140, dJ187J11.3, TLDC4	uc003qai.3	Q8NI08	OTTHUMG00000015513	ENST00000368357.3:c.617T>C	chr6.hg19:g.126203615T>C	ENSP00000357341:p.Val206Ala	57.0	0.0		50.0	5.0	NM_001199619	B2RNS2|B7Z2C4|B9EH71|G8JL91|Q3LID6|Q4G0V1|Q5TF95|Q6IPQ4|Q6NE83|Q86T89|Q8N1W4	Missense_Mutation	SNP	ENST00000368357.3	hg19	CCDS5132.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.480371	0.84747	.	.	ENSG00000111912	ENST00000368357;ENST00000392477;ENST00000229634;ENST00000413085	T;T;T;T	0.37752	2.42;2.42;2.42;1.18	5.63	5.63	0.86233	.	0.280930	0.34628	N	0.003811	T	0.49762	0.1576	M	0.61703	1.905	0.51482	D	0.999924	D;D;D;D	0.89917	1.0;0.998;0.993;0.995	D;D;P;D	0.87578	0.998;0.913;0.826;0.914	T	0.49790	-0.8902	10	0.49607	T	0.09	-0.3706	16.1251	0.81386	0.0:0.0:0.0:1.0	.	206;206;206;206	B3KXK4;Q8NI08-2;Q8NI08-4;Q8NI08	.;.;.;NCOA7_HUMAN	A	206;206;102;15	ENSP00000357341:V206A;ENSP00000376269:V206A;ENSP00000229634:V102A;ENSP00000389186:V15A	ENSP00000229634:V102A	V	+	2	0	NCOA7	126245308	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.999000	0.57031	2.261000	0.74972	0.528000	0.53228	GTC	.	.		0.338	NCOA7-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042083.4	XM_059748	
MAP3K5	4217	hgsc.bcm.edu	37	6	136878915	136878915	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:136878915A>G	ENST00000359015.4	-	30	4466	c.4106T>C	c.(4105-4107)tTt>tCt	p.F1369S	MAP3K5_ENST00000355845.4_Missense_Mutation_p.F616S	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1369					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTTGTTTCGAAAGTCAATGAT	0.408																																					p.F1369S		Atlas-SNP	.											.	MAP3K5	136	.	0			c.T4106C						.						141.0	123.0	129.0					6																	136878915		2203	4300	6503	SO:0001583	missense	4217	exon30			TTTCGAAAGTCAA	U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.4106T>C	chr6.hg19:g.136878915A>G	ENSP00000351908:p.Phe1369Ser	93.0	0.0		71.0	4.0	NM_005923	A6NIA0|B4DGB2|Q5THN3|Q99461	Missense_Mutation	SNP	ENST00000359015.4	hg19	CCDS5179.1	.	.	.	.	.	.	.	.	.	.	A	14.22	2.469096	0.43839	.	.	ENSG00000197442	ENST00000359015;ENST00000355845	D;D	0.87809	-2.3;-2.3	5.46	2.89	0.33648	Sterile alpha motif/pointed domain (1);	0.246535	0.42548	D	0.000683	T	0.66307	0.2776	L	0.36672	1.1	0.31781	N	0.630875	B	0.28128	0.201	B	0.24155	0.051	T	0.56854	-0.7910	10	0.33141	T	0.24	.	9.7268	0.40337	0.6042:0.0:0.0:0.3957	.	1369	Q99683	M3K5_HUMAN	S	1369;616	ENSP00000351908:F1369S;ENSP00000348104:F616S	ENSP00000348104:F616S	F	-	2	0	MAP3K5	136920608	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	1.594000	0.36697	0.885000	0.36088	0.533000	0.62120	TTT	.	.		0.408	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042383.1		
RAB32	10981	hgsc.bcm.edu	37	6	146875606	146875606	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:146875606A>G	ENST00000367495.3	+	3	722	c.543A>G	c.(541-543)atA>atG	p.I181M		NM_006834.3	NP_006825.1	Q13637	RAB32_HUMAN	RAB32, member RAS oncogene family	181	PKA-RII subunit binding domain.				antigen processing and presentation (GO:0019882)|endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome maturation (GO:0090382)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	8		Ovarian(120;0.142)		OV - Ovarian serous cystadenocarcinoma(155;2.68e-09)|GBM - Glioblastoma multiforme(68;0.00608)		ACATAAACATAGAGGAAGCTG	0.363																																					p.I181M		Atlas-SNP	.											.	RAB32	16	.	0			c.A543G						.						77.0	78.0	78.0					6																	146875606		2203	4300	6503	SO:0001583	missense	10981	exon3			AAACATAGAGGAA	U71127	CCDS5210.1	6q24.2	2010-08-20			ENSG00000118508	ENSG00000118508		"""RAB, member RAS oncogene"", ""A-kinase anchor proteins"""	9772	protein-coding gene	gene with protein product		612906					Standard	NM_006834		Approved		uc003qln.1	Q13637	OTTHUMG00000015755	ENST00000367495.3:c.543A>G	chr6.hg19:g.146875606A>G	ENSP00000356465:p.Ile181Met	86.0	0.0		62.0	37.0	NM_006834		Missense_Mutation	SNP	ENST00000367495.3	hg19	CCDS5210.1	.	.	.	.	.	.	.	.	.	.	A	17.89	3.499544	0.64298	.	.	ENSG00000118508	ENST00000367495	T	0.78924	-1.22	5.8	-3.7	0.04437	Small GTP-binding protein domain (1);	0.044767	0.85682	D	0.000000	D	0.84656	0.5520	H	0.95187	3.635	0.53005	D	0.999965	D	0.67145	0.996	D	0.71414	0.973	D	0.84060	0.0374	10	0.87932	D	0	-20.0784	7.5792	0.27955	0.2846:0.3199:0.0:0.3955	.	181	Q13637	RAB32_HUMAN	M	181	ENSP00000356465:I181M	ENSP00000356465:I181M	I	+	3	3	RAB32	146917299	0.771000	0.28555	0.979000	0.43373	0.719000	0.41307	-0.036000	0.12185	-0.467000	0.06932	0.533000	0.62120	ATA	.	.		0.363	RAB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042579.1	NM_006834	
NUP43	348995	hgsc.bcm.edu	37	6	150059861	150059861	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:150059861T>C	ENST00000340413.2	-	5	632	c.556A>G	c.(556-558)Att>Gtt	p.I186V	NUP43_ENST00000367403.3_Intron|NUP43_ENST00000367404.4_Intron|NUP43_ENST00000460354.2_Missense_Mutation_p.I186V	NM_198887.1	NP_942590.1	Q8NFH3	NUP43_HUMAN	nucleoporin 43kDa	186					carbohydrate metabolic process (GO:0005975)|chromosome segregation (GO:0007059)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				breast(1)|large_intestine(2)|lung(8)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	18		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;4.71e-13)|GBM - Glioblastoma multiforme(68;0.101)		ACAGTAAGAATCTCAGGAGTT	0.338																																					p.I186V		Atlas-SNP	.											.	NUP43	32	.	0			c.A556G						.						121.0	116.0	118.0					6																	150059861		2203	4299	6502	SO:0001583	missense	348995	exon5			TAAGAATCTCAGG	AF514997	CCDS5218.1	6q25.1	2013-01-10			ENSG00000120253	ENSG00000120253		"""WD repeat domain containing"""	21182	protein-coding gene	gene with protein product		608141				12196509	Standard	XM_005266961		Approved	bA350J20.1, FLJ13287	uc003qmz.3	Q8NFH3	OTTHUMG00000015795	ENST00000340413.2:c.556A>G	chr6.hg19:g.150059861T>C	ENSP00000342262:p.Ile186Val	72.0	0.0		58.0	4.0	NM_198887	B4E2F0|Q9H8S0	Missense_Mutation	SNP	ENST00000340413.2	hg19	CCDS5218.1	.	.	.	.	.	.	.	.	.	.	T	11.86	1.764785	0.31228	.	.	ENSG00000120253	ENST00000340413;ENST00000460354	T;T	0.64085	-0.08;-0.08	5.53	5.53	0.82687	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.094377	0.64402	D	0.000001	T	0.31888	0.0811	L	0.31420	0.93	0.80722	D	1	B	0.26512	0.151	B	0.21708	0.036	T	0.25187	-1.0139	10	0.12103	T	0.63	-21.8061	15.6916	0.77457	0.0:0.0:0.0:1.0	.	186	Q8NFH3	NUP43_HUMAN	V	186	ENSP00000342262:I186V;ENSP00000432401:I186V	ENSP00000342262:I186V	I	-	1	0	NUP43	150101554	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.089000	0.57685	2.120000	0.65058	0.372000	0.22366	ATT	.	.		0.338	NUP43-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396947.1	NM_198887	
PLEKHG1	57480	hgsc.bcm.edu	37	6	151144808	151144808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:151144808A>G	ENST00000358517.2	+	14	1677	c.1466A>G	c.(1465-1467)cAa>cGa	p.Q489R	PLEKHG1_ENST00000367328.1_Missense_Mutation_p.Q489R			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	489							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CAAGACATCCAAAAGGTAAGC	0.358																																					p.Q489R		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.A1466G						.						95.0	92.0	93.0					6																	151144808		2203	4299	6502	SO:0001583	missense	57480	exon15			ACATCCAAAAGGT	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1466A>G	chr6.hg19:g.151144808A>G	ENSP00000351318:p.Gln489Arg	54.0	0.0		31.0	16.0	NM_001029884	Q5T1F2	Missense_Mutation	SNP	ENST00000358517.2	hg19	CCDS34552.1	.	.	.	.	.	.	.	.	.	.	A	11.76	1.735276	0.30774	.	.	ENSG00000120278	ENST00000367328;ENST00000535018;ENST00000358517	T;T	0.60171	0.21;0.21	5.42	2.99	0.34606	.	0.357494	0.32719	N	0.005727	T	0.30386	0.0763	L	0.51422	1.61	0.42169	D	0.991637	B;B;B	0.12013	0.0;0.005;0.005	B;B;B	0.09377	0.001;0.004;0.004	T	0.17349	-1.0372	10	0.54805	T	0.06	.	7.198	0.25864	0.779:0.146:0.0751:0.0	.	296;489;489	Q5EBL9;Q5JYA6;Q9ULL1	.;.;PKHG1_HUMAN	R	489	ENSP00000356297:Q489R;ENSP00000351318:Q489R	ENSP00000351318:Q489R	Q	+	2	0	PLEKHG1	151186501	1.000000	0.71417	0.999000	0.59377	0.949000	0.60115	1.643000	0.37217	0.420000	0.25954	-0.274000	0.10170	CAA	.	.		0.358	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
PLEKHG1	57480	hgsc.bcm.edu	37	6	151152053	151152053	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:151152053T>C	ENST00000358517.2	+	15	2017	c.1806T>C	c.(1804-1806)ggT>ggC	p.G602G	PLEKHG1_ENST00000367328.1_Silent_p.G602G			Q9ULL1	PKHG1_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 1	602							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(19)|ovary(5)|prostate(4)|stomach(1)|urinary_tract(3)	53			BRCA - Breast invasive adenocarcinoma(37;0.0923)	OV - Ovarian serous cystadenocarcinoma(155;6.69e-13)		CCAGCTCTGGTCACAGGATTG	0.537																																					p.G602G		Atlas-SNP	.											.	PLEKHG1	97	.	0			c.T1806C						.						69.0	68.0	68.0					6																	151152053		2203	4300	6503	SO:0001819	synonymous_variant	57480	exon16			CTCTGGTCACAGG	AB033035	CCDS34552.1	6q25.1	2013-01-11			ENSG00000120278	ENSG00000120278		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	20884	protein-coding gene	gene with protein product						10574462	Standard	XM_005267064		Approved	KIAA1209, ARHGEF41	uc003qny.1	Q9ULL1	OTTHUMG00000015824	ENST00000358517.2:c.1806T>C	chr6.hg19:g.151152053T>C		76.0	0.0		55.0	4.0	NM_001029884	Q5T1F2	Silent	SNP	ENST00000358517.2	hg19	CCDS34552.1																																																																																			.	.		0.537	PLEKHG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042691.1		
LPA	4018	hgsc.bcm.edu	37	6	161016501	161016501	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:161016501A>G	ENST00000316300.5	-	21	3398	c.3354T>C	c.(3352-3354)gaT>gaC	p.D1118D	LPA_ENST00000447678.1_Silent_p.D1118D			P08519	APOA_HUMAN	lipoprotein, Lp(a)	3626	Kringle 10. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	TGACACTGGGATCCATGGTGT	0.517																																					p.D1118D		Atlas-SNP	.											.	LPA	237	.	0			c.T3354C						.						110.0	110.0	110.0					6																	161016501		2130	4263	6393	SO:0001819	synonymous_variant	4018	exon22			ACTGGGATCCATG	X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.3354T>C	chr6.hg19:g.161016501A>G		151.0	0.0		86.0	4.0	NM_005577	Q5VTD7|Q9UD88	Silent	SNP	ENST00000316300.5	hg19	CCDS43523.1																																																																																			.	.		0.517	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042957.1	NM_005577	
SMOC2	64094	hgsc.bcm.edu	37	6	168944304	168944304	+	Splice_Site	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr6:168944304G>T	ENST00000356284.2	+	5	683		c.e5-1		SMOC2_ENST00000354536.5_Splice_Site	NM_001166412.1	NP_001159884.1	Q9H3U7	SMOC2_HUMAN	SPARC related modular calcium binding 2						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	32		Breast(66;0.000141)|Esophageal squamous(34;0.222)|Ovarian(120;0.231)		OV - Ovarian serous cystadenocarcinoma(33;1.31e-19)|BRCA - Breast invasive adenocarcinoma(81;3.06e-06)|GBM - Glioblastoma multiforme(31;0.00109)		TCCTCTTTTAGGTTCCGTAAA	0.328																																					.		Atlas-SNP	.											SMOC2,NS,carcinoma,0,1	SMOC2	57	.	0			c.464-1G>T						.						96.0	94.0	95.0					6																	168944304		2203	4300	6503	SO:0001630	splice_region_variant	64094	exon5			CTTTTAGGTTCCG	AB014730	CCDS5307.1, CCDS55076.1	6q27	2013-01-10			ENSG00000112562	ENSG00000112562		"""EF-hand domain containing"""	20323	protein-coding gene	gene with protein product		607223				12031507	Standard	NM_022138		Approved	SMAP2	uc003qwr.2	Q9H3U7	OTTHUMG00000016050	ENST00000356284.2:c.464-1G>T	chr6.hg19:g.168944304G>T		61.0	0.0		28.0	2.0	NM_022138	B3KPS7|Q4G169|Q5TAT7|Q5TAT8|Q86VV9|Q96SF3|Q9H1L3|Q9H1L4|Q9H3U0|Q9H4F7|Q9HCV2	Splice_Site	SNP	ENST00000356284.2	hg19	CCDS55076.1	.	.	.	.	.	.	.	.	.	.	G	10.16	1.274547	0.23307	.	.	ENSG00000112562	ENST00000356284;ENST00000354536;ENST00000366793	.	.	.	4.69	4.69	0.59074	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8554	0.70332	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMOC2	168687153	1.000000	0.71417	0.976000	0.42696	0.075000	0.17131	5.201000	0.65163	2.157000	0.67596	0.650000	0.86243	.	.	.		0.328	SMOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043201.1		Intron
THSD7A	221981	hgsc.bcm.edu	37	7	11446083	11446083	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:11446083C>G	ENST00000423059.4	-	22	4332	c.4081G>C	c.(4081-4083)Ggg>Cgg	p.G1361R	AC004160.4_ENST00000425837.1_RNA|AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	1361	TSP type-1 14. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GTTCTGGTCCCTTCTCCACAC	0.418										HNSCC(18;0.044)																											p.G1361R		Atlas-SNP	.											.	THSD7A	219	.	0			c.G4081C						.						60.0	59.0	59.0					7																	11446083		1909	4125	6034	SO:0001583	missense	221981	exon21			TGGTCCCTTCTCC		CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.4081G>C	chr7.hg19:g.11446083C>G	ENSP00000406482:p.Gly1361Arg	193.0	0.0		242.0	84.0	NM_015204		Missense_Mutation	SNP	ENST00000423059.4	hg19	CCDS47543.1	.	.	.	.	.	.	.	.	.	.	C	26.2	4.712990	0.89112	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	D	0.83673	-1.75	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.92198	0.7526	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91831	0.5475	10	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	1361	Q9UPZ6	THS7A_HUMAN	R	1361	ENSP00000406482:G1361R	ENSP00000262042:G1361R	G	-	1	0	THSD7A	11412608	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.790000	0.85794	2.941000	0.99782	0.655000	0.94253	GGG	.	.		0.418	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325944.4	XM_928187.2	
HIBADH	11112	hgsc.bcm.edu	37	7	27672029	27672029	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:27672029A>G	ENST00000265395.2	-	3	494	c.288T>C	c.(286-288)gcT>gcC	p.A96A		NM_152740.3	NP_689953.1	P31937	3HIDH_HUMAN	3-hydroxyisobutyrate dehydrogenase	96					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|pentose-phosphate shunt (GO:0006098)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	mitochondrial matrix (GO:0005759)	3-hydroxyisobutyrate dehydrogenase activity (GO:0008442)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(4)|kidney(2)|lung(3)|ovary(2)|prostate(1)	12			GBM - Glioblastoma multiforme(3;0.0368)			TAATTCTGTCAGCTTTTTCAG	0.353																																					p.A96A		Atlas-SNP	.											.	HIBADH	28	.	0			c.T288C						.						134.0	129.0	131.0					7																	27672029		2203	4300	6503	SO:0001819	synonymous_variant	11112	exon3			TCTGTCAGCTTTT	AF529362	CCDS5414.1	7p15	2009-06-12			ENSG00000106049	ENSG00000106049	1.1.1.31		4907	protein-coding gene	gene with protein product		608475					Standard	NM_152740		Approved	NS5ATP1	uc003szf.3	P31937	OTTHUMG00000097035	ENST00000265395.2:c.288T>C	chr7.hg19:g.27672029A>G		69.0	0.0		82.0	4.0	NM_152740	Q546Z2|Q9UDN3	Silent	SNP	ENST00000265395.2	hg19	CCDS5414.1	.	.	.	.	.	.	.	.	.	.	A	11.09	1.535153	0.27475	.	.	ENSG00000106049	ENST00000425715	.	.	.	5.8	-6.09	0.02145	.	.	.	.	.	T	0.37293	0.0998	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45175	-0.9279	4	.	.	.	-21.1549	3.1029	0.06331	0.385:0.1537:0.0601:0.4012	.	.	.	.	P	39	.	.	L	-	2	0	HIBADH	27638554	0.589000	0.26807	0.991000	0.47740	0.998000	0.95712	-0.196000	0.09532	-0.446000	0.07149	0.528000	0.53228	CTG	.	.		0.353	HIBADH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214132.1	NM_152740	
AMPH	273	hgsc.bcm.edu	37	7	38431545	38431545	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:38431545A>G	ENST00000356264.2	-	19	1897	c.1682T>C	c.(1681-1683)aTa>aCa	p.I561T	AMPH_ENST00000428293.2_Missense_Mutation_p.I519T|AMPH_ENST00000471913.1_5'Flank|AMPH_ENST00000325590.5_Missense_Mutation_p.I519T	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin	561					endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						CTCTGCACCTATAGTTATTTC	0.587																																					p.I561T		Atlas-SNP	.											.	AMPH	157	.	0			c.T1682C						.						71.0	68.0	69.0					7																	38431545		2203	4300	6503	SO:0001583	missense	273	exon19			GCACCTATAGTTA		CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1682T>C	chr7.hg19:g.38431545A>G	ENSP00000348602:p.Ile561Thr	107.0	0.0		106.0	5.0	NM_001635	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	Missense_Mutation	SNP	ENST00000356264.2	hg19	CCDS5456.1	.	.	.	.	.	.	.	.	.	.	A	11.82	1.751719	0.31046	.	.	ENSG00000078053	ENST00000325590;ENST00000356264;ENST00000428293;ENST00000353242	T;T;T	0.60171	0.25;0.24;0.21	5.24	-4.31	0.03698	.	2.013320	0.02734	N	0.115458	T	0.31888	0.0811	N	0.08118	0	0.09310	N	1	B;B;B	0.13145	0.0;0.0;0.007	B;B;B	0.11329	0.002;0.002;0.006	T	0.20605	-1.0270	10	0.10902	T	0.67	6.6467	7.0376	0.25002	0.4722:0.0:0.4127:0.1151	.	519;561;449	P49418-2;P49418;Q8NFL4	.;AMPH_HUMAN;.	T	519;561;519;463	ENSP00000317441:I519T;ENSP00000348602:I561T;ENSP00000390734:I519T	ENSP00000317441:I519T	I	-	2	0	AMPH	38398070	0.000000	0.05858	0.000000	0.03702	0.102000	0.19082	0.178000	0.16820	-0.877000	0.04012	-0.326000	0.08463	ATA	.	.		0.587	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000226953.2	NM_001635	
POLM	27434	hgsc.bcm.edu	37	7	44119318	44119318	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:44119318T>C	ENST00000242248.5	-	4	595	c.494A>G	c.(493-495)gAg>gGg	p.E165G	POLM_ENST00000492971.1_5'Flank|POLM_ENST00000335195.6_Missense_Mutation_p.E165G|POLM_ENST00000395831.3_Missense_Mutation_p.E165G	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	165					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						GCCTGCTGCCTCGGCCAGTAT	0.647								DNA polymerases (catalytic subunits)																													p.E165G		Atlas-SNP	.											POLM,NS,carcinoma,0,1	POLM	50	.	0			c.A494G						.						37.0	41.0	40.0					7																	44119318		2203	4299	6502	SO:0001583	missense	27434	exon4			GCTGCCTCGGCCA	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.494A>G	chr7.hg19:g.44119318T>C	ENSP00000242248:p.Glu165Gly	47.0	0.0		68.0	3.0	NM_013284	D3DVK4|Q6P5X8|Q86WQ9	Missense_Mutation	SNP	ENST00000242248.5	hg19	CCDS34625.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.932015	0.73442	.	.	ENSG00000122678	ENST00000335195;ENST00000242248;ENST00000395831;ENST00000414235	T;T;T;T	0.48201	0.82;0.82;0.82;0.82	5.75	5.75	0.90469	DNA-directed DNA polymerase X (1);DNA-directed DNA polymerase, family X, beta-like, N-terminal (2);	0.154038	0.56097	D	0.000024	T	0.70020	0.3176	M	0.84326	2.69	0.46823	D	0.99921	D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0;0.999	D;D;D;D;D;D	0.91635	0.943;0.967;0.943;0.999;0.964;0.947	T	0.74674	-0.3586	10	0.72032	D	0.01	-36.2438	12.4405	0.55621	0.0:0.0:0.0:1.0	.	132;165;165;165;165;165	B4DG75;Q6PIY2;Q9H980;Q86WQ9;Q6P5X8;Q9NP87	.;.;.;.;.;DPOLM_HUMAN	G	165;165;165;132	ENSP00000335141:E165G;ENSP00000242248:E165G;ENSP00000379174:E165G;ENSP00000390899:E132G	ENSP00000242248:E165G	E	-	2	0	POLM	44085843	1.000000	0.71417	0.949000	0.38748	0.402000	0.30811	5.621000	0.67743	2.200000	0.70718	0.533000	0.62120	GAG	.	.		0.647	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
ABCA13	154664	hgsc.bcm.edu	37	7	48318670	48318670	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:48318670C>A	ENST00000435803.1	+	18	7903	c.7879C>A	c.(7879-7881)Caa>Aaa	p.Q2627K		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	2627					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						ATATATGAACCAATCTAAGGA	0.333																																					p.Q2627K		Atlas-SNP	.											.	ABCA13	1192	.	0			c.C7879A						.						42.0	41.0	41.0					7																	48318670		1808	4066	5874	SO:0001583	missense	154664	exon18			ATGAACCAATCTA	AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.7879C>A	chr7.hg19:g.48318670C>A	ENSP00000411096:p.Gln2627Lys	63.0	0.0		54.0	20.0	NM_152701	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	ENST00000435803.1	hg19	CCDS47584.1	.	.	.	.	.	.	.	.	.	.	C	2.973	-0.211932	0.06140	.	.	ENSG00000179869	ENST00000435803	T	0.56611	0.45	4.93	2.15	0.27550	.	0.632381	0.13900	N	0.354941	T	0.33294	0.0858	N	0.20986	0.625	0.09310	N	0.999998	B	0.06786	0.001	B	0.06405	0.002	T	0.20505	-1.0273	10	0.46703	T	0.11	.	3.8515	0.08957	0.1687:0.5792:0.1627:0.0894	.	2627	Q86UQ4	ABCAD_HUMAN	K	2627	ENSP00000411096:Q2627K	ENSP00000411096:Q2627K	Q	+	1	0	ABCA13	48289216	0.002000	0.14202	0.008000	0.14137	0.006000	0.05464	-0.167000	0.09940	0.163000	0.19507	-0.776000	0.03382	CAA	.	.		0.333	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341964.2	NM_152701	
ZNF679	168417	hgsc.bcm.edu	37	7	63727165	63727165	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:63727165G>A	ENST00000421025.1	+	5	1423	c.1154G>A	c.(1153-1155)tGt>tAt	p.C385Y	ZNF679_ENST00000255746.4_Missense_Mutation_p.C385Y	NM_001159524.1|NM_153363.2	NP_001152996.1|NP_699194.2	Q8IYX0	ZN679_HUMAN	zinc finger protein 679	385					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(3)|lung(11)|skin(1)|stomach(1)	18						TGTGAAGAATGTGACAAAGCT	0.383																																					p.C385Y		Atlas-SNP	.											.	ZNF679	80	.	0			c.G1154A						.						41.0	40.0	41.0					7																	63727165		692	1591	2283	SO:0001583	missense	168417	exon5			AAGAATGTGACAA	BC033523	CCDS47592.1	7q11.21	2013-01-08			ENSG00000197123	ENSG00000197123		"""Zinc fingers, C2H2-type"", ""-"""	28650	protein-coding gene	gene with protein product	"""hypothetical protein MGC42415"""					12477932	Standard	NM_153363		Approved	MGC42415	uc003tsx.3	Q8IYX0	OTTHUMG00000156486	ENST00000421025.1:c.1154G>A	chr7.hg19:g.63727165G>A	ENSP00000416809:p.Cys385Tyr	38.0	0.0		40.0	4.0	NM_153363		Missense_Mutation	SNP	ENST00000421025.1	hg19	CCDS47592.1	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181612	0.38511	.	.	ENSG00000197123	ENST00000421025;ENST00000255746	D;D	0.85861	-2.04;-2.04	0.819	0.819	0.18785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.93025	0.7780	H	0.95151	3.63	0.36675	D	0.878734	D	0.76494	0.999	D	0.83275	0.996	D	0.91639	0.5325	9	0.87932	D	0	.	6.9957	0.24780	0.0:0.0:1.0:0.0	.	385	Q8IYX0	ZN679_HUMAN	Y	385	ENSP00000416809:C385Y;ENSP00000255746:C385Y	ENSP00000255746:C385Y	C	+	2	0	ZNF679	63364600	1.000000	0.71417	0.751000	0.31187	0.752000	0.42762	6.652000	0.74377	0.191000	0.20236	0.194000	0.17425	TGT	.	.		0.383	ZNF679-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344317.2	NM_153363	
HIP1	3092	hgsc.bcm.edu	37	7	75174427	75174427	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:75174427G>C	ENST00000336926.6	-	26	2645	c.2619C>G	c.(2617-2619)atC>atG	p.I873M	HIP1_ENST00000434438.2_Missense_Mutation_p.I822M	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	873	I/LWEQ. {ECO:0000255|PROSITE- ProRule:PRU00292}.|Important for actin binding. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						TGGAGGCTGAGATAAGTCCTT	0.473			T	PDGFRB	CMML																																p.I873M		Atlas-SNP	.		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	.	HIP1	91	.	0			c.C2619G						.						126.0	128.0	128.0					7																	75174427		2203	4300	6503	SO:0001583	missense	3092	exon26			GGCTGAGATAAGT	AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.2619C>G	chr7.hg19:g.75174427G>C	ENSP00000336747:p.Ile873Met	78.0	0.0		60.0	24.0	NM_005338	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Missense_Mutation	SNP	ENST00000336926.6	hg19	CCDS34669.1	.	.	.	.	.	.	.	.	.	.	g	18.44	3.623706	0.66901	.	.	ENSG00000127946	ENST00000336926;ENST00000434438	T;T	0.62788	0.0;0.0	5.6	1.69	0.24217	I/LWEQ (4);	0.000000	0.85682	D	0.000000	T	0.80742	0.4681	H	0.94771	3.58	0.43771	D	0.99629	D;D	0.89917	1.0;1.0	D;D	0.85130	0.994;0.997	T	0.77474	-0.2574	10	0.87932	D	0	-29.4678	5.955	0.19269	0.2214:0.0:0.6411:0.1375	.	822;873	E7ES17;O00291	.;HIP1_HUMAN	M	873;822	ENSP00000336747:I873M;ENSP00000410300:I822M	ENSP00000336747:I873M	I	-	3	3	HIP1	75012363	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	1.353000	0.34045	0.032000	0.15435	0.655000	0.94253	ATC	.	.		0.473	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342863.2	NM_005338	
CCDC146	57639	hgsc.bcm.edu	37	7	76866342	76866342	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:76866342A>G	ENST00000285871.4	+	3	362	c.235A>G	c.(235-237)Atg>Gtg	p.M79V	CCDC146_ENST00000431197.1_5'UTR	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146	79										breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TGACGCCGTGATGAGGTATGC	0.418																																					p.M79V		Atlas-SNP	.											.	CCDC146	87	.	0			c.A235G						.						174.0	129.0	144.0					7																	76866342		2203	4300	6503	SO:0001583	missense	57639	exon3			GCCGTGATGAGGT	BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.235A>G	chr7.hg19:g.76866342A>G	ENSP00000285871:p.Met79Val	102.0	0.0		98.0	4.0	NM_020879	A8K8X6|Q9P223	Missense_Mutation	SNP	ENST00000285871.4	hg19	CCDS34671.1	.	.	.	.	.	.	.	.	.	.	A	4.999	0.185457	0.09495	.	.	ENSG00000135205	ENST00000415750;ENST00000285871	D;D	0.83506	-1.73;-1.73	5.55	-2.84	0.05751	.	0.776569	0.11905	N	0.518229	T	0.47600	0.1454	N	0.00538	-1.39	0.23791	N	0.996834	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.48736	-0.9009	10	0.19590	T	0.45	0.0885	6.0693	0.19881	0.5474:0.0:0.3389:0.1137	.	79;79	Q8IYE0;C9JRR4	CC146_HUMAN;.	V	79	ENSP00000388649:M79V;ENSP00000285871:M79V	ENSP00000285871:M79V	M	+	1	0	AC007000.1	76704278	1.000000	0.71417	0.012000	0.15200	0.839000	0.47603	1.536000	0.36072	-0.667000	0.05303	0.477000	0.44152	ATG	.	.		0.418	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341449.1	NM_020879	
PHTF2	57157	hgsc.bcm.edu	37	7	77551975	77551975	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:77551975A>G	ENST00000248550.7	+	10	1075	c.999A>G	c.(997-999)gaA>gaG	p.E333E	PHTF2_ENST00000416283.2_Silent_p.E299E|PHTF2_ENST00000454592.1_3'UTR|PHTF2_ENST00000424760.1_Silent_p.E295E|PHTF2_ENST00000275575.7_Silent_p.E295E|PHTF2_ENST00000422959.2_Silent_p.E299E|PHTF2_ENST00000307305.8_Silent_p.E295E|PHTF2_ENST00000415251.2_Silent_p.E295E|PHTF2_ENST00000450574.1_Silent_p.E299E			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	333					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						TCTCTGATGAAGTCTCCAGTG	0.393																																					p.E299E		Atlas-SNP	.											.	PHTF2	104	.	0			c.A897G						.						66.0	63.0	64.0					7																	77551975		1856	4090	5946	SO:0001819	synonymous_variant	57157	exon9			TGATGAAGTCTCC	AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.999A>G	chr7.hg19:g.77551975A>G		92.0	0.0		90.0	4.0	NM_001127359	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Silent	SNP	ENST00000248550.7	hg19																																																																																				.	.		0.393	PHTF2-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000340638.2	NM_020432	
PEX1	5189	hgsc.bcm.edu	37	7	92123943	92123943	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:92123943T>C	ENST00000248633.4	-	18	2879	c.2784A>G	c.(2782-2784)agA>agG	p.R928R	PEX1_ENST00000438045.1_Splice_Site_p.R606R|PEX1_ENST00000428214.1_Splice_Site_p.R871R	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	928					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CAGCCTGTGCTCTGGGAAAAA	0.353																																					p.R928R		Atlas-SNP	.											.	PEX1	102	.	0			c.A2784G						.						50.0	52.0	51.0					7																	92123943		2203	4300	6503	SO:0001630	splice_region_variant	5189	exon18			CTGTGCTCTGGGA	AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.2784-1A>G	chr7.hg19:g.92123943T>C		84.0	0.0		83.0	4.0	NM_000466	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Silent	SNP	ENST00000248633.4	hg19	CCDS5627.1																																																																																			.	.		0.353	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254066.3	NM_000466	Silent
COL1A2	1278	hgsc.bcm.edu	37	7	94056343	94056343	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:94056343T>C	ENST00000297268.6	+	47	3600	c.3129T>C	c.(3127-3129)gcT>gcC	p.A1043A		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1043					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	ATCAAGGTGCTCCTGGCTCCG	0.463										HNSCC(75;0.22)																											p.A1043A		Atlas-SNP	.											.	COL1A2	240	.	0			c.T3129C						.						93.0	82.0	86.0					7																	94056343		2203	4300	6503	SO:0001819	synonymous_variant	1278	exon47			AGGTGCTCCTGGC	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3129T>C	chr7.hg19:g.94056343T>C		88.0	0.0		91.0	5.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Silent	SNP	ENST00000297268.6	hg19	CCDS34682.1																																																																																			.	.		0.463	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
CASD1	64921	hgsc.bcm.edu	37	7	94164818	94164818	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:94164818G>C	ENST00000297273.4	+	8	1113	c.826G>C	c.(826-828)Gaa>Caa	p.E276Q		NM_022900.4	NP_075051.4	Q96PB1	CASD1_HUMAN	CAS1 domain containing 1	276						integral component of membrane (GO:0016021)				NS(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|ovary(3)|stomach(2)|upper_aerodigestive_tract(1)	31	all_cancers(62;6.71e-10)|all_epithelial(64;5e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ACATCTTCCTGAATCGAGCAG	0.323																																					p.E276Q		Atlas-SNP	.											.	CASD1	70	.	0			c.G826C						.						85.0	83.0	83.0					7																	94164818		2203	4300	6503	SO:0001583	missense	64921	exon8			CTTCCTGAATCGA	AF355594	CCDS5636.1	7q22	2006-03-09			ENSG00000127995	ENSG00000127995			16014	protein-coding gene	gene with protein product	"""chromosome 7 open reading frame 12"""	611686				11703667, 11528394	Standard	NM_022900		Approved	FLJ21213, FLJ21879, C7orf12	uc003uni.4	Q96PB1	OTTHUMG00000023356	ENST00000297273.4:c.826G>C	chr7.hg19:g.94164818G>C	ENSP00000297273:p.Glu276Gln	190.0	0.0		192.0	77.0	NM_022900	B3KW13|O14574|Q3LIE2|Q6P4R4|Q9H6T9|Q9H770	Missense_Mutation	SNP	ENST00000297273.4	hg19	CCDS5636.1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.057289	0.76074	.	.	ENSG00000127995	ENST00000297273	T	0.17370	2.28	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.21509	0.0518	N	0.19112	0.55	0.80722	D	1	D;D	0.61080	0.989;0.989	P;P	0.55785	0.784;0.784	T	0.04103	-1.0977	10	0.16896	T	0.51	.	19.0801	0.93178	0.0:0.0:1.0:0.0	.	276;276	Q8WZ77;Q96PB1	.;CASD1_HUMAN	Q	276	ENSP00000297273:E276Q	ENSP00000297273:E276Q	E	+	1	0	CASD1	94002754	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.391000	0.97249	2.593000	0.87608	0.591000	0.81541	GAA	.	.		0.323	CASD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255216.1	NM_022900	
ZNF394	84124	hgsc.bcm.edu	37	7	99091412	99091412	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:99091412T>C	ENST00000337673.6	-	3	1629	c.1426A>G	c.(1426-1428)Aag>Gag	p.K476E	ZNF394_ENST00000394177.3_5'Flank|ZNF394_ENST00000426306.2_3'UTR|ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	476					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					TTGAAGCTCTTCTCGCATTCT	0.453																																					p.K476E	Ovarian(24;589 697 9939 12704 40742)	Atlas-SNP	.											.	ZNF394	48	.	0			c.A1426G						.						120.0	116.0	117.0					7																	99091412		2203	4300	6503	SO:0001583	missense	84124	exon3			AGCTCTTCTCGCA	BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1426A>G	chr7.hg19:g.99091412T>C	ENSP00000337363:p.Lys476Glu	187.0	0.0		219.0	68.0	NM_032164	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	ENST00000337673.6	hg19	CCDS5666.1	.	.	.	.	.	.	.	.	.	.	T	20.7	4.028863	0.75504	.	.	ENSG00000160908	ENST00000337673	T	0.07567	3.18	3.58	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.51477	D	0.000085	T	0.26340	0.0643	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.01371	-1.1372	10	0.54805	T	0.06	.	10.7684	0.46308	0.0:0.0:0.0:1.0	.	476	Q53GI3	ZN394_HUMAN	E	476	ENSP00000337363:K476E	ENSP00000337363:K476E	K	-	1	0	ZNF394	98929348	0.916000	0.31088	0.963000	0.40424	0.817000	0.46193	3.134000	0.50538	1.858000	0.53909	0.533000	0.62120	AAG	.	.		0.453	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336498.1	NM_032164	
TRIM4	89122	hgsc.bcm.edu	37	7	99500933	99500933	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:99500933T>C	ENST00000355947.2	-	6	956	c.827A>G	c.(826-828)gAg>gGg	p.E276G	TRIM4_ENST00000354241.5_Missense_Mutation_p.E250G|TRIM4_ENST00000349062.2_Missense_Mutation_p.E250G	NM_033017.3	NP_148977.2	Q9C037	TRIM4_HUMAN	tripartite motif containing 4	276					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)	17	Esophageal squamous(72;0.0166)|Lung NSC(181;0.0211)|all_lung(186;0.0323)	Ovarian(593;0.238)				ATCCTGGATCTCACTCCTAAG	0.473																																					p.E276G		Atlas-SNP	.											.	TRIM4	33	.	0			c.A827G						.						105.0	99.0	101.0					7																	99500933		2203	4300	6503	SO:0001583	missense	89122	exon6			TGGATCTCACTCC	AF220023	CCDS5678.1, CCDS5679.1	7q22-q31.1	2013-01-09	2011-01-25		ENSG00000146833	ENSG00000146833		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16275	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM4"", ""tripartite motif protein 4"""		"""tripartite motif-containing 4"""			11331580	Standard	NM_033017		Approved	RNF87	uc003use.3	Q9C037	OTTHUMG00000156648	ENST00000355947.2:c.827A>G	chr7.hg19:g.99500933T>C	ENSP00000348216:p.Glu276Gly	89.0	0.0		85.0	4.0	NM_033017	A4D298|Q75MK1|Q96F06|Q9C036	Missense_Mutation	SNP	ENST00000355947.2	hg19	CCDS5679.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.515|7.515	0.655393|0.655393	0.14580|0.14580	.|.	.|.	ENSG00000146833|ENSG00000146833	ENST00000355947;ENST00000349062;ENST00000542799;ENST00000354241|ENST00000447480	T;T;T|.	0.05855|.	3.38;3.38;3.38|.	2.16|2.16	0.984|0.984	0.19773|0.19773	.|.	.|.	.|.	.|.	.|.	T|.	0.44159|.	0.1280|.	M|M	0.71871|0.71871	2.18|2.18	0.18873|0.18873	N|N	0.999984|0.999984	P;P;P|.	0.46987|.	0.591;0.827;0.888|.	B;B;B|.	0.43889|.	0.399;0.424;0.435|.	T|.	0.38222|.	-0.9671|.	9|.	0.62326|.	D|.	0.03|.	.|.	3.9474|3.9474	0.09353|0.09353	0.0:0.1841:0.0:0.8159|0.0:0.1841:0.0:0.8159	.|.	250;250;276|.	Q9C037-3;Q9C037-2;Q9C037|.	.;.;TRIM4_HUMAN|.	G|W	276;250;106;250|151	ENSP00000348216:E276G;ENSP00000275736:E250G;ENSP00000346186:E250G|.	ENSP00000275736:E250G|.	E|X	-|-	2|3	0|0	TRIM4|TRIM4	99338869|99338869	0.965000|0.965000	0.33210|0.33210	0.463000|0.463000	0.27130|0.27130	0.079000|0.079000	0.17450|0.17450	2.157000|2.157000	0.42320|0.42320	0.291000|0.291000	0.22468|0.22468	-0.263000|-0.263000	0.10527|0.10527	GAG|TGA	.	.		0.473	TRIM4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000345050.1	NM_033017	
TAF6	6878	hgsc.bcm.edu	37	7	99711537	99711537	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:99711537A>G	ENST00000344095.4	-	3	722	c.197T>C	c.(196-198)cTc>cCc	p.L66P	RP11-506M12.1_ENST00000494221.1_RNA|TAF6_ENST00000437822.2_Missense_Mutation_p.L103P|TAF6_ENST00000452041.1_Missense_Mutation_p.L66P|TAF6_ENST00000453269.2_Missense_Mutation_p.L66P|TAF6_ENST00000497233.1_5'Flank|TAF6_ENST00000418432.2_Missense_Mutation_p.L9P|TAF6_ENST00000472509.1_Missense_Mutation_p.L123P	NM_005641.3	NP_005632.1	P49848	TAF6_HUMAN	TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80kDa	66					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(2)	26	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACTGGTGGTGAGCTTCTGCCG	0.577																																					p.L103P		Atlas-SNP	.											.	TAF6	55	.	0			c.T308C						.						125.0	108.0	114.0					7																	99711537		2203	4300	6503	SO:0001583	missense	6878	exon3			GTGGTGAGCTTCT		CCDS5686.1, CCDS55135.1	7q	2010-02-26	2002-08-29	2001-12-07	ENSG00000106290	ENSG00000106290			11540	protein-coding gene	gene with protein product	"""TAF6 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 80 kD"", ""transcription initiation factor TFIID 70 kD subunit"""	602955	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, E, 70/85kD"""	TAF2E		826207	Standard	NM_139315		Approved	TAFII70, TAFII80, MGC:8964, TAFII85	uc011kji.2	P49848	OTTHUMG00000154771	ENST00000344095.4:c.197T>C	chr7.hg19:g.99711537A>G	ENSP00000344537:p.Leu66Pro	152.0	0.0		147.0	6.0	NM_001190415	A4D2B2|A4D2B3|B4DT11|D6W5U2|Q6AI29	Missense_Mutation	SNP	ENST00000344095.4	hg19	CCDS5686.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.512368	0.85389	.	.	ENSG00000106290	ENST00000453269;ENST00000472509;ENST00000452041;ENST00000344095;ENST00000418432;ENST00000437822;ENST00000493322;ENST00000440225;ENST00000452438;ENST00000523306;ENST00000449571;ENST00000520135;ENST00000451699;ENST00000417349	T;T;T;T;T;T;T;T;T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29;-0.29	5.63	5.63	0.86233	Histone-fold (2);TATA box binding protein associated factor (TAF) (2);	0.000000	0.85682	D	0.000000	D	0.84460	0.5477	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.998;0.996;0.998;0.998;0.986;0.99	D	0.87673	0.2542	10	0.87932	D	0	-23.7828	13.785	0.63104	1.0:0.0:0.0:0.0	.	103;66;56;66;66;9	B4DT11;P49848-2;A4D299;P49848;C9JTY6;B3KUR4	.;.;.;TAF6_HUMAN;.;.	P	66;123;66;66;9;103;66;66;66;56;66;56;66;66	ENSP00000389575:L66P;ENSP00000419760:L123P;ENSP00000416396:L66P;ENSP00000344537:L66P;ENSP00000399982:L103P;ENSP00000419555:L66P;ENSP00000410012:L66P;ENSP00000412346:L66P;ENSP00000428639:L56P;ENSP00000390073:L66P;ENSP00000428071:L56P;ENSP00000406315:L66P;ENSP00000390220:L66P	ENSP00000344537:L66P	L	-	2	0	TAF6	99549473	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.451000	0.90343	2.139000	0.66308	0.459000	0.35465	CTC	.	.		0.577	TAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337024.2	NM_005641	
STAG3	10734	hgsc.bcm.edu	37	7	99808723	99808723	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:99808723T>C	ENST00000426455.1	+	30	3735	c.3328T>C	c.(3328-3330)Tcc>Ccc	p.S1110P	STAG3_ENST00000317296.5_Missense_Mutation_p.S1110P|STAG3_ENST00000394018.2_Missense_Mutation_p.S1052P|GATS_ENST00000436886.2_Intron|GATS_ENST00000543273.1_RNA|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1110					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CACCCTCACCTCCACAGCTGT	0.602																																					p.S1110P		Atlas-SNP	.											.	STAG3	121	.	0			c.T3328C						.						60.0	63.0	62.0					7																	99808723		2203	4300	6503	SO:0001583	missense	10734	exon30			CTCACCTCCACAG	AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.3328T>C	chr7.hg19:g.99808723T>C	ENSP00000400359:p.Ser1110Pro	86.0	0.0		113.0	7.0	NM_012447	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	ENST00000426455.1	hg19	CCDS34703.1	.	.	.	.	.	.	.	.	.	.	t	18.27	3.587288	0.66105	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000339784;ENST00000379577;ENST00000317296;ENST00000412190	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.41	5.41	0.78517	.	0.000000	0.47093	D	0.000241	T	0.56645	0.1999	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	0.989;0.999;1.0	P;D;D	0.80764	0.837;0.994;0.963	T	0.60459	-0.7259	10	0.87932	D	0	-13.0087	11.841	0.52355	0.0:0.0:0.0:1.0	.	1052;1110;1110	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	P	1110;1052;773;130;1110;68	ENSP00000400359:S1110P;ENSP00000377586:S1052P;ENSP00000319318:S1110P;ENSP00000395039:S68P	ENSP00000319318:S1110P	S	+	1	0	STAG3	99646659	1.000000	0.71417	0.899000	0.35326	0.309000	0.27889	4.506000	0.60428	2.056000	0.61249	0.459000	0.35465	TCC	.	.		0.602	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000338734.2	NM_012447	
MUC17	140453	hgsc.bcm.edu	37	7	100680430	100680430	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:100680430T>C	ENST00000306151.4	+	3	5797	c.5733T>C	c.(5731-5733)gcT>gcC	p.A1911A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1911	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CTACAACTGCTGACGGTAGCA	0.502																																					p.A1911A		Atlas-SNP	.											.	MUC17	804	.	0			c.T5733C						.						248.0	252.0	251.0					7																	100680430		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			AACTGCTGACGGT	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.5733T>C	chr7.hg19:g.100680430T>C		130.0	0.0		97.0	4.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
CUX1	1523	hgsc.bcm.edu	37	7	101840321	101840321	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:101840321A>G	ENST00000292535.7	+	15	1668	c.1630A>G	c.(1630-1632)Agc>Ggc	p.S544G	SNORA48_ENST00000517015.1_RNA|CUX1_ENST00000550008.2_Missense_Mutation_p.S544G|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000556210.1_Missense_Mutation_p.S442G|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Missense_Mutation_p.S442G|CUX1_ENST00000360264.3_Missense_Mutation_p.S555G|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000549414.2_Missense_Mutation_p.S544G|CUX1_ENST00000437600.4_Intron	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	544					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AAGTGCTGGGAGCGTCTCCGA	0.512																																					p.S555G		Atlas-SNP	.											.	CUX1	253	.	0			c.A1663G						.						94.0	98.0	97.0					7																	101840321		2203	4300	6503	SO:0001583	missense	1523	exon15			GCTGGGAGCGTCT	M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.1630A>G	chr7.hg19:g.101840321A>G	ENSP00000292535:p.Ser544Gly	50.0	0.0		80.0	4.0	NM_001202543	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Missense_Mutation	SNP	ENST00000292535.7	hg19	CCDS5721.1	.	.	.	.	.	.	.	.	.	.	A	15.71	2.914871	0.52546	.	.	ENSG00000257923	ENST00000360264;ENST00000292535;ENST00000549414;ENST00000550008;ENST00000546411;ENST00000556210	T;T;T;T;T;T	0.61627	0.11;0.09;0.09;0.1;0.11;0.11	5.71	3.33	0.38152	Homeodomain protein CUT (1);Lambda repressor-like, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.38427	0.1040	N	0.24115	0.695	0.80722	D	1	B;B	0.12013	0.005;0.004	B;B	0.16722	0.016;0.009	T	0.09530	-1.0670	10	0.29301	T	0.29	-6.7211	6.5345	0.22346	0.7314:0.1321:0.1365:0.0	.	544;555	P39880;P39880-3	CUX1_HUMAN;.	G	555;544;544;544;442;442	ENSP00000353401:S555G;ENSP00000292535:S544G;ENSP00000446630:S544G;ENSP00000447373:S544G;ENSP00000450125:S442G;ENSP00000451558:S442G	ENSP00000292535:S544G	S	+	1	0	CUX1	101627041	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	5.058000	0.64300	0.434000	0.26340	0.459000	0.35465	AGC	.	.		0.512	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000347535.1	NM_001913	
DNAJC2	27000	hgsc.bcm.edu	37	7	102957429	102957429	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:102957429C>T	ENST00000379263.3	-	13	1525	c.1275G>A	c.(1273-1275)gaG>gaA	p.E425E	PMPCB_ENST00000420236.2_Intron|DNAJC2_ENST00000249270.7_Silent_p.E372E	NM_014377.1	NP_055192.1	Q99543	DNJC2_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 2	425					'de novo' cotranslational protein folding (GO:0051083)|chromatin modification (GO:0016568)|DNA replication (GO:0006260)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|Hsp70 protein binding (GO:0030544)|poly(A) RNA binding (GO:0044822)|ubiquitin binding (GO:0043130)			endometrium(1)|kidney(9)|large_intestine(6)|lung(4)|ovary(1)	21						CTTCCTCTTTCTCTTTTCTGA	0.393																																					p.E425E		Atlas-SNP	.											.	DNAJC2	46	.	0			c.G1275A						.						127.0	117.0	120.0					7																	102957429		1860	4098	5958	SO:0001819	synonymous_variant	27000	exon13			CTCTTTCTCTTTT	X98260	CCDS43628.1, CCDS47679.1	7q22-q32	2011-09-02	2008-07-01	2008-07-01	ENSG00000105821	ENSG00000105821		"""Heat shock proteins / DNAJ (HSP40)"""	13192	protein-coding gene	gene with protein product		605502	"""zuotin related factor 1"""	ZRF1		8885239	Standard	NM_001129887		Approved	MPP11, MPHOSPH11, ZUO1, zuotin	uc003vbo.3	Q99543	OTTHUMG00000157202	ENST00000379263.3:c.1275G>A	chr7.hg19:g.102957429C>T		280.0	1.0		232.0	89.0	NM_014377	A4VCI0|Q9BVX1	Silent	SNP	ENST00000379263.3	hg19	CCDS43628.1																																																																																			.	.		0.393	DNAJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347891.1		
PRRT4	401399	hgsc.bcm.edu	37	7	127991409	127991409	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:127991409T>C	ENST00000446477.2	-	6	2514	c.2201A>G	c.(2200-2202)gAg>gGg	p.E734G	PRRT4_ENST00000535159.1_Missense_Mutation_p.E734G|PRRT4_ENST00000489835.2_Silent_p.G389G|PRRT4_ENST00000435512.1_Missense_Mutation_p.E528G	NM_001174164.1	NP_001167635.1	C9JH25	PRRT4_HUMAN	proline-rich transmembrane protein 4	734						integral component of membrane (GO:0016021)				endometrium(4)|prostate(1)	5						GCAGAGGGCCTCCTCGATGCT	0.706																																					p.E734G		Atlas-SNP	.											.	PRRT4	31	.	0			c.A2201G						.						5.0	9.0	8.0					7																	127991409		665	1533	2198	SO:0001583	missense	401399	exon6			AGGGCCTCCTCGA	BC063892	CCDS47698.1, CCDS47698.2, CCDS55160.1	7q32.1	2011-10-10			ENSG00000224940	ENSG00000224940		"""Proline-rich transmembrane proteins"""	37280	protein-coding gene	gene with protein product							Standard	NM_001114726		Approved		uc022aky.1	C9JH25	OTTHUMG00000157714	ENST00000446477.2:c.2201A>G	chr7.hg19:g.127991409T>C	ENSP00000415026:p.Glu734Gly	56.0	0.0		86.0	4.0	NM_001174164	A4D0Z9|C9JVW7	Missense_Mutation	SNP	ENST00000446477.2	hg19	CCDS55160.1	.	.	.	.	.	.	.	.	.	.	T	19.78	3.890838	0.72524	.	.	ENSG00000224940	ENST00000446477;ENST00000480290;ENST00000535159;ENST00000435512	.	.	.	3.99	3.99	0.46301	.	.	.	.	.	T	0.76983	0.4064	.	.	.	0.43457	D	0.995653	D	0.89917	1.0	D	0.87578	0.998	T	0.78981	-0.1989	7	0.56958	D	0.05	-14.4227	11.1676	0.48552	0.0:0.0:0.0:1.0	.	734	C9JH25	PRRT4_HUMAN	G	734;263;734;528	.	ENSP00000410779:E528G	E	-	2	0	PRRT4	127778645	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.867000	0.56047	1.790000	0.52503	0.379000	0.24179	GAG	.	.		0.706	PRRT4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001114726	
CCDC136	64753	hgsc.bcm.edu	37	7	128445476	128445476	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:128445476T>C	ENST00000297788.4	+	6	1213	c.846T>C	c.(844-846)tcT>tcC	p.S282S	CCDC136_ENST00000464832.1_Silent_p.S332S|CCDC136_ENST00000487361.1_Silent_p.S282S|CCDC136_ENST00000378685.4_Silent_p.S320S	NM_022742.4	NP_073579	Q96JN2	CC136_HUMAN	coiled-coil domain containing 136	282	Glu-rich.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)	24						CAGCAGAGTCTCAGACTTCAG	0.493																																					p.S320S		Atlas-SNP	.											.	CCDC136	170	.	0			c.T960C						.						82.0	85.0	84.0					7																	128445476		2006	4185	6191	SO:0001819	synonymous_variant	64753	exon7			AGAGTCTCAGACT		CCDS47704.1, CCDS56510.1	7q33	2007-08-01			ENSG00000128596	ENSG00000128596			22225	protein-coding gene	gene with protein product		611902				15112360	Standard	NM_022742		Approved	KIAA1793, NAG6, DKFZP434G156	uc003vnv.2	Q96JN2	OTTHUMG00000158310	ENST00000297788.4:c.846T>C	chr7.hg19:g.128445476T>C		70.0	0.0		86.0	4.0	NM_001201372	A4D1K1|A7MCY7|A8MYA7|Q6ZVK7|Q9H8M3|Q9UFE1	Silent	SNP	ENST00000297788.4	hg19	CCDS47704.1	.	.	.	.	.	.	.	.	.	.	T	7.414	0.635312	0.14322	.	.	ENSG00000128596	ENST00000494552	.	.	.	5.65	-0.905	0.10527	.	.	.	.	.	T	0.50017	0.1591	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38023	-0.9680	4	.	.	.	-3.3201	4.9651	0.14087	0.0:0.344:0.1606:0.4954	.	.	.	.	P	159	.	.	L	+	2	0	CCDC136	128232712	1.000000	0.71417	0.996000	0.52242	0.572000	0.35998	0.524000	0.22940	-0.144000	0.11314	-0.274000	0.10170	CTC	.	.		0.493	CCDC136-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000350641.1	NM_022742	
CPA5	93979	hgsc.bcm.edu	37	7	130007288	130007288	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:130007288C>T	ENST00000485477.1	+	10	2043	c.914C>T	c.(913-915)gCc>gTc	p.A305V	CPA5_ENST00000355388.3_Missense_Mutation_p.A305V|CPA5_ENST00000461828.1_Missense_Mutation_p.A305V|CPA5_ENST00000466363.2_Missense_Mutation_p.A305V|CPA5_ENST00000474905.1_Missense_Mutation_p.A305V|CPA5_ENST00000431780.2_Missense_Mutation_p.A305V|CPA5_ENST00000393213.3_Missense_Mutation_p.A305V			Q8WXQ8	CBPA5_HUMAN	carboxypeptidase A5	305						extracellular region (GO:0005576)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(2)|large_intestine(7)|lung(4)|ovary(3)|pancreas(1)|skin(2)	23	Melanoma(18;0.0435)					GAGGTGGCTGCCATAGTGAAC	0.522																																					p.A305V		Atlas-SNP	.											.	CPA5	61	.	0			c.C914T						.						96.0	91.0	93.0					7																	130007288		2203	4300	6503	SO:0001583	missense	93979	exon11			TGGCTGCCATAGT	AF384667	CCDS5819.1, CCDS47713.1	7q32	2008-07-18			ENSG00000158525	ENSG00000158525			15722	protein-coding gene	gene with protein product		609561				11836249	Standard	NM_080385		Approved		uc003vps.2	Q8WXQ8	OTTHUMG00000157824	ENST00000485477.1:c.914C>T	chr7.hg19:g.130007288C>T	ENSP00000420237:p.Ala305Val	269.0	0.0		299.0	91.0	NM_080385	G3V0G8|Q6ZNI6|Q86SE2|Q86XM3|Q8NA08	Missense_Mutation	SNP	ENST00000485477.1	hg19	CCDS5819.1	.	.	.	.	.	.	.	.	.	.	C	17.26	3.344562	0.61073	.	.	ENSG00000158525	ENST00000355388;ENST00000461828;ENST00000466363;ENST00000485477;ENST00000431780;ENST00000474905;ENST00000393213	T;T;T;T;T;T;T	0.16743	2.32;2.32;2.32;2.32;2.32;2.32;2.32	5.87	5.87	0.94306	Peptidase M14, carboxypeptidase A (2);	0.099447	0.44688	D	0.000433	T	0.36880	0.0983	M	0.68728	2.09	0.20307	N	0.999917	D;P	0.54964	0.969;0.873	P;P	0.56216	0.794;0.791	T	0.10337	-1.0634	9	.	.	.	.	19.2073	0.93736	0.0:1.0:0.0:0.0	.	305;305	G3V0G8;Q8WXQ8	.;CBPA5_HUMAN	V	305	ENSP00000347549:A305V;ENSP00000418183:A305V;ENSP00000419025:A305V;ENSP00000420237:A305V;ENSP00000393045:A305V;ENSP00000417314:A305V;ENSP00000376907:A305V	.	A	+	2	0	CPA5	129794524	0.974000	0.33945	0.983000	0.44433	0.003000	0.03518	4.787000	0.62432	2.780000	0.95670	0.655000	0.94253	GCC	.	.		0.522	CPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349712.1	NM_001127441	
WDR91	29062	hgsc.bcm.edu	37	7	134870994	134870994	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:134870994T>C	ENST00000354475.4	-	15	2184	c.2153A>G	c.(2152-2154)gAc>gGc	p.D718G	WDR91_ENST00000344400.5_3'UTR|WDR91_ENST00000423565.1_Missense_Mutation_p.D683G	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	718										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						AGTGCTCCAGTCCACGGTGAC	0.607																																					p.D718G		Atlas-SNP	.											.	WDR91	82	.	0			c.A2153G						.						91.0	75.0	81.0					7																	134870994		2203	4300	6503	SO:0001583	missense	29062	exon15			CTCCAGTCCACGG	AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.2153A>G	chr7.hg19:g.134870994T>C	ENSP00000346466:p.Asp718Gly	98.0	0.0		117.0	5.0	NM_014149	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	ENST00000354475.4	hg19	CCDS34758.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.811966	0.70797	.	.	ENSG00000105875	ENST00000354475;ENST00000423565	T;T	0.61510	0.1;0.1	5.54	4.37	0.52481	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.043871	0.85682	D	0.000000	T	0.57184	0.2036	M	0.65975	2.015	0.80722	D	1	P	0.36110	0.537	B	0.40410	0.328	T	0.51411	-0.8709	10	0.18710	T	0.47	-30.8023	12.7783	0.57461	0.0:0.0:0.1369:0.863	.	718	A4D1P6	WDR91_HUMAN	G	718;683	ENSP00000346466:D718G;ENSP00000392555:D683G	ENSP00000346466:D718G	D	-	2	0	WDR91	134521534	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.294000	0.72738	0.912000	0.36772	0.533000	0.62120	GAC	.	.		0.607	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340019.1	NM_014149	
CREB3L2	64764	hgsc.bcm.edu	37	7	137586166	137586166	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:137586166A>G	ENST00000330387.6	-	8	1328	c.977T>C	c.(976-978)gTg>gCg	p.V326A	CREB3L2_ENST00000456390.1_Missense_Mutation_p.V326A	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2	326	bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						ACAAGACTCCACTCTACAAAG	0.453			T	FUS	fibromyxoid sarcoma																																p.V326A		Atlas-SNP	.		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	.	CREB3L2	62	.	0			c.T977C						.						72.0	67.0	69.0					7																	137586166		2203	4300	6503	SO:0001583	missense	64764	exon8			GACTCCACTCTAC	AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.977T>C	chr7.hg19:g.137586166A>G	ENSP00000329140:p.Val326Ala	77.0	0.0		89.0	5.0	NM_194071	Q6P454|Q6ZMR6	Missense_Mutation	SNP	ENST00000330387.6	hg19	CCDS34760.1	.	.	.	.	.	.	.	.	.	.	A	23.5	4.427123	0.83667	.	.	ENSG00000182158	ENST00000330387;ENST00000456390	T;T	0.60171	0.21;0.21	5.46	5.46	0.80206	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.72061	0.3414	M	0.69248	2.105	0.80722	D	1	P;P	0.52463	0.953;0.935	P;P	0.61003	0.867;0.882	T	0.75127	-0.3427	10	0.66056	D	0.02	0.5739	15.5429	0.76070	1.0:0.0:0.0:0.0	.	326;326	Q70SY1-2;Q70SY1	.;CR3L2_HUMAN	A	326	ENSP00000329140:V326A;ENSP00000403550:V326A	ENSP00000329140:V326A	V	-	2	0	CREB3L2	137236706	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	7.826000	0.86716	2.077000	0.62373	0.528000	0.53228	GTG	.	.		0.453	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341462.1	NM_194071	
UBN2	254048	hgsc.bcm.edu	37	7	138944069	138944069	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:138944069A>G	ENST00000473989.3	+	5	858	c.858A>G	c.(856-858)gaA>gaG	p.E286E	UBN2_ENST00000288561.8_Silent_p.E203E	NM_173569.3	NP_775840.3	Q6ZU65	UBN2_HUMAN	ubinuclein 2	286	Lys-rich.					extracellular space (GO:0005615)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	42						GGAAAGAGGAAGGGGAAAAGG	0.398																																					p.E286E		Atlas-SNP	.											.	UBN2	90	.	0			c.A858G						.						137.0	143.0	141.0					7																	138944069		1840	4089	5929	SO:0001819	synonymous_variant	254048	exon5			AGAGGAAGGGGAA	AK098644	CCDS43655.1, CCDS43655.2	7q34	2008-12-08			ENSG00000157741	ENSG00000157741			21931	protein-coding gene	gene with protein product		613841				19029251	Standard	NM_173569		Approved	FLJ25778, KIAA2030	uc011kqr.2	Q6ZU65	OTTHUMG00000157623	ENST00000473989.3:c.858A>G	chr7.hg19:g.138944069A>G		100.0	0.0		86.0	5.0	NM_173569	A4D1S2|Q2YDY4|Q6P1K0|Q86XN9|Q8N7D1	Silent	SNP	ENST00000473989.3	hg19	CCDS43655.2	.	.	.	.	.	.	.	.	.	.	A	10.22	1.290846	0.23564	.	.	ENSG00000157741	ENST00000483726	.	.	.	5.34	1.57	0.23409	.	.	.	.	.	T	0.46112	0.1376	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24941	-1.0146	4	.	.	.	-9.0277	3.8046	0.08771	0.6043:0.0:0.2474:0.1483	.	.	.	.	R	55	.	.	K	+	2	0	UBN2	138594609	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	0.340000	0.19892	0.177000	0.19895	0.528000	0.53228	AAG	.	.		0.398	UBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349272.3	NM_173569	
GIMAP4	55303	hgsc.bcm.edu	37	7	150269812	150269812	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:150269812A>G	ENST00000255945.2	+	3	829	c.654A>G	c.(652-654)gaA>gaG	p.E218E	GIMAP4_ENST00000461940.1_Silent_p.E232E|GIMAP4_ENST00000494750.1_3'UTR	NM_018326.2	NP_060796.1	Q9NUV9	GIMA4_HUMAN	GTPase, IMAP family member 4	218	AIG1-type G.					cytosol (GO:0005829)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(82;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		AGAACAAGGAAGGCTGCTACA	0.552																																					p.E218E		Atlas-SNP	.											.	GIMAP4	61	.	0			c.A654G						.						97.0	92.0	94.0					7																	150269812		2203	4300	6503	SO:0001819	synonymous_variant	55303	exon3			CAAGGAAGGCTGC	AK001972	CCDS5904.1	7q36.1	2014-04-04			ENSG00000133574	ENSG00000133574		"""GTPases, IMAP"""	21872	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 1"""	608087				15474311, 18701445	Standard	NM_018326		Approved	HIMAP4, FLJ11110, IMAP4, IAN1	uc003whl.3	Q9NUV9	OTTHUMG00000157475	ENST00000255945.2:c.654A>G	chr7.hg19:g.150269812A>G		90.0	0.0		134.0	7.0	NM_018326		Silent	SNP	ENST00000255945.2	hg19	CCDS5904.1																																																																																			.	.		0.552	GIMAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348927.1	NM_018326	
NOS3	4846	hgsc.bcm.edu	37	7	150704003	150704003	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:150704003T>C	ENST00000297494.3	+	16	2204	c.1847T>C	c.(1846-1848)aTc>aCc	p.I616T	NOS3_ENST00000461406.1_Missense_Mutation_p.I410T	NM_000603.4	NP_000594.2	P60323	NANO3_HUMAN	nitric oxide synthase 3 (endothelial cell)	0					germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic signaling pathway (GO:2001234)|oogenesis (GO:0048477)|regulation of cell cycle (GO:0051726)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			NS(3)|breast(3)|central_nervous_system(5)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(11)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	50	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TTCAACAGCATCTCCTGCTCA	0.607																																					p.I616T		Atlas-SNP	.											.	NOS3	131	.	0			c.T1847C						.						107.0	99.0	102.0					7																	150704003		2203	4300	6503	SO:0001583	missense	4846	exon16			ACAGCATCTCCTG		CCDS5912.1, CCDS55182.1, CCDS55183.1	7q36	2007-02-15			ENSG00000164867	ENSG00000164867	1.14.13.39		7876	protein-coding gene	gene with protein product	"""endothelial nitric oxide synthase"""	163729				1379542	Standard	NM_000603		Approved	ECNOS, eNOS	uc003wif.3	P29474	OTTHUMG00000158343	ENST00000297494.3:c.1847T>C	chr7.hg19:g.150704003T>C	ENSP00000297494:p.Ile616Thr	189.0	0.0		207.0	9.0	NM_000603	Q495E5	Missense_Mutation	SNP	ENST00000297494.3	hg19	CCDS5912.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.945880	0.53079	.	.	ENSG00000164867	ENST00000297494;ENST00000461406	T;T	0.58358	0.34;0.34	5.14	5.14	0.70334	Flavodoxin/nitric oxide synthase (2);	0.116551	0.35903	N	0.002904	T	0.42200	0.1192	L	0.29908	0.895	0.80722	D	1	B;B	0.19331	0.011;0.035	B;B	0.25987	0.063;0.065	T	0.27123	-1.0083	10	0.29301	T	0.29	-10.0815	13.2187	0.59875	0.0:0.0:0.0:1.0	.	410;616	E7ESA7;P29474	.;NOS3_HUMAN	T	616;410	ENSP00000297494:I616T;ENSP00000417143:I410T	ENSP00000297494:I616T	I	+	2	0	NOS3	150334936	1.000000	0.71417	0.978000	0.43139	0.980000	0.70556	7.001000	0.76297	2.066000	0.61787	0.491000	0.48974	ATC	.	.		0.607	NOS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350750.2	NM_000603	
CHPF2	54480	hgsc.bcm.edu	37	7	150935431	150935431	+	Silent	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:150935431G>C	ENST00000035307.2	+	4	3496	c.1983G>C	c.(1981-1983)ggG>ggC	p.G661G	MIR671_ENST00000390183.1_RNA|RP4-548D19.3_ENST00000607902.1_RNA|CHPF2_ENST00000495645.1_Silent_p.G653G	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	661					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						CTCCTATAGGGGGGAGATTTG	0.701																																					p.G661G		Atlas-SNP	.											.	CHPF2	52	.	0			c.G1983C						.						9.0	13.0	11.0					7																	150935431		2184	4268	6452	SO:0001819	synonymous_variant	54480	exon4			TATAGGGGGGAGA	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.1983G>C	chr7.hg19:g.150935431G>C		71.0	0.0		88.0	4.0	NM_019015	B2DBD8|Q6P2I4|Q6UXD2	Silent	SNP	ENST00000035307.2	hg19	CCDS34779.1																																																																																			.	.		0.701	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
SMARCD3	6604	hgsc.bcm.edu	37	7	150939255	150939255	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:150939255C>T	ENST00000262188.8	-	6	1053	c.643G>A	c.(643-645)Gat>Aat	p.D215N	SMARCD3_ENST00000477169.1_5'UTR|RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000392811.2_Missense_Mutation_p.D202N|SMARCD3_ENST00000356800.2_Missense_Mutation_p.D202N	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	215					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCATAAAGATCTTTGTCCAGC	0.542																																					p.D215N		Atlas-SNP	.											.	SMARCD3	92	.	0			c.G643A						.						103.0	108.0	106.0					7																	150939255		2203	4300	6503	SO:0001583	missense	6604	exon6			AAAGATCTTTGTC	U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.643G>A	chr7.hg19:g.150939255C>T	ENSP00000262188:p.Asp215Asn	99.0	0.0		124.0	5.0	NM_001003801	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	ENST00000262188.8	hg19	CCDS34780.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453643	0.84209	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.50001	0.76;0.76;0.76	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.59824	0.2222	L	0.39898	1.24	0.80722	D	1	D;D;D;B	0.67145	0.993;0.972;0.996;0.049	D;P;D;B	0.74674	0.984;0.83;0.981;0.065	T	0.58008	-0.7712	10	0.41790	T	0.15	-13.6949	16.2661	0.82579	0.0:1.0:0.0:0.0	.	215;215;202;215	B7Z4U8;B7ZA58;Q6STE5-2;Q6STE5	.;.;.;SMRD3_HUMAN	N	215;202;202;167	ENSP00000262188:D215N;ENSP00000376558:D202N;ENSP00000349254:D202N	ENSP00000262188:D215N	D	-	1	0	SMARCD3	150570188	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.818000	0.86416	2.423000	0.82170	0.561000	0.74099	GAT	.	.		0.542	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348825.1	NM_001003801	
KMT2C	58508	hgsc.bcm.edu	37	7	151919143	151919143	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr7:151919143A>G	ENST00000262189.6	-	22	3660	c.3442T>C	c.(3442-3444)Tca>Cca	p.S1148P	KMT2C_ENST00000355193.2_Missense_Mutation_p.S1148P	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1148					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										CAGCAGTCTGAGGAAGGCACT	0.274																																					p.S1148P		Atlas-SNP	.											.	MLL3	1564	.	0			c.T3442C						.						53.0	60.0	58.0					7																	151919143		2198	4294	6492	SO:0001583	missense	58508	exon22			AGTCTGAGGAAGG	AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.3442T>C	chr7.hg19:g.151919143A>G	ENSP00000262189:p.Ser1148Pro	76.0	0.0		63.0	4.0	NM_170606	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	ENST00000262189.6	hg19	CCDS5931.1	.	.	.	.	.	.	.	.	.	.	A	12.32	1.903787	0.33628	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	D;D	0.83837	-1.77;-1.76	5.58	5.58	0.84498	.	0.202603	0.24542	N	0.037639	T	0.79299	0.4422	N	0.19112	0.55	0.80722	D	1	P;D	0.64830	0.93;0.994	P;P	0.56088	0.462;0.791	T	0.76490	-0.2940	10	0.25751	T	0.34	.	10.2621	0.43434	0.8529:0.0:0.0:0.1471	.	1148;209	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	P	1148	ENSP00000262189:S1148P;ENSP00000347325:S1148P	ENSP00000262189:S1148P	S	-	1	0	MLL3	151550076	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.252000	0.58785	2.119000	0.64992	0.528000	0.53228	TCA	.	.		0.274	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000318887.3		
DEFA4	1669	hgsc.bcm.edu	37	8	6794324	6794324	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:6794324T>C	ENST00000297435.2	-	2	222	c.98A>G	c.(97-99)gAg>gGg	p.E33G		NM_001925.1	NP_001916.1	P12838	DEF4_HUMAN	defensin, alpha 4, corticostatin	33					antibacterial humoral response (GO:0019731)|defense response to fungus (GO:0050832)|innate immune response (GO:0045087)|killing of cells of other organism (GO:0031640)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	10				COAD - Colon adenocarcinoma(149;0.0572)|READ - Rectum adenocarcinoma(644;0.121)		CCCACGCTGCTCCTGGCCTGG	0.552																																					p.E33G		Atlas-SNP	.											.	DEFA4	19	.	0			c.A98G						.						74.0	70.0	71.0					8																	6794324		2203	4300	6503	SO:0001583	missense	1669	exon2			CGCTGCTCCTGGC	X65977	CCDS5961.1	8p23.1	2007-02-20			ENSG00000164821	ENSG00000164821		"""Defensins, alpha"""	2763	protein-coding gene	gene with protein product		601157		DEF4		8469233	Standard	NM_001925		Approved	HP-4	uc003wqu.1	P12838	OTTHUMG00000090382	ENST00000297435.2:c.98A>G	chr8.hg19:g.6794324T>C	ENSP00000297435:p.Glu33Gly	74.0	0.0		118.0	5.0	NM_001925	Q6EZF8	Missense_Mutation	SNP	ENST00000297435.2	hg19	CCDS5961.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033554	0.35893	.	.	ENSG00000164821	ENST00000297435	T	0.37411	1.2	1.66	1.66	0.24008	Defensin propeptide (1);	0.601645	0.12414	U	0.471030	T	0.51873	0.1700	.	.	.	0.09310	N	1	D	0.89917	1.0	D	0.78314	0.991	T	0.28202	-1.0051	9	0.87932	D	0	.	5.4467	0.16539	0.0:0.0:0.0:1.0	.	33	P12838	DEF4_HUMAN	G	33	ENSP00000297435:E33G	ENSP00000297435:E33G	E	-	2	0	DEFA4	6781734	0.001000	0.12720	0.005000	0.12908	0.020000	0.10135	0.074000	0.14662	1.014000	0.39417	0.456000	0.33151	GAG	.	.		0.552	DEFA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206754.1	NM_001925	
XPO7	23039	hgsc.bcm.edu	37	8	21848320	21848320	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:21848320A>G	ENST00000252512.9	+	18	2032		c.e18-1		XPO7_ENST00000433566.4_Splice_Site|XPO7_ENST00000434536.1_Splice_Site	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7						mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		TTTTTTCAATAGAGCGAGCAC	0.418																																					.		Atlas-SNP	.											.	XPO7	79	.	0			c.1933-2A>G						.						135.0	131.0	132.0					8																	21848320		1844	4091	5935	SO:0001630	splice_region_variant	23039	exon18			TTCAATAGAGCGA	AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1933-1A>G	chr8.hg19:g.21848320A>G		56.0	0.0		112.0	5.0	NM_015024	O94846|Q6PJK9|Q8NEK7	Splice_Site	SNP	ENST00000252512.9	hg19	CCDS47818.1	.	.	.	.	.	.	.	.	.	.	A	22.8	4.335284	0.81801	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0637	0.80856	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	XPO7	21904266	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.313000	0.96297	2.274000	0.75844	0.528000	0.53228	.	.	.		0.418	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375494.1	NM_015024	Intron
NEFM	4741	hgsc.bcm.edu	37	8	24775101	24775101	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:24775101A>G	ENST00000221166.5	+	3	2515	c.1733A>G	c.(1732-1734)gAg>gGg	p.E578G	GS1-72M22.1_ENST00000607058.1_RNA|NEFM_ENST00000518131.1_Missense_Mutation_p.E578G|NEFM_ENST00000433454.2_Missense_Mutation_p.E202G|NEFM_ENST00000437366.2_Missense_Mutation_p.E578G|NEFM_ENST00000521540.1_Intron			P07197	NFM_HUMAN	neurofilament, medium polypeptide	578	Tail.				axon cargo transport (GO:0008088)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|regulation of axon diameter (GO:0031133)	axon (GO:0030424)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)|neuromuscular junction (GO:0031594)	microtubule binding (GO:0008017)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|endometrium(7)|kidney(4)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|urinary_tract(1)	36		Prostate(55;0.157)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0197)|Epithelial(17;2.44e-10)|Colorectal(74;0.0108)|COAD - Colon adenocarcinoma(73;0.0375)		gctgaaggagaggaagccgaa	0.507																																					p.E578G		Atlas-SNP	.											.	NEFM	115	.	0			c.A1733G						.						35.0	39.0	37.0					8																	24775101		2203	4300	6503	SO:0001583	missense	4741	exon3			AAGGAGAGGAAGC	BC002421	CCDS6046.1, CCDS47831.1	8p21	2013-01-16	2008-09-19	2006-11-20	ENSG00000104722	ENSG00000104722		"""Intermediate filaments type IV"""	7734	protein-coding gene	gene with protein product		162250	"""neurofilament, medium polypeptide 150kDa"""	NEF3		1348579	Standard	NM_001105541		Approved	NFM, NF-M	uc003xed.4	P07197	OTTHUMG00000131990	ENST00000221166.5:c.1733A>G	chr8.hg19:g.24775101A>G	ENSP00000221166:p.Glu578Gly	107.0	0.0		105.0	5.0	NM_005382	B4DGN2|E9PBF7|Q4QRK6	Missense_Mutation	SNP	ENST00000221166.5	hg19	CCDS6046.1	.	.	.	.	.	.	.	.	.	.	A	1.383	-0.582978	0.03827	.	.	ENSG00000104722	ENST00000221166;ENST00000518131;ENST00000437366;ENST00000433454	D;D;D;D	0.95069	-1.88;-1.89;-1.94;-3.6	4.08	2.8	0.32819	.	0.000000	0.45867	D	0.000340	D	0.90580	0.7047	M	0.73598	2.24	0.48395	D	0.99964	B;P	0.44734	0.421;0.842	B;B	0.35859	0.08;0.212	D	0.87160	0.2214	10	0.26408	T	0.33	.	6.8428	0.23973	0.7047:0.1495:0.0:0.1457	.	578;578	E7EMV2;P07197	.;NFM_HUMAN	G	578;578;578;202	ENSP00000221166:E578G;ENSP00000427872:E578G;ENSP00000410137:E578G;ENSP00000412295:E202G	ENSP00000221166:E578G	E	+	2	0	NEFM	24831006	1.000000	0.71417	0.959000	0.39883	0.018000	0.09664	4.704000	0.61831	1.793000	0.52555	0.260000	0.18958	GAG	.	.		0.507	NEFM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254954.2	NM_005382	
NUGGC	389643	hgsc.bcm.edu	37	8	27887829	27887829	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:27887829T>C	ENST00000413272.2	-	16	2157	c.2015A>G	c.(2014-2016)gAa>gGa	p.E672G	NUGGC_ENST00000341513.6_Missense_Mutation_p.E672G	NM_001010906.1	NP_001010906.1	Q68CJ6	SLIP_HUMAN	nuclear GTPase, germinal center associated	672					cellular response to DNA damage stimulus (GO:0006974)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)										GCCCCCACCTTCGTAACAGAG	0.577																																					p.E672G		Atlas-SNP	.											.	.	.	.	0			c.A2015G						.						40.0	47.0	44.0					8																	27887829		2053	4178	6231	SO:0001583	missense	389643	exon16			CCACCTTCGTAAC	AB075870	CCDS47833.1	8p21.1	2012-06-07	2012-06-07	2012-06-07	ENSG00000189233	ENSG00000189233			33550	protein-coding gene	gene with protein product	"""speckled-like pattern in the germinal center"""		"""chromosome 8 open reading frame 80"""	C8orf80		19734146	Standard	NM_001010906		Approved	HMFN0672, SLIP-GC	uc003xgm.4	Q68CJ6	OTTHUMG00000155970	ENST00000413272.2:c.2015A>G	chr8.hg19:g.27887829T>C	ENSP00000408697:p.Glu672Gly	49.0	0.0		95.0	4.0	NM_001010906	Q6ZP73	Missense_Mutation	SNP	ENST00000413272.2	hg19	CCDS47833.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.619518	0.46736	.	.	ENSG00000189233	ENST00000413272;ENST00000341513	T;T	0.17854	2.25;2.25	5.04	5.04	0.67666	.	0.124363	0.56097	D	0.000039	T	0.28400	0.0702	L	0.34521	1.04	0.40530	D	0.980926	D	0.89917	1.0	D	0.69307	0.963	T	0.03503	-1.1030	10	0.66056	D	0.02	-26.059	11.4644	0.50230	0.0:0.0:0.0:1.0	.	672	Q68CJ6	SLIP_HUMAN	G	672	ENSP00000408697:E672G;ENSP00000345031:E672G	ENSP00000345031:E672G	E	-	2	0	C8orf80	27943748	1.000000	0.71417	0.998000	0.56505	0.024000	0.10985	4.119000	0.57891	2.011000	0.59026	0.460000	0.39030	GAA	.	.		0.577	NUGGC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000342494.1	NM_001010906	
ZNF395	55893	hgsc.bcm.edu	37	8	28210089	28210089	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:28210089C>T	ENST00000344423.5	-	6	1052		c.e6+1		ZNF395_ENST00000523202.1_Splice_Site|ZNF395_ENST00000523095.1_Splice_Site	NM_018660.2	NP_061130.1	Q9H8N7	ZN395_HUMAN	zinc finger protein 395						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(1)|kidney(5)|large_intestine(6)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		Ovarian(32;2.06e-05)		KIRC - Kidney renal clear cell carcinoma(542;0.102)|Kidney(114;0.123)|Colorectal(74;0.142)		CTCGCACATACCCCAGATGGA	0.587																																					.		Atlas-SNP	.											.	ZNF395	54	.	0			c.920+1G>A						.						126.0	109.0	115.0					8																	28210089		2203	4300	6503	SO:0001630	splice_region_variant	55893	exon7			CACATACCCCAGA	AB044750	CCDS6067.1	8p21	2008-05-02			ENSG00000186918	ENSG00000186918		"""Zinc fingers, C2H2-type"""	18737	protein-coding gene	gene with protein product		609494				14625278	Standard	NM_018660		Approved	PRF-1, HDBP2, PBF, DKFZp434K1210	uc003xgr.3	Q9H8N7	OTTHUMG00000102137	ENST00000344423.5:c.920+1G>A	chr8.hg19:g.28210089C>T		51.0	0.0		106.0	31.0	NM_018660	B3KUY7|D3DST4|Q6F6H2|Q9BY72|Q9NPB2|Q9NS57|Q9NS58|Q9NS59	Splice_Site	SNP	ENST00000344423.5	hg19	CCDS6067.1	.	.	.	.	.	.	.	.	.	.	C	19.38	3.815622	0.70912	.	.	ENSG00000186918	ENST00000344423;ENST00000523202;ENST00000523095	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4092	0.83701	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF395	28266008	1.000000	0.71417	1.000000	0.80357	0.682000	0.39822	7.608000	0.82898	2.466000	0.83321	0.561000	0.74099	.	.	.		0.587	ZNF395-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219976.1		Intron
FUT10	84750	hgsc.bcm.edu	37	8	33230111	33230111	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:33230111A>G	ENST00000327671.5	-	5	2055	c.1424T>C	c.(1423-1425)cTa>cCa	p.L475P	FUT10_ENST00000518672.1_Missense_Mutation_p.L447P|FUT10_ENST00000524021.1_Missense_Mutation_p.L447P	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	475					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		CTTGAATACTAGGCCCCAAAA	0.378																																					p.L475P		Atlas-SNP	.											.	FUT10	62	.	0			c.T1424C						.						62.0	58.0	59.0					8																	33230111		2203	4300	6503	SO:0001583	missense	84750	exon5			AATACTAGGCCCC	AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.1424T>C	chr8.hg19:g.33230111A>G	ENSP00000332757:p.Leu475Pro	121.0	0.0		140.0	6.0	NM_032664	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Missense_Mutation	SNP	ENST00000327671.5	hg19	CCDS6088.1	.	.	.	.	.	.	.	.	.	.	A	15.50	2.851326	0.51270	.	.	ENSG00000172728	ENST00000327671;ENST00000380081;ENST00000518672;ENST00000524021	T;T;T	0.40756	1.02;1.02;1.02	5.54	5.54	0.83059	.	0.211836	0.32819	N	0.005620	T	0.55986	0.1955	M	0.76574	2.34	0.37732	D	0.925325	D;D;D	0.57899	0.976;0.963;0.981	P;P;P	0.53689	0.656;0.48;0.732	T	0.63954	-0.6520	10	0.46703	T	0.11	-13.4589	13.6262	0.62165	1.0:0.0:0.0:0.0	.	525;475;517	B4E056;Q6P4F1;E7EU36	.;FUT10_HUMAN;.	P	475;517;447;447	ENSP00000332757:L475P;ENSP00000430428:L447P;ENSP00000429870:L447P	ENSP00000332757:L475P	L	-	2	0	FUT10	33349653	0.991000	0.36638	0.491000	0.27477	0.817000	0.46193	4.014000	0.57145	2.112000	0.64535	0.533000	0.62120	CTA	.	.		0.378	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376540.1	NM_032664	
TTI2	80185	hgsc.bcm.edu	37	8	33358008	33358008	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:33358008T>C	ENST00000431156.2	-	7	1878	c.1260A>G	c.(1258-1260)agA>agG	p.R420R	TTI2_ENST00000519356.1_5'UTR|TTI2_ENST00000520636.1_Splice_Site_p.R389R|MAK16_ENST00000360128.6_3'UTR|TTI2_ENST00000360742.5_Splice_Site_p.R420R	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	420																	TGCAGGAAACTCTGGAATCAG	0.408																																					p.R420R		Atlas-SNP	.											.	.	.	.	0			c.A1260G						.						79.0	72.0	75.0					8																	33358008		2203	4300	6503	SO:0001630	splice_region_variant	80185	exon7			GGAAACTCTGGAA	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1260-1A>G	chr8.hg19:g.33358008T>C		70.0	0.0		92.0	6.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Silent	SNP	ENST00000431156.2	hg19	CCDS6090.1																																																																																			.	.		0.408	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	Silent
ADAM32	203102	hgsc.bcm.edu	37	8	39091581	39091581	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:39091581T>C	ENST00000379907.4	+	16	1925	c.1798T>C	c.(1798-1800)Tct>Cct	p.S600P	ADAM32_ENST00000437682.2_Missense_Mutation_p.S501P|ADAM32_ENST00000519315.1_Missense_Mutation_p.S494P	NM_145004.5	NP_659441	Q8TC27	ADA32_HUMAN	ADAM metallopeptidase domain 32	600						integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|skin(2)	31		all_cancers(7;3e-05)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00771)|Breast(189;0.0503)	LUSC - Lung squamous cell carcinoma(45;6.2e-07)|Colorectal(1;0.00699)|READ - Rectum adenocarcinoma(1;0.146)			CAAAAATGGCTCTCAGTGTGA	0.299																																					p.S600P		Atlas-SNP	.											.	ADAM32	70	.	0			c.T1798C						.						51.0	43.0	46.0					8																	39091581		1806	4030	5836	SO:0001583	missense	203102	exon16			AATGGCTCTCAGT	BC026085	CCDS47846.1	8p11.22	2005-08-18	2005-08-18		ENSG00000197140	ENSG00000197140		"""ADAM metallopeptidase domain containing"""	15479	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 32"""			12568724	Standard	NM_145004		Approved		uc003xmt.4	Q8TC27	OTTHUMG00000164071	ENST00000379907.4:c.1798T>C	chr8.hg19:g.39091581T>C	ENSP00000369238:p.Ser600Pro	69.0	0.0		81.0	4.0	NM_145004	Q8TC42	Missense_Mutation	SNP	ENST00000379907.4	hg19	CCDS47846.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.663685	0.47572	.	.	ENSG00000197140	ENST00000437682;ENST00000519315;ENST00000379907	T;T;T	0.03413	3.94;4.0;4.33	5.0	-7.23	0.01480	ADAM, cysteine-rich (1);	2.562630	0.02191	N	0.061394	T	0.07683	0.0193	M	0.64997	1.995	0.09310	N	1	D;D;P	0.61080	0.989;0.974;0.928	P;P;P	0.50791	0.648;0.601;0.65	T	0.47328	-0.9126	10	0.87932	D	0	.	6.7453	0.23458	0.4605:0.0:0.3779:0.1616	.	501;494;600	E7EPX8;E7ER82;Q8TC27	.;.;ADA32_HUMAN	P	501;494;600	ENSP00000405978:S501P;ENSP00000429422:S494P;ENSP00000369238:S600P	ENSP00000369238:S600P	S	+	1	0	ADAM32	39210738	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-1.038000	0.03553	-0.884000	0.03976	-0.451000	0.05528	TCT	.	.		0.299	ADAM32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377089.1	NM_145004	
IDO2	169355	hgsc.bcm.edu	37	8	39836687	39836687	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:39836687A>G	ENST00000389060.4	+	3	297	c.297A>G	c.(295-297)ggA>ggG	p.G99G	IDO2_ENST00000343295.4_3'UTR|RP11-44K6.3_ENST00000517623.1_RNA|IDO2_ENST00000502986.2_Silent_p.G112G			Q6ZQW0	I23O2_HUMAN	indoleamine 2,3-dioxygenase 2	99					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)|tryptophan catabolic process to kynurenine (GO:0019441)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	heme binding (GO:0020037)|indoleamine 2,3-dioxygenase activity (GO:0033754)|metal ion binding (GO:0046872)|tryptophan 2,3-dioxygenase activity (GO:0004833)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(2)|upper_aerodigestive_tract(1)	18						GGCAGGAAGGAGAGGCGCAGC	0.637																																					p.G112G		Atlas-SNP	.											.	IDO2	78	.	0			c.A336G						.						28.0	32.0	30.0					8																	39836687		2034	4189	6223	SO:0001819	synonymous_variant	169355	exon4			GGAAGGAGAGGCG	AK128691		8p11.21	2012-04-19	2009-01-07	2009-01-07	ENSG00000188676	ENSG00000188676			27269	protein-coding gene	gene with protein product		612129	"""indoleamine-pyrrole 2,3 dioxygenase-like 1"""	INDOL1			Standard	NM_194294		Approved		uc010lwy.1	Q6ZQW0	OTTHUMG00000141271	ENST00000389060.4:c.297A>G	chr8.hg19:g.39836687A>G		62.0	0.0		128.0	6.0	NM_194294	A4UD41	Silent	SNP	ENST00000389060.4	hg19																																																																																				.	.		0.637	IDO2-004	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000372742.1	NM_194294	
CHRNA6	8973	hgsc.bcm.edu	37	8	42611844	42611844	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:42611844A>G	ENST00000276410.2	-	5	853	c.498T>C	c.(496-498)ccT>ccC	p.P166P	CHRNA6_ENST00000534622.1_Silent_p.P151P|CHRNA6_ENST00000530869.1_5'Flank	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	166					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	GATGATCAAAAGGGAAAAAGG	0.363																																					p.P166P		Atlas-SNP	.											.	CHRNA6	60	.	0			c.T498C						.						133.0	133.0	133.0					8																	42611844		2203	4300	6503	SO:0001819	synonymous_variant	8973	exon5			ATCAAAAGGGAAA	U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.498T>C	chr8.hg19:g.42611844A>G		74.0	0.0		94.0	4.0	NM_004198	B2R8V4|B4DQH1	Silent	SNP	ENST00000276410.2	hg19	CCDS6135.1																																																																																			.	.		0.363	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383156.1		
THAP1	55145	hgsc.bcm.edu	37	8	42693397	42693397	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:42693397C>A	ENST00000254250.3	-	3	580	c.350G>T	c.(349-351)gGa>gTa	p.G117V	THAP1_ENST00000345117.2_Missense_Mutation_p.D52Y|THAP1_ENST00000532093.1_5'Flank	NM_018105.2	NP_060575.1	Q9NVV9	THAP1_HUMAN	THAP domain containing, apoptosis associated protein 1	117					cell cycle (GO:0007049)|endothelial cell proliferation (GO:0001935)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|lung(4)|prostate(1)|skin(1)	7	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Acute lymphoblastic leukemia(644;0.000299)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0377)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CATTAGTAATCCAATAGCAGC	0.453																																					p.G117V		Atlas-SNP	.											.	THAP1	18	.	0			c.G350T						.						115.0	129.0	124.0					8																	42693397		2203	4300	6503	SO:0001583	missense	55145	exon3			AGTAATCCAATAG	BC021721	CCDS6136.1, CCDS6137.1	8p11.1	2013-01-25			ENSG00000131931	ENSG00000131931		"""THAP (C2CH-type zinc finger) domain containing"""	20856	protein-coding gene	gene with protein product		609520	"""dystonia 6, torsion (autosomal dominant)"""	DYT6		12575992, 12717420, 19182804	Standard	NM_018105		Approved	FLJ10477, 4833431A01Rik	uc003xpk.3	Q9NVV9	OTTHUMG00000165276	ENST00000254250.3:c.350G>T	chr8.hg19:g.42693397C>A	ENSP00000254250:p.Gly117Val	135.0	0.0		124.0	66.0	NM_018105	A6NCB6|D3DSY5|H9KV49|Q53FQ1|Q6IA99	Missense_Mutation	SNP	ENST00000254250.3	hg19	CCDS6136.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.73|13.73	2.325825|2.325825	0.41197|0.41197	.|.	.|.	ENSG00000131931|ENSG00000131931	ENST00000345117|ENST00000254250	D|D	0.97575|0.97811	-4.44|-4.55	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	.|0.164655	.|0.52532	.|D	.|0.000063	D|D	0.97210|0.97210	0.9088|0.9088	.|.	.|.	.|.	0.38563|0.38563	D|D	0.949741|0.949741	.|D	.|0.59357	.|0.985	.|P	.|0.50270	.|0.636	D|D	0.96583|0.96583	0.9432|0.9432	6|9	0.87932|0.24483	D|T	0|0.36	-35.9057|-35.9057	19.7971|19.7971	0.96490|0.96490	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|117	.|Q9NVV9	.|THAP1_HUMAN	Y|V	52|117	ENSP00000344966:D52Y|ENSP00000254250:G117V	ENSP00000344966:D52Y|ENSP00000254250:G117V	D|G	-|-	1|2	0|0	THAP1|THAP1	42812554|42812554	1.000000|1.000000	0.71417|0.71417	0.967000|0.967000	0.41034|0.41034	0.978000|0.978000	0.69477|0.69477	3.393000|3.393000	0.52544|0.52544	2.757000|2.757000	0.94681|0.94681	0.585000|0.585000	0.79938|0.79938	GAT|GGA	.	.		0.453	THAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383161.1	NM_018105	
GDAP1	54332	hgsc.bcm.edu	37	8	75262703	75262703	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:75262703G>A	ENST00000220822.7	+	1	87	c.7G>A	c.(7-9)Gag>Aag	p.E3K	GDAP1_ENST00000521096.1_Intron|GDAP1_ENST00000434412.2_5'UTR|CTD-2320G14.2_ENST00000521872.1_RNA	NM_001040875.2|NM_018972.2	NP_001035808.1|NP_061845.2	Q8TB36	GDAP1_HUMAN	ganglioside induced differentiation associated protein 1	3				E -> R (in Ref. 1; CAA76892). {ECO:0000305}.	cell death (GO:0008219)|mitochondrial fission (GO:0000266)|protein targeting to mitochondrion (GO:0006626)|response to retinoic acid (GO:0032526)	integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|nucleus (GO:0005634)		p.E3K(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10	Breast(64;0.00769)	Myeloproliferative disorder(644;0.0122)	BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.104)|all cancers(69;0.234)			CAAGATGGCTGAGAGGCAGGA	0.642																																					p.E3K		Atlas-SNP	.											GDAP1,ear,malignant_melanoma,0,1	GDAP1	36	.	1	Substitution - Missense(1)	skin(1)	c.G7A						.						30.0	31.0	31.0					8																	75262703		2203	4300	6503	SO:0001583	missense	54332	exon1			ATGGCTGAGAGGC		CCDS34911.1, CCDS47877.1	8q13.3	2014-09-17	2012-02-09						15968	protein-coding gene	gene with protein product		606598	"""Charcot-Marie-Tooth neuropathy 4A"""	CMT4A		8268915, 11743579	Standard	NM_018972		Approved	CMT4	uc003yah.3	Q8TB36		ENST00000220822.7:c.7G>A	chr8.hg19:g.75262703G>A	ENSP00000220822:p.Glu3Lys	47.0	0.0		50.0	2.0	NM_018972	A8K957|E7FJF3|E7FJF4	Missense_Mutation	SNP	ENST00000220822.7	hg19	CCDS34911.1	.	.	.	.	.	.	.	.	.	.	G	2.310	-0.358159	0.05138	.	.	ENSG00000104381	ENST00000220822	D	0.98914	-5.23	5.08	4.21	0.49690	.	0.798663	0.11092	N	0.600649	D	0.94315	0.8173	N	0.08118	0	0.47153	D	0.999334	B	0.02656	0.0	B	0.01281	0.0	D	0.89313	0.3634	10	0.11485	T	0.65	.	11.907	0.52717	0.0:0.641:0.359:0.0	.	3	Q8TB36	GDAP1_HUMAN	K	3	ENSP00000220822:E3K	ENSP00000220822:E3K	E	+	1	0	GDAP1	75425258	0.879000	0.30193	0.946000	0.38457	0.369000	0.29798	0.716000	0.25836	1.360000	0.45960	-0.165000	0.13383	GAG	.	.		0.642	GDAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379061.1	NM_018972	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617351	77617351	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:77617351C>T	ENST00000521891.2	+	2	1476	c.1028C>T	c.(1027-1029)tCt>tTt	p.S343F	ZFHX4_ENST00000050961.6_Missense_Mutation_p.S343F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.S343F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.S343F|ZFHX4_ENST00000517683.1_Intron	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAATCCACTTCTGTTTATCCC	0.433										HNSCC(33;0.089)																											p.S343F		Atlas-SNP	.											.	ZFHX4	878	.	0			c.C1028T						.						111.0	105.0	107.0					8																	77617351		1819	4089	5908	SO:0001583	missense	79776	exon2			CCACTTCTGTTTA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1028C>T	chr8.hg19:g.77617351C>T	ENSP00000430497:p.Ser343Phe	57.0	0.0		64.0	5.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	13.84	2.357254	0.41801	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.49720	0.77;0.82;0.79;0.78	5.53	5.53	0.82687	.	0.000000	0.44285	U	0.000474	T	0.56731	0.2005	N	0.20685	0.6	0.80722	D	1	D;D;D;B	0.76494	0.998;0.999;0.999;0.012	D;D;D;B	0.83275	0.991;0.996;0.996;0.005	T	0.56625	-0.7948	10	0.44086	T	0.13	.	19.6556	0.95837	0.0:1.0:0.0:0.0	.	343;343;343;343	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	343	ENSP00000430497:S343F;ENSP00000399605:S343F;ENSP00000050961:S343F;ENSP00000430848:S343F	ENSP00000050961:S343F	S	+	2	0	ZFHX4	77779906	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.127000	0.77210	2.882000	0.98803	0.655000	0.94253	TCT	.	.		0.433	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
RAD54B	25788	hgsc.bcm.edu	37	8	95384468	95384468	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:95384468A>G	ENST00000336148.5	-	15	2787	c.2663T>C	c.(2662-2664)tTt>tCt	p.F888S	RAD54B_ENST00000519348.1_5'UTR	NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	888					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			TCTTTCAAGAAAAGGATCTGT	0.363								Direct reversal of damage;Homologous recombination																													p.F888S		Atlas-SNP	.											.	RAD54B	88	.	0			c.T2663C						.						67.0	64.0	65.0					8																	95384468		2203	4300	6503	SO:0001583	missense	25788	exon15			TCAAGAAAAGGAT	AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.2663T>C	chr8.hg19:g.95384468A>G	ENSP00000336606:p.Phe888Ser	76.0	0.0		92.0	4.0	NM_012415	F6WBS8	Missense_Mutation	SNP	ENST00000336148.5	hg19	CCDS6262.1	.	.	.	.	.	.	.	.	.	.	A	18.02	3.530772	0.64860	.	.	ENSG00000197275	ENST00000336148;ENST00000546218	D	0.88586	-2.4	5.65	5.65	0.86999	.	0.050385	0.85682	D	0.000000	D	0.82976	0.5154	L	0.27053	0.805	0.80722	D	1	P	0.50156	0.932	B	0.41813	0.367	T	0.82538	-0.0407	10	0.28530	T	0.3	-25.1253	15.8801	0.79197	1.0:0.0:0.0:0.0	.	888	Q9Y620	RA54B_HUMAN	S	888;560	ENSP00000336606:F888S	ENSP00000336606:F888S	F	-	2	0	RAD54B	95453644	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	4.096000	0.57734	2.166000	0.68216	0.460000	0.39030	TTT	.	.		0.363	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257806.3	NM_012415	
FSBP	100861412	hgsc.bcm.edu	37	8	95449096	95449096	+	Start_Codon_SNP	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:95449096T>C	ENST00000481490.2	-	1	74	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	RAD54B_ENST00000297592.5_Intron|RAD54B_ENST00000336148.5_Intron	NM_001256141.1	NP_001243070.1	O95073	FSBP_HUMAN	fibrinogen silencer binding protein	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)											TTTCCTACCATTGTTCTTTTC	0.388																																					p.M1V		Atlas-SNP	.											.	FSBP	1	.	0			c.A1G						.																																			SO:0001582	initiator_codon_variant	100861412	exon1			CTACCATTGTTCT		CCDS59106.1	8q22.1	2012-08-13			ENSG00000265817	ENSG00000265817			43653	protein-coding gene	gene with protein product						20531236	Standard	NM_001256141		Approved		uc003ygm.3	O95073	OTTHUMG00000178341	ENST00000481490.2:c.1A>G	chr8.hg19:g.95449096T>C	ENSP00000420405:p.Met1Val	143.0	0.0		189.0	50.0	NM_001256141	Q8N4S5	Missense_Mutation	SNP	ENST00000481490.2	hg19	CCDS59106.1	.	.	.	.	.	.	.	.	.	.	T	10.07	1.249386	0.22880	.	.	ENSG00000197275	ENST00000481490	T	0.55234	0.53	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.69133	0.3077	.	.	.	0.80722	D	1	P	0.49447	0.924	P	0.57776	0.827	T	0.73665	-0.3911	9	0.87932	D	0	-9.7135	15.5617	0.76253	0.0:0.0:0.0:1.0	.	1	O95073	FSBP_HUMAN	V	1	ENSP00000420405:M1V	ENSP00000420405:M1V	M	-	1	0	RAD54B	95518272	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.655000	0.83696	2.147000	0.66899	0.533000	0.62120	ATG	.	.		0.388	FSBP-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000441631.1	NM_001256141	Missense_Mutation
SPAG1	6674	hgsc.bcm.edu	37	8	101252681	101252681	+	Missense_Mutation	SNP	G	G	C	rs150966245	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:101252681G>C	ENST00000388798.2	+	18	2522	c.2331G>C	c.(2329-2331)atG>atC	p.M777I	SPAG1_ENST00000251809.3_Missense_Mutation_p.M777I	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	777			M -> T (in dbSNP:rs6511). {ECO:0000269|PubMed:11517287}.		axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)	p.M777I(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AGGTCTCCATGGGATGCCTTG	0.488																																					p.M777I		Atlas-SNP	.											SPAG1,pharynx,carcinoma,0,1	SPAG1	80	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G2331C						.						82.0	89.0	87.0					8																	101252681		2203	4300	6503	SO:0001583	missense	6674	exon18			CTCCATGGGATGC	AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.2331G>C	chr8.hg19:g.101252681G>C	ENSP00000373450:p.Met777Ile	65.0	0.0		91.0	0.0	NM_003114	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	hg19	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	G	10.17	1.276558	0.23307	.	.	ENSG00000104450	ENST00000251809;ENST00000388798	T;T	0.60171	0.21;0.21	5.68	-11.4	0.00090	.	1.659360	0.03303	N	0.189258	T	0.33556	0.0867	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.09997	-1.0649	10	0.25106	T	0.35	2.3277	5.144	0.14975	0.1545:0.2189:0.4807:0.146	.	777	Q07617	SPAG1_HUMAN	I	777	ENSP00000251809:M777I;ENSP00000373450:M777I	ENSP00000251809:M777I	M	+	3	0	SPAG1	101321857	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.832000	0.00743	-3.203000	0.00216	-1.334000	0.01262	ATG	.	G|0.997;A|0.003		0.488	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218	
LRP12	29967	hgsc.bcm.edu	37	8	105503084	105503084	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:105503084G>A	ENST00000276654.5	-	7	2505	c.2397C>T	c.(2395-2397)gcC>gcT	p.A799A	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Silent_p.A780A	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	799					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGATCTGAGGCAAGATCAA	0.438																																					p.A799A		Atlas-SNP	.											.	LRP12	124	.	0			c.C2397T						.						161.0	132.0	142.0					8																	105503084		2203	4300	6503	SO:0001819	synonymous_variant	29967	exon7			ATCTGAGGCAAGA	AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.2397C>T	chr8.hg19:g.105503084G>A		131.0	0.0		159.0	37.0	NM_013437	A8K137|B4DRQ2	Silent	SNP	ENST00000276654.5	hg19	CCDS6303.1																																																																																			.	.		0.438	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000380821.1	NM_013437	
CSMD3	114788	hgsc.bcm.edu	37	8	113585826	113585826	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:113585826G>T	ENST00000297405.5	-	24	4190	c.3946C>A	c.(3946-3948)Cgc>Agc	p.R1316S	CSMD3_ENST00000343508.3_Missense_Mutation_p.R1276S|CSMD3_ENST00000455883.2_Missense_Mutation_p.R1212S|CSMD3_ENST00000352409.3_Missense_Mutation_p.R1316S	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1316	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTCAGTCCGCGCATAGATGCA	0.348										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R1316S		Atlas-SNP	.											CSMD3_ENST00000343508,NS,carcinoma,0,2	CSMD3	2325	.	0			c.C3946A						.						123.0	124.0	123.0					8																	113585826		2203	4300	6503	SO:0001583	missense	114788	exon24			GTCCGCGCATAGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3946C>A	chr8.hg19:g.113585826G>T	ENSP00000297405:p.Arg1316Ser	116.0	0.0		131.0	34.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	10.67	1.415716	0.25552	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.27557	1.66;1.66;1.66;1.66;1.66	4.85	-2.53	0.06326	CUB (5);	0.191183	0.33572	N	0.004775	T	0.22085	0.0532	N	0.10760	0.04	0.25265	N	0.98957	P;P;D	0.53619	0.706;0.75;0.961	B;P;P	0.51582	0.421;0.557;0.674	T	0.34700	-0.9818	10	0.19147	T	0.46	.	18.8933	0.92413	0.0:0.0:0.2404:0.7596	.	1212;1316;1276	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	S	1276;1316;656;1212;1316	ENSP00000345799:R1276S;ENSP00000297405:R1316S;ENSP00000341558:R656S;ENSP00000412263:R1212S;ENSP00000343124:R1316S	ENSP00000297405:R1316S	R	-	1	0	CSMD3	113655002	0.485000	0.25972	0.985000	0.45067	0.986000	0.74619	-0.233000	0.09041	-0.337000	0.08426	0.591000	0.81541	CGC	.	.		0.348	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
TATDN1	83940	hgsc.bcm.edu	37	8	125498418	125498418	+	IGR	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:125498418G>T	ENST00000276692.6	-	0	1018				RNF139_ENST00000303545.3_Missense_Mutation_p.E176D|RP11-158K1.3_ENST00000518639.1_RNA	NM_032026.3	NP_114415.1	Q6P1N9	TATD1_HUMAN	TatD DNase domain containing 1						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(2)|upper_aerodigestive_tract(1)	15	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			ACATCAGAGAGACTTTACTGT	0.353																																					p.E176D		Atlas-SNP	.											.	RNF139	57	.	0			c.G528T						.						143.0	141.0	142.0					8																	125498418		2203	4300	6503	SO:0001628	intergenic_variant	11236	exon2			CAGAGAGACTTTA	AF212250	CCDS6351.1, CCDS55273.1	8q24.13	2004-06-07			ENSG00000147687	ENSG00000147687			24220	protein-coding gene	gene with protein product						12477932	Standard	NM_032026		Approved	CDA11	uc003yrd.2	Q6P1N9	OTTHUMG00000165068		chr8.hg19:g.125498418G>T		120.0	0.0		192.0	104.0	NM_007218	B2R5J0|Q8TD02|Q9BY40	Missense_Mutation	SNP	ENST00000276692.6	hg19	CCDS6351.1	.	.	.	.	.	.	.	.	.	.	G	7.633	0.679177	0.14907	.	.	ENSG00000170881	ENST00000303545;ENST00000517684	T	0.23754	1.89	5.34	4.45	0.53987	.	0.059734	0.64402	D	0.000003	T	0.13927	0.0337	N	0.14661	0.345	0.32414	N	0.550302	B	0.33777	0.425	B	0.34418	0.182	T	0.11665	-1.0578	10	0.21540	T	0.41	-13.5081	9.5266	0.39169	0.2098:0.0:0.7902:0.0	.	176	Q8WU17	RN139_HUMAN	D	176;49	ENSP00000304051:E176D	ENSP00000304051:E176D	E	+	3	2	RNF139	125567599	1.000000	0.71417	1.000000	0.80357	0.526000	0.34562	2.903000	0.48711	2.642000	0.89623	0.650000	0.86243	GAG	.	.		0.353	TATDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381655.1	NM_032026	
CYP11B2	1585	hgsc.bcm.edu	37	8	143996601	143996601	+	Missense_Mutation	SNP	C	C	G	rs552105650		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:143996601C>G	ENST00000323110.2	-	3	458	c.456G>C	c.(454-456)aaG>aaC	p.K152N		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	152					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	TCTGCACGGCCTTGGGCGACA	0.642									Familial Hyperaldosteronism type I				.|||	1	0.000199681	0.0	0.0	5008	,	,		19898	0.0		0.0	False		,,,				2504	0.001				p.K152N		Atlas-SNP	.											.	CYP11B2	107	.	0			c.G456C						.						62.0	52.0	55.0					8																	143996601		2203	4300	6503	SO:0001583	missense	1585	exon3	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	CACGGCCTTGGGC	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.456G>C	chr8.hg19:g.143996601C>G	ENSP00000325822:p.Lys152Asn	194.0	0.0		294.0	23.0	NM_000498	B0ZBE4|Q16726	Missense_Mutation	SNP	ENST00000323110.2	hg19	CCDS6393.1	.	.	.	.	.	.	.	.	.	.	.	8.417	0.845455	0.16963	.	.	ENSG00000179142	ENST00000323110	T	0.69685	-0.42	3.44	-4.07	0.03975	.	0.994613	0.08154	N	0.989473	T	0.56156	0.1966	L	0.58810	1.83	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.51212	-0.8734	10	0.56958	D	0.05	.	5.076	0.14632	0.2202:0.1889:0.0:0.5909	.	152	P19099	C11B2_HUMAN	N	152	ENSP00000325822:K152N	ENSP00000325822:K152N	K	-	3	2	CYP11B2	143993603	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.715000	0.04997	-0.723000	0.04915	-0.258000	0.10820	AAG	.	.		0.642	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359904.1		
COMMD5	28991	hgsc.bcm.edu	37	8	146076709	146076709	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:146076709C>T	ENST00000305103.3	-	2	267	c.15G>A	c.(13-15)ggG>ggA	p.G5G	ZNF250_ENST00000543949.1_3'UTR|AF235103.1_ENST00000578937.1_RNA|COMMD5_ENST00000450361.2_Silent_p.G5G|COMMD5_ENST00000402718.3_Silent_p.G5G	NM_014066.3	NP_054785.2	Q9GZQ3	COMD5_HUMAN	COMM domain containing 5	5						nucleus (GO:0005634)		p.G5G(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|ovary(1)|pancreas(1)	11	all_cancers(97;1.14e-11)|all_epithelial(106;7.74e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;8.75e-39)|OV - Ovarian serous cystadenocarcinoma(54;1.13e-38)|all cancers(56;8.48e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)			GAGTTGCAGCCCCCACAGCAG	0.597																																					p.G5G		Atlas-SNP	.											COMMD5,colon,carcinoma,0,2	COMMD5	18	.	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)	c.G15A						.						63.0	66.0	65.0					8																	146076709		2203	4300	6503	SO:0001819	synonymous_variant	28991	exon2			TGCAGCCCCCACA	AK023070	CCDS6436.1	8q24.3	2006-11-06				ENSG00000170619			17902	protein-coding gene	gene with protein product		608216				15799966, 10918053	Standard	NM_014066		Approved	HT002, FLJ13008, HCaRG	uc003zem.3	Q9GZQ3		ENST00000305103.3:c.15G>A	chr8.hg19:g.146076709C>T		249.0	0.0		386.0	0.0	NM_001081004	D3DWN7|Q9NVN6|Q9UHX5	Silent	SNP	ENST00000305103.3	hg19	CCDS6436.1																																																																																			.	.		0.597	COMMD5-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000382962.1	NM_014066	
DOCK8	81704	hgsc.bcm.edu	37	9	334272	334272	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:334272C>G	ENST00000453981.1	+	11	1285	c.1173C>G	c.(1171-1173)tgC>tgG	p.C391W	DOCK8_ENST00000432829.2_Missense_Mutation_p.C323W|DOCK8_ENST00000469391.1_Missense_Mutation_p.C323W			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	391					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		AATCCTTCTGCCAGCGTTTGG	0.453																																					p.C391W		Atlas-SNP	.											.	DOCK8	401	.	0			c.C1173G						.						91.0	88.0	89.0					9																	334272		2203	4300	6503	SO:0001583	missense	81704	exon11			CTTCTGCCAGCGT	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1173C>G	chr9.hg19:g.334272C>G	ENSP00000408464:p.Cys391Trp	86.0	0.0		118.0	5.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	C	19.36	3.812358	0.70912	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391	T;T;T	0.03635	3.86;3.86;3.86	5.87	5.87	0.94306	.	0.086767	0.85682	D	0.000000	T	0.21962	0.0529	M	0.89715	3.055	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.982	T	0.00170	-1.1961	10	0.87932	D	0	.	11.5446	0.50685	0.0:0.8931:0.0:0.1069	.	323;391	E9PH09;Q8NF50	.;DOCK8_HUMAN	W	391;391;323;323	ENSP00000408464:C391W;ENSP00000394888:C323W;ENSP00000419438:C323W	ENSP00000287364:C391W	C	+	3	2	DOCK8	324272	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.747000	0.26290	2.941000	0.99782	0.655000	0.94253	TGC	.	.		0.453	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
KANK1	23189	hgsc.bcm.edu	37	9	713074	713074	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:713074T>C	ENST00000382303.1	+	7	2960	c.2308T>C	c.(2308-2310)Tat>Cat	p.Y770H	KANK1_ENST00000382297.2_Missense_Mutation_p.Y770H|KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_Missense_Mutation_p.Y612H	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	770					negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TAACGACAACTATCTGGTTGG	0.522																																					p.Y770H		Atlas-SNP	.											.	KANK1	231	.	0			c.T2308C						.						90.0	92.0	91.0					9																	713074		2203	4300	6503	SO:0001583	missense	23189	exon7			GACAACTATCTGG	AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.2308T>C	chr9.hg19:g.713074T>C	ENSP00000371740:p.Tyr770His	109.0	0.0		106.0	40.0	NM_001256876	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Missense_Mutation	SNP	ENST00000382303.1	hg19	CCDS34976.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.642458	0.87859	.	.	ENSG00000107104	ENST00000382303;ENST00000354485;ENST00000382297;ENST00000382293	T;T;T	0.18016	2.24;2.24;2.24	5.97	5.97	0.96955	.	0.000000	0.51477	D	0.000094	T	0.41488	0.1161	M	0.67953	2.075	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.71184	0.972;0.909	T	0.23833	-1.0177	10	0.87932	D	0	-12.1515	16.4608	0.84044	0.0:0.0:0.0:1.0	.	770;770	Q5W0W1;Q14678	.;KANK1_HUMAN	H	770;770;770;612	ENSP00000371740:Y770H;ENSP00000371734:Y770H;ENSP00000371730:Y612H	ENSP00000346479:Y770H	Y	+	1	0	KANK1	703074	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.950000	0.87804	2.288000	0.76882	0.533000	0.62120	TAT	.	.		0.522	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051484.2	NM_015158	
MLLT3	4300	hgsc.bcm.edu	37	9	20620823	20620823	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:20620823T>G	ENST00000380338.4	-	2	309	c.23A>C	c.(22-24)cAg>cCg	p.Q8P	MLLT3_ENST00000429426.2_Missense_Mutation_p.Q5P|MLLT3_ENST00000475957.1_5'UTR|MLLT3_ENST00000355930.6_5'UTR	NM_004529.2	NP_004520.2	P42568	AF9_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3	8	YEATS. {ECO:0000255|PROSITE- ProRule:PRU00376}.				anterior/posterior pattern specification (GO:0009952)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|regulation of transcription, DNA-templated (GO:0006355)|segment specification (GO:0007379)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)				central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(6)|lung(24)|ovary(1)|prostate(4)|skin(1)|urinary_tract(7)	66				GBM - Glioblastoma multiforme(3;4.35e-105)|Lung(42;3.48e-06)|LUSC - Lung squamous cell carcinoma(42;7.92e-05)		CAGCTTCACCTGCACGGCACA	0.612			T	MLL	ALL																																p.Q8P		Atlas-SNP	.		Dom	yes		9	9p22	4300	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 3 (AF9)"""		L	.	MLLT3	125	.	0			c.A23C						.						60.0	61.0	61.0					9																	20620823		2203	4300	6503	SO:0001583	missense	4300	exon2			TTCACCTGCACGG	L13744	CCDS6494.1	9p22	2008-02-05	2001-11-28		ENSG00000171843	ENSG00000171843			7136	protein-coding gene	gene with protein product		159558	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 3"""			8506309, 8414510	Standard	NM_001286691		Approved	AF-9, AF9, YEATS3	uc003zoe.2	P42568	OTTHUMG00000019650	ENST00000380338.4:c.23A>C	chr9.hg19:g.20620823T>G	ENSP00000369695:p.Gln8Pro	71.0	0.0		84.0	5.0	NM_004529	B1AMQ2|B2R7B3|B7Z755|D3DRJ8|Q8IVB0	Missense_Mutation	SNP	ENST00000380338.4	hg19	CCDS6494.1	.	.	.	.	.	.	.	.	.	.	T	17.32	3.358821	0.61403	.	.	ENSG00000171843	ENST00000380338;ENST00000429426;ENST00000540751	.	.	.	5.38	4.22	0.49857	.	0.085068	0.48767	D	0.000164	T	0.67887	0.2941	L	0.47716	1.5	0.80722	D	1	D;D	0.76494	0.999;0.997	D;D	0.79784	0.993;0.983	T	0.68981	-0.5266	9	0.87932	D	0	-7.8369	11.3969	0.49847	0.1357:0.0:0.0:0.8643	.	5;8	B7Z755;P42568	.;AF9_HUMAN	P	8;5;47	.	ENSP00000369695:Q8P	Q	-	2	0	MLLT3	20610823	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.029000	0.88807	0.842000	0.35045	0.459000	0.35465	CAG	.	.		0.612	MLLT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051872.1	NM_004529	
DDX58	23586	hgsc.bcm.edu	37	9	32466317	32466317	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:32466317T>C	ENST00000379883.2	-	16	2465	c.2308A>G	c.(2308-2310)Aca>Gca	p.T770A	DDX58_ENST00000379868.1_Missense_Mutation_p.T567A|DDX58_ENST00000379882.1_Missense_Mutation_p.T725A|DDX58_ENST00000542096.1_Missense_Mutation_p.T699A	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	770	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.|Interaction with ZC3HAV1.|Repressor domain.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TCGTCCCATGTCTGAAGGCGT	0.373																																					p.T770A		Atlas-SNP	.											.	DDX58	82	.	0			c.A2308G						.						222.0	210.0	214.0					9																	32466317		2203	4300	6503	SO:0001583	missense	23586	exon16			CCCATGTCTGAAG	AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.2308A>G	chr9.hg19:g.32466317T>C	ENSP00000369213:p.Thr770Ala	115.0	0.0		110.0	5.0	NM_014314	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Missense_Mutation	SNP	ENST00000379883.2	hg19	CCDS6526.1	.	.	.	.	.	.	.	.	.	.	T	2.042	-0.419821	0.04734	.	.	ENSG00000107201	ENST00000379882;ENST00000379883;ENST00000379868;ENST00000542096	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.18	-7.18	0.01505	Helicase, C-terminal (1);	1.666380	0.02946	N	0.141105	T	0.29749	0.0743	N	0.26042	0.785	0.28708	N	0.903694	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.0	T	0.31138	-0.9954	10	0.11485	T	0.65	4.5695	17.0152	0.86416	0.0:0.6194:0.0:0.3806	.	725;699;770	O95786-2;B3KWW1;O95786	.;.;DDX58_HUMAN	A	725;770;567;699	ENSP00000369212:T725A;ENSP00000369213:T770A;ENSP00000369197:T567A;ENSP00000442160:T699A	ENSP00000369197:T567A	T	-	1	0	DDX58	32456317	0.002000	0.14202	0.002000	0.10522	0.113000	0.19764	-0.618000	0.05578	-1.649000	0.01508	-0.256000	0.11100	ACA	.	.		0.373	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052011.1	NM_014314	
FXN	2395	hgsc.bcm.edu	37	9	71661353	71661353	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:71661353T>C	ENST00000377270.3	+	2	742	c.218T>C	c.(217-219)gTc>gCc	p.V73A	FXN_ENST00000498653.1_5'UTR|FXN_ENST00000396366.2_Missense_Mutation_p.V73A|FXN_ENST00000396364.3_Missense_Mutation_p.V73A	NM_000144.4	NP_000135.2	Q16595	FRDA_HUMAN	frataxin	73					adult walking behavior (GO:0007628)|aerobic respiration (GO:0009060)|cellular iron ion homeostasis (GO:0006879)|cellular response to hydrogen peroxide (GO:0070301)|embryo development ending in birth or egg hatching (GO:0009792)|heme biosynthetic process (GO:0006783)|ion transport (GO:0006811)|iron incorporation into metallo-sulfur cluster (GO:0018283)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|oxidative phosphorylation (GO:0006119)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)|proprioception (GO:0019230)|protein autoprocessing (GO:0016540)|regulation of ferrochelatase activity (GO:0010722)|response to iron ion (GO:0010039)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2 iron, 2 sulfur cluster binding (GO:0051537)|ferric iron binding (GO:0008199)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)|iron chaperone activity (GO:0034986)|iron-sulfur cluster binding (GO:0051536)			large_intestine(1)|lung(1)	2						AAGCAGAGTGTCTATTTGATG	0.418																																					p.V73A		Atlas-SNP	.											.	FXN	9	.	0			c.T218C						.						110.0	102.0	105.0					9																	71661353		2203	4300	6503	SO:0001583	missense	2395	exon2			AGAGTGTCTATTT	U43752	CCDS6626.1, CCDS43834.1, CCDS55313.1	9q21.11	2014-09-17	2004-08-16	2004-08-19	ENSG00000165060	ENSG00000165060			3951	protein-coding gene	gene with protein product		606829	"""Friedreich ataxia"""	FRDA		8596916, 8841185	Standard	NM_000144		Approved	FA, FARR, X25, CyaY	uc004aha.2	Q16595	OTTHUMG00000019977	ENST00000377270.3:c.218T>C	chr9.hg19:g.71661353T>C	ENSP00000366482:p.Val73Ala	105.0	0.0		115.0	5.0	NM_000144	A8MXJ6|C9JJ89|O15545|O95656|Q15294|Q5VZ01	Missense_Mutation	SNP	ENST00000377270.3	hg19	CCDS6626.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	4.266|4.266	0.048515|0.048515	0.08243|0.08243	.|.	.|.	ENSG00000165060|ENSG00000165060	ENST00000484259|ENST00000377270;ENST00000396364;ENST00000396366	.|D;D;D	.|0.88354	.|-2.37;-2.37;-2.37	4.94|4.94	2.57|2.57	0.30868|0.30868	.|.	.|0.391028	.|0.24409	.|N	.|0.038780	T|T	0.78786|0.78786	0.4338|0.4338	L|L	0.38175|0.38175	1.15|1.15	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.12630	.|0.005;0.002;0.006	.|B;B;B	.|0.09377	.|0.004;0.002;0.004	T|T	0.58103|0.58103	-0.7695|-0.7695	5|10	.|0.07813	.|T	.|0.8	-12.7372|-12.7372	6.9731|6.9731	0.24660|0.24660	0.0:0.1863:0.0:0.8137|0.0:0.1863:0.0:0.8137	.|.	.|73;73;73	.|Q16595-2;Q16595;A8MXJ6	.|.;FRDA_HUMAN;.	P|A	11|73	.|ENSP00000366482:V73A;ENSP00000379650:V73A;ENSP00000379652:V73A	.|ENSP00000366482:V73A	S|V	+|+	1|2	0|0	FXN|FXN	70851173|70851173	0.932000|0.932000	0.31603|0.31603	0.049000|0.049000	0.19019|0.19019	0.047000|0.047000	0.14425|0.14425	1.790000|1.790000	0.38734|0.38734	0.319000|0.319000	0.23209|0.23209	-0.421000|-0.421000	0.06004|0.06004	TCT|GTC	.	.		0.418	FXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052568.2	NM_000144	
PRUNE2	158471	hgsc.bcm.edu	37	9	79321218	79321218	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:79321218T>C	ENST00000376718.3	-	8	6095	c.5972A>G	c.(5971-5973)gAa>gGa	p.E1991G	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E1632G	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1991					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TTCTTGACCTTCATTAGTTGA	0.423																																					p.E1991G		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A5972G						.						121.0	105.0	109.0					9																	79321218		1568	3582	5150	SO:0001583	missense	158471	exon8			TGACCTTCATTAG	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.5972A>G	chr9.hg19:g.79321218T>C	ENSP00000365908:p.Glu1991Gly	99.0	0.0		87.0	4.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.21|13.21	2.168361|2.168361	0.38315|0.38315	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.53857|.	0.6;0.6|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.132018|.	0.34700|.	N|.	0.003750|.	T|.	0.72455|.	0.3462|.	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D|.	0.65815|.	0.995|.	P|.	0.57425|.	0.82|.	T|.	0.71265|.	-0.4644|.	10|.	0.87932|.	D|.	0|.	-15.6032|-15.6032	16.3305|16.3305	0.83010|0.83010	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1991|.	Q8WUY3|.	PRUN2_HUMAN|.	G|W	1991;1632;1990|1312	ENSP00000365908:E1991G;ENSP00000397425:E1632G|.	ENSP00000365908:E1991G|.	E|X	-|-	2|3	0|0	PRUNE2|PRUNE2	78511038|78511038	0.000000|0.000000	0.05858|0.05858	0.103000|0.103000	0.21229|0.21229	0.027000|0.027000	0.11550|0.11550	0.597000|0.597000	0.24059|0.24059	2.317000|2.317000	0.78254|0.78254	0.459000|0.459000	0.35465|0.35465	GAA|TGA	.	.		0.423	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
PRUNE2	158471	hgsc.bcm.edu	37	9	79322807	79322807	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:79322807C>T	ENST00000376718.3	-	8	4506	c.4383G>A	c.(4381-4383)aaG>aaA	p.K1461K	PRUNE2_ENST00000428286.1_Silent_p.K1102K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	1461					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCTCAAGATCCTTTTCAGGTA	0.428																																					p.K1461K		Atlas-SNP	.											.	PRUNE2	331	.	0			c.G4383A						.						63.0	64.0	64.0					9																	79322807		1568	3582	5150	SO:0001819	synonymous_variant	158471	exon8			AAGATCCTTTTCA	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.4383G>A	chr9.hg19:g.79322807C>T		141.0	0.0		160.0	45.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Silent	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	C	0.015	-1.539480	0.00942	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.35	2.52	0.30459	.	.	.	.	.	T	0.35480	0.0933	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.21177	-1.0253	4	.	.	.	-0.0249	8.6948	0.34289	0.0:0.6754:0.0:0.3246	.	.	.	.	R	783	.	.	G	-	1	0	PRUNE2	78512627	0.400000	0.25295	0.001000	0.08648	0.007000	0.05969	0.798000	0.27014	0.348000	0.23949	-0.258000	0.10820	GGA	.	.		0.428	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
SPATA31E1	286234	hgsc.bcm.edu	37	9	90501957	90501957	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:90501957T>C	ENST00000325643.5	+	4	2621	c.2555T>C	c.(2554-2556)cTc>cCc	p.L852P		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	852					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GGTACAGACCTCCAGTCCCTG	0.577																																					p.L852P		Atlas-SNP	.											.	.	.	.	0			c.T2555C						.						47.0	45.0	45.0					9																	90501957		2203	4300	6503	SO:0001583	missense	286234	exon4			CAGACCTCCAGTC	AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.2555T>C	chr9.hg19:g.90501957T>C	ENSP00000322640:p.Leu852Pro	67.0	0.0		111.0	7.0	NM_178828	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Missense_Mutation	SNP	ENST00000325643.5	hg19	CCDS6676.1	.	.	.	.	.	.	.	.	.	.	t	11.03	1.519447	0.27211	.	.	ENSG00000177992	ENST00000325643;ENST00000539327	T	0.06068	3.35	2.57	-0.148	0.13424	.	1.489590	0.04472	N	0.376278	T	0.13457	0.0326	L	0.41573	1.285	0.09310	N	0.999999	D;D	0.71674	0.998;0.994	D;P	0.65443	0.935;0.737	T	0.17992	-1.0351	10	0.51188	T	0.08	.	3.0452	0.06151	0.248:0.0:0.2551:0.4969	.	852;504	Q6ZUB1;Q8NA33	CI079_HUMAN;.	P	852;504	ENSP00000322640:L852P	ENSP00000322640:L852P	L	+	2	0	C9orf79	89691777	0.000000	0.05858	0.000000	0.03702	0.024000	0.10985	0.016000	0.13377	-0.032000	0.13758	0.455000	0.32223	CTC	.	.		0.577	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052954.2	NM_178828	
NFIL3	4783	hgsc.bcm.edu	37	9	94171681	94171681	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:94171681A>G	ENST00000297689.3	-	2	1730	c.1336T>C	c.(1336-1338)Tca>Cca	p.S446P		NM_005384.2	NP_005375.2	Q16649	NFIL3_HUMAN	nuclear factor, interleukin 3 regulated	446					cellular response to interleukin-4 (GO:0071353)|circadian rhythm (GO:0007623)|immune response (GO:0006955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	16						CTCTTGAGTGAGACAACCTCT	0.413																																					p.S446P	Esophageal Squamous(152;732 1832 10053 26981 51762)	Atlas-SNP	.											.	NFIL3	43	.	0			c.T1336C						.						124.0	119.0	120.0					9																	94171681		2203	4300	6503	SO:0001583	missense	4783	exon2			TGAGTGAGACAAC	X64318	CCDS6690.1	9q22	2013-01-10			ENSG00000165030	ENSG00000165030		"""basic leucine zipper proteins"""	7787	protein-coding gene	gene with protein product		605327		IL3BP1		7565758, 1620116	Standard	NM_005384		Approved	E4BP4, NFIL3A, NF-IL3A	uc004arh.3	Q16649	OTTHUMG00000020209	ENST00000297689.3:c.1336T>C	chr9.hg19:g.94171681A>G	ENSP00000297689:p.Ser446Pro	203.0	0.0		206.0	9.0	NM_005384	B2R9Y8|Q14211|Q6FGQ8|Q96HS0	Missense_Mutation	SNP	ENST00000297689.3	hg19	CCDS6690.1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.886342	0.51908	.	.	ENSG00000165030	ENST00000375724;ENST00000297689	.	.	.	5.17	5.17	0.71159	Vertebrate interleukin-3 regulated transcription factor (1);	0.221649	0.30401	N	0.009703	T	0.65606	0.2707	L	0.60455	1.87	0.37761	D	0.92631	D	0.53462	0.96	P	0.56514	0.8	T	0.72257	-0.4346	9	0.72032	D	0.01	-5.0822	10.424	0.44367	0.8545:0.0:0.0:0.1455	.	446	Q16649	NFIL3_HUMAN	P	446	.	ENSP00000297689:S446P	S	-	1	0	NFIL3	93211502	1.000000	0.71417	0.315000	0.25238	0.629000	0.37895	4.739000	0.62080	2.153000	0.67306	0.533000	0.62120	TCA	.	.		0.413	NFIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053038.2	NM_005384	
SMC2	10592	hgsc.bcm.edu	37	9	106896730	106896730	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:106896730T>C	ENST00000286398.7	+	23	3431	c.3143T>C	c.(3142-3144)cTt>cCt	p.L1048P	SMC2_ENST00000374787.3_Missense_Mutation_p.L1048P|SMC2_ENST00000374793.3_Missense_Mutation_p.L1048P|SMC2_ENST00000303219.8_Missense_Mutation_p.L1048P	NM_001042551.1|NM_001265602.1|NM_006444.2	NP_001036016.1|NP_001252531.1|NP_006435.2	O95347	SMC2_HUMAN	structural maintenance of chromosomes 2	1048					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(14)|ovary(5)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	48						TTTTCTACTCTTTTGCCTGGT	0.383																																					p.L1048P		Atlas-SNP	.											.	SMC2	127	.	0			c.T3143C						.						123.0	120.0	121.0					9																	106896730		2203	4300	6503	SO:0001583	missense	10592	exon23			CTACTCTTTTGCC	AF092563	CCDS35086.1	9q31.1	2008-05-14	2006-07-06	2006-07-06	ENSG00000136824	ENSG00000136824		"""Structural maintenance of chromosomes proteins"""	14011	protein-coding gene	gene with protein product		605576	"""SMC2 (structural maintenance of chromosomes 2, yeast)-like 1"", ""SMC2 structural maintenance of chromosomes 2-like 1 (yeast)"""	SMC2L1		9789013	Standard	NM_006444		Approved	hCAP-E, CAP-E	uc011lvl.2	O95347	OTTHUMG00000020401	ENST00000286398.7:c.3143T>C	chr9.hg19:g.106896730T>C	ENSP00000286398:p.Leu1048Pro	98.0	0.0		117.0	5.0	NM_006444	Q6IEE0|Q9P1P2	Missense_Mutation	SNP	ENST00000286398.7	hg19	CCDS35086.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.235396	0.79800	.	.	ENSG00000136824	ENST00000286398;ENST00000374793;ENST00000303219;ENST00000374787	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	5.58	5.58	0.84498	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	M	0.91249	3.19	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.53027	-0.8496	10	0.87932	D	0	-7.5375	14.5857	0.68322	0.0:0.0:0.0:1.0	.	1048	O95347	SMC2_HUMAN	P	1048	ENSP00000286398:L1048P;ENSP00000363925:L1048P;ENSP00000306152:L1048P;ENSP00000363919:L1048P	ENSP00000286398:L1048P	L	+	2	0	SMC2	105936551	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	8.040000	0.89188	2.126000	0.65437	0.397000	0.26171	CTT	.	.		0.383	SMC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053470.1		
KIAA0368	23392	hgsc.bcm.edu	37	9	114213757	114213757	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:114213757A>G	ENST00000338205.5	-	2	320	c.101T>C	c.(100-102)cTt>cCt	p.L34P	KIAA0368_ENST00000259335.4_Missense_Mutation_p.L212P			Q5VYK3	ECM29_HUMAN	KIAA0368	40					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	centrosome (GO:0005813)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|late endosome (GO:0005770)|membrane (GO:0016020)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|proteasome complex (GO:0000502)				NS(2)|breast(3)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(23)|prostate(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	65						AACAGGAGGAAGGAATTTAGA	0.353																																					p.L212P		Atlas-SNP	.											.	KIAA0368	144	.	0			c.T635C						.						60.0	56.0	57.0					9																	114213757		1834	4091	5925	SO:0001583	missense	23392	exon4			GGAGGAAGGAATT	AK025689	CCDS48006.1	9q32	2012-11-29	2006-11-23	2006-11-23	ENSG00000136813	ENSG00000136813			29020	protein-coding gene	gene with protein product	"""ECM29 homolog (S. cerevisiae)"""					9205841, 15496406, 20682791	Standard	NM_001080398		Approved	FLJ22036, ECM29	uc004bfe.1	Q5VYK3	OTTHUMG00000020489	ENST00000338205.5:c.101T>C	chr9.hg19:g.114213757A>G	ENSP00000339889:p.Leu34Pro	101.0	0.0		60.0	4.0	NM_001080398	O15074|Q8WU82	Missense_Mutation	SNP	ENST00000338205.5	hg19		.	.	.	.	.	.	.	.	.	.	A	24.1	4.497710	0.85069	.	.	ENSG00000136813	ENST00000338205;ENST00000259335	T	0.79845	-1.31	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.89529	0.6741	M	0.79011	2.435	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.90891	0.4761	10	0.87932	D	0	.	15.6977	0.77512	1.0:0.0:0.0:0.0	.	40	Q5VYK3	ECM29_HUMAN	P	34;212	ENSP00000259335:L212P	ENSP00000259335:L212P	L	-	2	0	KIAA0368	113253578	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.923000	0.92808	2.107000	0.64212	0.482000	0.46254	CTT	.	.		0.353	KIAA0368-001	NOVEL	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000053637.2	NM_014686	
DFNB31	25861	hgsc.bcm.edu	37	9	117186678	117186678	+	Missense_Mutation	SNP	C	C	G	rs117352600	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:117186678C>G	ENST00000362057.3	-	6	1520	c.1352G>C	c.(1351-1353)gGt>gCt	p.G451A	DFNB31_ENST00000265134.6_Missense_Mutation_p.G68A|DFNB31_ENST00000374059.3_Missense_Mutation_p.G100A	NM_001173425.1|NM_015404.3	NP_001166896.1|NP_056219	Q9P202	WHRN_HUMAN	deafness, autosomal recessive 31	451					inner ear receptor stereocilium organization (GO:0060122)|retina homeostasis (GO:0001895)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	actin filament (GO:0005884)|cilium (GO:0005929)|cytoplasm (GO:0005737)|stereocilia ankle link complex (GO:0002142)|stereocilium (GO:0032420)				central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|ovary(5)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GACGCTGCCACCACGGTACTC	0.627																																					p.G451A		Atlas-SNP	.											DFNB31,NS,carcinoma,0,1	DFNB31	100	.	0			c.G1352C						.						98.0	79.0	86.0					9																	117186678		2203	4300	6503	SO:0001583	missense	25861	exon6			CTGCCACCACGGT	AK056190	CCDS6806.1, CCDS43870.1	9q32	2013-06-19			ENSG00000095397	ENSG00000095397			16361	protein-coding gene	gene with protein product	"""whirlin"""	607928				12833159, 17171570	Standard	NM_015404		Approved	CIP98, WHRN, USH2D, PDZD7B	uc004biz.4	Q9P202	OTTHUMG00000020539	ENST00000362057.3:c.1352G>C	chr9.hg19:g.117186678C>G	ENSP00000354623:p.Gly451Ala	198.0	0.0		235.0	0.0	NM_001173425	A5PKU1|A5PKZ9|Q5TAU9|Q5TAV0|Q5TAV1|Q5TAV2|Q96MZ9|Q9H9F4|Q9UFZ3	Missense_Mutation	SNP	ENST00000362057.3	hg19	CCDS6806.1	.	.	.	.	.	.	.	.	.	.	C	11.77	1.736298	0.30774	.	.	ENSG00000095397	ENST00000265134;ENST00000374059;ENST00000362057	T;T;T	0.06294	4.21;4.2;3.32	5.49	2.08	0.27032	.	0.580016	0.18819	N	0.130285	T	0.05273	0.0140	L	0.43152	1.355	0.80722	D	1	B;B;B	0.28512	0.139;0.139;0.214	B;B;B	0.30572	0.05;0.034;0.117	T	0.39165	-0.9627	10	0.33141	T	0.24	-2.7096	2.0825	0.03638	0.2411:0.3747:0.0:0.3842	.	451;451;100	B9EGE6;Q9P202;Q9P202-4	.;WHRN_HUMAN;.	A	68;100;451	ENSP00000265134:G68A;ENSP00000363172:G100A;ENSP00000354623:G451A	ENSP00000265134:G68A	G	-	2	0	DFNB31	116226499	0.453000	0.25721	0.081000	0.20488	0.944000	0.59088	2.923000	0.48868	0.771000	0.33359	0.561000	0.74099	GGT	.	C|0.997;T|0.003		0.627	DFNB31-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053776.2	NM_015404	
ASTN2	23245	hgsc.bcm.edu	37	9	119976991	119976991	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:119976991G>C	ENST00000313400.4	-	3	761	c.661C>G	c.(661-663)Ctg>Gtg	p.L221V	ASTN2_ENST00000361477.3_5'UTR|ASTN2_ENST00000373996.3_Missense_Mutation_p.L221V|ASTN2_ENST00000361209.2_Missense_Mutation_p.L221V			O75129	ASTN2_HUMAN	astrotactin 2	221					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						GTGAACACCAGCAGCAGCAGC	0.602																																					p.L221V		Atlas-SNP	.											ASTN2,right_upper_lobe,carcinoma,+2,1	ASTN2	307	.	0			c.C661G						.						34.0	35.0	35.0					9																	119976991		2203	4300	6503	SO:0001583	missense	23245	exon3			ACACCAGCAGCAG	AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.661C>G	chr9.hg19:g.119976991G>C	ENSP00000314038:p.Leu221Val	61.0	0.0		83.0	4.0	NM_014010	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	ENST00000313400.4	hg19		.	.	.	.	.	.	.	.	.	.	G	19.87	3.907561	0.72868	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000361209	T;T;T	0.14022	2.62;2.62;2.54	5.41	4.5	0.54988	.	0.000000	0.56097	D	0.000023	T	0.23249	0.0562	L	0.27053	0.805	0.47476	D	0.999432	D;D;P	0.69078	0.971;0.997;0.946	P;D;P	0.72625	0.835;0.978;0.808	T	0.01982	-1.1235	9	.	.	.	-12.1738	14.2439	0.65975	0.0739:0.0:0.9261:0.0	.	221;221;221	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	V	221	ENSP00000314038:L221V;ENSP00000363108:L221V;ENSP00000354504:L221V	.	L	-	1	2	ASTN2	119016812	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	4.130000	0.57964	1.250000	0.43966	0.655000	0.94253	CTG	.	.		0.602	ASTN2-201	KNOWN	basic	protein_coding	protein_coding		NM_014010	
GOLGA2	2801	hgsc.bcm.edu	37	9	131022366	131022366	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:131022366G>A	ENST00000421699.2	-	18	1792	c.1780C>T	c.(1780-1782)Ctg>Ttg	p.L594L	GOLGA2_ENST00000609374.1_Silent_p.L582L|AL590708.1_ENST00000408370.1_RNA	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	594					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GTTTCCTTCAGCTCGCTCAGC	0.632																																					p.L594L		Atlas-SNP	.											.	GOLGA2	69	.	0			c.C1780T						.						87.0	82.0	84.0					9																	131022366		2203	4300	6503	SO:0001819	synonymous_variant	2801	exon18			CCTTCAGCTCGCT	L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1780C>T	chr9.hg19:g.131022366G>A		33.0	0.0		40.0	8.0	NM_004486	Q6GRM9|Q9BRB0|Q9NYF9	Silent	SNP	ENST00000421699.2	hg19	CCDS6896.2																																																																																			.	.		0.632	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054358.2	NM_004486	
PPAPDC3	84814	hgsc.bcm.edu	37	9	134183331	134183331	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:134183331C>T	ENST00000372264.3	+	2	777	c.473C>T	c.(472-474)aCg>aTg	p.T158M		NM_032728.3	NP_116117.3	Q8NBV4	PPAC3_HUMAN	phosphatidic acid phosphatase type 2 domain containing 3	158					negative regulation of myotube differentiation (GO:0010832)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)	hydrolase activity (GO:0016787)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16	all_hematologic(7;0.0119)			OV - Ovarian serous cystadenocarcinoma(145;1.22e-05)|Epithelial(140;0.000173)		GACATCATGACGGTGGCCGGC	0.682																																					p.T158M		Atlas-SNP	.											.	PPAPDC3	24	.	0			c.C473T						.						23.0	22.0	23.0					9																	134183331		2200	4296	6496	SO:0001583	missense	84814	exon2			TCATGACGGTGGC	AK027568	CCDS6942.1	9q34.2-q34.3	2008-02-26	2005-07-15	2005-07-15	ENSG00000160539	ENSG00000160539			28174	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 67"""	C9orf67		12958361	Standard	NM_032728		Approved	MGC12921, FLJ14662, NET39	uc004cal.2	Q8NBV4	OTTHUMG00000020822	ENST00000372264.3:c.473C>T	chr9.hg19:g.134183331C>T	ENSP00000361338:p.Thr158Met	11.0	0.0		31.0	9.0	NM_032728	Q5T6P0|Q96SS7|Q9BRC3	Missense_Mutation	SNP	ENST00000372264.3	hg19	CCDS6942.1	.	.	.	.	.	.	.	.	.	.	C	15.23	2.771215	0.49680	.	.	ENSG00000160539	ENST00000372264	T	0.75260	-0.92	4.68	4.68	0.58851	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.051238	0.85682	D	0.000000	T	0.77718	0.4172	L	0.45352	1.415	0.80722	D	1	D	0.71674	0.998	D	0.63033	0.91	T	0.76639	-0.2885	10	0.41790	T	0.15	-18.2091	10.6287	0.45523	0.0:0.8993:0.0:0.1007	.	158	Q8NBV4	PPAC3_HUMAN	M	158	ENSP00000361338:T158M	ENSP00000361338:T158M	T	+	2	0	PPAPDC3	133173152	1.000000	0.71417	0.978000	0.43139	0.032000	0.12392	4.316000	0.59178	2.296000	0.77279	0.505000	0.49811	ACG	.	.		0.682	PPAPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054724.1	NM_032728	
RAPGEF1	2889	hgsc.bcm.edu	37	9	134497361	134497361	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:134497361T>C	ENST00000372189.3	-	11	1799	c.1676A>G	c.(1675-1677)gAg>gGg	p.E559G	RAPGEF1_ENST00000372195.1_Missense_Mutation_p.E576G|RAPGEF1_ENST00000372190.3_Missense_Mutation_p.E577G	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	559					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CGAGTAGTCCTCCAGCAACTG	0.582																																					p.E577G		Atlas-SNP	.											.	RAPGEF1	126	.	0			c.A1730G						.						56.0	63.0	60.0					9																	134497361		2077	4206	6283	SO:0001583	missense	2889	exon11			TAGTCCTCCAGCA	BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1676A>G	chr9.hg19:g.134497361T>C	ENSP00000361263:p.Glu559Gly	167.0	0.0		215.0	9.0	NM_198679	Q5JUE4|Q8IV73	Missense_Mutation	SNP	ENST00000372189.3	hg19	CCDS48047.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.9|20.9	4.059388|4.059388	0.76074|0.76074	.|.	.|.	ENSG00000107263|ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000372191;ENST00000357686|ENST00000419442	T;T;T|.	0.27256|.	1.68;1.68;1.68|.	5.57|5.57	5.57|5.57	0.84162|0.84162	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71178|0.71178	0.3309|0.3309	M|M	0.64997|0.64997	1.995|1.995	0.50467|0.50467	D|D	0.999879|0.999879	D;D;D;D;D;D;D|.	0.89917|.	1.0;0.996;0.985;1.0;0.985;0.985;0.991|.	D;D;P;D;P;P;D|.	0.87578|.	0.996;0.986;0.831;0.998;0.831;0.831;0.919|.	T|T	0.70630|0.70630	-0.4819|-0.4819	10|5	0.18276|.	T|.	0.48|.	.|.	14.9117|14.9117	0.70761|0.70761	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	254;17;539;520;576;559;577|.	E9PDT1;Q5JUE7;C9JL20;Q13905-2;Q68DL3;Q13905;Q13905-3|.	.;.;.;.;.;RPGF1_HUMAN;.|.	G|G	559;576;453;559;577;539;485;254;576|18	ENSP00000361269:E576G;ENSP00000361263:E559G;ENSP00000361264:E577G|.	ENSP00000266110:E559G|.	E|R	-|-	2|1	0|2	RAPGEF1|RAPGEF1	133487182|133487182	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	7.392000|7.392000	0.79840|0.79840	2.117000|2.117000	0.64856|0.64856	0.459000|0.459000	0.35465|0.35465	GAG|AGG	.	.		0.582	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000054759.2	NM_005312	
SOHLH1	402381	hgsc.bcm.edu	37	9	138590847	138590847	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:138590847T>C	ENST00000298466.5	-	2	251	c.191A>G	c.(190-192)gAg>gGg	p.E64G	SOHLH1_ENST00000425225.1_Missense_Mutation_p.E64G	NM_001012415.2	NP_001012415	Q5JUK2	SOLH1_HUMAN	spermatogenesis and oogenesis specific basic helix-loop-helix 1	64	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				oogenesis (GO:0048477)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(5)|prostate(1)	12		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.66e-07)|Epithelial(140;1.11e-06)|all cancers(34;6.45e-05)		TCACCTGCGCTCCCTCTCGCT	0.697																																					p.E64G		Atlas-SNP	.											.	SOHLH1	70	.	0			c.A191G						.						49.0	47.0	48.0					9																	138590847		2203	4295	6498	SO:0001583	missense	402381	exon2			CTGCGCTCCCTCT	BC031861	CCDS35174.1, CCDS48054.1	9q34.3	2013-05-21	2006-03-16	2006-03-16	ENSG00000165643	ENSG00000165643		"""Basic helix-loop-helix proteins"""	27845	protein-coding gene	gene with protein product	"""spermatogenesis associated 27"""	610224	"""chromosome 9 open reading frame 157"""	C9orf157		12477932	Standard	NM_001012415		Approved	NOHLH, TEB2, bA100C15.3, bHLHe80, SPATA27	uc010nbe.3	Q5JUK2	OTTHUMG00000020915	ENST00000298466.5:c.191A>G	chr9.hg19:g.138590847T>C	ENSP00000298466:p.Glu64Gly	109.0	0.0		171.0	7.0	NM_001012415	C9JG81|Q5EE14|Q5EGC2|Q8NEE3	Missense_Mutation	SNP	ENST00000298466.5	hg19	CCDS35174.1	.	.	.	.	.	.	.	.	.	.	T	17.75	3.465171	0.63513	.	.	ENSG00000165643	ENST00000298466;ENST00000425225	D;D	0.97831	-4.56;-4.56	3.13	1.91	0.25777	Helix-loop-helix DNA-binding (5);	0.000000	0.33057	N	0.005321	D	0.97031	0.9030	L	0.44542	1.39	0.27971	N	0.936395	D;D	0.76494	0.998;0.999	D;D	0.70487	0.947;0.969	D	0.92293	0.5843	10	0.66056	D	0.02	-17.4684	6.1749	0.20439	0.0:0.0:0.2615:0.7385	.	64;64	Q5JUK2-2;Q5JUK2	.;SOLH1_HUMAN	G	64	ENSP00000298466:E64G;ENSP00000404438:E64G	ENSP00000298466:E64G	E	-	2	0	SOHLH1	137730668	1.000000	0.71417	0.988000	0.46212	0.945000	0.59286	0.975000	0.29449	0.361000	0.24292	0.454000	0.30748	GAG	.	.		0.697	SOHLH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055018.2	NM_001012415	
GPSM1	26086	hgsc.bcm.edu	37	9	139232412	139232412	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:139232412A>G	ENST00000440944.1	+	6	1032	c.812A>G	c.(811-813)tAc>tGc	p.Y271C	GPSM1_ENST00000392945.3_Missense_Mutation_p.Y271C	NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	271	Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		GCCGCCGAGTACTACAAGTAG	0.627																																					p.Y271C		Atlas-SNP	.											.	GPSM1	50	.	0			c.A812G						.						47.0	40.0	43.0					9																	139232412		2192	4295	6487	SO:0001583	missense	26086	exon6			CCGAGTACTACAA	AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.812A>G	chr9.hg19:g.139232412A>G	ENSP00000392828:p.Tyr271Cys	61.0	0.0		99.0	4.0	NM_015597	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Missense_Mutation	SNP	ENST00000440944.1	hg19	CCDS48055.1	.	.	.	.	.	.	.	.	.	.	A	16.45	3.126089	0.56721	.	.	ENSG00000160360	ENST00000392945;ENST00000440944;ENST00000354753	T;T;T	0.75260	-0.92;-0.92;-0.92	4.1	4.1	0.47936	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.286251	0.29087	U	0.013182	T	0.79828	0.4513	L	0.43646	1.37	0.80722	D	1	D;D	0.76494	0.999;0.961	D;P	0.70716	0.97;0.569	T	0.80099	-0.1524	10	0.49607	T	0.09	-16.0651	12.5816	0.56393	1.0:0.0:0.0:0.0	.	271;271	Q86YR5;Q86YR5-3	GPSM1_HUMAN;.	C	271;271;248	ENSP00000376674:Y271C;ENSP00000392828:Y271C;ENSP00000346797:Y248C	ENSP00000346797:Y248C	Y	+	2	0	GPSM1	138352233	1.000000	0.71417	0.993000	0.49108	0.755000	0.42902	7.299000	0.78831	1.624000	0.50355	0.379000	0.24179	TAC	.	.		0.627	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_015597	
NET1	10276	hgsc.bcm.edu	37	10	5496244	5496244	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:5496244C>T	ENST00000355029.4	+	9	927	c.785C>T	c.(784-786)gCc>gTc	p.A262V	NET1_ENST00000380359.3_Missense_Mutation_p.A208V|NET1_ENST00000542715.1_Missense_Mutation_p.A81V	NM_001047160.2	NP_001040625.1	Q7Z628	ARHG8_HUMAN	neuroepithelial cell transforming 1	262	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|myoblast migration (GO:0051451)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|kidney(2)|large_intestine(9)|lung(5)|prostate(2)|skin(1)	23						CGCTTGAATGCCTACAGAGGT	0.433																																					p.A262V		Atlas-SNP	.											.	NET1	82	.	0			c.C785T						.						83.0	85.0	84.0					10																	5496244		2203	4300	6503	SO:0001583	missense	10276	exon9			TGAATGCCTACAG	AJ010046	CCDS7067.1, CCDS41483.1	10p15	2013-01-10	2008-09-12		ENSG00000173848	ENSG00000173848		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14592	protein-coding gene	gene with protein product		606450				8649828	Standard	NR_073040		Approved	ARHGEF8, NET1A	uc001iia.4	Q7Z628	OTTHUMG00000017596	ENST00000355029.4:c.785C>T	chr10.hg19:g.5496244C>T	ENSP00000347134:p.Ala262Val	108.0	0.0		82.0	4.0	NM_001047160	Q12773|Q96D82|Q99903|Q9UEN6	Missense_Mutation	SNP	ENST00000355029.4	hg19	CCDS41483.1	.	.	.	.	.	.	.	.	.	.	C	15.38	2.815264	0.50527	.	.	ENSG00000173848	ENST00000355029;ENST00000542715;ENST00000449083;ENST00000380359;ENST00000380337	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	6.07	5.16	0.70880	Dbl homology (DH) domain (5);	0.000000	0.41712	D	0.000834	T	0.42154	0.1190	L	0.31476	0.935	0.80722	D	1	P;B	0.38335	0.627;0.428	B;B	0.32465	0.146;0.146	T	0.27938	-1.0059	10	0.22109	T	0.4	-21.8148	14.564	0.68162	0.0:0.9282:0.0:0.0718	.	208;262	Q5SQI7;Q7Z628	.;ARHG8_HUMAN	V	262;81;80;208;80	ENSP00000347134:A262V;ENSP00000446452:A81V;ENSP00000403101:A80V;ENSP00000369717:A208V	ENSP00000347134:A262V	A	+	2	0	NET1	5486244	1.000000	0.71417	1.000000	0.80357	0.508000	0.34012	7.688000	0.84153	2.884000	0.98904	0.655000	0.94253	GCC	.	.		0.433	NET1-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000046553.3	NM_005863	
NSUN6	221078	hgsc.bcm.edu	37	10	18937549	18937549	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:18937549T>C	ENST00000377304.4	-	2	519	c.101A>G	c.(100-102)gAa>gGa	p.E34G	RP11-139J15.7_ENST00000606425.1_Missense_Mutation_p.E22G	NM_182543.2	NP_872349.1	Q8TEA1	NSUN6_HUMAN	NOP2/Sun domain family, member 6	34							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15						CCTTTCTGCTTCTTGTTTACC	0.343																																					p.E34G		Atlas-SNP	.											.	NSUN6	46	.	0			c.A101G						.						178.0	165.0	170.0					10																	18937549		2203	4299	6502	SO:0001583	missense	221078	exon2			TCTGCTTCTTGTT	BC035778	CCDS7130.1	10p13	2014-06-23	2009-11-23	2004-08-26	ENSG00000241058	ENSG00000241058		"""NOP2/Sun domain containing"""	23529	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family 6"", ""NOL1/NOP2/Sun domain family, member 6"", ""ARL5B antisense RNA 1"""	NOPD1, ARL5B-AS1			Standard	XM_005252394		Approved	FLJ23743	uc010qcp.1	Q8TEA1	OTTHUMG00000017767	ENST00000377304.4:c.101A>G	chr10.hg19:g.18937549T>C	ENSP00000366519:p.Glu34Gly	111.0	0.0		97.0	4.0	NM_182543	B0YJ54	Missense_Mutation	SNP	ENST00000377304.4	hg19	CCDS7130.1	.	.	.	.	.	.	.	.	.	.	T	12.74	2.027944	0.35797	.	.	ENSG00000241058	ENST00000377304	T	0.32988	1.43	4.84	-0.992	0.10232	.	0.400925	0.28393	N	0.015505	T	0.28863	0.0716	L	0.53249	1.67	0.47547	D	0.999452	B	0.22604	0.072	B	0.26969	0.075	T	0.25984	-1.0116	10	0.56958	D	0.05	.	13.6389	0.62237	0.0:0.0:0.5206:0.4794	.	34	Q8TEA1	NSUN6_HUMAN	G	34	ENSP00000366519:E34G	ENSP00000366519:E34G	E	-	2	0	NSUN6	18977555	0.334000	0.24739	0.763000	0.31416	0.665000	0.39181	0.134000	0.15932	-0.092000	0.12417	0.383000	0.25322	GAA	.	.		0.343	NSUN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047083.1	NM_182543	
TMEM72	643236	hgsc.bcm.edu	37	10	45429185	45429185	+	5'UTR	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:45429185T>C	ENST00000544540.1	+	0	440				TMEM72-AS1_ENST00000450287.2_RNA			A0PK05	TMM72_HUMAN	transmembrane protein 72							integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(2)|lung(10)	15						GGTGGCCTGCTTCCTCCACCC	0.617																																					p.F104L		Atlas-SNP	.											.	TMEM72	25	.	0			c.T310C						.						52.0	55.0	54.0					10																	45429185		1568	3582	5150	SO:0001623	5_prime_UTR_variant	643236	exon4			GCCTGCTTCCTCC	AB235418	CCDS41504.1	10q11.21	2008-10-24	2008-08-21	2008-08-21	ENSG00000187783	ENSG00000187783			31658	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 127"""	C10orf127			Standard	NM_001123376		Approved	bA285G1.3, KSP37	uc001jbn.2	A0PK05	OTTHUMG00000018067	ENST00000544540.1:c.-45T>C	chr10.hg19:g.45429185T>C		108.0	0.0		142.0	6.0	NM_001123376	A1L181|Q5T740	Missense_Mutation	SNP	ENST00000544540.1	hg19		.	.	.	.	.	.	.	.	.	.	T	27.0	4.787913	0.90367	.	.	ENSG00000187783	ENST00000389583	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.77205	0.4096	M	0.74258	2.255	0.80722	D	1	D	0.67145	0.996	D	0.73380	0.98	T	0.79259	-0.1877	9	0.59425	D	0.04	-18.8848	12.4511	0.55677	0.0:0.0:0.0:1.0	.	104	A0PK05	TMM72_HUMAN	L	104	.	ENSP00000374234:F104L	F	+	1	0	TMEM72	44749191	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	5.661000	0.68025	2.254000	0.74563	0.533000	0.62120	TTC	.	.		0.617	TMEM72-201	KNOWN	basic	protein_coding	protein_coding		NM_001123376	
ZNF488	118738	hgsc.bcm.edu	37	10	48371474	48371474	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:48371474A>G	ENST00000395702.2	+	2	1169	c.942A>G	c.(940-942)gaA>gaG	p.E314E	ZNF488_ENST00000494156.1_3'UTR|ZNF488_ENST00000586537.1_Silent_p.E207E			Q96MN9	ZN488_HUMAN	zinc finger protein 488	314					negative regulation of transcription, DNA-templated (GO:0045892)|oligodendrocyte development (GO:0014003)|positive regulation of oligodendrocyte differentiation (GO:0048714)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|ovary(2)	14						AGCGGAGAGAAGAGGCCCTTG	0.597																																					p.E314E		Atlas-SNP	.											.	ZNF488	38	.	0			c.A942G						.						94.0	93.0	93.0					10																	48371474		2203	4300	6503	SO:0001819	synonymous_variant	118738	exon2			GAGAGAAGAGGCC	AK056666	CCDS73120.1	10q11.22	2014-04-10			ENSG00000165388	ENSG00000265763		"""Zinc fingers, C2H2-type"""	23535	protein-coding gene	gene with protein product							Standard	NM_153034		Approved	FLJ32104	uc001jex.3	Q96MN9	OTTHUMG00000188322	ENST00000395702.2:c.942A>G	chr10.hg19:g.48371474A>G		55.0	0.0		95.0	4.0	NM_153034	Q05CE0	Silent	SNP	ENST00000395702.2	hg19	CCDS7217.1																																																																																			.	.		0.597	ZNF488-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000314632.1	NM_153034	
SGMS1	259230	hgsc.bcm.edu	37	10	52087035	52087035	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:52087035A>G	ENST00000361781.2	-	8	1630	c.671T>C	c.(670-672)cTg>cCg	p.L224P	SGMS1_ENST00000429490.1_Missense_Mutation_p.L55P	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	230					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						ACACCGATACAGGTACAGCGT	0.398																																					p.L224P		Atlas-SNP	.											.	SGMS1	40	.	0			c.T671C						.						99.0	92.0	95.0					10																	52087035		2203	4300	6503	SO:0001583	missense	259230	exon8			CGATACAGGTACA	AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.671T>C	chr10.hg19:g.52087035A>G	ENSP00000354829:p.Leu224Pro	91.0	0.0		112.0	5.0	NM_147156	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	ENST00000361781.2	hg19	CCDS7240.1	.	.	.	.	.	.	.	.	.	.	A	26.2	4.715522	0.89112	.	.	ENSG00000198964	ENST00000412547;ENST00000361781;ENST00000429490	T	0.55760	0.5	5.73	5.73	0.89815	.	0.073707	0.56097	D	0.000030	T	0.67906	0.2943	L	0.57536	1.79	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.68621	0.959;0.95	T	0.70777	-0.4780	10	0.87932	D	0	-13.7289	14.2815	0.66216	1.0:0.0:0.0:0.0	.	55;230	B4DJU2;Q86VZ5	.;SMS1_HUMAN	P	24;224;55	ENSP00000354829:L224P	ENSP00000354829:L224P	L	-	2	0	SGMS1	51757041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.962000	0.93254	2.324000	0.78689	0.533000	0.62120	CTG	.	.		0.398	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048074.2	NM_147156	
BICC1	80114	hgsc.bcm.edu	37	10	60549107	60549107	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:60549107A>G	ENST00000373886.3	+	7	690	c.686A>G	c.(685-687)cAg>cGg	p.Q229R		NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	229					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						CCCTCTATTCAGCATATATCA	0.403																																					p.Q229R		Atlas-SNP	.											.	BICC1	121	.	0			c.A686G						.						144.0	136.0	139.0					10																	60549107		2203	4300	6503	SO:0001583	missense	80114	exon7			CTATTCAGCATAT	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.686A>G	chr10.hg19:g.60549107A>G	ENSP00000362993:p.Gln229Arg	202.0	0.0		175.0	8.0	NM_001080512		Missense_Mutation	SNP	ENST00000373886.3	hg19	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	A	16.98	3.271918	0.59649	.	.	ENSG00000122870	ENST00000373886	T	0.30714	1.52	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.39835	0.1093	L	0.56769	1.78	0.80722	D	1	D	0.59357	0.985	P	0.50537	0.643	T	0.13335	-1.0513	10	0.19590	T	0.45	-9.024	15.9023	0.79387	1.0:0.0:0.0:0.0	.	229	Q9H694	BICC1_HUMAN	R	229	ENSP00000362993:Q229R	ENSP00000362993:Q229R	Q	+	2	0	BICC1	60219113	1.000000	0.71417	0.997000	0.53966	0.963000	0.63663	7.043000	0.76572	2.153000	0.67306	0.533000	0.62120	CAG	.	.		0.403	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
CHST3	9469	hgsc.bcm.edu	37	10	73767842	73767842	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:73767842C>T	ENST00000373115.4	+	3	1490	c.1053C>T	c.(1051-1053)tcC>tcT	p.S351S		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	351					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						TCCGCCTGTCCGCGGAGCTGG	0.706																																					p.S351S		Atlas-SNP	.											.	CHST3	36	.	0			c.C1053T						.						6.0	5.0	5.0					10																	73767842		1770	3355	5125	SO:0001819	synonymous_variant	9469	exon3			CCTGTCCGCGGAG	AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1053C>T	chr10.hg19:g.73767842C>T		28.0	0.0		39.0	19.0	NM_004273	O75099|Q52M30	Silent	SNP	ENST00000373115.4	hg19	CCDS7312.1																																																																																			.	.		0.706	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048563.1	NM_004273	
IFIT1B	439996	hgsc.bcm.edu	37	10	91144454	91144454	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:91144454A>G	ENST00000371809.3	+	2	1464	c.1384A>G	c.(1384-1386)Agg>Ggg	p.R462G	LIPA_ENST00000371837.1_Intron	NM_001010987.2	NP_001010987.1	Q5T764	IFT1B_HUMAN	interferon-induced protein with tetratricopeptide repeats 1B	462										endometrium(2)|large_intestine(3)|lung(8)	13						GTGCTATGAGAGGGCTCTGAG	0.408																																					p.R462G		Atlas-SNP	.											.	IFIT1B	39	.	0			c.A1384G						.						152.0	159.0	157.0					10																	91144454		2203	4300	6503	SO:0001583	missense	439996	exon2			TATGAGAGGGCTC		CCDS31242.1	10q23.31	2014-05-22	2010-03-22	2010-03-22	ENSG00000204010	ENSG00000204010		"""Tetratricopeptide (TTC) repeat domain containing"""	23442	protein-coding gene	gene with protein product			"""interferon-induced protein with tetratricopeptide repeats 1-like"""	IFIT1L			Standard	NM_001010987		Approved	bA149I23.6	uc001kgh.3	Q5T764	OTTHUMG00000018709	ENST00000371809.3:c.1384A>G	chr10.hg19:g.91144454A>G	ENSP00000360874:p.Arg462Gly	105.0	0.0		134.0	6.0	NM_001010987	A7E245	Missense_Mutation	SNP	ENST00000371809.3	hg19	CCDS31242.1	.	.	.	.	.	.	.	.	.	.	A	19.34	3.809643	0.70797	.	.	ENSG00000204010	ENST00000371809	T	0.68331	-0.32	4.13	-3.3	0.05003	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.546343	0.16394	N	0.216346	T	0.57007	0.2024	L	0.59436	1.845	0.24518	N	0.99418	P	0.45768	0.866	P	0.46208	0.507	T	0.53795	-0.8388	10	0.72032	D	0.01	.	1.4588	0.02391	0.4588:0.2558:0.1562:0.1292	.	462	Q5T764	IFT1B_HUMAN	G	462	ENSP00000360874:R462G	ENSP00000360874:R462G	R	+	1	2	IFIT1B	91134434	0.141000	0.22595	0.008000	0.14137	0.582000	0.36321	0.280000	0.18790	-0.907000	0.03862	0.456000	0.33151	AGG	.	.		0.408	IFIT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049296.3	NM_001010987	
KIF20B	9585	hgsc.bcm.edu	37	10	91522426	91522426	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:91522426T>C	ENST00000371728.3	+	29	4888	c.4823T>C	c.(4822-4824)gTg>gCg	p.V1608A	KIF20B_ENST00000394289.2_Missense_Mutation_p.V1608A|KIF20B_ENST00000416354.1_Missense_Mutation_p.V1638A|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.V1568A	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1608	Interaction with PIN1.			V -> A (in Ref. 1; BAB69456). {ECO:0000305}.	ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TCTTGTGAAGTGTCAACAGAA	0.338																																					p.V1568A		Atlas-SNP	.											.	KIF20B	191	.	0			c.T4703C						.						90.0	85.0	87.0					10																	91522426		2203	4300	6503	SO:0001583	missense	9585	exon29			GTGAAGTGTCAAC	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4823T>C	chr10.hg19:g.91522426T>C	ENSP00000360793:p.Val1608Ala	91.0	0.0		86.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	T	26.6	4.752730	0.89753	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	6.06	6.06	0.98353	.	0.000000	0.45606	D	0.000355	T	0.68449	0.3002	M	0.62723	1.935	0.41059	D	0.985363	D;D	0.69078	0.996;0.997	P;D	0.64042	0.836;0.921	T	0.71087	-0.4694	10	0.62326	D	0.03	-11.1571	15.5919	0.76537	0.0:0.0:0.0:1.0	.	1608;1568	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	A	1568;1638;1608;1608	ENSP00000260753:V1568A;ENSP00000411545:V1638A;ENSP00000377830:V1608A;ENSP00000360793:V1608A	ENSP00000260753:V1568A	V	+	2	0	KIF20B	91512406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.010000	0.76353	2.324000	0.78689	0.533000	0.62120	GTG	.	.		0.338	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
KIF20B	9585	hgsc.bcm.edu	37	10	91522431	91522431	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:91522431A>G	ENST00000371728.3	+	29	4893	c.4828A>G	c.(4828-4830)Aca>Gca	p.T1610A	KIF20B_ENST00000394289.2_Missense_Mutation_p.T1610A|KIF20B_ENST00000416354.1_Missense_Mutation_p.T1640A|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.T1570A	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1610	Interaction with PIN1.				ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TGAAGTGTCAACAGAAAATGA	0.348																																					p.T1570A		Atlas-SNP	.											.	KIF20B	191	.	0			c.A4708G						.						90.0	85.0	86.0					10																	91522431		2203	4300	6503	SO:0001583	missense	9585	exon29			GTGTCAACAGAAA	L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4828A>G	chr10.hg19:g.91522431A>G	ENSP00000360793:p.Thr1610Ala	95.0	0.0		91.0	4.0	NM_016195	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	ENST00000371728.3	hg19		.	.	.	.	.	.	.	.	.	.	A	13.92	2.381615	0.42207	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.55760	0.5;0.5;0.5;0.5	6.06	0.978	0.19740	.	0.122710	0.37053	N	0.002270	T	0.44265	0.1285	M	0.66939	2.045	0.36363	D	0.860849	B;B	0.12630	0.003;0.006	B;B	0.14578	0.005;0.011	T	0.36744	-0.9735	10	0.56958	D	0.05	-7.7027	4.3202	0.11013	0.5109:0.0:0.1349:0.3542	.	1610;1570	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	A	1570;1640;1610;1610	ENSP00000260753:T1570A;ENSP00000411545:T1640A;ENSP00000377830:T1610A;ENSP00000360793:T1610A	ENSP00000260753:T1570A	T	+	1	0	KIF20B	91512411	0.989000	0.36119	0.993000	0.49108	0.995000	0.86356	1.233000	0.32648	-0.077000	0.12752	-0.274000	0.10170	ACA	.	.		0.348	KIF20B-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000049330.1	NM_016195	
TNKS2	80351	hgsc.bcm.edu	37	10	93609348	93609348	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:93609348A>G	ENST00000371627.4	+	20	3070	c.2691A>G	c.(2689-2691)gaA>gaG	p.E897E		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	897	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				TTGAGAGAGAACAGGTGAGTA	0.338																																					p.E897E		Atlas-SNP	.											.	TNKS2	103	.	0			c.A2691G						.						101.0	97.0	98.0					10																	93609348		2203	4299	6502	SO:0001819	synonymous_variant	80351	exon20			GAGAGAACAGGTG	AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.2691A>G	chr10.hg19:g.93609348A>G		104.0	0.0		71.0	4.0	NM_025235	B2RBD3|Q9H8F2|Q9HAS4	Silent	SNP	ENST00000371627.4	hg19	CCDS7417.1																																																																																			.	.		0.338	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049374.1	NM_025235	
TLX1NB	100038246	hgsc.bcm.edu	37	10	102849600	102849600	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:102849600A>G	ENST00000445873.1	-	3	1339	c.63T>C	c.(61-63)tcT>tcC	p.S21S	TLX1NB_ENST00000425505.1_5'Flank	NM_001085398.1	NP_001078867.1	P0CAT3	TLXNB_HUMAN	TLX1 neighbor	21																	GGGAAAGGAGAGAGTGCTGAC	0.652																																					p.S21S		Atlas-SNP	.											.	.	.	.	0			c.T63C						.						15.0	18.0	17.0					10																	102849600		1924	4113	6037	SO:0001819	synonymous_variant	100038246	exon3			AAGGAGAGAGTGC	BC019674	CCDS60615.1	10q24	2014-04-01			ENSG00000236311	ENSG00000236311			37183	protein-coding gene	gene with protein product		612734				17303350	Standard	NM_001085398		Approved	TD1, TDI, APT-B7	uc001ksv.3	P0CAT3	OTTHUMG00000018925	ENST00000445873.1:c.63T>C	chr10.hg19:g.102849600A>G		75.0	0.0		78.0	4.0	NM_001085398		Silent	SNP	ENST00000445873.1	hg19																																																																																				.	.		0.652	TLX1NB-001	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000049925.2	NM_001085398	
USMG5	84833	hgsc.bcm.edu	37	10	105152185	105152185	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:105152185G>T	ENST00000369825.1	-	3	512	c.30C>A	c.(28-30)taC>taA	p.Y10*	MIR1307_ENST00000408840.1_RNA|USMG5_ENST00000337003.4_Nonsense_Mutation_p.Y10*|USMG5_ENST00000309579.3_Nonsense_Mutation_p.Y10*|USMG5_ENST00000369811.1_Nonsense_Mutation_p.Y10*|USMG5_ENST00000369815.1_Nonsense_Mutation_p.Y10*			Q96IX5	USMG5_HUMAN	up-regulated during skeletal muscle growth 5 homolog (mouse)	10						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)				breast(1)	1		Colorectal(252;0.142)		Epithelial(162;3.94e-09)|all cancers(201;2.76e-08)|BRCA - Breast invasive adenocarcinoma(275;0.197)		CAGTGAACTGGTATTGCGCAT	0.269																																					p.Y10X		Atlas-SNP	.											.	USMG5	5	.	0			c.C30A						.						35.0	40.0	38.0					10																	105152185		2193	4291	6484	SO:0001587	stop_gained	84833	exon3			GAACTGGTATTGC	BC007087	CCDS7548.1	10q24.33	2011-04-13	2008-06-05		ENSG00000173915	ENSG00000173915			30889	protein-coding gene	gene with protein product		615204	"""upregulated during skeletal muscle growth 5"", ""upregulated during skeletal muscle growth 5 homolog (mouse)"""			12477932	Standard	NM_032747		Approved	MGC14697, bA792D24.4, DAPIT	uc001kwx.2	Q96IX5	OTTHUMG00000018984	ENST00000369825.1:c.30C>A	chr10.hg19:g.105152185G>T	ENSP00000358840:p.Tyr10*	98.0	0.0		117.0	6.0	NM_001206427	B2R4N2|D3DR92	Nonsense_Mutation	SNP	ENST00000369825.1	hg19	CCDS7548.1	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722614	0.48728	.	.	ENSG00000173915	ENST00000369825;ENST00000369815;ENST00000309579;ENST00000337003;ENST00000369811	.	.	.	6.17	2.96	0.34315	.	0.192756	0.37348	N	0.002122	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	10.9458	0.47299	0.2742:0.0:0.7258:0.0	.	.	.	.	X	10	.	ENSP00000311245:Y10X	Y	-	3	2	USMG5	105142175	1.000000	0.71417	0.996000	0.52242	0.473000	0.32948	3.199000	0.51043	0.954000	0.37851	-0.137000	0.14449	TAC	.	.		0.269	USMG5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050142.1	NM_032747	
CUZD1	50624	hgsc.bcm.edu	37	10	124593456	124593456	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:124593456T>C	ENST00000368904.1	-	10	2332	c.1383A>G	c.(1381-1383)ggA>ggG	p.G461G	CUZD1_ENST00000392790.1_Splice_Site_p.G461G|CUZD1_ENST00000545804.1_Splice_Site_p.G461G					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		CTCGACTACATCTGGAACAGA	0.338																																					p.G461G		Atlas-SNP	.											.	CUZD1	82	.	0			c.A1383G						.						72.0	73.0	72.0					10																	124593456		2203	4300	6503	SO:0001630	splice_region_variant	50624	exon8			ACTACATCTGGAA	AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.1383-1A>G	chr10.hg19:g.124593456T>C		121.0	0.0		144.0	7.0	NM_022034		Silent	SNP	ENST00000368904.1	hg19	CCDS7631.1																																																																																			.	.		0.338	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050829.2	NM_022034	Silent
PSTK	118672	hgsc.bcm.edu	37	10	124742793	124742793	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:124742793T>A	ENST00000368887.3	+	3	954	c.514T>A	c.(514-516)Ttg>Atg	p.L172M	PSTK_ENST00000405485.1_Missense_Mutation_p.L172M|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	172					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		TTCAGATTCGTTGGGCTTTTG	0.378																																					p.L172M		Atlas-SNP	.											PSTK,NS,lymphoid_neoplasm,0,1	PSTK	34	.	0			c.T514A						.						52.0	51.0	52.0					10																	124742793		2203	4300	6503	SO:0001583	missense	118672	exon3			GATTCGTTGGGCT	AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.514T>A	chr10.hg19:g.124742793T>A	ENSP00000357882:p.Leu172Met	109.0	0.0		96.0	0.0	NM_153336	Q6ZSS9	Missense_Mutation	SNP	ENST00000368887.3	hg19	CCDS7633.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.987176	0.53934	.	.	ENSG00000179988	ENST00000368887;ENST00000405485	T;T	0.30448	1.53;1.53	5.86	0.849	0.18972	.	0.153654	0.41605	D	0.000841	T	0.45175	0.1329	M	0.73962	2.25	0.09310	N	1	P	0.52692	0.955	P	0.57244	0.816	T	0.34900	-0.9810	10	0.52906	T	0.07	-19.4718	9.706	0.40216	0.0:0.3732:0.0:0.6268	.	172	Q8IV42	PSTK_HUMAN	M	172	ENSP00000357882:L172M;ENSP00000384764:L172M	ENSP00000357882:L172M	L	+	1	2	PSTK	124732783	0.114000	0.22134	0.002000	0.10522	0.932000	0.56968	0.517000	0.22832	-0.087000	0.12528	0.460000	0.39030	TTG	.	.		0.378	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050811.1	NM_153336	
MKI67	4288	hgsc.bcm.edu	37	10	129899525	129899525	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:129899525C>T	ENST00000368654.3	-	14	10077	c.9702G>A	c.(9700-9702)aaG>aaA	p.K3234K	MKI67_ENST00000368653.3_Silent_p.K2874K	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3234					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				GGCTTACCTTCTTTGGATTTT	0.408																																					p.K3234K		Atlas-SNP	.											.	MKI67	363	.	0			c.G9702A						.						115.0	108.0	110.0					10																	129899525		2203	4300	6503	SO:0001819	synonymous_variant	4288	exon14			TACCTTCTTTGGA	X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9702G>A	chr10.hg19:g.129899525C>T		77.0	0.0		103.0	5.0	NM_002417	Q5VWH2	Silent	SNP	ENST00000368654.3	hg19	CCDS7659.1																																																																																			.	.		0.408	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050999.1	NM_002417	
LRRC27	80313	hgsc.bcm.edu	37	10	134151182	134151182	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:134151182T>C	ENST00000368614.3	+	3	429	c.324T>C	c.(322-324)tcT>tcC	p.S108S	LRRC27_ENST00000356571.4_Silent_p.S108S|LRRC27_ENST00000368610.3_Silent_p.S46S|LRRC27_ENST00000368612.1_Silent_p.S46S|LRRC27_ENST00000432555.2_5'UTR|LRRC27_ENST00000368613.4_Silent_p.S108S|LRRC27_ENST00000368615.3_Silent_p.S108S|LRRC27_ENST00000392638.2_Silent_p.S108S|LRRC27_ENST00000344079.5_Silent_p.S108S	NM_030626.2	NP_085129.1	Q9C0I9	LRC27_HUMAN	leucine rich repeat containing 27	108										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)	18		all_cancers(35;6.28e-08)|all_epithelial(44;6.75e-06)|Lung NSC(174;0.0108)|all_lung(145;0.0173)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)|Colorectal(31;0.19)		OV - Ovarian serous cystadenocarcinoma(35;9.12e-05)|Epithelial(32;0.000116)|all cancers(32;0.000145)|BRCA - Breast invasive adenocarcinoma(275;0.218)		CGCTTCCTTCTGGGATTGGAG	0.433																																					p.S108S		Atlas-SNP	.											.	LRRC27	64	.	0			c.T324C						.						78.0	76.0	76.0					10																	134151182		2203	4300	6503	SO:0001819	synonymous_variant	80313	exon3			TCCTTCTGGGATT	AB051461	CCDS31316.1, CCDS44496.1	10q26.3	2013-09-20			ENSG00000148814	ENSG00000148814			29346	protein-coding gene	gene with protein product						11214970	Standard	NM_030626		Approved	KIAA1674	uc010quw.1	Q9C0I9	OTTHUMG00000019284	ENST00000368614.3:c.324T>C	chr10.hg19:g.134151182T>C		85.0	0.0		104.0	5.0	NM_001143757	A6NE72|A6NJB4|A6NKD3|D3DRH0|Q5SZH6|Q5SZH8|Q5SZH9|Q86XT5|Q8N7C8|Q8NA21	Silent	SNP	ENST00000368614.3	hg19	CCDS31316.1	.	.	.	.	.	.	.	.	.	.	T	0.034	-1.317225	0.01331	.	.	ENSG00000148814	ENST00000450442	.	.	.	4.84	-2.8	0.05823	.	.	.	.	.	T	0.39064	0.1064	.	.	.	0.52501	D	0.999958	.	.	.	.	.	.	T	0.25363	-1.0134	4	.	.	.	-0.2086	2.1069	0.03693	0.1194:0.2763:0.1221:0.4822	.	.	.	.	P	60	.	.	L	+	2	0	LRRC27	134001172	0.150000	0.22732	0.024000	0.17045	0.003000	0.03518	-0.586000	0.05787	-1.201000	0.02659	-1.676000	0.00740	CTG	.	.		0.433	LRRC27-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051058.2	XM_290462	
RIC8A	60626	hgsc.bcm.edu	37	11	205324	205324	+	5'Flank	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:205324A>G	ENST00000526104.1	+	0	0				BET1L_ENST00000410108.1_Intron|BET1L_ENST00000529614.2_Missense_Mutation_p.F86S|RP11-304M2.5_ENST00000526963.1_RNA|BET1L_ENST00000332865.6_3'UTR|BET1L_ENST00000325147.9_3'UTR|BET1L_ENST00000486280.1_Missense_Mutation_p.F82S|BET1L_ENST00000382762.3_Missense_Mutation_p.F105S			Q9NPQ8	RIC8A_HUMAN	RIC8 guanine nucleotide exchange factor A						adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|basement membrane organization (GO:0071711)|cell migration involved in gastrulation (GO:0042074)|cell-cell adhesion involved in gastrulation (GO:0070586)|in utero embryonic development (GO:0001701)|vasculature development (GO:0001944)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)|skin(1)	13		all_cancers(49;9.23e-07)|all_epithelial(84;0.000315)|Breast(177;0.00122)|Ovarian(85;0.0202)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;4.45e-27)|Epithelial(43;2.94e-26)|OV - Ovarian serous cystadenocarcinoma(40;5.86e-21)|BRCA - Breast invasive adenocarcinoma(625;3.57e-05)|Lung(200;0.105)|LUSC - Lung squamous cell carcinoma(625;0.122)		CCTGGACAAGAAGTAGGAGAG	0.572																																					p.F105S		Atlas-SNP	.											.	BET1L	7	.	0			c.T314C						.						52.0	57.0	55.0					11																	205324		2202	4300	6502	SO:0001631	upstream_gene_variant	51272	exon4			GACAAGAAGTAGG	AK022870	CCDS7690.1, CCDS65982.1	11p15.5	2013-08-05	2013-08-05		ENSG00000177963	ENSG00000177963			29550	protein-coding gene	gene with protein product		609146	"""resistance to inhibitors of cholinesterase 8 homolog A (C. elegans)"""			10985349, 11230166	Standard	XM_005253052		Approved	synembryn, synembryn-A	uc001lof.3	Q9NPQ8	OTTHUMG00000119069		chr11.hg19:g.205324A>G	Exception_encountered	97.0	0.0		123.0	5.0	NM_001098787	Q0P508|Q2T9J1|Q7Z352|Q96EZ1|Q96SZ2|Q9H064|Q9H5H3|Q9H9E7	Missense_Mutation	SNP	ENST00000526104.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.18	3.050211	0.55218	.	.	ENSG00000177951	ENST00000382762;ENST00000529614;ENST00000486280	.	.	.	5.2	5.2	0.72013	.	0.319896	0.28241	N	0.016069	T	0.46054	0.1373	L	0.27053	0.805	0.34001	D	0.650324	B	0.06786	0.001	B	0.10450	0.005	T	0.55231	-0.8173	9	0.44086	T	0.13	.	14.2391	0.65945	1.0:0.0:0.0:0.0	.	105	Q9NYM9	BET1L_HUMAN	S	105;86;82	.	ENSP00000372210:F105S	F	-	2	0	BET1L	195324	1.000000	0.71417	0.990000	0.47175	0.567000	0.35839	9.093000	0.94163	1.964000	0.57103	0.379000	0.24179	TTC	.	.		0.572	RIC8A-002	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000384761.1	NM_021932	
MRGPRE	116534	hgsc.bcm.edu	37	11	3249741	3249741	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:3249741T>C	ENST00000389832.5	-	2	595	c.289A>G	c.(289-291)Acc>Gcc	p.T97A	MRGPRE_ENST00000436689.2_Missense_Mutation_p.T96A|AC109309.4_ENST00000418995.2_RNA			Q86SM8	MRGRE_HUMAN	MAS-related GPR, member E	97						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	19		Medulloblastoma(188;0.00106)|all_epithelial(84;0.00111)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00529)|LUSC - Lung squamous cell carcinoma(625;0.19)		GCCAGGCTGGTCTGCACGAAG	0.667																																					p.T97A		Atlas-SNP	.											.	MRGPRE	35	.	0			c.A289G						.						44.0	54.0	51.0					11																	3249741		2178	4274	6452	SO:0001583	missense	116534	exon2			GGCTGGTCTGCAC	AY255572	CCDS41603.1, CCDS41603.2	11p15.5	2012-08-21	2004-03-25		ENSG00000184350	ENSG00000184350		"""GPCR / Class A : Orphans"""	30694	protein-coding gene	gene with protein product		607232	"""G protein-coupled receptor 167"""	GPR167		11551509	Standard	NM_001039165		Approved	mrgE	uc001lxq.5	Q86SM8	OTTHUMG00000011708	ENST00000389832.5:c.289A>G	chr11.hg19:g.3249741T>C	ENSP00000374482:p.Thr97Ala	73.0	0.0		134.0	6.0	NM_001039165	Q2M1V7	Missense_Mutation	SNP	ENST00000389832.5	hg19		.	.	.	.	.	.	.	.	.	.	t	4.323	0.059308	0.08339	.	.	ENSG00000184350	ENST00000436689;ENST00000389832	.	.	.	3.48	-4.87	0.03123	GPCR, rhodopsin-like superfamily (1);	1.230950	0.06196	N	0.682246	T	0.15609	0.0376	N	0.04880	-0.145	0.09310	N	1	B	0.18610	0.029	B	0.28232	0.087	T	0.33214	-0.9877	9	0.13108	T	0.6	-6.0187	6.3775	0.21515	0.0:0.4025:0.163:0.4345	.	96	Q86SM8	MRGRE_HUMAN	A	97;96	.	ENSP00000374482:T96A	T	-	1	0	MRGPRE	3206317	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.162000	0.03141	-0.657000	0.05373	-0.425000	0.05940	ACC	.	.		0.667	MRGPRE-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000032346.5	XM_171536	
SMPD1	6609	hgsc.bcm.edu	37	11	6412065	6412065	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:6412065G>A	ENST00000342245.4	+	1	405	c.237G>A	c.(235-237)cgG>cgA	p.R79R	SMPD1_ENST00000527275.1_Silent_p.R79R|SMPD1_ENST00000533196.1_Intron|SMPD1_ENST00000356761.2_Silent_p.R79R|SMPD1_ENST00000299397.3_Silent_p.R79R	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	77					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	TAGTGCCCCGGCTCCGAGATG	0.607																																					p.R79R		Atlas-SNP	.											.	SMPD1	108	.	0			c.G237A						.						56.0	59.0	58.0					11																	6412065		2201	4296	6497	SO:0001819	synonymous_variant	6609	exon1			GCCCCGGCTCCGA	AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.237G>A	chr11.hg19:g.6412065G>A		88.0	0.0		89.0	23.0	NM_000543	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Silent	SNP	ENST00000342245.4	hg19	CCDS44531.1																																																																																			.	.		0.607	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000384205.1	NM_000543	
RBMXL2	27288	hgsc.bcm.edu	37	11	7111267	7111267	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:7111267G>T	ENST00000306904.5	+	1	1103	c.916G>T	c.(916-918)Ggc>Tgc	p.G306C		NM_014469.4	NP_055284.3	O75526	RMXL2_HUMAN	RNA binding motif protein, X-linked-like 2	306	Arg/Gly/Pro-rich.					nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15				Epithelial(150;5.14e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		CGGAGGAGGAGGCCGCTACGA	0.667																																					p.G306C		Atlas-SNP	.											.	RBMXL2	47	.	0			c.G916T						.						18.0	21.0	20.0					11																	7111267		2198	4293	6491	SO:0001583	missense	27288	exon1			GGAGGAGGCCGCT	AF069682	CCDS7777.1	11p15	2013-07-16				ENSG00000170748		"""RNA binding motif (RRM) containing"""	17886	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G T"""	605444				10958650	Standard	NM_014469		Approved	HNRNPG-T, HNRPGT	uc001mfc.2	O75526		ENST00000306904.5:c.916G>T	chr11.hg19:g.7111267G>T	ENSP00000304139:p.Gly306Cys	86.0	0.0		109.0	48.0	NM_014469	Q6PEZ2|Q9NQU0	Missense_Mutation	SNP	ENST00000306904.5	hg19	CCDS7777.1	.	.	.	.	.	.	.	.	.	.	g	12.81	2.050157	0.36181	.	.	ENSG00000170748	ENST00000306904	T	0.78816	-1.21	3.51	-0.579	0.11720	.	0.220955	0.46145	U	0.000308	T	0.74642	0.3743	L	0.38531	1.155	0.30422	N	0.777987	D	0.76494	0.999	D	0.65573	0.936	T	0.68416	-0.5414	10	0.36615	T	0.2	.	4.0236	0.09677	0.4188:0.1771:0.404:0.0	.	306	O75526	HNRGT_HUMAN	C	306	ENSP00000304139:G306C	ENSP00000304139:G306C	G	+	1	0	RBMXL2	7067843	1.000000	0.71417	0.470000	0.27216	0.848000	0.48234	3.677000	0.54619	-0.098000	0.12285	-1.096000	0.02151	GGC	.	.		0.667	RBMXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384552.1	NM_014469	
SCUBE2	57758	hgsc.bcm.edu	37	11	9052315	9052315	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:9052315A>G	ENST00000309263.3	-	17	2316	c.2244T>C	c.(2242-2244)tgT>tgC	p.C748C	SCUBE2_ENST00000520467.1_Silent_p.C720C|SCUBE2_ENST00000457346.2_Silent_p.C777C|RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000450649.2_Silent_p.C622C			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	748						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CTCTGGTTTCACAGTCCTGAA	0.547																																					p.C720C		Atlas-SNP	.											.	SCUBE2	102	.	0			c.T2160C						.						114.0	114.0	114.0					11																	9052315		2201	4296	6497	SO:0001819	synonymous_variant	57758	exon17			GGTTTCACAGTCC	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2244T>C	chr11.hg19:g.9052315A>G		64.0	0.0		58.0	4.0	NM_020974	Q2NKQ8|Q6ZWI1	Silent	SNP	ENST00000309263.3	hg19																																																																																				.	.		0.547	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
SCUBE2	57758	hgsc.bcm.edu	37	11	9082018	9082018	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:9082018T>C	ENST00000309263.3	-	8	976	c.904A>G	c.(904-906)Aca>Gca	p.T302A	SCUBE2_ENST00000520467.1_Missense_Mutation_p.T302A|SCUBE2_ENST00000457346.2_Missense_Mutation_p.T302A|SCUBE2_ENST00000450649.2_Missense_Mutation_p.T302A|RP11-467K18.2_ENST00000521394.2_RNA			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	302	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		TGGACACCTGTCGAAGTATCC	0.512																																					p.T302A		Atlas-SNP	.											.	SCUBE2	102	.	0			c.A904G						.						172.0	154.0	160.0					11																	9082018		2201	4296	6497	SO:0001583	missense	57758	exon8			CACCTGTCGAAGT	AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.904A>G	chr11.hg19:g.9082018T>C	ENSP00000310658:p.Thr302Ala	72.0	0.0		87.0	6.0	NM_001170690	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	ENST00000309263.3	hg19		.	.	.	.	.	.	.	.	.	.	T	21.7	4.184039	0.78677	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	D;D;D;D	0.87179	-2.22;-2.22;-2.22;-2.22	5.94	5.94	0.96194	Epidermal growth factor-like (1);	0.000000	0.85682	D	0.000000	D	0.92071	0.7487	L	0.56769	1.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.998	D	0.91709	0.5380	10	0.45353	T	0.12	.	16.4075	0.83691	0.0:0.0:0.0:1.0	.	302;302;302	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	A	302	ENSP00000390481:T302A;ENSP00000310658:T302A;ENSP00000415187:T302A;ENSP00000429969:T302A	ENSP00000310658:T302A	T	-	1	0	SCUBE2	9038594	1.000000	0.71417	0.943000	0.38184	0.979000	0.70002	8.040000	0.89188	2.275000	0.75901	0.528000	0.53228	ACA	.	.		0.512	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000385812.2	NM_020974	
WEE1	7465	hgsc.bcm.edu	37	11	9598196	9598196	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:9598196T>C	ENST00000450114.2	+	4	1262	c.1009T>C	c.(1009-1011)Tct>Cct	p.S337P	snoU13_ENST00000458785.1_RNA|WEE1_ENST00000299613.6_Missense_Mutation_p.S123P	NM_003390.3	NP_003381.1	P30291	WEE1_HUMAN	WEE1 G2 checkpoint kinase	337	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				blood coagulation (GO:0007596)|establishment of cell polarity (GO:0030010)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|neuron projection morphogenesis (GO:0048812)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	23				all cancers(16;4.59e-09)|Epithelial(150;3.15e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0484)		ATTGGCGGGCTCTGTTGATGA	0.398																																					p.S337P		Atlas-SNP	.											.	WEE1	54	.	0			c.T1009C						.						92.0	97.0	95.0					11																	9598196		2201	4294	6495	SO:0001583	missense	7465	exon4			GCGGGCTCTGTTG	X62048	CCDS7800.1, CCDS44536.1	11p15.4	2013-10-21	2013-10-21		ENSG00000166483	ENSG00000166483			12761	protein-coding gene	gene with protein product		193525	"""wee1+ (S. pombe) homolog"", ""WEE1 homolog (S. pombe)"""			1840647	Standard	NM_003390		Approved		uc001mhs.3	P30291	OTTHUMG00000165863	ENST00000450114.2:c.1009T>C	chr11.hg19:g.9598196T>C	ENSP00000402084:p.Ser337Pro	157.0	0.0		149.0	6.0	NM_003390	B3KVE1|D3DQV0	Missense_Mutation	SNP	ENST00000450114.2	hg19	CCDS7800.1	.	.	.	.	.	.	.	.	.	.	T	28.7	4.945667	0.92593	.	.	ENSG00000166483	ENST00000450114;ENST00000299613	T;T	0.67865	-0.29;-0.29	5.61	5.61	0.85477	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72985	0.3529	L	0.52126	1.63	0.80722	D	1	P;P	0.45715	0.865;0.772	P;P	0.54431	0.752;0.52	T	0.71520	-0.4568	10	0.36615	T	0.2	-12.1839	15.8077	0.78527	0.0:0.0:0.0:1.0	.	145;337	Q6MZL0;P30291	.;WEE1_HUMAN	P	337;123	ENSP00000402084:S337P;ENSP00000299613:S123P	ENSP00000299613:S123P	S	+	1	0	WEE1	9554772	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.655000	0.83696	2.132000	0.65825	0.528000	0.53228	TCT	.	.		0.398	WEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386757.1	NM_003390	
SWAP70	23075	hgsc.bcm.edu	37	11	9761767	9761767	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:9761767T>C	ENST00000318950.6	+	9	1331	c.1228T>C	c.(1228-1230)Tct>Cct	p.S410P	SWAP70_ENST00000447399.2_Missense_Mutation_p.S352P	NM_015055.2	NP_055870.2	Q9UH65	SWP70_HUMAN	SWAP switching B-cell complex 70kDa subunit	410					isotype switching (GO:0045190)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	11				all cancers(16;1.21e-10)|Epithelial(150;2.81e-09)|BRCA - Breast invasive adenocarcinoma(625;0.00649)		TCAAAAGTCCTCTGAACTGGA	0.468																																					p.S410P		Atlas-SNP	.											.	SWAP70	40	.	0			c.T1228C						.						89.0	83.0	85.0					11																	9761767		2201	4294	6495	SO:0001583	missense	23075	exon9			AAGTCCTCTGAAC	AB014540	CCDS31426.1, CCDS73257.1	11p15	2013-01-10			ENSG00000133789	ENSG00000133789		"""Pleckstrin homology (PH) domain containing"", ""EF-hand domain containing"""	17070	protein-coding gene	gene with protein product		604762				9734811, 10681448	Standard	XM_005252829		Approved	KIAA0640, SWAP-70	uc001mhw.3	Q9UH65	OTTHUMG00000165865	ENST00000318950.6:c.1228T>C	chr11.hg19:g.9761767T>C	ENSP00000315630:p.Ser410Pro	60.0	0.0		106.0	5.0	NM_015055	D3DQV1|O75135|Q7LCY6|Q9P061|Q9P0Z8	Missense_Mutation	SNP	ENST00000318950.6	hg19	CCDS31426.1	.	.	.	.	.	.	.	.	.	.	T	14.43	2.533453	0.45073	.	.	ENSG00000133789	ENST00000447399;ENST00000318950	T;T	0.30448	1.95;1.53	5.25	5.25	0.73442	.	0.244803	0.40064	N	0.001183	T	0.25005	0.0607	N	0.19112	0.55	0.34726	D	0.729236	P;P;D	0.56521	0.875;0.641;0.976	B;B;P	0.47864	0.276;0.188;0.559	T	0.34179	-0.9839	10	0.44086	T	0.13	-3.496	10.4245	0.44369	0.1455:0.0:0.0:0.8545	.	352;410;352	E7EMB1;Q9UH65;B3KUB9	.;SWP70_HUMAN;.	P	352;410	ENSP00000399056:S352P;ENSP00000315630:S410P	ENSP00000315630:S410P	S	+	1	0	SWAP70	9718343	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	3.807000	0.55591	1.980000	0.57719	0.482000	0.46254	TCT	.	.		0.468	SWAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386766.2	NM_015055	
KCNJ11	3767	hgsc.bcm.edu	37	11	17409184	17409184	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:17409184T>C	ENST00000339994.4	-	1	1022	c.455A>G	c.(454-456)cAg>cGg	p.Q152R	KCNJ11_ENST00000526747.1_5'Flank|KCNJ11_ENST00000528731.1_Missense_Mutation_p.Q65R	NM_000525.3	NP_000516.3	Q14654	KCJ11_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 11	152					cellular response to glucose stimulus (GO:0071333)|cellular response to nicotine (GO:0071316)|cellular response to tumor necrosis factor (GO:0071356)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|negative regulation of insulin secretion (GO:0046676)|neurological system process (GO:0050877)|positive regulation of cation channel activity (GO:2001259)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ischemia (GO:0002931)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	ATP-sensitive potassium channel complex (GO:0008282)|axolemma (GO:0030673)|cell body fiber (GO:0070852)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|mitochondrion (GO:0005739)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)|ion channel binding (GO:0044325)|potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(3)|skin(2)	16				READ - Rectum adenocarcinoma(2;0.0276)|Colorectal(2;0.0633)	Diazoxide(DB01119)|Glimepiride(DB00222)|Glyburide(DB01016)|Ibutilide(DB00308)|Levosimendan(DB00922)|Thiamylal(DB01154)|Verapamil(DB00661)|Yohimbine(DB01392)	CACGATGTTCTGCACGATGAG	0.557											OREG0020810	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q152R		Atlas-SNP	.											.	KCNJ11	39	.	0			c.A455G						.						115.0	92.0	100.0					11																	17409184		2200	4293	6493	SO:0001583	missense	3767	exon1			ATGTTCTGCACGA	D50582	CCDS31436.1, CCDS53606.1	11p15.1	2011-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6257	protein-coding gene	gene with protein product		600937				7502040, 16382105	Standard	NM_001166290		Approved	Kir6.2, BIR	uc001mna.3	Q14654		ENST00000339994.4:c.455A>G	chr11.hg19:g.17409184T>C	ENSP00000345708:p.Gln152Arg	63.0	0.0	717	84.0	4.0	NM_000525	B4DWI4|E9PNK0|Q2M1H7|Q58EX3|Q8IW96	Missense_Mutation	SNP	ENST00000339994.4	hg19	CCDS31436.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.943577	0.73672	.	.	ENSG00000187486	ENST00000339994;ENST00000528731;ENST00000526912	D;D;D	0.96136	-3.92;-3.92;-3.92	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	D	0.98340	0.9449	H	0.95679	3.705	0.58432	D	0.999995	D	0.65815	0.995	D	0.81914	0.995	D	0.99612	1.0981	10	0.87932	D	0	.	14.5548	0.68094	0.0:0.0:0.0:1.0	.	152	B2RC52	.	R	152;65;65	ENSP00000345708:Q152R;ENSP00000434755:Q65R;ENSP00000432729:Q65R	ENSP00000345708:Q152R	Q	-	2	0	KCNJ11	17365760	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	8.040000	0.89188	1.850000	0.53721	0.379000	0.24179	CAG	.	.		0.557	KCNJ11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387037.1	NM_000525	
PRMT3	10196	hgsc.bcm.edu	37	11	20409581	20409581	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:20409581G>T	ENST00000331079.6	+	2	262	c.45G>T	c.(43-45)gtG>gtT	p.V15V	PRMT3_ENST00000437750.2_Intron	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	15					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						GGGGCGCTGTGGAGAATGAGG	0.667																																					p.V15V		Atlas-SNP	.											.	PRMT3	50	.	0			c.G45T						.						55.0	51.0	53.0					11																	20409581		2202	4300	6502	SO:0001819	synonymous_variant	10196	exon2			CGCTGTGGAGAAT	AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.45G>T	chr11.hg19:g.20409581G>T		185.0	0.0		212.0	76.0	NM_005788	B4DUC7	Silent	SNP	ENST00000331079.6	hg19	CCDS7853.1																																																																																			.	.		0.667	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387489.1	NM_005788	
FANCF	2188	hgsc.bcm.edu	37	11	22646565	22646565	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:22646565A>G	ENST00000327470.3	-	1	822	c.792T>C	c.(790-792)acT>acC	p.T264T	AC103801.2_ENST00000428556.2_5'Flank	NM_022725.3	NP_073562.1	Q9NPI8	FANCF_HUMAN	Fanconi anemia, complementation group F	264					DNA repair (GO:0006281)|ovarian follicle development (GO:0001541)|spermatogenesis (GO:0007283)	Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)	ubiquitin-protein transferase activity (GO:0004842)			kidney(3)|large_intestine(3)|lung(6)|skin(1)	13						GGTGGCGGCTAGTCACTAAAG	0.552			"""N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia		OREG0020844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T264T		Atlas-SNP	.	yes	Rec		Fanconi anaemia F	11	11p15	2188	"""Fanconi anemia, complementation group F"""		L	.	FANCF	24	.	0			c.T792C						.						51.0	61.0	58.0					11																	22646565		2203	4300	6503	SO:0001819	synonymous_variant	2188	exon1	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GCGGCTAGTCACT		CCDS7857.1	11p15	2014-09-17				ENSG00000183161		"""Fanconi anemia, complementation groups"""	3587	protein-coding gene	gene with protein product		613897				9382107	Standard	NM_022725		Approved	FAF	uc001mql.1	Q9NPI8		ENST00000327470.3:c.792T>C	chr11.hg19:g.22646565A>G		67.0	0.0	757	108.0	33.0	NM_022725	Q52LM0	Silent	SNP	ENST00000327470.3	hg19	CCDS7857.1																																																																																			.	.		0.552	FANCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387712.2	NM_022725	
BDNF	627	hgsc.bcm.edu	37	11	27695819	27695819	+	5'UTR	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:27695819T>C	ENST00000420794.1	-	0	153				BDNF_ENST00000438929.1_Missense_Mutation_p.T5A|BDNF_ENST00000314915.6_Intron|BDNF_ENST00000533131.1_Intron|BDNF-AS_ENST00000499568.2_RNA|BDNF_ENST00000395980.2_Intron|BDNF_ENST00000525950.1_Intron|BDNF_ENST00000418212.1_Intron|BDNF_ENST00000530861.1_Intron|BDNF-AS_ENST00000530686.1_RNA|BDNF_ENST00000395978.3_Intron|BDNF-AS_ENST00000501663.2_RNA|BDNF_ENST00000395986.2_Intron|BDNF-AS_ENST00000499008.3_RNA|BDNF_ENST00000395981.3_Intron|BDNF_ENST00000356660.4_Intron|BDNF-AS_ENST00000502161.2_RNA|BDNF-AS_ENST00000501176.2_RNA|BDNF_ENST00000584049.1_Intron|BDNF-AS_ENST00000500662.2_RNA|BDNF_ENST00000395983.3_Intron|BDNF_ENST00000533246.1_Intron|BDNF_ENST00000532997.1_Intron	NM_001143811.1	NP_001137283.1	P23560	BDNF_HUMAN	brain-derived neurotrophic factor						axon extension (GO:0048675)|axon guidance (GO:0007411)|axon target recognition (GO:0007412)|behavioral fear response (GO:0001662)|chronic inflammatory response (GO:0002544)|circadian rhythm (GO:0007623)|dendrite development (GO:0016358)|dendrite extension (GO:0097484)|feeding behavior (GO:0007631)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glutamate secretion (GO:0014047)|inner ear development (GO:0048839)|learning or memory (GO:0007611)|mechanoreceptor differentiation (GO:0042490)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|nerve development (GO:0021675)|nervous system development (GO:0007399)|neuron recognition (GO:0008038)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of synapse assembly (GO:0051965)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of retinal cell programmed cell death (GO:0046668)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|response to anesthetic (GO:0072347)|response to fluoxetine (GO:0014076)|response to hormone (GO:0009725)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to vitamin A (GO:0033189)|taste bud development (GO:0061193)|ureteric bud development (GO:0001657)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	growth factor activity (GO:0008083)			breast(1)|large_intestine(3)|lung(2)	6						AGAAAACTGGTGGCTCCACAC	0.408																																					p.T5A		Atlas-SNP	.											.	BDNF	63	.	0			c.A13G						.						72.0	66.0	68.0					11																	27695819		1567	3577	5144	SO:0001623	5_prime_UTR_variant	627	exon2			AACTGGTGGCTCC	AB038670	CCDS7865.1, CCDS7866.1, CCDS44558.1, CCDS41628.1	11p14.1	2014-01-30			ENSG00000176697	ENSG00000176697		"""Endogenous ligands"""	1033	protein-coding gene	gene with protein product	"""neurotrophin"""	113505				2236018, 1889806, 17942328, 17493809	Standard	NM_170731		Approved		uc009yje.3	P23560	OTTHUMG00000178797	ENST00000420794.1:c.-351A>G	chr11.hg19:g.27695819T>C		91.0	0.0		94.0	4.0	NM_001143810	A7LA85|A7LA92|D3DQZ2|Q598Q1|Q6DN19|Q6YNR2|Q6YNR3|Q9BYY7|Q9UC24	Missense_Mutation	SNP	ENST00000420794.1	hg19	CCDS7866.1	.	.	.	.	.	.	.	.	.	.	T	3.356	-0.131525	0.06753	.	.	ENSG00000176697	ENST00000438929	T	0.56275	0.47	5.92	0.773	0.18516	.	.	.	.	.	T	0.37320	0.0999	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.17776	-1.0358	8	0.87932	D	0	.	3.3116	0.07018	0.2581:0.2254:0.0:0.5166	.	5	P23560-4	.	A	5	ENSP00000414303:T5A	ENSP00000414303:T5A	T	-	1	0	BDNF	27652395	0.993000	0.37304	0.561000	0.28357	0.009000	0.06853	0.277000	0.18734	-0.118000	0.11851	-0.256000	0.11100	ACC	.	.		0.408	BDNF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_170735	
TTC17	55761	hgsc.bcm.edu	37	11	43411338	43411338	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:43411338G>C	ENST00000039989.4	+	3	400	c.386G>C	c.(385-387)gGc>gCc	p.G129A	TTC17_ENST00000299240.6_Missense_Mutation_p.G129A|RP11-484D2.4_ENST00000394183.2_RNA	NM_018259.5	NP_060729.2	Q96AE7	TTC17_HUMAN	tetratricopeptide repeat domain 17	129					actin filament polymerization (GO:0030041)|cilium organization (GO:0044782)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(27)|ovary(5)|prostate(3)|skin(3)	53						CTATATGATGGCACATACATA	0.393																																					p.G129A		Atlas-SNP	.											.	TTC17	112	.	0			c.G386C						.						136.0	133.0	134.0					11																	43411338		2203	4300	6503	SO:0001583	missense	55761	exon3			ATGATGGCACATA	AK001540	CCDS31466.1	11p11.2	2013-01-10			ENSG00000052841	ENSG00000052841		"""Tetratricopeptide (TTC) repeat domain containing"""	25596	protein-coding gene	gene with protein product						12477932	Standard	NM_018259		Approved	FLJ10890	uc001mxi.3	Q96AE7	OTTHUMG00000166398	ENST00000039989.4:c.386G>C	chr11.hg19:g.43411338G>C	ENSP00000039989:p.Gly129Ala	215.0	0.0		198.0	57.0	NM_018259	G3XAB3|Q8NEC0	Missense_Mutation	SNP	ENST00000039989.4	hg19	CCDS31466.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476333	0.84640	.	.	ENSG00000052841	ENST00000299240;ENST00000039989	T;T	0.31510	1.49;1.49	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.45776	0.1359	L	0.51422	1.61	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.998	P;D;D	0.75020	0.792;0.985;0.948	T	0.27938	-1.0059	10	0.02654	T	1	-14.4097	18.713	0.91664	0.0:0.0:1.0:0.0	.	129;129;129	Q8NEC0;Q96AE7;G3XAB3	.;TTC17_HUMAN;.	A	129	ENSP00000299240:G129A;ENSP00000039989:G129A	ENSP00000039989:G129A	G	+	2	0	TTC17	43367914	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.813000	0.99286	2.477000	0.83638	0.563000	0.77884	GGC	.	.		0.393	TTC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389577.2	NM_018259	
ACCS	84680	hgsc.bcm.edu	37	11	44102738	44102738	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:44102738A>G	ENST00000263776.8	+	12	1413	c.979A>G	c.(979-981)Atg>Gtg	p.M327V		NM_001127219.1|NM_032592.3	NP_001120691.1|NP_115981.1	Q96QU6	1A1L1_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)	327					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			breast(4)|endometrium(3)|large_intestine(11)|lung(15)|ovary(1)|skin(1)	35						GGACTTCGGGATGTCTGGGCT	0.632																																					p.M327V	Esophageal Squamous(158;148 1889 8077 23160 41213)	Atlas-SNP	.											.	ACCS	64	.	0			c.A979G						.						96.0	91.0	93.0					11																	44102738		2203	4300	6503	SO:0001583	missense	84680	exon12			TTCGGGATGTCTG	AY026508	CCDS7907.1	11p11	2008-03-12	2008-01-28		ENSG00000110455	ENSG00000110455			23989	protein-coding gene	gene with protein product		608405				11470512	Standard	NM_032592		Approved	PHACS, ACS	uc009yks.1	Q96QU6	OTTHUMG00000166427	ENST00000263776.8:c.979A>G	chr11.hg19:g.44102738A>G	ENSP00000263776:p.Met327Val	101.0	0.0		140.0	6.0	NM_032592	B4E219|Q8WUL4|Q96LX5	Missense_Mutation	SNP	ENST00000263776.8	hg19	CCDS7907.1	.	.	.	.	.	.	.	.	.	.	A	1.320	-0.599861	0.03744	.	.	ENSG00000110455	ENST00000263776	D	0.90133	-2.62	5.31	2.98	0.34508	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.153558	0.64402	D	0.000007	T	0.80369	0.4610	N	0.20845	0.615	0.80722	D	1	B	0.16166	0.016	B	0.24006	0.05	T	0.69202	-0.5207	10	0.27785	T	0.31	-26.1217	4.9596	0.14059	0.6855:0.1684:0.1462:0.0	.	327	Q96QU6	1A1L1_HUMAN	V	327	ENSP00000263776:M327V	ENSP00000263776:M327V	M	+	1	0	ACCS	44059314	1.000000	0.71417	1.000000	0.80357	0.042000	0.13812	4.031000	0.57267	0.844000	0.35094	-0.316000	0.08728	ATG	.	.		0.632	ACCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389721.1	NM_032592	
CKAP5	9793	hgsc.bcm.edu	37	11	46818446	46818446	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:46818446T>C	ENST00000529230.1	-	12	1429	c.1383A>G	c.(1381-1383)gaA>gaG	p.E461E	CKAP5_ENST00000415402.1_Silent_p.E461E|CKAP5_ENST00000532321.1_5'Flank|CKAP5_ENST00000312055.5_Silent_p.E461E|CKAP5_ENST00000354558.3_Silent_p.E461E			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	461					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						TACCCAATGCTTCAAATGCGG	0.413																																					p.E461E	Ovarian(4;85 273 2202 4844 13323)	Atlas-SNP	.											.	CKAP5	134	.	0			c.A1383G						.						153.0	131.0	139.0					11																	46818446		2201	4299	6500	SO:0001819	synonymous_variant	9793	exon12			CAATGCTTCAAAT		CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.1383A>G	chr11.hg19:g.46818446T>C		142.0	0.0		145.0	6.0	NM_001008938	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Silent	SNP	ENST00000529230.1	hg19	CCDS31477.1																																																																																			.	.		0.413	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390679.1	NM_014756	
FNBP4	23360	hgsc.bcm.edu	37	11	47758184	47758184	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:47758184T>C	ENST00000263773.5	-	9	1577	c.1565A>G	c.(1564-1566)gAa>gGa	p.E522G	FNBP4_ENST00000534003.1_5'UTR	NM_015308.2	NP_056123.2	Q8N3X1	FNBP4_HUMAN	formin binding protein 4	522						nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	44						ATCCTGTTCTTCTTCTACTTT	0.313																																					p.E522G		Atlas-SNP	.											.	FNBP4	99	.	0			c.A1565G						.						157.0	133.0	140.0					11																	47758184		1792	4062	5854	SO:0001583	missense	23360	exon9			TGTTCTTCTTCTA	BC037404	CCDS41644.1	11q12.1	2008-02-05			ENSG00000109920	ENSG00000109920			19752	protein-coding gene	gene with protein product		615265				10231032	Standard	NM_015308		Approved	KIAA1014	uc009ylv.3	Q8N3X1	OTTHUMG00000166533	ENST00000263773.5:c.1565A>G	chr11.hg19:g.47758184T>C	ENSP00000263773:p.Glu522Gly	87.0	0.0		81.0	4.0	NM_015308	Q9H985|Q9NT81|Q9Y2L7	Missense_Mutation	SNP	ENST00000263773.5	hg19	CCDS41644.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.069603	0.76301	.	.	ENSG00000109920	ENST00000263773	T	0.13089	2.62	6.16	6.16	0.99307	.	0.285900	0.43579	D	0.000555	T	0.16041	0.0386	N	0.19112	0.55	0.58432	D	0.999996	D	0.59767	0.986	P	0.50970	0.655	T	0.01283	-1.1396	10	0.72032	D	0.01	-11.1806	14.1793	0.65564	0.0:0.0:0.0:1.0	.	522	Q8N3X1	FNBP4_HUMAN	G	522	ENSP00000263773:E522G	ENSP00000263773:E522G	E	-	2	0	FNBP4	47714760	1.000000	0.71417	1.000000	0.80357	0.923000	0.55619	4.233000	0.58651	2.367000	0.80283	0.528000	0.53228	GAA	.	.		0.313	FNBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390237.3		
OR4C15	81309	hgsc.bcm.edu	37	11	55322070	55322070	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:55322070A>G	ENST00000314644.2	+	1	288	c.288A>G	c.(286-288)ctA>ctG	p.L96L		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	42						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GCAACATGCTAATTGTAGTAA	0.438										HNSCC(20;0.049)																											p.L96L		Atlas-SNP	.											.	OR4C15	145	.	0			c.A288G						.						161.0	134.0	143.0					11																	55322070		2201	4296	6497	SO:0001819	synonymous_variant	81309	exon1			CATGCTAATTGTA	BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.288A>G	chr11.hg19:g.55322070A>G		59.0	0.0		77.0	4.0	NM_001001920	Q6IFE2	Silent	SNP	ENST00000314644.2	hg19	CCDS31501.1																																																																																			.	.		0.438	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391164.1	NM_001001920	
OR5F1	338674	hgsc.bcm.edu	37	11	55761365	55761365	+	Missense_Mutation	SNP	G	G	A	rs377087548		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:55761365G>A	ENST00000278409.1	-	1	736	c.737C>T	c.(736-738)aCa>aTa	p.T246I		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	246					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AATTATGGCTGTCAGGTGAGA	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18311	0.0		0.0	False		,,,				2504	0.001				p.T246I		Atlas-SNP	.											.	OR5F1	116	.	0			c.C737T						.						86.0	82.0	84.0					11																	55761365		2201	4296	6497	SO:0001583	missense	338674	exon1			ATGGCTGTCAGGT	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.737C>T	chr11.hg19:g.55761365G>A	ENSP00000278409:p.Thr246Ile	92.0	0.0		84.0	34.0	NM_003697	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	hg19	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	G	3.668	-0.068137	0.07228	.	.	ENSG00000149133	ENST00000278409	T	0.36157	1.27	2.99	-1.74	0.08056	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.33760	0.0874	L	0.52266	1.64	0.09310	N	1	P	0.39601	0.68	B	0.43155	0.41	T	0.30504	-0.9976	9	0.51188	T	0.08	.	8.5481	0.33435	0.5023:0.0:0.4977:0.0	.	246	O95221	OR5F1_HUMAN	I	246	ENSP00000278409:T246I	ENSP00000278409:T246I	T	-	2	0	OR5F1	55517941	0.000000	0.05858	0.028000	0.17463	0.115000	0.19883	-0.029000	0.12329	-0.336000	0.08438	-0.738000	0.03535	ACA	.	.		0.493	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
OR5T2	219464	hgsc.bcm.edu	37	11	56000212	56000212	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:56000212T>A	ENST00000313264.4	-	1	525	c.450A>T	c.(448-450)gaA>gaT	p.E150D		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AGAGAAAGCATTCTGTGGTTC	0.423																																					p.E150D		Atlas-SNP	.											.	OR5T2	107	.	0			c.A450T						.						178.0	153.0	161.0					11																	56000212		2201	4296	6497	SO:0001583	missense	219464	exon1			AAAGCATTCTGTG	AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.450A>T	chr11.hg19:g.56000212T>A	ENSP00000323688:p.Glu150Asp	177.0	0.0		208.0	77.0	NM_001004746	B9EGX5|Q6IFC8	Missense_Mutation	SNP	ENST00000313264.4	hg19	CCDS31523.1	.	.	.	.	.	.	.	.	.	.	T	18.28	3.588863	0.66105	.	.	ENSG00000181718	ENST00000313264	T	0.00354	7.92	5.07	-1.8	0.07907	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000668	T	0.00271	0.0008	L	0.55481	1.735	0.09310	N	0.999995	P	0.44690	0.841	B	0.41412	0.356	T	0.50533	-0.8817	10	0.62326	D	0.03	.	11.3966	0.49845	0.0:0.5914:0.0:0.4086	.	150	Q8NGG2	OR5T2_HUMAN	D	150	ENSP00000323688:E150D	ENSP00000323688:E150D	E	-	3	2	OR5T2	55756788	0.000000	0.05858	0.938000	0.37757	0.731000	0.41821	-1.558000	0.02164	-0.164000	0.10927	0.386000	0.25728	GAA	.	.		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391598.1	NM_001004746	
FAM111B	374393	hgsc.bcm.edu	37	11	58892143	58892143	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:58892143A>G	ENST00000343597.3	+	4	764	c.573A>G	c.(571-573)atA>atG	p.I191M	FAM111B_ENST00000411426.1_Missense_Mutation_p.I161M|FAM111B_ENST00000529618.1_Missense_Mutation_p.I161M	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	191							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						TTGTTGCTATAGGAAGGACAA	0.353																																					p.I191M		Atlas-SNP	.											.	FAM111B	84	.	0			c.A573G						.						105.0	100.0	101.0					11																	58892143		2201	4294	6495	SO:0001583	missense	374393	exon4			TGCTATAGGAAGG	BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.573A>G	chr11.hg19:g.58892143A>G	ENSP00000341565:p.Ile191Met	119.0	0.0		125.0	5.0	NM_198947	B4E2G2|Q6P661	Missense_Mutation	SNP	ENST00000343597.3	hg19	CCDS7972.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.985973	0.35036	.	.	ENSG00000189057	ENST00000411426;ENST00000529618;ENST00000534403;ENST00000343597	T;T;T	0.33216	1.42;1.42;1.42	4.52	-4.46	0.03536	.	1.601420	0.04307	U	0.348379	T	0.27134	0.0665	L	0.52573	1.65	0.09310	N	1	P	0.44578	0.838	P	0.44990	0.466	T	0.35674	-0.9779	10	0.87932	D	0	.	0.5444	0.00651	0.2481:0.233:0.123:0.3959	.	191	Q6SJ93	F111B_HUMAN	M	161;161;161;191	ENSP00000393855:I161M;ENSP00000432875:I161M;ENSP00000341565:I191M	ENSP00000341565:I191M	I	+	3	3	FAM111B	58648719	0.010000	0.17322	0.001000	0.08648	0.004000	0.04260	-0.181000	0.09740	-0.510000	0.06523	-1.870000	0.00554	ATA	.	.		0.353	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393974.1	NM_198947	
DAGLA	747	hgsc.bcm.edu	37	11	61502340	61502340	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:61502340A>G	ENST00000257215.5	+	10	1110	c.994A>G	c.(994-996)Agg>Ggg	p.R332G		NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	332					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		GTGTCCTGCGAGGCCGCGGTT	0.607																																					p.R332G		Atlas-SNP	.											.	DAGLA	109	.	0			c.A994G						.						143.0	120.0	128.0					11																	61502340		2202	4299	6501	SO:0001583	missense	747	exon10			CCTGCGAGGCCGC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.994A>G	chr11.hg19:g.61502340A>G	ENSP00000257215:p.Arg332Gly	86.0	0.0		113.0	5.0	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	hg19	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	A	10.83	1.461936	0.26248	.	.	ENSG00000134780	ENST00000257215	T	0.25579	1.79	4.01	2.0	0.26442	.	0.125473	0.53938	D	0.000058	T	0.12305	0.0299	N	0.25094	0.71	0.34086	D	0.660161	P	0.43477	0.808	B	0.30179	0.112	T	0.26815	-1.0092	10	0.25751	T	0.34	-28.0368	11.5875	0.50927	0.5275:0.4725:0.0:0.0	.	332	Q9Y4D2	DGLA_HUMAN	G	332	ENSP00000257215:R332G	ENSP00000257215:R332G	R	+	1	2	DAGLA	61258916	0.058000	0.20735	0.438000	0.26821	0.974000	0.67602	0.343000	0.19944	0.394000	0.25230	0.459000	0.35465	AGG	.	.		0.607	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
CAPN1	823	hgsc.bcm.edu	37	11	64981537	64981537	+	IGR	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:64981537C>T	ENST00000527323.1	+	0	3086				SLC22A20_ENST00000525437.1_RNA			P07384	CAN1_HUMAN	calpain 1, (mu/I) large subunit						extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell proliferation (GO:0008284)|proteolysis (GO:0006508)|receptor catabolic process (GO:0032801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			breast(2)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	13		Lung NSC(402;0.094)|Melanoma(852;0.16)		Lung(977;0.00168)|LUSC - Lung squamous cell carcinoma(976;0.00813)		ACCAACGACTCGGGGGCCTGG	0.697																																					p.S65L		Atlas-SNP	.											.	SLC22A20	36	.	0			c.C194T						.						9.0	12.0	11.0					11																	64981537		1865	4064	5929	SO:0001628	intergenic_variant	440044	exon1			ACGACTCGGGGGC	X04366	CCDS44644.1	11q13	2013-01-10			ENSG00000014216	ENSG00000014216	3.4.22.52	"""EF-hand domain containing"""	1476	protein-coding gene	gene with protein product		114220				3017764, 2209092	Standard	NM_005186		Approved	muCANP, muCL, CANP, CANPL1	uc009yqd.2	P07384	OTTHUMG00000165614		chr11.hg19:g.64981537C>T		65.0	0.0		63.0	20.0	NM_001004326	Q2TTR0|Q6DHV4	Missense_Mutation	SNP	ENST00000527323.1	hg19	CCDS44644.1																																																																																			.	.		0.697	CAPN1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385325.1		
LTBP3	4054	hgsc.bcm.edu	37	11	65306671	65306671	+	Silent	SNP	G	G	T	rs575913813	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:65306671G>T	ENST00000301873.5	-	28	4060	c.3792C>A	c.(3790-3792)cgC>cgA	p.R1264R	LTBP3_ENST00000530785.1_Silent_p.R267R|LTBP3_ENST00000532932.1_Silent_p.R694R|LTBP3_ENST00000536982.1_Silent_p.R843R|LTBP3_ENST00000322147.4_Silent_p.R1217R|LTBP3_ENST00000529189.1_Silent_p.R220R	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	1264	EGF-like 13; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						ACAGCAGCCCGCGCTGGTTCA	0.711																																					p.R1264R		Atlas-SNP	.											.	LTBP3	55	.	0			c.C3792A						.						5.0	4.0	4.0					11																	65306671		2056	4014	6070	SO:0001819	synonymous_variant	4054	exon28			CAGCCCGCGCTGG	AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.3792C>A	chr11.hg19:g.65306671G>T		55.0	0.0		70.0	4.0	NM_001130144	O15107|Q96HB9|Q9H7K2|Q9UFN4	Silent	SNP	ENST00000301873.5	hg19	CCDS44647.1																																																																																			.	.		0.711	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390538.1	NM_021070	
EHBP1L1	254102	hgsc.bcm.edu	37	11	65347712	65347712	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:65347712T>C	ENST00000309295.4	+	5	738	c.473T>C	c.(472-474)cTg>cCg	p.L158P		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	158						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GGGGTGCTGCTGCGGGAGGGC	0.642																																					p.L158P		Atlas-SNP	.											.	EHBP1L1	64	.	0			c.T473C						.						77.0	86.0	83.0					11																	65347712		2195	4288	6483	SO:0001583	missense	254102	exon5			TGCTGCTGCGGGA	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.473T>C	chr11.hg19:g.65347712T>C	ENSP00000312671:p.Leu158Pro	101.0	0.0		146.0	6.0	NM_001099409	Q8TB89|Q9H7M7	Missense_Mutation	SNP	ENST00000309295.4	hg19	CCDS44649.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.209837	0.79240	.	.	ENSG00000173442	ENST00000309295;ENST00000533237	T;T	0.52057	0.68;0.68	5.56	5.56	0.83823	.	0.260438	0.26460	N	0.024252	T	0.66597	0.2805	M	0.72894	2.215	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.70124	-0.4958	10	0.87932	D	0	.	12.0941	0.53744	0.0:0.0:0.0:1.0	.	158	Q8N3D4	EH1L1_HUMAN	P	158	ENSP00000312671:L158P;ENSP00000431996:L158P	ENSP00000312671:L158P	L	+	2	0	EHBP1L1	65104288	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.676000	0.61627	2.115000	0.64714	0.454000	0.30748	CTG	.	.		0.642	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
TPCN2	219931	hgsc.bcm.edu	37	11	68835002	68835002	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:68835002C>G	ENST00000294309.3	+	8	859	c.758C>G	c.(757-759)aCc>aGc	p.T253S	TPCN2_ENST00000542467.1_Missense_Mutation_p.T253S|TPCN2_ENST00000442692.2_3'UTR	NM_139075.3	NP_620714.2	Q8NHX9	TPC2_HUMAN	two pore segment channel 2	253					calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|release of sequestered calcium ion into cytosol (GO:0051209)|smooth muscle contraction (GO:0006939)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|protein kinase binding (GO:0019901)|voltage-gated calcium channel activity (GO:0005245)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	32			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			GAGAGGCTGACCTACTTCCAG	0.657																																					p.T253S		Atlas-SNP	.											.	TPCN2	63	.	0			c.C758G						.						134.0	104.0	114.0					11																	68835002		2200	4294	6494	SO:0001583	missense	219931	exon8			GGCTGACCTACTT	AK023366	CCDS8189.1	11q13.1	2011-07-05			ENSG00000162341	ENSG00000162341		"""Voltage-gated ion channels / Two-pore channels"""	20820	protein-coding gene	gene with protein product		612163				16382101	Standard	NM_139075		Approved	TPC2	uc001oos.2	Q8NHX9	OTTHUMG00000167898	ENST00000294309.3:c.758C>G	chr11.hg19:g.68835002C>G	ENSP00000294309:p.Thr253Ser	46.0	0.0		56.0	11.0	NM_139075	Q9NT82	Missense_Mutation	SNP	ENST00000294309.3	hg19	CCDS8189.1	.	.	.	.	.	.	.	.	.	.	c	6.762	0.509544	0.12883	.	.	ENSG00000162341	ENST00000356782;ENST00000294309;ENST00000535009;ENST00000542467	D;D	0.98531	-4.98;-4.98	4.97	-1.68	0.08212	Ion transport (1);	1.166550	0.05931	N	0.635100	D	0.93119	0.7809	N	0.22421	0.69	0.09310	N	1	P;B;B	0.40360	0.714;0.238;0.317	B;B;B	0.37550	0.253;0.186;0.164	D	0.90096	0.4181	10	0.10111	T	0.7	-14.4464	4.1192	0.10098	0.1654:0.3636:0.0:0.471	.	253;253;168	E7ETX0;Q8NHX9;F5H1G5	.;TPC2_HUMAN;.	S	183;253;168;253	ENSP00000294309:T253S;ENSP00000445551:T253S	ENSP00000294309:T253S	T	+	2	0	TPCN2	68591578	0.000000	0.05858	0.910000	0.35882	0.815000	0.46073	-0.007000	0.12810	0.002000	0.14630	0.643000	0.83706	ACC	.	.		0.657	TPCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396878.2	NM_139075	
TENM4	26011	hgsc.bcm.edu	37	11	78498080	78498080	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:78498080G>A	ENST00000278550.7	-	16	2690	c.2228C>T	c.(2227-2229)aCc>aTc	p.T743I		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	743	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.T743N(2)									GCAGCGGCAGGTGCCCCCTAC	0.697																																					p.T743I		Atlas-SNP	.											ODZ4_ENST00000278550,NS,carcinoma,0,2	.	.	.	2	Substitution - Missense(2)	breast(2)	c.C2228T						.						6.0	9.0	8.0					11																	78498080		2027	4089	6116	SO:0001583	missense	26011	exon16			CGGCAGGTGCCCC	AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.2228C>T	chr11.hg19:g.78498080G>A	ENSP00000278550:p.Thr743Ile	58.0	0.0		74.0	3.0	NM_001098816	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	ENST00000278550.7	hg19	CCDS44688.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.39|14.39	2.519797|2.519797	0.44866|0.44866	.|.	.|.	ENSG00000149256|ENSG00000149256	ENST00000533525|ENST00000278550	.|T	.|0.03330	.|3.97	5.07|5.07	5.07|5.07	0.68467|0.68467	.|EGF, extracellular (1);Epidermal growth factor-like (1);	.|0.106709	.|0.64402	.|D	.|0.000012	T|T	0.06690|0.06690	0.0171|0.0171	L|L	0.39514|0.39514	1.22|1.22	0.36346|0.36346	D|D	0.859766|0.859766	.|P	.|0.52316	.|0.952	.|P	.|0.49226	.|0.603	T|T	0.42965|0.42965	-0.9420|-0.9420	5|9	.|.	.|.	.|.	.|.	14.2704|14.2704	0.66149|0.66149	0.0:0.1486:0.8514:0.0|0.0:0.1486:0.8514:0.0	.|.	.|743	.|Q6N022	.|TEN4_HUMAN	S|I	57|743	.|ENSP00000278550:T743I	.|.	P|T	-|-	1|2	0|0	ODZ4|ODZ4	78175728|78175728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.881000|0.881000	0.50899|0.50899	2.801000|2.801000	0.47908|0.47908	2.653000|2.653000	0.90120|0.90120	0.561000|0.561000	0.74099|0.74099	CCT|ACC	.	.		0.697	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391406.2		
SLC36A4	120103	hgsc.bcm.edu	37	11	92917643	92917643	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:92917643T>C	ENST00000326402.4	-	3	353	c.223A>G	c.(223-225)Act>Gct	p.T75A	SLC36A4_ENST00000529184.1_5'UTR	NM_152313.2	NP_689526.2	Q6YBV0	S36A4_HUMAN	solute carrier family 36 (proton/amino acid symporter), member 4	75					L-alanine transport (GO:0015808)|proline transport (GO:0015824)|tryptophan transport (GO:0015827)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	25		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				AAAAGGCCAGTTCCAATATTT	0.313																																					p.T75A		Atlas-SNP	.											.	SLC36A4	61	.	0			c.A223G						.						179.0	188.0	185.0					11																	92917643		2201	4298	6499	SO:0001583	missense	120103	exon3			GGCCAGTTCCAAT	AY162216	CCDS8291.1, CCDS66202.1	11q21	2013-05-22			ENSG00000180773	ENSG00000180773		"""Solute carriers"""	19660	protein-coding gene	gene with protein product		613760					Standard	XM_005273758		Approved	PAT4, FLJ38932	uc001pdn.3	Q6YBV0	OTTHUMG00000167368	ENST00000326402.4:c.223A>G	chr11.hg19:g.92917643T>C	ENSP00000317382:p.Thr75Ala	64.0	0.0		68.0	4.0	NM_152313	Q86X30|Q8IVM5|Q8N8S6	Missense_Mutation	SNP	ENST00000326402.4	hg19	CCDS8291.1	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501790	0.85176	.	.	ENSG00000180773	ENST00000326402	T	0.01821	4.62	6.06	6.06	0.98353	.	0.071003	0.64402	D	0.000016	T	0.10423	0.0255	M	0.70842	2.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.00195	-1.1932	10	0.87932	D	0	-20.5103	16.286	0.82722	0.0:0.0:0.0:1.0	.	75	Q6YBV0	S36A4_HUMAN	A	75	ENSP00000317382:T75A	ENSP00000317382:T75A	T	-	1	0	SLC36A4	92557291	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.303000	0.72794	2.323000	0.78572	0.528000	0.53228	ACT	.	.		0.313	SLC36A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394329.2		
KIAA1377	57562	hgsc.bcm.edu	37	11	101833708	101833708	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:101833708T>C	ENST00000263468.8	+	6	2212	c.1942T>C	c.(1942-1944)Tca>Cca	p.S648P	KIAA1377_ENST00000537689.1_Missense_Mutation_p.S449P	NM_020802.2	NP_065853.2	Q9P2H0	K1377_HUMAN	KIAA1377	648										breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(18)|ovary(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	53	all_epithelial(12;0.0104)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00931)		BRCA - Breast invasive adenocarcinoma(274;0.038)		AAACAGTCATTCACTGAAGAA	0.348																																					p.S648P		Atlas-SNP	.											.	KIAA1377	111	.	0			c.T1942C						.						52.0	51.0	51.0					11																	101833708		2203	4299	6502	SO:0001583	missense	57562	exon6			AGTCATTCACTGA	AK095004	CCDS31658.1	11q22.2	2006-02-03			ENSG00000110318	ENSG00000110318			29264	protein-coding gene	gene with protein product		614634				10718198	Standard	XM_005271627		Approved		uc001pgm.3	Q9P2H0	OTTHUMG00000167319	ENST00000263468.8:c.1942T>C	chr11.hg19:g.101833708T>C	ENSP00000263468:p.Ser648Pro	95.0	0.0		96.0	4.0	NM_020802	Q4G0U6	Missense_Mutation	SNP	ENST00000263468.8	hg19	CCDS31658.1	.	.	.	.	.	.	.	.	.	.	T	0.110	-1.140146	0.01728	.	.	ENSG00000110318	ENST00000263468;ENST00000537689	T;T	0.08546	3.08;3.08	5.45	3.14	0.36123	.	0.769745	0.11819	N	0.526446	T	0.05044	0.0135	N	0.17674	0.51	0.09310	N	1	B	0.17667	0.023	B	0.18871	0.023	T	0.45352	-0.9267	10	0.23891	T	0.37	-0.5782	3.6374	0.08154	0.1614:0.1798:0.0:0.6587	.	648	Q9P2H0	K1377_HUMAN	P	648;449	ENSP00000263468:S648P;ENSP00000443184:S449P	ENSP00000263468:S648P	S	+	1	0	KIAA1377	101338918	0.016000	0.18221	0.000000	0.03702	0.004000	0.04260	1.921000	0.40035	0.462000	0.27095	-0.250000	0.11733	TCA	.	.		0.348	KIAA1377-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394140.1	NM_020802	
IL18	3606	hgsc.bcm.edu	37	11	112020884	112020884	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:112020884G>C	ENST00000280357.7	-	4	356	c.137C>G	c.(136-138)tCa>tGa	p.S46*	IL18_ENST00000533858.1_5'UTR|IL18_ENST00000528832.1_Nonsense_Mutation_p.S46*|IL18_ENST00000524595.1_Nonsense_Mutation_p.S42*|SDHD_ENST00000532699.1_Intron	NM_001562.3	NP_001553.1	Q14116	IL18_HUMAN	interleukin 18	46					angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|cellular response to organic cyclic compound (GO:0071407)|chemokine biosynthetic process (GO:0042033)|granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0042253)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma biosynthetic process (GO:0042095)|interleukin-13 biosynthetic process (GO:0042231)|interleukin-2 biosynthetic process (GO:0042094)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MAPK cascade (GO:0000165)|natural killer cell activation (GO:0030101)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NK T cell proliferation (GO:0051142)|positive regulation of tissue remodeling (GO:0034105)|regulation of cell adhesion (GO:0030155)|sleep (GO:0030431)|T-helper 1 type immune response (GO:0042088)|type 2 immune response (GO:0042092)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	cytokine activity (GO:0005125)						all_cancers(61;5.7e-14)|all_epithelial(67;3.4e-08)|Melanoma(852;8.81e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|Epithelial(105;8.15e-07)|all cancers(92;1.43e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.055)		TCTTATGACTGATAATTTAGA	0.299																																					p.S46X		Atlas-SNP	.											.	IL18	10	.	0			c.C137G						.						95.0	89.0	91.0					11																	112020884		1791	4063	5854	SO:0001587	stop_gained	3606	exon4			ATGACTGATAATT	U90434	CCDS44731.1, CCDS58180.1	11q22.2-q22.3	2014-04-04	2014-04-04		ENSG00000150782	ENSG00000150782		"""Interleukins and interleukin receptors"""	5986	protein-coding gene	gene with protein product	"""interferon-gamma-inducing factor"""	600953	"""interleukin 18 (interferon-gamma-inducing factor)"""			7477296, 9693051	Standard	NM_001562		Approved	IGIF, IL1F4, IL-1g, IL-18	uc001pnb.2	Q14116	OTTHUMG00000167006	ENST00000280357.7:c.137C>G	chr11.hg19:g.112020884G>C	ENSP00000280357:p.Ser46*	94.0	0.0		99.0	36.0	NM_001562	O75599|Q6FGY3|Q6WWJ7	Nonsense_Mutation	SNP	ENST00000280357.7	hg19	CCDS44731.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263835	0.80358	.	.	ENSG00000150782	ENST00000280357;ENST00000524595;ENST00000528832	.	.	.	4.97	4.97	0.65823	.	0.642927	0.13849	N	0.358505	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.8517	13.9222	0.63940	0.0:0.0:1.0:0.0	.	.	.	.	X	46;42;46	.	ENSP00000280357:S46X	S	-	2	0	IL18	111526094	0.285000	0.24296	0.480000	0.27341	0.287000	0.27160	3.965000	0.56788	2.740000	0.93945	0.650000	0.86243	TCA	.	.		0.299	IL18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000392409.1	NM_001562	
NCAM1	4684	hgsc.bcm.edu	37	11	113105812	113105812	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:113105812T>C	ENST00000533760.1	+	13	1966	c.1367T>C	c.(1366-1368)gTa>gCa	p.V456A	NCAM1_ENST00000316851.7_Missense_Mutation_p.V574A|NCAM1_ENST00000401611.2_Missense_Mutation_p.V583A|NCAM1_ENST00000397957.4_3'UTR	NM_001242608.1	NP_001229537.1	P13591	NCAM1_HUMAN	neural cell adhesion molecule 1	584	Ig-like C2-type 5.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix organization (GO:0030198)|interferon-gamma-mediated signaling pathway (GO:0060333)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(27)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	49		all_cancers(61;5.82e-19)|all_epithelial(67;6.87e-12)|Melanoma(852;1.99e-05)|all_hematologic(158;3.66e-05)|Acute lymphoblastic leukemia(157;0.00119)|Breast(348;0.0109)|all_neural(223;0.0299)|Medulloblastoma(222;0.0458)|Renal(330;0.198)|Prostate(24;0.207)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.000114)|all cancers(92;0.000467)|OV - Ovarian serous cystadenocarcinoma(223;0.212)		ACGTACGCCGTAAGGCTGGCG	0.552																																					p.V610A		Atlas-SNP	.											.	NCAM1	372	.	0			c.T1829C						.						26.0	30.0	28.0					11																	113105812		2011	4166	6177	SO:0001583	missense	4684	exon16			ACGCCGTAAGGCT		CCDS73384.1, CCDS73385.1, CCDS73386.1, CCDS73387.1, CCDS73388.1	11q23.2	2013-02-11			ENSG00000149294	ENSG00000149294		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7656	protein-coding gene	gene with protein product		116930					Standard	NM_000615		Approved	NCAM, CD56	uc021qqp.1	P13591	OTTHUMG00000167196	ENST00000533760.1:c.1367T>C	chr11.hg19:g.113105812T>C	ENSP00000473281:p.Val456Ala	83.0	0.0		95.0	4.0	NM_001242607	A8K8T8|P13592|P13593|Q05C58|Q15829|Q16180|Q16209|Q59FL7|Q86X47|Q96CJ3	Missense_Mutation	SNP	ENST00000533760.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.80	2.940991	0.52972	.	.	ENSG00000149294	ENST00000531044;ENST00000401611;ENST00000316851;ENST00000433634	T;T	0.61392	0.11;0.11	5.84	5.84	0.93424	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.075248	0.52532	U	0.000070	T	0.76140	0.3946	.	.	.	0.58432	D	0.999995	D;D;D;D	0.61697	0.988;0.988;0.99;0.977	P;D;D;D	0.67548	0.883;0.92;0.952;0.938	T	0.79468	-0.1791	9	0.87932	D	0	-34.9693	16.2087	0.82144	0.0:0.0:0.0:1.0	.	584;574;584;574	P13591-5;P13591-1;P13591;P13591-3	.;.;NCAM1_HUMAN;.	A	456;583;574;18	ENSP00000384055:V583A;ENSP00000318472:V574A	ENSP00000318472:V574A	V	+	2	0	NCAM1	112611022	1.000000	0.71417	0.182000	0.23118	0.006000	0.05464	6.105000	0.71505	2.233000	0.73108	0.482000	0.46254	GTA	.	.		0.552	NCAM1-003	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000394068.2	NM_000615	
USP28	57646	hgsc.bcm.edu	37	11	113683141	113683141	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:113683141C>T	ENST00000003302.4	-	16	1897	c.1829G>A	c.(1828-1830)cGa>cAa	p.R610Q	USP28_ENST00000260188.5_Missense_Mutation_p.R610Q|USP28_ENST00000545540.1_Missense_Mutation_p.R485Q|USP28_ENST00000544967.1_Missense_Mutation_p.R318Q	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	610	USP.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CCAGCTCTGTCGGGGTTGATT	0.438																																					p.R610Q	Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	Atlas-SNP	.											.	USP28	135	.	0			c.G1829A						.						151.0	154.0	153.0					11																	113683141		2201	4296	6497	SO:0001583	missense	57646	exon16			CTCTGTCGGGGTT	AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.1829G>A	chr11.hg19:g.113683141C>T	ENSP00000003302:p.Arg610Gln	92.0	0.0		94.0	4.0	NM_020886	B0YJC0|B0YJC1|Q9P213	Missense_Mutation	SNP	ENST00000003302.4	hg19	CCDS31680.1	.	.	.	.	.	.	.	.	.	.	C	12.03	1.814469	0.32053	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000544967;ENST00000545540;ENST00000538475	T;T;T;T;T	0.31510	1.49;1.49;1.49;1.49;1.49	5.43	3.45	0.39498	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.178672	0.49305	D	0.000159	T	0.20659	0.0497	N	0.12637	0.245	0.41029	D	0.985143	D;P;D	0.59767	0.986;0.604;0.982	P;B;P	0.49301	0.606;0.183;0.471	T	0.02603	-1.1135	10	0.17832	T	0.49	-12.4082	10.1697	0.42902	0.1355:0.7936:0.0:0.0709	.	485;610;318	B4E3L3;Q96RU2;G3V1N5	.;UBP28_HUMAN;.	Q	610;610;318;485;314	ENSP00000003302:R610Q;ENSP00000260188:R610Q;ENSP00000442431:R318Q;ENSP00000444991:R485Q;ENSP00000442257:R314Q	ENSP00000003302:R610Q	R	-	2	0	USP28	113188351	0.998000	0.40836	0.875000	0.34327	0.061000	0.15899	3.595000	0.54016	1.299000	0.44798	-0.123000	0.14984	CGA	.	.		0.438	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398789.1		
TRAPPC4	51399	hgsc.bcm.edu	37	11	118896697	118896697	+	IGR	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:118896697C>T	ENST00000533632.1	+	0	1759				SLC37A4_ENST00000545985.1_Missense_Mutation_p.V322M|SLC37A4_ENST00000525102.1_5'UTR|SLC37A4_ENST00000538950.1_Missense_Mutation_p.V249M|SLC37A4_ENST00000357590.5_Missense_Mutation_p.V322M|SLC37A4_ENST00000330775.7_Missense_Mutation_p.V321M	NM_016146.4	NP_057230.1	Q9Y296	TPPC4_HUMAN	trafficking protein particle complex 4						dendrite development (GO:0016358)|ER to Golgi vesicle-mediated transport (GO:0006888)|extracellular matrix organization (GO:0030198)	cis-Golgi network (GO:0005801)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi stack (GO:0005795)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)|TRAPP complex (GO:0030008)				NS(1)|endometrium(1)|large_intestine(2)|lung(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		TCACTGGTCACTGTTACCCGG	0.572																																					p.V322M		Atlas-SNP	.											.	SLC37A4	19	.	0			c.G964A						.						52.0	58.0	56.0					11																	118896697		2080	4221	6301	SO:0001628	intergenic_variant	2542	exon8			TGGTCACTGTTAC	AF078862	CCDS8407.1	11q23.3	2011-10-10				ENSG00000196655		"""Trafficking protein particle complex"""	19943	protein-coding gene	gene with protein product		610971				10810093	Standard	NM_016146		Approved	TRS23, SBDN, PTD009	uc010ryo.2	Q9Y296			chr11.hg19:g.118896697C>T		121.0	0.0		139.0	6.0	NM_001467	A8K3A5|B4DME1	Missense_Mutation	SNP	ENST00000533632.1	hg19	CCDS8407.1																																																																																			.	.		0.572	TRAPPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389332.1	NM_016146	
SRPR	6734	hgsc.bcm.edu	37	11	126135040	126135040	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:126135040A>G	ENST00000332118.6	-	11	1493	c.1339T>C	c.(1339-1341)Ttc>Ctc	p.F447L	SRPR_ENST00000530680.1_5'Flank|SRPR_ENST00000532259.1_Missense_Mutation_p.F419L	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	447					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		AGGACACTGAAGCCATTCTCT	0.483																																					p.F447L		Atlas-SNP	.											.	SRPR	60	.	0			c.T1339C						.						51.0	50.0	50.0					11																	126135040		2201	4299	6500	SO:0001583	missense	6734	exon11			CACTGAAGCCATT	BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1339T>C	chr11.hg19:g.126135040A>G	ENSP00000328023:p.Phe447Leu	72.0	0.0		85.0	4.0	NM_003139	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	ENST00000332118.6	hg19	CCDS31717.1	.	.	.	.	.	.	.	.	.	.	A	19.07	3.755325	0.69648	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	5.26	5.26	0.73747	ATPase, AAA+ type, core (1);Signal recognition particle, SRP54 subunit, GTPase (2);	0.091750	0.85682	D	0.000000	T	0.33731	0.0873	N	0.04636	-0.2	0.80722	D	1	B;B	0.14805	0.005;0.011	B;B	0.18871	0.023;0.023	T	0.24657	-1.0154	9	0.08381	T	0.77	-8.5065	15.3398	0.74287	1.0:0.0:0.0:0.0	.	419;447	E9PJS4;P08240	.;SRPR_HUMAN	L	447;419	.	ENSP00000328023:F447L	F	-	1	0	SRPR	125640250	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.120000	0.77153	2.215000	0.71742	0.528000	0.53228	TTC	.	.		0.483	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386425.2	NM_003139	
ST3GAL4	6484	hgsc.bcm.edu	37	11	126279255	126279255	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:126279255A>G	ENST00000526727.1	+	8	1094	c.720A>G	c.(718-720)gcA>gcG	p.A240A	ST3GAL4_ENST00000227495.6_Silent_p.A236A|ST3GAL4_ENST00000534457.1_Silent_p.A235A|ST3GAL4_ENST00000356132.4_Silent_p.A246A|ST3GAL4_ENST00000449406.2_Silent_p.A229A|ST3GAL4_ENST00000534083.1_Silent_p.A240A|ST3GAL4_ENST00000532243.1_Silent_p.A239A|ST3GAL4_ENST00000530591.1_Silent_p.A236A|ST3GAL4_ENST00000444328.2_Silent_p.A240A|ST3GAL4_ENST00000392669.2_Silent_p.A240A			Q11206	SIA4C_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 4	240					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)|monosialoganglioside sialyltransferase activity (GO:0047288)			endometrium(1)|large_intestine(2)|lung(5)|stomach(1)	9	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0739)|all_lung(97;0.0798)|all_neural(223;0.138)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0767)		TGGAGATTGCAGCTGACAAAC	0.527																																					p.A240A		Atlas-SNP	.											.	ST3GAL4	25	.	0			c.A720G						.						105.0	105.0	105.0					11																	126279255		2201	4297	6498	SO:0001819	synonymous_variant	6484	exon9			GATTGCAGCTGAC	X74570	CCDS8474.1, CCDS58193.1, CCDS58194.1	11q23-q24	2013-03-01	2003-01-14	2005-02-07	ENSG00000110080	ENSG00000110080	2.4.99.4	"""Sialyltransferases"""	10864	protein-coding gene	gene with protein product	"""ST3Gal IV"""	104240	"""sialyltransferase 4C (beta-galactosidase alpha-2,3-sialytransferase)"""	CGS23, SIAT4, NANTA3, SIAT4C		8557707, 8288606	Standard	NM_006278		Approved	STZ, SAT3, FLJ11867	uc001qds.3	Q11206	OTTHUMG00000165830	ENST00000526727.1:c.720A>G	chr11.hg19:g.126279255A>G		114.0	0.0		119.0	7.0	NM_001254757	A8K6B2|O60497|Q8N6A6|Q8NFG7|Q96QQ9	Silent	SNP	ENST00000526727.1	hg19	CCDS58193.1																																																																																			.	.		0.527	ST3GAL4-003	PUTATIVE	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386470.1	NM_006278	
TP53AIP1	63970	hgsc.bcm.edu	37	11	128807456	128807456	+	Intron	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:128807456T>C	ENST00000531399.1	-	2	351				TP53AIP1_ENST00000602346.1_Silent_p.T86T|TP53AIP1_ENST00000530777.1_Intron|TP53AIP1_ENST00000458238.2_Intron	NM_022112.2	NP_071395.2	Q9HCN2	TPIP1_HUMAN	tumor protein p53 regulated apoptosis inducing protein 1						apoptotic process (GO:0006915)	mitochondrion (GO:0005739)				large_intestine(1)|lung(1)|skin(1)	3						ACCCAGATGCTGTCACTGGGT	0.577																																					p.T86T		Atlas-SNP	.											.	TP53AIP1	12	.	0			c.A258G						.						64.0	60.0	62.0					11																	128807456		2201	4297	6498	SO:0001627	intron_variant	63970	exon2			AGATGCTGTCACT	AB045831	CCDS8480.1, CCDS8480.2, CCDS55797.1, CCDS55798.1, CCDS58195.1	11q24.3	2011-01-26	2009-03-09		ENSG00000120471	ENSG00000120471			29984	protein-coding gene	gene with protein product		605426				11030628, 12019168	Standard	NM_022112		Approved	p53AIP1	uc021qsd.1	Q9HCN2		ENST00000531399.1:c.141+116A>G	chr11.hg19:g.128807456T>C		51.0	0.0		108.0	5.0	NM_001251964	Q6NT40|Q7Z6F7|Q9HCN0|Q9HCN1	Silent	SNP	ENST00000531399.1	hg19	CCDS8480.2																																																																																			.	.		0.577	TP53AIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386244.1	NM_022112	
APLP2	334	hgsc.bcm.edu	37	11	130011950	130011950	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:130011950T>G	ENST00000263574.5	+	17	2243	c.2171T>G	c.(2170-2172)aTc>aGc	p.I724S	APLP2_ENST00000539648.1_Missense_Mutation_p.I512S|APLP2_ENST00000278756.7_Missense_Mutation_p.I722S|APLP2_ENST00000338167.5_Missense_Mutation_p.I712S|APLP2_ENST00000345598.5_Missense_Mutation_p.I483S|APLP2_ENST00000528499.1_Missense_Mutation_p.I656S|APLP2_ENST00000543137.1_Missense_Mutation_p.I619S	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	724					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		TATGGCACCATCAGCCACGGG	0.592																																					p.I724S		Atlas-SNP	.											.	APLP2	71	.	0			c.T2171G						.						75.0	58.0	63.0					11																	130011950		2201	4297	6498	SO:0001583	missense	334	exon17			GCACCATCAGCCA	L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.2171T>G	chr11.hg19:g.130011950T>G	ENSP00000263574:p.Ile724Ser	91.0	0.0		111.0	33.0	NM_001642	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Missense_Mutation	SNP	ENST00000263574.5	hg19	CCDS8486.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.474193	0.84640	.	.	ENSG00000084234	ENST00000528499;ENST00000539648;ENST00000263574;ENST00000345598;ENST00000338167;ENST00000278756;ENST00000543137	D;D;D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84	5.75	5.75	0.90469	Beta-amyloid precursor protein C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.97015	0.9025	M	0.63428	1.95	0.80722	D	1	D;D;D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0;0.999;1.0	D;D;D;D;D;D;D	0.91635	0.996;0.999;0.996;0.999;0.999;0.994;0.997	D	0.96843	0.9619	9	.	.	.	-29.7097	15.2493	0.73532	0.0:0.0:0.0:1.0	.	512;724;668;483;650;656;712	F5H845;Q06481;Q06481-2;Q06481-5;B4E3I5;Q06481-4;Q06481-3	.;APLP2_HUMAN;.;.;.;.;.	S	656;512;724;483;712;722;619	ENSP00000435914:I656S;ENSP00000443728:I512S;ENSP00000263574:I724S;ENSP00000263575:I483S;ENSP00000345444:I712S;ENSP00000278756:I722S;ENSP00000444122:I619S	.	I	+	2	0	APLP2	129517160	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.640000	0.83355	2.188000	0.69820	0.528000	0.53228	ATC	.	.		0.592	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386109.1	NM_001642	
NTM	50863	hgsc.bcm.edu	37	11	132184537	132184537	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:132184537A>G	ENST00000374786.1	+	6	1353	c.874A>G	c.(874-876)Aac>Gac	p.N292D	NTM_ENST00000374784.1_Missense_Mutation_p.N292D|NTM_ENST00000374791.3_Missense_Mutation_p.N292D|NTM_ENST00000427481.2_Missense_Mutation_p.N283D|NTM_ENST00000539799.1_Missense_Mutation_p.N292D|NTM_ENST00000474900.1_3'UTR|NTM_ENST00000425719.2_Missense_Mutation_p.N292D	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin	292	Ig-like C2-type 3.				cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TGACTATGGGAACTACACTTG	0.483																																					p.N292D		Atlas-SNP	.											.	NTM	253	.	0			c.A874G						.						104.0	92.0	96.0					11																	132184537		2201	4297	6498	SO:0001583	missense	50863	exon6			TATGGGAACTACA	AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.874A>G	chr11.hg19:g.132184537A>G	ENSP00000363918:p.Asn292Asp	86.0	0.0		97.0	4.0	NM_001144059	A0MTT2|Q6UXJ3|Q86VJ9	Missense_Mutation	SNP	ENST00000374786.1	hg19	CCDS8491.1	.	.	.	.	.	.	.	.	.	.	A	18.17	3.563689	0.65651	.	.	ENSG00000182667	ENST00000374791;ENST00000539799;ENST00000427481;ENST00000374786;ENST00000425719;ENST00000374784	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	5.62	4.48	0.54585	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.038633	0.85682	D	0.000000	T	0.79545	0.4464	M	0.72479	2.2	0.53005	D	0.999967	D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.958;1.0;0.984;0.999	D;D;D;P;D;D;D	0.97110	0.98;1.0;1.0;0.882;1.0;0.924;0.966	T	0.80420	-0.1390	10	0.66056	D	0.02	-32.0373	12.025	0.53365	0.8705:0.0:0.0:0.1295	.	292;283;251;292;292;292;292	B7Z1Z5;B7Z1I4;B7Z1H3;Q9P121-4;Q9P121;Q9P121-3;Q9P121-2	.;.;.;.;NTRI_HUMAN;.;.	D	292;292;283;292;292;292	ENSP00000363923:N292D;ENSP00000437668:N292D;ENSP00000416320:N283D;ENSP00000363918:N292D;ENSP00000396722:N292D;ENSP00000363916:N292D	ENSP00000363916:N292D	N	+	1	0	NTM	131689747	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	8.910000	0.92685	0.946000	0.37632	-0.336000	0.08194	AAC	.	.		0.483	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000141937.1	NM_016522	
FBXL14	144699	hgsc.bcm.edu	37	12	1702306	1702306	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:1702306A>G	ENST00000339235.3	-	1	1025	c.927T>C	c.(925-927)tcT>tcC	p.S309S	WNT5B_ENST00000537031.1_Intron|FBXL14_ENST00000543278.1_5'Flank	NM_152441.2	NP_689654.1	Q8N1E6	FXL14_HUMAN	F-box and leucine-rich repeat protein 14	309					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)	8	Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00115)			AGAGGGAGAGAGACTTGAGGC	0.602																																					p.S309S		Atlas-SNP	.											.	FBXL14	19	.	0			c.T927C						.						97.0	80.0	86.0					12																	1702306		2203	4300	6503	SO:0001819	synonymous_variant	144699	exon1			GGAGAGAGACTTG	BC028132	CCDS8509.1	12p13.33	2011-06-09			ENSG00000171823	ENSG00000171823		"""F-boxes / Leucine-rich repeats"""	28624	protein-coding gene	gene with protein product		609081				12477932	Standard	NM_152441		Approved	MGC40195, Fbl14	uc001qjh.3	Q8N1E6	OTTHUMG00000090369	ENST00000339235.3:c.927T>C	chr12.hg19:g.1702306A>G		60.0	0.0		42.0	4.0	NM_152441		Silent	SNP	ENST00000339235.3	hg19	CCDS8509.1																																																																																			.	.		0.602	FBXL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206741.1	NM_152441	
CLEC9A	283420	hgsc.bcm.edu	37	12	10213810	10213810	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:10213810A>G	ENST00000355819.1	+	6	870	c.257A>G	c.(256-258)aAg>aGg	p.K86R		NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A	86					positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						ACAGAATGGAAGAGAAGCTGT	0.408																																					p.K86R		Atlas-SNP	.											.	CLEC9A	41	.	0			c.A257G						.						92.0	85.0	88.0					12																	10213810		2203	4300	6503	SO:0001583	missense	283420	exon6			AATGGAAGAGAAG		CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.257A>G	chr12.hg19:g.10213810A>G	ENSP00000348074:p.Lys86Arg	101.0	0.0		82.0	4.0	NM_207345	B0ZBM2	Missense_Mutation	SNP	ENST00000355819.1	hg19	CCDS8611.1	.	.	.	.	.	.	.	.	.	.	A	9.585	1.124688	0.20959	.	.	ENSG00000197992	ENST00000355819	T	0.01455	4.87	4.0	2.83	0.33086	C-type lectin-like (1);	1.095870	0.07076	N	0.836270	T	0.01905	0.0060	L	0.36672	1.1	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.50224	-0.8853	10	0.17369	T	0.5	.	5.7181	0.17972	0.8699:0.0:0.1301:0.0	.	86	Q6UXN8	CLC9A_HUMAN	R	86	ENSP00000348074:K86R	ENSP00000348074:K86R	K	+	2	0	CLEC9A	10105077	0.010000	0.17322	0.001000	0.08648	0.024000	0.10985	0.984000	0.29565	0.854000	0.35336	0.533000	0.62120	AAG	.	.		0.408	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000399564.1	NM_207345	
TMEM52B	120939	hgsc.bcm.edu	37	12	10342627	10342627	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:10342627T>C	ENST00000381923.2	+	6	844	c.440T>C	c.(439-441)tTc>tCc	p.F147S	TMEM52B_ENST00000298530.3_Missense_Mutation_p.F127S|TMEM52B_ENST00000536952.1_Missense_Mutation_p.F147S			Q4KMG9	TM52B_HUMAN	transmembrane protein 52B	147						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATGAGTCGCTTCACAGTAGCC	0.562																																					p.F127S		Atlas-SNP	.											.	.	.	.	0			c.T380C						.						57.0	53.0	54.0					12																	10342627		2203	4300	6503	SO:0001583	missense	120939	exon4			GTCGCTTCACAGT	AY358845	CCDS8619.1, CCDS66314.1	12p13.2	2012-08-15	2012-08-15	2012-08-15	ENSG00000165685	ENSG00000165685			26438	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 59"""	C12orf59		12975309	Standard	XM_005253299		Approved	FLJ31166	uc001qxq.3	Q4KMG9	OTTHUMG00000168410	ENST00000381923.2:c.440T>C	chr12.hg19:g.10342627T>C	ENSP00000371348:p.Phe147Ser	110.0	0.0		99.0	4.0	NM_153022	Q96NA7	Missense_Mutation	SNP	ENST00000381923.2	hg19		.	.	.	.	.	.	.	.	.	.	T	15.16	2.751469	0.49257	.	.	ENSG00000165685	ENST00000381923;ENST00000298530;ENST00000536952	T;T;T	0.28666	1.6;1.6;1.6	4.63	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.49253	0.1546	M	0.64997	1.995	0.44754	D	0.997753	D;D	0.76494	0.997;0.999	D;D	0.85130	0.991;0.997	T	0.39231	-0.9624	10	0.27082	T	0.32	-28.7633	12.311	0.54927	0.0:0.0:0.0:1.0	.	147;127	Q4KMG9;Q4KMG9-2	CL059_HUMAN;.	S	147;127;147	ENSP00000371348:F147S;ENSP00000298530:F127S;ENSP00000446102:F147S	ENSP00000298530:F127S	F	+	2	0	C12orf59	10233894	1.000000	0.71417	1.000000	0.80357	0.393000	0.30537	4.880000	0.63107	2.058000	0.61347	0.477000	0.44152	TTC	.	.		0.562	TMEM52B-002	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000399645.1	NM_153022	
SLCO1B3	28234	hgsc.bcm.edu	37	12	21015742	21015742	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:21015742A>G	ENST00000381545.3	+	8	900	c.681A>G	c.(679-681)ggA>ggG	p.G227G	SLCO1B3_ENST00000553473.1_Silent_p.G227G|LST3_ENST00000540229.1_Silent_p.G227G|SLCO1B3_ENST00000261196.2_Silent_p.G227G|LST3_ENST00000381541.3_Intron|SLCO1B7_ENST00000554957.1_Intron	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	227					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	TTGCACTGGGATCTCTGTTTG	0.363																																					p.G227G		Atlas-SNP	.											.	SLCO1B3	151	.	0			c.A681G						.						189.0	164.0	173.0					12																	21015742		2203	4300	6503	SO:0001819	synonymous_variant	28234	exon8			ACTGGGATCTCTG		CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.681A>G	chr12.hg19:g.21015742A>G		208.0	0.0		91.0	6.0	NM_019844	E7EMT8|Q5JAR4	Silent	SNP	ENST00000381545.3	hg19	CCDS8684.1																																																																																			.	.		0.363	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000401936.1	NM_019844	
BHLHE41	79365	hgsc.bcm.edu	37	12	26276611	26276611	+	Missense_Mutation	SNP	T	T	C	rs75677280		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:26276611T>C	ENST00000242728.4	-	4	645	c.298A>G	c.(298-300)Acc>Gcc	p.T100A	RP11-283G6.3_ENST00000535914.1_RNA|RP11-283G6.3_ENST00000545819.1_RNA	NM_030762.2	NP_110389.1	Q9C0J9	BHE41_HUMAN	basic helix-loop-helix family, member e41	100					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|circadian regulation of gene expression (GO:0032922)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of transcription by competitive promoter binding (GO:0010944)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)	nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|MRF binding (GO:0043426)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(1)	5						GTTAAGGCGGTTAAAGCTTTT	0.468											OREG0021711	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T100A		Atlas-SNP	.											.	BHLHE41	20	.	0			c.A298G						.						141.0	133.0	136.0					12																	26276611		2203	4300	6503	SO:0001583	missense	79365	exon4			AGGCGGTTAAAGC	AB044088	CCDS8706.1	12p12.1	2011-12-05	2009-01-12	2009-01-12	ENSG00000123095	ENSG00000123095		"""Basic helix-loop-helix proteins"""	16617	protein-coding gene	gene with protein product	"""differentially expressed in chondrocytes 2"", ""Enhancer-of-split and hairy-related protein 1"""	606200	"""basic helix-loop-helix domain containing, class B, 3"""	BHLHB3		11162494, 18557763	Standard	NM_030762		Approved	DEC2, SHARP-1, SHARP1, bHLHe41	uc001rhb.3	Q9C0J9	OTTHUMG00000169174	ENST00000242728.4:c.298A>G	chr12.hg19:g.26276611T>C	ENSP00000242728:p.Thr100Ala	102.0	0.0	785	81.0	4.0	NM_030762	A2I2N8	Missense_Mutation	SNP	ENST00000242728.4	hg19	CCDS8706.1	.	.	.	.	.	.	.	.	.	.	T	16.28	3.078924	0.55753	.	.	ENSG00000123095	ENST00000242728;ENST00000540731	T	0.57107	0.42	4.16	4.16	0.48862	Helix-loop-helix DNA-binding (4);	0.000000	0.85682	U	0.000000	T	0.57080	0.2029	L	0.27053	0.805	0.80722	D	1	D	0.62365	0.991	D	0.67231	0.95	T	0.60105	-0.7328	10	0.54805	T	0.06	-4.4045	12.4975	0.55937	0.0:0.0:0.0:1.0	.	100	Q9C0J9	BHE41_HUMAN	A	100	ENSP00000242728:T100A	ENSP00000242728:T100A	T	-	1	0	BHLHE41	26167878	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.873000	0.69644	1.880000	0.54463	0.533000	0.62120	ACC	.	.		0.468	BHLHE41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402714.1	NM_030762	
ITPR2	3709	hgsc.bcm.edu	37	12	26811016	26811016	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:26811016A>G	ENST00000381340.3	-	17	2350	c.1934T>C	c.(1933-1935)aTc>aCc	p.I645T		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	645					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AGTTACAGGGATAGCAGTGGT	0.338																																					p.I645T		Atlas-SNP	.											.	ITPR2	270	.	0			c.T1934C						.						102.0	93.0	96.0					12																	26811016		1847	4092	5939	SO:0001583	missense	3709	exon17			ACAGGGATAGCAG	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.1934T>C	chr12.hg19:g.26811016A>G	ENSP00000370744:p.Ile645Thr	110.0	0.0		73.0	4.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844189	0.71488	.	.	ENSG00000123104	ENST00000381340	D	0.96716	-4.1	4.8	4.8	0.61643	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.98333	0.9447	M	0.91459	3.21	0.80722	D	1	D	0.67145	0.996	D	0.72625	0.978	D	0.99513	1.0956	10	0.87932	D	0	.	14.5354	0.67955	1.0:0.0:0.0:0.0	.	645	Q14571	ITPR2_HUMAN	T	645	ENSP00000370744:I645T	ENSP00000370744:I645T	I	-	2	0	ITPR2	26702283	1.000000	0.71417	0.573000	0.28510	0.837000	0.47467	9.123000	0.94387	2.020000	0.59435	0.533000	0.62120	ATC	.	.		0.338	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
SCAF11	9169	hgsc.bcm.edu	37	12	46320825	46320825	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:46320825T>C	ENST00000369367.3	-	11	2892	c.2659A>G	c.(2659-2661)Act>Gct	p.T887A	SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000419565.2_Missense_Mutation_p.T887A|SCAF11_ENST00000465950.1_Missense_Mutation_p.T572A|SCAF11_ENST00000549162.1_Missense_Mutation_p.T695A	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	887	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						TCTCTAGAAGTTTCTCTTCTT	0.448																																					p.T887A		Atlas-SNP	.											.	SCAF11	145	.	0			c.A2659G						.						128.0	130.0	129.0					12																	46320825		2203	4300	6503	SO:0001583	missense	9169	exon11			TAGAAGTTTCTCT	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2659A>G	chr12.hg19:g.46320825T>C	ENSP00000358374:p.Thr887Ala	88.0	0.0		93.0	4.0	NM_004719	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	ENST00000369367.3	hg19	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	7.397	0.631970	0.14322	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.47869	1.47;2.2;1.47;2.2;0.83	5.81	3.43	0.39272	.	0.703582	0.13292	N	0.398916	T	0.42245	0.1194	L	0.56769	1.78	0.09310	N	1	B;B	0.17667	0.023;0.003	B;B	0.19946	0.027;0.002	T	0.32719	-0.9896	10	0.29301	T	0.29	-0.7387	7.9723	0.30134	0.0:0.0693:0.3955:0.5353	.	695;887	F8VXG7;Q99590	.;SCAFB_HUMAN	A	572;887;695;887;827	ENSP00000449812:T572A;ENSP00000358374:T887A;ENSP00000448864:T695A;ENSP00000413036:T887A;ENSP00000446746:T827A	ENSP00000358374:T887A	T	-	1	0	SCAF11	44607092	0.070000	0.21116	0.384000	0.26145	0.871000	0.50021	1.161000	0.31773	0.462000	0.27095	0.533000	0.62120	ACT	.	.		0.448	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	
SCAF11	9169	hgsc.bcm.edu	37	12	46357973	46357973	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:46357973T>C	ENST00000369367.3	-	2	213		c.e2-2		SCAF11_ENST00000395454.2_Splice_Site|SCAF11_ENST00000395453.2_Splice_Site|SCAF11_ENST00000419565.2_Splice_Site	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						AAGGGTTTCCTATAAGATAAA	0.264																																					.		Atlas-SNP	.											.	SCAF11	145	.	0			.						.						38.0	36.0	37.0					12																	46357973		1777	4042	5819	SO:0001630	splice_region_variant	9169	.			GTTTCCTATAAGA	Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.21-2A>G	chr12.hg19:g.46357973T>C		19.0	0.0		23.0	13.0	.	A6NEU9|A6NLW5|Q8IW59	Splice_Site	SNP	ENST00000369367.3	hg19	CCDS8748.2	.	.	.	.	.	.	.	.	.	.	T	11.44	1.638202	0.29157	.	.	ENSG00000139218	ENST00000266589	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.2066	0.54355	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SCAF11	44644240	0.999000	0.42202	0.932000	0.37286	0.189000	0.23516	4.167000	0.58209	2.207000	0.71202	0.459000	0.35465	.	.	.		0.264	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313992.2	NM_004719	Intron
CERS5	91012	hgsc.bcm.edu	37	12	50536965	50536965	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:50536965T>C	ENST00000317551.6	-	3	450	c.326A>G	c.(325-327)gAg>gGg	p.E109G	CERS5_ENST00000422340.2_Missense_Mutation_p.E51G	NM_147190.2	NP_671723.1	Q8N5B7	CERS5_HUMAN	ceramide synthase 5	109					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sphingosine N-acyltransferase activity (GO:0050291)										TGACAGGCCCTCCAGCCTTTT	0.483																																					p.E109G		Atlas-SNP	.											.	.	.	.	0			c.A326G						.						128.0	134.0	132.0					12																	50536965		2203	4300	6503	SO:0001583	missense	91012	exon3			AGGCCCTCCAGCC		CCDS8801.1, CCDS61120.1	12q13.12	2014-09-04	2011-07-08	2011-07-08	ENSG00000139624			"""Homeoboxes / CERS class"""	23749	protein-coding gene	gene with protein product		615335	"""LAG1 longevity assurance homolog 5 (S. cerevisiae)"", ""LAG1 homolog, ceramide synthase 5"""	LASS5			Standard	NM_147190		Approved	Trh4, MGC45411, FLJ25304	uc001rwd.4	Q8N5B7	OTTHUMG00000169819	ENST00000317551.6:c.326A>G	chr12.hg19:g.50536965T>C	ENSP00000325485:p.Glu109Gly	94.0	0.0		130.0	6.0	NM_147190	B4DV54	Missense_Mutation	SNP	ENST00000317551.6	hg19	CCDS8801.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.60|16.60	3.169789|3.169789	0.57584|0.57584	.|.	.|.	ENSG00000139624|ENSG00000139624	ENST00000551005;ENST00000317551;ENST00000422340|ENST00000547800	D;D;D|.	0.96913|.	-4.17;-4.17;-4.17|.	4.53|4.53	4.53|4.53	0.55603|0.55603	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);|.	0.163360|.	0.52532|.	D|.	0.000061|.	T|T	0.75715|0.75715	0.3887|0.3887	M|M	0.80847|0.80847	2.515|2.515	0.53688|0.53688	D|D	0.999976|0.999976	D;B;B|.	0.53885|.	0.963;0.049;0.03|.	P;B;B|.	0.62298|.	0.9;0.051;0.033|.	T|T	0.78028|0.78028	-0.2364|-0.2364	10|5	0.30078|.	T|.	0.28|.	-2.7838|-2.7838	14.3303|14.3303	0.66550|0.66550	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	51;109;28|.	B4DV54;Q8N5B7;F8W0U5|.	.;CERS5_HUMAN;.|.	G|G	28;109;51|44	ENSP00000447556:E28G;ENSP00000325485:E109G;ENSP00000389050:E51G|.	ENSP00000325485:E109G|.	E|R	-|-	2|1	0|2	CERS5|CERS5	48823232|48823232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.940000|0.940000	0.58332|0.58332	6.035000|6.035000	0.70940|0.70940	2.037000|2.037000	0.60232|0.60232	0.533000|0.533000	0.62120|0.62120	GAG|AGG	.	.		0.483	CERS5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000406069.3	NM_147190	
SLC4A8	9498	hgsc.bcm.edu	37	12	51856125	51856125	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:51856125A>G	ENST00000453097.2	+	10	1350	c.1133A>G	c.(1132-1134)gAg>gGg	p.E378G	SLC4A8_ENST00000514353.3_Missense_Mutation_p.E325G|SLC4A8_ENST00000358657.3_Missense_Mutation_p.E405G|SLC4A8_ENST00000535225.2_Missense_Mutation_p.E325G|SLC4A8_ENST00000394856.1_Missense_Mutation_p.E325G	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AAGGCAAAAGAGCGAGATGAT	0.448																																					p.E378G		Atlas-SNP	.											.	SLC4A8	292	.	0			c.A1133G						.						119.0	117.0	118.0					12																	51856125		2203	4300	6503	SO:0001583	missense	9498	exon10			CAAAAGAGCGAGA	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1133A>G	chr12.hg19:g.51856125A>G	ENSP00000405812:p.Glu378Gly	92.0	0.0		102.0	5.0	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	hg19	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	A	19.29	3.799840	0.70567	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.79141	-1.24;-1.24;-1.24;-1.24;-1.24	5.02	5.02	0.67125	Bicarbonate transporter, cytoplasmic (2);Phosphotransferase/anion transporter (1);	0.142197	0.64402	D	0.000009	T	0.68146	0.2969	N	0.20807	0.61	0.58432	D	0.999992	P;B;B;B;B;B	0.36354	0.549;0.004;0.364;0.015;0.021;0.04	B;B;B;B;B;B	0.39935	0.13;0.005;0.209;0.314;0.149;0.149	T	0.71351	-0.4619	10	0.49607	T	0.09	.	14.4078	0.67093	1.0:0.0:0.0:0.0	.	325;405;325;378;378;378	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	G	325;405;378;325;378;325;325	ENSP00000441520:E325G;ENSP00000351483:E405G;ENSP00000405812:E378G;ENSP00000378325:E325G;ENSP00000442561:E325G	ENSP00000315789:E378G	E	+	2	0	SLC4A8	50142392	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	9.283000	0.95860	2.185000	0.69588	0.533000	0.62120	GAG	.	.		0.448	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
SP1	6667	hgsc.bcm.edu	37	12	53800445	53800445	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:53800445A>G	ENST00000327443.4	+	4	1850	c.1752A>G	c.(1750-1752)gaA>gaG	p.E584E	SP1_ENST00000426431.2_Silent_p.E577E	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	584	Transactivation domain C (highly charged).				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GTGGAGAGGAAGGAGAAAACA	0.547																																					p.E584E		Atlas-SNP	.											.	SP1	57	.	0			c.A1752G						.						95.0	93.0	93.0					12																	53800445		2203	4300	6503	SO:0001819	synonymous_variant	6667	exon4			AGAGGAAGGAGAA	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.1752A>G	chr12.hg19:g.53800445A>G		75.0	0.0		86.0	4.0	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Silent	SNP	ENST00000327443.4	hg19	CCDS8857.1																																																																																			.	.		0.547	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
AMHR2	269	hgsc.bcm.edu	37	12	53823319	53823319	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:53823319A>G	ENST00000257863.4	+	8	1130	c.1050A>G	c.(1048-1050)ggA>ggG	p.G350G	AMHR2_ENST00000379791.3_Silent_p.G350G|AMHR2_ENST00000550311.1_Silent_p.G350G	NM_001164690.1|NM_020547.2	NP_001158162.1|NP_065434.1	Q16671	AMHR2_HUMAN	anti-Mullerian hormone receptor, type II	350	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Mullerian duct regression (GO:0001880)|negative regulation of anti-Mullerian hormone signaling pathway (GO:1902613)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)	integral component of plasma membrane (GO:0005887)	anti-Mullerian hormone receptor activity (GO:1990272)|ATP binding (GO:0005524)|hormone binding (GO:0042562)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta receptor activity, type II (GO:0005026)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|skin(2)	34					Adenosine triphosphate(DB00171)	GTGCCATTGGAGACCTGGGCC	0.577																																					p.G350G		Atlas-SNP	.											.	AMHR2	61	.	0			c.A1050G						.						106.0	95.0	99.0					12																	53823319		2203	4300	6503	SO:0001819	synonymous_variant	269	exon8			CATTGGAGACCTG	AF172932	CCDS8858.1, CCDS53798.1, CCDS55829.1	12q13	2013-03-14							465	protein-coding gene	gene with protein product	"""Muellerian inhibiting substance type II receptor"""	600956				7493017	Standard	NM_001164690		Approved	MISR2, MISRII	uc001scx.2	Q16671	OTTHUMG00000170048	ENST00000257863.4:c.1050A>G	chr12.hg19:g.53823319A>G		132.0	0.0		138.0	7.0	NM_020547	A0AVE1|B9EGB7|E9PGD2|F8W1D2|Q13762|Q647K2	Silent	SNP	ENST00000257863.4	hg19	CCDS8858.1																																																																																			.	.		0.577	AMHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407048.1	NM_020547	
OR6C1	390321	hgsc.bcm.edu	37	12	55714409	55714409	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:55714409A>G	ENST00000379668.2	+	1	64	c.26A>G	c.(25-27)gAg>gGg	p.E9G		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	9						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						GAAATAACAGAGTTTATTCTT	0.393																																					p.E9G		Atlas-SNP	.											.	OR6C1	58	.	0			c.A26G						.						62.0	63.0	63.0					12																	55714409		2203	4300	6503	SO:0001583	missense	390321	exon1			TAACAGAGTTTAT	AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.26A>G	chr12.hg19:g.55714409A>G	ENSP00000368990:p.Glu9Gly	86.0	0.0		74.0	4.0	NM_001005182	B2RNM0	Missense_Mutation	SNP	ENST00000379668.2	hg19	CCDS31818.1	.	.	.	.	.	.	.	.	.	.	a	11.67	1.708587	0.30322	.	.	ENSG00000205330	ENST00000379668	T	0.11385	2.78	5.21	4.01	0.46588	.	0.782577	0.11725	N	0.535522	T	0.12092	0.0294	L	0.57130	1.785	0.27404	N	0.954758	B	0.13145	0.007	B	0.19946	0.027	T	0.09885	-1.0654	10	0.52906	T	0.07	.	5.3683	0.16125	0.7615:0.0:0.083:0.1556	.	9	Q96RD1	OR6C1_HUMAN	G	9	ENSP00000368990:E9G	ENSP00000368990:E9G	E	+	2	0	OR6C1	54000676	0.006000	0.16342	0.995000	0.50966	0.775000	0.43874	0.091000	0.15046	2.185000	0.69588	0.374000	0.22700	GAG	.	.		0.393	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398152.1	NM_001005182	
DNAJC14	85406	hgsc.bcm.edu	37	12	56222422	56222422	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:56222422T>C	ENST00000357606.3	-	3	310	c.21A>G	c.(19-21)ggA>ggG	p.G7G	DNAJC14_ENST00000317269.3_Silent_p.G7G|TMEM198B_ENST00000478241.1_RNA|DNAJC14_ENST00000317287.5_Silent_p.G7G|RP11-762I7.5_ENST00000546837.1_5'Flank			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	7					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						ACCCTCTTTCTCCGGGGTGCT	0.562																																					p.G7G		Atlas-SNP	.											.	DNAJC14	52	.	0			c.A21G						.						52.0	52.0	52.0					12																	56222422		2203	4300	6503	SO:0001819	synonymous_variant	85406	exon2			TCTTTCTCCGGGG	AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.21A>G	chr12.hg19:g.56222422T>C		104.0	0.0		91.0	4.0	NM_032364	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	ENST00000357606.3	hg19	CCDS8894.1																																																																																			.	.		0.562	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409095.1	NM_032364	
PRIM1	5557	hgsc.bcm.edu	37	12	57135246	57135246	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:57135246T>C	ENST00000338193.6	-	9	991	c.955A>G	c.(955-957)Agc>Ggc	p.S319G		NM_000946.2	NP_000937.1	P49642	PRI1_HUMAN	primase, DNA, polypeptide 1 (49kDa)	319					DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			kidney(1)|lung(6)|prostate(1)	8						CTAAAAGGGCTCTTCAGTAGA	0.403																																					p.S319G		Atlas-SNP	.											.	PRIM1	22	.	0			c.A955G						.						71.0	64.0	66.0					12																	57135246		1836	4106	5942	SO:0001583	missense	5557	exon9			AAGGGCTCTTCAG	BC005266	CCDS44926.1	12q13.3	2007-06-19	2007-06-19			ENSG00000198056			9369	protein-coding gene	gene with protein product		176635				8530050	Standard	NM_000946		Approved		uc001smd.3	P49642	OTTHUMG00000170034	ENST00000338193.6:c.955A>G	chr12.hg19:g.57135246T>C	ENSP00000350491:p.Ser319Gly	89.0	0.0		103.0	6.0	NM_000946		Missense_Mutation	SNP	ENST00000338193.6	hg19	CCDS44926.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.424566	0.83667	.	.	ENSG00000198056	ENST00000537418;ENST00000338193;ENST00000549549;ENST00000550770	T;T;T	0.49432	0.78;0.78;0.78	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.65015	0.2651	M	0.81682	2.555	0.80722	D	1	D	0.54207	0.965	P	0.59643	0.861	T	0.64922	-0.6293	10	0.28530	T	0.3	-12.0557	14.235	0.65919	0.0:0.0:0.0:1.0	.	319	P49642	PRI1_HUMAN	G	326;319;100;322	ENSP00000350491:S319G;ENSP00000449806:S100G;ENSP00000450185:S322G	ENSP00000350491:S319G	S	-	1	0	PRIM1	55421513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.560000	0.82277	2.148000	0.66965	0.533000	0.62120	AGC	.	.		0.403	PRIM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406956.1	NM_000946	
MYO1A	4640	hgsc.bcm.edu	37	12	57437910	57437910	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:57437910A>G	ENST00000442789.2	-	10	1011	c.724T>C	c.(724-726)Tcc>Ccc	p.S242P	MYO1A_ENST00000544473.1_Missense_Mutation_p.S80P|MYO1A_ENST00000300119.3_Missense_Mutation_p.S242P	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	242	Myosin motor.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						CTGAAGCTGGAGGCGTCGTCC	0.562																																					p.S242P		Atlas-SNP	.											.	MYO1A	122	.	0			c.T724C						.						104.0	94.0	97.0					12																	57437910		2203	4300	6503	SO:0001583	missense	4640	exon9			AGCTGGAGGCGTC	L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.724T>C	chr12.hg19:g.57437910A>G	ENSP00000393392:p.Ser242Pro	157.0	0.0		202.0	9.0	NM_005379	Q9UQD7	Missense_Mutation	SNP	ENST00000442789.2	hg19	CCDS8929.1	.	.	.	.	.	.	.	.	.	.	A	14.89	2.671256	0.47781	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.72394	-0.65;-0.65;-0.65	4.81	0.8	0.18672	Myosin head, motor domain (2);	0.269795	0.35013	N	0.003502	T	0.65186	0.2667	L	0.52823	1.66	0.36184	D	0.849593	B	0.30937	0.301	B	0.36418	0.224	T	0.68561	-0.5376	10	0.56958	D	0.05	.	10.5198	0.44912	0.454:0.546:0.0:0.0	.	242	Q9UBC5	MYO1A_HUMAN	P	242;242;80	ENSP00000300119:S242P;ENSP00000393392:S242P;ENSP00000440514:S80P	ENSP00000300119:S242P	S	-	1	0	MYO1A	55724177	0.471000	0.25862	0.738000	0.30950	0.831000	0.47069	1.058000	0.30504	0.385000	0.24970	0.460000	0.39030	TCC	.	.		0.562	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313833.2	NM_005379	
AGAP2	116986	hgsc.bcm.edu	37	12	58123479	58123479	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:58123479T>C	ENST00000547588.1	-	13	2499	c.2500A>G	c.(2500-2502)Agg>Ggg	p.R834G	AGAP2_ENST00000257897.3_Missense_Mutation_p.R498G	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	834	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TTTTTCCTCCTCTGCTTCTTC	0.577																																					p.R834G		Atlas-SNP	.											.	AGAP2	167	.	0			c.A2500G						.						150.0	148.0	148.0					12																	58123479		2203	4300	6503	SO:0001583	missense	116986	exon13			TCCTCCTCTGCTT	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2500A>G	chr12.hg19:g.58123479T>C	ENSP00000449241:p.Arg834Gly	100.0	0.0		108.0	7.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	ENST00000547588.1	hg19	CCDS44932.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.29|17.29	3.352148|3.352148	0.61183|0.61183	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000328568|ENST00000257897;ENST00000547588	.|T;T	.|0.35973	.|1.39;1.28	4.39|4.39	4.39|4.39	0.52855|0.52855	.|Pleckstrin homology domain (3);	.|0.359275	.|0.30911	.|N	.|0.008631	T|T	0.54431|0.54431	0.1858|0.1858	L|L	0.59436|0.59436	1.845|1.845	0.47905|0.47905	D|D	0.999545|0.999545	.|D;P;D	.|0.76494	.|0.999;0.917;0.987	.|D;P;P	.|0.78314	.|0.991;0.774;0.9	T|T	0.57711|0.57711	-0.7764|-0.7764	5|10	.|0.66056	.|D	.|0.02	.|.	13.0225|13.0225	0.58796|0.58796	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|498;834;834	.|Q99490-2;F8VVT9;Q99490	.|.;.;AGAP2_HUMAN	G|G	697|498;834	.|ENSP00000257897:R498G;ENSP00000449241:R834G	.|ENSP00000257897:R498G	E|R	-|-	2|1	0|2	AGAP2|AGAP2	56409746|56409746	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.765000|0.765000	0.43378|0.43378	0.647000|0.647000	0.24812|0.24812	1.978000|1.978000	0.57642|0.57642	0.379000|0.379000	0.24179|0.24179	GAG|AGG	.	.		0.577	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
C12orf56	115749	hgsc.bcm.edu	37	12	64664453	64664453	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:64664453A>G	ENST00000543942.2	-	12	2252	c.1626T>C	c.(1624-1626)ggT>ggC	p.G542G	C12orf56_ENST00000536975.1_5'UTR|RPS11P6_ENST00000535684.1_RNA|C12orf56_ENST00000333722.5_Silent_p.G382G	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	542										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		AAGCTGAAAGACCCCTCACCA	0.453																																					p.G542G		Atlas-SNP	.											.	C12orf56	42	.	0			c.T1626C						.						84.0	78.0	80.0					12																	64664453		1888	4128	6016	SO:0001819	synonymous_variant	115749	exon12			TGAAAGACCCCTC		CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.1626T>C	chr12.hg19:g.64664453A>G		72.0	0.0		99.0	4.0	NM_001170633		Silent	SNP	ENST00000543942.2	hg19																																																																																				.	.		0.453	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000401058.2	NM_001099676	
ATP2B1	490	hgsc.bcm.edu	37	12	90015351	90015351	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:90015351T>C	ENST00000428670.3	-	10	2018	c.1562A>G	c.(1561-1563)aAt>aGt	p.N521S	ATP2B1_ENST00000359142.3_Missense_Mutation_p.N521S|ATP2B1_ENST00000348959.3_Missense_Mutation_p.N521S|ATP2B1_ENST00000393164.2_Missense_Mutation_p.N264S|ATP2B1_ENST00000261173.2_Missense_Mutation_p.N521S			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	521					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						ATAAGCACAATTCACAGAAAT	0.269																																					p.N521S		Atlas-SNP	.											.	ATP2B1	191	.	0			c.A1562G						.						61.0	62.0	61.0					12																	90015351		2201	4295	6496	SO:0001583	missense	490	exon9			GCACAATTCACAG	J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.1562A>G	chr12.hg19:g.90015351T>C	ENSP00000392043:p.Asn521Ser	76.0	0.0		72.0	4.0	NM_001001323	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Missense_Mutation	SNP	ENST00000428670.3	hg19	CCDS9035.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.386860	0.82902	.	.	ENSG00000070961	ENST00000261173;ENST00000348959;ENST00000359142;ENST00000428670;ENST00000393164	T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.85504	0.5712	M	0.84683	2.71	0.80722	D	1	D;D;P	0.71674	0.998;0.992;0.9	D;P;P	0.76071	0.987;0.85;0.888	D	0.87143	0.2204	9	.	.	.	-13.7261	16.0337	0.80603	0.0:0.0:0.0:1.0	.	521;521;521	P20020-3;P20020-2;P20020-6	.;.;.	S	521;521;521;521;264	ENSP00000261173:N521S;ENSP00000343599:N521S;ENSP00000352054:N521S;ENSP00000392043:N521S;ENSP00000376869:N264S	.	N	-	2	0	ATP2B1	88539482	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.188000	0.69820	0.460000	0.39030	AAT	.	.		0.269	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406653.1	NM_001682	
ALDH1L2	160428	hgsc.bcm.edu	37	12	105424187	105424187	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:105424187C>T	ENST00000258494.9	-	21	2571	c.2431G>A	c.(2431-2433)Gtg>Atg	p.V811M	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	811	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)	p.V811M(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						TCTGTGAACACGGTCGGCTCC	0.373																																					p.V811M		Atlas-SNP	.											ALDH1L2,rectum,carcinoma,0,1	ALDH1L2	71	.	1	Substitution - Missense(1)	large_intestine(1)	c.G2431A						.						87.0	83.0	84.0					12																	105424187		2203	4300	6503	SO:0001583	missense	160428	exon21			TGAACACGGTCGG	AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2431G>A	chr12.hg19:g.105424187C>T	ENSP00000258494:p.Val811Met	53.0	0.0		84.0	4.0	NM_001034173	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	ENST00000258494.9	hg19	CCDS31891.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.7|24.7	4.560897|4.560897	0.86335|0.86335	.|.	.|.	ENSG00000136010|ENSG00000136010	ENST00000548418|ENST00000258494	.|D	.|0.82081	.|-1.57	6.06|6.06	6.06|6.06	0.98353|0.98353	.|Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.93383|0.93383	0.7890|0.7890	H|H	0.95645|0.95645	3.7|3.7	0.80722|0.80722	D|D	1|1	.|D	.|0.76494	.|0.999	.|D	.|0.68353	.|0.957	D|D	0.94563|0.94563	0.7764|0.7764	5|10	.|0.87932	.|D	.|0	.|.	14.7322|14.7322	0.69391|0.69391	0.0:0.9314:0.0:0.0686|0.0:0.9314:0.0:0.0686	.|.	.|811	.|Q3SY69	.|AL1L2_HUMAN	H|M	63|811	.|ENSP00000258494:V811M	.|ENSP00000258494:V811M	R|V	-|-	2|1	0|0	ALDH1L2|ALDH1L2	103948317|103948317	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.849000|0.849000	0.48306|0.48306	5.970000|5.970000	0.70431|0.70431	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	CGT|GTG	.	.		0.373	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406098.1	XM_090294	
MYO1H	283446	hgsc.bcm.edu	37	12	109834370	109834370	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:109834370T>C	ENST00000431443.2	+	3	424	c.424T>C	c.(424-426)Tcc>Ccc	p.S142P	MYO1H_ENST00000310903.5_Missense_Mutation_p.S142P	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	142	Myosin motor.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						ACTGCTGTTCTCCAACCCAGT	0.522																																					p.S142P		Atlas-SNP	.											.	MYO1H	98	.	0			c.T424C						.						67.0	65.0	65.0					12																	109834370		1938	4150	6088	SO:0001583	missense	283446	exon3			CTGTTCTCCAACC		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.424T>C	chr12.hg19:g.109834370T>C	ENSP00000444076:p.Ser142Pro	58.0	0.0		93.0	4.0	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	hg19		.	.	.	.	.	.	.	.	.	.	T	24.0	4.482103	0.84747	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.73469	-0.75;-0.75	4.8	4.8	0.61643	.	.	.	.	.	D	0.90964	0.7159	H	0.98426	4.23	0.47621	D	0.999471	D	0.76494	0.999	D	0.68943	0.961	D	0.94213	0.7460	9	0.87932	D	0	.	14.2704	0.66149	0.0:0.0:0.0:1.0	.	142	F5H3C6	.	P	142	ENSP00000439182:S142P;ENSP00000444076:S142P	ENSP00000439182:S142P	S	+	1	0	MYO1H	108318753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.184000	0.72008	2.112000	0.64535	0.524000	0.50904	TCC	.	.		0.522	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
CLIP1	6249	hgsc.bcm.edu	37	12	122826186	122826186	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:122826186C>T	ENST00000540338.1	-	10	1606	c.1565G>A	c.(1564-1566)aGa>aAa	p.R522K	CLIP1_ENST00000537178.1_Missense_Mutation_p.R476K|CLIP1_ENST00000358808.2_Missense_Mutation_p.R511K|CLIP1_ENST00000302528.7_Missense_Mutation_p.R511K|CLIP1_ENST00000361654.4_Missense_Mutation_p.R476K|CLIP1_ENST00000545889.1_Missense_Mutation_p.R212K			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	522					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TTCCTGTACTCTCAATGCTAG	0.418																																					p.R522K		Atlas-SNP	.											.	CLIP1	126	.	0			c.G1565A						.						133.0	135.0	134.0					12																	122826186		2203	4300	6503	SO:0001583	missense	6249	exon11			TGTACTCTCAATG		CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.1565G>A	chr12.hg19:g.122826186C>T	ENSP00000439093:p.Arg522Lys	69.0	0.0		66.0	4.0	NM_001247997	A0AVD3|Q17RS4|Q29RG0	Missense_Mutation	SNP	ENST00000540338.1	hg19	CCDS58285.1	.	.	.	.	.	.	.	.	.	.	C	12.30	1.896467	0.33442	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000537178;ENST00000540338;ENST00000540304	T;T;T;T;T;T	0.61859	2.64;0.63;0.63;0.64;0.54;0.07	5.01	4.12	0.48240	.	0.177541	0.49916	N	0.000124	T	0.45074	0.1324	L	0.40543	1.245	0.09310	N	1	B;B;B;B	0.30584	0.0;0.286;0.184;0.052	B;B;B;B	0.31946	0.004;0.138;0.079;0.047	T	0.26258	-1.0108	10	0.16420	T	0.52	-7.4457	10.1323	0.42687	0.0:0.8465:0.0:0.1535	.	212;476;511;522	F5H0N7;P30622-2;P30622-1;P30622	.;.;.;CLIP1_HUMAN	K	212;511;511;356;476;522;445	ENSP00000438743:R212K;ENSP00000303585:R511K;ENSP00000351665:R511K;ENSP00000445531:R476K;ENSP00000439093:R522K;ENSP00000437786:R445K	ENSP00000303585:R511K	R	-	2	0	CLIP1	121392139	0.609000	0.26975	0.070000	0.20053	0.996000	0.88848	3.046000	0.49846	1.239000	0.43787	0.655000	0.94253	AGA	.	.		0.418	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000401625.1	NM_002956	
ZCCHC8	55596	hgsc.bcm.edu	37	12	122958449	122958449	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:122958449A>G	ENST00000336229.4	-	14	1849	c.1719T>C	c.(1717-1719)tcT>tcC	p.S573S	ZCCHC8_ENST00000543897.1_Silent_p.S335S|ZCCHC8_ENST00000536306.1_Silent_p.S335S|ZCCHC8_ENST00000538116.1_Silent_p.S184S	NM_017612.3	NP_060082.2	Q6NZY4	ZCHC8_HUMAN	zinc finger, CCHC domain containing 8	573					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(8)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.25e-05)|Epithelial(86;0.000113)|BRCA - Breast invasive adenocarcinoma(302;0.202)		TCTGCTTTTCAGATGTTTTTC	0.493																																					p.S573S		Atlas-SNP	.											.	ZCCHC8	56	.	0			c.T1719C						.						214.0	208.0	210.0					12																	122958449		1962	4166	6128	SO:0001819	synonymous_variant	55596	exon14			CTTTTCAGATGTT	BC017704		12q24.31	2014-04-14				ENSG00000033030		"""Zinc fingers, CCHC domain containing"""	25265	protein-coding gene	gene with protein product						12477932	Standard	XM_005253581		Approved	DKFZp434E2220	uc001ucn.3	Q6NZY4		ENST00000336229.4:c.1719T>C	chr12.hg19:g.122958449A>G		60.0	0.0		90.0	4.0	NM_017612	Q7L2P6|Q8N2K5|Q96SK7|Q9NSS2|Q9NSS3	Silent	SNP	ENST00000336229.4	hg19																																																																																				.	.		0.493	ZCCHC8-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_017612	
RILPL1	353116	hgsc.bcm.edu	37	12	123983122	123983122	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:123983122T>C	ENST00000376874.4	-	4	1005	c.770A>G	c.(769-771)gAg>gGg	p.E257G	RILPL1_ENST00000340724.6_Missense_Mutation_p.E105G	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	257					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CTGGCTGTGCTCCCCCTGCAG	0.632																																					p.E257G		Atlas-SNP	.											.	RILPL1	23	.	0			c.A770G						.						42.0	47.0	46.0					12																	123983122		2081	4212	6293	SO:0001583	missense	353116	exon4			CTGTGCTCCCCCT	AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.770A>G	chr12.hg19:g.123983122T>C	ENSP00000366070:p.Glu257Gly	106.0	0.0		179.0	8.0	NM_178314	Q66K36|Q8N1M0	Missense_Mutation	SNP	ENST00000376874.4	hg19	CCDS45006.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.374324	0.42105	.	.	ENSG00000188026	ENST00000376874;ENST00000340724	T;T	0.23147	1.92;1.92	5.22	1.45	0.22620	.	1.363090	0.04323	N	0.351132	T	0.23965	0.0580	L	0.47716	1.5	0.80722	D	1	B;B;B	0.24258	0.004;0.1;0.0	B;B;B	0.24541	0.006;0.054;0.001	T	0.04708	-1.0932	10	0.25751	T	0.34	-2.2299	6.756	0.23514	0.0:0.1365:0.128:0.7356	.	233;257;106	Q5EBL4-2;Q5EBL4;Q5EBL4-3	.;RIPL1_HUMAN;.	G	257;105	ENSP00000366070:E257G;ENSP00000345874:E105G	ENSP00000345874:E105G	E	-	2	0	RILPL1	122549075	0.997000	0.39634	0.054000	0.19295	0.895000	0.52256	2.778000	0.47726	0.062000	0.16340	0.454000	0.30748	GAG	.	.		0.632	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400595.1	NM_178314	
POLE	5426	hgsc.bcm.edu	37	12	133219191	133219191	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:133219191T>C	ENST00000320574.5	-	37	4896	c.4853A>G	c.(4852-4854)aAc>aGc	p.N1618S	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Missense_Mutation_p.N1591S	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1618					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GACCCCATAGTTGATCTTGTC	0.582								DNA polymerases (catalytic subunits)																													p.N1618S		Atlas-SNP	.											.	POLE	416	.	0			c.A4853G						.						58.0	59.0	59.0					12																	133219191		2203	4300	6503	SO:0001583	missense	5426	exon37			CCATAGTTGATCT		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4853A>G	chr12.hg19:g.133219191T>C	ENSP00000322570:p.Asn1618Ser	77.0	0.0		140.0	40.0	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	hg19	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	2.489	-0.317887	0.05386	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.20738	2.05;2.05;2.05	5.6	2.78	0.32641	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.108697	0.85682	N	0.000000	T	0.06050	0.0157	N	0.02011	-0.69	0.22521	N	0.999026	B	0.02656	0.0	B	0.06405	0.002	T	0.41034	-0.9531	10	0.02654	T	1	.	8.9578	0.35829	0.0:0.6997:0.0:0.3003	.	1618	Q07864	DPOE1_HUMAN	S	1618;1629;1591	ENSP00000322570:N1618S;ENSP00000406383:N1629S;ENSP00000445753:N1591S	ENSP00000322570:N1618S	N	-	2	0	POLE	131729264	0.999000	0.42202	1.000000	0.80357	0.933000	0.57130	0.721000	0.25911	0.714000	0.32081	-0.248000	0.11899	AAC	.	.		0.582	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
PARP4	143	hgsc.bcm.edu	37	13	25017789	25017789	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:25017789T>C	ENST00000381989.3	-	28	3551	c.3446A>G	c.(3445-3447)gAg>gGg	p.E1149G		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1149					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		AGAACAAACCTCATGACTGGT	0.398																																					p.E1149G		Atlas-SNP	.											.	PARP4	142	.	0			c.A3446G						.						126.0	137.0	133.0					13																	25017789		2203	4300	6503	SO:0001630	splice_region_variant	143	exon28			CAAACCTCATGAC	AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3447+1A>G	chr13.hg19:g.25017789T>C		64.0	0.0		86.0	5.0	NM_006437	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	ENST00000381989.3	hg19	CCDS9307.1	.	.	.	.	.	.	.	.	.	.	t	14.92	2.680445	0.47886	.	.	ENSG00000102699	ENST00000381989	T	0.65916	-0.18	4.66	4.66	0.58398	.	0.136282	0.47852	D	0.000216	T	0.65048	0.2654	L	0.48642	1.525	0.45962	D	0.998787	D	0.54047	0.964	P	0.52672	0.706	T	0.68277	-0.5451	10	0.62326	D	0.03	-13.432	12.1286	0.53930	0.0:0.0:0.0:1.0	.	1149	Q9UKK3	PARP4_HUMAN	G	1149	ENSP00000371419:E1149G	ENSP00000371419:E1149G	E	-	2	0	PARP4	23915789	1.000000	0.71417	0.936000	0.37596	0.134000	0.20937	6.219000	0.72231	1.970000	0.57323	0.529000	0.55759	GAG	.	.		0.398	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044189.1	NM_006437	Missense_Mutation
ATP12A	479	hgsc.bcm.edu	37	13	25274939	25274939	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:25274939A>G	ENST00000381946.3	+	13	1927	c.1760A>G	c.(1759-1761)gAc>gGc	p.D587G	RNY1P7_ENST00000384743.1_RNA|ATP12A_ENST00000218548.6_Missense_Mutation_p.D593G			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	587					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TACTCATTTGACATAGACGCT	0.458																																					p.D593G	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											ATP12A,colon,carcinoma,0,3	ATP12A	172	.	0			c.A1778G						.						137.0	125.0	129.0					13																	25274939		2203	4300	6503	SO:0001583	missense	479	exon13			CATTTGACATAGA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1760A>G	chr13.hg19:g.25274939A>G	ENSP00000371372:p.Asp587Gly	134.0	0.0		140.0	60.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	16.13	3.035648	0.54896	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	T;T	0.80909	-1.43;-1.43	6.17	5.0	0.66597	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.063239	0.64402	D	0.000005	D	0.84070	0.5391	L	0.47716	1.5	0.58432	D	0.999999	D;D	0.67145	0.996;0.996	D;P	0.63597	0.916;0.903	D	0.84454	0.0590	10	0.66056	D	0.02	.	10.5257	0.44948	0.9246:0.0:0.0754:0.0	.	593;587	P54707-2;P54707	.;AT12A_HUMAN	G	593;587	ENSP00000218548:D593G;ENSP00000371372:D587G	ENSP00000218548:D593G	D	+	2	0	ATP12A	24172939	1.000000	0.71417	0.831000	0.32960	0.010000	0.07245	9.228000	0.95250	1.161000	0.42604	-0.250000	0.11733	GAC	.	.		0.458	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
CENPJ	55835	hgsc.bcm.edu	37	13	25478135	25478135	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:25478135T>C	ENST00000381884.4	-	8	2939	c.2754A>G	c.(2752-2754)gaA>gaG	p.E918E	CENPJ_ENST00000545981.1_Silent_p.E918E	NM_018451.4	NP_060921.3	Q9HC77	CENPJ_HUMAN	centromere protein J	918					cell division (GO:0051301)|centriole replication (GO:0007099)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|microtubule polymerization (GO:0046785)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|gamma-tubulin small complex (GO:0008275)|microtubule (GO:0005874)	protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|tubulin binding (GO:0015631)			endometrium(5)|kidney(4)|large_intestine(14)|lung(13)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.00793)|Epithelial(112;0.0411)|OV - Ovarian serous cystadenocarcinoma(117;0.139)		CTTTAAACTTTTCTATTTCTG	0.373																																					p.E918E		Atlas-SNP	.											.	CENPJ	116	.	0			c.A2754G						.						186.0	176.0	179.0					13																	25478135		2203	4300	6503	SO:0001819	synonymous_variant	55835	exon8			AAACTTTTCTATT	AF139625	CCDS9310.1	13q12.12	2013-11-05			ENSG00000151849	ENSG00000151849			17272	protein-coding gene	gene with protein product	"""centrosomal P4.1-associated protein"""	609279	"""microcephaly, primary autosomal recessive 6"""	MCPH6		11003675, 22699936	Standard	NM_018451		Approved	CPAP, BM032, LAP, LIP1, Sas-4, SASS4, SCKL4	uc001upt.5	Q9HC77	OTTHUMG00000016595	ENST00000381884.4:c.2754A>G	chr13.hg19:g.25478135T>C		110.0	0.0		110.0	5.0	NM_018451	Q2KHM6|Q5JPD5|Q5T6R5|Q96KS5|Q9C067	Silent	SNP	ENST00000381884.4	hg19	CCDS9310.1																																																																																			.	.		0.373	CENPJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044209.1	NM_018451	
AMER2	219287	hgsc.bcm.edu	37	13	25745556	25745556	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:25745556A>G	ENST00000515384.1	-	1	869	c.202T>C	c.(202-204)Ttc>Ctc	p.F68L	AMER2-AS1_ENST00000413501.1_lincRNA|AMER2_ENST00000381853.3_Missense_Mutation_p.F68L|AMER2_ENST00000357816.2_Missense_Mutation_p.F68L			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	68	Gly-rich.				ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										AATAATTTGAAGGCAGCTTTA	0.587																																					p.F68L		Atlas-SNP	.											.	.	.	.	0			c.T202C						.						47.0	53.0	51.0					13																	25745556		2196	4283	6479	SO:0001583	missense	219287	exon1			ATTTGAAGGCAGC	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.202T>C	chr13.hg19:g.25745556A>G	ENSP00000426528:p.Phe68Leu	77.0	0.0		93.0	4.0	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Missense_Mutation	SNP	ENST00000515384.1	hg19	CCDS53859.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198323	0.79015	.	.	ENSG00000165566	ENST00000357816;ENST00000381853;ENST00000515384	T;T;T	0.27890	1.64;1.64;1.64	3.4	3.4	0.38934	.	0.000000	0.85682	D	0.000000	T	0.45994	0.1370	L	0.46741	1.465	0.44643	D	0.997625	D;D	0.76494	0.999;0.999	D;D	0.83275	0.991;0.996	T	0.46105	-0.9215	10	0.87932	D	0	-1.9422	11.4533	0.50167	1.0:0.0:0.0:0.0	.	68;68	Q8N7J2;Q8N7J2-2	F123A_HUMAN;.	L	68	ENSP00000350469:F68L;ENSP00000371277:F68L;ENSP00000426528:F68L	ENSP00000350469:F68L	F	-	1	0	FAM123A	24643556	1.000000	0.71417	0.982000	0.44146	0.887000	0.51463	6.492000	0.73654	1.546000	0.49388	0.260000	0.18958	TTC	.	.		0.587	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
FLT3	2322	hgsc.bcm.edu	37	13	28588598	28588598	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:28588598T>C	ENST00000241453.7	-	23	2931	c.2850A>G	c.(2848-2850)gcA>gcG	p.A950A	FLT3_ENST00000537084.1_Silent_p.A909A|FLT3_ENST00000380982.4_Silent_p.A953A|FLT3_ENST00000469894.1_5'UTR	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	950					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	CCGCTTCTTCTGCATCTGCCA	0.413			"""Mis, O"""		"""AML, ALL"""																																p.A950A		Atlas-SNP	.		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	.	FLT3	15525	.	0			c.A2850G						.						84.0	78.0	80.0					13																	28588598		2203	4300	6503	SO:0001819	synonymous_variant	2322	exon23			TTCTTCTGCATCT	U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.2850A>G	chr13.hg19:g.28588598T>C		102.0	0.0		95.0	4.0	NM_004119	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	ENST00000241453.7	hg19	CCDS31953.1																																																																																			.	.		0.413	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000044319.2		
POSTN	10631	hgsc.bcm.edu	37	13	38153044	38153044	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:38153044T>C	ENST00000379747.4	-	15	2016	c.1899A>G	c.(1897-1899)acA>acG	p.T633T	POSTN_ENST00000541481.1_Silent_p.T633T|POSTN_ENST00000379749.4_Silent_p.T633T|POSTN_ENST00000379743.4_Silent_p.T633T|POSTN_ENST00000541179.1_Silent_p.T633T|POSTN_ENST00000379742.4_Silent_p.T633T	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	633					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		TTCCAACAGGTGTGTCTATGA	0.249																																					p.T633T		Atlas-SNP	.											.	POSTN	161	.	0			c.A1899G						.						41.0	46.0	44.0					13																	38153044		2195	4294	6489	SO:0001819	synonymous_variant	10631	exon15			AACAGGTGTGTCT	D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.1899A>G	chr13.hg19:g.38153044T>C		97.0	0.0		77.0	4.0	NM_006475	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	ENST00000379747.4	hg19	CCDS9364.1																																																																																			.	.		0.249	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000044566.2	NM_006475	
FREM2	341640	hgsc.bcm.edu	37	13	39343836	39343836	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:39343836T>C	ENST00000280481.7	+	4	5748	c.5532T>C	c.(5530-5532)gaT>gaC	p.D1844D		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1844	Calx-beta 1.				cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		TCCTGAGTGATGGGGAGCATG	0.542																																					p.D1844D		Atlas-SNP	.											.	FREM2	385	.	0			c.T5532C						.						142.0	115.0	124.0					13																	39343836		2203	4300	6503	SO:0001819	synonymous_variant	341640	exon4			GAGTGATGGGGAG	BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.5532T>C	chr13.hg19:g.39343836T>C		257.0	0.0		302.0	115.0	NM_207361	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Silent	SNP	ENST00000280481.7	hg19	CCDS31960.1																																																																																			.	.		0.542	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044599.2	NM_207361	
LACC1	144811	hgsc.bcm.edu	37	13	44455553	44455553	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:44455553A>C	ENST00000441843.1	+	2	917	c.432A>C	c.(430-432)aaA>aaC	p.K144N	CCDC122_ENST00000444614.3_5'Flank|LACC1_ENST00000325686.6_Missense_Mutation_p.K144N|CCDC122_ENST00000476570.2_5'Flank	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	144																	GGCTTTTTAAACAGTCCATTG	0.338																																					p.K144N		Atlas-SNP	.											.	.	.	.	0			c.A432C						.						77.0	82.0	80.0					13																	44455553		2203	4300	6503	SO:0001583	missense	144811	exon2			TTTTAAACAGTCC	AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.432A>C	chr13.hg19:g.44455553A>C	ENSP00000391747:p.Lys144Asn	79.0	0.0		84.0	4.0	NM_001128303	A2A3Z6|Q8N8X5	Missense_Mutation	SNP	ENST00000441843.1	hg19	CCDS9391.1	.	.	.	.	.	.	.	.	.	.	A	8.320	0.824010	0.16678	.	.	ENSG00000179630	ENST00000441843;ENST00000425906;ENST00000325686	T;T	0.46451	0.87;0.87	5.66	1.71	0.24356	.	0.285942	0.41396	D	0.000884	T	0.28863	0.0716	L	0.48877	1.53	0.09310	N	1	B	0.26120	0.142	B	0.15870	0.014	T	0.12091	-1.0561	10	0.30854	T	0.27	-31.9683	6.159	0.20354	0.7199:0.136:0.1442:0.0	.	144	Q8IV20	LACC1_HUMAN	N	144	ENSP00000391747:K144N;ENSP00000317619:K144N	ENSP00000317619:K144N	K	+	3	2	LACC1	43353553	0.763000	0.28462	0.942000	0.38095	0.132000	0.20833	1.171000	0.31896	0.522000	0.28464	0.533000	0.62120	AAA	.	.		0.338	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044726.3	NM_153218	
MYCBP2	23077	hgsc.bcm.edu	37	13	77740659	77740659	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:77740659T>C	ENST00000544440.2	-	41	6048	c.6031A>G	c.(6031-6033)Aca>Gca	p.T2011A	MYCBP2_ENST00000357337.6_Missense_Mutation_p.T2011A|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000407578.2_Missense_Mutation_p.T2049A					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AATTCGATTGTCATCCACCTC	0.413																																					p.T2049A		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A6145G						.						115.0	108.0	110.0					13																	77740659		2203	4300	6503	SO:0001583	missense	23077	exon41			CGATTGTCATCCA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.6031A>G	chr13.hg19:g.77740659T>C	ENSP00000444596:p.Thr2011Ala	119.0	0.0		150.0	6.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	16.88	3.245090	0.59103	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.29655	1.56;1.56;1.56	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.22936	0.0554	L	0.28400	0.85	0.54753	D	0.999985	B	0.23591	0.088	B	0.21360	0.034	T	0.04752	-1.0929	10	0.37606	T	0.19	.	11.2346	0.48933	0.1366:0.0:0.0:0.8634	.	2011	O75592	MYCB2_HUMAN	A	2011;2049;2011	ENSP00000349892:T2011A;ENSP00000384288:T2049A;ENSP00000444596:T2011A	ENSP00000349892:T2011A	T	-	1	0	MYCBP2	76638660	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.149000	0.71795	2.205000	0.71048	0.528000	0.53228	ACA	.	.		0.413	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
RNF219	79596	hgsc.bcm.edu	37	13	79213208	79213208	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:79213208T>C	ENST00000282003.6	-	4	359		c.e4-2			NM_024546.3	NP_078822.3	Q5W0B1	RN219_HUMAN	ring finger protein 219								zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(11)|liver(1)|lung(11)|prostate(1)|skin(1)	32		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.0848)		GBM - Glioblastoma multiforme(99;0.0414)		TATTTCGTCCTGAAAAAGCAT	0.348																																					.		Atlas-SNP	.											.	RNF219	94	.	0			c.301-2A>G						.						63.0	63.0	63.0					13																	79213208		2203	4298	6501	SO:0001630	splice_region_variant	79596	exon5			TCGTCCTGAAAAA	BC028586	CCDS31997.1	13q31.1	2011-05-23	2008-03-26	2008-03-26	ENSG00000152193	ENSG00000152193		"""RING-type (C3HC4) zinc fingers"""	20308	protein-coding gene	gene with protein product		615906	"""chromosome 13 open reading frame 7"""	C13orf7			Standard	XM_006719865		Approved	FLJ13449	uc001vkw.1	Q5W0B1	OTTHUMG00000017122	ENST00000282003.6:c.301-2A>G	chr13.hg19:g.79213208T>C		111.0	0.0		89.0	4.0	NM_024546	B2RN99|Q8TBY2|Q9H0T2|Q9H8M0	Splice_Site	SNP	ENST00000282003.6	hg19	CCDS31997.1	.	.	.	.	.	.	.	.	.	.	T	17.71	3.457593	0.63401	.	.	ENSG00000152193	ENST00000282003	.	.	.	4.66	4.66	0.58398	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7069	0.57065	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	RNF219	78111209	1.000000	0.71417	1.000000	0.80357	0.865000	0.49528	1.697000	0.37784	2.036000	0.60181	0.533000	0.62120	.	.	.		0.348	RNF219-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045363.1	NM_024546	Intron
FARP1	10160	hgsc.bcm.edu	37	13	99043122	99043122	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:99043122T>C	ENST00000319562.6	+	11	1341	c.1076T>C	c.(1075-1077)gTg>gCg	p.V359A	FARP1_ENST00000376586.2_Missense_Mutation_p.V359A|FARP1_ENST00000595437.1_Missense_Mutation_p.V359A	NM_005766.2	NP_005757.1	Q9Y4F1	FARP1_HUMAN	FERM, RhoGEF (ARHGEF) and pleckstrin domain protein 1 (chondrocyte-derived)	359					dendrite morphogenesis (GO:0048813)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|synapse assembly (GO:0007416)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|synapse (GO:0045202)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|endometrium(6)|kidney(6)|large_intestine(13)|lung(16)|ovary(1)|skin(3)|urinary_tract(1)	49	all_neural(89;0.0982)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.233)			CATAAGAAGGTGCAGTTTGAA	0.453																																					p.V359A		Atlas-SNP	.											.	FARP1	207	.	0			c.T1076C						.						151.0	138.0	142.0					13																	99043122		2203	4300	6503	SO:0001583	missense	10160	exon11			AGAAGGTGCAGTT	AB008430	CCDS9487.1, CCDS32000.1, CCDS66572.1	13q32.2	2013-01-10			ENSG00000152767	ENSG00000152767		"""Rho guanine nucleotide exchange factors"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Pleckstrin homology (PH) domain containing"""	3591	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 75"""	602654				9425278	Standard	NM_005766		Approved	CDEP, PLEKHC2, MGC87400, PPP1R75	uc001vnj.3	Q9Y4F1	OTTHUMG00000017248	ENST00000319562.6:c.1076T>C	chr13.hg19:g.99043122T>C	ENSP00000322926:p.Val359Ala	99.0	0.0		91.0	4.0	NM_005766	Q5JVI9|Q6IQ29	Missense_Mutation	SNP	ENST00000319562.6	hg19	CCDS9487.1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.115770	0.56505	.	.	ENSG00000152767	ENST00000376586;ENST00000376584;ENST00000319562	D;D	0.85629	-2.01;-2.01	5.66	5.66	0.87406	FERM adjacent (FA) (1);	0.197470	0.46145	D	0.000312	D	0.82843	0.5125	N	0.25890	0.77	0.58432	D	0.999999	P;D	0.54964	0.951;0.969	P;P	0.52343	0.696;0.634	T	0.80336	-0.1425	10	0.19590	T	0.45	.	15.8839	0.79226	0.0:0.0:0.0:1.0	.	359;359	Q9Y4F1;C9JME2	FARP1_HUMAN;.	A	359;64;359	ENSP00000365771:V359A;ENSP00000322926:V359A	ENSP00000322926:V359A	V	+	2	0	FARP1	97841123	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	6.251000	0.72441	2.158000	0.67659	0.533000	0.62120	GTG	.	.		0.453	FARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045541.3	NM_005766	
DOCK9	23348	hgsc.bcm.edu	37	13	99515318	99515318	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:99515318C>T	ENST00000376460.1	-	32	3614	c.3534G>A	c.(3532-3534)cgG>cgA	p.R1178R	DOCK9_ENST00000442173.1_Silent_p.R1178R|DOCK9_ENST00000461998.1_5'UTR|DOCK9_ENST00000339416.2_Silent_p.R1179R|DOCK9_ENST00000448493.2_Silent_p.R1190R	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	1179					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					TCACATTGATCCGCTGGACGT	0.522																																					p.R1179R		Atlas-SNP	.											.	DOCK9	311	.	0			c.G3537A						.						54.0	53.0	54.0					13																	99515318		2016	4180	6196	SO:0001819	synonymous_variant	23348	exon32			ATTGATCCGCTGG	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.3534G>A	chr13.hg19:g.99515318C>T		132.0	0.0		117.0	45.0	NM_001130049	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Silent	SNP	ENST00000376460.1	hg19	CCDS45062.1																																																																																			.	.		0.522	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
PCID2	55795	hgsc.bcm.edu	37	13	113834473	113834473	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:113834473T>C	ENST00000337344.4	-	11	935	c.859A>G	c.(859-861)Agc>Ggc	p.S287G	PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375457.2_Splice_Site_p.S285G|PCID2_ENST00000246505.5_Splice_Site_p.S341G|PCID2_ENST00000375459.1_Splice_Site_p.S285G|PCID2_ENST00000375477.1_Splice_Site_p.S287G|PCID2_ENST00000375479.2_Splice_Site_p.S287G	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	287	PCI.				negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			ATACTCTACCTCACAGCTCTG	0.473																																					p.S341G		Atlas-SNP	.											.	PCID2	30	.	0			c.A1021G						.						131.0	125.0	127.0					13																	113834473		2203	4300	6503	SO:0001630	splice_region_variant	55795	exon11			TCTACCTCACAGC	AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.860+1A>G	chr13.hg19:g.113834473T>C		121.0	0.0		103.0	6.0	NM_001258212	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	ENST00000337344.4	hg19	CCDS9532.2	.	.	.	.	.	.	.	.	.	.	T	15.80	2.940745	0.52972	.	.	ENSG00000126226	ENST00000337344;ENST00000375479;ENST00000375477;ENST00000246505;ENST00000375459;ENST00000375457;ENST00000375462;ENST00000246506;ENST00000351317	T;T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52;1.52	5.76	5.76	0.90799	PCI/PINT associated module (1);Proteasome component (PCI) domain (1);	0.130098	0.64402	D	0.000002	T	0.32823	0.0842	L	0.47716	1.5	0.80722	D	1	P;B	0.35139	0.486;0.16	B;B	0.36922	0.236;0.21	T	0.10245	-1.0638	10	0.59425	D	0.04	-13.4827	16.0776	0.80979	0.0:0.0:0.0:1.0	.	341;287	Q5JVF3-4;Q5JVF3	.;PCID2_HUMAN	G	287;287;287;341;285;285;264;287;264	ENSP00000337405:S287G;ENSP00000364628:S287G;ENSP00000364626:S287G;ENSP00000246505:S341G;ENSP00000364608:S285G;ENSP00000364606:S285G;ENSP00000327335:S264G	ENSP00000246505:S341G	S	-	1	0	PCID2	112882474	1.000000	0.71417	0.970000	0.41538	0.126000	0.20510	7.646000	0.83445	2.200000	0.70718	0.533000	0.62120	AGC	.	.		0.473	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045897.1	NM_018386	Missense_Mutation
OR4K2	390431	hgsc.bcm.edu	37	14	20345276	20345276	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:20345276C>G	ENST00000298642.2	+	1	886	c.850C>G	c.(850-852)Cca>Gca	p.P284A		NM_001005501.1	NP_001005501.1	Q8NGD2	OR4K2_HUMAN	olfactory receptor, family 4, subfamily K, member 2	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(16)|ovary(2)|skin(9)|upper_aerodigestive_tract(2)	43	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		CACTCTGAACCCAATAATCTA	0.368																																					p.P284A		Atlas-SNP	.											.	OR4K2	97	.	0			c.C850G						.						106.0	112.0	110.0					14																	20345276		2203	4300	6503	SO:0001583	missense	390431	exon1			CTGAACCCAATAA		CCDS32023.1	14q11.2	2013-09-23			ENSG00000165762	ENSG00000165762		"""GPCR / Class A : Olfactory receptors"""	14728	protein-coding gene	gene with protein product							Standard	NM_001005501		Approved		uc001vwh.1	Q8NGD2	OTTHUMG00000170624	ENST00000298642.2:c.850C>G	chr14.hg19:g.20345276C>G	ENSP00000298642:p.Pro284Ala	50.0	0.0		27.0	5.0	NM_001005501	B2RNK8|Q6IFA5	Missense_Mutation	SNP	ENST00000298642.2	hg19	CCDS32023.1	.	.	.	.	.	.	.	.	.	.	.	12.05	1.821532	0.32237	.	.	ENSG00000165762	ENST00000298642	T	0.63255	-0.03	5.16	5.16	0.70880	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000153	T	0.72078	0.3416	M	0.86268	2.805	0.51767	D	0.999932	P	0.41524	0.753	P	0.44647	0.456	T	0.77822	-0.2445	10	0.72032	D	0.01	.	16.183	0.81925	0.0:1.0:0.0:0.0	.	284	Q8NGD2	OR4K2_HUMAN	A	284	ENSP00000298642:P284A	ENSP00000298642:P284A	P	+	1	0	OR4K2	19415116	1.000000	0.71417	0.991000	0.47740	0.058000	0.15608	7.249000	0.78278	2.681000	0.91329	0.591000	0.81541	CCA	.	.		0.368	OR4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409864.1		
LRRC16B	90668	hgsc.bcm.edu	37	14	24530141	24530141	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:24530141T>C	ENST00000342740.5	+	26	2350	c.2196T>C	c.(2194-2196)ttT>ttC	p.F732F	LRRC16B_ENST00000334420.7_5'UTR	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	732						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		TCCAGCTGTTTCCCAGCCTCT	0.587																																					p.F732F		Atlas-SNP	.											LRRC16B,colon,carcinoma,0,1	LRRC16B	120	.	0			c.T2196C						.						50.0	38.0	42.0					14																	24530141		2007	3863	5870	SO:0001819	synonymous_variant	90668	exon26			GCTGTTTCCCAGC	AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2196T>C	chr14.hg19:g.24530141T>C		124.0	1.0		112.0	5.0	NM_138360	Q8TEF7|Q96HS9	Silent	SNP	ENST00000342740.5	hg19	CCDS32054.1																																																																																			.	.		0.587	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416527.1	NM_138360	
SCFD1	23256	hgsc.bcm.edu	37	14	31139491	31139491	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:31139491A>G	ENST00000458591.2	+	11	1112	c.885A>G	c.(883-885)gaA>gaG	p.E295E	SCFD1_ENST00000541123.1_Silent_p.E110E|SCFD1_ENST00000544052.2_Silent_p.E228E|SCFD1_ENST00000421551.3_Silent_p.E236E|SCFD1_ENST00000396629.2_Silent_p.E203E	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	295					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		TTAATTTGGAAGAATCTTCAG	0.333																																					p.E295E		Atlas-SNP	.											.	SCFD1	43	.	0			c.A885G						.						90.0	110.0	103.0					14																	31139491		2203	4295	6498	SO:0001819	synonymous_variant	23256	exon11			TTTGGAAGAATCT	AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.885A>G	chr14.hg19:g.31139491A>G		174.0	0.0		93.0	4.0	NM_016106	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Silent	SNP	ENST00000458591.2	hg19	CCDS9639.1																																																																																			.	.		0.333	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276612.3	NM_182835	
FKBP3	2287	hgsc.bcm.edu	37	14	45590787	45590787	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:45590787C>T	ENST00000216330.3	-	5	765	c.355G>A	c.(355-357)Gga>Aga	p.G119R	FKBP3_ENST00000396062.3_Missense_Mutation_p.G119R			Q00688	FKBP3_HUMAN	FK506 binding protein 3, 25kDa	119					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)	p.G119*(1)		NS(1)|biliary_tract(1)|endometrium(1)|large_intestine(2)|lung(6)|skin(1)	12						GTTTTATCTCCCTTTTTCAGA	0.338																																					p.G119R		Atlas-SNP	.											FKBP3,colon,carcinoma,0,1	FKBP3	21	.	1	Substitution - Nonsense(1)	large_intestine(1)	c.G355A						.						122.0	113.0	116.0					14																	45590787		2203	4300	6503	SO:0001583	missense	2287	exon4			TATCTCCCTTTTT	M96256	CCDS9683.1	14q21.2	2008-08-11	2002-08-29		ENSG00000100442	ENSG00000100442			3719	protein-coding gene	gene with protein product		186947	"""FK506-binding protein 3 (25kD)"""			1374240, 1532945	Standard	NM_002013		Approved	FKBP-25, PPIase	uc010tqf.2	Q00688	OTTHUMG00000140267	ENST00000216330.3:c.355G>A	chr14.hg19:g.45590787C>T	ENSP00000216330:p.Gly119Arg	95.0	0.0		48.0	2.0	NM_002013	B2R4Q9|Q14317	Missense_Mutation	SNP	ENST00000216330.3	hg19	CCDS9683.1	.	.	.	.	.	.	.	.	.	.	C	33	5.231659	0.95207	.	.	ENSG00000100442	ENST00000216330;ENST00000396062	T;T	0.63096	-0.02;-0.02	6.17	6.17	0.99709	Peptidyl-prolyl cis-trans isomerase, FKBP-type, domain (1);	0.000000	0.85682	D	0.000000	T	0.66366	0.2782	M	0.65975	2.015	0.80722	D	1	D	0.59357	0.985	B	0.42851	0.4	T	0.71293	-0.4636	10	0.87932	D	0	-9.0144	20.4745	0.99168	0.0:1.0:0.0:0.0	.	119	Q00688	FKBP3_HUMAN	R	119	ENSP00000216330:G119R;ENSP00000379374:G119R	ENSP00000216330:G119R	G	-	1	0	FKBP3	44660537	1.000000	0.71417	0.996000	0.52242	0.929000	0.56500	7.508000	0.81686	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.338	FKBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276796.1	NM_002013	
FANCM	57697	hgsc.bcm.edu	37	14	45653040	45653040	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:45653040T>C	ENST00000267430.5	+	17	4535	c.4450T>C	c.(4450-4452)Ttc>Ctc	p.F1484L	FANCM_ENST00000555013.1_3'UTR|FANCM_ENST00000542564.2_Missense_Mutation_p.F1458L	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1484					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						ATTAGAAGACTTCAAGGTTTG	0.328								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.F1484L		Atlas-SNP	.											.	FANCM	225	.	0			c.T4450C						.						68.0	66.0	67.0					14																	45653040		2203	4299	6502	SO:0001583	missense	57697	exon17	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GAAGACTTCAAGG	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.4450T>C	chr14.hg19:g.45653040T>C	ENSP00000267430:p.Phe1484Leu	149.0	0.0		78.0	4.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Missense_Mutation	SNP	ENST00000267430.5	hg19	CCDS32070.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.65|12.65	2.000561|2.000561	0.35320|0.35320	.|.	.|.	ENSG00000187790|ENSG00000187790	ENST00000267430;ENST00000542564;ENST00000556250|ENST00000554809	T;T;T|.	0.18338|.	2.82;2.82;2.22|.	5.2|5.2	-0.582|-0.582	0.11709|0.11709	.|.	1.380460|.	0.04154|.	N|.	0.321751|.	T|T	0.39462|0.39462	0.1079|0.1079	L|L	0.57536|0.57536	1.79|1.79	0.09310|0.09310	N|N	1|1	P;P|.	0.35745|.	0.518;0.518|.	B;B|.	0.30401|.	0.115;0.115|.	T|T	0.35076|0.35076	-0.9803|-0.9803	10|5	0.10111|.	T|.	0.7|.	.|.	5.3297|5.3297	0.15926|0.15926	0.2918:0.0:0.3021:0.4061|0.2918:0.0:0.3021:0.4061	.|.	1458;1484|.	B2RTQ9;Q8IYD8|.	.;FANCM_HUMAN|.	L|P	1484;1458;1000|416	ENSP00000267430:F1484L;ENSP00000442493:F1458L;ENSP00000452033:F1000L|.	ENSP00000267430:F1484L|.	F|L	+|+	1|2	0|0	FANCM|FANCM	44722790|44722790	0.009000|0.009000	0.17119|0.17119	0.005000|0.005000	0.12908|0.12908	0.005000|0.005000	0.04900|0.04900	0.445000|0.445000	0.21677|0.21677	-0.257000|-0.257000	0.09459|0.09459	-1.286000|-1.286000	0.01371|0.01371	TTC|CTT	.	.		0.328	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
POLE2	5427	hgsc.bcm.edu	37	14	50120709	50120709	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:50120709T>C	ENST00000216367.5	-	15	1309	c.1210A>G	c.(1210-1212)Aga>Gga	p.R404G	POLE2_ENST00000556584.1_5'UTR|POLE2_ENST00000554396.1_Splice_Site_p.R404G|POLE2_ENST00000539565.2_Splice_Site_p.R378G	NM_002692.3	NP_002683.2	P56282	DPOE2_HUMAN	polymerase (DNA directed), epsilon 2, accessory subunit	404					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	epsilon DNA polymerase complex (GO:0008622)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	10	all_epithelial(31;0.0021)|Breast(41;0.0124)				Cladribine(DB00242)	AATTCTTACCTGCAAGGATTA	0.358																																					p.R404G		Atlas-SNP	.											.	POLE2	36	.	0			c.A1210G						.						52.0	51.0	51.0					14																	50120709		2203	4300	6503	SO:0001630	splice_region_variant	5427	exon15			CTTACCTGCAAGG	AF025840	CCDS32073.1, CCDS55914.1, CCDS55915.1	14q21-q22	2012-05-18	2012-05-18		ENSG00000100479	ENSG00000100479		"""DNA polymerases"""	9178	protein-coding gene	gene with protein product	"""DNA polymerase epsilon subunit B"""	602670	"""polymerase (DNA directed), epsilon 2 (p59 subunit)"""			9405441, 9443964	Standard	NM_002692		Approved	DPE2	uc001wwu.3	P56282	OTTHUMG00000170813	ENST00000216367.5:c.1211+1A>G	chr14.hg19:g.50120709T>C		119.0	0.0		88.0	4.0	NM_001197331	A0AV55|A4FU92|A4LBB7|A6NH58|B4DDE6|O43560	Missense_Mutation	SNP	ENST00000216367.5	hg19	CCDS32073.1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.923866	0.92319	.	.	ENSG00000100479	ENST00000216367;ENST00000539565;ENST00000554396	T;T;T	0.34667	1.35;1.35;1.35	6.16	6.16	0.99307	DNA polymerase alpha/epsilon, subunit B (1);	0.000000	0.85682	D	0.000000	T	0.71702	0.3371	H	0.94734	3.575	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.80289	-0.1445	10	0.87932	D	0	-25.1949	16.8061	0.85666	0.0:0.0:0.0:1.0	.	404;378;404	A4FU92;B4DDE6;P56282	.;.;DPOE2_HUMAN	G	404;378;404	ENSP00000216367:R404G;ENSP00000446313:R378G;ENSP00000451621:R404G	ENSP00000216367:R404G	R	-	1	2	POLE2	49190459	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.250000	0.72435	2.367000	0.80283	0.528000	0.53228	AGA	.	.		0.358	POLE2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410512.1	NM_002692	Missense_Mutation
ARID4A	5926	hgsc.bcm.edu	37	14	58831470	58831470	+	Missense_Mutation	SNP	A	A	G	rs78751371		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:58831470A>G	ENST00000355431.3	+	20	3036	c.2663A>G	c.(2662-2664)gAt>gGt	p.D888G	ARID4A_ENST00000395168.3_Missense_Mutation_p.D888G|ARID4A_ENST00000348476.3_Missense_Mutation_p.D888G|ARID4A_ENST00000431317.2_Missense_Mutation_p.D888G	NM_002892.3	NP_002883.3	P29374	ARI4A_HUMAN	AT rich interactive domain 4A (RBP1-like)	888					erythrocyte development (GO:0048821)|histone H3-K4 trimethylation (GO:0080182)|histone H3-K9 trimethylation (GO:0036124)|histone H4-K20 trimethylation (GO:0034773)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|central_nervous_system(1)|cervix(4)|endometrium(8)|kidney(2)|large_intestine(14)|lung(19)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						AGGACCAGTGATTGTATTGGA	0.348																																					p.D888G		Atlas-SNP	.											.	ARID4A	222	.	0			c.A2663G						.						85.0	78.0	80.0					14																	58831470		2202	4300	6502	SO:0001583	missense	5926	exon20			CCAGTGATTGTAT	S57153	CCDS9732.1, CCDS9733.1, CCDS45114.1	14q22.3	2013-02-07	2004-01-28	2004-01-28	ENSG00000032219	ENSG00000032219		"""-"""	9885	protein-coding gene	gene with protein product		180201	"""retinoblastoma-binding protein 1"""	RBBP1		1857421, 8455946	Standard	NM_023000		Approved	RBP1, RBP-1	uc001xdp.3	P29374	OTTHUMG00000140320	ENST00000355431.3:c.2663A>G	chr14.hg19:g.58831470A>G	ENSP00000347602:p.Asp888Gly	84.0	0.0		53.0	4.0	NM_002892	Q15991|Q15992|Q15993	Missense_Mutation	SNP	ENST00000355431.3	hg19	CCDS9732.1	.	.	.	.	.	.	.	.	.	.	A	12.73	2.024084	0.35701	.	.	ENSG00000032219	ENST00000355431;ENST00000348476;ENST00000395168;ENST00000431317;ENST00000417477	T;T;T;T;T	0.14893	2.48;2.49;2.48;2.49;2.47	5.59	5.59	0.84812	.	0.562418	0.20407	N	0.092934	T	0.19685	0.0473	L	0.44542	1.39	0.30386	N	0.781438	P;P;P	0.45827	0.867;0.501;0.571	B;B;B	0.42282	0.382;0.154;0.153	T	0.05007	-1.0912	10	0.54805	T	0.06	-23.0368	15.7863	0.78306	1.0:0.0:0.0:0.0	.	888;888;888	P29374-3;P29374;P29374-2	.;ARI4A_HUMAN;.	G	888;888;888;888;566	ENSP00000347602:D888G;ENSP00000344556:D888G;ENSP00000378597:D888G;ENSP00000397368:D888G;ENSP00000416053:D566G	ENSP00000344556:D888G	D	+	2	0	ARID4A	57901223	1.000000	0.71417	0.984000	0.44739	0.993000	0.82548	5.116000	0.64661	2.132000	0.65825	0.528000	0.53228	GAT	.	A|0.999;T|0.001		0.348	ARID4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276927.2	NM_023001	
ATP6V1D	51382	hgsc.bcm.edu	37	14	67807190	67807190	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:67807190T>C	ENST00000216442.7	-	8	1119	c.569A>G	c.(568-570)gAg>gGg	p.E190G	ATP6V1D_ENST00000555431.1_Missense_Mutation_p.E135G|ATP6V1D_ENST00000555474.1_Missense_Mutation_p.E91G|ATP6V1D_ENST00000554236.1_Missense_Mutation_p.S168G|ATP6V1D_ENST00000553974.1_5'Flank|Y_RNA_ENST00000362885.1_RNA	NM_015994.3	NP_057078.1	Q9Y5K8	VATD_HUMAN	ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D	190					cellular iron ion homeostasis (GO:0006879)|cilium assembly (GO:0042384)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|protein localization to cilium (GO:0061512)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	7				all cancers(60;0.000739)|OV - Ovarian serous cystadenocarcinoma(108;0.00597)|BRCA - Breast invasive adenocarcinoma(234;0.00957)		CTCATCCAGCTCTGTGATGAT	0.348																																					p.E190G		Atlas-SNP	.											.	ATP6V1D	21	.	0			c.A569G						.						123.0	118.0	120.0					14																	67807190		2203	4300	6503	SO:0001583	missense	51382	exon8			TCCAGCTCTGTGA	AF145316	CCDS9780.1	14q23-q24.2	2010-04-21	2002-08-29	2002-05-10	ENSG00000100554	ENSG00000100554		"""ATPases / V-type"""	13527	protein-coding gene	gene with protein product		609398	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump)"""	ATP6M		9442887	Standard	NM_015994		Approved	VATD, VMA8	uc001xjf.3	Q9Y5K8		ENST00000216442.7:c.569A>G	chr14.hg19:g.67807190T>C	ENSP00000216442:p.Glu190Gly	78.0	0.0		58.0	4.0	NM_015994	B2RE33|Q9Y688	Missense_Mutation	SNP	ENST00000216442.7	hg19	CCDS9780.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	33|33	5.261693|5.261693	0.95368|0.95368	.|.	.|.	ENSG00000100554|ENSG00000100554	ENST00000555474;ENST00000216442;ENST00000555431|ENST00000554236	.|.	.|.	.|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.88340|0.88340	0.6410|0.6410	H|H	0.97077|0.97077	3.935|3.935	0.36499|0.36499	D|D	0.868894|0.868894	D|.	0.89917|.	1.0|.	D|.	0.79108|.	0.992|.	D|D	0.93908|0.93908	0.7194|0.7194	9|5	0.87932|.	D|.	0|.	-27.3306|-27.3306	16.8222|16.8222	0.85835|0.85835	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	190|.	Q9Y5K8|.	VATD_HUMAN|.	G|G	91;190;135|168	.|.	ENSP00000216442:E190G|.	E|S	-|-	2|1	0|0	ATP6V1D|ATP6V1D	66876943|66876943	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.953000|7.953000	0.87836|0.87836	2.371000|2.371000	0.80710|0.80710	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.	.		0.348	ATP6V1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412511.1	NM_015994	
TMEM229B	161145	hgsc.bcm.edu	37	14	67940454	67940454	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:67940454T>C	ENST00000557006.1	-	4	469	c.187A>G	c.(187-189)Atg>Gtg	p.M63V	TMEM229B_ENST00000357461.2_Missense_Mutation_p.M63V			Q8NBD8	T229B_HUMAN	transmembrane protein 229B	63						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGCAGGTACATGCGCTCCACG	0.637																																					p.M63V		Atlas-SNP	.											.	TMEM229B	20	.	0			c.A187G						.						53.0	43.0	47.0					14																	67940454		2203	4299	6502	SO:0001583	missense	161145	exon3			GGTACATGCGCTC	AK090706	CCDS9783.1	14q23.3-q24.1	2009-09-22	2009-09-22	2009-09-22	ENSG00000198133	ENSG00000198133			20130	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 83"""	C14orf83			Standard	NM_182526		Approved	FLJ33387	uc001xjk.3	Q8NBD8		ENST00000557006.1:c.187A>G	chr14.hg19:g.67940454T>C	ENSP00000451774:p.Met63Val	123.0	0.0		78.0	4.0	NM_182526		Missense_Mutation	SNP	ENST00000557006.1	hg19	CCDS9783.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.337029	0.60963	.	.	ENSG00000198133	ENST00000557006;ENST00000357461;ENST00000554278;ENST00000554480	.	.	.	4.69	4.69	0.59074	.	0.261255	0.51477	D	0.000096	T	0.48132	0.1483	L	0.29908	0.895	0.80722	D	1	B	0.34349	0.45	B	0.37198	0.243	T	0.48948	-0.8989	9	0.39692	T	0.17	-32.5338	14.177	0.65549	0.0:0.0:0.0:1.0	.	63	Q8NBD8	T229B_HUMAN	V	63	.	ENSP00000350050:M63V	M	-	1	0	TMEM229B	67010207	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.186000	0.72026	1.758000	0.51981	0.454000	0.30748	ATG	.	.		0.637	TMEM229B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412718.2	NM_182526	
SLC8A3	6547	hgsc.bcm.edu	37	14	70512763	70512763	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:70512763A>G	ENST00000381269.2	-	8	3438	c.2685T>C	c.(2683-2685)cgT>cgC	p.R895R	SLC8A3_ENST00000356921.2_Silent_p.R889R|SLC8A3_ENST00000357887.3_Silent_p.R893R|SLC8A3_ENST00000216568.7_Silent_p.R266R|SLC8A3_ENST00000534137.1_Silent_p.R892R|SLC8A3_ENST00000394330.2_Silent_p.R252R|SLC8A3_ENST00000528359.1_Silent_p.R893R	NM_058240.2|NM_183002.1	NP_489479.1|NP_892114.1	P57103	NAC3_HUMAN	solute carrier family 8 (sodium/calcium exchanger), member 3	895					blood coagulation (GO:0007596)|calcium ion export from cell (GO:1990034)|calcium ion import into cell (GO:1990035)|calcium ion transport into cytosol (GO:0060402)|cell communication (GO:0007154)|cellular response to cAMP (GO:0071320)|hematopoietic progenitor cell differentiation (GO:0002244)|ion transport (GO:0006811)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	calcium:sodium antiporter activity (GO:0005432)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(18)|ovary(2)|pancreas(2)|prostate(3)|skin(6)	54				BRCA - Breast invasive adenocarcinoma(234;0.0079)|all cancers(60;0.0102)|OV - Ovarian serous cystadenocarcinoma(108;0.0555)		GCTTGCAGCCACGGGGGCCAC	0.567											OREG0022773	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R895R		Atlas-SNP	.											.	SLC8A3	234	.	0			c.T2685C						.						25.0	27.0	26.0					14																	70512763		2203	4299	6502	SO:0001819	synonymous_variant	6547	exon8			GCAGCCACGGGGG	AJ304852	CCDS9799.1, CCDS9800.1, CCDS35498.1, CCDS41967.1, CCDS45131.1, CCDS53904.1	14q24.1	2013-05-22	2008-09-02		ENSG00000100678	ENSG00000100678		"""Solute carriers"""	11070	protein-coding gene	gene with protein product		607991				8798769	Standard	XM_005268017		Approved	NCX3	uc001xly.3	P57103	OTTHUMG00000152342	ENST00000381269.2:c.2685T>C	chr14.hg19:g.70512763A>G		124.0	0.0	1122	85.0	4.0	NM_183002	Q5K3P6|Q5K3P7|Q8IUE9|Q8IUF0|Q8NFI7|Q96QG1|Q96QG2	Silent	SNP	ENST00000381269.2	hg19	CCDS35498.1																																																																																			.	.		0.567	SLC8A3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390736.1		
MAP3K9	4293	hgsc.bcm.edu	37	14	71201208	71201208	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:71201208A>G	ENST00000554752.2	-	10	1920	c.1921T>C	c.(1921-1923)Tcc>Ccc	p.S641P	MAP3K9_ENST00000554146.1_Missense_Mutation_p.S355P|MAP3K9_ENST00000553414.1_Missense_Mutation_p.S360P|MAP3K9_ENST00000381250.4_Missense_Mutation_p.S618P|MAP3K9_ENST00000555993.2_Missense_Mutation_p.S641P	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	641					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		TCTACCAGGGACTTGAGGCTG	0.547																																					p.S641P	GBM(114;411 1587 13539 28235 50070)	Atlas-SNP	.											.	MAP3K9	109	.	0			c.T1921C						.						101.0	93.0	95.0					14																	71201208		2203	4300	6503	SO:0001583	missense	4293	exon10			CCAGGGACTTGAG	AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.1921T>C	chr14.hg19:g.71201208A>G	ENSP00000451612:p.Ser641Pro	84.0	0.0		78.0	4.0	NM_033141	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	ENST00000554752.2	hg19		.	.	.	.	.	.	.	.	.	.	A	9.676	1.147960	0.21288	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	5.81	3.45	0.39498	.	0.224635	0.48767	D	0.000179	T	0.04003	0.0112	N	0.01874	-0.695	0.42936	D	0.994332	B;B;B;B	0.06786	0.0;0.001;0.001;0.001	B;B;B;B	0.10450	0.002;0.002;0.005;0.005	T	0.35895	-0.9770	10	0.02654	T	1	.	8.7954	0.34876	0.5097:0.3769:0.0:0.1134	.	355;641;641;360	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	P	641;641;360;618;355;346	ENSP00000451612:S641P;ENSP00000451038:S360P;ENSP00000370649:S618P;ENSP00000451921:S355P	ENSP00000005198:S641P	S	-	1	0	MAP3K9	70270961	1.000000	0.71417	0.997000	0.53966	0.969000	0.65631	1.181000	0.32017	0.461000	0.27071	0.379000	0.24179	TCC	.	.		0.547	MAP3K9-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412550.2		
SIPA1L1	26037	hgsc.bcm.edu	37	14	72176082	72176082	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:72176082T>C	ENST00000555818.1	+	15	4320	c.3972T>C	c.(3970-3972)gcT>gcC	p.A1324A	SIPA1L1_ENST00000381232.3_Silent_p.A1303A|SIPA1L1_ENST00000554874.1_3'UTR|SIPA1L1_ENST00000358550.2_Silent_p.A1303A|SIPA1L1_ENST00000537413.1_Silent_p.A778A	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1324	Ser-rich.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCACCTCTGCTGACAGTGGCA	0.582																																					p.A1324A		Atlas-SNP	.											.	SIPA1L1	219	.	0			c.T3972C						.						96.0	78.0	85.0					14																	72176082		2203	4300	6503	SO:0001819	synonymous_variant	26037	exon15			CTCTGCTGACAGT	AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3972T>C	chr14.hg19:g.72176082T>C		135.0	0.0		98.0	4.0	NM_015556	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	ENST00000555818.1	hg19	CCDS9807.1																																																																																			.	.		0.582	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000412806.1	NM_015556	
RBM25	58517	hgsc.bcm.edu	37	14	73566448	73566448	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:73566448A>G	ENST00000261973.7	+	9	1142	c.857A>G	c.(856-858)gAc>gGc	p.D286G	RBM25_ENST00000525321.1_Missense_Mutation_p.D286G|RBM25_ENST00000540173.1_Missense_Mutation_p.D286G|RBM25_ENST00000526754.1_Missense_Mutation_p.D286G|RBM25_ENST00000527432.1_Missense_Mutation_p.D286G	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	286	Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		AAATTCAGAGACACACATAAG	0.348																																					p.D286G		Atlas-SNP	.											.	RBM25	81	.	0			c.A857G						.						135.0	140.0	138.0					14																	73566448		2203	4299	6502	SO:0001583	missense	58517	exon9			TCAGAGACACACA	BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.857A>G	chr14.hg19:g.73566448A>G	ENSP00000261973:p.Asp286Gly	103.0	0.0		76.0	4.0	NM_021239	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	ENST00000261973.7	hg19	CCDS32113.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.05|15.05	2.719102|2.719102	0.48622|0.48622	.|.	.|.	ENSG00000119707|ENSG00000119707	ENST00000261973;ENST00000540173;ENST00000527432;ENST00000525321;ENST00000526754|ENST00000532192	T;T;T;T;T|.	0.50001|.	0.76;1.35;0.76;1.29;1.35|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.68384|0.68384	0.2995|0.2995	L|L	0.55481|0.55481	1.735|1.735	0.80722|0.80722	D|D	1|1	B;D|.	0.60575|.	0.059;0.988|.	B;P|.	0.61940|.	0.059;0.896|.	T|T	0.67126|0.67126	-0.5749|-0.5749	10|5	0.66056|.	D|.	0.02|.	.|.	14.7853|14.7853	0.69800|0.69800	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	286;286|.	P49756;P49756-2|.	RBM25_HUMAN;.|.	G|A	286|65	ENSP00000261973:D286G;ENSP00000437934:D286G;ENSP00000431150:D286G;ENSP00000436868:D286G;ENSP00000436225:D286G|.	ENSP00000261973:D286G|.	D|T	+|+	2|1	0|0	RBM25|RBM25	72636201|72636201	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.297000|9.297000	0.96120|0.96120	1.900000|1.900000	0.55004|0.55004	0.397000|0.397000	0.26171|0.26171	GAC|ACA	.	.		0.348	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394966.1	XM_027330	
NUMB	8650	hgsc.bcm.edu	37	14	73743385	73743385	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:73743385C>T	ENST00000355058.3	-	13	2135	c.1857G>A	c.(1855-1857)caG>caA	p.Q619Q	NUMB_ENST00000555238.1_Silent_p.Q619Q|NUMB_ENST00000555394.1_Silent_p.Q571Q|NUMB_ENST00000359560.3_Silent_p.Q608Q|NUMB_ENST00000559312.1_Silent_p.Q424Q|NUMB_ENST00000535282.1_Silent_p.Q608Q|NUMB_ENST00000556772.1_Silent_p.Q475Q|NUMB_ENST00000555738.2_Silent_p.Q462Q|NUMB_ENST00000544991.3_Silent_p.Q424Q|NUMB_ENST00000560335.1_Silent_p.Q473Q|NUMB_ENST00000356296.4_Silent_p.Q571Q|NUMB_ENST00000454166.4_Silent_p.Q473Q|RP4-647C14.3_ENST00000556578.1_RNA|NUMB_ENST00000554546.1_Silent_p.Q560Q|NUMB_ENST00000557597.1_Silent_p.Q608Q|NUMB_ENST00000554521.2_Silent_p.Q413Q			P49757	NUMB_HUMAN	numb homolog (Drosophila)	619					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		ATGCAGCCCACTGGGCTTCAA	0.488																																					p.Q619Q		Atlas-SNP	.											.	NUMB	56	.	0			c.G1857A						.						73.0	69.0	70.0					14																	73743385		2203	4300	6503	SO:0001819	synonymous_variant	8650	exon13			AGCCCACTGGGCT	L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1857G>A	chr14.hg19:g.73743385C>T		143.0	0.0		90.0	4.0	NM_001005743	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Silent	SNP	ENST00000355058.3	hg19	CCDS32116.1																																																																																			.	.		0.488	NUMB-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000414416.1		
GTF2A1	2957	hgsc.bcm.edu	37	14	81662585	81662585	+	Splice_Site	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:81662585C>T	ENST00000553612.1	-	6	882	c.479G>A	c.(478-480)gGc>gAc	p.G160D	GTF2A1_ENST00000434192.2_Splice_Site_p.G121D	NM_001278940.1|NM_015859.3	NP_001265869.1|NP_056943.1	P52655	TF2AA_HUMAN	general transcription factor IIA, 1, 19/37kDa	160					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIA complex (GO:0005672)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	12				BRCA - Breast invasive adenocarcinoma(234;0.0287)		AAGAAGCTGGCCTAAAGCAAA	0.408																																					p.G160D		Atlas-SNP	.											.	GTF2A1	34	.	0			c.G479A						.						120.0	110.0	113.0					14																	81662585		2203	4300	6503	SO:0001630	splice_region_variant	2957	exon6			AGCTGGCCTAAAG	X75383	CCDS9873.1, CCDS9874.1	14q31	2010-03-23	2002-08-29					"""General transcription factors"""	4646	protein-coding gene	gene with protein product		600520	"""glucose regulated protein, 58kD pseudogene"""			8224848	Standard	NM_015859		Approved	TFIIA	uc001xvf.2	P52655		ENST00000553612.1:c.479-1G>A	chr14.hg19:g.81662585C>T		94.0	0.0		68.0	4.0	NM_015859	Q3KNQ9	Missense_Mutation	SNP	ENST00000553612.1	hg19	CCDS9873.1	.	.	.	.	.	.	.	.	.	.	C	29.8	5.040802	0.93685	.	.	ENSG00000165417	ENST00000553612;ENST00000344860;ENST00000434192	T;T	0.61627	0.09;0.09	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	T	0.74275	0.3695	M	0.67953	2.075	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.69457	-0.5140	10	0.23302	T	0.38	.	19.1268	0.93388	0.0:1.0:0.0:0.0	.	160	P52655	TF2AA_HUMAN	D	160;121;121	ENSP00000452454:G160D;ENSP00000409492:G121D	ENSP00000298173:G160D	G	-	2	0	GTF2A1	80732338	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.270000	0.78493	2.503000	0.84419	0.561000	0.74099	GGC	.	.		0.408	GTF2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413309.1	NM_015859	Missense_Mutation
RPS6KA5	9252	hgsc.bcm.edu	37	14	91386646	91386646	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:91386646T>C	ENST00000261991.3	-	7	883	c.710A>G	c.(709-711)gAc>gGc	p.D237G	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.D158G|RPS6KA5_ENST00000418736.2_Missense_Mutation_p.D237G	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	237	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		ACTCCACCAGTCAACTGCCTA	0.289																																					p.D237G		Atlas-SNP	.											.	RPS6KA5	135	.	0			c.A710G						.						87.0	93.0	91.0					14																	91386646		2203	4299	6502	SO:0001583	missense	9252	exon7			CACCAGTCAACTG	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.710A>G	chr14.hg19:g.91386646T>C	ENSP00000261991:p.Asp237Gly	189.0	0.0		103.0	5.0	NM_182398	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	hg19	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.393621	0.83011	.	.	ENSG00000100784	ENST00000261991;ENST00000536315;ENST00000418736	T;T;T	0.75589	-0.95;-0.95;-0.95	5.31	5.31	0.75309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.099481	0.64402	D	0.000002	D	0.92648	0.7664	H	0.99609	4.655	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.95857	0.8880	10	0.87932	D	0	.	15.2506	0.73542	0.0:0.0:0.0:1.0	.	237;237	O75582-2;O75582	.;KS6A5_HUMAN	G	237;158;237	ENSP00000261991:D237G;ENSP00000442803:D158G;ENSP00000402787:D237G	ENSP00000261991:D237G	D	-	2	0	RPS6KA5	90456399	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	7.298000	0.78815	1.998000	0.58463	0.528000	0.53228	GAC	.	.		0.289	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755	
CCDC88C	440193	hgsc.bcm.edu	37	14	91792363	91792363	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:91792363T>C	ENST00000389857.6	-	11	1174	c.1088A>G	c.(1087-1089)aAg>aGg	p.K363R		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	363					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				CAGCATGGCCTTGGTTTCAAT	0.473																																					p.K363R		Atlas-SNP	.											.	CCDC88C	192	.	0			c.A1088G						.						47.0	46.0	46.0					14																	91792363		1961	4156	6117	SO:0001583	missense	440193	exon11			ATGGCCTTGGTTT		CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.1088A>G	chr14.hg19:g.91792363T>C	ENSP00000374507:p.Lys363Arg	81.0	0.0		75.0	4.0	NM_001080414	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	ENST00000389857.6	hg19	CCDS45151.1	.	.	.	.	.	.	.	.	.	.	T	29.5	5.010011	0.93346	.	.	ENSG00000015133	ENST00000389857	T	0.52983	0.64	5.22	5.22	0.72569	.	0.000000	0.49916	U	0.000138	T	0.66538	0.2799	M	0.65498	2.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67688	-0.5606	10	0.46703	T	0.11	-52.4231	15.1049	0.72312	0.0:0.0:0.0:1.0	.	363	Q9P219	DAPLE_HUMAN	R	363	ENSP00000374507:K363R	ENSP00000374507:K363R	K	-	2	0	CCDC88C	90862116	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.542000	0.82095	1.977000	0.57605	0.454000	0.30748	AAG	.	.		0.473	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411650.1	XM_029353	
TRIP11	9321	hgsc.bcm.edu	37	14	92466343	92466343	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:92466343T>C	ENST00000267622.4	-	12	5040	c.4667A>G	c.(4666-4668)aAa>aGa	p.K1556R		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	1556					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		TTCCATTTGTTTTTGTTTCAG	0.338			T	PDGFRB	AML																																p.K1556R	Ovarian(84;609 1888 9852 42686)	Atlas-SNP	.		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	.	TRIP11	184	.	0			c.A4667G						.						117.0	104.0	108.0					14																	92466343		2201	4300	6501	SO:0001583	missense	9321	exon12			ATTTGTTTTTGTT	L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.4667A>G	chr14.hg19:g.92466343T>C	ENSP00000267622:p.Lys1556Arg	172.0	0.0		92.0	4.0	NM_004239	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	ENST00000267622.4	hg19	CCDS9899.1	.	.	.	.	.	.	.	.	.	.	T	28.0	4.884533	0.91814	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.04862	3.54	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.24160	0.0585	M	0.70275	2.135	0.54753	D	0.999982	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.987	T	0.00790	-1.1565	10	0.30854	T	0.27	.	16.2421	0.82418	0.0:0.0:0.0:1.0	.	1292;1556	F5H1Z0;Q15643	.;TRIPB_HUMAN	R	1556;1292	ENSP00000267622:K1556R	ENSP00000267622:K1556R	K	-	2	0	TRIP11	91536096	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.873000	0.87193	2.234000	0.73211	0.533000	0.62120	AAA	.	.		0.338	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411823.1		
CPSF2	53981	hgsc.bcm.edu	37	14	92609578	92609578	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:92609578T>C	ENST00000298875.4	+	9	1365	c.1080T>C	c.(1078-1080)acT>acC	p.T360T		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	360					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		ACAGAACTACTCCTGGGACTT	0.388																																					p.T360T	Ovarian(78;28 1788 18702 44111)	Atlas-SNP	.											.	CPSF2	63	.	0			c.T1080C						.						80.0	75.0	77.0					14																	92609578		2203	4300	6503	SO:0001819	synonymous_variant	53981	exon9			AACTACTCCTGGG	AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.1080T>C	chr14.hg19:g.92609578T>C		131.0	0.0		62.0	4.0	NM_017437	B3KME1|Q6NSJ1|Q9H3W7	Silent	SNP	ENST00000298875.4	hg19	CCDS9902.1																																																																																			.	.		0.388	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412123.1		
UNC79	57578	hgsc.bcm.edu	37	14	94120353	94120353	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:94120353T>C	ENST00000393151.2	+	38	6381	c.6381T>C	c.(6379-6381)gcT>gcC	p.A2127A	UNC79_ENST00000256339.4_Silent_p.A1950A|UNC79_ENST00000553484.1_Silent_p.A2149A|UNC79_ENST00000555664.1_Silent_p.A2088A			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2127					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						CCATCGCAGCTCTCAGTCAGC	0.502																																					p.A1950A		Atlas-SNP	.											.	UNC79	366	.	0			c.T5850C						.						110.0	105.0	107.0					14																	94120353		2203	4300	6503	SO:0001819	synonymous_variant	57578	exon38			CGCAGCTCTCAGT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.6381T>C	chr14.hg19:g.94120353T>C		127.0	0.0		81.0	6.0	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	hg19																																																																																				.	.		0.502	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
ASB2	51676	hgsc.bcm.edu	37	14	94404109	94404109	+	Missense_Mutation	SNP	A	A	G	rs533852407		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:94404109A>G	ENST00000315988.4	-	7	2050	c.1562T>C	c.(1561-1563)cTc>cCc	p.L521P	ASB2_ENST00000555019.1_Missense_Mutation_p.L569P|RP11-131H24.4_ENST00000557646.1_5'Flank|ASB2_ENST00000556337.1_5'Flank	NM_016150.4	NP_057234.2	Q96Q27	ASB2_HUMAN	ankyrin repeat and SOCS box containing 2	521					intracellular signal transduction (GO:0035556)|myoblast differentiation (GO:0045445)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|skeletal muscle cell differentiation (GO:0035914)	Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|soft_tissue(1)|urinary_tract(1)	27		all_cancers(154;0.13)		COAD - Colon adenocarcinoma(157;0.217)|Epithelial(152;0.232)		CCGCGAGCAGAGCTGCACGTT	0.592																																					p.L569P		Atlas-SNP	.											.	ASB2	71	.	0			c.T1706C						.						110.0	91.0	97.0					14																	94404109		2203	4300	6503	SO:0001583	missense	51676	exon9			GAGCAGAGCTGCA	AF159164	CCDS9915.1, CCDS55940.1	14q31-q32	2013-01-10	2011-01-25					"""Ankyrin repeat domain containing"""	16012	protein-coding gene	gene with protein product		605759	"""ankyrin repeat and SOCS box-containing 2"""				Standard	NM_016150		Approved	ASB-2	uc001ycd.3	Q96Q27		ENST00000315988.4:c.1562T>C	chr14.hg19:g.94404109A>G	ENSP00000320675:p.Leu521Pro	125.0	0.0		93.0	4.0	NM_001202429	B2RDP9|B4E166|Q9NSU5|Q9Y567	Missense_Mutation	SNP	ENST00000315988.4	hg19	CCDS9915.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.056147	0.76074	.	.	ENSG00000100628	ENST00000555019;ENST00000434324;ENST00000315988;ENST00000543546;ENST00000555507	T;T;T	0.73681	-0.77;-0.66;-0.7	5.13	5.13	0.70059	.	0.062950	0.64402	D	0.000004	D	0.84365	0.5456	M	0.69358	2.11	0.80722	D	1	P;D;P	0.89917	0.747;1.0;0.747	B;D;B	0.87578	0.405;0.998;0.405	D	0.85123	0.0970	10	0.49607	T	0.09	-7.9602	14.9326	0.70929	1.0:0.0:0.0:0.0	.	537;569;521	B3KPZ6;B4E166;Q96Q27	.;.;ASB2_HUMAN	P	569;537;521;467;467	ENSP00000451575:L569P;ENSP00000320675:L521P;ENSP00000450940:L467P	ENSP00000320675:L521P	L	-	2	0	ASB2	93473862	1.000000	0.71417	0.999000	0.59377	0.939000	0.58152	7.476000	0.81055	1.933000	0.56026	0.379000	0.24179	CTC	.	.		0.592	ASB2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000412845.1		
EML1	2009	hgsc.bcm.edu	37	14	100380523	100380523	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:100380523A>G	ENST00000262233.6	+	14	1641	c.1502A>G	c.(1501-1503)gAa>gGa	p.E501G	EML1_ENST00000334192.4_Missense_Mutation_p.E520G|EML1_ENST00000327921.9_Missense_Mutation_p.E489G	NM_004434.2	NP_004425.2	O00423	EMAL1_HUMAN	echinoderm microtubule associated protein like 1	501	Tandem atypical propeller in EMLs.				brain development (GO:0007420)|hematopoietic progenitor cell differentiation (GO:0002244)|microtubule cytoskeleton organization (GO:0000226)|mitotic spindle organization (GO:0007052)|neuroblast proliferation (GO:0007405)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	calcium ion binding (GO:0005509)|microtubule binding (GO:0008017)|tubulin binding (GO:0015631)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Melanoma(154;0.0879)|all_epithelial(191;0.216)				CAGATTCCAGAACAGTTTGGT	0.428																																					p.E520G		Atlas-SNP	.											.	EML1	97	.	0			c.A1559G						.						112.0	100.0	104.0					14																	100380523		2203	4300	6503	SO:0001583	missense	2009	exon15			TTCCAGAACAGTT	AK023861	CCDS32154.1, CCDS32155.1	14q32	2013-01-10		2002-02-15		ENSG00000066629		"""WD repeat domain containing"""	3330	protein-coding gene	gene with protein product		602033		EMAPL		9226380, 10521658	Standard	XM_005267397		Approved	EMAP, HuEMAP, ELP79	uc001ygr.3	O00423		ENST00000262233.6:c.1502A>G	chr14.hg19:g.100380523A>G	ENSP00000262233:p.Glu501Gly	144.0	0.0		83.0	4.0	NM_001008707	Q86U15|Q8N536|Q8N5C4|Q8WWL6	Missense_Mutation	SNP	ENST00000262233.6	hg19	CCDS32155.1	.	.	.	.	.	.	.	.	.	.	A	18.03	3.531344	0.64972	.	.	ENSG00000066629	ENST00000327921;ENST00000262233;ENST00000334192;ENST00000542138	T;T;T	0.41065	1.01;1.01;1.01	5.04	5.04	0.67666	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.047681	0.85682	D	0.000000	T	0.62648	0.2445	M	0.68952	2.095	0.80722	D	1	D;B;D	0.89917	1.0;0.012;1.0	D;B;D	0.91635	0.996;0.009;0.999	T	0.65841	-0.6070	10	0.59425	D	0.04	-30.6283	14.7834	0.69784	1.0:0.0:0.0:0.0	.	489;501;520	F8W717;O00423;O00423-3	.;EMAL1_HUMAN;.	G	489;501;520;520	ENSP00000327384:E489G;ENSP00000262233:E501G;ENSP00000334314:E520G	ENSP00000262233:E501G	E	+	2	0	EML1	99450276	1.000000	0.71417	1.000000	0.80357	0.246000	0.25737	9.132000	0.94455	1.899000	0.54978	0.477000	0.44152	GAA	.	.		0.428	EML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413943.1	NM_001008707	
MTA1	9112	hgsc.bcm.edu	37	14	105916421	105916421	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr14:105916421C>T	ENST00000331320.7	+	5	482	c.268C>T	c.(268-270)Ccg>Tcg	p.P90S	MTA1_ENST00000406191.1_Missense_Mutation_p.P90S|MTA1_ENST00000405646.1_Missense_Mutation_p.P73S	NM_001203258.1|NM_004689.3	NP_001190187.1|NP_004680.2	Q13330	MTA1_HUMAN	metastasis associated 1	90	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				circadian regulation of gene expression (GO:0032922)|double-strand break repair (GO:0006302)|entrainment of circadian clock by photoperiod (GO:0043153)|locomotor rhythm (GO:0045475)|positive regulation of protein autoubiquitination (GO:1902499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression, epigenetic (GO:0040029)|regulation of inflammatory response (GO:0050727)|response to ionizing radiation (GO:0010212)|response to lipopolysaccharide (GO:0032496)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|microtubule (GO:0005874)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|stomach(1)	14		all_cancers(154;0.0293)|all_epithelial(191;0.128)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00897)|Epithelial(46;0.026)	Epithelial(152;0.19)		AATGGAGAACCCGGAAATGGT	0.627																																					p.P90S		Atlas-SNP	.											MTA1,NS,carcinoma,0,1	MTA1	61	.	0			c.C268T						.						61.0	66.0	64.0					14																	105916421		2203	4300	6503	SO:0001583	missense	9112	exon5			GAGAACCCGGAAA	U35113	CCDS32169.1, CCDS55954.1	14q32.33	2013-01-25			ENSG00000182979	ENSG00000182979		"""GATA zinc finger domain containing"""	7410	protein-coding gene	gene with protein product		603526				8083195, 7607577	Standard	NM_004689		Approved		uc001yqx.3	Q13330	OTTHUMG00000150362	ENST00000331320.7:c.268C>T	chr14.hg19:g.105916421C>T	ENSP00000333633:p.Pro90Ser	147.0	0.0		100.0	0.0	NM_004689	A5PLK4|Q86SW2|Q8NFI8|Q96GI8	Missense_Mutation	SNP	ENST00000331320.7	hg19	CCDS32169.1	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746070	0.69418	.	.	ENSG00000182979	ENST00000331320;ENST00000406191;ENST00000405646;ENST00000498644	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	4.14	4.14	0.48551	Bromo adjacent homology (BAH) domain (3);	0.000000	0.85682	U	0.000000	D	0.83367	0.5239	L	0.56396	1.775	0.80722	D	1	P	0.38250	0.624	B	0.39465	0.3	D	0.83910	0.0295	10	0.41790	T	0.15	-11.5496	14.9627	0.71169	0.0:1.0:0.0:0.0	.	90	Q13330	MTA1_HUMAN	S	90;90;73;4	ENSP00000333633:P90S;ENSP00000385702:P90S;ENSP00000384180:P73S;ENSP00000448146:P4S	ENSP00000333633:P90S	P	+	1	0	MTA1	104987466	1.000000	0.71417	0.914000	0.36105	0.674000	0.39518	3.448000	0.52943	1.839000	0.53478	0.306000	0.20318	CCG	.	.		0.627	MTA1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000317849.15		
CHRM5	1133	hgsc.bcm.edu	37	15	34355738	34355738	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:34355738T>C	ENST00000383263.5	+	3	1490	c.820T>C	c.(820-822)Tcc>Ccc	p.S274P	CHRM5_ENST00000557872.1_Missense_Mutation_p.S274P	NM_012125.3	NP_036257.1	P08912	ACM5_HUMAN	cholinergic receptor, muscarinic 5	274					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|dopamine transport (GO:0015872)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|gastric acid secretion (GO:0001696)|metabolic process (GO:0008152)|regulation of phosphatidylinositol dephosphorylation (GO:0060304)|transmission of nerve impulse (GO:0019226)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	20		all_lung(180;1.76e-08)		all cancers(64;4.82e-17)|GBM - Glioblastoma multiforme(113;2.58e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0262)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Imipramine(DB00458)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Ziprasidone(DB00246)	CTGGTCATCCTCCCGCAGGAG	0.622																																					p.S274P		Atlas-SNP	.											.	CHRM5	59	.	0			c.T820C						.						47.0	47.0	47.0					15																	34355738		2201	4298	6499	SO:0001583	missense	1133	exon3			TCATCCTCCCGCA		CCDS10031.1	15q26	2012-08-08			ENSG00000184984	ENSG00000184984		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1954	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 5"""	118496					Standard	NM_012125		Approved		uc001zhk.1	P08912	OTTHUMG00000129369	ENST00000383263.5:c.820T>C	chr15.hg19:g.34355738T>C	ENSP00000372750:p.Ser274Pro	33.0	0.0		54.0	24.0	NM_012125	Q96RG7	Missense_Mutation	SNP	ENST00000383263.5	hg19	CCDS10031.1	.	.	.	.	.	.	.	.	.	.	T	11.50	1.656802	0.29425	.	.	ENSG00000184984	ENST00000383263	T	0.63255	-0.03	5.42	5.42	0.78866	GPCR, rhodopsin-like superfamily (1);	0.306724	0.32028	N	0.006691	T	0.56702	0.2003	L	0.39085	1.19	0.58432	D	0.999995	B	0.32939	0.391	B	0.37731	0.257	T	0.55296	-0.8163	10	0.33141	T	0.24	-21.8193	15.6252	0.76851	0.0:0.0:0.0:1.0	.	274	P08912	ACM5_HUMAN	P	274	ENSP00000372750:S274P	ENSP00000372750:S274P	S	+	1	0	CHRM5	32143030	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	7.812000	0.86109	2.275000	0.75901	0.528000	0.53228	TCC	.	.		0.622	CHRM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251521.2		
CASC5	57082	hgsc.bcm.edu	37	15	40897317	40897317	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:40897317A>G	ENST00000346991.5	+	3	435	c.45A>G	c.(43-45)atA>atG	p.I15M	CASC5_ENST00000527044.1_Missense_Mutation_p.I15M|snoU13_ENST00000459027.1_RNA|CASC5_ENST00000399668.2_Missense_Mutation_p.I15M			Q8NG31	CASC5_HUMAN	cancer susceptibility candidate 5	15	Interaction with BUB1 and BUB1B.				acrosome assembly (GO:0001675)|attachment of spindle microtubules to kinetochore (GO:0008608)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|nucleosome assembly (GO:0006334)|protein localization to kinetochore (GO:0034501)|spindle assembly checkpoint (GO:0071173)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.I15M(2)		NS(1)|breast(7)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(13)|lung(16)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_cancers(109;2.03e-18)|all_epithelial(112;4.26e-15)|Lung NSC(122;1.12e-10)|all_lung(180;2.59e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;4.99e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0861)|COAD - Colon adenocarcinoma(120;0.211)		GTGACAATATAGAGAGACCTG	0.303																																					p.I15M		Atlas-SNP	.											CASC5_ENST00000346991,NS,carcinoma,0,2	CASC5	269	.	2	Substitution - Missense(2)	kidney(2)	c.A45G						.						140.0	133.0	135.0					15																	40897317		1825	4071	5896	SO:0001583	missense	57082	exon3			CAATATAGAGAGA	AF173994	CCDS42023.1, CCDS42024.1	15q14	2013-07-03			ENSG00000137812	ENSG00000137812		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	24054	protein-coding gene	gene with protein product	"""cancer/testis antigen 29"", ""kinetochore null 1 homolog (C. elegans)"", ""blinkin, bub-linking kinetochore protein"", ""protein phosphatase 1, regulatory subunit 55"""	609173				10980622, 10780384, 18045986	Standard	NM_170589		Approved	D40, AF15Q14, CT29, hKNL-1, KNL1, hSpc105, PPP1R55, Spc7	uc010bbt.1	Q8NG31	OTTHUMG00000166532	ENST00000346991.5:c.45A>G	chr15.hg19:g.40897317A>G	ENSP00000335463:p.Ile15Met	144.0	1.0		56.0	3.0	NM_144508	Q8NHE1|Q8WXA6|Q9HCK2|Q9NR92	Missense_Mutation	SNP	ENST00000346991.5	hg19	CCDS42023.1	.	.	.	.	.	.	.	.	.	.	A	9.239	1.037721	0.19669	.	.	ENSG00000137812	ENST00000346991;ENST00000260369;ENST00000527044;ENST00000399668	T;T;T	0.20598	2.06;2.06;2.06	5.1	1.48	0.22813	.	0.666646	0.12871	N	0.432303	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	B;B;B	0.20780	0.048;0.048;0.048	B;B;B	0.16289	0.015;0.015;0.015	T	0.29027	-1.0025	10	0.41790	T	0.15	.	3.2925	0.06954	0.6458:0.0:0.1844:0.1699	.	15;15;15	Q8NG31-2;Q8NG31;Q8NG31-4	.;CASC5_HUMAN;.	M	15	ENSP00000335463:I15M;ENSP00000432654:I15M;ENSP00000382576:I15M	ENSP00000260369:I15M	I	+	3	3	CASC5	38684609	0.014000	0.17966	0.186000	0.23195	0.664000	0.39144	0.539000	0.23175	0.079000	0.16929	0.533000	0.62120	ATA	.	.		0.303	CASC5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000390224.2	NM_144508	
UBR1	197131	hgsc.bcm.edu	37	15	43360145	43360145	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:43360145T>C	ENST00000290650.4	-	6	827	c.749A>G	c.(748-750)gAc>gGc	p.D250G	UBR1_ENST00000382177.2_Missense_Mutation_p.D250G	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	250					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		GAGCTCACAGTCAAGAGCTCT	0.428																																					p.D250G		Atlas-SNP	.											.	UBR1	124	.	0			c.A749G						.						121.0	112.0	115.0					15																	43360145		2203	4299	6502	SO:0001583	missense	197131	exon6			TCACAGTCAAGAG		CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.749A>G	chr15.hg19:g.43360145T>C	ENSP00000290650:p.Asp250Gly	102.0	0.0		78.0	4.0	NM_174916	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	ENST00000290650.4	hg19	CCDS10091.1	.	.	.	.	.	.	.	.	.	.	T	13.12	2.142152	0.37825	.	.	ENSG00000159459	ENST00000290650;ENST00000382177;ENST00000546274	T;T	0.69435	0.41;-0.4	5.73	4.61	0.57282	Adaptor protein ClpS, core (1);Ribosomal protein L7/L12, C-terminal/adaptor protein ClpS-like (2);	0.268407	0.43260	D	0.000592	T	0.27063	0.0663	N	0.01009	-1.055	0.32079	N	0.593426	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.40627	-0.9553	10	0.05351	T	0.99	-4.8412	4.6682	0.12676	0.0:0.2668:0.0:0.7332	.	250;250	B4DYL2;Q8IWV7	.;UBR1_HUMAN	G	250	ENSP00000290650:D250G;ENSP00000371612:D250G	ENSP00000290650:D250G	D	-	2	0	UBR1	41147437	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.117000	0.41939	2.171000	0.68590	0.528000	0.53228	GAC	.	.		0.428	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253202.1	NM_174916	
ZSCAN29	146050	hgsc.bcm.edu	37	15	43661910	43661910	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:43661910T>C	ENST00000396976.2	-	1	336	c.202A>G	c.(202-204)Acc>Gcc	p.T68A	TUBGCP4_ENST00000570081.1_Intron|ZSCAN29_ENST00000396972.1_Missense_Mutation_p.T68A|ZSCAN29_ENST00000563508.1_5'Flank|ZSCAN29_ENST00000568898.1_Missense_Mutation_p.T67A|ZSCAN29_ENST00000562072.1_Missense_Mutation_p.T67A|TUBGCP4_ENST00000564079.1_5'Flank|TUBGCP4_ENST00000260383.7_5'Flank	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	68	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GGTAAGACGGTCAGGAACTGC	0.527																																					p.T68A		Atlas-SNP	.											.	ZSCAN29	57	.	0			c.A202G						.						101.0	100.0	100.0					15																	43661910		2201	4299	6500	SO:0001583	missense	146050	exon1			AGACGGTCAGGAA	AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.202A>G	chr15.hg19:g.43661910T>C	ENSP00000380174:p.Thr68Ala	113.0	0.0		93.0	4.0	NM_152455	B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	ENST00000396976.2	hg19	CCDS10095.2	.	.	.	.	.	.	.	.	.	.	T	12.59	1.983983	0.35036	.	.	ENSG00000140265	ENST00000396976;ENST00000396972	T;T	0.04317	3.65;3.65	4.79	2.43	0.29744	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.263624	0.26971	N	0.021565	T	0.05273	0.0140	L	0.53617	1.68	0.80722	D	1	B;B;B;B	0.17038	0.0;0.02;0.008;0.014	B;B;B;B	0.22880	0.001;0.042;0.02;0.017	T	0.33163	-0.9879	10	0.39692	T	0.17	-0.4876	4.1613	0.10285	0.1778:0.1089:0.0:0.7133	.	68;67;68;68	Q8IWY8-4;C9K0J8;Q8IWY8-3;Q8IWY8	.;.;.;ZSC29_HUMAN	A	68	ENSP00000380174:T68A;ENSP00000380170:T68A	ENSP00000380170:T68A	T	-	1	0	ZSCAN29	41449202	0.973000	0.33851	0.990000	0.47175	0.998000	0.95712	1.100000	0.31025	0.393000	0.25203	0.533000	0.62120	ACC	.	.		0.527	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253278.1	NM_152455	
FBN1	2200	hgsc.bcm.edu	37	15	48738934	48738934	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:48738934A>G	ENST00000316623.5	-	47	6212	c.5757T>C	c.(5755-5757)ggT>ggC	p.G1919G		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	1919	EGF-like 32; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		AAAGGATGAAACCATGATTGC	0.403																																					p.G1919G		Atlas-SNP	.											.	FBN1	310	.	0			c.T5757C						.						114.0	105.0	108.0					15																	48738934		2198	4295	6493	SO:0001819	synonymous_variant	2200	exon47			GATGAAACCATGA	X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.5757T>C	chr15.hg19:g.48738934A>G		64.0	0.0		61.0	4.0	NM_000138	B2RUU0|D2JYH6|Q15972|Q75N87	Silent	SNP	ENST00000316623.5	hg19	CCDS32232.1																																																																																			.	.		0.403	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000417355.1		
USP50	373509	hgsc.bcm.edu	37	15	50833322	50833322	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:50833322T>C	ENST00000532404.1	-	4	757	c.584A>G	c.(583-585)gAg>gGg	p.E195G	USP50_ENST00000530218.1_Intron	NM_203494.4	NP_987090.2	Q70EL3	UBP50_HUMAN	ubiquitin specific peptidase 50	200	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(1)|kidney(2)|large_intestine(4)|liver(1)|lung(5)	13				all cancers(107;0.000519)|GBM - Glioblastoma multiforme(94;0.00288)		GGTGCATTTCTCACACTTTAA	0.448																																					p.E195G		Atlas-SNP	.											.	USP50	24	.	0			c.A584G						.						153.0	147.0	149.0					15																	50833322		1964	4151	6115	SO:0001583	missense	373509	exon4			CATTTCTCACACT	AI990110	CCDS53944.1	15q21.1	2008-02-05	2005-08-08			ENSG00000170236		"""Ubiquitin-specific peptidases"""	20079	protein-coding gene	gene with protein product			"""ubiquitin specific protease 50"""			12838346	Standard	NM_203494		Approved		uc021sky.1	Q70EL3		ENST00000532404.1:c.584A>G	chr15.hg19:g.50833322T>C	ENSP00000434676:p.Glu195Gly	94.0	0.0		85.0	4.0	NM_203494	E9PP86	Missense_Mutation	SNP	ENST00000532404.1	hg19	CCDS53944.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.266740	0.59540	.	.	ENSG00000170236	ENST00000532404	T	0.26957	1.7	5.45	5.45	0.79879	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.235440	0.38492	N	0.001677	T	0.23094	0.0558	N	0.16478	0.41	0.34385	D	0.693571	D	0.54964	0.969	P	0.55749	0.783	T	0.04565	-1.0942	10	0.02654	T	1	-24.2808	13.0409	0.58899	0.0:0.0:0.0:1.0	.	200	Q70EL3	UBP50_HUMAN	G	195	ENSP00000434676:E195G	ENSP00000434676:E195G	E	-	2	0	USP50	48620614	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	5.140000	0.64807	2.051000	0.60960	0.459000	0.35465	GAG	.	.		0.448	USP50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395249.1		
TRPM7	54822	hgsc.bcm.edu	37	15	50881855	50881855	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:50881855T>C	ENST00000313478.7	-	27	4606		c.e27-2		TRPM7_ENST00000560955.1_Splice_Site	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7						actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		CTCTGTGTCCTTTAATAGAAA	0.289																																					.		Atlas-SNP	.											.	TRPM7	145	.	0			c.4325-2A>G						.						118.0	109.0	112.0					15																	50881855		1783	4056	5839	SO:0001630	splice_region_variant	54822	exon28			GTGTCCTTTAATA	AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.4325-2A>G	chr15.hg19:g.50881855T>C		81.0	0.0		56.0	4.0	NM_017672	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Splice_Site	SNP	ENST00000313478.7	hg19	CCDS42035.1	.	.	.	.	.	.	.	.	.	.	T	15.96	2.985798	0.53934	.	.	ENSG00000092439	ENST00000313478	.	.	.	4.5	3.37	0.38596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8202	0.40878	0.0:0.0823:0.0:0.9177	.	.	.	.	.	-1	.	.	.	-	.	.	TRPM7	48669147	1.000000	0.71417	0.955000	0.39395	0.896000	0.52359	4.107000	0.57811	0.604000	0.29930	0.528000	0.53228	.	.	.		0.289	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000418604.1	NM_017672	Intron
MYO5A	4644	hgsc.bcm.edu	37	15	52697484	52697484	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:52697484A>G	ENST00000399231.3	-	9	1296	c.1053T>C	c.(1051-1053)ccT>ccC	p.P351P	MYO5A_ENST00000399233.2_Splice_Site_p.P351P|MYO5A_ENST00000356338.6_Splice_Site_p.P351P|MYO5A_ENST00000358212.6_Splice_Site_p.P351P|MYO5A_ENST00000553916.1_Splice_Site_p.P351P	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	351	Myosin motor.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CTGAACTTACAGGTATTGTGC	0.363																																					p.P351P		Atlas-SNP	.											.	MYO5A	145	.	0			c.T1053C						.						76.0	69.0	71.0					15																	52697484		1876	4099	5975	SO:0001630	splice_region_variant	4644	exon9			ACTTACAGGTATT		CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.1053+1T>C	chr15.hg19:g.52697484A>G		67.0	0.0		88.0	5.0	NM_000259	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	ENST00000399231.3	hg19	CCDS42037.1																																																																																			.	.		0.363	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000268102.1	NM_000259	Silent
UNC13C	440279	hgsc.bcm.edu	37	15	54590036	54590036	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:54590036C>A	ENST00000260323.11	+	11	4016	c.4016C>A	c.(4015-4017)tCt>tAt	p.S1339Y	UNC13C_ENST00000537900.1_Missense_Mutation_p.S1337Y|UNC13C_ENST00000545554.1_Missense_Mutation_p.S1339Y	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	1339					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TCAGCTGTATCTGGGGCCATA	0.363																																					p.S1339Y		Atlas-SNP	.											.	UNC13C	674	.	0			c.C4016A						.						65.0	64.0	64.0					15																	54590036		1856	4087	5943	SO:0001583	missense	440279	exon10			CTGTATCTGGGGC	AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.4016C>A	chr15.hg19:g.54590036C>A	ENSP00000260323:p.Ser1339Tyr	340.0	0.0		304.0	104.0	NM_001080534	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	ENST00000260323.11	hg19	CCDS45264.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644585	0.87859	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.71579	-0.58;-0.58;-0.58	5.59	5.59	0.84812	C2 calcium/lipid-binding domain, CaLB (1);	0.113447	0.64402	D	0.000009	D	0.85927	0.5811	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.981;0.997	D	0.87560	0.2471	10	0.87932	D	0	.	18.5536	0.91075	0.0:1.0:0.0:0.0	.	1339;1339	F5H090;Q8NB66	.;UN13C_HUMAN	Y	1339;1339;1337	ENSP00000260323:S1339Y;ENSP00000438156:S1339Y;ENSP00000442569:S1337Y	ENSP00000260323:S1339Y	S	+	2	0	UNC13C	52377328	1.000000	0.71417	0.992000	0.48379	0.993000	0.82548	7.776000	0.85560	2.605000	0.88082	0.650000	0.86243	TCT	.	.		0.363	UNC13C-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000419028.3	NM_173166	
AQP9	366	hgsc.bcm.edu	37	15	58467128	58467128	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:58467128T>C	ENST00000219919.4	+	4	758	c.388T>C	c.(388-390)Tcc>Ccc	p.S130P	ALDH1A2_ENST00000558231.1_Intron|AQP9_ENST00000536493.1_Missense_Mutation_p.S130P|AQP9_ENST00000558772.1_Missense_Mutation_p.S65P	NM_020980.3	NP_066190.2	O43315	AQP9_HUMAN	aquaporin 9	130					amine transport (GO:0015837)|canalicular bile acid transport (GO:0015722)|carboxylic acid transport (GO:0046942)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|glycerol transport (GO:0015793)|immune response (GO:0006955)|metabolic process (GO:0008152)|polyol transport (GO:0015791)|purine nucleobase transport (GO:0006863)|pyrimidine nucleobase transport (GO:0015855)|pyrimidine-containing compound transmembrane transport (GO:0072531)|response to mercury ion (GO:0046689)|response to organic substance (GO:0010033)|response to osmotic stress (GO:0006970)|transmembrane transport (GO:0055085)|transport (GO:0006810)|water homeostasis (GO:0030104)|water transport (GO:0006833)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carboxylic acid transmembrane transporter activity (GO:0046943)|glycerol channel activity (GO:0015254)|polyol transmembrane transporter activity (GO:0015166)|porin activity (GO:0015288)|purine nucleobase transmembrane transporter activity (GO:0005345)|pyrimidine nucleobase transmembrane transporter activity (GO:0005350)|water channel activity (GO:0015250)|water transmembrane transporter activity (GO:0005372)	p.S130T(1)		endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)	21				GBM - Glioblastoma multiforme(80;0.16)		TGGACTTATGTCCTTTGCTGG	0.478																																					p.S130P		Atlas-SNP	.											AQP9,NS,carcinoma,0,1	AQP9	39	.	1	Substitution - Missense(1)	lung(1)	c.T388C						.						134.0	120.0	125.0					15																	58467128		2192	4292	6484	SO:0001583	missense	366	exon4			CTTATGTCCTTTG	AF016495	CCDS10165.1	15q	2005-09-20			ENSG00000103569	ENSG00000103569		"""Ion channels / Aquaporins"""	643	protein-coding gene	gene with protein product		602914					Standard	NM_020980		Approved	SSC1, HsT17287	uc002aez.2	O43315	OTTHUMG00000132631	ENST00000219919.4:c.388T>C	chr15.hg19:g.58467128T>C	ENSP00000219919:p.Ser130Pro	108.0	1.0		144.0	6.0	NM_020980	Q9NP32	Missense_Mutation	SNP	ENST00000219919.4	hg19	CCDS10165.1	.	.	.	.	.	.	.	.	.	.	t	7.335	0.619818	0.14193	.	.	ENSG00000103569	ENST00000219919;ENST00000536493	T;T	0.11604	2.76;2.76	5.4	-1.85	0.07784	Aquaporin-like (2);	0.731491	0.12956	N	0.425450	T	0.10035	0.0246	L	0.46157	1.445	0.09310	N	1	B	0.31599	0.33	B	0.37480	0.251	T	0.36286	-0.9754	10	0.27785	T	0.31	.	7.3998	0.26956	0.2668:0.0:0.3994:0.3338	.	130	O43315	AQP9_HUMAN	P	130	ENSP00000219919:S130P;ENSP00000441390:S130P	ENSP00000219919:S130P	S	+	1	0	AQP9	56254420	1.000000	0.71417	0.975000	0.42487	0.039000	0.13416	0.914000	0.28624	-0.108000	0.12066	-1.176000	0.01726	TCC	.	.		0.478	AQP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255878.2	NM_020980	
ICE2	79664	hgsc.bcm.edu	37	15	60768331	60768331	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:60768331A>G	ENST00000261520.4	-	3	311	c.77T>C	c.(76-78)tTc>tCc	p.F26S	NARG2_ENST00000439632.1_5'UTR|NARG2_ENST00000561114.1_Missense_Mutation_p.F26S|NARG2_ENST00000558654.1_5'UTR	NM_024611.4	NP_078887.2														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						TTCTCGAGAGAAAAATGTCTT	0.308																																					p.F26S		Atlas-SNP	.											.	NARG2	82	.	0			c.T77C						.						46.0	50.0	48.0					15																	60768331		2201	4294	6495	SO:0001583	missense	79664	exon3			CGAGAGAAAAATG																												ENST00000261520.4:c.77T>C	chr15.hg19:g.60768331A>G	ENSP00000261520:p.Phe26Ser	123.0	0.0		85.0	4.0	NM_024611		Missense_Mutation	SNP	ENST00000261520.4	hg19	CCDS10176.1	.	.	.	.	.	.	.	.	.	.	A	22.2	4.252236	0.80135	.	.	ENSG00000128915	ENST00000261520	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.66934	0.2840	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.70335	-0.4900	9	0.87932	D	0	-15.953	14.6261	0.68621	1.0:0.0:0.0:0.0	.	26	Q659A1	NARG2_HUMAN	S	26	.	ENSP00000261520:F26S	F	-	2	0	NARG2	58555623	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.812000	0.69194	2.239000	0.73571	0.533000	0.62120	TTC	.	.		0.308	NARG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256136.1		
PIF1	80119	hgsc.bcm.edu	37	15	65108548	65108548	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:65108548T>C	ENST00000268043.4	-	13	1969	c.1875A>G	c.(1873-1875)ccA>ccG	p.P625P	PIF1_ENST00000333425.6_Intron|PIF1_ENST00000559239.1_Silent_p.P625P					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						CATCATCATCTGGGGACTCCT	0.577																																					p.P625P		Atlas-SNP	.											.	PIF1	43	.	0			c.A1875G						.						94.0	86.0	89.0					15																	65108548		2202	4299	6501	SO:0001819	synonymous_variant	80119	exon13			ATCATCTGGGGAC	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.1875A>G	chr15.hg19:g.65108548T>C		90.0	0.0		96.0	4.0	NM_025049		Silent	SNP	ENST00000268043.4	hg19	CCDS10195.2																																																																																			.	.		0.577	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049	
DENND4A	10260	hgsc.bcm.edu	37	15	65956954	65956954	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:65956954T>C	ENST00000431932.2	-	30	5542	c.5334A>G	c.(5332-5334)ggA>ggG	p.G1778G	DENND4A_ENST00000443035.3_Silent_p.G1821G	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1778					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						GACTCATTGGTCCATAGACAT	0.333																																					p.G1821G		Atlas-SNP	.											.	DENND4A	217	.	0			c.A5463G						.						101.0	95.0	97.0					15																	65956954		1830	4081	5911	SO:0001819	synonymous_variant	10260	exon31			CATTGGTCCATAG	AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.5334A>G	chr15.hg19:g.65956954T>C		169.0	0.0		149.0	7.0	NM_001144823	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Silent	SNP	ENST00000431932.2	hg19	CCDS45285.1																																																																																			.	.		0.333	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419611.1	NM_005848	
CELF6	60677	hgsc.bcm.edu	37	15	72581260	72581260	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:72581260C>A	ENST00000569547.1	-	9	1113	c.1042G>T	c.(1042-1044)Ggc>Tgc	p.G348C	RP11-106M3.3_ENST00000570175.1_RNA|CELF6_ENST00000567083.1_Missense_Mutation_p.G348C|RP11-106M3.2_ENST00000379915.4_RNA|CELF6_ENST00000539635.1_Missense_Mutation_p.G209C|CELF6_ENST00000543764.2_Intron|CELF6_ENST00000395258.2_Missense_Mutation_p.G235C|CELF6_ENST00000569311.1_5'Flank|CELF6_ENST00000287202.5_Missense_Mutation_p.G348C			Q96J87	CELF6_HUMAN	CUGBP, Elav-like family member 6	348					mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(2)	13						TCAGCCACGCCGGGGCTCTGG	0.677																																					p.G348C		Atlas-SNP	.											.	CELF6	30	.	0			c.G1042T						.						5.0	5.0	5.0					15																	72581260		2019	3993	6012	SO:0001583	missense	60677	exon9			CCACGCCGGGGCT	AF425606	CCDS10242.1, CCDS53955.1, CCDS53956.1	15q24	2013-02-12	2010-02-19	2010-02-19	ENSG00000140488	ENSG00000140488		"""RNA binding motif (RRM) containing"""	14059	protein-coding gene	gene with protein product		612681	"""Bruno (Drosophila) -like 6, RNA binding protein"", ""bruno-like 6, RNA binding protein (Drosophila)"""	BRUNOL6		10893231	Standard	NM_052840		Approved		uc002auh.2	Q96J87	OTTHUMG00000133444	ENST00000569547.1:c.1042G>T	chr15.hg19:g.72581260C>A	ENSP00000454749:p.Gly348Cys	189.0	0.0		204.0	93.0	NM_001172684	B4DG28|B4DJB6|Q6PII4|Q6ZNJ7|Q8N607	Missense_Mutation	SNP	ENST00000569547.1	hg19	CCDS10242.1	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063340	0.36373	.	.	ENSG00000140488	ENST00000287202;ENST00000437872;ENST00000379915;ENST00000395258;ENST00000539635	T;T;T	0.24908	1.83;2.07;3.57	4.75	1.26	0.21427	.	0.285626	0.24838	U	0.035190	T	0.37812	0.1017	L	0.57536	1.79	0.27313	N	0.957257	D;D;D;D	0.65815	0.988;0.995;0.994;0.988	P;D;P;P	0.67725	0.687;0.953;0.757;0.687	T	0.09975	-1.0650	10	0.66056	D	0.02	.	5.2205	0.15366	0.0:0.4738:0.0:0.5262	.	348;235;209;348	B4DJB6;Q96J87-2;B3KWE6;Q96J87	.;.;.;CELF6_HUMAN	C	348;348;199;235;209	ENSP00000287202:G348C;ENSP00000378677:G235C;ENSP00000443162:G209C	ENSP00000287202:G348C	G	-	1	0	CELF6	70368314	0.044000	0.20184	0.989000	0.46669	0.986000	0.74619	0.761000	0.26489	0.410000	0.25675	0.561000	0.74099	GGC	.	.		0.677	CELF6-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	protein_coding	OTTHUMT00000420180.1	NM_052840	
HEXA	3073	hgsc.bcm.edu	37	15	72638893	72638893	+	Nonsense_Mutation	SNP	G	G	C	rs587779406		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:72638893G>C	ENST00000268097.5	-	11	1808	c.1305C>G	c.(1303-1305)taC>taG	p.Y435*	RP11-106M3.2_ENST00000379915.4_RNA|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000457859.2_Intron|HEXA_ENST00000429918.2_Nonsense_Mutation_p.Y262*|HEXA_ENST00000567159.1_Nonsense_Mutation_p.Y435*|HEXA_ENST00000566304.1_Nonsense_Mutation_p.Y446*	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	435					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.Y435Y(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GTTCCACTATGTAGAAATCCT	0.572																																					p.Y435X		Atlas-SNP	.											HEXA,rectum,carcinoma,0,2	HEXA	48	.	1	Substitution - coding silent(1)	ovary(1)	c.C1305G						.						101.0	109.0	107.0					15																	72638893		2199	4297	6496	SO:0001587	stop_gained	3073	exon11			CACTATGTAGAAA	M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1305C>G	chr15.hg19:g.72638893G>C	ENSP00000268097:p.Tyr435*	92.0	0.0		133.0	0.0	NM_000520	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Nonsense_Mutation	SNP	ENST00000268097.5	hg19	CCDS10243.1	.	.	.	.	.	.	.	.	.	.	G	38	6.701998	0.97776	.	.	ENSG00000213614	ENST00000268097;ENST00000429918	.	.	.	5.88	2.7	0.31948	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.1925	9.9799	0.41806	0.3062:0.0:0.6938:0.0	.	.	.	.	X	435;262	.	ENSP00000268097:Y435X	Y	-	3	2	HEXA	70425947	1.000000	0.71417	0.067000	0.19924	0.922000	0.55478	3.432000	0.52824	0.267000	0.21916	0.655000	0.94253	TAC	.	.		0.572	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257317.2	NM_000520	
CSPG4	1464	hgsc.bcm.edu	37	15	75969161	75969161	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:75969161T>C	ENST00000308508.5	-	10	5791	c.5699A>G	c.(5698-5700)gAt>gGt	p.D1900G	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	1900	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						CCGCCCTGAATCCACATCGGC	0.667																																					p.D1900G		Atlas-SNP	.											.	CSPG4	175	.	0			c.A5699G						.						23.0	24.0	24.0					15																	75969161		2197	4291	6488	SO:0001583	missense	1464	exon10			CCTGAATCCACAT	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.5699A>G	chr15.hg19:g.75969161T>C	ENSP00000312506:p.Asp1900Gly	70.0	0.0		85.0	4.0	NM_001897	D3DW77|Q92675	Missense_Mutation	SNP	ENST00000308508.5	hg19	CCDS10284.1	.	.	.	.	.	.	.	.	.	.	T	16.42	3.117699	0.56505	.	.	ENSG00000173546	ENST00000308508	T	0.21734	1.99	5.29	5.29	0.74685	.	0.085952	0.49916	D	0.000133	T	0.27098	0.0664	M	0.68593	2.085	0.48236	D	0.999612	P	0.48089	0.905	B	0.41894	0.369	T	0.08186	-1.0734	10	0.62326	D	0.03	.	14.4022	0.67056	0.0:0.0:0.0:1.0	.	1900	Q6UVK1	CSPG4_HUMAN	G	1900	ENSP00000312506:D1900G	ENSP00000312506:D1900G	D	-	2	0	CSPG4	73756216	1.000000	0.71417	0.901000	0.35422	0.263000	0.26337	7.751000	0.85126	1.991000	0.58162	0.459000	0.35465	GAT	.	.		0.667	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
TSPAN3	10099	hgsc.bcm.edu	37	15	77348564	77348564	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:77348564A>G	ENST00000267970.4	-	2	370	c.97T>C	c.(97-99)Tat>Cat	p.Y33H	TSPAN3_ENST00000559494.1_Intron|TSPAN3_ENST00000558394.1_5'UTR|TSPAN3_ENST00000561277.1_5'UTR|TSPAN3_ENST00000346495.2_Missense_Mutation_p.Y33H|TSPAN3_ENST00000424443.3_Intron|TSPAN3_ENST00000558745.1_5'UTR	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	33						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		ATGAAGACATAGGCTCCCACA	0.428																																					p.Y33H		Atlas-SNP	.											.	TSPAN3	21	.	0			c.T97C						.						99.0	99.0	99.0					15																	77348564		2196	4294	6490	SO:0001583	missense	10099	exon2			AGACATAGGCTCC		CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.97T>C	chr15.hg19:g.77348564A>G	ENSP00000267970:p.Tyr33His	94.0	0.0		97.0	4.0	NM_198902	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Missense_Mutation	SNP	ENST00000267970.4	hg19	CCDS10292.1	.	.	.	.	.	.	.	.	.	.	A	29.2	4.985404	0.93044	.	.	ENSG00000140391	ENST00000267970;ENST00000346495	T;T	0.80738	-1.41;-1.41	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.89111	0.6622	M	0.85777	2.775	0.80722	D	1	P;P	0.42248	0.774;0.604	P;P	0.54431	0.752;0.566	D	0.89950	0.4079	10	0.59425	D	0.04	.	16.3196	0.82941	1.0:0.0:0.0:0.0	.	33;33	A6NEH4;O60637	.;TSN3_HUMAN	H	33	ENSP00000267970:Y33H;ENSP00000341329:Y33H	ENSP00000267970:Y33H	Y	-	1	0	TSPAN3	75135619	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.313000	0.96297	2.248000	0.74166	0.459000	0.35465	TAT	.	.		0.428	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289792.3	NM_005724	
HYKK	123688	hgsc.bcm.edu	37	15	78825563	78825563	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:78825563G>T	ENST00000569878.1	+	4	673	c.673G>T	c.(673-675)Gga>Tga	p.G225*	HYKK_ENST00000563233.1_Intron|HYKK_ENST00000388988.4_Nonsense_Mutation_p.G225*|HYKK_ENST00000408962.2_Intron			A2RU49	HYKK_HUMAN	hydroxylysine kinase	225						cytoplasm (GO:0005737)	hydroxylysine kinase activity (GO:0047992)										TATCAATCACGGAGATCTTAA	0.353																																					p.G225X		Atlas-SNP	.											AGPHD1,brain,glioma,0,2	AGPHD1	22	.	0			c.G673T						.						56.0	50.0	52.0					15																	78825563		1827	4078	5905	SO:0001587	stop_gained	123688	exon5			AATCACGGAGATC	BC132753, BC144383, BM045979	CCDS42063.1, CCDS45318.1	15q25.1	2013-06-11	2013-06-11	2013-06-11	ENSG00000188266	ENSG00000188266	2.7.1.81		34403	protein-coding gene	gene with protein product	"""5-hydroxylysine kinase"""	614681	"""aminoglycoside phosphotransferase domain containing 1"""	AGPHD1		18780872, 22241472	Standard	NM_001013619		Approved	LOC123688	uc010unc.2	A2RU49		ENST00000569878.1:c.673G>T	chr15.hg19:g.78825563G>T	ENSP00000455459:p.Gly225*	125.0	0.0		139.0	0.0	NM_001013619	B7ZMA5|F8W6X5|Q6ZTN0	Nonsense_Mutation	SNP	ENST00000569878.1	hg19	CCDS42063.1	.	.	.	.	.	.	.	.	.	.	G	37	5.995893	0.97184	.	.	ENSG00000188266	ENST00000388988	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	20.1577	0.98120	0.0:0.0:1.0:0.0	.	.	.	.	X	225	.	ENSP00000373640:G225X	G	+	1	0	AGPHD1	76612618	1.000000	0.71417	0.829000	0.32907	0.931000	0.56810	9.610000	0.98337	2.767000	0.95098	0.655000	0.94253	GGA	.	.		0.353	HYKK-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435834.1	NM_001013619	
WDR93	56964	hgsc.bcm.edu	37	15	90281279	90281279	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:90281279T>C	ENST00000268130.7	+	16	1874	c.1773T>C	c.(1771-1773)taT>taC	p.Y591Y	WDR93_ENST00000560294.1_Silent_p.Y563Y|WDR93_ENST00000444934.2_Silent_p.Y308Y	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	591					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			CAGGAGACTATTCACATGAAA	0.463																																					p.Y591Y		Atlas-SNP	.											.	WDR93	63	.	0			c.T1773C						.						271.0	268.0	269.0					15																	90281279		2200	4299	6499	SO:0001819	synonymous_variant	56964	exon16			AGACTATTCACAT		CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1773T>C	chr15.hg19:g.90281279T>C		79.0	0.0		93.0	4.0	NM_020212	Q8N7Y8|Q9NP89	Silent	SNP	ENST00000268130.7	hg19	CCDS32326.1																																																																																			.	.		0.463	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416369.1	NM_020212	
IGF1R	3480	hgsc.bcm.edu	37	15	99467825	99467825	+	Silent	SNP	G	G	A	rs146023463		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr15:99467825G>A	ENST00000268035.6	+	13	3305	c.2694G>A	c.(2692-2694)ccG>ccA	p.P898P	IGF1R_ENST00000558762.1_Silent_p.P898P	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	898	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	GGCTAAACCCGGGGAACTACA	0.498																																					p.P898P		Atlas-SNP	.											.	IGF1R	147	.	0			c.G2694A						.	G		0,4394		0,0,2197	138.0	129.0	132.0		2694	-11.8	0.5	15	dbSNP_134	132	2,8592	2.2+/-6.3	0,2,4295	no	coding-synonymous	IGF1R	NM_000875.3		0,2,6492	AA,AG,GG		0.0233,0.0,0.0154		898/1368	99467825	2,12986	2197	4297	6494	SO:0001819	synonymous_variant	3480	exon13			AAACCCGGGGAAC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.2694G>A	chr15.hg19:g.99467825G>A		198.0	0.0		195.0	72.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Silent	SNP	ENST00000268035.6	hg19	CCDS10378.1																																																																																			.	G|1.000;A|0.000		0.498	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
RHBDF1	64285	hgsc.bcm.edu	37	16	113173	113173	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:113173T>C	ENST00000262316.6	-	5	612	c.470A>G	c.(469-471)gAc>gGc	p.D157G	RHBDF1_ENST00000454039.2_Missense_Mutation_p.D157G	NM_022450.3	NP_071895.3	Q96CC6	RHDF1_HUMAN	rhomboid 5 homolog 1 (Drosophila)	157					cell migration (GO:0016477)|cell proliferation (GO:0008283)|negative regulation of protein secretion (GO:0050709)|protein transport (GO:0015031)|proteolysis (GO:0006508)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	18		all_cancers(16;2.56e-05)|all_epithelial(16;0.000116)|Hepatocellular(780;0.0068)|Lung NSC(18;0.0795)|all_lung(18;0.159)				GGCCAGGGGGTCTATGATCTG	0.652																																					p.D157G		Atlas-SNP	.											.	RHBDF1	54	.	0			c.A470G						.						25.0	30.0	28.0					16																	113173		2158	4221	6379	SO:0001583	missense	64285	exon5			AGGGGGTCTATGA	BC014425	CCDS32344.1	16p13.3	2008-02-05	2006-02-22		ENSG00000007384	ENSG00000007384			20561	protein-coding gene	gene with protein product		614403	"""chromosome 16 open reading frame 8"", ""rhomboid family 1 (Drosophila)"""	C16orf8		8318735, 15965977	Standard	NM_022450		Approved	EGFR-RS, FLJ2235, Dist1	uc002cfl.4	Q96CC6	OTTHUMG00000060719	ENST00000262316.6:c.470A>G	chr16.hg19:g.113173T>C	ENSP00000262316:p.Asp157Gly	50.0	0.0		83.0	4.0	NM_022450	Q04842|Q1W6H2|Q4TT59|Q96S34|Q9H6E1	Missense_Mutation	SNP	ENST00000262316.6	hg19	CCDS32344.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.016199	0.75161	.	.	ENSG00000007384	ENST00000262316;ENST00000454039;ENST00000450643	T;T;T	0.80566	-1.39;-1.39;-1.39	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.88793	0.6533	M	0.76328	2.33	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.997	P;D;D	0.71414	0.879;0.951;0.973	D	0.90020	0.4127	10	0.72032	D	0.01	-36.921	14.8533	0.70316	0.0:0.0:0.0:1.0	.	157;180;157	F5GWL4;B4E3Q0;Q96CC6	.;.;RHDF1_HUMAN	G	157	ENSP00000262316:D157G;ENSP00000392133:D157G;ENSP00000408915:D157G	ENSP00000262316:D157G	D	-	2	0	RHBDF1	53173	1.000000	0.71417	1.000000	0.80357	0.315000	0.28087	7.953000	0.87836	2.107000	0.64212	0.379000	0.24179	GAC	.	.		0.652	RHBDF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134178.2	NM_022450	
CAPN15	6650	hgsc.bcm.edu	37	16	599102	599102	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:599102A>G	ENST00000219611.2	+	5	1922	c.1559A>G	c.(1558-1560)gAg>gGg	p.E520G	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	520	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGACCCCAGGAGATCAACTGC	0.657																																					p.E520G		Atlas-SNP	.											.	SOLH	47	.	0			c.A1559G						.						94.0	93.0	94.0					16																	599102		2200	4300	6500	SO:0001583	missense	6650	exon5			CCCAGGAGATCAA	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.1559A>G	chr16.hg19:g.599102A>G	ENSP00000219611:p.Glu520Gly	86.0	0.0		109.0	5.0	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	ENST00000219611.2	hg19	CCDS10410.1	.	.	.	.	.	.	.	.	.	.	a	24.7	4.564817	0.86439	.	.	ENSG00000103326	ENST00000219611	D	0.92099	-2.97	5.04	5.04	0.67666	Peptidase C2, calpain, catalytic domain (3);	0.669254	0.14978	N	0.287444	D	0.95965	0.8686	M	0.81112	2.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95723	0.8768	10	0.87932	D	0	.	13.6292	0.62186	1.0:0.0:0.0:0.0	.	520	O75808	CAN15_HUMAN	G	520	ENSP00000219611:E520G	ENSP00000219611:E520G	E	+	2	0	SOLH	539103	1.000000	0.71417	0.999000	0.59377	0.463000	0.32649	5.938000	0.70170	1.903000	0.55091	0.454000	0.30748	GAG	.	.		0.657	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
TPSAB1	7177	hgsc.bcm.edu	37	16	1291189	1291189	+	Missense_Mutation	SNP	G	G	T	rs143010092		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:1291189G>T	ENST00000338844.3	+	3	130	c.97G>T	c.(97-99)Ggg>Tgg	p.G33W	TPSAB1_ENST00000461509.2_Missense_Mutation_p.G40W	NM_003294.3	NP_003285.2	Q15661	TRYB1_HUMAN	tryptase alpha/beta 1	33	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				defense response (GO:0006952)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.G33R(1)		NS(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|skin(1)	10		Hepatocellular(780;0.00369)				GGGCATCGTCGGGGGTCAGGA	0.701																																					p.G33W		Atlas-SNP	.											TPSAB1,NS,carcinoma,0,1	TPSAB1	24	.	1	Substitution - Missense(1)	lung(1)	c.G97T						.						38.0	39.0	39.0					16																	1291189		2199	4300	6499	SO:0001583	missense	7177	exon3			ATCGTCGGGGGTC	M33494	CCDS10431.1	16p13.3	2009-11-13	2004-10-14	2004-10-15	ENSG00000172236	ENSG00000172236			12019	protein-coding gene	gene with protein product	"""tryptase alpha II"", ""tryptase beta I"", ""tryptase-I"", ""tryptase-II"", ""tryptase-III"""	191080	"""tryptase beta 1"""	TPSB1, TPS1, TPS2		2203827, 9920877	Standard	NM_003294		Approved		uc002ckz.3	Q15661	OTTHUMG00000090467	ENST00000338844.3:c.97G>T	chr16.hg19:g.1291189G>T	ENSP00000343577:p.Gly33Trp	153.0	0.0		231.0	0.0	NM_003294	D2E6R9|D2E6S1|P15157|Q15663|Q6B052|Q9H2Y4|Q9H2Y5|Q9UQI1	Missense_Mutation	SNP	ENST00000338844.3	hg19	CCDS10431.1	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063325	0.55432	.	.	ENSG00000172236	ENST00000338844;ENST00000461509	D;D	0.86562	-2.14;-2.14	3.38	3.38	0.38709	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48767	D	0.000170	D	0.94085	0.8104	M	0.90870	3.155	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.94990	0.8133	10	0.87932	D	0	.	12.6931	0.56988	0.0:0.0:1.0:0.0	.	33	Q15661	TRYB1_HUMAN	W	33;40	ENSP00000343577:G33W;ENSP00000418247:G40W	ENSP00000343577:G33W	G	+	1	0	TPSAB1	1231190	0.970000	0.33590	0.257000	0.24404	0.160000	0.22226	3.309000	0.51903	1.905000	0.55150	0.479000	0.44913	GGG	.	G|1.000;A|0.000		0.701	TPSAB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000206914.1	NM_003294	
TSC2	7249	hgsc.bcm.edu	37	16	2103446	2103446	+	Missense_Mutation	SNP	A	A	G	rs137854108		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:2103446A>G	ENST00000219476.3	+	4	959	c.329A>G	c.(328-330)cAg>cGg	p.Q110R	TSC2_ENST00000353929.4_Missense_Mutation_p.Q110R|TSC2_ENST00000382538.6_Missense_Mutation_p.Q61R|TSC2_ENST00000401874.2_Missense_Mutation_p.Q110R|TSC2_ENST00000568454.1_Missense_Mutation_p.Q121R|TSC2_ENST00000350773.4_Missense_Mutation_p.Q110R|TSC2_ENST00000439673.2_Intron	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	110	Required for interaction with TSC1.				acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCCATCGTGCAGGGGCAGGTA	0.687			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.Q110R		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.A329G						.						13.0	15.0	14.0					16																	2103446		2181	4274	6455	SO:0001583	missense	7249	exon4	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	TCGTGCAGGGGCA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.329A>G	chr16.hg19:g.2103446A>G	ENSP00000219476:p.Gln110Arg	63.0	0.0		93.0	4.0	NM_001114382	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Missense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	.	9.145	1.014873	0.19355	.	.	ENSG00000103197	ENST00000219476;ENST00000432909;ENST00000401874;ENST00000353929;ENST00000382538;ENST00000350773;ENST00000445113	T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38	4.79	4.79	0.61399	Armadillo-like helical (1);Armadillo-type fold (1);Tuberin, N-terminal (1);	0.208445	0.42172	D	0.000752	D	0.83440	0.5255	L	0.49126	1.545	0.44395	D	0.997305	P;D;P;D;D	0.71674	0.583;0.998;0.776;0.979;0.969	B;D;P;P;D	0.70227	0.37;0.91;0.583;0.61;0.968	T	0.79701	-0.1693	10	0.17369	T	0.5	-20.5712	9.7033	0.40200	0.8452:0.0:0.0:0.1548	.	61;110;110;110;110	B4DIL8;B7Z2B8;P49815-4;P49815-5;P49815	.;.;.;.;TSC2_HUMAN	R	110;61;110;110;61;110;121	ENSP00000219476:Q110R;ENSP00000384468:Q110R;ENSP00000248099:Q110R;ENSP00000371978:Q61R;ENSP00000344383:Q110R	ENSP00000219476:Q110R	Q	+	2	0	TSC2	2043447	1.000000	0.71417	1.000000	0.80357	0.358000	0.29455	7.029000	0.76477	1.801000	0.52704	0.379000	0.24179	CAG	.	.		0.687	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
SRRM2	23524	hgsc.bcm.edu	37	16	2813553	2813553	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:2813553T>C	ENST00000301740.8	+	11	3573	c.3024T>C	c.(3022-3024)agT>agC	p.S1008S		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	1008	Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						CGGGGCCAAGTCTTTCTGGAT	0.473																																					p.S1008S		Atlas-SNP	.											.	SRRM2	263	.	0			c.T3024C						.						110.0	118.0	115.0					16																	2813553		2198	4300	6498	SO:0001819	synonymous_variant	23524	exon11			GCCAAGTCTTTCT	AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.3024T>C	chr16.hg19:g.2813553T>C		107.0	0.0		98.0	4.0	NM_016333	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Silent	SNP	ENST00000301740.8	hg19	CCDS32373.1																																																																																			.	.		0.473	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436411.1		
ZG16B	124220	hgsc.bcm.edu	37	16	2881993	2881993	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:2881993T>C	ENST00000382280.3	+	4	539	c.460T>C	c.(460-462)Tct>Cct	p.S154P	ZG16B_ENST00000572863.1_Missense_Mutation_p.S124P	NM_145252.2	NP_660295.2	Q96DA0	ZG16B_HUMAN	zymogen granule protein 16B	154					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)			central_nervous_system(1)|lung(2)|ovary(1)|prostate(1)	5						CCAGATCTCCTCTGCCTACCC	0.507																																					p.S154P		Atlas-SNP	.											.	ZG16B	16	.	0			c.T460C						.						64.0	67.0	66.0					16																	2881993		1958	4162	6120	SO:0001583	missense	124220	exon4			ATCTCCTCTGCCT	BC009722	CCDS10479.2	16p13.3	2014-02-12	2012-12-07		ENSG00000162078	ENSG00000162078			30456	protein-coding gene	gene with protein product	"""jacalin-like lectin domain containing 2"""		"""zymogen granule protein 16 homolog B (rat)"""			12477932	Standard	NM_145252		Approved	HRPE773, PRO1567, JCLN2	uc002cru.3	Q96DA0	OTTHUMG00000128933	ENST00000382280.3:c.460T>C	chr16.hg19:g.2881993T>C	ENSP00000371715:p.Ser154Pro	83.0	0.0		120.0	5.0	NM_145252	A6NIY1|B2R4F6|Q6UW28	Missense_Mutation	SNP	ENST00000382280.3	hg19	CCDS10479.2	.	.	.	.	.	.	.	.	.	.	t	15.35	2.807423	0.50421	.	.	ENSG00000162078	ENST00000382280	T	0.33438	1.41	3.28	-6.56	0.01848	Mannose-binding lectin (3);	2.349280	0.02322	N	0.073045	T	0.30230	0.0758	L	0.42245	1.32	0.09310	N	1	D	0.67145	0.996	P	0.49561	0.615	T	0.49560	-0.8927	10	0.52906	T	0.07	0.022	6.035	0.19702	0.4556:0.0:0.3711:0.1733	.	154	Q96DA0	ZG16B_HUMAN	P	154	ENSP00000371715:S154P	ENSP00000371715:S154P	S	+	1	0	ZG16B	2821994	0.000000	0.05858	0.000000	0.03702	0.457000	0.32468	-2.937000	0.00685	-1.913000	0.01079	0.454000	0.30748	TCT	.	.		0.507	ZG16B-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250912.1	NM_145252	
TIGD7	91151	hgsc.bcm.edu	37	16	3349414	3349414	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:3349414T>C	ENST00000396862.1	-	2	3029	c.1201A>G	c.(1201-1203)Aat>Gat	p.N401D	TIGD7_ENST00000268674.2_Missense_Mutation_p.N401D|TIGD7_ENST00000574598.1_5'Flank	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	401						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TAAAGAAGATTTTCCCATGCA	0.308																																					p.N401D		Atlas-SNP	.											.	TIGD7	41	.	0			c.A1201G						.						91.0	101.0	98.0					16																	3349414		2197	4299	6496	SO:0001583	missense	91151	exon2			GAAGATTTTCCCA	AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1201A>G	chr16.hg19:g.3349414T>C	ENSP00000380071:p.Asn401Asp	240.0	0.0		215.0	81.0	NM_033208	Q9BXZ0	Missense_Mutation	SNP	ENST00000396862.1	hg19	CCDS10500.1	.	.	.	.	.	.	.	.	.	.	T	8.165	0.790433	0.16258	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.33865	1.39;1.39	5.32	5.32	0.75619	.	0.000000	0.42682	U	0.000664	T	0.44623	0.1302	L	0.27053	0.805	0.28178	N	0.928306	D	0.63880	0.993	D	0.70227	0.968	T	0.36578	-0.9742	10	0.52906	T	0.07	.	11.6709	0.51401	0.0:0.0:0.0:1.0	.	401	Q6NT04	TIGD7_HUMAN	D	401	ENSP00000380071:N401D;ENSP00000268674:N401D	ENSP00000268674:N401D	N	-	1	0	TIGD7	3289415	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.321000	0.43805	2.006000	0.58801	0.533000	0.62120	AAT	.	.		0.308	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251465.1	NM_033208	
SCNN1G	6340	hgsc.bcm.edu	37	16	23208690	23208690	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:23208690T>C	ENST00000300061.2	+	6	1162	c.1019T>C	c.(1018-1020)gTc>gCc	p.V340A	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	340					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	TATCCCTTCGTCGAAGATGTG	0.453																																					p.V340A		Atlas-SNP	.											.	SCNN1G	82	.	0			c.T1019C						.						117.0	103.0	108.0					16																	23208690		2197	4300	6497	SO:0001583	missense	6340	exon6			CCTTCGTCGAAGA	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1019T>C	chr16.hg19:g.23208690T>C	ENSP00000300061:p.Val340Ala	88.0	0.0		120.0	5.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	hg19	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.054696	0.36277	.	.	ENSG00000166828	ENST00000300061	T	0.64803	-0.12	5.62	5.62	0.85841	.	0.225126	0.38058	N	0.001837	T	0.51176	0.1659	N	0.24115	0.695	0.25077	N	0.990958	B	0.26975	0.165	B	0.28385	0.089	T	0.54289	-0.8316	10	0.87932	D	0	-37.2688	14.9985	0.71451	0.0:0.0:0.0:1.0	.	340	P51170	SCNNG_HUMAN	A	340	ENSP00000300061:V340A	ENSP00000300061:V340A	V	+	2	0	SCNN1G	23116191	1.000000	0.71417	0.979000	0.43373	0.095000	0.18619	5.505000	0.66981	2.151000	0.67156	0.533000	0.62120	GTC	.	.		0.453	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
CD2BP2	10421	hgsc.bcm.edu	37	16	30365247	30365247	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:30365247T>C	ENST00000305596.3	-	4	525	c.350A>G	c.(349-351)gAc>gGc	p.D117G	CD2BP2_ENST00000569466.1_Missense_Mutation_p.D117G|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	117					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						CAGCCAGCTGTCTCGGATCTG	0.622																																					p.D117G		Atlas-SNP	.											.	CD2BP2	30	.	0			c.A350G						.						66.0	62.0	63.0					16																	30365247		2197	4300	6497	SO:0001583	missense	10421	exon4			CAGCTGTCTCGGA	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.350A>G	chr16.hg19:g.30365247T>C	ENSP00000304903:p.Asp117Gly	86.0	0.0		119.0	6.0	NM_006110	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	hg19	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	N	22.1	4.241159	0.79912	.	.	ENSG00000169217	ENST00000305596	T	0.66995	-0.24	4.87	4.87	0.63330	.	0.108415	0.64402	D	0.000002	T	0.72550	0.3474	M	0.86805	2.84	0.80722	D	1	D	0.53885	0.963	B	0.43889	0.435	T	0.80155	-0.1500	10	0.87932	D	0	1.2721	13.591	0.61959	0.0:0.0:0.0:1.0	.	117	O95400	CD2B2_HUMAN	G	117	ENSP00000304903:D117G	ENSP00000304903:D117G	D	-	2	0	CD2BP2	30272748	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.774000	0.75012	2.041000	0.60428	0.456000	0.33151	GAC	.	.		0.622	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110	
ITGAL	3683	hgsc.bcm.edu	37	16	30490673	30490673	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:30490673A>G	ENST00000356798.6	+	6	647	c.467A>G	c.(466-468)gAc>gGc	p.D156G	RP11-297C4.3_ENST00000562525.1_RNA|ITGAL_ENST00000454514.2_Intron|RP11-297C4.2_ENST00000569459.1_RNA|ITGAL_ENST00000358164.5_Intron|ITGAL_ENST00000433423.2_Intron	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	156	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GGCAACGTAGACCTGGTATTT	0.473																																					p.D156G	NSCLC(110;1462 1641 3311 33990 49495)	Atlas-SNP	.											.	ITGAL	149	.	0			c.A467G						.						119.0	107.0	111.0					16																	30490673		2197	4300	6497	SO:0001583	missense	3683	exon6			ACGTAGACCTGGT		CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.467A>G	chr16.hg19:g.30490673A>G	ENSP00000349252:p.Asp156Gly	62.0	0.0		73.0	4.0	NM_002209	O43746|Q45H73|Q96HB1|Q9UBC8	Missense_Mutation	SNP	ENST00000356798.6	hg19	CCDS32433.1	.	.	.	.	.	.	.	.	.	.	A	25.0	4.590583	0.86851	.	.	ENSG00000005844	ENST00000356798	D	0.93247	-3.19	5.98	5.98	0.97165	von Willebrand factor, type A (3);	0.000000	0.56097	D	0.000021	D	0.97601	0.9214	H	0.95504	3.68	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.98572	1.0646	10	0.87932	D	0	.	13.9892	0.64355	1.0:0.0:0.0:0.0	.	156	P20701	ITAL_HUMAN	G	156	ENSP00000349252:D156G	ENSP00000349252:D156G	D	+	2	0	ITGAL	30398174	1.000000	0.71417	0.998000	0.56505	0.940000	0.58332	6.040000	0.70980	2.289000	0.77006	0.421000	0.28195	GAC	.	.		0.473	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434508.2		
ZNF267	10308	hgsc.bcm.edu	37	16	31927599	31927599	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:31927599A>G	ENST00000300870.10	+	4	2238	c.2029A>G	c.(2029-2031)Aca>Gca	p.T677A		NM_001265588.1|NM_003414.5	NP_001252517.1|NP_003405	Q14586	ZN267_HUMAN	zinc finger protein 267	677					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(5)|kidney(1)|large_intestine(14)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	41						ATACCTCACTACACATCGGAG	0.443																																					p.T677A		Atlas-SNP	.											.	ZNF267	94	.	0			c.A2029G						.						108.0	98.0	101.0					16																	31927599		2197	4300	6497	SO:0001583	missense	10308	exon4			CTCACTACACATC	X78925	CCDS32440.1	16p11.2	2013-01-08			ENSG00000185947	ENSG00000185947		"""Zinc fingers, C2H2-type"", ""-"""	13060	protein-coding gene	gene with protein product		604752				7865130	Standard	NM_003414		Approved	HZF2	uc002ecs.5	Q14586		ENST00000300870.10:c.2029A>G	chr16.hg19:g.31927599A>G	ENSP00000300870:p.Thr677Ala	56.0	0.0		52.0	4.0	NM_003414	A0JNZ9|Q8NE41|Q9NRJ0	Missense_Mutation	SNP	ENST00000300870.10	hg19	CCDS32440.1	.	.	.	.	.	.	.	.	.	.	.	1.653	-0.513380	0.04200	.	.	ENSG00000185947	ENST00000300870	T	0.17213	2.29	0.468	0.468	0.16732	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06962	0.0177	N	0.12853	0.265	0.09310	N	0.999999	B	0.23185	0.081	B	0.15484	0.013	T	0.41875	-0.9484	9	0.09843	T	0.71	.	5.2175	0.15350	0.9999:0.0:1.0E-4:0.0	.	677	Q14586	ZN267_HUMAN	A	677	ENSP00000300870:T677A	ENSP00000300870:T677A	T	+	1	0	ZNF267	31835100	0.000000	0.05858	0.005000	0.12908	0.005000	0.04900	-0.244000	0.08903	0.413000	0.25759	0.402000	0.26972	ACA	.	.		0.443	ZNF267-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432446.2	NM_003414	
SNX20	124460	hgsc.bcm.edu	37	16	50707345	50707345	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:50707345T>C	ENST00000330943.4	-	4	1094	c.923A>G	c.(922-924)gAg>gGg	p.E308G	RP11-401P9.5_ENST00000570241.2_RNA|RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron|SNX20_ENST00000300590.3_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	308					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CACAGTGAGCTCCTTCAGGGT	0.657																																					p.E308G		Atlas-SNP	.											.	SNX20	50	.	0			c.A923G						.						54.0	59.0	57.0					16																	50707345		2198	4300	6498	SO:0001583	missense	124460	exon4			GTGAGCTCCTTCA	AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.923A>G	chr16.hg19:g.50707345T>C	ENSP00000332062:p.Glu308Gly	148.0	0.0		184.0	8.0	NM_182854	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Missense_Mutation	SNP	ENST00000330943.4	hg19	CCDS10745.1	.	.	.	.	.	.	.	.	.	.	T	17.11	3.306389	0.60305	.	.	ENSG00000167208	ENST00000330943;ENST00000413750	T	0.46451	0.87	5.67	5.67	0.87782	.	0.115560	0.64402	D	0.000020	T	0.60830	0.2299	M	0.78801	2.425	0.53688	D	0.999975	D	0.65815	0.995	P	0.57425	0.82	T	0.66630	-0.5875	10	0.87932	D	0	-11.9079	14.4848	0.67609	0.0:0.0:0.0:1.0	.	308	Q7Z614	SNX20_HUMAN	G	308;144	ENSP00000332062:E308G	ENSP00000332062:E308G	E	-	2	0	SNX20	49264846	1.000000	0.71417	0.929000	0.37066	0.108000	0.19459	4.560000	0.60802	2.161000	0.67846	0.459000	0.35465	GAG	.	.		0.657	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256879.2	NM_153337	
SALL1	6299	hgsc.bcm.edu	37	16	51175352	51175352	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:51175352T>C	ENST00000251020.4	-	2	814	c.781A>G	c.(781-783)Aat>Gat	p.N261D	SALL1_ENST00000440970.1_Missense_Mutation_p.N164D|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	261					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			AAGTCTGCATTCTGAGAAGCC	0.488																																					p.N261D	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.A781G						.						87.0	88.0	88.0					16																	51175352		2198	4300	6498	SO:0001583	missense	6299	exon2			CTGCATTCTGAGA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.781A>G	chr16.hg19:g.51175352T>C	ENSP00000251020:p.Asn261Asp	109.0	0.0		98.0	4.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	10.90	1.482571	0.26598	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.06849	3.25;3.29	4.75	4.75	0.60458	.	0.262921	0.44097	D	0.000491	T	0.06142	0.0159	N	0.14661	0.345	0.31008	N	0.719553	B	0.23377	0.084	B	0.19148	0.024	T	0.07347	-1.0777	10	0.39692	T	0.17	.	14.4208	0.67183	0.0:0.0:0.0:1.0	.	261	Q9NSC2	SALL1_HUMAN	D	261;164;225	ENSP00000251020:N261D;ENSP00000407914:N164D	ENSP00000251020:N261D	N	-	1	0	SALL1	49732853	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	5.012000	0.64017	1.980000	0.57719	0.402000	0.26972	AAT	.	.		0.488	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
BBS2	583	hgsc.bcm.edu	37	16	56533696	56533696	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:56533696T>C	ENST00000245157.5	-	12	1941	c.1521A>G	c.(1519-1521)gcA>gcG	p.A507A	BBS2_ENST00000568104.1_Silent_p.A507A|BBS2_ENST00000561951.1_5'Flank	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	507					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						TCACCCTCTGTGCCCGTTCTG	0.423									Bardet-Biedl syndrome																												p.A507A		Atlas-SNP	.											.	BBS2	67	.	0			c.A1521G						.						171.0	163.0	166.0					16																	56533696		2198	4300	6498	SO:0001819	synonymous_variant	583	exon12	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CCTCTGTGCCCGT	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.1521A>G	chr16.hg19:g.56533696T>C		101.0	0.0		100.0	4.0	NM_031885	Q96CM0|Q96SN9	Silent	SNP	ENST00000245157.5	hg19	CCDS32451.1																																																																																			.	.		0.423	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
NLRC5	84166	hgsc.bcm.edu	37	16	57060298	57060298	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:57060298T>C	ENST00000262510.6	+	6	1668	c.1443T>C	c.(1441-1443)gcT>gcC	p.A481A	NLRC5_ENST00000436936.1_Silent_p.A481A|NLRC5_ENST00000539144.1_Silent_p.A481A|NLRC5_ENST00000308149.7_Silent_p.A481A	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	481	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				AAGATATTGCTCCACCCTTGA	0.597																																					p.A481A		Atlas-SNP	.											.	NLRC5	186	.	0			c.T1443C						.						41.0	39.0	40.0					16																	57060298		2198	4300	6498	SO:0001819	synonymous_variant	84166	exon5			TATTGCTCCACCC	AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.1443T>C	chr16.hg19:g.57060298T>C		124.0	0.0		146.0	6.0	NM_032206	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Silent	SNP	ENST00000262510.6	hg19	CCDS10773.1	.	.	.	.	.	.	.	.	.	.	T	0.104	-1.147767	0.01714	.	.	ENSG00000140853	ENST00000538805	.	.	.	5.4	-1.34	0.09143	.	.	.	.	.	T	0.18383	0.0441	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.23547	-1.0185	4	.	.	.	.	0.5041	0.00584	0.3299:0.2365:0.1152:0.3184	.	.	.	.	P	234	.	.	S	+	1	0	NLRC5	55617799	0.001000	0.12720	0.003000	0.11579	0.034000	0.12701	-0.119000	0.10676	-0.193000	0.10415	0.459000	0.35465	TCC	.	.		0.597	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257346.1	NM_032206	
CNOT1	23019	hgsc.bcm.edu	37	16	58633211	58633211	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:58633211A>G	ENST00000317147.5	-	2	363	c.31T>C	c.(31-33)Tct>Cct	p.S11P	CNOT1_ENST00000569240.1_Missense_Mutation_p.S11P|CNOT1_ENST00000441024.2_Missense_Mutation_p.S11P	NM_001265612.1|NM_016284.4	NP_001252541.1|NP_057368.3	A5YKK6	CNOT1_HUMAN	CCR4-NOT transcription complex, subunit 1	11					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cytoplasmic mRNA processing body assembly (GO:0010606)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of stem cell maintenance (GO:2000036)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)	estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|retinoic acid receptor binding (GO:0042974)			breast(1)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(24)|lung(25)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(2)	87				Kidney(780;0.0722)|OV - Ovarian serous cystadenocarcinoma(108;0.173)|Epithelial(162;0.239)		CTGATTTGAGACAAGGCCAGC	0.502																																					p.S11P		Atlas-SNP	.											.	CNOT1	359	.	0			c.T31C						.						90.0	86.0	88.0					16																	58633211		2198	4300	6498	SO:0001583	missense	23019	exon2			TTTGAGACAAGGC	AL833549	CCDS10799.1, CCDS45501.1, CCDS58468.1	16q21	2008-02-05			ENSG00000125107	ENSG00000125107			7877	protein-coding gene	gene with protein product		604917		NOT1		14702039	Standard	NM_016284		Approved	CDC39, NOT1H, KIAA1007, AD-005	uc002env.4	A5YKK6	OTTHUMG00000133487	ENST00000317147.5:c.31T>C	chr16.hg19:g.58633211A>G	ENSP00000320949:p.Ser11Pro	115.0	0.0		100.0	4.0	NM_206999	Q68DX7|Q7Z3K2|Q8IWB8|Q8TB53|Q9BVZ6|Q9UFR8|Q9UI27|Q9Y2L0	Missense_Mutation	SNP	ENST00000317147.5	hg19	CCDS10799.1	.	.	.	.	.	.	.	.	.	.	A	15.63	2.891706	0.52014	.	.	ENSG00000125107	ENST00000317147;ENST00000394200;ENST00000441024	T;T	0.24723	1.84;1.84	5.46	5.46	0.80206	.	0.109719	0.64402	D	0.000005	T	0.45776	0.1359	L	0.54323	1.7	0.80722	D	1	D;D;B	0.57899	0.981;0.978;0.046	D;B;B	0.71184	0.972;0.4;0.032	T	0.27226	-1.0080	9	.	.	.	-13.9785	15.5431	0.76070	1.0:0.0:0.0:0.0	.	11;11;11	A5YKK6-4;A5YKK6;A5YKK6-2	.;CNOT1_HUMAN;.	P	11	ENSP00000320949:S11P;ENSP00000413113:S11P	.	S	-	1	0	CNOT1	57190712	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.312000	0.96287	2.065000	0.61736	0.455000	0.32223	TCT	.	.		0.502	CNOT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257385.3	NM_016284	
DYNC1LI2	1783	hgsc.bcm.edu	37	16	66783141	66783141	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:66783141A>G	ENST00000258198.2	-	3	463	c.257T>C	c.(256-258)cTa>cCa	p.L86P	RP11-61A14.4_ENST00000501143.1_lincRNA|DYNC1LI2_ENST00000440564.2_Intron|DYNC1LI2_ENST00000443351.2_Missense_Mutation_p.L86P|DYNC1LI2_ENST00000379482.2_Missense_Mutation_p.L86P	NM_006141.2	NP_006132.1	O43237	DC1L2_HUMAN	dynein, cytoplasmic 1, light intermediate chain 2	86					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|centrosome localization (GO:0051642)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based movement (GO:0007018)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			central_nervous_system(3)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|skin(4)|stomach(1)	15		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0907)|Epithelial(162;0.212)		GAGATATTCTAGGCCTCTTCC	0.463																																					p.L86P		Atlas-SNP	.											.	DYNC1LI2	37	.	0			c.T257C						.						243.0	208.0	220.0					16																	66783141		2200	4300	6500	SO:0001583	missense	1783	exon3			TATTCTAGGCCTC	AF035812	CCDS10818.1, CCDS67049.1	16q22.1	2008-02-05	2005-11-25	2005-11-25	ENSG00000135720	ENSG00000135720		"""Cytoplasmic dyneins"""	2966	protein-coding gene	gene with protein product		611406	"""dynein, cytoplasmic, light intermediate polypeptide 2"""	DNCLI2		16260502	Standard	NM_006141		Approved		uc002eqb.1	O43237	OTTHUMG00000137523	ENST00000258198.2:c.257T>C	chr16.hg19:g.66783141A>G	ENSP00000258198:p.Leu86Pro	153.0	0.0		150.0	6.0	NM_006141	A8K6V1|B4DZP4|Q8TAT3	Missense_Mutation	SNP	ENST00000258198.2	hg19	CCDS10818.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.445733	0.84101	.	.	ENSG00000135720	ENST00000258198;ENST00000379482;ENST00000443351	T;T;T	0.33865	1.53;1.53;1.39	4.81	4.81	0.61882	.	0.000000	0.64402	D	0.000001	T	0.65460	0.2693	M	0.88310	2.945	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.996	D;P;D	0.81914	0.995;0.899;0.988	T	0.73720	-0.3894	10	0.87932	D	0	-15.6057	14.5285	0.67905	1.0:0.0:0.0:0.0	.	86;86;86	B4DHD8;B4DZP4;O43237	.;.;DC1L2_HUMAN	P	86	ENSP00000258198:L86P;ENSP00000368795:L86P;ENSP00000394289:L86P	ENSP00000258198:L86P	L	-	2	0	DYNC1LI2	65340642	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	9.081000	0.94049	2.018000	0.59344	0.374000	0.22700	CTA	.	.		0.463	DYNC1LI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268846.1	NM_006141	
CCDC79	283847	hgsc.bcm.edu	37	16	66820006	66820006	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:66820006T>C	ENST00000558713.2	-	7	560	c.488A>G	c.(487-489)gAt>gGt	p.D163G	CCDC79_ENST00000415744.1_Missense_Mutation_p.D163G|CCDC79_ENST00000561333.1_5'UTR|CCDC79_ENST00000433154.1_Missense_Mutation_p.D163G|CCDC79_ENST00000433574.1_Missense_Mutation_p.D163G|CCDC79_ENST00000432602.1_Missense_Mutation_p.D163G			Q8NA31	TERB1_HUMAN	coiled-coil domain containing 79	163					meiotic telomere clustering (GO:0045141)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|skin(2)	7						ATCTGACAAATCCAACTCATG	0.303																																					p.D163G		Atlas-SNP	.											.	CCDC79	32	.	0			c.A488G						.						95.0	80.0	84.0					16																	66820006		692	1588	2280	SO:0001583	missense	283847	exon8			GACAAATCCAACT	AK093213		16q22.1	2012-10-03			ENSG00000249961	ENSG00000249961			26675	protein-coding gene	gene with protein product							Standard	NM_001136505		Approved	FLJ35894	uc010viv.2	Q8NA31	OTTHUMG00000133562	ENST00000558713.2:c.488A>G	chr16.hg19:g.66820006T>C	ENSP00000462883:p.Asp163Gly	87.0	0.0		96.0	4.0	NM_001136505	A0AUW1	Missense_Mutation	SNP	ENST00000558713.2	hg19		.	.	.	.	.	.	.	.	.	.	T	13.08	2.129233	0.37533	.	.	ENSG00000177461	ENST00000433154;ENST00000432602;ENST00000433574;ENST00000415744	T;T;T;T	0.11277	2.79;2.79;2.79;2.79	5.47	5.47	0.80525	Armadillo-like helical (1);Armadillo-type fold (1);	0.382525	0.25261	N	0.031954	T	0.09642	0.0237	L	0.34521	1.04	0.29706	N	0.839742	B;P	0.35575	0.265;0.51	B;B	0.29785	0.054;0.107	T	0.05903	-1.0857	10	0.41790	T	0.15	-7.5295	15.5315	0.75968	0.0:0.0:0.0:1.0	.	163;163	Q8NA31;Q8NA31-2	CCD79_HUMAN;.	G	163	ENSP00000463762:D163G;ENSP00000462977:D163G;ENSP00000462037:D163G;ENSP00000462236:D163G	ENSP00000440822:D163G	D	-	2	0	CCDC79	65377507	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.584000	0.60971	2.059000	0.61396	0.533000	0.62120	GAT	.	.		0.303	CCDC79-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000418864.2		
RLTPR	146206	hgsc.bcm.edu	37	16	67683061	67683061	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:67683061C>T	ENST00000334583.6	+	18	2002	c.1674C>T	c.(1672-1674)ttC>ttT	p.F558F	RLTPR_ENST00000545661.1_Silent_p.F522F	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	558					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GAAGGAACTTCAACGTCCGGT	0.652																																					p.F558F		Atlas-SNP	.											.	RLTPR	124	.	0			c.C1674T						.						54.0	64.0	60.0					16																	67683061		2067	4193	6260	SO:0001819	synonymous_variant	146206	exon18			GAACTTCAACGTC	AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.1674C>T	chr16.hg19:g.67683061C>T		132.0	0.0		143.0	50.0	NM_001013838	B8X2Z3	Silent	SNP	ENST00000334583.6	hg19	CCDS45513.1																																																																																			.	.		0.652	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467858.1	NM_001013838	
SLC7A6OS	84138	hgsc.bcm.edu	37	16	68344764	68344764	+	Silent	SNP	A	A	G	rs147089863		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:68344764A>G	ENST00000263997.6	-	1	84	c.66T>C	c.(64-66)gcT>gcC	p.A22A	PRMT7_ENST00000339507.5_5'Flank|PRMT7_ENST00000441236.1_5'Flank|snoU13_ENST00000458872.1_RNA|PRMT7_ENST00000449359.3_5'Flank|PRMT7_ENST00000348497.4_5'Flank	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	22					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		CGAGCACAAGAGCCTCCGCCG	0.657																																					p.A22A		Atlas-SNP	.											.	SLC7A6OS	22	.	0			c.T66C						.	A		1,4393	2.1+/-5.4	0,1,2196	32.0	30.0	31.0		66	-10.9	0.0	16	dbSNP_134	31	0,8600		0,0,4300	no	coding-synonymous	SLC7A6OS	NM_032178.2		0,1,6496	GG,GA,AA		0.0,0.0228,0.0077		22/310	68344764	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	84138	exon1			CACAAGAGCCTCC		CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.66T>C	chr16.hg19:g.68344764A>G		123.0	0.0		112.0	5.0	NM_032178	Q8TCZ3|Q9H8R8	Silent	SNP	ENST00000263997.6	hg19	CCDS10865.1																																																																																			.	A|1.000;G|0.000		0.657	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178	
CFDP1	10428	hgsc.bcm.edu	37	16	75338933	75338933	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:75338933T>C	ENST00000283882.3	-	6	930	c.798A>G	c.(796-798)cgA>cgG	p.R266R		NM_006324.2	NP_006315.1	Q9UEE9	CFDP1_HUMAN	craniofacial development protein 1	266	BCNT-C. {ECO:0000255|PROSITE- ProRule:PRU00610}.				cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|negative regulation of fibroblast apoptotic process (GO:2000270)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)					endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5						CCTCTTTCCCTCGATTATGGA	0.458																																					p.R266R		Atlas-SNP	.											.	CFDP1	17	.	0			c.A798G						.						167.0	163.0	165.0					16																	75338933		2198	4300	6498	SO:0001819	synonymous_variant	10428	exon6			TTTCCCTCGATTA	AB009285	CCDS10916.1	16q22.2-q22.3	2011-08-12			ENSG00000153774	ENSG00000153774			1873	protein-coding gene	gene with protein product	"""Bucentaur"", ""centromere protein 29"""	608108				9602175, 9006920, 11992732	Standard	NM_006324		Approved	BCNT, p97, CP27, SWC5, Yeti, CENP-29	uc002fdy.3	Q9UEE9	OTTHUMG00000137615	ENST00000283882.3:c.798A>G	chr16.hg19:g.75338933T>C		77.0	0.0		79.0	4.0	NM_006324	O00393|O00404|Q9UEF0|Q9UEF1|Q9UEF8	Silent	SNP	ENST00000283882.3	hg19	CCDS10916.1																																																																																			.	.		0.458	CFDP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269031.2	NM_006324	
SYCE1L	100130958	hgsc.bcm.edu	37	16	77245136	77245136	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:77245136A>G	ENST00000378644.4	+	7	441	c.386A>G	c.(385-387)gAt>gGt	p.D129G	RP11-538I12.2_ENST00000569032.1_RNA	NM_001129979.1	NP_001123451.1	A8MT33	SYC1L_HUMAN	synaptonemal complex central element protein 1-like	129					synaptonemal complex assembly (GO:0007130)	synaptonemal complex (GO:0000795)				breast(1)|prostate(1)	2						CAGCTGGAGGATCTGATGGGC	0.562																																					p.D129G		Atlas-SNP	.											.	SYCE1L	10	.	0			c.A386G						.						168.0	157.0	160.0					16																	77245136		692	1591	2283	SO:0001583	missense	100130958	exon7			TGGAGGATCTGAT		CCDS45533.1	16q23.1	2009-10-06			ENSG00000205078	ENSG00000205078			37236	protein-coding gene	gene with protein product	"""meiosis-related protein"""					16328886	Standard	NM_001129979		Approved	MRP2	uc010vnh.1	A8MT33		ENST00000378644.4:c.386A>G	chr16.hg19:g.77245136A>G	ENSP00000367911:p.Asp129Gly	189.0	0.0		211.0	84.0	NM_001129979	A6NF23	Missense_Mutation	SNP	ENST00000378644.4	hg19	CCDS45533.1	.	.	.	.	.	.	.	.	.	.	A	12.85	2.060333	0.36373	.	.	ENSG00000205078	ENST00000378644	T	0.32023	1.47	3.82	1.51	0.23008	.	0.170354	0.25402	U	0.030923	T	0.29850	0.0746	M	0.62723	1.935	0.09310	N	1	P	0.52061	0.95	P	0.46339	0.513	T	0.18999	-1.0319	10	0.66056	D	0.02	.	3.8292	0.08867	0.6629:0.2209:0.1162:0.0	.	129	A8MT33	SYC1L_HUMAN	G	129	ENSP00000367911:D129G	ENSP00000367911:D129G	D	+	2	0	SYCE1L	75802637	0.392000	0.25229	0.007000	0.13788	0.415000	0.31203	1.051000	0.30417	0.292000	0.22492	0.460000	0.39030	GAT	.	.		0.562	SYCE1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433889.1	NM_001129979	
CENPN	55839	hgsc.bcm.edu	37	16	81066277	81066277	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:81066277T>C	ENST00000393335.3	+	11	1114	c.1040T>C	c.(1039-1041)gTc>gCc	p.V347A	RP11-303E16.2_ENST00000566639.1_RNA|RP11-303E16.3_ENST00000561808.1_RNA|RP11-303E16.3_ENST00000566390.1_RNA	NM_001100625.2	NP_001094095.2	Q96H22	CENPN_HUMAN	centromere protein N	0					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|large_intestine(5)|lung(4)	10						CTTCTGTTTGTCCCATTGTAT	0.423																																					p.V347A		Atlas-SNP	.											.	CENPN	84	.	0			c.T1040C						.						82.0	86.0	85.0					16																	81066277		1893	4104	5997	SO:0001583	missense	55839	exon11			TGTTTGTCCCATT	AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000393335.3:c.1040T>C	chr16.hg19:g.81066277T>C	ENSP00000377007:p.Val347Ala	89.0	0.0		100.0	6.0	NM_001100625	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	ENST00000393335.3	hg19	CCDS42199.1	.	.	.	.	.	.	.	.	.	.	T	7.373	0.627202	0.14257	.	.	ENSG00000166451	ENST00000393335	T	0.26373	1.74	0.559	0.559	0.17272	.	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B	0.20261	0.043	B	0.09377	0.004	T	0.21484	-1.0244	9	0.87932	D	0	-5.1847	.	.	.	.	347	A8MZE6	.	A	347	ENSP00000377007:V347A	ENSP00000377007:V347A	V	+	2	0	CENPN	79623778	0.006000	0.16342	0.010000	0.14722	0.010000	0.07245	0.449000	0.21744	0.469000	0.27268	0.459000	0.35465	GTC	.	.		0.423	CENPN-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000269052.1	NM_018455	
CMIP	80790	hgsc.bcm.edu	37	16	81703808	81703808	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:81703808A>G	ENST00000537098.3	+	8	959	c.887A>G	c.(886-888)gAg>gGg	p.E296G	CMIP_ENST00000539778.2_Missense_Mutation_p.E202G|CMIP_ENST00000566513.1_3'UTR|CMIP_ENST00000398040.4_Missense_Mutation_p.E143G	NM_198390.2	NP_938204.2	Q8IY22	CMIP_HUMAN	c-Maf inducing protein	296						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(5)|kidney(1)|lung(7)	13						GCCTTGAACGAGCTCAACGCG	0.582																																					p.E296G		Atlas-SNP	.											.	CMIP	37	.	0			c.A887G						.						59.0	64.0	62.0					16																	81703808		1996	4175	6171	SO:0001583	missense	80790	exon8			TGAACGAGCTCAA	AB051481	CCDS54044.1, CCDS54045.1	16q23	2011-08-04			ENSG00000153815	ENSG00000153815			24319	protein-coding gene	gene with protein product		610112				11214970, 12939343	Standard	NM_030629		Approved		uc002fgp.3	Q8IY22		ENST00000537098.3:c.887A>G	chr16.hg19:g.81703808A>G	ENSP00000446100:p.Glu296Gly	91.0	0.0		106.0	5.0	NM_198390	Q9C0G9	Missense_Mutation	SNP	ENST00000537098.3	hg19	CCDS54044.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.472447	0.43942	.	.	ENSG00000153815	ENST00000537098;ENST00000539778;ENST00000398040;ENST00000542097	T;T	0.09817	2.94;2.94	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.17746	0.0426	N	0.24115	0.695	0.58432	D	0.999999	D;D;D	0.61080	0.989;0.989;0.981	D;D;D	0.70487	0.969;0.969;0.954	T	0.13764	-1.0497	10	0.16420	T	0.52	.	14.6727	0.68956	1.0:0.0:0.0:0.0	.	143;202;296	Q8IY22-3;Q8IY22-2;Q8IY22	.;.;CMIP_HUMAN	G	296;202;202;109	ENSP00000446100:E296G;ENSP00000440401:E202G	ENSP00000381120:E202G	E	+	2	0	CMIP	80261309	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.724000	0.91462	1.865000	0.54081	0.383000	0.25322	GAG	.	.		0.582	CMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432399.2	NM_030629	
OSGIN1	29948	hgsc.bcm.edu	37	16	83994667	83994667	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:83994667A>G	ENST00000343939.2	+	6	1110	c.727A>G	c.(727-729)Aag>Gag	p.K243E	OSGIN1_ENST00000393306.1_Missense_Mutation_p.K160E|OSGIN1_ENST00000361711.3_Missense_Mutation_p.K160E|OSGIN1_ENST00000565123.1_Missense_Mutation_p.K160E			Q9UJX0	OSGI1_HUMAN	oxidative stress induced growth inhibitor 1	243					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)		growth factor activity (GO:0008083)			autonomic_ganglia(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(1)	12						CTGGATGCAGAAGAAGCGAAG	0.577																																					p.K160E		Atlas-SNP	.											OSGIN1,NS,carcinoma,0,1	OSGIN1	33	.	0			c.A478G						.						64.0	65.0	65.0					16																	83994667		2200	4300	6500	SO:0001583	missense	29948	exon5			ATGCAGAAGAAGC	AY258066	CCDS10939.1	16q23.3	2010-11-23			ENSG00000140961	ENSG00000140961			30093	protein-coding gene	gene with protein product	"""bone marrow stromal cell-derived growth inhibitor"", ""pregnancy induced growth inhibitor"""	607975				11459809, 14570898	Standard	NM_182981		Approved	BDGI, OKL38	uc002fhc.3	Q9UJX0	OTTHUMG00000137640	ENST00000343939.2:c.727A>G	chr16.hg19:g.83994667A>G	ENSP00000343376:p.Lys243Glu	56.0	0.0		60.0	3.0	NM_182981	Q52M33|Q86UQ1|Q96S88|Q9BZ70	Missense_Mutation	SNP	ENST00000343939.2	hg19		.	.	.	.	.	.	.	.	.	.	A	4.652	0.121229	0.08881	.	.	ENSG00000140961	ENST00000343939;ENST00000361711;ENST00000393306	T;T;T	0.22539	1.95;1.95;1.95	4.53	2.13	0.27403	.	0.759254	0.12484	N	0.464825	T	0.13372	0.0324	L	0.38531	1.155	0.09310	N	1	B	0.30146	0.27	B	0.28916	0.096	T	0.31998	-0.9923	10	0.10377	T	0.69	-25.0361	6.5396	0.22372	0.6216:0.2898:0.0886:0.0	.	243	Q9UJX0	OSGI1_HUMAN	E	243;160;160	ENSP00000343376:K243E;ENSP00000355374:K160E;ENSP00000376983:K160E	ENSP00000343376:K243E	K	+	1	0	OSGIN1	82552168	0.008000	0.16893	0.239000	0.24122	0.818000	0.46254	0.955000	0.29188	0.594000	0.29761	0.402000	0.26972	AAG	.	.		0.577	OSGIN1-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000269081.1	NM_013370	
KLHDC4	54758	hgsc.bcm.edu	37	16	87742992	87742992	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:87742992C>T	ENST00000270583.5	-	10	1384	c.1326G>A	c.(1324-1326)ggG>ggA	p.G442G	KLHDC4_ENST00000353170.5_Silent_p.G385G|KLHDC4_ENST00000566349.1_5'UTR|KLHDC4_ENST00000347925.5_Silent_p.G411G	NM_017566.3	NP_060036.2	Q8TBB5	KLDC4_HUMAN	kelch domain containing 4	442										breast(2)|endometrium(3)|lung(10)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(2)	21				BRCA - Breast invasive adenocarcinoma(80;0.0283)		CGTAGAGCACCCCATGCTTCA	0.672																																					p.G442G		Atlas-SNP	.											.	KLHDC4	45	.	0			c.G1326A						.						87.0	88.0	88.0					16																	87742992		2198	4300	6498	SO:0001819	synonymous_variant	54758	exon10			GAGCACCCCATGC	AK001742	CCDS10963.1, CCDS54050.1, CCDS54051.1	16q24	2008-02-05			ENSG00000104731	ENSG00000104731			25272	protein-coding gene	gene with protein product							Standard	NM_001184854		Approved	DKFZp434G0522	uc002fki.3	Q8TBB5	OTTHUMG00000137657	ENST00000270583.5:c.1326G>A	chr16.hg19:g.87742992C>T		78.0	0.0		104.0	5.0	NM_017566	D3DUN3|D3DUN4|D3DUN5|Q96F29|Q9BVN3	Silent	SNP	ENST00000270583.5	hg19	CCDS10963.1																																																																																			.	.		0.672	KLHDC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000269109.2	NM_017566	
CA5A	763	hgsc.bcm.edu	37	16	87960395	87960395	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:87960395T>C	ENST00000309893.2	-	2	364	c.299A>G	c.(298-300)tAc>tGc	p.Y100C	CA5A_ENST00000568801.1_5'UTR	NM_001739.1	NP_001730.1	P35218	CAH5A_HUMAN	carbonic anhydrase VA, mitochondrial	100					bicarbonate transport (GO:0015701)|one-carbon metabolic process (GO:0006730)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(80;0.0513)	Brinzolamide(DB01194)|Zonisamide(DB00909)	CTGGAAGAGGTAGCCAGTGTT	0.577																																					p.Y100C		Atlas-SNP	.											.	CA5A	32	.	0			c.A299G						.						77.0	71.0	73.0					16																	87960395		2198	4300	6498	SO:0001583	missense	763	exon2			AAGAGGTAGCCAG	L19297	CCDS10965.1	16q24.2	2012-08-21			ENSG00000174990	ENSG00000174990	4.2.1.1	"""Carbonic anhydrases"""	1377	protein-coding gene	gene with protein product		114761		CA5		8356065, 7490083	Standard	NM_001739		Approved	CAV, CAVA	uc002fkn.1	P35218	OTTHUMG00000137677	ENST00000309893.2:c.299A>G	chr16.hg19:g.87960395T>C	ENSP00000309649:p.Tyr100Cys	68.0	0.0		86.0	4.0	NM_001739	B2RPF2	Missense_Mutation	SNP	ENST00000309893.2	hg19	CCDS10965.1	.	.	.	.	.	.	.	.	.	.	T	15.82	2.947355	0.53186	.	.	ENSG00000174990	ENST00000309893	T	0.68331	-0.32	4.1	2.98	0.34508	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.070438	0.64402	D	0.000016	T	0.80819	0.4696	M	0.84846	2.72	0.52099	D	0.999946	D	0.89917	1.0	D	0.91635	0.999	T	0.80077	-0.1533	10	0.66056	D	0.02	-20.4895	9.1125	0.36737	0.1636:0.0:0.0:0.8364	.	100	P35218	CAH5A_HUMAN	C	100	ENSP00000309649:Y100C	ENSP00000309649:Y100C	Y	-	2	0	CA5A	86517896	1.000000	0.71417	0.995000	0.50966	0.671000	0.39405	5.631000	0.67812	0.457000	0.26962	0.454000	0.30748	TAC	.	.		0.577	CA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269164.1	NM_001739	
FANCA	2175	hgsc.bcm.edu	37	16	89849430	89849430	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:89849430C>T	ENST00000389301.3	-	16	1581	c.1551G>A	c.(1549-1551)cgG>cgA	p.R517R	FANCA_ENST00000568369.1_Silent_p.R517R	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	517					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		GGTCGGCCAGCCGTGTCTTGG	0.557			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.R517R		Atlas-SNP	.	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	.	FANCA	99	.	0			c.G1551A						.						183.0	133.0	150.0					16																	89849430		2198	4300	6498	SO:0001819	synonymous_variant	2175	exon16	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	GGCCAGCCGTGTC	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.1551G>A	chr16.hg19:g.89849430C>T		326.0	0.0		393.0	157.0	NM_000135	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	ENST00000389301.3	hg19	CCDS32515.1																																																																																			.	.		0.557	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000421927.1		
GAS8	2622	hgsc.bcm.edu	37	16	90106894	90106894	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:90106894A>G	ENST00000268699.4	+	9	1320	c.1198A>G	c.(1198-1200)Acg>Gcg	p.T400A	GAS8_ENST00000536122.1_Missense_Mutation_p.T375A|GAS8_ENST00000540721.1_3'UTR|URAHP_ENST00000517889.1_RNA	NM_001481.2	NP_001472.1	O95995	GAS8_HUMAN	growth arrest-specific 8	400					cellular protein localization (GO:0034613)|negative regulation of cell proliferation (GO:0008285)|sperm motility (GO:0030317)	Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile cilium (GO:0031514)				endometrium(3)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.029)		TGCAGCCCTGACGCTGGTGTC	0.627																																					p.T400A		Atlas-SNP	.											.	GAS8	29	.	0			c.A1198G						.						47.0	42.0	43.0					16																	90106894		2197	4300	6497	SO:0001583	missense	2622	exon9			GCCCTGACGCTGG	AF050079	CCDS10992.1, CCDS67101.1, CCDS73932.1	16q24.3	2014-07-18	2003-01-16	2003-01-17	ENSG00000141013	ENSG00000141013			4166	protein-coding gene	gene with protein product		605178	"""growth arrest-specific 11"""	GAS11		9790751	Standard	NM_001481		Approved		uc002fqi.1	O95995	OTTHUMG00000138988	ENST00000268699.4:c.1198A>G	chr16.hg19:g.90106894A>G	ENSP00000268699:p.Thr400Ala	42.0	0.0		64.0	4.0	NM_001481	B2RCT1|B7Z4U1|G3V1L5|Q2M234	Missense_Mutation	SNP	ENST00000268699.4	hg19	CCDS10992.1	.	.	.	.	.	.	.	.	.	.	A	3.350	-0.132786	0.06711	.	.	ENSG00000141013	ENST00000536122;ENST00000268699;ENST00000540721	T;T	0.40476	1.03;1.03	5.66	0.994	0.19832	.	0.386283	0.31438	N	0.007644	T	0.15955	0.0384	N	0.05124	-0.11	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.002	T	0.14172	-1.0482	9	.	.	.	-24.706	4.5345	0.12022	0.4755:0.0:0.1488:0.3757	.	371;400	B7Z1X3;O95995	.;GAS8_HUMAN	A	375;400;371	ENSP00000440977:T375A;ENSP00000268699:T400A	.	T	+	1	0	GAS8	88634395	0.002000	0.14202	0.431000	0.26735	0.810000	0.45777	0.274000	0.18680	0.957000	0.37930	0.454000	0.30748	ACG	.	.		0.627	GAS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000272877.2		
TUSC5	286753	hgsc.bcm.edu	37	17	1198888	1198888	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:1198888T>C	ENST00000333813.3	+	2	830	c.491T>C	c.(490-492)aTc>aCc	p.I164T		NM_172367.2	NP_758955.2	Q8IXB3	TUSC5_HUMAN	tumor suppressor candidate 5	164					response to biotic stimulus (GO:0009607)	integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|prostate(4)|skin(2)	15				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		ATCGTCATTATCATGGTGGCC	0.612																																					p.I164T		Atlas-SNP	.											.	TUSC5	25	.	0			c.T491C						.						94.0	105.0	102.0					17																	1198888		2146	4248	6394	SO:0001583	missense	286753	exon2			TCATTATCATGGT	AB090231	CCDS42225.1	17p13.3	2009-10-16			ENSG00000184811	ENSG00000184811			29592	protein-coding gene	gene with protein product	"""located at seventeen p thirteen point three 1"", ""interferon induced transmembrane protein domain containing 3"""	612211				12660825	Standard	NM_172367		Approved	LOST1, IFITMD3	uc002fsi.1	Q8IXB3	OTTHUMG00000132196	ENST00000333813.3:c.491T>C	chr17.hg19:g.1198888T>C	ENSP00000329548:p.Ile164Thr	69.0	0.0		116.0	5.0	NM_172367	A6NMK4	Missense_Mutation	SNP	ENST00000333813.3	hg19	CCDS42225.1	.	.	.	.	.	.	.	.	.	.	T	15.52	2.858712	0.51376	.	.	ENSG00000184811	ENST00000333813	D	0.87179	-2.22	5.56	5.56	0.83823	.	0.163511	0.38381	U	0.001712	D	0.92130	0.7505	M	0.81497	2.545	0.44843	D	0.997851	D	0.56968	0.978	P	0.60236	0.871	D	0.92409	0.5936	10	0.51188	T	0.08	-17.1909	13.0902	0.59162	0.0:0.0:0.0:1.0	.	164	Q8IXB3	TUSC5_HUMAN	T	164	ENSP00000329548:I164T	ENSP00000329548:I164T	I	+	2	0	TUSC5	1145638	1.000000	0.71417	0.988000	0.46212	0.060000	0.15804	4.477000	0.60223	2.124000	0.65301	0.496000	0.49642	ATC	.	.		0.612	TUSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255249.1	NM_172367	
ACADVL	37	hgsc.bcm.edu	37	17	7123814	7123814	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7123814C>A	ENST00000356839.5	+	3	349	c.170C>A	c.(169-171)tCt>tAt	p.S57Y	DLG4_ENST00000399510.2_5'Flank|MIR324_ENST00000362183.1_RNA|ACADVL_ENST00000350303.5_Intron|ACADVL_ENST00000543245.2_Missense_Mutation_p.S80Y|ACADVL_ENST00000581562.1_3'UTR	NM_000018.3|NM_001270448.1	NP_000009.1|NP_001257377.1	P49748	ACADV_HUMAN	acyl-CoA dehydrogenase, very long chain	57	Catalytic.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy derivation by oxidation of organic compounds (GO:0015980)|epithelial cell differentiation (GO:0030855)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of fatty acid oxidation (GO:0046322)|regulation of cholesterol metabolic process (GO:0090181)|small molecule metabolic process (GO:0044281)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)			breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(2)|liver(2)|lung(1)|ovary(4)|skin(1)	21						TCCCACCCCTCTGACGCTCTG	0.577																																					p.S80Y		Atlas-SNP	.											.	ACADVL	43	.	0			c.C239A						.						68.0	70.0	69.0					17																	7123814		2203	4300	6503	SO:0001583	missense	37	exon4			ACCCCTCTGACGC	BC012912	CCDS11090.1, CCDS42249.1, CCDS58509.1	17p13.1	2010-04-30	2010-04-30		ENSG00000072778	ENSG00000072778			92	protein-coding gene	gene with protein product		609575	"""acyl-Coenzyme A dehydrogenase, very long chain"""			8921384	Standard	NM_000018		Approved	VLCAD, LCACD, ACAD6	uc002gev.4	P49748	OTTHUMG00000102157	ENST00000356839.5:c.170C>A	chr17.hg19:g.7123814C>A	ENSP00000349297:p.Ser57Tyr	79.0	0.0		101.0	36.0	NM_001270447	B4DEB6|F5H2A9|O76056|Q8WUL0	Missense_Mutation	SNP	ENST00000356839.5	hg19	CCDS11090.1	.	.	.	.	.	.	.	.	.	.	C	18.40	3.616576	0.66672	.	.	ENSG00000072778	ENST00000543245;ENST00000356839;ENST00000322910;ENST00000542255	D	0.96967	-4.19	5.82	2.5	0.30297	.	0.814642	0.11767	N	0.531520	D	0.93661	0.7975	L	0.36672	1.1	0.19300	N	0.99997	P;P;P	0.49635	0.797;0.926;0.8	B;B;B	0.44315	0.332;0.446;0.365	D	0.86613	0.1874	10	0.59425	D	0.04	.	11.3334	0.49490	0.4807:0.5193:0.0:0.0	.	103;80;57	G3V1M7;F5H2A9;P49748	.;.;ACADV_HUMAN	Y	80;103;57;103	ENSP00000438689:S80Y	ENSP00000325395:S57Y	S	+	2	0	ACADVL	7064538	0.000000	0.05858	0.256000	0.24389	0.007000	0.05969	0.662000	0.25038	0.756000	0.33013	0.655000	0.94253	TCT	.	.		0.577	ACADVL-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000220001.5	NM_000018	
DNAH2	146754	hgsc.bcm.edu	37	17	7699846	7699846	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7699846A>G	ENST00000572933.1	+	50	9199	c.7739A>G	c.(7738-7740)gAg>gGg	p.E2580G	DNAH2_ENST00000389173.2_Missense_Mutation_p.E2580G			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	2580	AAA 3. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TTTGAGGAAGAGGTGAAGCCC	0.547																																					p.E2580G		Atlas-SNP	.											.	DNAH2	498	.	0			c.A7739G						.						134.0	109.0	117.0					17																	7699846		2203	4300	6503	SO:0001583	missense	146754	exon49			AGGAAGAGGTGAA	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.7739A>G	chr17.hg19:g.7699846A>G	ENSP00000458355:p.Glu2580Gly	67.0	0.0		96.0	4.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	A	17.94	3.511578	0.64522	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.35048	1.33	5.4	5.4	0.78164	.	0.056757	0.64402	D	0.000002	T	0.41050	0.1142	M	0.69463	2.115	0.80722	D	1	B	0.27700	0.186	B	0.35688	0.208	T	0.34004	-0.9846	10	0.44086	T	0.13	.	11.0254	0.47743	0.8444:0.1556:0.0:0.0	.	2580	Q9P225	DYH2_HUMAN	G	2580	ENSP00000373825:E2580G	ENSP00000353818:E2580G	E	+	2	0	DNAH2	7640571	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.921000	0.56454	2.264000	0.75181	0.496000	0.49642	GAG	.	.		0.547	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
CHD3	1107	hgsc.bcm.edu	37	17	7803881	7803881	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7803881T>C	ENST00000330494.7	+	18	2960	c.2810T>C	c.(2809-2811)tTg>tCg	p.L937S	CHD3_ENST00000358181.4_Missense_Mutation_p.L937S|CHD3_ENST00000380358.4_Missense_Mutation_p.L996S	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	937					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				CTTAGCAACTTGGAGGGCTTC	0.488																																					p.L996S		Atlas-SNP	.											.	CHD3	169	.	0			c.T2987C						.						66.0	69.0	68.0					17																	7803881		2203	4300	6503	SO:0001583	missense	1107	exon18			GCAACTTGGAGGG	U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.2810T>C	chr17.hg19:g.7803881T>C	ENSP00000332628:p.Leu937Ser	74.0	0.0		81.0	4.0	NM_001005271	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	ENST00000330494.7	hg19	CCDS32554.1	.	.	.	.	.	.	.	.	.	.	T	13.81	2.347084	0.41599	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.91945	-2.94;-2.94;-2.94	4.63	4.63	0.57726	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.32901	N	0.005517	D	0.93058	0.7790	L	0.31157	0.91	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.87578	0.996;0.998;0.998	D	0.94084	0.7347	10	0.87932	D	0	-12.0132	14.4958	0.67685	0.0:0.0:0.0:1.0	.	937;937;996	Q12873-2;Q12873;E9PG89	.;CHD3_HUMAN;.	S	996;937;937	ENSP00000369716:L996S;ENSP00000350907:L937S;ENSP00000332628:L937S	ENSP00000332628:L937S	L	+	2	0	CHD3	7744606	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	7.825000	0.86693	2.085000	0.62840	0.402000	0.26972	TTG	.	.		0.488	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318050.1	NM_001005273	
CNTROB	116840	hgsc.bcm.edu	37	17	7851016	7851016	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:7851016G>C	ENST00000563694.1	+	14	3046	c.2121G>C	c.(2119-2121)gaG>gaC	p.E707D	CNTROB_ENST00000380255.3_3'UTR|CNTROB_ENST00000565740.1_Missense_Mutation_p.E707D|CNTROB_ENST00000380262.3_Missense_Mutation_p.E707D	NM_053051.3	NP_444279.2	Q8N137	CNTRB_HUMAN	centrobin, centrosomal BRCA2 interacting protein	707	Pro-rich.|Required for centrosome localization.				centriole replication (GO:0007099)|centrosome separation (GO:0051299)|cytokinesis (GO:0000910)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)	protein domain specific binding (GO:0019904)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(9)	25		Prostate(122;0.173)				CTCAGCTGGAGGGCCTCAAGA	0.542																																					p.E707D		Atlas-SNP	.											.	CNTROB	61	.	0			c.G2121C						.						82.0	88.0	86.0					17																	7851016		2203	4300	6503	SO:0001583	missense	116840	exon14			GCTGGAGGGCCTC	AF331638	CCDS32557.1, CCDS11126.1	17p13.1	2006-03-15				ENSG00000170037			29616	protein-coding gene	gene with protein product	"""centrobin"""	611425				11984006, 16275750	Standard	NM_001037144		Approved	LIP8, PP1221	uc002gjp.3	Q8N137		ENST00000563694.1:c.2121G>C	chr17.hg19:g.7851016G>C	ENSP00000456335:p.Glu707Asp	105.0	0.0		121.0	71.0	NM_001037144	A6NHQ1|Q331K3|Q69YV7|Q8NCB8|Q8WXV3|Q96CQ7|Q9C060	Missense_Mutation	SNP	ENST00000563694.1	hg19	CCDS11126.1	.	.	.	.	.	.	.	.	.	.	G	11.30	1.598749	0.28445	.	.	ENSG00000170037	ENST00000380262	T	0.10192	2.9	5.41	-5.03	0.02973	.	0.536026	0.16924	N	0.193956	T	0.04952	0.0133	L	0.27053	0.805	0.51482	D	0.999927	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.06405	0.002;0.002;0.002	T	0.30794	-0.9966	10	0.72032	D	0.01	-1.0222	1.0312	0.01538	0.4235:0.1135:0.1943:0.2688	.	707;707;707	Q8N137-3;Q8N137;Q8N137-2	.;CNTRB_HUMAN;.	D	707	ENSP00000369614:E707D	ENSP00000369614:E707D	E	+	3	2	CNTROB	7791741	0.725000	0.28048	0.263000	0.24496	0.490000	0.33462	-0.594000	0.05733	-0.705000	0.05035	-1.210000	0.01631	GAG	.	.		0.542	CNTROB-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000421372.1	NM_053051	
PER1	5187	hgsc.bcm.edu	37	17	8051338	8051338	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:8051338A>G	ENST00000317276.4	-	10	1448	c.1211T>C	c.(1210-1212)cTc>cCc	p.L404P	PER1_ENST00000578089.1_5'Flank|PER1_ENST00000581082.1_Missense_Mutation_p.L384P|PER1_ENST00000354903.5_Missense_Mutation_p.L388P	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	404	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						AGCCAGCATGAGGGGTCGGTC	0.637			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.L404P		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.T1211C						.						45.0	40.0	41.0					17																	8051338		2203	4300	6503	SO:0001583	missense	5187	exon10			AGCATGAGGGGTC	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1211T>C	chr17.hg19:g.8051338A>G	ENSP00000314420:p.Leu404Pro	101.0	0.0		80.0	4.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	A	19.04	3.749661	0.69533	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.16324	2.35;2.35	5.17	5.17	0.71159	PAS fold-3 (1);PAS (2);	0.286010	0.32819	N	0.005612	T	0.45696	0.1355	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.989;0.998	T	0.51756	-0.8665	10	0.87932	D	0	-24.0286	13.0042	0.58694	1.0:0.0:0.0:0.0	.	388;404	B4DI49;O15534	.;PER1_HUMAN	P	404;388	ENSP00000314420:L404P;ENSP00000346979:L388P	ENSP00000314420:L404P	L	-	2	0	PER1	7992063	0.976000	0.34144	1.000000	0.80357	0.978000	0.69477	6.054000	0.71096	2.171000	0.68590	0.460000	0.39030	CTC	.	.		0.637	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
VAMP2	6844	hgsc.bcm.edu	37	17	8064968	8064968	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:8064968G>A	ENST00000316509.6	-	3	335	c.240C>T	c.(238-240)agC>agT	p.S80S	VAMP2_ENST00000404970.3_Silent_p.S35S|VAMP2_ENST00000481878.1_Silent_p.S80S|VAMP2_ENST00000488857.1_Silent_p.S82S|RP11-599B13.6_ENST00000498285.1_Silent_p.S80S	NM_014232.2	NP_055047.2	P63027	VAMP2_HUMAN	vesicle-associated membrane protein 2 (synaptobrevin 2)	80	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|exocytosis (GO:0006887)|glutamate secretion (GO:0014047)|membrane organization (GO:0061024)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|SNARE complex (GO:0031201)|synaptic vesicle (GO:0008021)	calcium-dependent protein binding (GO:0048306)|protein self-association (GO:0043621)									Botulinum Toxin Type B(DB00042)	GCTTGGCTGCGCTTGTTTCAA	0.567																																					p.S80S		Atlas-SNP	.											VAMP2,colon,carcinoma,0,1	VAMP2	5	.	0			c.C240T						.						129.0	123.0	125.0					17																	8064968		2203	4300	6503	SO:0001819	synonymous_variant	6844	exon3			GGCTGCGCTTGTT		CCDS32561.1	17p13.1	2013-09-19			ENSG00000220205	ENSG00000220205		"""Vesicle-associated membrane proteins"""	12643	protein-coding gene	gene with protein product		185881		SYB2		1976629	Standard	NM_014232		Approved	VAMP-2	uc010cnt.1	P63027	OTTHUMG00000150254	ENST00000316509.6:c.240C>T	chr17.hg19:g.8064968G>A		138.0	0.0		130.0	13.0	NM_014232	P19065|Q9BUC2	Silent	SNP	ENST00000316509.6	hg19	CCDS32561.1																																																																																			.	.		0.567	VAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317118.1		
MYH10	4628	hgsc.bcm.edu	37	17	8393813	8393813	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:8393813T>C	ENST00000269243.4	-	33	4774	c.4636A>G	c.(4636-4638)Acc>Gcc	p.T1546A	MYH10_ENST00000360416.3_Missense_Mutation_p.T1577A|MYH10_ENST00000396239.1_Missense_Mutation_p.T1567A|MYH10_ENST00000379980.4_Missense_Mutation_p.T1562A	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1546					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						TCCAGCTGGGTCCTCATTTCC	0.557																																					p.T1577A		Atlas-SNP	.											.	MYH10	148	.	0			c.A4729G						.						121.0	109.0	113.0					17																	8393813		2203	4300	6503	SO:0001583	missense	4628	exon35			GCTGGGTCCTCAT	M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4636A>G	chr17.hg19:g.8393813T>C	ENSP00000269243:p.Thr1546Ala	179.0	0.0		182.0	8.0	NM_001256012	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	ENST00000269243.4	hg19	CCDS11144.1	.	.	.	.	.	.	.	.	.	.	T	14.87	2.664519	0.47572	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;D;T;T	0.82255	-1.59;-1.59;-0.95;-0.95	4.56	4.56	0.56223	Myosin tail (1);	0.000000	0.85682	D	0.000000	T	0.72358	0.3450	N	0.21373	0.66	0.58432	D	0.999999	B;B;B	0.17038	0.02;0.001;0.02	B;B;B	0.25405	0.06;0.017;0.06	T	0.66221	-0.5978	10	0.14252	T	0.57	.	14.3574	0.66748	0.0:0.0:0.0:1.0	.	1555;1577;1546	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	A	1546;1577;1567;1562	ENSP00000269243:T1546A;ENSP00000353590:T1577A;ENSP00000379539:T1567A;ENSP00000369315:T1562A	ENSP00000269243:T1546A	T	-	1	0	MYH10	8334538	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.067000	0.71193	2.037000	0.60232	0.533000	0.62120	ACC	.	.		0.557	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000227001.2		
NT5M	56953	hgsc.bcm.edu	37	17	17250185	17250185	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:17250185T>C	ENST00000389022.4	+	5	827	c.611T>C	c.(610-612)cTg>cCg	p.L204P	NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial	204					dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)	p.L204P(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CACCTGCAGCTGCAGCCCCCC	0.672																																					p.L204P		Atlas-SNP	.											NT5M,NS,carcinoma,0,1	NT5M	17	.	1	Substitution - Missense(1)	kidney(1)	c.T611C						.						30.0	36.0	34.0					17																	17250185		2202	4298	6500	SO:0001583	missense	56953	exon5			TGCAGCTGCAGCC	AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.611T>C	chr17.hg19:g.17250185T>C	ENSP00000373674:p.Leu204Pro	90.0	0.0		107.0	5.0	NM_020201		Missense_Mutation	SNP	ENST00000389022.4	hg19	CCDS32581.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.08|17.08	3.297044|3.297044	0.60086|0.60086	.|.	.|.	ENSG00000205309|ENSG00000205309	ENST00000446264|ENST00000389022	.|T	.|0.49139	.|0.79	5.79|5.79	4.72|4.72	0.59763|0.59763	.|HAD-like domain (2);	0.043809|.	0.85682|.	D|.	0.000000|.	T|T	0.48660|0.48660	0.1512|0.1512	M|M	0.61703|0.61703	1.905|1.905	0.47214|0.47214	D|D	0.999351|0.999351	B|B;B	0.32350|0.28439	0.366|0.212;0.212	B|B;B	0.27796|0.36030	0.083|0.216;0.216	T|T	0.52230|0.52230	-0.8603|-0.8603	9|9	0.72032|0.54805	D|T	0.01|0.06	-30.5484|-30.5484	10.2483|10.2483	0.43354|0.43354	0.0:0.0778:0.0:0.9222|0.0:0.0778:0.0:0.9222	.|.	203|210;204	F6S3X3|Q2I378;Q9NPB1	.|.;NT5M_HUMAN	R|P	203|204	.|ENSP00000373674:L204P	ENSP00000390695:C203R|ENSP00000373674:L204P	C|L	+|+	1|2	0|0	NT5M|NT5M	17190910|17190910	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.892000|0.892000	0.51952|0.51952	3.300000|3.300000	0.51834|0.51834	2.203000|2.203000	0.70933|0.70933	0.459000|0.459000	0.35465|0.35465	TGC|CTG	.	.		0.672	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446045.1		
KIAA0100	9703	hgsc.bcm.edu	37	17	26961916	26961916	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:26961916T>C	ENST00000528896.2	-	16	2763	c.2689A>G	c.(2689-2691)Atg>Gtg	p.M897V	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.M754V|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.M754V	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	897						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TCATCCTTCATCAGCTCGTAG	0.478																																					p.M897V		Atlas-SNP	.											.	KIAA0100	175	.	0			c.A2689G						.						219.0	239.0	232.0					17																	26961916		2203	4300	6503	SO:0001583	missense	9703	exon16			CCTTCATCAGCTC	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2689A>G	chr17.hg19:g.26961916T>C	ENSP00000436773:p.Met897Val	116.0	0.0		80.0	36.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.493281	0.64186	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.24350	1.86;1.86	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.45856	0.1363	M	0.61703	1.905	0.80722	D	1	P	0.49447	0.924	P	0.60682	0.878	T	0.18178	-1.0345	10	0.30854	T	0.27	.	16.2996	0.82804	0.0:0.0:0.0:1.0	.	897	Q14667	K0100_HUMAN	V	897;867;897;754	ENSP00000436773:M897V;ENSP00000446443:M754V	ENSP00000005905:M897V	M	-	1	0	KIAA0100	23986043	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.828000	0.69307	2.252000	0.74401	0.455000	0.32223	ATG	.	.		0.478	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KIAA0100	9703	hgsc.bcm.edu	37	17	26961957	26961957	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:26961957T>C	ENST00000528896.2	-	16	2722	c.2648A>G	c.(2647-2649)gAt>gGt	p.D883G	RP11-192H23.7_ENST00000577814.1_RNA|KIAA0100_ENST00000544884.1_Missense_Mutation_p.D740G|RP11-192H23.7_ENST00000583787.1_RNA|KIAA0100_ENST00000389003.3_Missense_Mutation_p.D740G	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	883						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					AAAAACATCATCCAAGAAAAC	0.473																																					p.D883G		Atlas-SNP	.											.	KIAA0100	175	.	0			c.A2648G						.						184.0	201.0	195.0					17																	26961957		2203	4300	6503	SO:0001583	missense	9703	exon16			ACATCATCCAAGA	D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.2648A>G	chr17.hg19:g.26961957T>C	ENSP00000436773:p.Asp883Gly	87.0	0.0		69.0	5.0	NM_014680	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Missense_Mutation	SNP	ENST00000528896.2	hg19	CCDS32595.1	.	.	.	.	.	.	.	.	.	.	T	19.99	3.928545	0.73327	.	.	ENSG00000007202	ENST00000005905;ENST00000389003;ENST00000528896;ENST00000544884	T;T	0.75050	-0.9;-0.79	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	D	0.85982	0.5824	M	0.76170	2.325	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.87526	0.2449	10	0.87932	D	0	.	16.2996	0.82804	0.0:0.0:0.0:1.0	.	883	Q14667	K0100_HUMAN	G	883;853;883;740	ENSP00000436773:D883G;ENSP00000446443:D740G	ENSP00000005905:D883G	D	-	2	0	KIAA0100	23986084	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.554000	0.82212	2.252000	0.74401	0.455000	0.32223	GAT	.	.		0.473	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390571.3	NM_014680	
KRT40	125115	hgsc.bcm.edu	37	17	39140493	39140493	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:39140493A>G	ENST00000398486.2	-	3	193	c.33T>C	c.(31-33)tcT>tcC	p.S11S	KRT40_ENST00000377755.4_Silent_p.S11S	NM_182497.3	NP_872303.2	Q6A162	K1C40_HUMAN	keratin 40	11	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)	9		Breast(137;0.00043)				AGGACTCAGGAGAGCAGTGTG	0.547																																					p.S11S		Atlas-SNP	.											.	KRT40	27	.	0			c.T33C						.						33.0	42.0	39.0					17																	39140493		2083	4224	6307	SO:0001819	synonymous_variant	125115	exon3			CTCAGGAGAGCAG	AK093919	CCDS42320.1	17q21.2	2013-01-16			ENSG00000204889	ENSG00000204889		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	26707	protein-coding gene	gene with protein product						16831889	Standard	NM_182497		Approved	FLJ36600, KA36	uc010cxh.1	Q6A162	OTTHUMG00000133596	ENST00000398486.2:c.33T>C	chr17.hg19:g.39140493A>G		60.0	0.0		102.0	5.0	NM_182497	Q6IFU5	Silent	SNP	ENST00000398486.2	hg19	CCDS42320.1																																																																																			.	.		0.547	KRT40-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257701.3	NM_182497	
EFTUD2	9343	hgsc.bcm.edu	37	17	42964105	42964105	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:42964105T>C	ENST00000426333.2	-	3	416	c.119A>G	c.(118-120)gAc>gGc	p.D40G	RN7SL405P_ENST00000582502.1_RNA|EFTUD2_ENST00000592576.1_Missense_Mutation_p.D40G|EFTUD2_ENST00000591382.1_Missense_Mutation_p.D40G|EFTUD2_ENST00000402521.3_Missense_Mutation_p.D5G|EFTUD2_ENST00000589211.1_5'UTR	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	40					gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				atcgtcgtcgtcatcatcatc	0.517																																					p.D40G	Ovarian(10;65 485 10258 29980 30707)	Atlas-SNP	.											.	EFTUD2	85	.	0			c.A119G						.						124.0	80.0	95.0					17																	42964105		2203	4300	6503	SO:0001583	missense	9343	exon3			TCGTCGTCATCAT	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.119A>G	chr17.hg19:g.42964105T>C	ENSP00000392094:p.Asp40Gly	105.0	0.0		121.0	6.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	hg19	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	T	16.73	3.204630	0.58234	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.72167	-0.57;-0.63	5.87	5.87	0.94306	.	0.305751	0.38272	N	0.001744	T	0.62962	0.2471	L	0.35723	1.085	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.57236	-0.7846	10	0.34782	T	0.22	.	16.2742	0.82636	0.0:0.0:0.0:1.0	.	40;40	B4DMC0;Q15029	.;U5S1_HUMAN	G	40;40;5	ENSP00000392094:D40G;ENSP00000385873:D5G	ENSP00000262414:D40G	D	-	2	0	EFTUD2	40319631	1.000000	0.71417	0.153000	0.22517	0.626000	0.37791	7.642000	0.83385	2.253000	0.74438	0.533000	0.62120	GAC	.	.		0.517	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
HEXIM1	10614	hgsc.bcm.edu	37	17	43227633	43227633	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:43227633A>G	ENST00000332499.2	+	1	2950	c.1076A>G	c.(1075-1077)gAc>gGc	p.D359G	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	359					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AAGTTTGGAGACTAGACTGAA	0.517																																					p.D359G		Atlas-SNP	.											.	HEXIM1	25	.	0			c.A1076G						.						36.0	44.0	42.0					17																	43227633		2079	4166	6245	SO:0001583	missense	10614	exon1			TTGGAGACTAGAC	AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.1076A>G	chr17.hg19:g.43227633A>G	ENSP00000328773:p.Asp359Gly	70.0	0.0		85.0	4.0	NM_006460	B2R8Y5	Missense_Mutation	SNP	ENST00000332499.2	hg19	CCDS11495.1	.	.	.	.	.	.	.	.	.	.	A	19.26	3.793599	0.70452	.	.	ENSG00000186834	ENST00000332499	.	.	.	4.14	4.14	0.48551	.	0.101963	0.39475	N	0.001358	T	0.50616	0.1626	N	0.08118	0	0.37438	D	0.914297	D	0.71674	0.998	D	0.85130	0.997	T	0.62751	-0.6788	9	0.72032	D	0.01	.	10.6538	0.45663	1.0:0.0:0.0:0.0	.	359	O94992	HEXI1_HUMAN	G	359	.	ENSP00000328773:D359G	D	+	2	0	HEXIM1	40583416	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.622000	0.54217	1.747000	0.51819	0.459000	0.35465	GAC	.	.		0.517	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449821.2	NM_006460	
PHOSPHO1	162466	hgsc.bcm.edu	37	17	47304050	47304050	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:47304050T>C	ENST00000310544.4	-	2	131	c.4A>G	c.(4-6)Agt>Ggt	p.S2G	PHOSPHO1_ENST00000514112.1_5'UTR|PHOSPHO1_ENST00000413580.1_5'UTR			Q8TCT1	PHOP1_HUMAN	phosphatase, orphan 1	2					bone mineralization involved in bone maturation (GO:0035630)|dephosphorylation (GO:0016311)|endochondral ossification (GO:0001958)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|regulation of bone mineralization (GO:0030500)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|phosphocholine phosphatase activity (GO:0052731)|phosphoethanolamine phosphatase activity (GO:0052732)|pyrophosphatase activity (GO:0016462)							Epithelial(5;8.1e-06)|all cancers(6;7.71e-05)		Choline(DB00122)	AAACAGCCACTCATTGTCGGT	0.562																																					p.S2G		Atlas-SNP	.											.	PHOSPHO1	7	.	0			c.A4G						.						116.0	104.0	108.0					17																	47304050		2203	4300	6503	SO:0001583	missense	162466	exon2			AGCCACTCATTGT	AJ457189	CCDS11547.1, CCDS45726.1	17q21.32	2008-05-02				ENSG00000173868			16815	protein-coding gene	gene with protein product						12464021	Standard	NM_178500		Approved		uc010wlv.1	Q8TCT1		ENST00000310544.4:c.4A>G	chr17.hg19:g.47304050T>C	ENSP00000311925:p.Ser2Gly	54.0	0.0		115.0	5.0	NM_178500	E9PAM0|Q17RU6	Missense_Mutation	SNP	ENST00000310544.4	hg19	CCDS11547.1	.	.	.	.	.	.	.	.	.	.	T	12.68	2.011403	0.35511	.	.	ENSG00000173868	ENST00000310544;ENST00000511066;ENST00000503902	T	0.43688	0.94	4.92	4.92	0.64577	.	0.349141	0.33419	N	0.004940	T	0.27134	0.0665	N	0.14661	0.345	0.80722	D	1	B	0.20887	0.049	B	0.22386	0.039	T	0.09058	-1.0692	10	0.54805	T	0.06	.	10.8726	0.46891	0.0:0.0:0.0:1.0	.	2	Q8TCT1	PHOP1_HUMAN	G	2	ENSP00000311925:S2G	ENSP00000311925:S2G	S	-	1	0	PHOSPHO1	44659049	0.996000	0.38824	1.000000	0.80357	0.811000	0.45836	3.432000	0.52824	2.071000	0.62044	0.459000	0.35465	AGT	.	.		0.562	PHOSPHO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364467.2		
TEX14	56155	hgsc.bcm.edu	37	17	56692692	56692692	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:56692692C>T	ENST00000240361.8	-	8	885	c.800G>A	c.(799-801)gGg>gAg	p.G267E	TEX14_ENST00000349033.5_Missense_Mutation_p.G261E|TEX14_ENST00000389934.3_Missense_Mutation_p.G261E			Q8IWB6	TEX14_HUMAN	testis expressed 14	267	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				attachment of spindle microtubules to kinetochore (GO:0008608)|intercellular bridge organization (GO:0043063)|male meiosis (GO:0007140)|mitotic sister chromatid separation (GO:0051306)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)	cell (GO:0005623)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|kinetochore (GO:0000776)|midbody (GO:0030496)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)			breast(6)|endometrium(5)|kidney(3)|large_intestine(22)|liver(1)|lung(24)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	81	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GACCCTGCTCCCATTCCACAC	0.532																																					p.G267E		Atlas-SNP	.											.	TEX14	343	.	0			c.G800A						.						96.0	83.0	87.0					17																	56692692		2203	4300	6503	SO:0001583	missense	56155	exon8			CTGCTCCCATTCC	AF285601	CCDS32692.1, CCDS32693.1, CCDS56042.1	17q22	2013-09-20	2007-03-13		ENSG00000121101	ENSG00000121101			11737	protein-coding gene	gene with protein product	"""cancer/testis antigen 113"""	605792	"""testis expressed sequence 14"""			11279525, 12711554	Standard	NM_031272		Approved	CT113	uc010dcz.2	Q8IWB6	OTTHUMG00000179245	ENST00000240361.8:c.800G>A	chr17.hg19:g.56692692C>T	ENSP00000240361:p.Gly267Glu	92.0	0.0		120.0	5.0	NM_001201457	A6NH19|Q7RTP3|Q8ND97|Q9BXT9	Missense_Mutation	SNP	ENST00000240361.8	hg19	CCDS56042.1	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255705	0.59321	.	.	ENSG00000121101	ENST00000240361;ENST00000389934;ENST00000349033	T;T;T	0.53640	0.61;0.61;0.61	5.58	5.58	0.84498	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.156845	0.45867	D	0.000323	T	0.65015	0.2651	M	0.73753	2.245	0.28585	N	0.909916	D;D;D	0.67145	0.996;0.973;0.991	D;P;P	0.64877	0.93;0.885;0.885	T	0.64385	-0.6420	10	0.72032	D	0.01	-20.4935	11.5868	0.50923	0.0:0.9182:0.0:0.0818	.	267;261;261	Q8IWB6;Q8IWB6-3;Q8IWB6-2	TEX14_HUMAN;.;.	E	267;261;261	ENSP00000240361:G267E;ENSP00000374584:G261E;ENSP00000268910:G261E	ENSP00000240361:G267E	G	-	2	0	TEX14	54047691	0.998000	0.40836	0.996000	0.52242	0.282000	0.26991	3.458000	0.53014	2.646000	0.89796	0.561000	0.74099	GGG	.	.		0.532	TEX14-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000445446.1		
CACNG4	27092	hgsc.bcm.edu	37	17	65026831	65026831	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:65026831G>A	ENST00000262138.3	+	4	697	c.695G>A	c.(694-696)aGg>aAg	p.R232K	AC005544.1_ENST00000375684.1_5'Flank|RP11-74H8.1_ENST00000579138.1_RNA	NM_014405.3	NP_055220.1	Q9UBN1	CCG4_HUMAN	calcium channel, voltage-dependent, gamma subunit 4	232					membrane depolarization (GO:0051899)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)|transmission of nerve impulse (GO:0019226)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(3)	19	all_cancers(12;9.86e-11)		BRCA - Breast invasive adenocarcinoma(6;1.35e-07)			CCTTATGCCAGGATGCCGAGC	0.552																																					p.R232K		Atlas-SNP	.											.	CACNG4	44	.	0			c.G695A						.						73.0	77.0	76.0					17																	65026831		2203	4300	6503	SO:0001583	missense	27092	exon4			ATGCCAGGATGCC	AH008289	CCDS11667.1	17q24	2006-01-23				ENSG00000075461		"""Calcium channel subunits"""	1408	protein-coding gene	gene with protein product		606404				10613843	Standard	NM_014405		Approved	MGC11138, MGC24983	uc002jft.2	Q9UBN1		ENST00000262138.3:c.695G>A	chr17.hg19:g.65026831G>A	ENSP00000262138:p.Arg232Lys	149.0	0.0		173.0	68.0	NM_014405	B2RCK0	Missense_Mutation	SNP	ENST00000262138.3	hg19	CCDS11667.1	.	.	.	.	.	.	.	.	.	.	G	24.5	4.537970	0.85917	.	.	ENSG00000075461	ENST00000262138	T	0.58060	0.36	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.79123	2.44	0.80722	D	1	D	0.58268	0.982	B	0.44315	0.446	T	0.59815	-0.7383	10	0.11485	T	0.65	-0.0339	18.0456	0.89331	0.0:0.0:1.0:0.0	.	232	Q9UBN1	CCG4_HUMAN	K	232	ENSP00000262138:R232K	ENSP00000262138:R232K	R	+	2	0	CACNG4	62457293	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.319000	0.96338	2.274000	0.75844	0.556000	0.70494	AGG	.	.		0.552	CACNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447036.1	NM_014405	
AMZ2	51321	hgsc.bcm.edu	37	17	66246396	66246396	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:66246396T>C	ENST00000359904.3	+	2	1200	c.68T>C	c.(67-69)gTa>gCa	p.V23A	AMZ2_ENST00000585050.1_Intron|AMZ2_ENST00000577866.1_Missense_Mutation_p.V23A|AMZ2_ENST00000577985.1_Missense_Mutation_p.V23A|AMZ2_ENST00000580753.1_Missense_Mutation_p.V23A|AMZ2_ENST00000577273.1_Missense_Mutation_p.V23A|AMZ2_ENST00000392720.2_Missense_Mutation_p.V23A|RP11-147L13.2_ENST00000577698.1_RNA|AMZ2_ENST00000359783.4_Missense_Mutation_p.V23A	NM_016627.4	NP_057711.3	Q86W34	AMZ2_HUMAN	archaelysin family metallopeptidase 2	23							metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(3)	9	all_cancers(12;1.12e-09)		BRCA - Breast invasive adenocarcinoma(8;3.17e-08)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCAGTGCTTGTATCACAGTAT	0.388																																					p.V23A		Atlas-SNP	.											.	AMZ2	15	.	0			c.T68C						.						111.0	110.0	110.0					17																	66246396		2203	4300	6503	SO:0001583	missense	51321	exon2			TGCTTGTATCACA	CR609550	CCDS11674.1, CCDS32714.1	17q24.2	2010-04-08			ENSG00000196704	ENSG00000196704			28041	protein-coding gene	gene with protein product	"""archaemetzincin-2"""	615169				15972818	Standard	XM_005257436		Approved		uc002jgr.1	Q86W34		ENST00000359904.3:c.68T>C	chr17.hg19:g.66246396T>C	ENSP00000352976:p.Val23Ala	80.0	0.0		90.0	4.0	NM_001033574	A6NLD9|B3KR44|Q5XKF1|Q9NZE2	Missense_Mutation	SNP	ENST00000359904.3	hg19	CCDS11674.1	.	.	.	.	.	.	.	.	.	.	T	5.734	0.319854	0.10845	.	.	ENSG00000196704	ENST00000359904;ENST00000359783;ENST00000392720	T;T;T	0.18810	2.19;2.19;2.19	3.58	2.5	0.30297	.	0.091982	0.42821	D	0.000644	T	0.13286	0.0322	L	0.45137	1.4	0.09310	N	1	B;B	0.29188	0.236;0.132	B;B	0.24848	0.056;0.017	T	0.11012	-1.0605	10	0.38643	T	0.18	-15.743	2.631	0.04945	0.2295:0.1264:0.0:0.6441	.	23;23	A6NLD9;Q86W34	.;AMZ2_HUMAN	A	23	ENSP00000352976:V23A;ENSP00000352831:V23A;ENSP00000376481:V23A	ENSP00000352831:V23A	V	+	2	0	AMZ2	63757991	0.059000	0.20769	0.013000	0.15412	0.715000	0.41141	1.102000	0.31050	1.619000	0.50296	0.254000	0.18369	GTA	.	.		0.388	AMZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448261.1	NM_016627	
DNAH17	8632	hgsc.bcm.edu	37	17	76472713	76472713	+	Nonsense_Mutation	SNP	C	C	A	rs116230343	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:76472713C>A	ENST00000585328.1	-	52	8204	c.8080G>T	c.(8080-8082)Gaa>Taa	p.E2694*	DNAH17_ENST00000389840.5_Nonsense_Mutation_p.E2685*|DNAH17_ENST00000586052.1_Intron	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2685					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TGGTCTTTTTCGTCAACCATT	0.488																																					p.E2699X		Atlas-SNP	.											.	DNAH17	347	.	0			c.G8095T						.						156.0	177.0	170.0					17																	76472713		2014	4177	6191	SO:0001587	stop_gained	8632	exon52			CTTTTTCGTCAAC	AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.8080G>T	chr17.hg19:g.76472713C>A	ENSP00000465516:p.Glu2694*	279.0	0.0		513.0	297.0	NM_173628	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Nonsense_Mutation	SNP	ENST00000585328.1	hg19		.	.	.	.	.	.	.	.	.	.	C	49	15.769301	0.99844	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	.	.	.	4.64	2.47	0.30058	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15066	T	0.55	.	8.0951	0.30824	0.0:0.6116:0.3066:0.0818	.	.	.	.	X	2694;2685	.	ENSP00000300671:E2694X	E	-	1	0	DNAH17	73984308	0.408000	0.25360	0.141000	0.22245	0.808000	0.45660	1.708000	0.37899	0.935000	0.37341	0.455000	0.32223	GAA	.	C|0.986;T|0.014		0.488	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000318962.2	NM_173628	
CARD14	79092	hgsc.bcm.edu	37	17	78180851	78180851	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:78180851T>C	ENST00000573882.1	+	22	3310	c.2774T>C	c.(2773-2775)gTc>gCc	p.V925A	CARD14_ENST00000344227.2_Missense_Mutation_p.V925A|RP11-334C17.5_ENST00000572730.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA|RP11-334C17.5_ENST00000570309.1_RNA|RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000573346.1_RNA			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	925	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GTCATCCACGTCTCTGTCAAC	0.612																																					p.V925A		Atlas-SNP	.											.	CARD14	98	.	0			c.T2774C						.						129.0	98.0	108.0					17																	78180851		2203	4299	6502	SO:0001583	missense	79092	exon20			TCCACGTCTCTGT	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2774T>C	chr17.hg19:g.78180851T>C	ENSP00000458715:p.Val925Ala	78.0	0.0		136.0	8.0	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	T	12.05	1.820897	0.32237	.	.	ENSG00000141527	ENST00000344227	T	0.20200	2.09	4.93	4.93	0.64822	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (1);	0.311068	0.31760	N	0.007114	T	0.23330	0.0564	L	0.61218	1.895	0.80722	D	1	B	0.32918	0.39	B	0.29862	0.108	T	0.05305	-1.0893	10	0.87932	D	0	-16.9294	12.5224	0.56067	0.0:0.0:0.0:1.0	.	925	Q9BXL6	CAR14_HUMAN	A	925	ENSP00000344549:V925A	ENSP00000344549:V925A	V	+	2	0	CARD14	75795446	0.650000	0.27331	0.025000	0.17156	0.024000	0.10985	5.939000	0.70179	1.848000	0.53677	0.402000	0.26972	GTC	.	.		0.612	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
SMCHD1	23347	hgsc.bcm.edu	37	18	2728514	2728514	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:2728514A>G	ENST00000320876.6	+	23	3171	c.2833A>G	c.(2833-2835)Aca>Gca	p.T945A	SMCHD1_ENST00000609587.1_3'UTR|RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.T945A	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	945					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						AGAAAATGGAACAGCTTTCCC	0.333																																					p.T945A		Atlas-SNP	.											.	SMCHD1	88	.	0			c.A2833G						.						92.0	87.0	89.0					18																	2728514		1831	4082	5913	SO:0001583	missense	23347	exon23			AATGGAACAGCTT	AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2833A>G	chr18.hg19:g.2728514A>G	ENSP00000326603:p.Thr945Ala	74.0	0.0		65.0	4.0	NM_015295	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	ENST00000320876.6	hg19	CCDS45822.1	.	.	.	.	.	.	.	.	.	.	A	14.72	2.619764	0.46736	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.23552	1.9;1.9	5.84	5.84	0.93424	.	0.166789	0.52532	D	0.000069	T	0.21631	0.0521	L	0.50333	1.59	0.30633	N	0.757275	P	0.44006	0.824	B	0.34418	0.182	T	0.34551	-0.9824	10	0.54805	T	0.06	-18.768	11.29	0.49245	0.9295:0.0:0.0705:0.0	.	945	A6NHR9	SMHD1_HUMAN	A	945	ENSP00000326603:T945A;ENSP00000261598:T945A	ENSP00000261598:T945A	T	+	1	0	SMCHD1	2718514	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.074000	0.57577	2.230000	0.72887	0.528000	0.53228	ACA	.	.		0.333	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441082.2		
RBBP8	5932	hgsc.bcm.edu	37	18	20573440	20573440	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:20573440A>G	ENST00000399722.2	+	11	2001	c.1650A>G	c.(1648-1650)ccA>ccG	p.P550P	RBBP8_ENST00000399725.2_Silent_p.P550P|RBBP8_ENST00000360790.5_Silent_p.P550P|RBBP8_ENST00000327155.5_Silent_p.P550P	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	550	Damage-recruitment motif.				blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AAGATTCCCCAGGGGAGCCCT	0.458								Homologous recombination																													p.P550P		Atlas-SNP	.											.	RBBP8	138	.	0			c.A1650G						.						43.0	44.0	44.0					18																	20573440		2202	4299	6501	SO:0001819	synonymous_variant	5932	exon11			TTCCCCAGGGGAG	AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.1650A>G	chr18.hg19:g.20573440A>G		90.0	0.0		91.0	4.0	NM_203292	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Silent	SNP	ENST00000399722.2	hg19	CCDS11875.1																																																																																			.	.		0.458	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446387.1	NM_203291	
GAREM	64762	hgsc.bcm.edu	37	18	29867200	29867200	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:29867200C>T	ENST00000269209.6	-	4	1363	c.1360G>A	c.(1360-1362)Gaa>Aaa	p.E454K	RP11-344B2.2_ENST00000579580.1_RNA|GAREM_ENST00000399218.4_Missense_Mutation_p.E454K|GAREM_ENST00000578619.1_5'Flank			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	454					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										CACAGCTCTTCGTAGGGAAGT	0.537																																					p.E454K		Atlas-SNP	.											.	.	.	.	0			c.G1360A						.						97.0	99.0	98.0					18																	29867200		2203	4300	6503	SO:0001583	missense	64762	exon4			GCTCTTCGTAGGG	AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.1360G>A	chr18.hg19:g.29867200C>T	ENSP00000269209:p.Glu454Lys	86.0	0.0		103.0	12.0	NM_022751	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Missense_Mutation	SNP	ENST00000269209.6	hg19	CCDS56057.1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480505	0.84747	.	.	ENSG00000141441	ENST00000399218;ENST00000269209	T;T	0.33438	1.41;1.41	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.44603	0.1301	L	0.43152	1.355	0.80722	D	1	D;D	0.63880	0.982;0.993	B;P	0.56823	0.383;0.807	T	0.25745	-1.0123	10	0.54805	T	0.06	-21.1773	19.0993	0.93268	0.0:1.0:0.0:0.0	.	454;454	Q9H706;Q9H706-3	FA59A_HUMAN;.	K	454	ENSP00000382165:E454K;ENSP00000269209:E454K	ENSP00000269209:E454K	E	-	1	0	FAM59A	28121198	1.000000	0.71417	0.975000	0.42487	0.741000	0.42261	7.220000	0.78008	2.821000	0.97095	0.561000	0.74099	GAA	.	.		0.537	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255365.1	NM_022751	
DTNA	1837	hgsc.bcm.edu	37	18	32428290	32428290	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:32428290A>G	ENST00000399113.3	+	13	1296	c.1296A>G	c.(1294-1296)gaA>gaG	p.E432E	DTNA_ENST00000597674.1_Silent_p.E54E|DTNA_ENST00000399121.5_Silent_p.E372E|DTNA_ENST00000601125.1_Silent_p.E54E|DTNA_ENST00000595022.1_Silent_p.E372E|DTNA_ENST00000591182.1_Silent_p.E80E|DTNA_ENST00000283365.9_Silent_p.E375E|DTNA_ENST00000598334.1_Silent_p.E372E|DTNA_ENST00000269192.7_Silent_p.E141E|DTNA_ENST00000598774.1_Silent_p.E375E|DTNA_ENST00000556414.3_Silent_p.E84E|DTNA_ENST00000348997.5_Silent_p.E429E|DTNA_ENST00000269191.6_Silent_p.E432E|DTNA_ENST00000599844.1_Silent_p.E54E|DTNA_ENST00000399097.3_Silent_p.E80E|DTNA_ENST00000597599.1_Silent_p.E372E|DTNA_ENST00000444659.1_Silent_p.E432E|DTNA_ENST00000596745.1_Intron|DTNA_ENST00000598142.1_Silent_p.E375E|DTNA_ENST00000269190.7_Silent_p.E433E			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	432	Syntrophin-binding region.				neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						GGCTTGATGAAGAACACAGGC	0.463																																					p.E432E		Atlas-SNP	.											.	DTNA	321	.	0			c.A1296G						.						101.0	94.0	96.0					18																	32428290		2203	4300	6503	SO:0001819	synonymous_variant	1837	exon13			TGATGAAGAACAC	U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1296A>G	chr18.hg19:g.32428290A>G		96.0	0.0		105.0	5.0	NM_001390	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Silent	SNP	ENST00000399113.3	hg19	CCDS59311.1																																																																																			.	.		0.463	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255422.2	NM_001390	
ZNF24	7572	hgsc.bcm.edu	37	18	32920511	32920512	+	Nonsense_Mutation	DNP	TC	TC	CA			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T|C	T|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:32920511_32920512TC>CA	ENST00000261332.6	-	2	282_283	c.103_104GA>TG	c.(103-105)GAa>TGa	p.E35*	ZNF24_ENST00000589881.1_Nonsense_Mutation_p.E35*|ZNF24_ENST00000399061.3_Nonsense_Mutation_p.E35*	NM_006965.2	NP_008896.2	P17028	ZNF24_HUMAN	zinc finger protein 24	35					myelination (GO:0042552)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	15						TGATCCCTCTTCGCCATCAGGA	0.495																																					p.E35G|p.E35X	Colon(42;769 913 8916 19469 46270)	Atlas-SNP	.											.	ZNF24	40	.	0			c.A104G|c.G103T						.																																			SO:0001587	stop_gained	7572	exon2			CCCTCTTCGCCAT|CCTCTTCGCCATC	AF016052	CCDS11912.1	18q12	2013-01-09	2006-05-10		ENSG00000172466	ENSG00000172466		"""-"", ""Zinc fingers, C2H2-type"""	13032	protein-coding gene	gene with protein product		194534	"""zinc finger protein 24 (KOX 17)"""	ZNF191			Standard	NM_006965		Approved	ZSCAN3, Zfp191, KOX17	uc002kys.2	P17028	OTTHUMG00000132565	ENST00000261332.6:c.103_104delinsCA	chr18.hg19:g.32920511_32920512delinsCA	ENSP00000261332:p.Glu35*	45.0	0.0		60.0|59.0	22.0|21.0	NM_006965	O14754|Q53YE4|Q6ICR5|Q8IZN4	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000261332.6	hg19	CCDS11912.1																																																																																			.	.		0.495	ZNF24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255769.1	NM_006965	
FHOD3	80206	hgsc.bcm.edu	37	18	34182680	34182680	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:34182680A>G	ENST00000359247.4	+	8	762	c.762A>G	c.(760-762)aaA>aaG	p.K254K	FHOD3_ENST00000590592.1_Silent_p.K254K|FHOD3_ENST00000591635.1_5'UTR|FHOD3_ENST00000257209.4_Silent_p.K254K|FHOD3_ENST00000445677.1_Silent_p.K254K	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	254	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGGAGGAAAAAGATGGAGTTG	0.368																																					p.K254K		Atlas-SNP	.											.	FHOD3	210	.	0			c.A762G						.						214.0	198.0	204.0					18																	34182680		2203	4300	6503	SO:0001819	synonymous_variant	80206	exon8			GGAAAAAGATGGA	AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.762A>G	chr18.hg19:g.34182680A>G		236.0	0.0		244.0	22.0	NM_025135	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Silent	SNP	ENST00000359247.4	hg19																																																																																				.	.		0.368	FHOD3-001	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460884.1	XM_371114	
EPG5	57724	hgsc.bcm.edu	37	18	43481064	43481064	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:43481064T>C	ENST00000282041.5	-	26	4577	c.4543A>G	c.(4543-4545)Acg>Gcg	p.T1515A	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1515					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						GGAGGCTTCGTCGGGTGCAGA	0.502																																					p.T1515A		Atlas-SNP	.											.	EPG5	199	.	0			c.A4543G						.						64.0	72.0	70.0					18																	43481064		2039	4173	6212	SO:0001583	missense	57724	exon26			GCTTCGTCGGGTG	AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4543A>G	chr18.hg19:g.43481064T>C	ENSP00000282041:p.Thr1515Ala	54.0	0.0		69.0	4.0	NM_020964	A2BDF3|Q9H8C8	Missense_Mutation	SNP	ENST00000282041.5	hg19	CCDS11926.2	.	.	.	.	.	.	.	.	.	.	T	0.556	-0.847236	0.02651	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	T	0.09538	2.97	5.59	-11.2	0.00127	.	.	.	.	.	T	0.03959	0.0111	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32107	-0.9919	9	0.11794	T	0.64	1.4365	7.6007	0.28075	0.1431:0.1185:0.0717:0.6668	.	1515	Q9HCE0	EPG5_HUMAN	A	1515;390	ENSP00000282041:T1515A	ENSP00000282041:T1515A	T	-	1	0	EPG5	41735062	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.313000	0.02718	-2.647000	0.00426	-2.026000	0.00426	ACG	.	.		0.502	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445081.1	NM_020964	
C18orf25	147339	hgsc.bcm.edu	37	18	43820148	43820148	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:43820148A>G	ENST00000282059.6	+	3	1267	c.893A>G	c.(892-894)gAg>gGg	p.E298G	C18orf25_ENST00000321319.6_Intron	NM_145055.3	NP_659492	Q96B23	CR025_HUMAN	chromosome 18 open reading frame 25	298										central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	11						CTGAATGCAGAGGCAGGTTGG	0.542																																					p.E298G		Atlas-SNP	.											.	C18orf25	27	.	0			c.A893G						.						33.0	34.0	34.0					18																	43820148		1974	4164	6138	SO:0001583	missense	147339	exon3			ATGCAGAGGCAGG	AL713661	CCDS42430.1, CCDS42431.1	18q21.1	2014-01-03			ENSG00000152242	ENSG00000152242			28172	protein-coding gene	gene with protein product	"""ARKadia-like 1"""					15722956	Standard	NM_001008239		Approved	MGC12909, ARKL1, RNF111L1	uc002lbw.3	Q96B23		ENST00000282059.6:c.893A>G	chr18.hg19:g.43820148A>G	ENSP00000282059:p.Glu298Gly	72.0	0.0		100.0	5.0	NM_145055	A8K123|A8KAB6|Q5XG78|Q6N058|Q86TB5|Q8TCQ5	Missense_Mutation	SNP	ENST00000282059.6	hg19	CCDS42430.1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499911	0.44455	.	.	ENSG00000152242	ENST00000282059	.	.	.	5.76	5.76	0.90799	.	0.435818	0.25363	N	0.031208	T	0.35941	0.0949	N	0.08118	0	0.80722	D	1	B	0.34290	0.447	B	0.33690	0.168	T	0.37361	-0.9709	9	0.51188	T	0.08	-9.3126	16.0843	0.81031	1.0:0.0:0.0:0.0	.	298	Q96B23	CR025_HUMAN	G	298	.	ENSP00000282059:E298G	E	+	2	0	C18orf25	42074146	1.000000	0.71417	1.000000	0.80357	0.805000	0.45488	6.278000	0.72614	2.191000	0.70037	0.533000	0.62120	GAG	.	.		0.542	C18orf25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445242.1	NM_145055	
LOXHD1	125336	hgsc.bcm.edu	37	18	44190737	44190737	+	Splice_Site	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:44190737A>G	ENST00000441551.2	-	6	759		c.e6+1		LOXHD1_ENST00000536736.1_Splice_Site			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1						calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						AGCTGAACTCACCTGGGACAG	0.547																																					.		Atlas-SNP	.											.	LOXHD1	367	.	0			c.759+2T>C						.						98.0	116.0	111.0					18																	44190737		692	1591	2283	SO:0001630	splice_region_variant	125336	exon7			GAACTCACCTGGG	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000441551.2:c.759+1T>C	chr18.hg19:g.44190737A>G		69.0	0.0		73.0	4.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Splice_Site	SNP	ENST00000441551.2	hg19		.	.	.	.	.	.	.	.	.	.	A	15.62	2.887914	0.52014	.	.	ENSG00000167210	ENST00000536736;ENST00000441551	.	.	.	5.7	5.7	0.88788	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.953	0.79859	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LOXHD1	42444735	1.000000	0.71417	0.991000	0.47740	0.541000	0.35023	6.623000	0.74238	2.174000	0.68829	0.383000	0.25322	.	.	.		0.547	LOXHD1-013	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000446054.1	NM_144612	Intron
DYM	54808	hgsc.bcm.edu	37	18	46798653	46798653	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:46798653A>G	ENST00000269445.6	-	11	1603	c.1146T>C	c.(1144-1146)atT>atC	p.I382I	DYM_ENST00000442713.2_Silent_p.I192I	NM_017653.3	NP_060123.3	Q7RTS9	DYM_HUMAN	dymeclin	382					bone development (GO:0060348)|Golgi organization (GO:0007030)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	enzyme binding (GO:0019899)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	18						CATGATACAGAATCTCAAGAA	0.294																																					p.I382I		Atlas-SNP	.											.	DYM	52	.	0			c.T1146C						.						72.0	68.0	70.0					18																	46798653		2203	4299	6502	SO:0001819	synonymous_variant	54808	exon11			ATACAGAATCTCA	AK000078	CCDS11937.1	18q21.1	2008-03-12			ENSG00000141627	ENSG00000141627			21317	protein-coding gene	gene with protein product		607461					Standard	NM_017653		Approved	FLJ20071, DMC, SMC	uc002ldi.1	Q7RTS9	OTTHUMG00000132659	ENST00000269445.6:c.1146T>C	chr18.hg19:g.46798653A>G		128.0	0.0		99.0	4.0	NM_017653	A8K5I8|B2RCF9|B4DKI7|Q3ZTS8|Q6P2P5|Q8N2M0|Q9BVE9|Q9NPU7	Silent	SNP	ENST00000269445.6	hg19	CCDS11937.1																																																																																			.	.		0.294	DYM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255912.3	NM_017653	
CDH7	1005	hgsc.bcm.edu	37	18	63525083	63525083	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr18:63525083A>G	ENST00000397968.2	+	8	1693	c.1267A>G	c.(1267-1269)Aga>Gga	p.R423G	CDH7_ENST00000323011.3_Missense_Mutation_p.R423G|CDH7_ENST00000536984.2_Missense_Mutation_p.R423G	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	423	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				AGACTTGGAGAGATACTTCAA	0.368																																					p.R423G		Atlas-SNP	.											.	CDH7	362	.	0			c.A1267G						.						140.0	128.0	132.0					18																	63525083		2203	4300	6503	SO:0001583	missense	1005	exon8			TTGGAGAGATACT	AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.1267A>G	chr18.hg19:g.63525083A>G	ENSP00000381058:p.Arg423Gly	78.0	0.0		93.0	4.0	NM_004361	Q9H157	Missense_Mutation	SNP	ENST00000397968.2	hg19	CCDS11993.1	.	.	.	.	.	.	.	.	.	.	A	18.01	3.526825	0.64860	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.49432	0.78;0.78;0.78	4.42	4.42	0.53409	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.53045	0.1772	L	0.31926	0.97	0.58432	D	0.999999	D;D	0.62365	0.991;0.969	P;P	0.59825	0.864;0.65	T	0.56353	-0.7993	10	0.56958	D	0.05	.	14.1166	0.65159	1.0:0.0:0.0:0.0	.	423;423	F5H5X9;Q9ULB5	.;CADH7_HUMAN	G	423	ENSP00000319166:R423G;ENSP00000443030:R423G;ENSP00000381058:R423G	ENSP00000319166:R423G	R	+	1	2	CDH7	61676063	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.884000	0.48562	1.990000	0.58119	0.454000	0.30748	AGA	.	.		0.368	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256217.2	NM_033646	
APC2	10297	hgsc.bcm.edu	37	19	1469059	1469059	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:1469059A>G	ENST00000535453.1	+	14	7472	c.5759A>G	c.(5758-5760)cAg>cGg	p.Q1920R	APC2_ENST00000238483.4_Missense_Mutation_p.Q1646R|C19orf25_ENST00000588427.1_Intron|APC2_ENST00000233607.2_Missense_Mutation_p.Q1920R			P02655	APOC2_HUMAN	adenomatosis polyposis coli 2	0					cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|chylomicron remnant clearance (GO:0034382)|chylomicron remodeling (GO:0034371)|high-density lipoprotein particle clearance (GO:0034384)|lipid catabolic process (GO:0016042)|lipoprotein metabolic process (GO:0042157)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cholesterol transport (GO:0032375)|negative regulation of lipid metabolic process (GO:0045833)|negative regulation of receptor-mediated endocytosis (GO:0048261)|negative regulation of very-low-density lipoprotein particle clearance (GO:0010916)|phospholipid efflux (GO:0033700)|phototransduction, visible light (GO:0007603)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipid catabolic process (GO:0060697)|positive regulation of triglyceride catabolic process (GO:0010898)|positive regulation of very-low-density lipoprotein particle remodeling (GO:0010902)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|triglyceride-rich lipoprotein particle remodeling (GO:0034370)|very-low-density lipoprotein particle remodeling (GO:0034372)	chylomicron (GO:0042627)|early endosome (GO:0005769)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate-density lipoprotein particle (GO:0034363)|low-density lipoprotein particle (GO:0034362)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)	lipase inhibitor activity (GO:0055102)|lipid binding (GO:0008289)|lipoprotein lipase activator activity (GO:0060230)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|kidney(4)|large_intestine(2)|lung(5)|pancreas(1)|skin(2)	18		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGGCGAAGCAGCACAAGACG	0.761																																					p.Q1920R		Atlas-SNP	.											.	APC2	50	.	0			c.A5759G						.						2.0	2.0	2.0					19																	1469059		1302	3008	4310	SO:0001583	missense	10297	exon15			CGAAGCAGCACAA		CCDS12068.1	19p13.3	2013-02-14			ENSG00000115266	ENSG00000115266		"""Armadillo repeat containing"""	24036	protein-coding gene	gene with protein product	"""adenomatous polyposis coli like"""	612034				9823329, 10021369	Standard	XM_005259475		Approved	APCL	uc002lsr.1	O95996		ENST00000535453.1:c.5759A>G	chr19.hg19:g.1469059A>G	ENSP00000442954:p.Gln1920Arg	25.0	0.0		52.0	4.0	NM_005883	C0JYY4|Q9BS39|Q9UDE3|Q9UNK3	Missense_Mutation	SNP	ENST00000535453.1	hg19	CCDS12068.1	.	.	.	.	.	.	.	.	.	.	A	17.12	3.307691	0.60305	.	.	ENSG00000115266	ENST00000233607;ENST00000238483;ENST00000535453	D;D;D	0.83419	-1.72;-1.72;-1.72	3.9	2.86	0.33363	Adenomatous polyposis coli protein basic domain (1);	0.625158	0.13820	N	0.360516	T	0.76528	0.4000	L	0.50333	1.59	0.80722	D	1	P;P	0.37176	0.531;0.586	B;B	0.39531	0.201;0.302	T	0.68857	-0.5298	10	0.41790	T	0.15	-16.3218	4.169	0.10320	0.6251:0.2525:0.1224:0.0	.	1919;1920	O95996-3;O95996	.;APC2_HUMAN	R	1920;1646;1920	ENSP00000233607:Q1920R;ENSP00000238483:Q1646R;ENSP00000442954:Q1920R	ENSP00000233607:Q1920R	Q	+	2	0	APC2	1420059	0.699000	0.27786	0.999000	0.59377	0.894000	0.52154	1.878000	0.39608	0.420000	0.25954	0.418000	0.28097	CAG	.	.		0.761	APC2-004	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449539.2	NM_005883	
ATP8B3	148229	hgsc.bcm.edu	37	19	1791983	1791983	+	Intron	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:1791983T>C	ENST00000310127.6	-	19	2429				ATP8B3_ENST00000539485.1_Missense_Mutation_p.E736G|ATP8B3_ENST00000525591.1_Missense_Mutation_p.E689G	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGGTCCTGCTCCATCTCGTT	0.682																																					p.E689G		Atlas-SNP	.											.	ATP8B3	108	.	0			c.A2066G						.						13.0	14.0	14.0					19																	1791983		1875	4066	5941	SO:0001627	intron_variant	148229	exon19			TCCTGCTCCATCT	AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.2190+16A>G	chr19.hg19:g.1791983T>C		108.0	0.0		102.0	5.0	NM_001178002	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	ENST00000310127.6	hg19	CCDS45901.1	.	.	.	.	.	.	.	.	.	.	T	15.65	2.895376	0.52121	.	.	ENSG00000130270	ENST00000539485;ENST00000525591	T;T	0.73681	-0.77;-0.77	4.58	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.85678	0.5752	.	.	.	0.46701	D	0.99916	D	0.89917	1.0	D	0.97110	1.0	D	0.87643	0.2523	9	0.87932	D	0	.	12.7566	0.57339	0.0:0.0:0.0:1.0	.	689	Q7Z485	.	G	736;689	ENSP00000443574:E736G;ENSP00000437115:E689G	ENSP00000437115:E689G	E	-	2	0	ATP8B3	1742983	1.000000	0.71417	0.997000	0.53966	0.009000	0.06853	7.911000	0.87458	1.700000	0.51204	0.459000	0.35465	GAG	.	.		0.682	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388279.1	NM_138813	
ZFR2	23217	hgsc.bcm.edu	37	19	3821457	3821457	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:3821457A>G	ENST00000262961.4	-	10	1522	c.1512T>C	c.(1510-1512)ctT>ctC	p.L504L		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	504							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		TGGCAATGGGAAGGTCCGGGT	0.637																																					p.L504L		Atlas-SNP	.											.	ZFR2	63	.	0			c.T1512C						.						26.0	29.0	28.0					19																	3821457		1967	4144	6111	SO:0001819	synonymous_variant	23217	exon10			AATGGGAAGGTCC	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1512T>C	chr19.hg19:g.3821457A>G		74.0	0.0		95.0	4.0	NM_015174		Silent	SNP	ENST00000262961.4	hg19	CCDS45921.1																																																																																			.	.		0.637	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
HOOK2	29911	hgsc.bcm.edu	37	19	12883615	12883615	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:12883615T>C	ENST00000397668.3	-	5	440	c.367A>G	c.(367-369)Atc>Gtc	p.I123V	HOOK2_ENST00000589965.1_Intron|HOOK2_ENST00000264827.5_Missense_Mutation_p.I123V	NM_013312.2	NP_037444.2	Q96ED9	HOOK2_HUMAN	hook microtubule-tethering protein 2	123	Required for localization to the centrosome and induction of aggresome formation.|Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endocytosis (GO:0006897)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|protein transport (GO:0015031)	centrosome (GO:0005813)|FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(5)|skin(1)	20						TCGCAACTGATGGCACAGCCC	0.602																																					p.I123V		Atlas-SNP	.											.	HOOK2	73	.	0			c.A367G						.						63.0	64.0	63.0					19																	12883615		1941	4144	6085	SO:0001583	missense	29911	exon5			AACTGATGGCACA	AF044924	CCDS42507.1, CCDS42508.1	19p13.2	2013-08-21	2013-08-21						19885	protein-coding gene	gene with protein product		607824	"""hook homolog 2 (Drosophila)"""			9927460	Standard	NM_013312		Approved	HK2	uc002muy.2	Q96ED9		ENST00000397668.3:c.367A>G	chr19.hg19:g.12883615T>C	ENSP00000380785:p.Ile123Val	58.0	0.0		66.0	4.0	NM_001100176	O60562	Missense_Mutation	SNP	ENST00000397668.3	hg19	CCDS42508.1	.	.	.	.	.	.	.	.	.	.	T	2.999	-0.206456	0.06180	.	.	ENSG00000095066	ENST00000397668;ENST00000264827	T;T	0.13778	2.56;2.56	3.64	3.64	0.41730	.	0.074612	0.53938	D	0.000060	T	0.07052	0.0179	N	0.16201	0.385	0.36769	D	0.883683	B;B	0.28026	0.165;0.198	B;B	0.30316	0.069;0.114	T	0.13737	-1.0498	10	0.02654	T	1	-14.1091	11.5553	0.50743	0.0:0.0:0.0:1.0	.	123;123	Q96ED9-2;Q96ED9	.;HOOK2_HUMAN	V	123	ENSP00000380785:I123V;ENSP00000264827:I123V	ENSP00000264827:I123V	I	-	1	0	HOOK2	12744615	0.977000	0.34250	0.998000	0.56505	0.969000	0.65631	2.078000	0.41567	1.417000	0.47077	0.374000	0.22700	ATC	.	.		0.602	HOOK2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451008.1	NM_013312	
STX10	8677	hgsc.bcm.edu	37	19	13255480	13255480	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:13255480A>G	ENST00000587230.1	-	7	648	c.584T>C	c.(583-585)cTg>cCg	p.L195P	STX10_ENST00000242770.5_Missense_Mutation_p.W194R|STX10_ENST00000343587.5_Missense_Mutation_p.L146P|STX10_ENST00000589083.1_Missense_Mutation_p.L195P	NM_001271609.1	NP_001258538.1	O60499	STX10_HUMAN	syntaxin 10	195	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			GAAGGCATCCAGCATGCTGCC	0.632																																					p.L195P		Atlas-SNP	.											.	STX10	12	.	0			c.T584C						.						75.0	67.0	69.0					19																	13255480		2203	4300	6503	SO:0001583	missense	8677	exon7			GCATCCAGCATGC	AF035531	CCDS32922.1, CCDS62569.1, CCDS62570.1, CCDS62571.1	19p13.13	2008-07-22				ENSG00000104915			11428	protein-coding gene	gene with protein product		603765				9446797	Standard	NM_003765		Approved	hsyn10, SYN10	uc021upq.2	O60499		ENST00000587230.1:c.584T>C	chr19.hg19:g.13255480A>G	ENSP00000466298:p.Leu195Pro	74.0	0.0		98.0	4.0	NM_003765	A6NC41|Q6IAP4|Q96AE8	Missense_Mutation	SNP	ENST00000587230.1	hg19	CCDS32922.1	.	.	.	.	.	.	.	.	.	.	A	18.06	3.539988	0.65085	.	.	ENSG00000104915	ENST00000343587;ENST00000242770;ENST00000440593	.	.	.	4.07	4.07	0.47477	Syntaxin/epimorphin, conserved site (1);Target SNARE coiled-coil domain (3);	0.000000	0.53938	D	0.000051	T	0.81418	0.4818	M	0.91768	3.24	0.80722	D	1	D;D	0.89917	0.984;1.0	P;D	0.97110	0.882;1.0	D	0.84759	0.0761	9	0.72032	D	0.01	.	11.0367	0.47804	1.0:0.0:0.0:0.0	.	146;195	O60499-2;O60499	.;STX10_HUMAN	P	146;195;195	.	ENSP00000242770:L195P	L	-	2	0	STX10	13116480	1.000000	0.71417	1.000000	0.80357	0.824000	0.46624	6.510000	0.73729	1.700000	0.51204	0.379000	0.24179	CTG	.	.		0.632	STX10-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452918.1	NM_003765	
USHBP1	83878	hgsc.bcm.edu	37	19	17370230	17370230	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:17370230T>C	ENST00000252597.3	-	7	1087	c.914A>G	c.(913-915)gAg>gGg	p.E305G	USHBP1_ENST00000431146.2_Missense_Mutation_p.E241G	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1											breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						TTTGAGCTTCTCAATGCTCCT	0.557																																					p.E305G		Atlas-SNP	.											.	USHBP1	85	.	0			c.A914G						.						87.0	86.0	86.0					19																	17370230		2203	4300	6503	SO:0001583	missense	83878	exon7			AGCTTCTCAATGC	AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.914A>G	chr19.hg19:g.17370230T>C	ENSP00000252597:p.Glu305Gly	100.0	0.0		119.0	5.0	NM_031941		Missense_Mutation	SNP	ENST00000252597.3	hg19	CCDS12353.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.134068	0.77662	.	.	ENSG00000130307	ENST00000252597;ENST00000431146;ENST00000324554	T;T;T	0.61510	0.1;0.1;0.1	5.33	5.33	0.75918	Usher syndrome type-1C protein-binding protein 1, PDZ domain (1);	0.073517	0.49305	D	0.000142	T	0.73768	0.3629	M	0.75777	2.31	0.46298	D	0.998977	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.77557	0.979;0.99;0.979	T	0.76149	-0.3065	10	0.56958	D	0.05	-25.1579	11.9652	0.53031	0.0:0.0:0.0:1.0	.	241;305;305	B4DUE8;Q8N8Y1;Q8N6Y0	.;.;USBP1_HUMAN	G	305;241;305	ENSP00000252597:E305G;ENSP00000407902:E241G;ENSP00000324174:E305G	ENSP00000252597:E305G	E	-	2	0	USHBP1	17231230	1.000000	0.71417	0.997000	0.53966	0.831000	0.47069	4.914000	0.63348	2.144000	0.66660	0.533000	0.62120	GAG	.	.		0.557	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463328.1	NM_031941	
FCHO1	23149	hgsc.bcm.edu	37	19	17881358	17881358	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:17881358A>G	ENST00000596536.1	+	8	744	c.461A>G	c.(460-462)gAg>gGg	p.E154G	FCHO1_ENST00000252771.7_Missense_Mutation_p.E154G|FCHO1_ENST00000594202.1_Missense_Mutation_p.E154G|FCHO1_ENST00000596951.1_Missense_Mutation_p.E154G|FCHO1_ENST00000597512.1_Missense_Mutation_p.E161G|FCHO1_ENST00000595033.1_Missense_Mutation_p.E104G|FCHO1_ENST00000539407.1_Missense_Mutation_p.E154G|FCHO1_ENST00000600676.1_Missense_Mutation_p.E154G|FCHO1_ENST00000389133.4_Missense_Mutation_p.E154G	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	154	Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CTGCGGAGGGAGAGTACCAGC	0.622																																					p.E154G		Atlas-SNP	.											.	FCHO1	69	.	0			c.A461G						.						35.0	36.0	35.0					19																	17881358		2203	4299	6502	SO:0001583	missense	23149	exon7			GGAGGGAGAGTAC	AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.461A>G	chr19.hg19:g.17881358A>G	ENSP00000470731:p.Glu154Gly	55.0	0.0		68.0	6.0	NM_001161358	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	ENST00000596536.1	hg19	CCDS32955.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.478761	0.84747	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.44083	0.93;0.93;0.93	4.56	4.56	0.56223	.	0.057776	0.64402	D	0.000002	T	0.61350	0.2340	M	0.74647	2.275	0.53688	D	0.999975	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.79108	0.956;0.992;0.991	T	0.65162	-0.6235	10	0.72032	D	0.01	-29.2557	10.202	0.43089	1.0:0.0:0.0:0.0	.	104;154;154	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	G	154	ENSP00000252771:E154G;ENSP00000373785:E154G;ENSP00000437978:E154G	ENSP00000252771:E154G	E	+	2	0	FCHO1	17742358	1.000000	0.71417	0.998000	0.56505	0.945000	0.59286	8.318000	0.89990	1.925000	0.55765	0.402000	0.26972	GAG	.	.		0.622	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466946.2	NM_015122	
COMP	1311	hgsc.bcm.edu	37	19	18899995	18899995	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:18899995G>A	ENST00000222271.2	-	5	546	c.502C>T	c.(502-504)Ctg>Ttg	p.L168L	COMP_ENST00000542601.2_Silent_p.L135L|COMP_ENST00000425807.1_Intron	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	168	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GCGAAAGCCAGCCCCACGCCC	0.647																																					p.L168L		Atlas-SNP	.											.	COMP	62	.	0			c.C502T						.						12.0	15.0	14.0					19																	18899995		2192	4255	6447	SO:0001819	synonymous_variant	1311	exon5			AAGCCAGCCCCAC	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.502C>T	chr19.hg19:g.18899995G>A		86.0	0.0		81.0	31.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Silent	SNP	ENST00000222271.2	hg19	CCDS12385.1																																																																																			.	.		0.647	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
ATP13A1	57130	hgsc.bcm.edu	37	19	19764869	19764869	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:19764869A>G	ENST00000357324.6	-	14	1924	c.1898T>C	c.(1897-1899)aTg>aCg	p.M633T	ATP13A1_ENST00000496082.1_5'UTR|ATP13A1_ENST00000291503.5_Missense_Mutation_p.M515T	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	633						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						AAGCACGGACATTCGCTTCAG	0.532																																					p.M633T	Esophageal Squamous(142;920 1789 9047 14684 24777)	Atlas-SNP	.											.	ATP13A1	82	.	0			c.T1898C						.						48.0	57.0	54.0					19																	19764869		2202	4300	6502	SO:0001583	missense	57130	exon14			ACGGACATTCGCT	AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.1898T>C	chr19.hg19:g.19764869A>G	ENSP00000349877:p.Met633Thr	81.0	0.0		96.0	4.0	NM_020410	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Missense_Mutation	SNP	ENST00000357324.6	hg19	CCDS32970.2	.	.	.	.	.	.	.	.	.	.	A	19.28	3.797441	0.70567	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	T;T	0.74737	-0.87;-0.87	5.04	5.04	0.67666	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.89553	0.6748	H	0.95679	3.705	0.80722	D	1	D;D	0.89917	1.0;0.992	D;P	0.91635	0.999;0.822	D	0.91999	0.5609	10	0.66056	D	0.02	-49.6543	12.7194	0.57134	1.0:0.0:0.0:0.0	.	633;515	Q9HD20;Q9HD20-2	AT131_HUMAN;.	T	515;633	ENSP00000291503:M515T;ENSP00000349877:M633T	ENSP00000291503:M515T	M	-	2	0	ATP13A1	19625869	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.851000	0.92205	1.906000	0.55180	0.379000	0.24179	ATG	.	.		0.532	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329005.1	NM_020410	
ZNF682	91120	hgsc.bcm.edu	37	19	20116962	20116962	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:20116962A>G	ENST00000397165.2	-	4	1509	c.1349T>C	c.(1348-1350)gTc>gCc	p.V450A	ZNF682_ENST00000358523.5_Missense_Mutation_p.V418A|ZNF682_ENST00000397162.1_Missense_Mutation_p.V418A|ZNF682_ENST00000597972.1_Missense_Mutation_p.V456A|ZNF682_ENST00000595736.1_Missense_Mutation_p.V374A|ZNF682_ENST00000596019.1_Intron	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	450			V -> I (in dbSNP:rs17679334).		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						ATAGCGTTTGACGGCAGTATG	0.383																																					p.V450A		Atlas-SNP	.											.	ZNF682	51	.	0			c.T1349C						.						88.0	97.0	94.0					19																	20116962		2169	4289	6458	SO:0001583	missense	91120	exon4			CGTTTGACGGCAG	AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.1349T>C	chr19.hg19:g.20116962A>G	ENSP00000380351:p.Val450Ala	53.0	0.0		63.0	5.0	NM_033196	B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	ENST00000397165.2	hg19	CCDS42533.1	.	.	.	.	.	.	.	.	.	.	a	8.884	0.952446	0.18431	.	.	ENSG00000197124	ENST00000397165;ENST00000397162;ENST00000341262;ENST00000358523	T;T;T	0.18502	2.21;2.21;2.21	1.09	-2.18	0.07037	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.08403	0.0209	N	0.10837	0.055	0.18873	N	0.999988	B	0.16603	0.018	B	0.26614	0.071	T	0.36625	-0.9740	9	0.87932	D	0	.	4.1969	0.10447	0.5658:0.0:0.0:0.4342	.	450	O95780	ZN682_HUMAN	A	450;418;119;418	ENSP00000380351:V450A;ENSP00000380348:V418A;ENSP00000351324:V418A	ENSP00000340236:V119A	V	-	2	0	ZNF682	19977962	0.138000	0.22547	0.000000	0.03702	0.000000	0.00434	1.357000	0.34090	-0.602000	0.05775	-0.669000	0.03829	GTC	.	.		0.383	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462888.1	NM_033196	
DPY19L3	147991	hgsc.bcm.edu	37	19	32944160	32944160	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:32944160T>C	ENST00000342179.5	+	9	1180	c.965T>C	c.(964-966)gTa>gCa	p.V322A	DPY19L3_ENST00000392250.2_Missense_Mutation_p.V322A|DPY19L3_ENST00000586987.1_Missense_Mutation_p.V322A	NM_207325.2	NP_997208.2	Q6ZPD9	D19L3_HUMAN	dpy-19-like 3 (C. elegans)	322						integral component of membrane (GO:0016021)	transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(4)|pancreas(1)	32	Esophageal squamous(110;0.162)					AACCTTTCAGTATTCATTGCA	0.318																																					p.V322A		Atlas-SNP	.											.	DPY19L3	70	.	0			c.T965C						.						112.0	100.0	104.0					19																	32944160		2203	4300	6503	SO:0001583	missense	147991	exon9			TTTCAGTATTCAT		CCDS12422.1	19q13.11	2008-02-05				ENSG00000178904			27120	protein-coding gene	gene with protein product		613894					Standard	NM_207325		Approved		uc002ntg.3	Q6ZPD9		ENST00000342179.5:c.965T>C	chr19.hg19:g.32944160T>C	ENSP00000344937:p.Val322Ala	157.0	0.0		83.0	4.0	NM_001172774	Q68DC7|Q6ZTB7|Q6ZTS2	Missense_Mutation	SNP	ENST00000342179.5	hg19	CCDS12422.1	.	.	.	.	.	.	.	.	.	.	T	11.09	1.535753	0.27475	.	.	ENSG00000178904	ENST00000392250;ENST00000319326;ENST00000342179	T;T	0.56275	0.47;0.47	5.86	5.86	0.93980	.	0.192172	0.45867	D	0.000324	T	0.31765	0.0807	N	0.12961	0.28	0.30900	N	0.729398	B	0.09022	0.002	B	0.10450	0.005	T	0.28554	-1.0040	10	0.10636	T	0.68	-24.0619	10.0118	0.41990	0.0:0.0754:0.0:0.9246	.	322	Q6ZPD9	D19L3_HUMAN	A	322	ENSP00000376081:V322A;ENSP00000344937:V322A	ENSP00000315672:V322A	V	+	2	0	DPY19L3	37636000	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.793000	0.47845	2.240000	0.73641	0.533000	0.62120	GTA	.	.		0.318	DPY19L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450311.1	NM_207325	
KIRREL2	84063	hgsc.bcm.edu	37	19	36352785	36352785	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:36352785A>G	ENST00000360202.5	+	11	1567	c.1369A>G	c.(1369-1371)Agc>Ggc	p.S457G	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Missense_Mutation_p.S457G|KIRREL2_ENST00000262625.7_Missense_Mutation_p.S457G|KIRREL2_ENST00000347900.6_Missense_Mutation_p.S407G	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	457	Ig-like C2-type 5.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCCCCAGAGAGCCGCGGGGG	0.637																																					p.S457G		Atlas-SNP	.											.	KIRREL2	170	.	0			c.A1369G						.						27.0	30.0	29.0					19																	36352785		2202	4290	6492	SO:0001583	missense	84063	exon11			CCAGAGAGCCGCG	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1369A>G	chr19.hg19:g.36352785A>G	ENSP00000353331:p.Ser457Gly	112.0	0.0		132.0	6.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	A	0.007	-1.985925	0.00443	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.14391	2.51;2.51;2.51	4.54	2.39	0.29439	Immunoglobulin-like (1);	0.346063	0.20850	N	0.084556	T	0.03959	0.0111	N	0.02011	-0.69	0.09310	N	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.01281	0.0;0.0;0.0;0.0;0.0	T	0.43556	-0.9384	10	0.12766	T	0.61	-2.2705	6.2161	0.20656	0.2288:0.0:0.7712:0.0	.	457;437;457;407;457	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	G	457;407;457;437	ENSP00000262625:S457G;ENSP00000345067:S407G;ENSP00000353331:S457G	ENSP00000262625:S457G	S	+	1	0	KIRREL2	41044625	0.001000	0.12720	0.006000	0.13384	0.014000	0.08584	0.594000	0.24014	0.929000	0.37192	-0.239000	0.12128	AGC	.	.		0.637	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
ZNF829	374899	hgsc.bcm.edu	37	19	37383232	37383232	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:37383232T>C	ENST00000391711.3	-	6	825	c.461A>G	c.(460-462)aAa>aGa	p.K154R	ZNF345_ENST00000432005.2_Intron|ZNF829_ENST00000520965.1_Missense_Mutation_p.K235R|ZNF345_ENST00000526123.1_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTCCCATGGTTTCTCTTCACT	0.333																																					p.K235R		Atlas-SNP	.											.	ZNF829	70	.	0			c.A704G						.						67.0	60.0	62.0					19																	37383232		1914	4133	6047	SO:0001583	missense	374899	exon6			CATGGTTTCTCTT	BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.461A>G	chr19.hg19:g.37383232T>C	ENSP00000429266:p.Lys154Arg	83.0	0.0		60.0	4.0	NM_001171979	Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	ENST00000391711.3	hg19	CCDS42557.1	.	.	.	.	.	.	.	.	.	.	T	10.26	1.302019	0.23736	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.32753	1.44	3.18	3.18	0.36537	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31327	0.0793	M	0.67625	2.065	0.22591	N	0.998954	B	0.28667	0.219	B	0.26864	0.074	T	0.18967	-1.0320	9	0.48119	T	0.1	.	9.7618	0.40537	0.0:0.0:0.0:1.0	.	154	Q3KNS6	ZN829_HUMAN	R	154	ENSP00000429266:K154R	ENSP00000429266:K154R	K	-	2	0	ZNF829	42075072	0.005000	0.15991	0.950000	0.38849	0.718000	0.41266	0.355000	0.20163	1.693000	0.51124	0.528000	0.53228	AAA	.	.		0.333	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109575.3	NM_001037232	
WDR87	83889	hgsc.bcm.edu	37	19	38378513	38378513	+	Missense_Mutation	SNP	T	T	G	rs528496306		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:38378513T>G	ENST00000303868.5	-	6	5905	c.5681A>C	c.(5680-5682)aAg>aCg	p.K1894T	WDR87_ENST00000447313.2_Missense_Mutation_p.K1933T	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1894	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						CTGTGTCAGCTTCTCCTCTAC	0.398													T|||	1	0.000199681	0.0008	0.0	5008	,	,		20520	0.0		0.0	False		,,,				2504	0.0				p.K1894T		Atlas-SNP	.											.	WDR87	191	.	0			c.A5681C						.						198.0	142.0	159.0					19																	38378513		692	1591	2283	SO:0001583	missense	83889	exon6			GTCAGCTTCTCCT	AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.5681A>C	chr19.hg19:g.38378513T>G	ENSP00000368025:p.Lys1894Thr	206.0	0.0		208.0	84.0	NM_031951	Q9BWV9	Missense_Mutation	SNP	ENST00000303868.5	hg19	CCDS46063.1	.	.	.	.	.	.	.	.	.	.	T	7.411	0.634647	0.14322	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.23552	1.9;1.9	5.26	-2.7	0.06004	.	.	.	.	.	T	0.10723	0.0262	N	0.19112	0.55	0.09310	N	1	B;B	0.29270	0.24;0.24	B;B	0.20384	0.029;0.029	T	0.25012	-1.0144	9	0.33940	T	0.23	.	1.1911	0.01865	0.243:0.1587:0.3738:0.2245	.	1894;1933	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	T	1933;1894	ENSP00000405012:K1933T;ENSP00000368025:K1894T	ENSP00000368025:K1894T	K	-	2	0	WDR87	43070353	0.000000	0.05858	0.006000	0.13384	0.015000	0.08874	-2.088000	0.01359	-0.194000	0.10399	0.519000	0.50382	AAG	.	.		0.398	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000314628.2	XM_940478	
CATSPERG	57828	hgsc.bcm.edu	37	19	38834967	38834967	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:38834967A>G	ENST00000409235.3	+	6	743	c.628A>G	c.(628-630)Aga>Gga	p.R210G	CATSPERG_ENST00000215069.4_Missense_Mutation_p.R195G|CATSPERG_ENST00000410018.1_Missense_Mutation_p.R210G	NM_021185.4	NP_067008.3	Q6ZRH7	CTSRG_HUMAN	catsper channel auxiliary subunit gamma	210					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|plasma membrane (GO:0005886)|sperm principal piece (GO:0097228)				breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|pancreas(2)|prostate(6)|skin(3)|stomach(1)|urinary_tract(2)	40						CTTCCTGAAGAGAGACCGGGA	0.547																																					p.R210G		Atlas-SNP	.											.	CATSPERG	121	.	0			c.A628G						.						118.0	104.0	108.0					19																	38834967		692	1591	2283	SO:0001583	missense	57828	exon6			CTGAAGAGAGACC	AK128220	CCDS12514.2	19q13.1	2014-05-13	2012-02-22	2009-07-17	ENSG00000099338	ENSG00000099338			25243	protein-coding gene	gene with protein product		613452	"""chromosome 19 open reading frame 15"", ""cation channel, sperm-associated, gamma"""	C19orf15		19516020	Standard	NM_021185		Approved	DKFZp434A1022, FLJ46353	uc002oih.4	Q6ZRH7	OTTHUMG00000153223	ENST00000409235.3:c.628A>G	chr19.hg19:g.38834967A>G	ENSP00000386962:p.Arg210Gly	108.0	0.0		149.0	6.0	NM_021185	A6NEG6|Q659E1	Missense_Mutation	SNP	ENST00000409235.3	hg19	CCDS12514.2	.	.	.	.	.	.	.	.	.	.	A	12.54	1.967333	0.34754	.	.	ENSG00000099338	ENST00000410018;ENST00000409235;ENST00000409410;ENST00000215069	T;T;T;T	0.35421	1.31;1.31;1.31;1.31	4.84	3.81	0.43845	.	0.706063	0.13360	N	0.393711	T	0.42743	0.1216	M	0.71581	2.175	0.29909	N	0.823736	P;P	0.41848	0.728;0.763	P;B	0.44359	0.447;0.288	T	0.46133	-0.9213	10	0.72032	D	0.01	-6.4806	8.5606	0.33509	0.8048:0.1952:0.0:0.0	.	210;210	Q6ZRH7;B8ZZI7	CTSRG_HUMAN;.	G	210;210;210;195	ENSP00000387057:R210G;ENSP00000386962:R210G;ENSP00000386950:R210G;ENSP00000215069:R195G	ENSP00000215069:R195G	R	+	1	2	CATSPERG	43526807	0.945000	0.32115	0.713000	0.30519	0.121000	0.20230	2.022000	0.41030	0.851000	0.35264	-0.321000	0.08615	AGA	.	.		0.547	CATSPERG-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000330204.1	NM_021185	
ZNF780B	163131	hgsc.bcm.edu	37	19	40541735	40541735	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:40541735A>G	ENST00000434248.1	-	5	1096	c.1031T>C	c.(1030-1032)cTt>cCt	p.L344P	ZNF780B_ENST00000221355.6_Missense_Mutation_p.L196P	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					CTTTGTCAGAAGAGTAAAGGC	0.428																																					p.L344P		Atlas-SNP	.											.	ZNF780B	143	.	0			c.T1031C						.						64.0	66.0	66.0					19																	40541735		2203	4300	6503	SO:0001583	missense	163131	exon5			GTCAGAAGAGTAA	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1031T>C	chr19.hg19:g.40541735A>G	ENSP00000391641:p.Leu344Pro	92.0	0.0		86.0	4.0	NM_001005851	B9EH00	Missense_Mutation	SNP	ENST00000434248.1	hg19	CCDS46077.1	.	.	.	.	.	.	.	.	.	.	A	9.651	1.141618	0.21205	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.09163	3.01;3.01	1.88	-3.76	0.04359	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21468	0.0517	M	0.70275	2.135	0.09310	N	0.999998	D	0.76494	0.999	D	0.67103	0.949	T	0.06752	-1.0809	9	0.39692	T	0.17	.	4.3998	0.11381	0.4309:0.4122:0.0:0.157	.	344	Q9Y6R6	Z780B_HUMAN	P	344;196	ENSP00000391641:L344P;ENSP00000221355:L196P	ENSP00000221355:L196P	L	-	2	0	ZNF780B	45233575	0.000000	0.05858	0.001000	0.08648	0.057000	0.15508	-2.722000	0.00810	-0.842000	0.04195	0.247000	0.18012	CTT	.	.		0.428	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851	
SPTBN4	57731	hgsc.bcm.edu	37	19	41060447	41060447	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:41060447T>C	ENST00000352632.3	+	24	5065	c.4979T>C	c.(4978-4980)cTc>cCc	p.L1660P	SPTBN4_ENST00000392023.1_Missense_Mutation_p.L336P|SPTBN4_ENST00000338932.3_Missense_Mutation_p.L1660P|SPTBN4_ENST00000595535.1_Missense_Mutation_p.L1660P|SPTBN4_ENST00000598249.1_Missense_Mutation_p.L1660P|SPTBN4_ENST00000392025.1_Missense_Mutation_p.L403P			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1660					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CTGCAGCTGCTCAAGAAACAC	0.701																																					p.L1660P		Atlas-SNP	.											.	SPTBN4	213	.	0			c.T4979C						.						17.0	15.0	16.0					19																	41060447		2183	4275	6458	SO:0001583	missense	57731	exon24			AGCTGCTCAAGAA	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.4979T>C	chr19.hg19:g.41060447T>C	ENSP00000263373:p.Leu1660Pro	117.0	0.0		168.0	7.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	ENST00000352632.3	hg19	CCDS12559.1	.	.	.	.	.	.	.	.	.	.	T	17.34	3.363817	0.61513	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.48	4.48	0.54585	.	0.000000	0.51477	D	0.000083	T	0.72779	0.3503	M	0.90425	3.115	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.995;0.996;0.997;0.998;0.995	T	0.79217	-0.1894	10	0.87932	D	0	.	12.7686	0.57408	0.0:0.0:0.0:1.0	.	403;403;336;1660;1660	Q9H254-3;C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;.;SPTN4_HUMAN;.	P	1660;1660;1660;403;336	ENSP00000263373:L1660P;ENSP00000340345:L1660P;ENSP00000375879:L403P;ENSP00000375877:L336P	ENSP00000340345:L1660P	L	+	2	0	SPTBN4	45752287	1.000000	0.71417	1.000000	0.80357	0.282000	0.26991	7.792000	0.85828	1.653000	0.50694	0.260000	0.18958	CTC	.	.		0.701	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
ZNF226	7769	hgsc.bcm.edu	37	19	44680289	44680289	+	Missense_Mutation	SNP	A	A	G	rs200035894		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:44680289A>G	ENST00000590089.1	+	7	1241	c.874A>G	c.(874-876)Agc>Ggc	p.S292G	ZNF226_ENST00000454662.2_Missense_Mutation_p.S292G|ZNF226_ENST00000337433.5_Missense_Mutation_p.S292G|ZNF226_ENST00000588883.1_3'UTR			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	292					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				CTTCTGTTACAGCCCAGTTCT	0.443																																					p.S292G	Pancreas(115;581 1665 13228 19278 50070)	Atlas-SNP	.											.	.	.	.	0			c.A874G						.						56.0	57.0	56.0					19																	44680289		2071	4224	6295	SO:0001583	missense	7769	exon6			TGTTACAGCCCAG	AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.874A>G	chr19.hg19:g.44680289A>G	ENSP00000465121:p.Ser292Gly	140.0	0.0		148.0	6.0	NM_001032372	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	ENST00000590089.1	hg19	CCDS46102.1	.	.	.	.	.	.	.	.	.	.	A	3.628	-0.076071	0.07184	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.16457	2.34;2.34	4.28	3.25	0.37280	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.651325	0.12784	N	0.439434	T	0.11965	0.0291	L	0.39085	1.19	0.09310	N	1	B	0.31241	0.315	B	0.19946	0.027	T	0.19451	-1.0305	10	0.34782	T	0.22	.	8.2416	0.31662	0.8999:0.0:0.1001:0.0	.	292	Q9NYT6	ZN226_HUMAN	G	292	ENSP00000336719:S292G;ENSP00000393265:S292G	ENSP00000336719:S292G	S	+	1	0	ZNF226	49372129	0.000000	0.05858	0.007000	0.13788	0.001000	0.01503	0.255000	0.18333	0.817000	0.34445	0.533000	0.62120	AGC	.	A|0.999;T|0.001		0.443	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460712.1		
ZNF112	7771	hgsc.bcm.edu	37	19	44832241	44832241	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:44832241T>C	ENST00000337401.4	-	5	2175	c.2087A>G	c.(2086-2088)gAt>gGt	p.D696G	ZNF112_ENST00000354340.4_Missense_Mutation_p.D690G|ZNF112_ENST00000536500.1_Missense_Mutation_p.D713G	NM_001083335.1	NP_001076804.1	Q9UJU3	ZN112_HUMAN	zinc finger protein 112	696					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACCACACTCATCACATTGGTA	0.448																																					p.D696G		Atlas-SNP	.											.	ZFP112	219	.	0			c.A2087G						.						103.0	86.0	92.0					19																	44832241		2203	4300	6503	SO:0001583	missense	7771	exon5			CACTCATCACATT	AF198358		19q13.2	2014-02-06	2012-11-27		ENSG00000062370	ENSG00000062370		"""Zinc fingers, C2H2-type"""	12892	protein-coding gene	gene with protein product		603994	"""zinc finger protein 112 homolog (mouse)"", ""zinc finger protein 228"""	ZFP112, ZNF228			Standard	NM_013380		Approved			Q9UJU3	OTTHUMG00000182357	ENST00000337401.4:c.2087A>G	chr19.hg19:g.44832241T>C	ENSP00000337081:p.Asp696Gly	75.0	0.0		88.0	4.0	NM_001083335	A4FU53|Q9HCA7	Missense_Mutation	SNP	ENST00000337401.4	hg19	CCDS54276.1	.	.	.	.	.	.	.	.	.	.	T	11.03	1.520342	0.27211	.	.	ENSG00000062370	ENST00000337401;ENST00000412927;ENST00000354340;ENST00000536500;ENST00000253426	T;T;T	0.19394	2.15;2.15;2.15	5.0	2.74	0.32292	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.731907	0.11185	N	0.590573	T	0.18551	0.0445	L	0.56396	1.775	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.32693	-0.9897	10	0.17832	T	0.49	-1.1888	6.0501	0.19781	0.0:0.0945:0.3356:0.5699	.	695;713;696	B4DYT4;F5GWS7;Q9UJU3	.;.;ZF112_HUMAN	G	696;696;690;713;695	ENSP00000337081:D696G;ENSP00000346305:D690G;ENSP00000441990:D713G	ENSP00000253426:D695G	D	-	2	0	ZNF285	49524081	0.000000	0.05858	0.447000	0.26932	0.983000	0.72400	-2.525000	0.00948	0.865000	0.35603	0.533000	0.62120	GAT	.	.		0.448	ZNF112-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000460744.1	NM_013380	
ZNF180	7733	hgsc.bcm.edu	37	19	44988603	44988603	+	Missense_Mutation	SNP	T	T	C	rs573184540	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:44988603T>C	ENST00000221327.4	-	3	457	c.176A>G	c.(175-177)gAa>gGa	p.E59G	ZNF180_ENST00000587047.1_Missense_Mutation_p.K61E|ZNF180_ENST00000592529.1_Missense_Mutation_p.E32G|ZNF180_ENST00000391956.4_Intron|ZNF180_ENST00000585514.1_5'UTR|ZNF180_ENST00000586637.1_Silent_p.R68R	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	59					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CCCAGTGTCTTCTCCCTCGAC	0.458													T|||	2	0.000399361	0.0	0.0	5008	,	,		20243	0.002		0.0	False		,,,				2504	0.0				p.E59G	Esophageal Squamous(180;1353 2003 32862 46574 49854)	Atlas-SNP	.											.	ZNF180	103	.	0			c.A176G						.						105.0	94.0	97.0					19																	44988603		2203	4300	6503	SO:0001583	missense	7733	exon3			GTGTCTTCTCCCT	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.176A>G	chr19.hg19:g.44988603T>C	ENSP00000221327:p.Glu59Gly	72.0	0.0		80.0	4.0	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Missense_Mutation	SNP	ENST00000221327.4	hg19	CCDS12639.1	.	.	.	.	.	.	.	.	.	.	T	14.05	2.418925	0.42918	.	.	ENSG00000167384	ENST00000221327	T	0.08193	3.12	3.52	3.52	0.40303	.	0.000000	0.34531	N	0.003882	T	0.04588	0.0125	N	0.19112	0.55	0.21762	N	0.999554	P;P	0.50443	0.935;0.935	B;B	0.39094	0.29;0.29	T	0.42224	-0.9464	10	0.20046	T	0.44	-22.6394	8.7454	0.34583	0.0:0.0:0.0:1.0	.	58;59	Q58F03;Q9UJW8	.;ZN180_HUMAN	G	59	ENSP00000221327:E59G	ENSP00000221327:E59G	E	-	2	0	ZNF180	49680443	1.000000	0.71417	1.000000	0.80357	0.657000	0.38888	0.796000	0.26986	1.848000	0.53677	0.528000	0.53228	GAA	.	.		0.458	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
CBLC	23624	hgsc.bcm.edu	37	19	45285709	45285709	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:45285709T>C	ENST00000270279.3	+	4	803	c.740T>C	c.(739-741)gTc>gCc	p.V247A	CBLC_ENST00000341505.4_Missense_Mutation_p.V247A	NM_012116.3	NP_036248.3	Q9ULV8	CBLC_HUMAN	Cbl proto-oncogene C, E3 ubiquitin protein ligase	247	Cbl-PTB. {ECO:0000255|PROSITE- ProRule:PRU00839}.|SH2-like.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of MAP kinase activity (GO:0043407)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|ligase activity (GO:0016874)|phosphotyrosine binding (GO:0001784)|SH3 domain binding (GO:0017124)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(6)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Lung NSC(12;0.00136)|all_lung(12;0.00371)	Ovarian(192;0.231)				TATGATGAGGTCCAAGAGCGT	0.622			M		AML																																p.V247A		Atlas-SNP	.		Rec	yes		19	19q13.2	23624	Cas-Br-M (murine) ecotropic retroviral transforming sequence c		L	.	CBLC	41	.	0			c.T740C						.						83.0	75.0	78.0					19																	45285709		2203	4300	6503	SO:0001583	missense	23624	exon4			ATGAGGTCCAAGA	AB028645	CCDS12643.1, CCDS46109.1	19q13.2	2013-07-09	2013-07-09		ENSG00000142273	ENSG00000142273		"""RING-type (C3HC4) zinc fingers"""	15961	protein-coding gene	gene with protein product		608453	"""Cas-Br-M (murine) ectropic retroviral transforming sequence c"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence c"""			10362357, 10571044	Standard	NM_012116		Approved	CBL-3, CBL-SL, RNF57	uc002ozs.3	Q9ULV8	OTTHUMG00000150715	ENST00000270279.3:c.740T>C	chr19.hg19:g.45285709T>C	ENSP00000270279:p.Val247Ala	118.0	0.0		207.0	9.0	NM_001130852	Q8N1E5|Q9Y5Z2|Q9Y5Z3	Missense_Mutation	SNP	ENST00000270279.3	hg19	CCDS12643.1	.	.	.	.	.	.	.	.	.	.	.	14.43	2.533334	0.45073	.	.	ENSG00000142273	ENST00000270279;ENST00000341505	D;D	0.82081	-1.57;-1.57	4.7	4.7	0.59300	Adaptor protein Cbl, PTB domain (1);SH2 motif (2);Adaptor protein Cbl, SH2-like (1);	0.000000	0.49305	D	0.000143	D	0.88808	0.6537	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.89287	0.3616	10	0.59425	D	0.04	-44.9982	12.4184	0.55506	0.0:0.0:0.0:1.0	.	247;247	Q9ULV8-2;Q9ULV8	.;CBLC_HUMAN	A	247	ENSP00000270279:V247A;ENSP00000340250:V247A	ENSP00000270279:V247A	V	+	2	0	CBLC	49977549	1.000000	0.71417	0.480000	0.27341	0.022000	0.10575	7.449000	0.80643	2.103000	0.63969	0.459000	0.35465	GTC	.	.		0.622	CBLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319732.2	NM_012116	
RSPH6A	81492	hgsc.bcm.edu	37	19	46305378	46305378	+	Splice_Site	SNP	C	C	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:46305378C>A	ENST00000221538.3	-	4	1940	c.1798G>T	c.(1798-1800)Gaa>Taa	p.E600*	RSPH6A_ENST00000600188.1_Splice_Site_p.E336*|RSPH6A_ENST00000597055.1_Splice_Site_p.E600*	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	600	Glu-rich.					intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						GCTTCCTTACCTGCATCTTCT	0.637																																					p.E600X		Atlas-SNP	.											.	RSPH6A	70	.	0			c.G1798T						.						96.0	69.0	78.0					19																	46305378		2203	4300	6503	SO:0001630	splice_region_variant	81492	exon4			CCTTACCTGCATC	AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1798+1G>T	chr19.hg19:g.46305378C>A		107.0	0.0		126.0	45.0	NM_030785	Q53FE2|Q6PEZ9	Nonsense_Mutation	SNP	ENST00000221538.3	hg19	CCDS12675.1	.	.	.	.	.	.	.	.	.	.	C	28.3	4.912655	0.92178	.	.	ENSG00000104941	ENST00000221538	.	.	.	4.15	4.15	0.48705	.	0.165132	0.52532	D	0.000078	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-1.5686	12.2908	0.54817	0.0:1.0:0.0:0.0	.	.	.	.	X	600	.	.	E	-	1	0	RSPH6A	50997218	1.000000	0.71417	0.998000	0.56505	0.119000	0.20118	4.199000	0.58426	2.606000	0.88127	0.456000	0.33151	GAA	.	.		0.637	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461657.1		Nonsense_Mutation
MYPOP	339344	hgsc.bcm.edu	37	19	46393962	46393962	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:46393962G>A	ENST00000322217.5	-	3	1205	c.1119C>T	c.(1117-1119)ctC>ctT	p.L373L		NM_001012643.2	NP_001012661.1	Q86VE0	MYPOP_HUMAN	Myb-related transcription factor, partner of profilin	373	Pro-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			large_intestine(2)|lung(1)|skin(1)	4						CGTGCGGAGGGAGCGGGGCTG	0.642																																					p.L373L		Atlas-SNP	.											.	MYPOP	23	.	0			c.C1119T						.						9.0	11.0	10.0					19																	46393962		2117	4202	6319	SO:0001819	synonymous_variant	339344	exon3			CGGAGGGAGCGGG	BC044311	CCDS33055.1	19q13.32	2014-06-13			ENSG00000176182	ENSG00000176182			20178	protein-coding gene	gene with protein product	"""p42 Myb-related transcription factor, partner of profilin"""					15615774	Standard	NM_001012643		Approved	P42pop	uc002pdt.3	Q86VE0	OTTHUMG00000182486	ENST00000322217.5:c.1119C>T	chr19.hg19:g.46393962G>A		64.0	0.0		75.0	25.0	NM_001012643		Silent	SNP	ENST00000322217.5	hg19	CCDS33055.1																																																																																			.	.		0.642	MYPOP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000461684.1	NM_001012643	
DHX34	9704	hgsc.bcm.edu	37	19	47876048	47876048	+	Silent	SNP	C	C	A	rs562906654	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:47876048C>A	ENST00000328771.4	+	8	2179	c.1830C>A	c.(1828-1830)gcC>gcA	p.A610A		NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	610					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CCATCGCAGCCGCACTTAGCG	0.682																																					p.A610A		Atlas-SNP	.											.	DHX34	98	.	0			c.C1830A						.						45.0	41.0	42.0					19																	47876048		2202	4300	6502	SO:0001819	synonymous_variant	9704	exon8			CGCAGCCGCACTT	D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1830C>A	chr19.hg19:g.47876048C>A		185.0	0.0		156.0	105.0	NM_014681	B4DMY8	Silent	SNP	ENST00000328771.4	hg19	CCDS12700.1																																																																																			.	.		0.682	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314313.3	NM_014681	
SLC17A7	57030	hgsc.bcm.edu	37	19	49937914	49937914	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:49937914C>T	ENST00000221485.3	-	5	753	c.582G>A	c.(580-582)tgG>tgA	p.W194*	SLC17A7_ENST00000543531.1_Nonsense_Mutation_p.W182*|SLC17A7_ENST00000600601.1_Nonsense_Mutation_p.W127*	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	194					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		CCCATTTGCTCCAGATCCCAT	0.592																																					p.W194X		Atlas-SNP	.											.	SLC17A7	57	.	0			c.G582A						.						60.0	60.0	60.0					19																	49937914		2203	4300	6503	SO:0001587	stop_gained	57030	exon5			TTTGCTCCAGATC	AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.582G>A	chr19.hg19:g.49937914C>T	ENSP00000221485:p.Trp194*	102.0	0.0		85.0	4.0	NM_020309	B4DFR9|B4DG46|Q6PCD0	Nonsense_Mutation	SNP	ENST00000221485.3	hg19	CCDS12764.1	.	.	.	.	.	.	.	.	.	.	C	37	6.117643	0.97300	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	.	.	.	4.83	4.83	0.62350	.	0.000000	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8135	0.78581	0.0:1.0:0.0:0.0	.	.	.	.	X	194;182	.	ENSP00000221485:W194X	W	-	3	0	SLC17A7	54629726	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.482000	0.81143	2.674000	0.91012	0.650000	0.86243	TGG	.	.		0.592	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465367.2		
MED25	81857	hgsc.bcm.edu	37	19	50338357	50338357	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:50338357T>C	ENST00000312865.6	+	14	1650	c.1597T>C	c.(1597-1599)Ttc>Ctc	p.F533L	MED25_ENST00000538643.1_Missense_Mutation_p.F320L	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	533	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		CCAGAGCGGCTTCGTCAACGG	0.602																																					p.F533L	GBM(51;894 1657 37868)	Atlas-SNP	.											.	MED25	98	.	0			c.T1597C						.						195.0	170.0	179.0					19																	50338357		2203	4300	6503	SO:0001583	missense	81857	exon14			AGCGGCTTCGTCA	AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1597T>C	chr19.hg19:g.50338357T>C	ENSP00000326767:p.Phe533Leu	150.0	0.0		122.0	5.0	NM_030973	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	ENST00000312865.6	hg19	CCDS33075.1	.	.	.	.	.	.	.	.	.	.	t	19.56	3.850008	0.71603	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070;ENST00000536547	D;D	0.87966	-2.32;-2.27	5.54	5.54	0.83059	Mediator complex, subunit Med25, PTOV activation and synapsin 2 (1);	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	M	0.64567	1.98	0.47698	D	0.99949	D;D;P	0.65815	0.995;0.989;0.866	D;D;P	0.80764	0.994;0.981;0.739	D	0.92293	0.5843	10	0.54805	T	0.06	.	14.6528	0.68811	0.0:0.0:0.0:1.0	.	320;533;533	B9TX30;B5ME50;Q71SY5	.;.;MED25_HUMAN	L	533;533;533;533;533;320;268;22	ENSP00000326767:F533L;ENSP00000437496:F320L	ENSP00000326767:F533L	F	+	1	0	MED25	55030169	1.000000	0.71417	1.000000	0.80357	0.107000	0.19398	5.554000	0.67294	2.111000	0.64477	0.260000	0.18958	TTC	.	.		0.602	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465316.1	NM_030973	
PPP2R1A	5518	hgsc.bcm.edu	37	19	52709237	52709237	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:52709237A>G	ENST00000322088.6	+	3	249	c.191A>G	c.(190-192)gAg>gGg	p.E64G	PPP2R1A_ENST00000473455.2_3'UTR|PPP2R1A_ENST00000444322.2_Intron|PPP2R1A_ENST00000462990.1_5'UTR	NM_014225.5	NP_055040.2	P30153	2AAA_HUMAN	protein phosphatase 2, regulatory subunit A, alpha	64	PP2A subunit B binding.|Polyoma small and medium T antigens Binding.				apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|chromosome segregation (GO:0007059)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine dephosphorylation (GO:0070262)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|protein complex assembly (GO:0006461)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	antigen binding (GO:0003823)|protein heterodimerization activity (GO:0046982)|protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)	p.E64G(1)		NS(1)|breast(4)|cervix(2)|endometrium(62)|kidney(1)|large_intestine(7)|lung(21)|ovary(32)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	135				GBM - Glioblastoma multiforme(134;0.00456)|OV - Ovarian serous cystadenocarcinoma(262;0.015)		GATGAAGATGAGGTCCTCCTG	0.552			Mis		clear cell ovarian carcinoma																																p.E64G		Atlas-SNP	.		Dom?	yes		19	19q13.41	5518	"""protein phosphatase 2, regulatory subunit A, alpha"""		E	PPP2R1A,colon,carcinoma,0,3	PPP2R1A	187	.	1	Substitution - Missense(1)	breast(1)	c.A191G						.						201.0	162.0	175.0					19																	52709237		2203	4300	6503	SO:0001583	missense	5518	exon3			AAGATGAGGTCCT		CCDS12849.1	19q13	2010-06-18	2010-04-14		ENSG00000105568	ENSG00000105568	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9302	protein-coding gene	gene with protein product	"""protein phosphatase 2A, regulatory subunit A, alpha isoform"", ""protein phosphatase 2, 65kDa regulatory subunit A"""	605983	"""protein phosphatase 2 (formerly 2A), regulatory subunit A (PR 65), alpha isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit A, alpha isoform"""				Standard	NR_033500		Approved	PR65A, PP2A-Aalpha	uc002pyp.3	P30153	OTTHUMG00000137367	ENST00000322088.6:c.191A>G	chr19.hg19:g.52709237A>G	ENSP00000324804:p.Glu64Gly	114.0	2.0		90.0	4.0	NM_014225	Q13773|Q6ICQ3|Q96DH3	Missense_Mutation	SNP	ENST00000322088.6	hg19	CCDS12849.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	20.2|20.2	3.947972|3.947972	0.73787|0.73787	.|.	.|.	ENSG00000105568|ENSG00000105568	ENST00000454220;ENST00000423369;ENST00000322088|ENST00000391791	T;T|T	0.08984|0.55234	3.03;3.03|0.53	3.47|3.47	3.47|3.47	0.39725|0.39725	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.295679|.	0.25695|.	N|.	0.028915|.	T|T	0.79417|0.79417	0.4442|0.4442	H|H	0.97131|0.97131	3.945|3.945	0.80722|0.80722	D|D	1|1	D;D|.	0.55172|.	0.97;0.97|.	P;P|.	0.61658|.	0.892;0.892|.	D|D	0.84499|0.84499	0.0615|0.0615	10|6	0.87932|.	D|.	0|.	-26.1968|-26.1968	10.5807|10.5807	0.45255|0.45255	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	64;64|.	A8K7B7;P30153|.	.;2AAA_HUMAN|.	G|G	104;64;64|43	ENSP00000391905:E104G;ENSP00000324804:E64G|ENSP00000375668:R43G	ENSP00000324804:E64G|.	E|R	+|+	2|1	0|2	PPP2R1A|PPP2R1A	57401049|57401049	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.932000|0.932000	0.56968|0.56968	7.765000|7.765000	0.85310|0.85310	1.819000|1.819000	0.53055|0.53055	0.402000|0.402000	0.26972|0.26972	GAG|AGG	.	.		0.552	PPP2R1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000267967.2	NM_014225	
ZNF808	388558	hgsc.bcm.edu	37	19	53057563	53057563	+	Missense_Mutation	SNP	C	C	T	rs558251598		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:53057563C>T	ENST00000359798.4	+	5	1574	c.1394C>T	c.(1393-1395)aCg>aTg	p.T465M		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	465					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		ACAGCTTTCACGTGTAATTCA	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		21702	0.0		0.001	False		,,,				2504	0.0				p.T465M		Atlas-SNP	.											.	ZNF808	81	.	0			c.C1394T						.						59.0	64.0	62.0					19																	53057563		2201	4298	6499	SO:0001583	missense	388558	exon5			CTTTCACGTGTAA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1394C>T	chr19.hg19:g.53057563C>T	ENSP00000352846:p.Thr465Met	102.0	0.0		52.0	4.0	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	hg19	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	0.032	-1.326287	0.01309	.	.	ENSG00000198482	ENST00000359798	T	0.07800	3.16	1.4	-2.81	0.05805	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06872	0.0175	L	0.41573	1.285	0.09310	N	1	B	0.17038	0.02	B	0.17098	0.017	T	0.24012	-1.0172	9	0.46703	T	0.11	.	6.3442	0.21341	0.0:0.4066:0.3159:0.2775	.	465	Q8N4W9	ZN808_HUMAN	M	465	ENSP00000352846:T465M	ENSP00000352846:T465M	T	+	2	0	ZNF808	57749375	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-5.040000	0.00157	-3.307000	0.00191	-2.208000	0.00301	ACG	.	.		0.413	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF808	388558	hgsc.bcm.edu	37	19	53058144	53058144	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:53058144A>G	ENST00000359798.4	+	5	2155	c.1975A>G	c.(1975-1977)Acc>Gcc	p.T659A		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	659					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		GTGTGGGAAGACCTTCAGTTA	0.423																																					p.T659A		Atlas-SNP	.											.	ZNF808	81	.	0			c.A1975G						.						106.0	110.0	108.0					19																	53058144		2202	4300	6502	SO:0001583	missense	388558	exon5			GGGAAGACCTTCA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1975A>G	chr19.hg19:g.53058144A>G	ENSP00000352846:p.Thr659Ala	73.0	0.0		35.0	4.0	NM_001039886	Q68CN7	Missense_Mutation	SNP	ENST00000359798.4	hg19	CCDS46167.1	.	.	.	.	.	.	.	.	.	.	.	0.160	-1.082320	0.01888	.	.	ENSG00000198482	ENST00000359798	T	0.03745	3.82	1.54	-3.09	0.05331	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01661	0.0053	N	0.21194	0.64	0.09310	N	1	B	0.13594	0.008	B	0.13407	0.009	T	0.48151	-0.9060	9	0.02654	T	1	.	0.0785	0.00029	0.3305:0.1668:0.193:0.3097	.	659	Q8N4W9	ZN808_HUMAN	A	659	ENSP00000352846:T659A	ENSP00000352846:T659A	T	+	1	0	ZNF808	57749956	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-1.297000	0.02759	-0.652000	0.05408	0.254000	0.18369	ACC	.	.		0.423	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
ZNF765	91661	hgsc.bcm.edu	37	19	53911420	53911420	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:53911420A>G	ENST00000396408.3	+	4	729	c.612A>G	c.(610-612)caA>caG	p.Q204Q	ZNF765_ENST00000594030.1_Intron	NM_001040185.1	NP_001035275.1	Q7L2R6	ZN765_HUMAN	zinc finger protein 765	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)	4				GBM - Glioblastoma multiforme(134;0.00379)		TATTCACACAAAAACAGGAAG	0.358																																					p.Q204Q		Atlas-SNP	.											.	ZNF765	61	.	0			c.A612G						.						65.0	66.0	66.0					19																	53911420		2173	4283	6456	SO:0001819	synonymous_variant	91661	exon4			CACACAAAAACAG	BC017357	CCDS46171.1	19q13.41	2013-01-08				ENSG00000196417		"""Zinc fingers, C2H2-type"", ""-"""	25092	protein-coding gene	gene with protein product						12477932	Standard	XR_430215		Approved		uc002qbm.3	Q7L2R6		ENST00000396408.3:c.612A>G	chr19.hg19:g.53911420A>G		155.0	0.0		80.0	4.0	NM_001040185	A8MYG0|B4DF18|B7ZAI5|B9EIL1|Q9BV49	Silent	SNP	ENST00000396408.3	hg19	CCDS46171.1																																																																																			.	.		0.358	ZNF765-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371603.1	NM_138372	
ZNF331	55422	hgsc.bcm.edu	37	19	54081146	54081146	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:54081146C>T	ENST00000253144.9	+	7	2665	c.1332C>T	c.(1330-1332)tgC>tgT	p.C444C	ZNF331_ENST00000511154.1_Silent_p.C444C|ZNF331_ENST00000512387.1_Silent_p.C444C|ZNF331_ENST00000511593.2_Silent_p.C444C|ZNF331_ENST00000411977.2_Silent_p.C444C|ZNF331_ENST00000513999.1_Silent_p.C444C|ZNF331_ENST00000449416.1_Silent_p.C444C	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C444C(1)		NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		GTAAGGAGTGCGGGAAGGCAT	0.488			T	?	follicular thyroid adenoma																																p.C444C		Atlas-SNP	.		Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	ZNF331_ENST00000253144,NS,carcinoma,0,1	ZNF331	66	.	1	Substitution - coding silent(1)	endometrium(1)	c.C1332T						.						77.0	64.0	69.0					19																	54081146		2203	4300	6503	SO:0001819	synonymous_variant	55422	exon5			GGAGTGCGGGAAG	AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.1332C>T	chr19.hg19:g.54081146C>T		49.0	0.0		40.0	2.0	NM_001253801	Q96GJ4	Silent	SNP	ENST00000253144.9	hg19	CCDS33102.1																																																																																			.	.		0.488	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371366.1	NM_018555	
ZFP28	140612	hgsc.bcm.edu	37	19	57066068	57066068	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:57066068C>G	ENST00000301318.3	+	8	1985	c.1914C>G	c.(1912-1914)atC>atG	p.I638M	AC007228.11_ENST00000596587.1_RNA	NM_020828.1	NP_065879.1	Q8NHY6	ZFP28_HUMAN	ZFP28 zinc finger protein	638					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(6)|ovary(1)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	35		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0302)		ATCAGAGAATCCATACTGGAG	0.458																																					p.I638M	Ovarian(124;554 1662 19430 21141 52494)	Atlas-SNP	.											.	ZFP28	99	.	0			c.C1914G						.						82.0	88.0	86.0					19																	57066068		2203	4300	6503	SO:0001583	missense	140612	exon8			GAGAATCCATACT		CCDS12946.1	19q13.43	2013-01-08	2012-11-27			ENSG00000196867		"""Zinc fingers, C2H2-type"", ""-"""	17801	protein-coding gene	gene with protein product			"""zinc finger protein 28 homolog (mouse)"""				Standard	NM_020828		Approved	KIAA1431, mkr5	uc002qnj.3	Q8NHY6		ENST00000301318.3:c.1914C>G	chr19.hg19:g.57066068C>G	ENSP00000301318:p.Ile638Met	77.0	0.0		109.0	31.0	NM_020828	A0JNV6|K7ES88|Q8NHU8|Q9BY30|Q9P2B6	Missense_Mutation	SNP	ENST00000301318.3	hg19	CCDS12946.1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.143204	0.37825	.	.	ENSG00000196867	ENST00000301318	T	0.08720	3.06	3.78	-2.03	0.07365	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41194	D	0.000929	T	0.18341	0.0440	L	0.52905	1.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00175	-1.1955	10	0.59425	D	0.04	.	10.0715	0.42337	0.0:0.4499:0.0:0.5501	.	638	Q8NHY6	ZFP28_HUMAN	M	638	ENSP00000301318:I638M	ENSP00000301318:I638M	I	+	3	3	ZFP28	61757880	0.000000	0.05858	0.987000	0.45799	0.982000	0.71751	-2.749000	0.00793	-0.377000	0.07930	-0.391000	0.06502	ATC	.	.		0.458	ZFP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458409.1	NM_020828	
ZNF551	90233	hgsc.bcm.edu	37	19	58198344	58198344	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:58198344A>C	ENST00000282296.5	+	3	886	c.701A>C	c.(700-702)cAc>cCc	p.H234P	ZNF551_ENST00000596085.1_Intron|ZNF551_ENST00000356715.4_Missense_Mutation_p.H218P|AC003006.7_ENST00000594684.1_Intron|AC003006.7_ENST00000599221.1_Intron			Q7Z340	ZN551_HUMAN	zinc finger protein 551	234					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		GCTTCAAGCCACAAACACACA	0.428																																					p.H234P		Atlas-SNP	.											.	ZNF551	65	.	0			c.A701C						.						87.0	89.0	88.0					19																	58198344		2203	4300	6503	SO:0001583	missense	90233	exon3			CAAGCCACAAACA	BX538151	CCDS12959.1, CCDS12959.2	19q13.43	2013-09-20			ENSG00000204519	ENSG00000204519		"""Zinc fingers, C2H2-type"", ""-"""	25108	protein-coding gene	gene with protein product							Standard	NM_138347		Approved	DKFZp686H1038	uc002qpw.5	Q7Z340	OTTHUMG00000183470	ENST00000282296.5:c.701A>C	chr19.hg19:g.58198344A>C	ENSP00000282296:p.His234Pro	66.0	0.0		99.0	5.0	NM_138347	B4DU22|P17034|Q8N246|Q9BRY1	Missense_Mutation	SNP	ENST00000282296.5	hg19	CCDS12959.2	.	.	.	.	.	.	.	.	.	.	A	2.818	-0.245476	0.05906	.	.	ENSG00000204519	ENST00000356715;ENST00000282296;ENST00000359821	.	.	.	2.34	-0.0395	0.13875	.	.	.	.	.	T	0.27933	0.0688	L	0.36672	1.1	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.20075	-1.0286	8	0.38643	T	0.18	.	4.4502	0.11617	0.6812:0.1971:0.1217:0.0	.	234	Q7Z340	ZN551_HUMAN	P	234;218;128	.	ENSP00000282296:H218P	H	+	2	0	ZNF551	62890156	.	.	0.000000	0.03702	0.008000	0.06430	.	.	-0.236000	0.09753	0.459000	0.35465	CAC	.	.		0.428	ZNF551-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000466803.2	NM_138347	
SNAP25	6616	hgsc.bcm.edu	37	20	10277688	10277688	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:10277688T>C	ENST00000254976.2	+	6	608	c.397T>C	c.(397-399)Ttc>Ctc	p.F133L	SNAP25-AS1_ENST00000421143.2_RNA|SNAP25-AS1_ENST00000453544.1_RNA|SNAP25_ENST00000495883.1_3'UTR|SNAP25_ENST00000304886.2_Missense_Mutation_p.F133L	NM_130811.2	NP_570824.1	P60880	SNP25_HUMAN	synaptosomal-associated protein, 25kDa	133					energy reserve metabolic process (GO:0006112)|glutamate secretion (GO:0014047)|long-term synaptic potentiation (GO:0060291)|neurotransmitter secretion (GO:0007269)|neurotransmitter uptake (GO:0001504)|regulation of establishment of protein localization (GO:0070201)|regulation of insulin secretion (GO:0050796)|regulation of neuron projection development (GO:0010975)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|growth cone (GO:0030426)|membrane (GO:0016020)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|SNARE complex (GO:0031201)|synaptobrevin 2-SNAP-25-syntaxin-1a-complexin I complex (GO:0070032)|trans-Golgi network (GO:0005802)	calcium-dependent protein binding (GO:0048306)			endometrium(1)|large_intestine(2)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	18					Botulinum Toxin Type A(DB00083)	CAGTGGCGGCTTCATCCGCAG	0.498																																					p.F133L		Atlas-SNP	.											.	SNAP25	79	.	0			c.T397C						.						62.0	58.0	60.0					20																	10277688		2203	4300	6503	SO:0001583	missense	6616	exon6			GGCGGCTTCATCC		CCDS13109.1, CCDS13110.1	20p12-p11.2	2008-08-01	2002-08-29		ENSG00000132639	ENSG00000132639			11132	protein-coding gene	gene with protein product	"""resistance to inhibitors of cholinesterase 4 homolog"""	600322	"""synaptosomal-associated protein, 25kD"""	SNAP		8661740, 10692432	Standard	NM_003081		Approved	SNAP-25, RIC-4, RIC4, SEC9, bA416N4.2, dJ1068F16.2	uc002wnr.2	P60880	OTTHUMG00000031863	ENST00000254976.2:c.397T>C	chr20.hg19:g.10277688T>C	ENSP00000254976:p.Phe133Leu	106.0	0.0		104.0	5.0	NM_003081	B2RAU4|D3DW16|D3DW17|P13795|P36974|P70557|P70558|Q53EM2|Q5U0B5|Q8IXK3|Q96FM2|Q9BR45	Missense_Mutation	SNP	ENST00000254976.2	hg19	CCDS13110.1	.	.	.	.	.	.	.	.	.	.	T	17.56	3.419042	0.62622	.	.	ENSG00000132639	ENST00000254976;ENST00000304886	.	.	.	5.86	5.86	0.93980	SNAP-25 (1);	0.000000	0.85682	D	0.000000	T	0.52256	0.1723	L	0.46157	1.445	0.80722	D	1	P;P	0.38827	0.649;0.515	B;B	0.36567	0.228;0.197	T	0.52313	-0.8592	9	0.36615	T	0.2	-4.1915	16.2652	0.82574	0.0:0.0:0.0:1.0	.	133;133	P60880-2;P60880	.;SNP25_HUMAN	L	133	.	ENSP00000254976:F133L	F	+	1	0	SNAP25	10225688	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.040000	0.89188	2.241000	0.73720	0.528000	0.53228	TTC	.	.		0.498	SNAP25-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077976.3	NM_130811	
TTLL9	164395	hgsc.bcm.edu	37	20	30510809	30510809	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:30510809A>G	ENST00000375938.4	+	8	870	c.617A>G	c.(616-618)gAg>gGg	p.E206G	TTLL9_ENST00000375921.2_Missense_Mutation_p.E133G|TTLL9_ENST00000535842.1_Missense_Mutation_p.E206G|TTLL9_ENST00000375934.4_Missense_Mutation_p.E188G|TTLL9_ENST00000310998.4_Missense_Mutation_p.E156G|TTLL9_ENST00000375922.4_Missense_Mutation_p.E133G			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9	206	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			ATTCCCGTGGAGAACTATGTG	0.403																																					p.E206G		Atlas-SNP	.											.	TTLL9	95	.	0			c.A617G						.						163.0	160.0	161.0					20																	30510809		1997	4170	6167	SO:0001583	missense	164395	exon8			CCGTGGAGAACTA	AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.617A>G	chr20.hg19:g.30510809A>G	ENSP00000365105:p.Glu206Gly	84.0	0.0		124.0	6.0	NM_001008409	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Missense_Mutation	SNP	ENST00000375938.4	hg19	CCDS42863.1	.	.	.	.	.	.	.	.	.	.	A	22.1	4.250781	0.80135	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000310998;ENST00000375921;ENST00000375935;ENST00000375934;ENST00000375922	T;T;T;T;T;T	0.05925	3.37;3.37;3.37;3.37;3.37;3.37	4.35	4.35	0.52113	.	0.055930	0.64402	D	0.000001	T	0.21550	0.0519	M	0.66939	2.045	0.58432	D	0.999999	D;D	0.89917	0.992;1.0	D;D	0.77557	0.969;0.99	T	0.00494	-1.1706	10	0.87932	D	0	.	12.5143	0.56024	1.0:0.0:0.0:0.0	.	206;93	Q3SXZ7;B1ANK8	TTLL9_HUMAN;.	G	206;206;156;133;151;188;133	ENSP00000365105:E206G;ENSP00000442515:E206G;ENSP00000308980:E156G;ENSP00000365086:E133G;ENSP00000365100:E188G;ENSP00000365088:E133G	ENSP00000308980:E156G	E	+	2	0	TTLL9	29974470	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	6.607000	0.74163	1.837000	0.53436	0.459000	0.35465	GAG	.	.		0.403	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001008409	
KIAA1755	85449	hgsc.bcm.edu	37	20	36874425	36874425	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:36874425A>G	ENST00000279024.4	-	2	378	c.107T>C	c.(106-108)cTg>cCg	p.L36P		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	36										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				GCCAGAGTCCAGGAGACGGAA	0.612																																					p.L36P		Atlas-SNP	.											.	KIAA1755	145	.	0			c.T107C						.						69.0	61.0	64.0					20																	36874425		2203	4300	6503	SO:0001583	missense	85449	exon2			GAGTCCAGGAGAC	AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.107T>C	chr20.hg19:g.36874425A>G	ENSP00000279024:p.Leu36Pro	86.0	0.0		88.0	4.0	NM_001029864	Q9C0A8	Missense_Mutation	SNP	ENST00000279024.4	hg19	CCDS33467.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.630205	0.87660	.	.	ENSG00000149633	ENST00000279024	T	0.10192	2.9	5.4	5.4	0.78164	.	0.000000	0.38164	N	0.001781	T	0.32912	0.0845	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04178	-1.0971	10	0.87932	D	0	.	14.9112	0.70758	1.0:0.0:0.0:0.0	.	36	Q5JYT7	K1755_HUMAN	P	36	ENSP00000279024:L36P	ENSP00000279024:L36P	L	-	2	0	KIAA1755	36307839	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	9.272000	0.95707	2.172000	0.68678	0.533000	0.62120	CTG	.	.		0.612	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079144.3	NM_001029864	
CHD6	84181	hgsc.bcm.edu	37	20	40052330	40052330	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:40052330T>C	ENST00000373233.3	-	30	4534	c.4357A>G	c.(4357-4359)Aga>Gga	p.R1453G		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1453	Myb-like.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GCTTGTTCTCTCCTAGTCCAC	0.403																																					p.R1453G		Atlas-SNP	.											.	CHD6	312	.	0			c.A4357G						.						107.0	109.0	108.0					20																	40052330		2203	4300	6503	SO:0001583	missense	84181	exon30			GTTCTCTCCTAGT	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.4357A>G	chr20.hg19:g.40052330T>C	ENSP00000362330:p.Arg1453Gly	142.0	0.0		119.0	5.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	ENST00000373233.3	hg19	CCDS13317.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.955273	0.73902	.	.	ENSG00000124177	ENST00000373233	D	0.94723	-3.5	6.02	0.655	0.17839	SANT domain, DNA binding (1);	0.000000	0.64402	D	0.000003	D	0.97281	0.9111	M	0.90425	3.115	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	D	0.97331	0.9950	10	0.87932	D	0	-18.5229	14.5297	0.67915	0.0:0.0:0.4819:0.5181	.	1453	Q8TD26	CHD6_HUMAN	G	1453	ENSP00000362330:R1453G	ENSP00000362330:R1453G	R	-	1	2	CHD6	39485744	1.000000	0.71417	0.858000	0.33744	0.998000	0.95712	3.013000	0.49582	0.113000	0.18004	0.533000	0.62120	AGA	.	.		0.403	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
TOX2	84969	hgsc.bcm.edu	37	20	42694558	42694558	+	Silent	SNP	C	C	G	rs199841880|rs34604629	byFrequency	TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:42694558C>G	ENST00000358131.5	+	6	1321	c.1113C>G	c.(1111-1113)tcC>tcG	p.S371S	TOX2_ENST00000341197.4_Silent_p.S389S|TOX2_ENST00000435864.2_3'UTR|TOX2_ENST00000372999.1_Silent_p.S347S|TOX2_ENST00000423191.2_Silent_p.S347S	NM_001098798.1	NP_001092268.1	Q96NM4	TOX2_HUMAN	TOX high mobility group box family member 2	371					female gonad development (GO:0008585)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to gonadotropin (GO:0034698)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.S347_P348insR(1)		NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(13)|ovary(1)|skin(2)	26		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.00189)			TCAGTGCGTCCCCGCCGCCGC	0.716																																					p.S389S		Atlas-SNP	.											TOX2_ENST00000348077,colon,carcinoma,+2,14	TOX2	158	.	1	Insertion - In frame(1)	haematopoietic_and_lymphoid_tissue(1)	c.C1167G						.						31.0	34.0	33.0					20																	42694558		2201	4298	6499	SO:0001819	synonymous_variant	84969	exon7			TGCGTCCCCGCCG	BC007636	CCDS13324.1, CCDS42875.1, CCDS46603.1	20q13.12	2007-03-20	2007-03-20	2007-03-20					16095	protein-coding gene	gene with protein product	"""granulosa cell HMG box 1"""	611163	"""chromosome 20 open reading frame 100"""	C20orf100		14764631	Standard	NM_001098796		Approved	dJ1108D11.2, GCX-1	uc010ggo.3	Q96NM4		ENST00000358131.5:c.1113C>G	chr20.hg19:g.42694558C>G		51.0	1.0		58.0	3.0	NM_001098797	A8K1J1|E1P5X0|G3XAC7|Q5TE33|Q5TE34|Q5TE35|Q96IC9|Q9BQN5	Silent	SNP	ENST00000358131.5	hg19	CCDS42875.1																																																																																			.	.		0.716	TOX2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079329.2		
KCNB1	3745	hgsc.bcm.edu	37	20	47990149	47990149	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:47990149A>G	ENST00000371741.4	-	2	2114	c.1948T>C	c.(1948-1950)Tct>Cct	p.S650P		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	650					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	AAGAAACTAGAGTGCTGGCTG	0.577																																					p.S650P		Atlas-SNP	.											.	KCNB1	142	.	0			c.T1948C						.						48.0	49.0	49.0					20																	47990149		2203	4300	6503	SO:0001583	missense	3745	exon2			AACTAGAGTGCTG	AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.1948T>C	chr20.hg19:g.47990149A>G	ENSP00000360806:p.Ser650Pro	49.0	0.0		64.0	5.0	NM_004975	Q14193	Missense_Mutation	SNP	ENST00000371741.4	hg19	CCDS13418.1	.	.	.	.	.	.	.	.	.	.	A	3.966	-0.009393	0.07727	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.26223	1.75	5.7	5.7	0.88788	.	0.890365	0.09895	N	0.741882	T	0.27313	0.0670	L	0.43152	1.355	0.44098	D	0.99686	B	0.14012	0.009	B	0.16289	0.015	T	0.03364	-1.1044	10	0.29301	T	0.29	.	15.6259	0.76855	1.0:0.0:0.0:0.0	.	650	Q14721	KCNB1_HUMAN	P	650;605	ENSP00000360806:S650P	ENSP00000360806:S650P	S	-	1	0	KCNB1	47423556	1.000000	0.71417	0.197000	0.23402	0.252000	0.25951	6.778000	0.75043	2.173000	0.68751	0.533000	0.62120	TCT	.	.		0.577	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080374.3	NM_004975	
TMEM189	387521	hgsc.bcm.edu	37	20	48741638	48741638	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:48741638T>C	ENST00000371652.4	-	6	866	c.770A>G	c.(769-771)aAg>aGg	p.K257R	TMEM189_ENST00000371650.5_Missense_Mutation_p.K254R|TMEM189-UBE2V1_ENST00000341698.2_Intron|TMEM189_ENST00000371656.2_Missense_Mutation_p.K182R|TMEM189_ENST00000557021.1_Intron	NM_199129.2	NP_954580			transmembrane protein 189											breast(1)|endometrium(2)|large_intestine(3)|lung(2)	8			BRCA - Breast invasive adenocarcinoma(9;3.02e-07)			TGCCCGAGGCTTCTCGCCCGT	0.582																																					p.K257R	GBM(75;703 1202 5766 12781 15082)	Atlas-SNP	.											.	TMEM189	15	.	0			c.A770G						.						89.0	75.0	80.0					20																	48741638		2203	4300	6503	SO:0001583	missense	387521	exon6			CGAGGCTTCTCGC	AF155120	CCDS13428.1, CCDS54473.1	20q13.13	2007-07-30			ENSG00000240849	ENSG00000240849			16735	protein-coding gene	gene with protein product		610994				11076860	Standard	NM_199129		Approved	Kua		A5PLL7	OTTHUMG00000152625	ENST00000371652.4:c.770A>G	chr20.hg19:g.48741638T>C	ENSP00000360715:p.Lys257Arg	82.0	0.0		100.0	4.0	NM_199129		Missense_Mutation	SNP	ENST00000371652.4	hg19	CCDS13428.1	.	.	.	.	.	.	.	.	.	.	T	14.62	2.590285	0.46214	.	.	ENSG00000240849	ENST00000371650;ENST00000371656;ENST00000371652	T;T	0.45276	0.9;0.91	5.64	5.64	0.86602	Kua-ubiquitin conjugating enzyme hybrid, localisation (1);	.	.	.	.	T	0.32852	0.0843	.	.	.	0.80722	D	1	B;B;B	0.31931	0.015;0.347;0.347	B;B;B	0.28638	0.022;0.092;0.092	T	0.08371	-1.0725	8	0.26408	T	0.33	.	15.8623	0.79035	0.0:0.0:0.0:1.0	.	182;254;257	Q5TGE2;Q5TGE1;A5PLL7	.;.;TM189_HUMAN	R	254;182;257	ENSP00000360713:K254R;ENSP00000360715:K257R	ENSP00000360713:K254R	K	-	2	0	TMEM189	48175045	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.595000	0.82710	2.139000	0.66308	0.533000	0.62120	AAG	.	.		0.582	TMEM189-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080529.1	NM_199129	
EDN3	1908	hgsc.bcm.edu	37	20	57896179	57896179	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:57896179G>T	ENST00000337938.2	+	3	859	c.473G>T	c.(472-474)cGc>cTc	p.R158L	EDN3_ENST00000311585.7_Missense_Mutation_p.R158L|EDN3_ENST00000371028.2_Missense_Mutation_p.R158L|EDN3_ENST00000371025.3_Missense_Mutation_p.R158L|EDN3_ENST00000395654.3_Missense_Mutation_p.R158L	NM_207034.1	NP_996917.1	P14138	EDN3_HUMAN	endothelin 3	158					blood circulation (GO:0008015)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|inositol phosphate-mediated signaling (GO:0048016)|melanocyte differentiation (GO:0030318)|multicellular organismal development (GO:0007275)|neural crest cell migration (GO:0001755)|neuron differentiation (GO:0030182)|neutrophil chemotaxis (GO:0030593)|peptide hormone secretion (GO:0030072)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate (GO:0010460)|positive regulation of hormone secretion (GO:0046887)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|regulation of developmental pigmentation (GO:0048070)|regulation of systemic arterial blood pressure by endothelin (GO:0003100)|regulation of vasoconstriction (GO:0019229)|signal transduction (GO:0007165)|vasoconstriction (GO:0042310)|vein smooth muscle contraction (GO:0014826)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	19	all_lung(29;0.0115)					CCACACTTGCGCTGCGCTTGT	0.567																																					p.R158L		Atlas-SNP	.											.	EDN3	83	.	0			c.G473T						.						112.0	104.0	107.0					20																	57896179		2203	4300	6503	SO:0001583	missense	1908	exon3			ACTTGCGCTGCGC	X52001	CCDS13477.1, CCDS13478.1, CCDS13479.1	20q13.2-q13.3	2013-02-26			ENSG00000124205	ENSG00000124205		"""Endogenous ligands"""	3178	protein-coding gene	gene with protein product		131242					Standard	NM_000114		Approved	ET3	uc002yaq.3	P14138	OTTHUMG00000032867	ENST00000337938.2:c.473G>T	chr20.hg19:g.57896179G>T	ENSP00000337128:p.Arg158Leu	127.0	0.0		187.0	66.0	NM_207034	E1P5I5|Q03229|Q7Z6D2|Q9UGT7	Missense_Mutation	SNP	ENST00000337938.2	hg19	CCDS13477.1	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820469	0.50633	.	.	ENSG00000124205	ENST00000337938;ENST00000311585;ENST00000371028;ENST00000371025;ENST00000395654	D;D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1;-2.1	4.87	4.87	0.63330	Endothelin-like toxin (1);	0.000000	0.85682	D	0.000000	D	0.91872	0.7427	M	0.62723	1.935	0.38627	D	0.951288	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.999;0.999	D	0.93303	0.6678	10	0.87932	D	0	-37.8245	13.8571	0.63534	0.0:0.0:1.0:0.0	.	158;158;158;158	P14138-2;Q7Z6D2;P14138;Q4FAT2	.;.;EDN3_HUMAN;.	L	158	ENSP00000337128:R158L;ENSP00000311854:R158L;ENSP00000360067:R158L;ENSP00000360064:R158L;ENSP00000379015:R158L	ENSP00000311854:R158L	R	+	2	0	EDN3	57329574	1.000000	0.71417	0.933000	0.37362	0.010000	0.07245	5.390000	0.66261	2.409000	0.81822	0.561000	0.74099	CGC	.	.		0.567	EDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079919.2	NM_000114	
ZGPAT	84619	hgsc.bcm.edu	37	20	62340023	62340023	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:62340023T>C	ENST00000328969.5	+	2	218	c.91T>C	c.(91-93)Tct>Cct	p.S31P	ARFRP1_ENST00000607873.1_5'Flank|ARFRP1_ENST00000324228.2_5'Flank|ZGPAT_ENST00000355969.6_Missense_Mutation_p.S31P|ARFRP1_ENST00000609142.1_5'Flank|RP4-583P15.15_ENST00000490623.2_5'Flank|ZGPAT_ENST00000357119.4_Missense_Mutation_p.S31P|ARFRP1_ENST00000440854.1_5'Flank|ARFRP1_ENST00000359715.5_5'Flank|ZGPAT_ENST00000369967.3_Missense_Mutation_p.S31P|ZGPAT_ENST00000448100.2_Missense_Mutation_p.S31P	NM_032527.4	NP_115916.3	Q8N5A5	ZGPAT_HUMAN	zinc finger, CCCH-type with G patch domain	31					negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)	14	all_cancers(38;1.13e-12)|all_epithelial(29;2.64e-14)|Lung NSC(23;4.79e-10)|all_lung(23;1.7e-09)					CCTGGATTCGTCTGAGCAGGC	0.652																																					p.S31P		Atlas-SNP	.											.	ZGPAT	57	.	0			c.T91C						.						30.0	33.0	32.0					20																	62340023		2200	4294	6494	SO:0001583	missense	84619	exon2			GATTCGTCTGAGC	AK027878	CCDS13534.1, CCDS13535.1, CCDS56203.1	20q13.3	2013-01-28	2004-12-01	2004-12-01	ENSG00000197114	ENSG00000197114		"""Zinc fingers, CCCH-type domain containing"", ""G patch domain containing"""	15948	protein-coding gene	gene with protein product			"""KIAA1847"""	KIAA1847		16952911	Standard	NM_181485		Approved	dJ583P15.3, MGC44880, FLJ14972, ZC3HDC9, ZC3H9, GPATC6, GPATCH6, ZIP	uc002ygk.3	Q8N5A5	OTTHUMG00000032998	ENST00000328969.5:c.91T>C	chr20.hg19:g.62340023T>C	ENSP00000332013:p.Ser31Pro	89.0	0.0		122.0	5.0	NM_032527	E1P5K1|Q4VXN9|Q5JWI9|Q5JWJ0|Q8NC55|Q8WUV4|Q96JI0|Q96JU4|Q9H401	Missense_Mutation	SNP	ENST00000328969.5	hg19	CCDS13534.1	.	.	.	.	.	.	.	.	.	.	T	13.08	2.129010	0.37533	.	.	ENSG00000197114	ENST00000448100;ENST00000355969;ENST00000357119;ENST00000431125;ENST00000369967;ENST00000328969	T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95	4.36	0.139	0.14798	.	0.802747	0.11801	N	0.528115	T	0.40743	0.1129	L	0.39898	1.24	0.09310	N	1	D;D;D	0.60160	0.984;0.987;0.984	P;P;P	0.53146	0.67;0.719;0.67	T	0.24154	-1.0168	10	0.46703	T	0.11	-0.0124	6.4878	0.22099	0.1633:0.0:0.3447:0.492	.	31;31;31	Q8N5A5-3;Q8N5A5;Q8N5A5-2	.;ZGPAT_HUMAN;.	P	31	ENSP00000391176:S31P;ENSP00000348242:S31P;ENSP00000349634:S31P;ENSP00000403966:S31P;ENSP00000358984:S31P;ENSP00000332013:S31P	ENSP00000332013:S31P	S	+	1	0	ZGPAT	61810467	0.000000	0.05858	0.004000	0.12327	0.415000	0.31203	-0.101000	0.10973	0.065000	0.16485	0.459000	0.35465	TCT	.	.		0.652	ZGPAT-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000080214.1	NM_181484	
CCT8	10694	hgsc.bcm.edu	37	21	30439969	30439969	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:30439969C>T	ENST00000286788.4	-	4	495	c.289G>A	c.(289-291)Gtt>Att	p.V97I	CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000542732.1_Missense_Mutation_p.V78I|CCT8_ENST00000540844.1_Missense_Mutation_p.V24I	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	97					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						CCATCTCCAACTTCTTGCTCT	0.408																																					p.V97I		Atlas-SNP	.											.	CCT8	38	.	0			c.G289A						.						90.0	84.0	86.0					21																	30439969		2203	4300	6503	SO:0001583	missense	10694	exon4			CTCCAACTTCTTG	Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.289G>A	chr21.hg19:g.30439969C>T	ENSP00000286788:p.Val97Ile	163.0	0.0		119.0	5.0	NM_006585	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	ENST00000286788.4	hg19	CCDS33528.1	.	.	.	.	.	.	.	.	.	.	C	14.57	2.574101	0.45902	.	.	ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844	T;T;T	0.80304	-1.36;-1.36;-1.36	5.55	5.55	0.83447	Chaperonin TCP-1, conserved site (1);	0.057626	0.64402	D	0.000002	T	0.79913	0.4528	L	0.55743	1.74	0.80722	D	1	B;B;B;B;B	0.22346	0.065;0.023;0.065;0.053;0.068	B;B;B;B;B	0.28849	0.095;0.03;0.066;0.039;0.033	T	0.73603	-0.3930	10	0.28530	T	0.3	-24.6387	19.8683	0.96840	0.0:1.0:0.0:0.0	.	24;78;97;97;97	B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990	.;.;.;.;TCPQ_HUMAN	I	97;97;78;24	ENSP00000286788:V97I;ENSP00000444984:V78I;ENSP00000442730:V24I	ENSP00000286788:V97I	V	-	1	0	CCT8	29361840	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.480000	0.81109	2.753000	0.94483	0.655000	0.94253	GTT	.	.		0.408	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171822.1		
KRTAP26-1	388818	hgsc.bcm.edu	37	21	31691918	31691918	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:31691918G>T	ENST00000360542.3	-	1	689	c.436C>A	c.(436-438)Caa>Aaa	p.Q146K		NM_203405.1	NP_981950.1	Q6PEX3	KR261_HUMAN	keratin associated protein 26-1	146						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16						AAGCAGAATTGGGGGCGATAG	0.547																																					p.Q146K		Atlas-SNP	.											.	KRTAP26-1	58	.	0			c.C436A						.						188.0	186.0	187.0					21																	31691918		2203	4300	6503	SO:0001583	missense	388818	exon1			AGAATTGGGGGCG	AB096936	CCDS13588.1	21q22.11	2007-11-23			ENSG00000197683	ENSG00000197683		"""Keratin associated proteins"""	33760	protein-coding gene	gene with protein product							Standard	NM_203405		Approved		uc002ynw.3	Q6PEX3	OTTHUMG00000057766	ENST00000360542.3:c.436C>A	chr21.hg19:g.31691918G>T	ENSP00000353742:p.Gln146Lys	164.0	0.0		140.0	74.0	NM_203405	B0RZD3	Missense_Mutation	SNP	ENST00000360542.3	hg19	CCDS13588.1	.	.	.	.	.	.	.	.	.	.	G	9.470	1.095348	0.20471	.	.	ENSG00000197683	ENST00000360542	T	0.03181	4.02	3.77	-4.27	0.03744	.	1.243450	0.06023	U	0.651676	T	0.02342	0.0072	L	0.32530	0.975	0.09310	N	1	P	0.35307	0.494	B	0.33799	0.17	T	0.42766	-0.9432	10	0.06099	T	0.92	-0.0422	4.7346	0.12982	0.4564:0.31:0.2336:0.0	.	146	Q6PEX3	KR261_HUMAN	K	146	ENSP00000353742:Q146K	ENSP00000353742:Q146K	Q	-	1	0	KRTAP26-1	30613789	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.947000	0.03901	-0.679000	0.05217	-0.140000	0.14226	CAA	.	.		0.547	KRTAP26-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128218.1	NM_203405	
SON	6651	hgsc.bcm.edu	37	21	34923955	34923955	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:34923955A>G	ENST00000356577.4	+	3	2893	c.2418A>G	c.(2416-2418)ttA>ttG	p.L806L	SON_ENST00000290239.6_Silent_p.L806L|SON_ENST00000300278.4_Silent_p.L806L|SON_ENST00000381679.4_Silent_p.L806L|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	806	17 X 10 AA tandem repeats of L-A-[ST]- [NSG]-[TS]-MDSQM.				cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						CCCAGATGTTAGCAACCAGCT	0.512																																					p.L806L		Atlas-SNP	.											.	SON	343	.	0			c.A2418G						.						136.0	135.0	135.0					21																	34923955		2203	4300	6503	SO:0001819	synonymous_variant	6651	exon3			GATGTTAGCAACC	AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.2418A>G	chr21.hg19:g.34923955A>G		98.0	0.0		63.0	4.0	NM_032195	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Silent	SNP	ENST00000356577.4	hg19	CCDS13629.1																																																																																			.	.		0.512	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140978.2	NM_138927	
SIK1	150094	hgsc.bcm.edu	37	21	44838373	44838373	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:44838373C>T	ENST00000270162.6	-	12	1643	c.1511G>A	c.(1510-1512)aGc>aAc	p.S504N		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	504					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	ACTGTCAGAGCTGGTTCCCTC	0.642																																					p.S504N		Atlas-SNP	.											.	SIK1	65	.	0			c.G1511A						.						37.0	39.0	38.0					21																	44838373		2202	4300	6502	SO:0001583	missense	150094	exon12			TCAGAGCTGGTTC	BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1511G>A	chr21.hg19:g.44838373C>T	ENSP00000270162:p.Ser504Asn	86.0	0.0		81.0	7.0	NM_173354	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Missense_Mutation	SNP	ENST00000270162.6	hg19	CCDS33575.1	.	.	.	.	.	.	.	.	.	.	C	11.98	1.799237	0.31869	.	.	ENSG00000142178	ENST00000270162	T	0.73469	-0.75	4.79	4.79	0.61399	.	0.110591	0.64402	D	0.000005	T	0.72867	0.3514	M	0.72118	2.19	0.43688	D	0.996137	B	0.18461	0.028	B	0.13407	0.009	T	0.69558	-0.5113	10	0.17369	T	0.5	.	17.8445	0.88725	0.0:1.0:0.0:0.0	.	504	P57059	SIK1_HUMAN	N	504	ENSP00000270162:S504N	ENSP00000270162:S504N	S	-	2	0	SIK1	43662801	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	4.562000	0.60816	2.205000	0.71048	0.655000	0.94253	AGC	.	.		0.642	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195654.1	NM_173354	
TRAPPC10	7109	hgsc.bcm.edu	37	21	45499543	45499543	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr21:45499543A>G	ENST00000291574.4	+	12	1743	c.1568A>G	c.(1567-1569)aAg>aGg	p.K523R		NM_003274.4	NP_003265.3	P48553	TPC10_HUMAN	trafficking protein particle complex 10	523					sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	sodium ion transmembrane transporter activity (GO:0015081)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(4)	41						CACACAAGGAAGCAGCTGGCC	0.428																																					p.K523R		Atlas-SNP	.											.	TRAPPC10	109	.	0			c.A1568G						.						76.0	73.0	74.0					21																	45499543		2203	4300	6503	SO:0001583	missense	7109	exon12			CAAGGAAGCAGCT	U19252	CCDS13704.1	21q22.3	2008-05-07	2008-05-07	2008-05-07	ENSG00000160218	ENSG00000160218		"""Trafficking protein particle complex"""	11868	protein-coding gene	gene with protein product	"""trafficking protein particle complex subunit 130"", ""TRAPP 130 kDa subunit"""	602103	"""transmembrane protein 1"""	TMEM1		7633421	Standard	NM_003274		Approved	EHOC-1, TRS130	uc002zea.3	P48553	OTTHUMG00000086894	ENST00000291574.4:c.1568A>G	chr21.hg19:g.45499543A>G	ENSP00000291574:p.Lys523Arg	120.0	0.0		97.0	5.0	NM_003274	Q3MIR2|Q86SI7|Q9UMD4|Q9Y4L3	Missense_Mutation	SNP	ENST00000291574.4	hg19	CCDS13704.1	.	.	.	.	.	.	.	.	.	.	A	8.423	0.846747	0.16963	.	.	ENSG00000160218	ENST00000291574	T	0.44881	0.91	5.49	4.34	0.51931	Tetratricopeptide-like helical (1);	0.045343	0.85682	D	0.000000	T	0.24470	0.0593	N	0.21448	0.665	0.39839	D	0.973082	B	0.26445	0.149	B	0.20384	0.029	T	0.06162	-1.0842	10	0.07482	T	0.82	.	11.082	0.48066	0.926:0.0:0.074:0.0	.	523	P48553	TPC10_HUMAN	R	523	ENSP00000291574:K523R	ENSP00000291574:K523R	K	+	2	0	TRAPPC10	44323971	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.064000	0.49986	0.908000	0.36671	0.482000	0.46254	AAG	.	.		0.428	TRAPPC10-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000195737.1	NM_003274	
MYO18B	84700	hgsc.bcm.edu	37	22	26164940	26164940	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:26164940A>G	ENST00000407587.2	+	4	1226	c.1057A>G	c.(1057-1059)Acc>Gcc	p.T353A	MYO18B_ENST00000536101.1_Missense_Mutation_p.T353A|MYO18B_ENST00000335473.7_Missense_Mutation_p.T353A			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	353						cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						TGAGCCTCAGACCCAGATGGA	0.552																																					p.T353A		Atlas-SNP	.											.	MYO18B	322	.	0			c.A1057G						.						35.0	38.0	37.0					22																	26164940		2101	4212	6313	SO:0001583	missense	84700	exon4			CCTCAGACCCAGA	AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.1057A>G	chr22.hg19:g.26164940A>G	ENSP00000386096:p.Thr353Ala	92.0	0.0		80.0	4.0	NM_032608	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	ENST00000407587.2	hg19		.	.	.	.	.	.	.	.	.	.	a	5.433	0.265000	0.10294	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.85955	-2.03;-2.03;-2.05	4.25	-7.05	0.01573	.	3.844790	0.00897	N	0.002311	T	0.68604	0.3019	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.60110	-0.7327	10	0.21540	T	0.41	.	10.2453	0.43336	0.3672:0.1107:0.5221:0.0	.	353;353;353	Q8IUG5;F5GXR6;F5GYU7	MY18B_HUMAN;.;.	A	353	ENSP00000441229:T353A;ENSP00000334563:T353A;ENSP00000386096:T353A	ENSP00000334563:T353A	T	+	1	0	MYO18B	24494940	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-2.095000	0.01350	-1.568000	0.01670	-0.423000	0.05987	ACC	.	.		0.552	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000400691.1	NM_032608	
EWSR1	2130	hgsc.bcm.edu	37	22	29693819	29693819	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:29693819A>G	ENST00000397938.2	+	13	1616	c.1297A>G	c.(1297-1299)Aaa>Gaa	p.K433E	EWSR1_ENST00000331029.7_Missense_Mutation_p.K395E|EWSR1_ENST00000414183.2_Missense_Mutation_p.K438E|EWSR1_ENST00000406548.1_Missense_Mutation_p.K432E|EWSR1_ENST00000332035.6_Missense_Mutation_p.K377E|EWSR1_ENST00000332050.6_Missense_Mutation_p.K360E	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	433	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TGTTCCAGGGAAAGATTTTCA	0.498			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.K438E		Atlas-SNP	.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	.	EWSR1	104	.	0			c.A1312G						.						93.0	88.0	90.0					22																	29693819		2203	4300	6503	SO:0001583	missense	2130	exon14			CCAGGGAAAGATT		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1297A>G	chr22.hg19:g.29693819A>G	ENSP00000381031:p.Lys433Glu	84.0	0.0		85.0	4.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	hg19	CCDS13851.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.0|22.0	4.235372|4.235372	0.79800|0.79800	.|.	.|.	ENSG00000182944|ENSG00000182944	ENST00000360091|ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	.|T;T;T;T;T;T	.|0.08193	.|3.12;3.12;3.12;3.12;3.12;3.12	5.79|5.79	5.79|5.79	0.91817|0.91817	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.000000	.|0.85682	.|U	.|0.000000	T|T	0.27384|0.27384	0.0672|0.0672	M|M	0.64676|0.64676	1.99|1.99	0.80722|0.80722	D|D	1|1	.|D;P;D;D;P	.|0.62365	.|0.988;0.947;0.988;0.991;0.947	.|D;D;D;D;D	.|0.78314	.|0.971;0.941;0.971;0.991;0.941	T|T	0.00448|0.00448	-1.1733|-1.1733	5|10	.|0.72032	.|D	.|0.01	.|.	15.7839|15.7839	0.78286|0.78286	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|377;432;377;438;433	.|Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.|.;.;.;.;EWS_HUMAN	G|E	88|360;433;432;395;438;377	.|ENSP00000330896:K360E;ENSP00000381031:K433E;ENSP00000385726:K432E;ENSP00000330516:K395E;ENSP00000400142:K438E;ENSP00000331699:K377E	.|ENSP00000330516:K395E	E|K	+|+	2|1	0|0	EWSR1|EWSR1	28023819|28023819	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.533000|0.533000	0.34776|0.34776	8.098000|8.098000	0.89540|0.89540	2.208000|2.208000	0.71279|0.71279	0.533000|0.533000	0.62120|0.62120	GAA|AAA	.	.		0.498	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
RTCB	51493	hgsc.bcm.edu	37	22	32792236	32792236	+	Splice_Site	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:32792236T>C	ENST00000216038.5	-	8	913	c.815A>G	c.(814-816)gAt>gGt	p.D272G	RTCB_ENST00000451746.2_Intron|RTCB_ENST00000476619.1_5'Flank	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase																		TACCAGCGCATCTGGAACAAG	0.453																																					p.D272G		Atlas-SNP	.											.	C22orf28	43	.	0			c.A815G						.						113.0	109.0	111.0					22																	32792236		2203	4300	6503	SO:0001630	splice_region_variant	51493	exon8			AGCGCATCTGGAA	BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.815-1A>G	chr22.hg19:g.32792236T>C		105.0	0.0		138.0	6.0	NM_014306		Missense_Mutation	SNP	ENST00000216038.5	hg19	CCDS13905.1	.	.	.	.	.	.	.	.	.	.	T	16.61	3.171446	0.57584	.	.	ENSG00000100220	ENST00000216038	T	0.31769	1.48	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.41994	0.1183	M	0.76574	2.34	0.80722	D	1	B	0.21071	0.051	B	0.30782	0.12	T	0.35425	-0.9789	10	0.87932	D	0	.	16.3947	0.83586	0.0:0.0:0.0:1.0	.	272	Q9Y3I0	RTCB_HUMAN	G	272	ENSP00000216038:D272G	ENSP00000216038:D272G	D	-	2	0	C22orf28	31122236	1.000000	0.71417	1.000000	0.80357	0.460000	0.32559	7.911000	0.87458	2.272000	0.75746	0.459000	0.35465	GAT	.	.		0.453	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075188.3	NM_014306	Missense_Mutation
KCTD17	79734	hgsc.bcm.edu	37	22	37449146	37449146	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:37449146A>G	ENST00000403888.3	+	2	218	c.217A>G	c.(217-219)Acc>Gcc	p.T73A	KCTD17_ENST00000402077.3_Missense_Mutation_p.T73A|RN7SKP214_ENST00000364208.1_RNA	NM_001282684.1	NP_001269613.1	Q8N5Z5	KCD17_HUMAN	potassium channel tetramerization domain containing 17	73	BTB.				protein homooligomerization (GO:0051260)		identical protein binding (GO:0042802)			NS(1)|breast(1)|endometrium(1)|lung(1)|prostate(1)	5						ATAGGATGAGACCGGGGCCTA	0.612																																					p.T73A		Atlas-SNP	.											.	KCTD17	17	.	0			c.A217G						.						78.0	48.0	58.0					22																	37449146		2201	4297	6498	SO:0001583	missense	79734	exon2			GATGAGACCGGGG	BC025403	CCDS13940.2, CCDS74854.1, CCDS74855.1	22q12.3	2013-06-20	2013-06-20		ENSG00000100379	ENSG00000100379			25705	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 17"""			12477932	Standard	XM_005261741		Approved	FLJ12242	uc011amv.2	Q8N5Z5	OTTHUMG00000150532	ENST00000403888.3:c.217A>G	chr22.hg19:g.37449146A>G	ENSP00000385096:p.Thr73Ala	85.0	0.0		125.0	5.0	NM_024681	B0QYA9|B0QYB0|O95517	Missense_Mutation	SNP	ENST00000403888.3	hg19		.	.	.	.	.	.	.	.	.	.	A	16.64	3.178637	0.57692	.	.	ENSG00000100379	ENST00000402077;ENST00000403888;ENST00000431531	T;T;T	0.76709	-1.04;-1.04;-1.04	4.01	4.01	0.46588	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.49305	D	0.000160	T	0.75140	0.3809	M	0.72353	2.195	0.52099	D	0.999944	B;B;B;B	0.31879	0.344;0.011;0.113;0.004	B;B;B;B	0.35353	0.201;0.022;0.171;0.037	T	0.75230	-0.3391	10	0.49607	T	0.09	-4.8341	8.6704	0.34147	0.8299:0.0:0.0:0.1701	.	73;64;73;27	Q8N5Z5-2;E9PCZ8;Q8N5Z5;B0QYB1	.;.;KCD17_HUMAN;.	A	73;73;34	ENSP00000384391:T73A;ENSP00000385096:T73A;ENSP00000402434:T34A	ENSP00000384391:T73A	T	+	1	0	KCTD17	35779092	1.000000	0.71417	0.999000	0.59377	0.973000	0.67179	4.722000	0.61958	1.674000	0.50907	0.482000	0.46254	ACC	.	.		0.612	KCTD17-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000318781.1	NM_024681	
RAC2	5880	hgsc.bcm.edu	37	22	37622734	37622734	+	Silent	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:37622734C>T	ENST00000249071.6	-	6	679	c.558G>A	c.(556-558)aaG>aaA	p.K186K	RAC2_ENST00000406508.1_Silent_p.K142K|RAC2_ENST00000405484.1_Silent_p.K179K	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	186					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	TGCAGGCGCGCTTCTGCTGCC	0.627																																					p.K186K		Atlas-SNP	.											.	RAC2	22	.	0			c.G558A						.						49.0	51.0	50.0					22																	37622734		2203	4299	6502	SO:0001819	synonymous_variant	5880	exon6			GGCGCGCTTCTGC	M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.558G>A	chr22.hg19:g.37622734C>T		55.0	0.0		70.0	24.0	NM_002872	Q9UDJ4	Silent	SNP	ENST00000249071.6	hg19	CCDS13945.1																																																																																			.	.		0.627	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318812.1		
GCAT	23464	hgsc.bcm.edu	37	22	38208955	38208955	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:38208955T>C	ENST00000248924.6	+	3	445	c.389T>C	c.(388-390)cTc>cCc	p.L130P	GCAT_ENST00000323205.6_Missense_Mutation_p.L156P|GCAT_ENST00000415371.1_3'UTR	NM_014291.3	NP_055106.1	O75600	KBL_HUMAN	glycine C-acetyltransferase	130					biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|L-threonine catabolic process to glycine (GO:0019518)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	glycine C-acetyltransferase activity (GO:0008890)|pyridoxal phosphate binding (GO:0030170)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|skin(1)	12	Melanoma(58;0.045)				Glycine(DB00145)	GATGCCATCCTCTATCCCAGC	0.552																																					p.L156P		Atlas-SNP	.											.	GCAT	27	.	0			c.T467C						.						92.0	83.0	86.0					22																	38208955		2203	4300	6503	SO:0001583	missense	23464	exon3			CCATCCTCTATCC	AF077740	CCDS13957.1, CCDS54527.1	22q13.1	2010-01-19	2010-01-19		ENSG00000100116	ENSG00000100116	2.3.1.29		4188	protein-coding gene	gene with protein product	"""2-amino-3-ketobutyrate coenzyme A ligase"""	607422	"""glycine C-acetyltransferase (2-amino-3-ketobutyrate coenzyme A ligase)"""				Standard	NM_014291		Approved	KBL	uc003aua.2	O75600	OTTHUMG00000150664	ENST00000248924.6:c.389T>C	chr22.hg19:g.38208955T>C	ENSP00000248924:p.Leu130Pro	77.0	0.0		95.0	5.0	NM_001171690	E2QC23|Q6ZWF1|Q96CA9	Missense_Mutation	SNP	ENST00000248924.6	hg19	CCDS13957.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	23.6|23.6	4.433902|4.433902	0.83776|0.83776	.|.	.|.	ENSG00000100116|ENSG00000100116	ENST00000323205;ENST00000248924;ENST00000445195;ENST00000394944|ENST00000451984	D;D;D|.	0.91945|.	-2.94;-2.94;-2.94|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.90745|0.90745	0.7095|0.7095	H|H	0.99011|0.99011	4.4|4.4	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	1.0;1.0|.	D|D	0.94428|0.94428	0.7647|0.7647	10|5	0.87932|.	D|.	0|.	-27.9058|-27.9058	15.742|15.742	0.77905|0.77905	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	156;130|.	E2QC23;O75600|.	.;KBL_HUMAN|.	P|P	156;130;156;156|115	ENSP00000371110:L156P;ENSP00000248924:L130P;ENSP00000406719:L156P|.	ENSP00000248924:L130P|.	L|S	+|+	2|1	0|0	GCAT|GCAT	36538901|36538901	1.000000|1.000000	0.71417|0.71417	0.982000|0.982000	0.44146|0.44146	0.835000|0.835000	0.47333|0.47333	7.359000|7.359000	0.79477|0.79477	2.137000|2.137000	0.66172|0.66172	0.533000|0.533000	0.62120|0.62120	CTC|TCT	.	.		0.552	GCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319506.1	NM_014291.2	
TNRC6B	23112	hgsc.bcm.edu	37	22	40708594	40708594	+	Silent	SNP	G	G	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:40708594G>T	ENST00000454349.2	+	18	4732	c.4521G>T	c.(4519-4521)ggG>ggT	p.G1507G	TNRC6B_ENST00000301923.9_Silent_p.G703G|TNRC6B_ENST00000402203.1_Silent_p.G703G|TNRC6B_ENST00000335727.9_Silent_p.G1397G	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	1507	Silencing domain; interaction with CNOT1 and PAN3.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						GTGTGCTGGGGGGTACAGCCA	0.488																																					p.G1507G		Atlas-SNP	.											.	TNRC6B	195	.	0			c.G4521T						.						126.0	124.0	125.0					22																	40708594		2014	4191	6205	SO:0001819	synonymous_variant	23112	exon18			GCTGGGGGGTACA	AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.4521G>T	chr22.hg19:g.40708594G>T		123.0	0.0		116.0	46.0	NM_001162501	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Silent	SNP	ENST00000454349.2	hg19	CCDS54533.1	.	.	.	.	.	.	.	.	.	.	G	9.640	1.138665	0.21123	.	.	ENSG00000100354	ENST00000446273	T	0.15256	2.44	5.16	1.97	0.26223	.	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.01889	-1.1253	7	0.52906	T	0.07	-0.7393	9.7368	0.40392	0.2229:0.0:0.7771:0.0	.	.	.	.	V	1193	ENSP00000409429:G1193V	ENSP00000409429:G1193V	G	+	2	0	TNRC6B	39038540	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.372000	0.44257	0.580000	0.29522	0.655000	0.94253	GGG	.	.		0.488	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	protein_coding			
DESI1	27351	hgsc.bcm.edu	37	22	42003333	42003333	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:42003333T>C	ENST00000263256.6	-	3	369	c.113A>G	c.(112-114)cAc>cGc	p.H38R		NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	38	PPPDE peptidase.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)										TATGGATGTGTGCCTGTCACA	0.473																																					p.H38R		Atlas-SNP	.											.	.	.	.	0			c.A113G						.						75.0	58.0	64.0					22																	42003333		2203	4300	6503	SO:0001583	missense	27351	exon3			GATGTGTGCCTGT	AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.113A>G	chr22.hg19:g.42003333T>C	ENSP00000263256:p.His38Arg	56.0	0.0		86.0	5.0	NM_015704		Missense_Mutation	SNP	ENST00000263256.6	hg19	CCDS33652.1	.	.	.	.	.	.	.	.	.	.	T	28.3	4.912565	0.92178	.	.	ENSG00000100418	ENST00000263256	.	.	.	5.98	5.98	0.97165	Domain of unknown function DUF862, eukaryotic (1);	0.152394	0.64402	D	0.000013	D	0.88581	0.6475	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92476	0.5989	9	0.87932	D	0	-25.5249	16.4728	0.84119	0.0:0.0:0.0:1.0	.	38	Q6ICB0	PPDE2_HUMAN	R	38	.	ENSP00000263256:H38R	H	-	2	0	PPPDE2	40333279	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.296000	0.77279	0.482000	0.46254	CAC	.	.		0.473	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000104124.3	NM_015704	
PACSIN2	11252	hgsc.bcm.edu	37	22	43284655	43284655	+	Silent	SNP	A	A	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43284655A>C	ENST00000263246.3	-	5	804	c.603T>G	c.(601-603)gtT>gtG	p.V201V	PACSIN2_ENST00000402229.1_Silent_p.V201V|PACSIN2_ENST00000407585.1_Silent_p.V201V|PACSIN2_ENST00000403744.3_Silent_p.V201V|PACSIN2_ENST00000337959.4_Silent_p.V201V	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	201	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				TTACCTTAAGAACATCTTGCT	0.453																																					p.V201V		Atlas-SNP	.											.	PACSIN2	48	.	0			c.T603G						.						252.0	237.0	242.0					22																	43284655		2009	4158	6167	SO:0001819	synonymous_variant	11252	exon5			CTTAAGAACATCT	AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.603T>G	chr22.hg19:g.43284655A>C		201.0	0.0		235.0	103.0	NM_007229	O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Silent	SNP	ENST00000263246.3	hg19	CCDS43023.1																																																																																			.	.		0.453	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319665.1	NM_007229	
MCAT	27349	hgsc.bcm.edu	37	22	43538972	43538972	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43538972G>A	ENST00000290429.6	-	1	428	c.383C>T	c.(382-384)tCg>tTg	p.S128L	MCAT_ENST00000327555.5_Missense_Mutation_p.S128L|MCAT_ENST00000464244.1_5'UTR	NM_173467.4	NP_775738.3	Q8IVS2	FABD_HUMAN	malonyl CoA:ACP acyltransferase (mitochondrial)	128					fatty acid biosynthetic process (GO:0006633)|metabolic process (GO:0008152)	mitochondrion (GO:0005739)	[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)	p.S128L(1)		breast(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	11		Ovarian(80;0.0694)				AGCGGCCAGCGATGCCACGAA	0.682																																					p.S128L		Atlas-SNP	.											MCAT,bladder,carcinoma,0,1	MCAT	26	.	1	Substitution - Missense(1)	urinary_tract(1)	c.C383T						.						18.0	16.0	17.0					22																	43538972		2200	4299	6499	SO:0001583	missense	27349	exon1			GCCAGCGATGCCA	AL359401	CCDS14045.1, CCDS33660.1	22q13.2	2010-04-27			ENSG00000100294	ENSG00000100294	2.3.1.39		29622	protein-coding gene	gene with protein product		614479				12882974	Standard	NM_173467		Approved	MT, MCT, fabD, FASN2C, NET62	uc003bdl.1	Q8IVS2	OTTHUMG00000150704	ENST00000290429.6:c.383C>T	chr22.hg19:g.43538972G>A	ENSP00000290429:p.Ser128Leu	136.0	0.0		197.0	70.0	NM_014507	B0QY72|O95510|O95511	Missense_Mutation	SNP	ENST00000290429.6	hg19	CCDS33660.1	.	.	.	.	.	.	.	.	.	.	G	32	5.190008	0.94923	.	.	ENSG00000100294	ENST00000327555;ENST00000290429	T;T	0.42513	0.97;0.97	4.6	4.6	0.57074	Acyl transferase/acyl hydrolase/lysophospholipase (1);Acyl transferase (1);Acyl transferase domain (1);	0.000000	0.85682	D	0.000000	T	0.76772	0.4034	H	0.96970	3.915	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.85868	0.1414	10	0.87932	D	0	-35.372	17.6259	0.88093	0.0:0.0:1.0:0.0	.	128;128	B0QY72;Q8IVS2	.;FABD_HUMAN	L	128	ENSP00000331306:S128L;ENSP00000290429:S128L	ENSP00000290429:S128L	S	-	2	0	MCAT	41868916	1.000000	0.71417	0.977000	0.42913	0.603000	0.37013	7.895000	0.87343	2.394000	0.81467	0.467000	0.42956	TCG	.	.		0.682	MCAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319677.2	NM_173467	
SCUBE1	80274	hgsc.bcm.edu	37	22	43614330	43614330	+	Missense_Mutation	SNP	T	T	C	rs34722413		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:43614330T>C	ENST00000360835.4	-	15	1948	c.1822A>G	c.(1822-1824)Agg>Ggg	p.R608G		NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	608					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TTGGCTGGCCTCTGGGCTACC	0.632																																					p.R608G		Atlas-SNP	.											.	SCUBE1	105	.	0			c.A1822G						.						97.0	97.0	97.0					22																	43614330		2203	4300	6503	SO:0001583	missense	80274	exon15			CTGGCCTCTGGGC		CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.1822A>G	chr22.hg19:g.43614330T>C	ENSP00000354080:p.Arg608Gly	89.0	0.0		146.0	6.0	NM_173050	Q5R336	Missense_Mutation	SNP	ENST00000360835.4	hg19	CCDS14048.1	.	.	.	.	.	.	.	.	.	.	T	14.10	2.433707	0.43224	.	.	ENSG00000159307	ENST00000360835;ENST00000381243	D	0.85339	-1.97	4.29	-1.18	0.09617	.	0.580008	0.18197	N	0.148642	T	0.77485	0.4137	L	0.50333	1.59	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.68021	-0.5519	10	0.87932	D	0	.	7.5505	0.27793	0.1022:0.0:0.2212:0.6767	.	608	Q8IWY4	SCUB1_HUMAN	G	608;238	ENSP00000354080:R608G	ENSP00000354080:R608G	R	-	1	2	SCUBE1	41944274	1.000000	0.71417	0.993000	0.49108	0.947000	0.59692	1.207000	0.32333	0.032000	0.15435	-0.459000	0.05422	AGG	.	.		0.632	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319582.3	NM_173050	
DENND6B	414918	hgsc.bcm.edu	37	22	50752089	50752089	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr22:50752089A>G	ENST00000413817.3	-	15	1339	c.1268T>C	c.(1267-1269)cTc>cCc	p.L423P	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	423					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GCTCTGGGTGAGCTCCAGGAG	0.716																																					p.L423P		Atlas-SNP	.											.	.	.	.	0			c.T1268C						.						10.0	12.0	11.0					22																	50752089		1926	4107	6033	SO:0001583	missense	414918	exon15			TGGGTGAGCTCCA	AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1268T>C	chr22.hg19:g.50752089A>G	ENSP00000391524:p.Leu423Pro	55.0	0.0		65.0	5.0	NM_001001794	A6X8I5	Missense_Mutation	SNP	ENST00000413817.3	hg19	CCDS46732.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977222	0.74360	.	.	ENSG00000205593	ENST00000413817	.	.	.	4.82	4.82	0.62117	.	0.212047	0.41605	D	0.000848	T	0.76198	0.3954	M	0.84082	2.675	0.80722	D	1	D;D	0.63880	0.993;0.993	P;P	0.58721	0.844;0.844	T	0.80580	-0.1319	9	0.87932	D	0	-32.2663	12.3145	0.54948	1.0:0.0:0.0:0.0	.	423;423	Q8NEG7;C9JIV6	F116B_HUMAN;.	P	423	.	ENSP00000391524:L423P	L	-	2	0	FAM116B	49094661	1.000000	0.71417	0.998000	0.56505	0.892000	0.51952	6.255000	0.72466	1.793000	0.52555	0.379000	0.24179	CTC	.	.		0.716	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316845.3	NM_001001794	
STS	412	hgsc.bcm.edu	37	X	7268085	7268085	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:7268085G>A	ENST00000217961.4	+	10	1755	c.1535G>A	c.(1534-1536)aGa>aAa	p.R512K		NM_000351.4	NP_000342.2	P08842	STS_HUMAN	steroid sulfatase (microsomal), isozyme S	512					cellular protein metabolic process (GO:0044267)|epidermis development (GO:0008544)|female pregnancy (GO:0007565)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|steroid catabolic process (GO:0006706)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|steryl-sulfatase activity (GO:0004773)|sulfuric ester hydrolase activity (GO:0008484)			NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|prostate(2)|skin(1)	27		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)			Norelgestromin(DB06713)	CCCAGAGAGAGAAACCCACTA	0.517									Ichthyosis																												p.R512K		Atlas-SNP	.											.	STS	64	.	0			c.G1535A						.						71.0	61.0	65.0					X																	7268085		2203	4299	6502	SO:0001583	missense	412	exon10	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GAGAGAGAAACCC	M16505	CCDS14127.1	Xp22.32	2013-06-10	2007-07-19		ENSG00000101846	ENSG00000101846	3.1.6.2	"""Arylsulfatase family"""	11425	protein-coding gene	gene with protein product	"""arylsulfatase C"""	300747	"""steroid sulfatase (microsomal), arylsulfatase C, isozyme S"""	ARSC1			Standard	NM_000351		Approved	ARSC	uc004cry.4	P08842	OTTHUMG00000021102	ENST00000217961.4:c.1535G>A	chrX.hg19:g.7268085G>A	ENSP00000217961:p.Arg512Lys	43.0	0.0		67.0	6.0	NM_000351	B2RA47	Missense_Mutation	SNP	ENST00000217961.4	hg19	CCDS14127.1	.	.	.	.	.	.	.	.	.	.	G	3.707	-0.060332	0.07317	.	.	ENSG00000101846	ENST00000217961	D	0.88896	-2.44	4.22	1.34	0.21922	Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.531849	0.19903	N	0.103469	T	0.70474	0.3228	N	0.12502	0.225	0.09310	N	0.999996	B	0.02656	0.0	B	0.04013	0.001	T	0.54397	-0.8300	10	0.06891	T	0.86	.	3.1784	0.06576	0.4155:0.209:0.3755:0.0	.	512	P08842	STS_HUMAN	K	512	ENSP00000217961:R512K	ENSP00000217961:R512K	R	+	2	0	STS	7278085	0.026000	0.19158	0.009000	0.14445	0.018000	0.09664	0.142000	0.16096	0.143000	0.18926	0.600000	0.82982	AGA	.	.		0.517	STS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055686.1	NM_000351	
ARHGAP6	395	hgsc.bcm.edu	37	X	11682867	11682867	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:11682867A>G	ENST00000337414.4	-	1	954	c.82T>C	c.(82-84)Tcc>Ccc	p.S28P	ARHGAP6_ENST00000380718.1_Missense_Mutation_p.S28P|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.S28P	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	28					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TTCCTCTTGGAGAAGCCCTTG	0.721																																					p.S28P		Atlas-SNP	.											.	ARHGAP6	130	.	0			c.T82C						.						6.0	8.0	7.0					X																	11682867		1808	3559	5367	SO:0001583	missense	395	exon1			TCTTGGAGAAGCC	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.82T>C	chrX.hg19:g.11682867A>G	ENSP00000338967:p.Ser28Pro	50.0	0.0		70.0	4.0	NM_006125	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	hg19	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	A	16.10	3.026337	0.54683	.	.	ENSG00000047648	ENST00000337414;ENST00000380718;ENST00000380732	T;T;T	0.35421	1.75;1.61;1.31	4.29	4.29	0.51040	.	.	.	.	.	T	0.37348	0.1000	N	0.24115	0.695	0.80722	D	1	D;D	0.65815	0.982;0.995	P;P	0.56278	0.764;0.795	T	0.24693	-1.0153	9	0.66056	D	0.02	.	10.4807	0.44691	1.0:0.0:0.0:0.0	.	28;28	O43182-2;O43182	.;RHG06_HUMAN	P	28	ENSP00000338967:S28P;ENSP00000370094:S28P;ENSP00000370108:S28P	ENSP00000338967:S28P	S	-	1	0	ARHGAP6	11592788	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.281000	0.65609	1.596000	0.50062	0.481000	0.45027	TCC	.	.		0.721	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
EGFL6	25975	hgsc.bcm.edu	37	X	13624532	13624532	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:13624532T>C	ENST00000361306.1	+	6	812	c.555T>C	c.(553-555)tgT>tgC	p.C185C	EGFL6_ENST00000380602.3_Silent_p.C185C	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	185	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						AAGTCATCTGTCCCTACAATC	0.418																																					p.C185C		Atlas-SNP	.											.	EGFL6	111	.	0			c.T555C						.						208.0	166.0	180.0					X																	13624532		2203	4300	6503	SO:0001819	synonymous_variant	25975	exon6			CATCTGTCCCTAC	AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.555T>C	chrX.hg19:g.13624532T>C		95.0	0.0		88.0	5.0	NM_001167890	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Silent	SNP	ENST00000361306.1	hg19	CCDS14155.1																																																																																			.	.		0.418	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055800.1	NM_015507	
RBBP7	5931	hgsc.bcm.edu	37	X	16876872	16876872	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:16876872A>G	ENST00000380087.2	-	4	768	c.408T>C	c.(406-408)ccT>ccC	p.P136P	RBBP7_ENST00000404022.1_Silent_p.P127P|RBBP7_ENST00000380084.4_Silent_p.P180P			Q16576	RBBP7_HUMAN	retinoblastoma binding protein 7	136					cell proliferation (GO:0008283)|cellular heat acclimation (GO:0070370)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of cell growth (GO:0030308)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	RNA binding (GO:0003723)			biliary_tract(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	25	Hepatocellular(33;0.0997)					CAATGATGTGAGGATTCTGCG	0.368																																					p.P180P		Atlas-SNP	.											.	RBBP7	58	.	0			c.T540C						.						255.0	206.0	222.0					X																	16876872		2203	4300	6503	SO:0001819	synonymous_variant	5931	exon4			GATGTGAGGATTC	U35143	CCDS14179.1, CCDS56598.1	Xp22.22	2013-01-10	2001-11-28		ENSG00000102054	ENSG00000102054		"""WD repeat domain containing"""	9890	protein-coding gene	gene with protein product	"""G1/S transition control protein-binding protein RbAp46"", ""retinoblastoma-binding protein 7"", ""retinoblastoma-binding protein RbAp46"", ""histone acetyltransferase type B subunit 2"", ""retinoblastoma-binding protein p46"""	300825	"""retinoblastoma-binding protein 7"""			7503932	Standard	NM_002893		Approved	RbAp46	uc004cxs.2	Q16576	OTTHUMG00000021198	ENST00000380087.2:c.408T>C	chrX.hg19:g.16876872A>G		81.0	0.0		86.0	4.0	NM_001198719	Q5JP00	Silent	SNP	ENST00000380087.2	hg19	CCDS14179.1																																																																																			.	.		0.368	RBBP7-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055920.2	NM_002893	
PTCHD1	139411	hgsc.bcm.edu	37	X	23411617	23411617	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:23411617T>C	ENST00000379361.4	+	3	2842	c.1982T>C	c.(1981-1983)cTc>cCc	p.L661P		NM_173495.2	NP_775766.2	Q96NR3	PTHD1_HUMAN	patched domain containing 1	661					cognition (GO:0050890)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(4)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|ovary(4)|skin(2)|urinary_tract(2)	42						AGAGAAGAACTCTATGATCTC	0.438																																					p.L661P		Atlas-SNP	.											.	PTCHD1	213	.	0			c.T1982C						.						72.0	68.0	69.0					X																	23411617		2203	4300	6503	SO:0001583	missense	139411	exon3			AAGAACTCTATGA	AK054858	CCDS35215.2	Xp22.13	2008-02-05			ENSG00000165186	ENSG00000165186			26392	protein-coding gene	gene with protein product		300828					Standard	NM_173495		Approved	FLJ30296	uc004dal.4	Q96NR3	OTTHUMG00000021251	ENST00000379361.4:c.1982T>C	chrX.hg19:g.23411617T>C	ENSP00000368666:p.Leu661Pro	86.0	0.0		94.0	6.0	NM_173495	B4DQH0|Q0IJ60|Q6P6B8	Missense_Mutation	SNP	ENST00000379361.4	hg19	CCDS35215.2	.	.	.	.	.	.	.	.	.	.	T	16.20	3.055954	0.55325	.	.	ENSG00000165186	ENST00000379361	D	0.85861	-2.04	5.48	5.48	0.80851	.	0.058057	0.64402	D	0.000001	D	0.82641	0.5081	N	0.14661	0.345	0.80722	D	1	D	0.55800	0.973	P	0.56163	0.793	D	0.83714	0.0189	10	0.39692	T	0.17	.	14.5487	0.68050	0.0:0.0:0.0:1.0	.	661	Q96NR3	PTHD1_HUMAN	P	661	ENSP00000368666:L661P	ENSP00000368666:L661P	L	+	2	0	PTCHD1	23321538	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.694000	0.84235	1.816000	0.52996	0.486000	0.48141	CTC	.	.		0.438	PTCHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056047.2	NM_173495	
FAM47C	442444	hgsc.bcm.edu	37	X	37026590	37026590	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:37026590G>A	ENST00000358047.3	+	1	159	c.107G>A	c.(106-108)aGg>aAg	p.R36K		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	36										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						CGCAAGCACAGGCGCCTGAGG	0.617																																					p.R36K		Atlas-SNP	.											.	FAM47C	267	.	0			c.G107A						.						27.0	26.0	27.0					X																	37026590		2202	4296	6498	SO:0001583	missense	442444	exon1			AGCACAGGCGCCT	AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.107G>A	chrX.hg19:g.37026590G>A	ENSP00000367913:p.Arg36Lys	281.0	0.0		313.0	218.0	NM_001013736	Q6ZU46	Missense_Mutation	SNP	ENST00000358047.3	hg19	CCDS35227.1	.	.	.	.	.	.	.	.	.	.	G	10.99	1.506146	0.26949	.	.	ENSG00000198173	ENST00000358047	T	0.19394	2.15	0.462	-0.569	0.11756	.	.	.	.	.	T	0.16128	0.0388	L	0.56769	1.78	0.09310	N	1	B	0.28783	0.222	B	0.27170	0.077	T	0.35895	-0.9770	8	0.15066	T	0.55	.	.	.	.	.	36	Q5HY64	FA47C_HUMAN	K	36	ENSP00000367913:R36K	ENSP00000367913:R36K	R	+	2	0	FAM47C	36936511	0.000000	0.05858	0.009000	0.14445	0.050000	0.14768	0.040000	0.13905	-0.369000	0.08028	0.287000	0.19450	AGG	.	.		0.617	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060508.1	NM_001013736	
TSPYL2	64061	hgsc.bcm.edu	37	X	53115071	53115071	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:53115071T>C	ENST00000375442.4	+	6	1629	c.1497T>C	c.(1495-1497)gcT>gcC	p.A499A		NM_022117.3	NP_071400.1	Q9H2G4	TSYL2_HUMAN	TSPY-like 2	499	Asn-rich.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|chromatin modification (GO:0016568)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA replication (GO:0008156)|nucleosome assembly (GO:0006334)|regulation of protein kinase activity (GO:0045859)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	rDNA binding (GO:0000182)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(1)	19						acgagagtgctgatgaccacg	0.448																																					p.A499A		Atlas-SNP	.											.	TSPYL2	53	.	0			c.T1497C						.						240.0	173.0	196.0					X																	53115071		2203	4300	6503	SO:0001819	synonymous_variant	64061	exon6			GAGTGCTGATGAC	AF273046	CCDS14350.1	Xp11	2014-06-09			ENSG00000184205	ENSG00000184205			24358	protein-coding gene	gene with protein product		300564				11318608, 11395479	Standard	NM_022117		Approved	SE20-4, HRIHFB2216, CTCL, DENTT, CDA1, CINAP, TSPX	uc004drw.3	Q9H2G4	OTTHUMG00000021597	ENST00000375442.4:c.1497T>C	chrX.hg19:g.53115071T>C		78.0	0.0		76.0	4.0	NM_022117	O94799|Q96DG7|Q9BZW6	Silent	SNP	ENST00000375442.4	hg19	CCDS14350.1																																																																																			.	.		0.448	TSPYL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056718.1	NM_022117	
KDM5C	8242	hgsc.bcm.edu	37	X	53228324	53228324	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:53228324T>C	ENST00000375401.3	-	15	2610	c.2078A>G	c.(2077-2079)gAg>gGg	p.E693G	KDM5C_ENST00000404049.3_Missense_Mutation_p.E692G|KDM5C_ENST00000465402.1_5'Flank|KDM5C_ENST00000375383.3_Missense_Mutation_p.E652G|KDM5C_ENST00000452825.3_Missense_Mutation_p.E626G|KDM5C_ENST00000375379.3_Missense_Mutation_p.E693G	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	693					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						AGCCTCTCGCTCAGCCTCTGT	0.522			"""N, F, S"""		clear cell renal carcinoma																																p.E693G		Atlas-SNP	.		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	.	KDM5C	385	.	0			c.A2078G						.						134.0	113.0	120.0					X																	53228324		2203	4300	6503	SO:0001583	missense	8242	exon15			TCTCGCTCAGCCT	Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.2078A>G	chrX.hg19:g.53228324T>C	ENSP00000364550:p.Glu693Gly	101.0	0.0		123.0	6.0	NM_004187	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Missense_Mutation	SNP	ENST00000375401.3	hg19	CCDS14351.1	.	.	.	.	.	.	.	.	.	.	t	21.9	4.223376	0.79464	.	.	ENSG00000126012	ENST00000452825;ENST00000375401;ENST00000404049;ENST00000375379;ENST00000375383	D;D;D;D;D	0.87887	-2.31;-2.02;-2.02;-2.02;-2.16	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.91533	0.7326	M	0.81942	2.565	0.58432	D	0.999997	P;D;D	0.55385	0.735;0.971;0.971	P;P;P	0.58172	0.549;0.834;0.834	D	0.92260	0.5816	10	0.87932	D	0	-6.9073	11.2689	0.49127	0.0:0.0:0.0:1.0	.	626;692;693	F5H3T1;B0QZ44;P41229	.;.;KDM5C_HUMAN	G	626;693;692;693;652	ENSP00000445176:E626G;ENSP00000364550:E693G;ENSP00000385394:E692G;ENSP00000364528:E693G;ENSP00000364532:E652G	ENSP00000364528:E693G	E	-	2	0	KDM5C	53245049	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.899000	0.87370	1.556000	0.49512	0.422000	0.28245	GAG	.	.		0.522	KDM5C-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056737.2	NM_004187	
TEX11	56159	hgsc.bcm.edu	37	X	69964030	69964030	+	Silent	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:69964030A>G	ENST00000395889.2	-	11	932	c.777T>C	c.(775-777)acT>acC	p.T259T	TEX11_ENST00000344304.3_Silent_p.T259T|TEX11_ENST00000374333.2_Silent_p.T244T	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	259					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TTTCTGGCCCAGTAGATTTCT	0.269																																					p.T259T		Atlas-SNP	.											.	TEX11	132	.	0			c.T777C						.						45.0	39.0	41.0					X																	69964030		2203	4289	6492	SO:0001819	synonymous_variant	56159	exon11			TGGCCCAGTAGAT	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.777T>C	chrX.hg19:g.69964030A>G		108.0	0.0		99.0	6.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Silent	SNP	ENST00000395889.2	hg19	CCDS35323.1																																																																																			.	.		0.269	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
ATP7A	538	hgsc.bcm.edu	37	X	77284804	77284804	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:77284804T>C	ENST00000341514.6	+	15	3129	c.2974T>C	c.(2974-2976)Tct>Cct	p.S992P	ATP7A_ENST00000343533.5_Missense_Mutation_p.S914P|ATP7A_ENST00000350425.4_Intron	NM_000052.5	NP_000043.4	Q04656	ATP7A_HUMAN	ATPase, Cu++ transporting, alpha polypeptide	992					blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|cartilage development (GO:0051216)|catecholamine metabolic process (GO:0006584)|cellular copper ion homeostasis (GO:0006878)|central nervous system neuron development (GO:0021954)|cerebellar Purkinje cell differentiation (GO:0021702)|collagen fibril organization (GO:0030199)|copper ion export (GO:0060003)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|dendrite morphogenesis (GO:0048813)|detoxification of copper ion (GO:0010273)|dopamine metabolic process (GO:0042417)|elastic fiber assembly (GO:0048251)|elastin biosynthetic process (GO:0051542)|epinephrine metabolic process (GO:0042414)|extracellular matrix organization (GO:0030198)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|lung alveolus development (GO:0048286)|mitochondrion organization (GO:0007005)|negative regulation of metalloenzyme activity (GO:0048553)|negative regulation of neuron apoptotic process (GO:0043524)|neuron projection morphogenesis (GO:0048812)|norepinephrine biosynthetic process (GO:0042421)|norepinephrine metabolic process (GO:0042415)|peptidyl-lysine modification (GO:0018205)|pigmentation (GO:0043473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of oxidoreductase activity (GO:0051353)|pyramidal neuron development (GO:0021860)|regulation of gene expression (GO:0010468)|regulation of oxidative phosphorylation (GO:0002082)|release of cytochrome c from mitochondria (GO:0001836)|removal of superoxide radicals (GO:0019430)|response to iron(III) ion (GO:0010041)|response to zinc ion (GO:0010043)|serotonin metabolic process (GO:0042428)|skin development (GO:0043588)|T-helper cell differentiation (GO:0042093)|transmembrane transport (GO:0055085)|tryptophan metabolic process (GO:0006568)|tyrosine metabolic process (GO:0006570)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|trans-Golgi network (GO:0005802)|trans-Golgi network transport vesicle (GO:0030140)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|copper-dependent protein binding (GO:0032767)|copper-exporting ATPase activity (GO:0004008)|superoxide dismutase copper chaperone activity (GO:0016532)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(26)|pancreas(1)|prostate(1)|urinary_tract(1)	53					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TTTCCAAGCCTCTATCACAGT	0.433																																					p.S992P		Atlas-SNP	.											.	ATP7A	248	.	0			c.T2974C						.						192.0	178.0	182.0					X																	77284804		2203	4296	6499	SO:0001583	missense	538	exon15			CAAGCCTCTATCA	L06133	CCDS35339.1, CCDS75997.1	Xq21.1	2012-10-22	2008-07-31		ENSG00000165240	ENSG00000165240	3.6.3.4	"""ATPases / P-type"""	869	protein-coding gene	gene with protein product	"""copper pump 1"", ""copper-transporting ATPase 1"""	300011	"""Menkes syndrome"""	MNK		10079817	Standard	NM_000052		Approved		uc004ecx.4	Q04656	OTTHUMG00000021885	ENST00000341514.6:c.2974T>C	chrX.hg19:g.77284804T>C	ENSP00000345728:p.Ser992Pro	84.0	0.0		106.0	5.0	NM_000052	B1AT72|O00227|O00745|Q9BYY8	Missense_Mutation	SNP	ENST00000341514.6	hg19	CCDS35339.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.157467	0.78114	.	.	ENSG00000165240	ENST00000343533;ENST00000341514	D;D	0.89415	-2.51;-2.51	6.06	4.88	0.63580	ATPase, P-type, ATPase-associated domain (1);	0.000000	0.85682	D	0.000000	D	0.93638	0.7968	M	0.81682	2.555	0.80722	D	1	D	0.54397	0.966	D	0.68943	0.961	D	0.92926	0.6359	10	0.54805	T	0.06	15.81	11.3265	0.49452	0.0:0.0:0.2853:0.7146	.	992	Q04656	ATP7A_HUMAN	P	914;992	ENSP00000343026:S914P;ENSP00000345728:S992P	ENSP00000345728:S992P	S	+	1	0	ATP7A	77171460	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.395000	0.52558	0.857000	0.35407	0.481000	0.45027	TCT	.	.		0.433	ATP7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057306.1	NM_000052	
TBX22	50945	hgsc.bcm.edu	37	X	79282219	79282219	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:79282219T>C	ENST00000373294.5	+	5	678	c.650T>C	c.(649-651)aTg>aCg	p.M217T	TBX22_ENST00000373291.1_Missense_Mutation_p.M97T|TBX22_ENST00000442340.1_Missense_Mutation_p.M97T|TBX22_ENST00000373296.3_Missense_Mutation_p.M217T	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	217					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGCAATCCATGCATAAGTAC	0.483																																					p.M217T		Atlas-SNP	.											.	TBX22	118	.	0			c.T650C						.						148.0	121.0	130.0					X																	79282219		2203	4300	6503	SO:0001583	missense	50945	exon5			AATCCATGCATAA	AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.650T>C	chrX.hg19:g.79282219T>C	ENSP00000362390:p.Met217Thr	71.0	0.0		63.0	44.0	NM_016954	Q5JZ06|Q96LC0|Q9HBF1	Missense_Mutation	SNP	ENST00000373294.5	hg19	CCDS14445.1	.	.	.	.	.	.	.	.	.	.	T	17.24	3.338130	0.60963	.	.	ENSG00000122145	ENST00000373296;ENST00000442340;ENST00000373294;ENST00000373291	D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5	3.88	3.88	0.44766	p53-like transcription factor, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.95900	0.8665	H	0.98027	4.13	0.80722	D	1	D	0.63046	0.992	D	0.66716	0.946	D	0.96018	0.9007	10	0.87932	D	0	.	9.9835	0.41828	0.0:0.0:0.0:1.0	.	217	Q9Y458	TBX22_HUMAN	T	217;97;217;97	ENSP00000362393:M217T;ENSP00000396394:M97T;ENSP00000362390:M217T;ENSP00000362388:M97T	ENSP00000362388:M97T	M	+	2	0	TBX22	79168875	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.012000	0.76366	1.547000	0.49401	0.486000	0.48141	ATG	.	.		0.483	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057334.1	NM_016954	
FAM46D	169966	hgsc.bcm.edu	37	X	79699173	79699173	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:79699173C>T	ENST00000308293.5	+	3	1374	c.1135C>T	c.(1135-1137)Cca>Tca	p.P379S	FAM46D_ENST00000538312.1_Missense_Mutation_p.P379S	NM_152630.4	NP_689843.1	Q8NEK8	FA46D_HUMAN	family with sequence similarity 46, member D	379										kidney(1)|large_intestine(6)|liver(3)|lung(11)|ovary(1)|upper_aerodigestive_tract(1)	23						GCCATACCACCCACTGCACTT	0.408																																					p.P379S		Atlas-SNP	.											.	FAM46D	69	.	0			c.C1135T						.						36.0	35.0	35.0					X																	79699173		2203	4298	6501	SO:0001583	missense	169966	exon5			TACCACCCACTGC	BX537938	CCDS14446.1	Xq21.1	2009-08-18			ENSG00000174016	ENSG00000174016			28399	protein-coding gene	gene with protein product	"""cancer/testis antigen 112"""					12477932	Standard	NM_152630		Approved	MGC26999, CT1.26, CT112	uc004edl.1	Q8NEK8	OTTHUMG00000021902	ENST00000308293.5:c.1135C>T	chrX.hg19:g.79699173C>T	ENSP00000308575:p.Pro379Ser	44.0	0.0		33.0	5.0	NM_001170574	B2R9Q6|Q7Z3F6|Q8NHU1	Missense_Mutation	SNP	ENST00000308293.5	hg19	CCDS14446.1	.	.	.	.	.	.	.	.	.	.	C	2.958	-0.215187	0.06101	.	.	ENSG00000174016	ENST00000538312;ENST00000308293	T;T	0.23348	1.91;1.91	5.21	2.38	0.29361	.	0.331275	0.28393	N	0.015516	T	0.20861	0.0502	L	0.48877	1.53	0.09310	N	0.999994	B	0.17038	0.02	B	0.17979	0.02	T	0.19257	-1.0311	10	0.54805	T	0.06	-0.0106	7.3091	0.26465	0.315:0.5095:0.1755:0.0	.	379	Q8NEK8	FA46D_HUMAN	S	379	ENSP00000443410:P379S;ENSP00000308575:P379S	ENSP00000308575:P379S	P	+	1	0	FAM46D	79585829	0.032000	0.19561	0.002000	0.10522	0.003000	0.03518	0.676000	0.25247	0.065000	0.16485	0.594000	0.82650	CCA	.	.		0.408	FAM46D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057338.1	NM_152630	
BRWD3	254065	hgsc.bcm.edu	37	X	79947359	79947359	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:79947359T>C	ENST00000373275.4	-	30	3660	c.3444A>G	c.(3442-3444)gaA>gaG	p.E1148E	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1148					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						GAATAACCCGTTCACATTCTT	0.463																																					p.E1148E		Atlas-SNP	.											.	BRWD3	251	.	0			c.A3444G						.						99.0	81.0	87.0					X																	79947359		2203	4300	6503	SO:0001819	synonymous_variant	254065	exon30			AACCCGTTCACAT		CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3444A>G	chrX.hg19:g.79947359T>C		76.0	0.0		87.0	5.0	NM_153252	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	ENST00000373275.4	hg19	CCDS14447.1																																																																																			.	.		0.463	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057344.1	NM_153252	
DIAPH2	1730	hgsc.bcm.edu	37	X	96167500	96167500	+	Silent	SNP	G	G	A			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:96167500G>A	ENST00000324765.8	+	7	1028	c.681G>A	c.(679-681)aaG>aaA	p.K227K	DIAPH2_ENST00000373061.3_Silent_p.K227K|DIAPH2_ENST00000355827.4_Silent_p.K227K|DIAPH2_ENST00000373049.4_Silent_p.K227K|DIAPH2_ENST00000373054.4_Silent_p.K223K			O60879	DIAP2_HUMAN	diaphanous-related formin 2	227	GBD/FH3. {ECO:0000255|PROSITE- ProRule:PRU00579}.				actin filament polymerization (GO:0030041)|cytokinesis (GO:0000910)|female gamete generation (GO:0007292)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)	endosome (GO:0005768)	receptor binding (GO:0005102)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51						ATATTGACAAGAAGAATCAGT	0.308																																					p.K227K		Atlas-SNP	.											.	DIAPH2	148	.	0			c.G681A						.						34.0	32.0	33.0					X																	96167500		2200	4289	6489	SO:0001819	synonymous_variant	1730	exon7			TGACAAGAAGAAT	Y15909	CCDS14467.1, CCDS14468.1	Xq22	2013-05-24	2013-05-24		ENSG00000147202	ENSG00000147202			2877	protein-coding gene	gene with protein product		300108	"""diaphanous (Drosophila, homolog) 2"", ""diaphanous homolog 2 (Drosophila)"""			9360932	Standard	NM_006729		Approved	POF, DIA, POF2, DIA2	uc004efu.4	O60879	OTTHUMG00000022689	ENST00000324765.8:c.681G>A	chrX.hg19:g.96167500G>A		66.0	0.0		75.0	4.0	NM_007309	A6NG19|O60878|Q8WX06|Q8WX48|Q9UJL2	Silent	SNP	ENST00000324765.8	hg19	CCDS14467.1																																																																																			.	.		0.308	DIAPH2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058871.2	NM_006729, NM_007309	
GPRASP1	9737	hgsc.bcm.edu	37	X	101910325	101910325	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:101910325A>G	ENST00000361600.5	+	5	2285	c.1484A>G	c.(1483-1485)cAg>cGg	p.Q495R	GPRASP1_ENST00000415986.1_Missense_Mutation_p.Q495R|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000537097.1_Missense_Mutation_p.Q495R|GPRASP1_ENST00000444152.1_Missense_Mutation_p.Q495R	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	495					endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GATGATGAACAGGTCATTATT	0.498																																					p.Q495R		Atlas-SNP	.											.	GPRASP1	140	.	0			c.A1484G						.						79.0	72.0	74.0					X																	101910325		2203	4300	6503	SO:0001583	missense	9737	exon3			ATGAACAGGTCAT	AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.1484A>G	chrX.hg19:g.101910325A>G	ENSP00000355146:p.Gln495Arg	94.0	0.0		113.0	5.0	NM_001099411	O43168|Q96LA1	Missense_Mutation	SNP	ENST00000361600.5	hg19	CCDS35352.1	.	.	.	.	.	.	.	.	.	.	A	10.89	1.478813	0.26511	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	T;T;T;T	0.08193	3.12;3.12;3.12;3.12	2.79	0.371	0.16168	.	.	.	.	.	T	0.04048	0.0113	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40553	-0.9557	9	0.49607	T	0.09	-0.2362	5.6912	0.17831	0.7341:0.0:0.2659:0.0	.	495	Q5JY77	GASP1_HUMAN	R	495	ENSP00000393691:Q495R;ENSP00000409420:Q495R;ENSP00000355146:Q495R;ENSP00000445683:Q495R	ENSP00000355146:Q495R	Q	+	2	0	GPRASP1	101796981	0.000000	0.05858	0.000000	0.03702	0.921000	0.55340	0.386000	0.20702	-0.001000	0.14495	0.422000	0.28245	CAG	.	.		0.498	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057634.2	NM_014710	
GUCY2F	2986	hgsc.bcm.edu	37	X	108708492	108708492	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:108708492A>G	ENST00000218006.2	-	3	1202	c.911T>C	c.(910-912)cTc>cCc	p.L304P		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	304					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						GGCTTCCCGGAGCTTTGGGTT	0.483																																					p.L304P		Atlas-SNP	.											.	GUCY2F	178	.	0			c.T911C						.						140.0	120.0	127.0					X																	108708492		2203	4300	6503	SO:0001583	missense	2986	exon3			TCCCGGAGCTTTG	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.911T>C	chrX.hg19:g.108708492A>G	ENSP00000218006:p.Leu304Pro	98.0	0.0		114.0	6.0	NM_001522	Q9UJF1	Missense_Mutation	SNP	ENST00000218006.2	hg19	CCDS14545.1	.	.	.	.	.	.	.	.	.	.	A	17.79	3.475541	0.63737	.	.	ENSG00000101890	ENST00000218006	T	0.75589	-0.95	3.94	3.94	0.45596	Extracellular ligand-binding receptor (1);	0.141402	0.48767	D	0.000161	D	0.83663	0.5303	M	0.80332	2.49	0.80722	D	1	D	0.58970	0.984	D	0.70487	0.969	T	0.82520	-0.0416	10	0.32370	T	0.25	.	10.183	0.42980	1.0:0.0:0.0:0.0	.	304	P51841	GUC2F_HUMAN	P	304	ENSP00000218006:L304P	ENSP00000218006:L304P	L	-	2	0	GUCY2F	108595148	1.000000	0.71417	0.106000	0.21319	0.979000	0.70002	8.513000	0.90542	1.764000	0.52075	0.486000	0.48141	CTC	.	.		0.483	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
TRPC5	7224	hgsc.bcm.edu	37	X	111090642	111090642	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:111090642T>C	ENST00000262839.2	-	6	2318	c.1400A>G	c.(1399-1401)gAg>gGg	p.E467G		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	467					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TTCCCATTCCTCCCTTGGACG	0.433																																					p.E467G		Atlas-SNP	.											.	TRPC5	142	.	0			c.A1400G						.						85.0	71.0	76.0					X																	111090642		2203	4300	6503	SO:0001583	missense	7224	exon6			CATTCCTCCCTTG	AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1400A>G	chrX.hg19:g.111090642T>C	ENSP00000262839:p.Glu467Gly	24.0	0.0		27.0	4.0	NM_012471	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	ENST00000262839.2	hg19	CCDS14561.1	.	.	.	.	.	.	.	.	.	.	T	19.80	3.894065	0.72639	.	.	ENSG00000072315	ENST00000262839	T	0.71222	-0.55	5.51	5.51	0.81932	Ion transport (1);	0.100743	0.64402	D	0.000003	T	0.64316	0.2587	L	0.33668	1.02	0.80722	D	1	B;B	0.32467	0.075;0.372	B;B	0.36030	0.103;0.216	T	0.66571	-0.5890	10	0.62326	D	0.03	-2.8893	14.7304	0.69377	0.0:0.0:0.0:1.0	.	468;467	Q59G51;Q9UL62	.;TRPC5_HUMAN	G	467	ENSP00000262839:E467G	ENSP00000262839:E467G	E	-	2	0	TRPC5	110977298	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.250000	0.72435	1.860000	0.53959	0.430000	0.28490	GAG	.	.		0.433	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057945.1	NM_012471	
XIAP	331	hgsc.bcm.edu	37	X	123019618	123019618	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:123019618T>C	ENST00000371199.3	+	2	405	c.106T>C	c.(106-108)Ttt>Ctt	p.F36L	XIAP_ENST00000355640.3_Missense_Mutation_p.F36L|XIAP_ENST00000434753.3_Missense_Mutation_p.F36L|XIAP_ENST00000468691.1_Intron	NM_001167.3	NP_001158.2	P98170	XIAP_HUMAN	X-linked inhibitor of apoptosis	36					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|copper ion homeostasis (GO:0055070)|inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein linear polyubiquitination (GO:1902530)|positive regulation of protein ubiquitination (GO:0031398)|protein ubiquitination (GO:0016567)|regulation of BMP signaling pathway (GO:0030510)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)	25						TTTTGCTAATTTTCCAAGTGG	0.383									X-linked Lymphoproliferative syndrome																												p.F36L		Atlas-SNP	.											.	XIAP	56	.	0			c.T106C						.						81.0	83.0	82.0					X																	123019618		2201	4299	6500	SO:0001583	missense	331	exon2	Familial Cancer Database	XLP, Duncan syndrome, Familial Fatal Epstein-Barr Infection, incl. XLP2	GCTAATTTTCCAA	U45880	CCDS14606.1	Xq25	2014-09-17	2008-03-04	2008-03-04	ENSG00000101966	ENSG00000101966		"""Baculoviral IAP repeat containing"""	592	protein-coding gene	gene with protein product		300079	"""baculoviral IAP repeat-containing 4"""	API3, BIRC4		8552191, 8654366	Standard	NM_001167		Approved	hILP	uc010nqu.3	P98170	OTTHUMG00000022336	ENST00000371199.3:c.106T>C	chrX.hg19:g.123019618T>C	ENSP00000360242:p.Phe36Leu	54.0	0.0		62.0	4.0	NM_001204401	D3DTF2|Q9NQ14	Missense_Mutation	SNP	ENST00000371199.3	hg19	CCDS14606.1	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263221	0.80358	.	.	ENSG00000101966	ENST00000434753;ENST00000430625;ENST00000371199;ENST00000355640	T;T;T;T	0.74002	-0.8;-0.8;-0.8;-0.8	5.81	5.81	0.92471	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	D	0.85767	0.5773	M	0.78637	2.42	0.54753	D	0.99998	D	0.89917	1.0	D	0.72075	0.976	D	0.86536	0.1825	9	.	.	.	-6.0358	15.1702	0.72865	0.0:0.0:0.0:1.0	.	36	P98170	XIAP_HUMAN	L	36	ENSP00000395230:F36L;ENSP00000400637:F36L;ENSP00000360242:F36L;ENSP00000347858:F36L	.	F	+	1	0	XIAP	122847299	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.509000	0.73725	1.965000	0.57142	0.413000	0.27773	TTT	.	.		0.383	XIAP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058165.5	NM_001167	
UTP14A	10813	hgsc.bcm.edu	37	X	129055252	129055252	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:129055252A>G	ENST00000394422.3	+	11	1065	c.1037A>G	c.(1036-1038)gAg>gGg	p.E346G	RP4-537K23.4_ENST00000432062.1_RNA|UTP14A_ENST00000425117.2_Missense_Mutation_p.E294G|UTP14A_ENST00000371042.3_Missense_Mutation_p.E178G|UTP14A_ENST00000371051.5_Missense_Mutation_p.E292G|UTP14A_ENST00000498179.1_3'UTR	NM_006649.3	NP_006640.2	Q9BVJ6	UT14A_HUMAN	UTP14, U3 small nucleolar ribonucleoprotein, homolog A (yeast)	346					rRNA processing (GO:0006364)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|liver(2)|lung(16)|ovary(3)|urinary_tract(1)	32						AGTGAGGAAGAGGAGGGAGGC	0.507																																					p.E346G		Atlas-SNP	.											.	UTP14A	74	.	0			c.A1037G						.						122.0	100.0	107.0					X																	129055252		2203	4300	6503	SO:0001583	missense	10813	exon11			AGGAAGAGGAGGG	AF039694	CCDS14615.1, CCDS55489.1	Xq26.1	2009-01-15	2004-06-01	2004-06-01	ENSG00000156697	ENSG00000156697			10665	protein-coding gene	gene with protein product		300508	"""serologically defined colon cancer antigen 16"""	SDCCAG16		9610721, 16354793	Standard	NM_006649		Approved	NY-CO-16	uc004euz.3	Q9BVJ6	OTTHUMG00000022378	ENST00000394422.3:c.1037A>G	chrX.hg19:g.129055252A>G	ENSP00000377944:p.Glu346Gly	118.0	0.0		124.0	6.0	NM_006649	A8K7A3|A8MVQ1|B4DQ08|E9PEL7|Q5JYF1	Missense_Mutation	SNP	ENST00000394422.3	hg19	CCDS14615.1	.	.	.	.	.	.	.	.	.	.	A	19.46	3.831382	0.71258	.	.	ENSG00000156697	ENST00000425117;ENST00000394422;ENST00000371051;ENST00000427972;ENST00000371042	T;T;T;T;T	0.18960	2.18;2.18;2.18;2.18;2.18	6.08	4.92	0.64577	.	0.301734	0.35040	N	0.003497	T	0.39989	0.1099	M	0.82823	2.61	0.09310	N	0.999996	D;B;B;D	0.65815	0.993;0.197;0.197;0.995	P;B;B;D	0.63957	0.869;0.159;0.159;0.92	T	0.38112	-0.9676	10	0.28530	T	0.3	-12.7787	4.6403	0.12545	0.6713:0.1616:0.1671:0.0	.	292;294;294;346	F8WD00;E9PEL7;B4DQ08;Q9BVJ6	.;.;.;UT14A_HUMAN	G	294;346;292;178;178	ENSP00000388669:E294G;ENSP00000377944:E346G;ENSP00000360090:E292G;ENSP00000413187:E178G;ENSP00000360081:E178G	ENSP00000360081:E178G	E	+	2	0	UTP14A	128882933	0.990000	0.36364	0.054000	0.19295	0.661000	0.39034	2.656000	0.46716	0.900000	0.36469	0.441000	0.28932	GAG	.	.		0.507	UTP14A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058221.1	NM_006649	
RBMX2	51634	hgsc.bcm.edu	37	X	129546386	129546386	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:129546386A>G	ENST00000305536.6	+	6	597	c.533A>G	c.(532-534)gAg>gGg	p.E178G		NM_016024.2	NP_057108.2	Q9Y388	RBMX2_HUMAN	RNA binding motif protein, X-linked 2	178	Lys-rich.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(4)|endometrium(2)|large_intestine(1)|liver(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	19						GCCGACCGGGAGGTACAGGCA	0.413																																					p.E178G		Atlas-SNP	.											.	RBMX2	46	.	0			c.A533G						.						50.0	49.0	50.0					X																	129546386		1895	4105	6000	SO:0001583	missense	51634	exon6			ACCGGGAGGTACA	AF078865	CCDS43993.1	Xq26.1	2013-02-12			ENSG00000134597	ENSG00000134597		"""RNA binding motif (RRM) containing"""	24282	protein-coding gene	gene with protein product						10810093	Standard	NM_016024		Approved	CGI-79	uc004evt.3	Q9Y388	OTTHUMG00000022395	ENST00000305536.6:c.533A>G	chrX.hg19:g.129546386A>G	ENSP00000339090:p.Glu178Gly	101.0	0.0		130.0	6.0	NM_016024	A8K9Z0|Q5JY82|Q9Y3I8	Missense_Mutation	SNP	ENST00000305536.6	hg19	CCDS43993.1	.	.	.	.	.	.	.	.	.	.	A	7.653	0.683367	0.14907	.	.	ENSG00000134597	ENST00000305536;ENST00000538614	T	0.13657	2.57	4.31	-1.23	0.09465	.	2.194050	0.01991	N	0.045503	T	0.09555	0.0235	N	0.24115	0.695	0.09310	N	1	B	0.29716	0.255	B	0.26614	0.071	T	0.25710	-1.0124	10	0.33940	T	0.23	.	5.9397	0.19186	0.3466:0.5441:0.1092:0.0	.	178	Q9Y388	RBMX2_HUMAN	G	178	ENSP00000339090:E178G	ENSP00000339090:E178G	E	+	2	0	RBMX2	129374067	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.005000	0.13129	-0.161000	0.10983	-0.377000	0.06932	GAG	.	.		0.413	RBMX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058265.1	NM_016024	
GPR112	139378	hgsc.bcm.edu	37	X	135438310	135438310	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:135438310A>G	ENST00000394143.1	+	9	7204	c.6913A>G	c.(6913-6915)Atg>Gtg	p.M2305V	GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Missense_Mutation_p.M2100V|GPR112_ENST00000370652.1_Missense_Mutation_p.M2305V|GPR112_ENST00000412101.1_Missense_Mutation_p.M2100V	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2305					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AGAGATGGTCATGGATCGAGC	0.353																																					p.M2305V		Atlas-SNP	.											.	GPR112	459	.	0			c.A6913G						.						144.0	131.0	136.0					X																	135438310		2203	4300	6503	SO:0001583	missense	139378	exon9			ATGGTCATGGATC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.6913A>G	chrX.hg19:g.135438310A>G	ENSP00000377699:p.Met2305Val	73.0	0.0		73.0	4.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	A	1.397	-0.579115	0.03854	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000394141	T;T;T;T	0.35421	1.35;1.35;1.31;1.31	4.86	0.89	0.19218	.	.	.	.	.	T	0.14141	0.0342	N	0.08118	0	0.09310	N	0.999999	B;B	0.25312	0.123;0.109	B;B	0.18871	0.023;0.021	T	0.21109	-1.0255	9	0.25751	T	0.34	.	1.5052	0.02485	0.5472:0.1776:0.1007:0.1745	.	2100;2305	Q8IZF6-3;Q8IZF6	.;GP112_HUMAN	V	2305;2305;2100;2100	ENSP00000377699:M2305V;ENSP00000359686:M2305V;ENSP00000416526:M2100V;ENSP00000377697:M2100V	ENSP00000359686:M2305V	M	+	1	0	GPR112	135265976	0.829000	0.29322	0.019000	0.16419	0.132000	0.20833	1.024000	0.30077	-0.043000	0.13513	0.481000	0.45027	ATG	.	.		0.353	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
SOX3	6658	hgsc.bcm.edu	37	X	139586972	139586972	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:139586972T>C	ENST00000370536.2	-	1	253	c.254A>G	c.(253-255)aAg>aGg	p.K85R		NM_005634.2	NP_005625.2	P41225	SOX3_HUMAN	SRY (sex determining region Y)-box 3	85					central nervous system development (GO:0007417)|face development (GO:0060324)|hypothalamus development (GO:0021854)|negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|organ morphogenesis (GO:0009887)|pituitary gland development (GO:0021983)|sensory organ development (GO:0007423)|Sertoli cell development (GO:0060009)|sex determination (GO:0007530)|spermatid differentiation (GO:0048515)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|pancreas(1)|skin(1)	10	Acute lymphoblastic leukemia(192;7.65e-05)					TACGGGGTTCTTGAGTTCAGT	0.711																																					p.K85R		Atlas-SNP	.											.	SOX3	44	.	0			c.A254G						.						8.0	7.0	7.0					X																	139586972		2132	4105	6237	SO:0001583	missense	6658	exon1			GGGTTCTTGAGTT		CCDS14669.1	Xq27.1	2013-10-17			ENSG00000134595	ENSG00000134595		"""SRY (sex determining region Y)-boxes"""	11199	protein-coding gene	gene with protein product		313430	"""panhypopituitarism"""	PHP		15800844	Standard	NM_005634		Approved		uc004fbd.1	P41225	OTTHUMG00000022544	ENST00000370536.2:c.254A>G	chrX.hg19:g.139586972T>C	ENSP00000359567:p.Lys85Arg	28.0	0.0		26.0	4.0	NM_005634	P35714|Q5JWI3|Q9NP49	Missense_Mutation	SNP	ENST00000370536.2	hg19	CCDS14669.1	.	.	.	.	.	.	.	.	.	.	t	24.7	4.558287	0.86231	.	.	ENSG00000134595	ENST00000370536	D	0.97906	-4.6	4.39	4.39	0.52855	.	0.132210	0.48767	U	0.000177	D	0.96688	0.8919	N	0.19112	0.55	0.50632	D	0.999884	D	0.69078	0.997	D	0.75020	0.985	D	0.95521	0.8594	9	.	.	.	.	12.082	0.53675	0.0:0.0:0.0:1.0	.	85	P41225	SOX3_HUMAN	R	85	ENSP00000359567:K85R	.	K	-	2	0	SOX3	139414638	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	7.435000	0.80391	1.433000	0.47394	0.427000	0.28365	AAG	.	.		0.711	SOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058577.1		
SLITRK4	139065	hgsc.bcm.edu	37	X	142717685	142717685	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:142717685T>C	ENST00000381779.4	-	2	1465	c.1240A>G	c.(1240-1242)Aca>Gca	p.T414A	SLITRK4_ENST00000356928.1_Missense_Mutation_p.T414A|SLITRK4_ENST00000338017.4_Missense_Mutation_p.T414A	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	414						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					TTAATCACTGTAATTTGATTG	0.398																																					p.T414A		Atlas-SNP	.											.	SLITRK4	162	.	0			c.A1240G						.						141.0	119.0	126.0					X																	142717685		2203	4300	6503	SO:0001583	missense	139065	exon2			TCACTGTAATTTG	BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.1240A>G	chrX.hg19:g.142717685T>C	ENSP00000371198:p.Thr414Ala	117.0	0.0		109.0	81.0	NM_001184750	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	ENST00000381779.4	hg19	CCDS14679.1	.	.	.	.	.	.	.	.	.	.	T	0.484	-0.878560	0.02550	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.55760	0.5;0.5;0.5	5.29	5.29	0.74685	.	0.270580	0.35739	N	0.003009	T	0.39200	0.1069	L	0.41236	1.265	0.35519	D	0.801312	B	0.02656	0.0	B	0.04013	0.001	T	0.42649	-0.9439	10	0.12430	T	0.62	-2.5162	9.3055	0.37872	0.1627:0.0:0.0:0.8373	.	414	Q8IW52	SLIK4_HUMAN	A	414	ENSP00000371198:T414A;ENSP00000349400:T414A;ENSP00000336627:T414A	ENSP00000336627:T414A	T	-	1	0	SLITRK4	142545351	0.110000	0.22057	0.959000	0.39883	0.990000	0.78478	0.276000	0.18716	1.874000	0.54306	0.437000	0.28790	ACA	.	.		0.398	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058617.1	NM_173078	
PNMA3	29944	hgsc.bcm.edu	37	X	152226282	152226282	+	Silent	SNP	T	T	C			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:152226282T>C	ENST00000370264.4	+	1	896	c.870T>C	c.(868-870)aaT>aaC	p.N290N	PNMA3_ENST00000447306.1_Silent_p.N290N|PNMA3_ENST00000370265.4_Silent_p.N290N			Q9UL41	PNMA3_HUMAN	paraneoplastic Ma antigen 3	290					positive regulation of apoptotic process (GO:0043065)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	16	Acute lymphoblastic leukemia(192;6.56e-05)					gaaacgtgaatcagactcgcc	0.478																																					p.N290N		Atlas-SNP	.											.	PNMA3	81	.	0			c.T870C						.						109.0	97.0	101.0					X																	152226282		2203	4300	6503	SO:0001819	synonymous_variant	29944	exon2			CGTGAATCAGACT	AF083116	CCDS35435.2, CCDS65344.1	Xq28	2012-02-09	2012-02-09		ENSG00000183837	ENSG00000183837		"""Paraneoplastic Ma antigens"""	18742	protein-coding gene	gene with protein product	"""paraneoplastic cancer-testis-brain antigen"""	300675	"""paraneoplastic antigen MA3"""			11558790	Standard	NM_013364		Approved	MA5, MA3, MGC132756, MGC132758	uc004fhc.2	Q9UL41	OTTHUMG00000024195	ENST00000370264.4:c.870T>C	chrX.hg19:g.152226282T>C		90.0	0.0		83.0	4.0	NM_013364	D3DWT7|Q9H0A4	Silent	SNP	ENST00000370264.4	hg19	CCDS35435.2																																																																																			.	.		0.478	PNMA3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060946.2	NM_013364	
GPAM	57678	hgsc.bcm.edu	37	10	113920573	113920585	+	Frame_Shift_Del	DEL	GACTTCCTCTTTC	GACTTCCTCTTTC	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	GACTTCCTCTTTC	GACTTCCTCTTTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:113920573_113920585delGACTTCCTCTTTC	ENST00000348367.4	-	16	1733_1745	c.1536_1548delGAAAGAGGAAGTC	c.(1534-1548)atgaaagaggaagtcfs	p.MKEEV512fs	GPAM_ENST00000423155.1_Frame_Shift_Del_p.MKEEV512fs|GPAM_ENST00000369425.1_Frame_Shift_Del_p.MKEEV512fs			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	512					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CACGAGCCAGGACTTCCTCTTTCATCACAAAGA	0.432																																					p.513_517del	Ovarian(161;1017 2606 18293 52943)	Atlas-INDEL	.											.	GPAM	68	.	0			c.1537_1549del						.																																			SO:0001589	frameshift_variant	57678	exon16			.	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1536_1548delGAAAGAGGAAGTC	chr10.hg19:g.113920573_113920585delGACTTCCTCTTTC	ENSP00000265276:p.Met512fs	115.0	0.0		96.0	12.0	NM_001244949	Q5VW51|Q86TA3	Frame_Shift_Del	DEL	ENST00000348367.4	hg19	CCDS7570.1																																																																																			.	.		0.432	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
GMEB2	26205	hgsc.bcm.edu	37	20	62221981	62221981	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr20:62221981delG	ENST00000266068.1	-	9	1532	c.1054delC	c.(1054-1056)ctgfs	p.L352fs	GMEB2_ENST00000370077.1_Frame_Shift_Del_p.L352fs|GMEB2_ENST00000370069.1_Frame_Shift_Del_p.L301fs			Q9UKD1	GMEB2_HUMAN	glucocorticoid modulatory element binding protein 2	352					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)	18	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;4.79e-09)|all cancers(9;2.76e-08)|BRCA - Breast invasive adenocarcinoma(10;5.15e-06)|OV - Ovarian serous cystadenocarcinoma(5;0.0114)			GGCGGTGGCAGGGAGACCGGC	0.667																																					p.L352fs		Atlas-INDEL	.											.	GMEB2	44	.	0			c.1055delT						.						62.0	48.0	53.0					20																	62221981		2197	4300	6497	SO:0001589	frameshift_variant	26205	exon10			.	AF173867	CCDS13528.1	20q13.33	2008-07-02			ENSG00000101216	ENSG00000101216			4371	protein-coding gene	gene with protein product		607451				10523663, 11743720	Standard	NM_012384		Approved	P79PIF, KIAA1269, PIF79	uc002yfq.1	Q9UKD1	OTTHUMG00000032988	ENST00000266068.1:c.1054delC	chr20.hg19:g.62221981delG	ENSP00000266068:p.Leu352fs	71.0	0.0		147.0	10.0	NM_012384	E1P5J3|Q5TDS0|Q9H431|Q9H4X7|Q9H4X8|Q9UF78|Q9ULF1	Frame_Shift_Del	DEL	ENST00000266068.1	hg19	CCDS13528.1																																																																																			.	.		0.667	GMEB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080166.1	NM_012384	
KIAA0196	9897	hgsc.bcm.edu	37	8	126059515	126059515	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:126059515delG	ENST00000318410.7	-	20	2787	c.2438delC	c.(2437-2439)cctfs	p.P813fs	KIAA0196-AS1_ENST00000519140.1_RNA|KIAA0196_ENST00000517845.1_Frame_Shift_Del_p.P665fs	NM_014846.3	NP_055661.3	Q12768	STRUM_HUMAN	KIAA0196	813					cell death (GO:0008219)|endosomal transport (GO:0016197)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|WASH complex (GO:0071203)				NS(1)|breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	42	Ovarian(258;0.0028)|all_neural(195;0.00294)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.000918)|COAD - Colon adenocarcinoma(160;0.205)			CTCATCCACAGGGGTAAACTT	0.408																																					p.P813fs		Atlas-INDEL	.											.	KIAA0196	90	.	0			c.2439delT						.						118.0	107.0	111.0					8																	126059515		2203	4300	6503	SO:0001589	frameshift_variant	9897	exon20			.		CCDS6355.1	8q24.13	2014-05-09			ENSG00000164961	ENSG00000164961			28984	protein-coding gene	gene with protein product	"""strumpellin"""	610657	"""spastic paraplegia 8 (autosomal dominant)"""	SPG8		9973294, 17160902, 23085491	Standard	NM_014846		Approved		uc003yrt.3	Q12768	OTTHUMG00000164991	ENST00000318410.7:c.2438delC	chr8.hg19:g.126059515delG	ENSP00000318016:p.Pro813fs	123.0	0.0		141.0	10.0	NM_014846	A8K4R7|Q3KQX5|Q8TBQ2	Frame_Shift_Del	DEL	ENST00000318410.7	hg19	CCDS6355.1																																																																																			.	.		0.408	KIAA0196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381369.1	NM_014846	
MED1	5469	hgsc.bcm.edu	37	17	37565247	37565247	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:37565247delT	ENST00000300651.6	-	17	3450	c.3227delA	c.(3226-3228)aagfs	p.K1076fs	CTB-131K11.1_ENST00000582842.1_RNA|MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		AGAGGAAGGCTTGCCCACCAT	0.522										HNSCC(31;0.082)																											p.K1076fs	Pancreas(21;279 768 2492 4877 24026)	Atlas-INDEL	.											.	MED1	123	.	0			c.3228delG						.						99.0	95.0	96.0					17																	37565247		2203	4300	6503	SO:0001589	frameshift_variant	5469	exon17			.	L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3227delA	chr17.hg19:g.37565247delT	ENSP00000300651:p.Lys1076fs	110.0	0.0		117.0	10.0	NM_004774	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Frame_Shift_Del	DEL	ENST00000300651.6	hg19	CCDS11336.1																																																																																			.	.		0.522	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256943.3	NM_004774	
ZFP36	7538	hgsc.bcm.edu	37	19	39899237	39899239	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	CTC	CTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:39899237_39899239delCTC	ENST00000248673.3	+	2	937_939	c.879_881delCTC	c.(877-882)ggctct>ggt	p.S294del	ZFP36_ENST00000597629.1_In_Frame_Del_p.S300del|MIR4530_ENST00000581459.1_RNA	NM_003407.3	NP_003398.2	P26651	TTP_HUMAN	ZFP36 ring finger protein	294					3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|intracellular signal transduction (GO:0035556)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|negative regulation of inflammatory response (GO:0050728)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of tumor necrosis factor production (GO:0032680)|response to starvation (GO:0042594)|RNA destabilization (GO:0050779)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|AU-rich element binding (GO:0017091)|C-C chemokine binding (GO:0019957)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|single-stranded RNA binding (GO:0003727)			large_intestine(1)|lung(5)|pancreas(1)	7	all_cancers(60;6.54e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;1.53e-06)|Ovarian(47;0.0512)		Epithelial(26;2.92e-26)|all cancers(26;2.01e-23)|Lung(45;0.000499)|LUSC - Lung squamous cell carcinoma(53;0.000657)			GCCTGGGGGGCTCTGACTCTCCC	0.645																																					p.299_300del	NSCLC(67;1164 1324 12056 21056 30097)	Atlas-INDEL	.											.	ZFP36	19	.	0			c.896_898del						.																																			SO:0001651	inframe_deletion	7538	exon2			.	M63625	CCDS12534.1, CCDS12534.2	19q13.1	2012-11-27	2012-11-27			ENSG00000128016		"""RING-type (C3HC4) zinc fingers"""	12862	protein-coding gene	gene with protein product		190700	"""zinc finger protein 36, C3H type, homolog (mouse)"""			1699942	Standard	NM_003407		Approved	RNF162A, TIS11, G0S24, TTP, NUP475, tristetraprolin	uc002olh.2	P26651		ENST00000248673.3:c.879_881delCTC	chr19.hg19:g.39899237_39899239delCTC	ENSP00000248673:p.Ser294del	84.0	0.0		93.0	21.0	NM_003407	B2RA54	In_Frame_Del	DEL	ENST00000248673.3	hg19																																																																																				.	.		0.645	ZFP36-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding			
FGD6	55785	hgsc.bcm.edu	37	12	95603722	95603722	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr12:95603722delA	ENST00000343958.4	-	2	1561	c.1338delT	c.(1336-1338)tttfs	p.F446fs	FGD6_ENST00000549499.1_Frame_Shift_Del_p.F446fs|FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000546711.1_Frame_Shift_Del_p.F446fs	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	446					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TACATCTTATAAAACCGGTCC	0.423																																					p.I447X		Atlas-INDEL	.											.	FGD6	127	.	0			c.1339delA						.						109.0	107.0	108.0					12																	95603722		2203	4300	6503	SO:0001589	frameshift_variant	55785	exon2			.	AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1338delT	chr12.hg19:g.95603722delA	ENSP00000344446:p.Phe446fs	103.0	0.0		163.0	11.0	NM_018351	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Frame_Shift_Del	DEL	ENST00000343958.4	hg19	CCDS31878.1																																																																																			.	.		0.423	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407600.1	NM_018351	
REXO4	57109	hgsc.bcm.edu	37	9	136277557	136277557	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr9:136277557delC	ENST00000371942.3	-	4	971	c.772delG	c.(772-774)gagfs	p.E259fs	REXO4_ENST00000478037.1_5'UTR|REXO4_ENST00000371935.2_Intron	NM_020385.2	NP_065118.2	Q9GZR2	REXO4_HUMAN	REX4, RNA exonuclease 4 homolog (S. cerevisiae)	259	Exonuclease.				regulation of transcription, DNA-templated (GO:0006355)	nucleolus (GO:0005730)|nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(4)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	15				OV - Ovarian serous cystadenocarcinoma(145;8.58e-08)|Epithelial(140;9.55e-07)|all cancers(34;1.05e-05)		ATGCTCTCCTCCCCCTTAGGG	0.547																																					p.E258fs		Atlas-INDEL	.											.	REXO4	27	.	0			c.773delA						.						172.0	153.0	159.0					9																	136277557		2203	4300	6503	SO:0001589	frameshift_variant	57109	exon4			.	AF273304	CCDS6969.1, CCDS65179.1	9q34	2008-02-05	2005-08-22	2005-08-22	ENSG00000148300	ENSG00000148300			12820	protein-coding gene	gene with protein product		602930	"""Xenopus prevents mitotic catatrophe 2 homolog"", ""XPMC2 prevents mitotic catastrophe 2 homolog (Xenopus laevis)"""	XPMC2H		9325058	Standard	NM_020385		Approved		uc004cdm.3	Q9GZR2	OTTHUMG00000020870	ENST00000371942.3:c.772delG	chr9.hg19:g.136277557delC	ENSP00000361010:p.Glu259fs	113.0	0.0		152.0	10.0	NM_020385	B2RAT2|Q5T8S4|Q5T8S5|Q5T8S6|Q9GZW3	Frame_Shift_Del	DEL	ENST00000371942.3	hg19	CCDS6969.1																																																																																			.	.		0.547	REXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054899.1		
DCAF4L2	138009	hgsc.bcm.edu	37	8	88885079	88885079	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:88885079delC	ENST00000319675.3	-	1	1217	c.1121delG	c.(1120-1122)ggcfs	p.G374fs		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	374										breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TCCTCGGAAGCCCCCGAGGCG	0.592																																					p.G374fs		Atlas-INDEL	.											.	DCAF4L2	187	.	0			c.1122delC						.						56.0	62.0	60.0					8																	88885079		2203	4300	6503	SO:0001589	frameshift_variant	138009	exon1			.	AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.1121delG	chr8.hg19:g.88885079delC	ENSP00000316496:p.Gly374fs	75.0	0.0		172.0	13.0	NM_152418		Frame_Shift_Del	DEL	ENST00000319675.3	hg19	CCDS6245.1																																																																																			.	.		0.592	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375302.1	NM_152418	
MINK1	50488	hgsc.bcm.edu	37	17	4791017	4791017	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:4791017delA	ENST00000355280.6	+	12	1358	c.1162delA	c.(1162-1164)aaafs	p.K388fs	MINK1_ENST00000453408.3_Frame_Shift_Del_p.K388fs|MINK1_ENST00000347992.7_Frame_Shift_Del_p.K388fs	NM_001024937.3|NM_015716.4|NM_153827.4	NP_001020108.1|NP_056531.1|NP_722549.2			misshapen-like kinase 1											central_nervous_system(2)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						GGCACACATCAAACACCTGCT	0.632																																					p.I387fs		Atlas-INDEL	.											.	MINK1	110	.	0			c.1161delC						.						8.0	10.0	9.0					17																	4791017		2027	4140	6167	SO:0001589	frameshift_variant	50488	exon12			.	AY775058	CCDS45588.1, CCDS45589.1, CCDS45590.1	17p13.2	2011-04-14	2010-06-24		ENSG00000141503	ENSG00000141503			17565	protein-coding gene	gene with protein product	"""misshapen/NIK-related kinase"""	609426	"""misshapen-like kinase 1 (zebrafish)"""			10708748, 12087176	Standard	NM_015716		Approved	B55, MINK, ZC3, MAP4K6, YSK2	uc010vsl.2	Q8N4C8		ENST00000355280.6:c.1162delA	chr17.hg19:g.4791017delA	ENSP00000347427:p.Lys388fs	95.0	0.0		145.0	11.0	NM_170663		Frame_Shift_Del	DEL	ENST00000355280.6	hg19	CCDS45588.1																																																																																			.	.		0.632	MINK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000439801.1	NM_015716	
USP54	159195	hgsc.bcm.edu	37	10	75264616	75264616	+	Frame_Shift_Del	DEL	G	G	-	rs376012785		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:75264616delG	ENST00000339859.4	-	21	4403	c.4303delC	c.(4303-4305)cacfs	p.H1435fs	RP11-137L10.6_ENST00000596320.1_RNA|USP54_ENST00000408019.1_Frame_Shift_Del_p.H1435fs|RP11-137L10.6_ENST00000595935.1_RNA|RP11-137L10.6_ENST00000600607.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000428547.1_Frame_Shift_Del_p.H1285fs|USP54_ENST00000422491.2_Intron|RP11-137L10.6_ENST00000593790.1_RNA|RP11-137L10.6_ENST00000442133.4_RNA|USP54_ENST00000394811.2_Intron|RP11-137L10.6_ENST00000595069.1_RNA|RP11-137L10.6_ENST00000597958.1_RNA			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1435					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					ACAAAACTGTGGGAAGAAACC	0.502																																					p.H1435fs	Colon(195;880 2046 8854 25025 38456)	Atlas-INDEL	.											.	USP54	178	.	0			c.4304delA						.						117.0	99.0	106.0					10																	75264616		2203	4300	6503	SO:0001589	frameshift_variant	159195	exon20			.	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.4303delC	chr10.hg19:g.75264616delG	ENSP00000345216:p.His1435fs	130.0	0.0		166.0	10.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Frame_Shift_Del	DEL	ENST00000339859.4	hg19	CCDS7329.2																																																																																			.	.		0.502	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
EYA1	2138	hgsc.bcm.edu	37	8	72267072	72267072	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr8:72267072delG	ENST00000340726.3	-	3	708	c.69delC	c.(67-69)cccfs	p.P23fs	EYA1_ENST00000388742.4_Frame_Shift_Del_p.P23fs|EYA1_ENST00000388740.3_Intron|EYA1_ENST00000388741.2_Intron|EYA1_ENST00000388743.2_Frame_Shift_Del_p.P23fs|EYA1_ENST00000303824.7_Frame_Shift_Del_p.P23fs|EYA1_ENST00000419131.1_Frame_Shift_Del_p.P23fs	NM_000503.4	NP_000494.2	Q99502	EYA1_HUMAN	EYA transcriptional coactivator and phosphatase 1	23					anatomical structure morphogenesis (GO:0009653)|aorta morphogenesis (GO:0035909)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular protein localization (GO:0034613)|cochlea morphogenesis (GO:0090103)|double-strand break repair (GO:0006302)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of mitotic spindle orientation (GO:0000132)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|histone dephosphorylation (GO:0016576)|lung epithelial cell differentiation (GO:0060487)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|neuron fate specification (GO:0048665)|otic vesicle morphogenesis (GO:0071600)|outer ear morphogenesis (GO:0042473)|outflow tract morphogenesis (GO:0003151)|pattern specification process (GO:0007389)|pharyngeal system development (GO:0060037)|positive regulation of DNA repair (GO:0045739)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein sumoylation (GO:0016925)|regulation of neuron differentiation (GO:0045664)|response to ionizing radiation (GO:0010212)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|striated muscle tissue development (GO:0014706)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)|RNA binding (GO:0003723)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(15)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	44	Breast(64;0.046)		Epithelial(68;0.0837)|all cancers(69;0.247)			TACCGAGTTTGGGGCCACTGG	0.463																																					p.K24fs		Atlas-INDEL	.											.	EYA1	108	.	0			c.70delA						.						160.0	165.0	164.0					8																	72267072		2203	4300	6503	SO:0001589	frameshift_variant	2138	exon2			.	AJ000098	CCDS34906.1, CCDS34907.1, CCDS47873.1, CCDS75750.1	8q13.3	2014-06-19	2014-06-19		ENSG00000104313	ENSG00000104313		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3519	protein-coding gene	gene with protein product		601653	"""eyes absent (Drosophila) homolog 1"", ""eyes absent homolog 1 (Drosophila)"""	BOR		9020840	Standard	XM_005251184		Approved		uc003xys.4	Q99502	OTTHUMG00000149894	ENST00000340726.3:c.69delC	chr8.hg19:g.72267072delG	ENSP00000342626:p.Pro23fs	127.0	0.0		177.0	11.0	NM_172059	A6NHQ0|G5E9R4|Q0P516|Q8WX80	Frame_Shift_Del	DEL	ENST00000340726.3	hg19	CCDS34906.1																																																																																			.	.		0.463	EYA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313788.2	NM_000503, NM_172060	
EFNB2	1948	hgsc.bcm.edu	37	13	107148141	107148141	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:107148141delC	ENST00000245323.4	-	3	603	c.454delG	c.(454-456)gtgfs	p.V152fs		NM_004093.3	NP_004084.1	P52799	EFNB2_HUMAN	ephrin-B2	152	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				anatomical structure morphogenesis (GO:0009653)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|lymph vessel development (GO:0001945)|negative regulation of keratinocyte proliferation (GO:0010839)|organ morphogenesis (GO:0009887)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|regulation of chemotaxis (GO:0050920)|viral process (GO:0016032)	focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	13	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					GTCTGGCACACCCCTCCCTCC	0.448																																					p.V152fs		Atlas-INDEL	.											.	EFNB2	39	.	0			c.455delT						.						315.0	276.0	289.0					13																	107148141		2203	4300	6503	SO:0001589	frameshift_variant	1948	exon3			.	L38734	CCDS9507.1	13q33	2011-03-09			ENSG00000125266	ENSG00000125266		"""Ephrins"""	3227	protein-coding gene	gene with protein product	"""HTK ligand"", ""ligand of eph-related kinase 5"", ""eph-related receptor tyrosine kinase ligand 5"""	600527		EPLG5		7833926	Standard	NM_004093		Approved	LERK5, Htk-L, HTKL, MGC126226, MGC126227, MGC126228	uc001vqi.3	P52799	OTTHUMG00000017324	ENST00000245323.4:c.454delG	chr13.hg19:g.107148141delC	ENSP00000245323:p.Val152fs	105.0	0.0		120.0	10.0	NM_004093	Q5JV56	Frame_Shift_Del	DEL	ENST00000245323.4	hg19	CCDS9507.1																																																																																			.	.		0.448	EFNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045733.4	NM_004093	
PPP1R15B	84919	hgsc.bcm.edu	37	1	204378837	204378837	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:204378837delG	ENST00000367188.4	-	1	2082	c.1703delC	c.(1702-1704)cctfs	p.P568fs	RP11-739N20.2_ENST00000443515.1_RNA	NM_032833.3	NP_116222.3	Q5SWA1	PR15B_HUMAN	protein phosphatase 1, regulatory subunit 15B	568					ER overload response (GO:0006983)|regulation of translation (GO:0006417)|response to hydrogen peroxide (GO:0042542)	protein phosphatase type 1 complex (GO:0000164)	protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|cervix(1)|kidney(4)|large_intestine(3)|lung(16)|ovary(1)|pancreas(2)|skin(1)|urinary_tract(3)	34	all_cancers(21;0.0032)|all_neural(3;0.0218)|Glioma(3;0.0382)|Breast(84;0.179)|all_epithelial(62;0.193)|Prostate(682;0.227)		all cancers(3;1.14e-29)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.139)			AAAATTTAAAGGGTTGTAGGG	0.443																																					p.P568fs		Atlas-INDEL	.											.	PPP1R15B	67	.	0			c.1704delT						.						66.0	67.0	67.0					1																	204378837		2203	4300	6503	SO:0001589	frameshift_variant	84919	exon1			.	AK027650	CCDS1445.1	1q32.1	2012-04-17	2011-10-04		ENSG00000158615	ENSG00000158615		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14951	protein-coding gene	gene with protein product		613257	"""protein phosphatase 1, regulatory (inhibitor) subunit 15B"""			11948623	Standard	XM_005245551		Approved	FLJ14744	uc001hav.4	Q5SWA1	OTTHUMG00000036105	ENST00000367188.4:c.1703delC	chr1.hg19:g.204378837delG	ENSP00000356156:p.Pro568fs	115.0	0.0		163.0	10.0	NM_032833	Q53GQ4|Q658M2|Q6P156|Q96SN1	Frame_Shift_Del	DEL	ENST00000367188.4	hg19	CCDS1445.1																																																																																			.	.		0.443	PPP1R15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087974.1	NM_032833	
PDZD2	23037	hgsc.bcm.edu	37	5	32090198	32090198	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:32090198delC	ENST00000438447.1	+	20	7032	c.6644delC	c.(6643-6645)accfs	p.T2215fs	PDZD2_ENST00000282493.3_Frame_Shift_Del_p.T2215fs			O15018	PDZD2_HUMAN	PDZ domain containing 2	2215					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CTCTACTTCACCCCAAGGCCA	0.617																																					p.T2215fs		Atlas-INDEL	.											.	PDZD2	306	.	0			c.6643delA						.						141.0	155.0	150.0					5																	32090198		2203	4300	6503	SO:0001589	frameshift_variant	23037	exon19			.	AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6644delC	chr5.hg19:g.32090198delC	ENSP00000402033:p.Thr2215fs	91.0	0.0		166.0	10.0	NM_178140	Q9BXD4	Frame_Shift_Del	DEL	ENST00000438447.1	hg19	CCDS34137.1																																																																																			.	.		0.617	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366608.1		
VSTM4	196740	hgsc.bcm.edu	37	10	50315774	50315774	+	Frame_Shift_Del	DEL	C	C	-	rs368171376		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:50315774delC	ENST00000332853.4	-	2	345	c.322delG	c.(322-324)gcgfs	p.A108fs	VSTM4_ENST00000298454.3_Frame_Shift_Del_p.A108fs	NM_001031746.3	NP_001026916.2	Q8IW00	VSTM4_HUMAN	V-set and transmembrane domain containing 4	108	Ig-like.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A108S(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(14)|skin(2)	31						CTGTAGAGCGCCCCCCGCTGC	0.612																																					p.A108fs		Atlas-INDEL	.											.	VSTM4	83	.	1	Substitution - Missense(1)	liver(1)	c.323delC						.						72.0	76.0	75.0					10																	50315774		2203	4300	6503	SO:0001589	frameshift_variant	196740	exon2			.	BC041414	CCDS7228.1, CCDS31198.1	10q11.23	2013-01-11	2011-07-01	2011-07-01	ENSG00000165633	ENSG00000165633		"""Immunoglobulin superfamily / V-set domain containing"""	26470	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 72"""	C10orf72			Standard	XR_246075		Approved	FLJ31737	uc001jhf.2	Q8IW00	OTTHUMG00000018184	ENST00000332853.4:c.322delG	chr10.hg19:g.50315774delC	ENSP00000331062:p.Ala108fs	111.0	0.0		145.0	10.0	NM_144984	B4DNI6|Q96MX7	Frame_Shift_Del	DEL	ENST00000332853.4	hg19	CCDS31198.1																																																																																			.	.		0.612	VSTM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047966.2	NM_144984	
PITPNA	5306	hgsc.bcm.edu	37	17	1444911	1444911	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:1444911delA	ENST00000313486.7	-	6	576	c.321delT	c.(319-321)tttfs	p.F107fs	PITPNA_ENST00000539476.1_Frame_Shift_Del_p.F107fs	NM_006224.3	NP_006215.1	Q00169	PIPNA_HUMAN	phosphatidylinositol transfer protein, alpha	107					axon guidance (GO:0007411)|lipid metabolic process (GO:0006629)|phospholipid transport (GO:0015914)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)|phosphatidylcholine transporter activity (GO:0008525)|phosphatidylinositol transporter activity (GO:0008526)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)	7				UCEC - Uterine corpus endometrioid carcinoma (25;0.0845)		TTTTAATCAGAAAGTCTTCTT	0.433																																					p.L108X		Atlas-INDEL	.											.	PITPNA	14	.	0			c.322delC						.						89.0	87.0	88.0					17																	1444911		1850	4098	5948	SO:0001589	frameshift_variant	5306	exon6			.	M73704	CCDS45563.1	17p13.3	2012-06-29	2003-05-09	2004-09-03	ENSG00000174238	ENSG00000174238			9001	protein-coding gene	gene with protein product		600174	"""phosphotidylinositol transfer protein"""	PITPN		8255295	Standard	NM_006224		Approved	VIB1A	uc021tnf.1	Q00169	OTTHUMG00000177779	ENST00000313486.7:c.321delT	chr17.hg19:g.1444911delA	ENSP00000316809:p.Phe107fs	146.0	0.0		177.0	11.0	NM_006224		Frame_Shift_Del	DEL	ENST00000313486.7	hg19	CCDS45563.1																																																																																			.	.		0.433	PITPNA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000438927.3		
PSMB10	5699	hgsc.bcm.edu	37	16	67970637	67970637	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr16:67970637delG	ENST00000358514.4	-	1	353	c.16delC	c.(16-18)ctgfs	p.L6fs	CTC-479C5.12_ENST00000573493.1_5'Flank	NM_002801.3	NP_002792.1	P40306	PSB10_HUMAN	proteasome (prosome, macropain) subunit, beta type, 10	6					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cell morphogenesis (GO:0000902)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|humoral immune response (GO:0006959)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|T cell proliferation (GO:0042098)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)			NS(2)|endometrium(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00415)|Epithelial(162;0.0182)|all cancers(182;0.119)	Carfilzomib(DB08889)	CGGGGCTCCAGGGCTGGCTTC	0.657																																					p.L6fs		Atlas-INDEL	.											.	PSMB10	19	.	0			c.17delT						.						6.0	8.0	8.0					16																	67970637		2065	4131	6196	SO:0001589	frameshift_variant	5699	exon1			.	Y13640	CCDS10853.1	16q22.1	2008-02-05			ENSG00000205220	ENSG00000205220		"""Proteasome (prosome, macropain) subunits"""	9538	protein-coding gene	gene with protein product		176847		MECL1		8268911	Standard	NM_002801		Approved	LMP10, MGC1665, beta2i	uc002eux.2	P40306	OTTHUMG00000137553	ENST00000358514.4:c.16delC	chr16.hg19:g.67970637delG	ENSP00000351314:p.Leu6fs	121.0	0.0		156.0	10.0	NM_002801	B2R5J4|Q5U098	Frame_Shift_Del	DEL	ENST00000358514.4	hg19	CCDS10853.1																																																																																			.	.		0.657	PSMB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268887.1	NM_002801	
DOCK9	23348	hgsc.bcm.edu	37	13	99567709	99567709	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr13:99567709delT	ENST00000376460.1	-	8	846	c.766delA	c.(766-768)agtfs	p.S257fs	DOCK9_ENST00000442173.1_Frame_Shift_Del_p.S257fs|DOCK9_ENST00000339416.2_Frame_Shift_Del_p.S258fs|DOCK9_ENST00000448493.2_Frame_Shift_Del_p.S269fs	NM_001130048.1|NM_015296.2	NP_001123520.1|NP_056111.1	Q9BZ29	DOCK9_HUMAN	dedicator of cytokinesis 9	258	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(18)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	59	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					AGATAACTACTTTTGTCCTGC	0.373																																					p.S257fs		Atlas-INDEL	.											.	DOCK9	311	.	0			c.770delG						.						85.0	79.0	81.0					13																	99567709		1993	4185	6178	SO:0001589	frameshift_variant	23348	exon8			.	AF527605	CCDS45062.1	13q32.3	2013-01-10			ENSG00000088387	ENSG00000088387		"""Pleckstrin homology (PH) domain containing"""	14132	protein-coding gene	gene with protein product	"""zizimin1"""	607325				12172552, 12432077	Standard	NM_015296		Approved	KIAA1058, ZIZ1	uc001vnt.2	Q9BZ29	OTTHUMG00000017260	ENST00000376460.1:c.766delA	chr13.hg19:g.99567709delT	ENSP00000365643:p.Ser257fs	118.0	0.0		148.0	10.0	NM_001130049	B3KX25|E9PFM9|Q5JUD4|Q5JUD6|Q5T2Q1|Q5TAN8|Q9BZ25|Q9BZ26|Q9BZ27|Q9BZ28|Q9UPU4	Frame_Shift_Del	DEL	ENST00000376460.1	hg19	CCDS45062.1																																																																																			.	.		0.373	DOCK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045566.1	NM_015296	
SIL1	64374	hgsc.bcm.edu	37	5	138362514	138362514	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:138362514delA	ENST00000394817.2	-	6	760	c.621delT	c.(619-621)tttfs	p.F207fs	CTB-46B19.2_ENST00000512875.2_RNA|SIL1_ENST00000509534.1_Frame_Shift_Del_p.F214fs|SIL1_ENST00000265195.5_Frame_Shift_Del_p.F207fs	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor	207	Interaction with HSPA5 and localization to the endoplasmic reticulum. {ECO:0000250}.				intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			ATTCAAGATCAAAGAGCGCAG	0.408									Marinesco-Sjgren syndrome																												p.D208fs		Atlas-INDEL	.											.	SIL1	31	.	0			c.622delG						.						117.0	109.0	112.0					5																	138362514		2203	4300	6503	SO:0001589	frameshift_variant	64374	exon7	Familial Cancer Database	Marinesco-Sjogren syndrome	.	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.621delT	chr5.hg19:g.138362514delA	ENSP00000378294:p.Phe207fs	108.0	0.0		194.0	13.0	NM_001037633	D3DQC2|Q8N2L3	Frame_Shift_Del	DEL	ENST00000394817.2	hg19	CCDS4209.1																																																																																			.	.		0.408	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251319.1	NM_022464	
FOXK2	3607	hgsc.bcm.edu	37	17	80544026	80544026	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr17:80544026delC	ENST00000335255.5	+	7	1700	c.1526delC	c.(1525-1527)gccfs	p.A509fs	RP13-638C3.3_ENST00000575085.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	509					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			GCCGTGCTGGCCCCTCCTAAG	0.632																																					p.A509fs		Atlas-INDEL	.											.	FOXK2	46	.	0			c.1525delG						.						22.0	22.0	22.0					17																	80544026		2191	4278	6469	SO:0001589	frameshift_variant	3607	exon7			.	U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1526delC	chr17.hg19:g.80544026delC	ENSP00000335677:p.Ala509fs	81.0	0.0		166.0	10.0	NM_004514	A6NEP5|Q13622|Q13623|Q13624	Frame_Shift_Del	DEL	ENST00000335255.5	hg19	CCDS11813.1																																																																																			.	.		0.632	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277099.2	NM_181430	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57081166	57081166	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:57081166delG	ENST00000532437.1	-	4	1307	c.996delC	c.(994-996)cccfs	p.P332fs	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Frame_Shift_Del_p.P332fs			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	332	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				GAGTCACAGCGGGGCAGGGAG	0.667																																					p.A333fs		Atlas-INDEL	.											TNKS1BP1,NS,carcinoma,0,1	TNKS1BP1	148	.	0			c.997delG						.						20.0	24.0	22.0					11																	57081166		2185	4289	6474	SO:0001589	frameshift_variant	85456	exon5			.	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.996delC	chr11.hg19:g.57081166delG	ENSP00000437271:p.Pro332fs	194.0	0.0		208.0	13.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Frame_Shift_Del	DEL	ENST00000532437.1	hg19	CCDS7951.1																																																																																			.	.		0.667	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
TENM2	57451	hgsc.bcm.edu	37	5	167675302	167675302	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:167675302delC	ENST00000518659.1	+	27	7397	c.7358delC	c.(7357-7359)gccfs	p.A2453fs	TENM2_ENST00000545108.1_Frame_Shift_Del_p.A2452fs|TENM2_ENST00000520394.1_Frame_Shift_Del_p.A2214fs|TENM2_ENST00000519204.1_Frame_Shift_Del_p.A2332fs|TENM2_ENST00000403607.2_Frame_Shift_Del_p.A2277fs	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2453					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										AAGGAGCCGGCCCCCTTTAAC	0.512																																					p.A2444fs		Atlas-INDEL	.											.	.	.	.	0			c.7330delG						.						60.0	61.0	61.0					5																	167675302		1939	4140	6079	SO:0001589	frameshift_variant	57451	exon27			.	AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.7358delC	chr5.hg19:g.167675302delC	ENSP00000429430:p.Ala2453fs	82.0	0.0		121.0	10.0	NM_001122679	Q9ULU2	Frame_Shift_Del	DEL	ENST00000518659.1	hg19																																																																																				.	.		0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376096.1	NM_001122679	
POGLUT1	56983	hgsc.bcm.edu	37	3	119187934	119187934	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:119187934delG	ENST00000295588.4	+	1	150	c.66delG	c.(64-66)cagfs	p.Q22fs		NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1	22					cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						CCTCAGCGCAGGGCCGCCAGA	0.731																																					p.Q22fs		Atlas-INDEL	.											.	POGLUT1	32	.	0			c.65delA						.						35.0	30.0	32.0					3																	119187934		2202	4296	6498	SO:0001589	frameshift_variant	56983	exon1			.	BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.66delG	chr3.hg19:g.119187934delG	ENSP00000295588:p.Gln22fs	108.0	0.0		178.0	11.0	NM_152305	B2RD13|Q53GJ4|Q8N2T1	Frame_Shift_Del	DEL	ENST00000295588.4	hg19	CCDS2988.1																																																																																			.	.		0.731	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355034.2	NM_152305	
ANXA8L1	728113	hgsc.bcm.edu	37	10	47756662	47756662	+	Frame_Shift_Del	DEL	T	T	-	rs202221168		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:47756662delT	ENST00000374277.5	+	8	698	c.576delT	c.(574-576)aatfs	p.N192fs	AL603965.1_ENST00000335083.5_Intron|ANXA8L2_ENST00000538825.1_Frame_Shift_Del_p.N130fs|ANXA8L2_ENST00000449464.2_3'UTR|ANXA8L2_ENST00000340243.6_Frame_Shift_Del_p.N173fs	NM_001630.2	NP_001621.2														endometrium(1)|pancreas(1)	2						CAGGCGAGAATATTCGTGGGA	0.597																																					p.N192fs		Atlas-INDEL	.											.	ANXA8L2	8	.	0			c.575delA						.						71.0	42.0	52.0					10																	47756662		1990	3787	5777	SO:0001589	frameshift_variant	244	exon8			.																												ENST00000374277.5:c.576delT	chr10.hg19:g.47756662delT	ENSP00000363395:p.Asn192fs	136.0	0.0		161.0	10.0	NM_001630		Frame_Shift_Del	DEL	ENST00000374277.5	hg19	CCDS7216.1																																																																																			.	.		0.597	ANXA8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047866.1		
PRKRA	8575	hgsc.bcm.edu	37	2	179300978	179300978	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr2:179300978delG	ENST00000325748.4	-	7	878	c.678delC	c.(676-678)atcfs	p.I226fs	PRKRA_ENST00000487082.1_Frame_Shift_Del_p.I201fs|PRKRA_ENST00000432031.2_Frame_Shift_Del_p.I215fs|PRKRA_ENST00000438687.3_Frame_Shift_Del_p.I113fs|AC009948.5_ENST00000436616.2_RNA|AC009948.5_ENST00000454488.1_RNA|AC009948.5_ENST00000453026.2_RNA	NM_003690.4	NP_003681.1	O75569	PRKRA_HUMAN	protein kinase, interferon-inducible double stranded RNA dependent activator	226	Sufficient for self-association and interaction with TARBP2.				cellular response to oxidative stress (GO:0034599)|gene expression (GO:0010467)|immune response (GO:0006955)|middle ear morphogenesis (GO:0042474)|negative regulation of cell proliferation (GO:0008285)|outer ear morphogenesis (GO:0042473)|positive regulation of catalytic activity (GO:0043085)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|production of siRNA involved in RNA interference (GO:0030422)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)|skeletal system morphogenesis (GO:0048705)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	enzyme activator activity (GO:0008047)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(2)	19			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.00634)|all cancers(119;0.0265)			TCAGTAAGTTGATCTTTTCAC	0.358																																					p.N227fs	Melanoma(200;68 3001 23825 48764)	Atlas-INDEL	.											.	PRKRA	56	.	0			c.679delA						.						158.0	180.0	173.0					2																	179300978		2203	4300	6503	SO:0001589	frameshift_variant	8575	exon7			.	AF072860	CCDS2279.1, CCDS46460.1, CCDS46461.1	2q31.2	2009-08-25			ENSG00000180228	ENSG00000180228			9438	protein-coding gene	gene with protein product	"""protein activator of the interferon-induced protein kinase"""	603424				9687506, 10336432	Standard	NM_003690		Approved	PACT, RAX, HSD14, DYT16	uc002umf.3	O75569	OTTHUMG00000132576	ENST00000325748.4:c.678delC	chr2.hg19:g.179300978delG	ENSP00000318176:p.Ile226fs	149.0	0.0		130.0	17.0	NM_003690	A8K3I6|Q53G24|Q6X7T5|Q8NDK4	Frame_Shift_Del	DEL	ENST00000325748.4	hg19	CCDS2279.1																																																																																			.	.		0.358	PRKRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255782.2	NM_003690	
HCFC1	3054	hgsc.bcm.edu	37	X	153217070	153217070	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:153217070delT	ENST00000310441.7	-	21	6315	c.5349delA	c.(5347-5349)gaafs	p.E1783fs	HCFC1_ENST00000354233.3_Frame_Shift_Del_p.E1714fs|HCFC1_ENST00000369984.4_Frame_Shift_Del_p.E1828fs	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	1783					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CATTGGCCACTTCGGTCAGGG	0.647																																					p.V1784fs		Atlas-INDEL	.											.	HCFC1	284	.	0			c.5350delG						.						40.0	52.0	48.0					X																	153217070		2082	4158	6240	SO:0001589	frameshift_variant	3054	exon21			.		CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.5349delA	chrX.hg19:g.153217070delT	ENSP00000309555:p.Glu1783fs	110.0	0.0		166.0	10.0	NM_005334	Q6P4G5	Frame_Shift_Del	DEL	ENST00000310441.7	hg19	CCDS44020.1																																																																																			.	.		0.647	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061099.4	NM_005334	
STAG2	10735	hgsc.bcm.edu	37	X	123224569	123224569	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chrX:123224569delT	ENST00000371160.1	+	31	3712	c.3422delT	c.(3421-3423)gttfs	p.V1141fs	STAG2_ENST00000354548.5_Frame_Shift_Del_p.V1072fs|STAG2_ENST00000371145.3_Frame_Shift_Del_p.V1141fs|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Frame_Shift_Del_p.V1141fs|STAG2_ENST00000371157.3_Frame_Shift_Del_p.V1141fs|STAG2_ENST00000371144.3_Frame_Shift_Del_p.V1141fs	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	1141					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTCATGAGTGTTTATCCAATG	0.373																																					p.V1141fs		Atlas-INDEL	.											.	STAG2	309	.	0			c.3421delG						.						198.0	149.0	166.0					X																	123224569		2203	4300	6503	SO:0001589	frameshift_variant	10735	exon31			.	Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.3422delT	chrX.hg19:g.123224569delT	ENSP00000360202:p.Val1141fs	120.0	0.0		129.0	10.0	NM_001042749	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Frame_Shift_Del	DEL	ENST00000371160.1	hg19	CCDS14607.1																																																																																			.	.		0.373	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000156159.2	NM_006603	
KCNA3	3738	hgsc.bcm.edu	37	1	111216834	111216834	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:111216834delC	ENST00000369769.2	-	1	821	c.598delG	c.(598-600)gacfs	p.D200fs		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	200					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	AAGCCCTCGTCCTCGCGGAAC	0.692																																					p.D200fs		Atlas-Indel,Pindel	.											.	KCNA3	91	.	0			c.599delA						.						43.0	49.0	47.0					1																	111216834		2203	4300	6503	SO:0001589	frameshift_variant	3738	exon1			.	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.598delG	chr1.hg19:g.111216834delC	ENSP00000358784:p.Asp200fs	69.0	0.0		109.0	55.0	NM_002232	Q5VWN2	Frame_Shift_Del	DEL	ENST00000369769.2	hg19	CCDS828.2																																																																																			.	.		0.692	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
TRIM33	51592	hgsc.bcm.edu	37	1	114973529	114973530	+	Frame_Shift_Ins	INS	-	-	CAAC			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:114973529_114973530insCAAC	ENST00000358465.2	-	6	1128_1129	c.1045_1046insGTTG	c.(1045-1047)aaafs	p.K349fs	TRIM33_ENST00000369543.2_Frame_Shift_Ins_p.K349fs|TRIM33_ENST00000450349.2_5'UTR	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	349	Necessary for oligomerization.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTACTTCTTTTATCCTGAAT	0.337			T	RET	papillary thyroid																																p.K349_E350delinsSX		Atlas-INDEL	.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33	115	.	0			c.1046_1047insGTTG						.																																			SO:0001589	frameshift_variant	51592	exon6			.	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1045_1046insGTTG	chr1.hg19:g.114973529_114973530insCAAC	ENSP00000351250:p.Lys349fs	172.0	0.0		148.0	11.0	NM_033020	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Frame_Shift_Ins	INS	ENST00000358465.2	hg19	CCDS872.1																																																																																			.	.		0.337	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	
GPAM	57678	hgsc.bcm.edu	37	10	113920588	113920593	+	In_Frame_Del	DEL	CACAAA	CACAAA	-	rs187077125		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	CACAAA	CACAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:113920588_113920593delCACAAA	ENST00000348367.4	-	16	1725_1730	c.1528_1533delTTTGTG	c.(1528-1533)tttgtgdel	p.FV510del	GPAM_ENST00000423155.1_In_Frame_Del_p.FV510del|GPAM_ENST00000369425.1_In_Frame_Del_p.FV510del			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	510					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CCTCTTTCATCACAAAGAAGTCTTCG	0.437																																					p.510_512del	Ovarian(161;1017 2606 18293 52943)	Atlas-INDEL	.											.	GPAM	68	.	0			c.1529_1534del						.																																			SO:0001651	inframe_deletion	57678	exon16			.	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1528_1533delTTTGTG	chr10.hg19:g.113920588_113920593delCACAAA	ENSP00000265276:p.Phe510_Val511del	91.0	0.0		84.0	12.0	NM_001244949	Q5VW51|Q86TA3	In_Frame_Del	DEL	ENST00000348367.4	hg19	CCDS7570.1																																																																																			.	.		0.437	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
HRNR	388697	hgsc.bcm.edu	37	1	152189562	152189562	+	Frame_Shift_Del	DEL	T	T	-	rs144150413		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:152189562delT	ENST00000368801.2	-	3	4618	c.4543delA	c.(4543-4545)agtfs	p.S1515fs	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1515					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GAAGAGTGACTGGAGCCAGAC	0.577																																					p.S1515fs		Atlas-INDEL	.											.	HRNR	403	.	0			c.4544delG						.																																			SO:0001589	frameshift_variant	388697	exon3			.	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.4543delA	chr1.hg19:g.152189562delT	ENSP00000357791:p.Ser1515fs	6.0	1.0		15.0	13.0	NM_001009931	Q5DT20|Q5U1F4	Frame_Shift_Del	DEL	ENST00000368801.2	hg19	CCDS30859.1																																																																																			.	.		0.577	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
OR8G5	219865	hgsc.bcm.edu	37	11	124134838	124134838	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr11:124134838delA	ENST00000524943.2	+	1	116	c.116delA	c.(115-117)gaafs	p.E39fs	OR8G1_ENST00000341493.2_RNA	NM_001005198.1	NP_001005198.1	Q8NG78	OR8G5_HUMAN	olfactory receptor, family 8, subfamily G, member 5	39						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)						Breast(109;0.0157)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0523)		ATGGCAGCAGAAAACCATTCT	0.418																																					p.E39fs	Ovarian(169;523 1969 8640 31295 51256)	Atlas-INDEL	.											.	.	.	.	0			c.115delG						.						52.0	52.0	52.0					11																	124134838		1938	4163	6101	SO:0001589	frameshift_variant	219865	exon1			.	BK004516	CCDS66256.1	11q24.1	2014-04-17		2004-03-10	ENSG00000255298	ENSG00000255298		"""GPCR / Class A : Olfactory receptors"""	19622	protein-coding gene	gene with protein product				OR8G5P, OR8G6			Standard	NM_001005198		Approved			Q8NG78	OTTHUMG00000186059	ENST00000524943.2:c.116delA	chr11.hg19:g.124134838delA	ENSP00000477014:p.Glu39fs	164.0	0.0		179.0	11.0	NM_001005198	B2RND3|Q6IEU6	Frame_Shift_Del	DEL	ENST00000524943.2	hg19																																																																																				.	.		0.418	OR8G5-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000387283.2	NM_001005198	
FCGBP	8857	hgsc.bcm.edu	37	19	40433636	40433636	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr19:40433636delC	ENST00000221347.6	-	2	640	c.633delG	c.(631-633)gggfs	p.G211fs		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	211	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)		p.G211G(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			TGACCTTTGACCCCGAGAGAT	0.547																																					p.S212fs		Atlas-INDEL	.											.	FCGBP	416	.	1	Substitution - coding silent(1)	lung(1)	c.634delT						.						73.0	72.0	73.0					19																	40433636		2203	4300	6503	SO:0001589	frameshift_variant	8857	exon2			.	D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.633delG	chr19.hg19:g.40433636delC	ENSP00000221347:p.Gly211fs	159.0	0.0		154.0	10.0	NM_003890	O95784	Frame_Shift_Del	DEL	ENST00000221347.6	hg19	CCDS12546.1																																																																																			.	.		0.547	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462507.1	NM_003890	
CLDN16	10686	hgsc.bcm.edu	37	3	190106065	190106065	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:190106065delG	ENST00000264734.2	+	1	405	c.157delG	c.(157-159)gggfs	p.G53fs	CLDN16_ENST00000456423.1_Frame_Shift_Del_p.G53fs|CLDN16_ENST00000468220.1_Intron	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	53					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		CCACTTAAGTGGGGCCAGGGC	0.502																																					p.S52fs		Pindel	.											.	CLDN16	59	.	0			c.156delT						.						146.0	129.0	135.0					3																	190106065		2203	4300	6503	SO:0001589	frameshift_variant	10686	exon1			.	AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.157delG	chr3.hg19:g.190106065delG	ENSP00000264734:p.Gly53fs	204.0	0.0		211.0	10.0	NM_006580		Frame_Shift_Del	DEL	ENST00000264734.2	hg19	CCDS3296.1																																																																																			.	.		0.502	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343519.1	NM_006580	
GPAM	57678	hgsc.bcm.edu	37	10	113920573	113920593	+	In_Frame_Del	DEL	GACTTCCTCTTTCATCACAAA	GACTTCCTCTTTCATCACAAA	-	rs187077125		TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	GACTTCCTCTTTCATCACAAA	GACTTCCTCTTTCATCACAAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr10:113920573_113920593delGACTTCCTCTTTCATCACAAA	ENST00000348367.4	-	16	1725_1745	c.1528_1548delTTTGTGATGAAAGAGGAAGTC	c.(1528-1548)tttgtgatgaaagaggaagtcdel	p.FVMKEEV510del	GPAM_ENST00000423155.1_In_Frame_Del_p.FVMKEEV510del|GPAM_ENST00000369425.1_In_Frame_Del_p.FVMKEEV510del			Q9HCL2	GPAT1_HUMAN	glycerol-3-phosphate acyltransferase, mitochondrial	510					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|defense response to virus (GO:0051607)|fatty acid homeostasis (GO:0055089)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|interleukin-2 secretion (GO:0070970)|negative regulation of activation-induced cell death of T cells (GO:0070236)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of multicellular organism growth (GO:0040018)|regulation of cytokine secretion (GO:0050707)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			breast(2)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31				Epithelial(162;0.0306)|all cancers(201;0.123)		CACGAGCCAGGACTTCCTCTTTCATCACAAAGAAGTCTTCG	0.439																																					p.510_517del	Ovarian(161;1017 2606 18293 52943)	Pindel	.											.	GPAM	68	.	0			c.1529_1549del						.																																			SO:0001651	inframe_deletion	57678	exon16			.	AL832464	CCDS7570.1	10q25.3	2009-07-15			ENSG00000119927	ENSG00000119927			24865	protein-coding gene	gene with protein product	"""glycerol-3-phosphate acyltransferase 1, mitochondrial"""	602395				10997877, 8369314	Standard	NM_020918		Approved	KIAA1560, MGC26846, GPAT1	uc001kzp.3	Q9HCL2	OTTHUMG00000019055	ENST00000348367.4:c.1528_1548delTTTGTGATGAAAGAGGAAGTC	chr10.hg19:g.113920573_113920593delGACTTCCTCTTTCATCACAAA	ENSP00000265276:p.Phe510_Val516del	99.0	0.0		97.0	11.0	NM_001244949	Q5VW51|Q86TA3	In_Frame_Del	DEL	ENST00000348367.4	hg19	CCDS7570.1																																																																																			.	.		0.439	GPAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050377.1	NM_020918	
EIF4EBP3	8637	hgsc.bcm.edu	37	5	139928556	139928556	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr5:139928556delC	ENST00000310331.2	+	2	241	c.169delC	c.(169-171)cccfs	p.P58fs	ANKHD1-EIF4EBP3_ENST00000532219.1_Frame_Shift_Del_p.T2582fs|SRA1_ENST00000520427.1_5'Flank|ANKHD1_ENST00000297183.6_Frame_Shift_Del_p.T2582fs	NM_003732.2	NP_003723.1	O60516	4EBP3_HUMAN	eukaryotic translation initiation factor 4E binding protein 3	58					negative regulation of translational initiation (GO:0045947)	eukaryotic translation initiation factor 4F complex (GO:0016281)|membrane (GO:0016020)	translation repressor activity (GO:0030371)			endometrium(1)|ovary(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCCCGGACACCCCCCTGCTG	0.582																																					p.T2582fs		Pindel	.											.	ANKHD1-EIF4EBP3	179	.	0			c.7744delA						.						43.0	43.0	43.0					5																	139928556		2203	4300	6503	SO:0001589	frameshift_variant	404734	exon35			.	AF038869	CCDS4226.1	5q31.3	2007-07-18			ENSG00000243056	ENSG00000243056			3290	protein-coding gene	gene with protein product		603483				9593750	Standard	NM_003732		Approved	4E-BP3	uc003lfy.1	O60516	OTTHUMG00000129498	ENST00000310331.2:c.169delC	chr5.hg19:g.139928556delC	ENSP00000308472:p.Pro58fs	146.0	0.0		238.0	10.0	NM_020690		Frame_Shift_Del	DEL	ENST00000310331.2	hg19	CCDS4226.1																																																																																			.	.		0.582	EIF4EBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251668.2	NM_003732	
DNAJC19	131118	hgsc.bcm.edu	37	3	180702431	180702431	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr3:180702431delT	ENST00000382564.2	-	6	518	c.348delA	c.(346-348)aaafs	p.K116fs	DNAJC19_ENST00000491873.1_Frame_Shift_Del_p.K91fs|DNAJC19_ENST00000479269.1_Frame_Shift_Del_p.K91fs|DNAJC19_ENST00000486355.1_3'UTR	NM_145261.3	NP_660304.1	Q96DA6	TIM14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 19	116	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cellular protein metabolic process (GO:0044267)|genitalia development (GO:0048806)|protein folding (GO:0006457)|protein targeting to mitochondrion (GO:0006626)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)				large_intestine(2)|lung(1)	3	all_cancers(143;3.12e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-36)|OV - Ovarian serous cystadenocarcinoma(80;1.55e-22)			ATTTACTTCATTTTTTAGCTT	0.274																																					p.X117E		Pindel	.											.	DNAJC19	4	.	0			c.349delT						.						53.0	50.0	51.0					3																	180702431		2200	4289	6489	SO:0001589	frameshift_variant	131118	exon6			.		CCDS33895.1, CCDS54684.1	3q26.33	2014-09-17			ENSG00000205981	ENSG00000205981		"""Heat shock proteins / DNAJ (HSP40)"""	30528	protein-coding gene	gene with protein product		608977				19564938	Standard	NM_145261		Approved	TIMM14, Tim14, Pam18	uc003fkt.3	Q96DA6	OTTHUMG00000158180	ENST00000382564.2:c.348delA	chr3.hg19:g.180702431delT	ENSP00000372005:p.Lys116fs	291.0	0.0		241.0	10.0	NM_145261	B2R4B1|C9JBV1	Frame_Shift_Del	DEL	ENST00000382564.2	hg19	CCDS33895.1																																																																																			.	.		0.274	DNAJC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350336.1	NM_145261	
TRIM33	51592	hgsc.bcm.edu	37	1	114973529	114973563	+	Splice_Site	DEL	TTTATCCTGAATAAGAGAAATGCATCATTAGGTTA	TTTATCCTGAATAAGAGAAATGCATCATTAGGTTA	-			TCGA-DD-A3A1-01A-11D-A20W-10	TCGA-DD-A3A1-11A-11D-A20W-10	TTTATCCTGAATAAGAGAAATGCATCATTAGGTTA	TTTATCCTGAATAAGAGAAATGCATCATTAGGTTA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	f2249a54-91a5-4996-aa54-8ba33cba817c	c6b1efb7-67ef-47f9-afdd-cad7f1d19a46	g.chr1:114973529_114973563delTTTATCCTGAATAAGAGAAATGCATCATTAGGTTA	ENST00000358465.2	-	6	1124_1129	c.1041_1046delTAACCTAATGATGCATTTCTCTTATTCAGGATAAA	c.(1039-1047)agtaaccta>aga	p.SNL347fs	TRIM33_ENST00000369543.2_Splice_Site_p.SNL347fs|TRIM33_ENST00000450349.2_5'UTR	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	347	Necessary for oligomerization.				gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		ATTTACTTCTTTTATCCTGAATAAGAGAAATGCATCATTAGGTTATCAACTTATC	0.319			T	RET	papillary thyroid																																p.347_349del		Pindel	.		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	.	TRIM33	115	.	0			c.1041_1047del						.																																			SO:0001630	splice_region_variant	51592	exon6			.	AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.1041-1TAACCTAATGATGCATTTCTCTTATTCAGGATAAA>-	chr1.hg19:g.114973529_114973563delTTTATCCTGAATAAGAGAAATGCATCATTAGGTTA		145.0	0.0		132.0	12.0	NM_033020	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Frame_Shift_Del	DEL	ENST00000358465.2	hg19	CCDS872.1																																																																																			.	.		0.319	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032854.1	NM_015906	Frame_Shift_Del
