#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPL22	6146	hgsc.bcm.edu	37	1	6257754	6257754	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:6257754G>T	ENST00000234875.4	-	2	113	c.75C>A	c.(73-75)tgC>tgA	p.C25*	RPL22_ENST00000484532.1_5'UTR|RPL22_ENST00000497965.1_5'UTR	NM_000983.3	NP_000974.1	P35268	RL22_HUMAN	ribosomal protein L22	25					alpha-beta T cell differentiation (GO:0046632)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|skin(1)	6	Ovarian(185;0.0634)	all_cancers(23;2.78e-38)|all_epithelial(116;8.88e-22)|all_lung(118;7.95e-08)|Lung NSC(185;1.6e-06)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;4.53e-38)|GBM - Glioblastoma multiforme(13;3.33e-32)|OV - Ovarian serous cystadenocarcinoma(86;2.8e-19)|Colorectal(212;6.8e-08)|COAD - Colon adenocarcinoma(227;8.04e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|BRCA - Breast invasive adenocarcinoma(365;0.00107)|STAD - Stomach adenocarcinoma(132;0.00311)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CAGGGTGGGTGCAATCAAGAG	0.403			T	RUNX1	"""AML, CML"""																																p.C25X		Atlas-SNP	.		Dom	yes		1	1p36.31	6146	ribosomal protein L22 (EAP)		L	.	RPL22	24	.	0			c.C75A						.						75.0	65.0	68.0					1																	6257754		2203	4300	6503	SO:0001587	stop_gained	6146	exon2			GTGGGTGCAATCA	BC058887	CCDS58.1	1p36.31	2011-04-06			ENSG00000116251	ENSG00000116251		"""L ribosomal proteins"""	10315	protein-coding gene	gene with protein product		180474				8395054	Standard	NM_000983		Approved	EAP, L22	uc001amd.3	P35268	OTTHUMG00000000953	ENST00000234875.4:c.75C>A	chr1.hg19:g.6257754G>T	ENSP00000346088:p.Cys25*	42.0	0.0		57.0	36.0	NM_000983	B2R495|Q6IBD1	Nonsense_Mutation	SNP	ENST00000234875.4	hg19	CCDS58.1	.	.	.	.	.	.	.	.	.	.	G	33	5.214143	0.95104	.	.	ENSG00000116251	ENST00000234875	.	.	.	4.35	0.596	0.17496	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.3432	0.32256	0.4593:0.0:0.5407:0.0	.	.	.	.	X	25	.	ENSP00000346088:C25X	C	-	3	2	RPL22	6180341	1.000000	0.71417	0.998000	0.56505	0.988000	0.76386	1.080000	0.30779	0.241000	0.21283	-0.459000	0.05422	TGC	.	.		0.403	RPL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002830.1	NM_000983	
THAP3	90326	hgsc.bcm.edu	37	1	6688628	6688628	+	Silent	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:6688628C>T	ENST00000054650.4	+	3	302	c.144C>T	c.(142-144)ccC>ccT	p.P48P	THAP3_ENST00000307896.6_Silent_p.P48P|THAP3_ENST00000377627.3_Silent_p.P48P	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3	48							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		ACTTCAAGCCCAAGCAGCACA	0.612																																					p.P48P		Atlas-SNP	.											.	THAP3	43	.	0			c.C144T						.						67.0	56.0	60.0					1																	6688628		2203	4300	6503	SO:0001819	synonymous_variant	90326	exon2			CAAGCCCAAGCAG	BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.144C>T	chr1.hg19:g.6688628C>T		116.0	0.0		188.0	84.0	NM_001195752	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Silent	SNP	ENST00000054650.4	hg19	CCDS55572.1																																																																																			.	.		0.612	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004203.1	NM_138350	
CELF3	11189	hgsc.bcm.edu	37	1	151688481	151688481	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:151688481C>G	ENST00000290583.4	-	1	809	c.16G>C	c.(16-18)Gcc>Ccc	p.A6P	AL589765.1_ENST00000442233.2_Intron|RIIAD1_ENST00000326413.3_Intron|CELF3_ENST00000290585.4_Missense_Mutation_p.A6P	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	6					mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						AGCTTGATGGCATCCGGCTCC	0.597																																					p.A6P		Atlas-SNP	.											.	CELF3	49	.	0			c.G16C						.						69.0	62.0	64.0					1																	151688481		2203	4300	6503	SO:0001583	missense	11189	exon1			TGATGGCATCCGG	U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.16G>C	chr1.hg19:g.151688481C>G	ENSP00000290583:p.Ala6Pro	58.0	0.0		122.0	53.0	NM_007185	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	ENST00000290583.4	hg19	CCDS1002.1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.608560	0.87258	.	.	ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833	T;T	0.74106	-0.81;1.33	4.88	4.88	0.63580	Nucleotide-binding, alpha-beta plait (1);	.	.	.	.	T	0.78830	0.4345	L	0.46567	1.45	0.80722	D	1	D;D;D;D	0.76494	0.981;0.999;0.999;0.999	P;D;D;D	0.81914	0.709;0.97;0.983;0.995	T	0.81156	-0.1061	9	0.87932	D	0	.	15.6407	0.76997	0.0:1.0:0.0:0.0	.	6;6;6;6	Q5SZQ7;Q5SZQ8-2;Q5SZQ8;Q5SZQ8-3	.;.;CELF3_HUMAN;.	P	6	ENSP00000290585:A6P;ENSP00000290583:A6P	ENSP00000290583:A6P	A	-	1	0	CELF3	149955105	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.255000	0.78338	2.558000	0.86282	0.478000	0.44815	GCC	.	.		0.597	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036663.2	NM_007185	
IGSF9	57549	hgsc.bcm.edu	37	1	159898638	159898638	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:159898638C>T	ENST00000368094.1	-	19	2737	c.2540G>A	c.(2539-2541)cGg>cAg	p.R847Q	IGSF9_ENST00000493195.1_5'UTR|IGSF9_ENST00000361509.3_Missense_Mutation_p.R831Q	NM_001135050.1	NP_001128522.1	Q9P2J2	TUTLA_HUMAN	immunoglobulin superfamily, member 9	847	Pro-rich.				dendrite development (GO:0016358)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(17)|ovary(3)|prostate(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_hematologic(112;0.0597)	Breast(1374;0.000126)	BRCA - Breast invasive adenocarcinoma(70;0.111)			GTCTGGGCCCCGGCAAATGGG	0.692																																					p.R847Q		Atlas-SNP	.											.	IGSF9	123	.	0			c.G2540A						.						6.0	7.0	7.0					1																	159898638		2153	4237	6390	SO:0001583	missense	57549	exon19			GGGCCCCGGCAAA	AB037776	CCDS1190.1, CCDS44254.1	1q22-q23	2013-02-11			ENSG00000085552	ENSG00000085552		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	18132	protein-coding gene	gene with protein product		609738				11991715	Standard	NM_020789		Approved	KIAA1355, Nrt1, IGSF9A	uc001fur.2	Q9P2J2	OTTHUMG00000022794	ENST00000368094.1:c.2540G>A	chr1.hg19:g.159898638C>T	ENSP00000357073:p.Arg847Gln	13.0	0.0		26.0	4.0	NM_001135050		Missense_Mutation	SNP	ENST00000368094.1	hg19	CCDS44254.1	.	.	.	.	.	.	.	.	.	.	C	31	5.079536	0.94050	.	.	ENSG00000085552	ENST00000361509;ENST00000368094	T;T	0.78816	-1.21;-1.14	5.15	5.15	0.70609	.	0.000000	0.35179	N	0.003397	D	0.83193	0.5201	M	0.66939	2.045	0.33031	D	0.53016	D	0.89917	1.0	D	0.79108	0.992	T	0.83312	-0.0022	9	.	.	.	-20.9578	16.1159	0.81304	0.0:1.0:0.0:0.0	.	847	Q9P2J2	TUTLA_HUMAN	Q	831;847	ENSP00000355049:R831Q;ENSP00000357073:R847Q	.	R	-	2	0	IGSF9	158165262	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	4.681000	0.61663	2.378000	0.81104	0.655000	0.94253	CGG	.	.		0.692	IGSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059115.1	NM_020789	
GORAB	92344	hgsc.bcm.edu	37	1	170508682	170508682	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:170508682C>A	ENST00000367763.3	+	2	488	c.468C>A	c.(466-468)tgC>tgA	p.C156*	GORAB_ENST00000367762.1_Nonsense_Mutation_p.C156*|GORAB_ENST00000465717.1_3'UTR	NM_152281.2	NP_689494.2	Q5T7V8	GORAB_HUMAN	golgin, RAB6-interacting	156						cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(2)|large_intestine(3)|liver(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	17						AGCCAGATTGCAAATTGGAGA	0.398																																					p.C156X		Atlas-SNP	.											.	GORAB	41	.	0			c.C468A						.						55.0	57.0	56.0					1																	170508682		2203	4300	6503	SO:0001587	stop_gained	92344	exon2			AGATTGCAAATTG	AK021814	CCDS1289.1, CCDS53428.1	1q24.2	2009-02-13	2009-02-13	2009-02-13	ENSG00000120370	ENSG00000120370			25676	protein-coding gene	gene with protein product	"""gerodermia osteodysplastica"""	607983	"""SCY1-like 1 binding protein 1"""	SCYL1BP1		12783284, 15781263, 18997784	Standard	NM_152281		Approved	FLJ11752, NTKL-BP1, GO	uc001gha.2	Q5T7V8	OTTHUMG00000035228	ENST00000367763.3:c.468C>A	chr1.hg19:g.170508682C>A	ENSP00000356737:p.Cys156*	54.0	0.0		139.0	31.0	NM_152281	Q49A22|Q6P1P9|Q9HAE6|Q9Y350	Nonsense_Mutation	SNP	ENST00000367763.3	hg19	CCDS1289.1	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768546	0.31320	.	.	ENSG00000120370	ENST00000367763;ENST00000367762	.	.	.	5.51	3.31	0.37934	.	0.393945	0.31092	N	0.008267	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-19.1541	7.7954	0.29143	0.1349:0.7046:0.0:0.1605	.	.	.	.	X	156	.	ENSP00000356736:C156X	C	+	3	2	GORAB	168775306	0.990000	0.36364	1.000000	0.80357	0.088000	0.18126	2.401000	0.44513	1.325000	0.45301	-0.237000	0.12165	TGC	.	.		0.398	GORAB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000085226.1	NM_152281	
TNN	63923	hgsc.bcm.edu	37	1	175105078	175105078	+	Splice_Site	SNP	G	G	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr1:175105078G>C	ENST00000239462.4	+	16	3540		c.e16+1			NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N						axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		TTCTGGCTTGGTATGATCTCA	0.562																																					.		Atlas-SNP	.											.	TNN	297	.	0			c.3427+1G>C						.						106.0	108.0	107.0					1																	175105078		2203	4300	6503	SO:0001630	splice_region_variant	63923	exon16			GGCTTGGTATGAT	AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3427+1G>C	chr1.hg19:g.175105078G>C		61.0	0.0		191.0	41.0	NM_022093	B9EGP3|Q5R360	Splice_Site	SNP	ENST00000239462.4	hg19	CCDS30943.1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.757290	0.89843	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.003	0.92841	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TNN	173371701	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.538000	0.98072	2.555000	0.86185	0.655000	0.94253	.	.	.		0.562	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084422.1	XM_040527	Intron
GEN1	348654	hgsc.bcm.edu	37	2	17954051	17954051	+	Splice_Site	SNP	A	A	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:17954051A>G	ENST00000381254.2	+	8	1167	c.953A>G	c.(952-954)aAg>aGg	p.K318R	GEN1_ENST00000317402.7_Splice_Site_p.K318R|SMC6_ENST00000402989.1_Intron	NM_001130009.1	NP_001123481.1	Q17RS7	GEN_HUMAN	GEN1 Holliday junction 5' flap endonuclease	318					DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair via homologous recombination (GO:0000724)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|regulation of centrosome duplication (GO:0010824)|resolution of mitotic recombination intermediates (GO:0071140)|resolution of recombination intermediates (GO:0071139)	centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					AATATTAAGAAGTAAGTTTTT	0.348								Homologous recombination																													p.K318R		Atlas-SNP	.											.	GEN1	79	.	0			c.A953G						.						47.0	48.0	48.0					2																	17954051		2203	4299	6502	SO:0001630	splice_region_variant	348654	exon8			TTAAGAAGTAAGT	AK098188	CCDS1691.1	2p24.2	2013-06-04	2013-06-04		ENSG00000178295	ENSG00000178295			26881	protein-coding gene	gene with protein product	"""Holliday junction resolvase"""	612449	"""Gen endonuclease homolog 1 (Drosophila)"""			15576351	Standard	NM_182625		Approved	FLJ40869, Gen	uc002rct.2	Q17RS7	OTTHUMG00000121173	ENST00000381254.2:c.953+1A>G	chr2.hg19:g.17954051A>G		82.0	0.0		63.0	31.0	NM_182625	Q17RS9|Q6ZN37	Missense_Mutation	SNP	ENST00000381254.2	hg19	CCDS1691.1	.	.	.	.	.	.	.	.	.	.	A	11.22	1.573219	0.28092	.	.	ENSG00000178295	ENST00000317402;ENST00000381254;ENST00000528873	T;T;T	0.44083	0.93;0.93;0.93	5.63	0.528	0.17089	-3&apos (1); exonuclease, C-terminal domain (1);5&apos (1);	0.213792	0.36444	N	0.002582	T	0.31263	0.0791	L	0.42245	1.32	0.34778	D	0.734472	B	0.19200	0.034	B	0.15052	0.012	T	0.27536	-1.0071	10	0.41790	T	0.15	-11.5345	9.7716	0.40593	0.5839:0.0:0.4161:0.0	.	318	Q17RS7	GEN_HUMAN	R	318;318;89	ENSP00000318977:K318R;ENSP00000370653:K318R;ENSP00000431542:K89R	ENSP00000318977:K318R	K	+	2	0	GEN1	17817532	1.000000	0.71417	0.927000	0.36925	0.710000	0.40934	1.486000	0.35530	0.098000	0.17522	-0.290000	0.09829	AAG	.	.		0.348	GEN1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000241661.2	NM_182625	Missense_Mutation
SPAST	6683	hgsc.bcm.edu	37	2	32341263	32341263	+	Silent	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:32341263T>C	ENST00000315285.3	+	7	1205	c.1080T>C	c.(1078-1080)ctT>ctC	p.L360L	SPAST_ENST00000345662.1_Silent_p.L328L	NM_014946.3	NP_055761.2			spastin											breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TTGTTATTCTTCCTTCTCTGA	0.328																																					p.L360L		Atlas-SNP	.											.	SPAST	61	.	0			c.T1080C						.						134.0	129.0	131.0					2																	32341263		2203	4300	6503	SO:0001819	synonymous_variant	6683	exon7			TATTCTTCCTTCT	AJ246001	CCDS1778.1, CCDS1779.1	2p24-p21	2014-09-17	2005-03-15	2005-03-17	ENSG00000021574	ENSG00000021574		"""ATPases / AAA-type"""	11233	protein-coding gene	gene with protein product		604277	"""spastic paraplegia 4 (autosomal dominant; spastin)"""	SPG4		10493830, 10610178	Standard	NM_014946		Approved	FSP2, ADPSP, KIAA1083	uc002roc.3	Q9UBP0	OTTHUMG00000128455	ENST00000315285.3:c.1080T>C	chr2.hg19:g.32341263T>C		68.0	0.0		54.0	21.0	NM_014946		Silent	SNP	ENST00000315285.3	hg19	CCDS1778.1																																																																																			.	.		0.328	SPAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250253.1	NM_199436	
VIT	5212	hgsc.bcm.edu	37	2	36982183	36982183	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:36982183C>T	ENST00000389975.3	+	5	697	c.395C>T	c.(394-396)tCc>tTc	p.S132F	VIT_ENST00000497382.1_5'UTR|VIT_ENST00000379241.3_Missense_Mutation_p.S132F|VIT_ENST00000379242.3_Missense_Mutation_p.S132F|VIT_ENST00000457137.2_Missense_Mutation_p.S132F|VIT_ENST00000401530.1_Missense_Mutation_p.S132F|VIT_ENST00000404084.1_Missense_Mutation_p.S110F	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	132	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TGGAGAGAATCCTTTATCGTC	0.438																																					p.S132F		Atlas-SNP	.											.	VIT	138	.	0			c.C395T						.						131.0	113.0	119.0					2																	36982183		2203	4300	6503	SO:0001583	missense	5212	exon5			GAGAATCCTTTAT	AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.395C>T	chr2.hg19:g.36982183C>T	ENSP00000374625:p.Ser132Phe	202.0	0.0		244.0	87.0	NM_001177969	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	ENST00000389975.3	hg19	CCDS54347.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.311984	0.81358	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000402257;ENST00000457137;ENST00000404084;ENST00000379241;ENST00000401530	D;D;D;D;D;D	0.91180	-2.8;-2.8;-2.8;-2.8;-2.8;-2.8	5.63	5.63	0.86233	LCCL (4);	0.110275	0.64402	D	0.000004	D	0.96408	0.8828	M	0.90705	3.14	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;0.999;0.999;1.0;1.0	D;D;D;D;D;D	0.91635	0.999;0.977;0.961;0.989;0.989;0.999	D	0.96719	0.9531	10	0.72032	D	0.01	-25.1552	19.3047	0.94157	0.0:1.0:0.0:0.0	.	132;132;132;132;132;132	B4DRU4;E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4;Q6UXI7-3	.;.;.;VITRN_HUMAN;.;.	F	132;132;132;132;110;132;132	ENSP00000368544:S132F;ENSP00000374625:S132F;ENSP00000393561:S132F;ENSP00000384154:S110F;ENSP00000368543:S132F;ENSP00000385658:S132F	ENSP00000368543:S132F	S	+	2	0	VIT	36835687	1.000000	0.71417	0.994000	0.49952	0.710000	0.40934	4.588000	0.60999	2.652000	0.90054	0.655000	0.94253	TCC	.	.		0.438	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding			
CNGA3	1261	hgsc.bcm.edu	37	2	99012481	99012481	+	Missense_Mutation	SNP	G	G	T	rs104893614		TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:99012481G>T	ENST00000272602.2	+	7	887	c.848G>T	c.(847-849)cGg>cTg	p.R283L	CNGA3_ENST00000409937.1_Missense_Mutation_p.R287L|CNGA3_ENST00000436404.2_Missense_Mutation_p.R265L|CNGA3_ENST00000393504.1_Missense_Mutation_p.R283L			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	283			R -> Q (in ACHM2; does not reveal any detectable calcium influx upon agonist application at 37 degrees Celsius; the channel function could be restored by incubating the transfected cells at 27 degrees Celsius; the dose-response relationship for cGMP-activation is not significantly different from that of wild-type CNGA3; the dose-response relationship of the mutant CNGA3 + CNGB3 is similar to that of the wild-type protein; a substantial reduction of macroscopic cGMP maximum current to only one-third of the mean value for wild-type CNGA3 + CNGB3 is observed for the mutant CNGA3 + CNGB3; the channel density into the cell membrane is considerably improved by decreasing the cultivation temparature). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:18521937, ECO:0000269|PubMed:9662398}.|R -> W (in ACHM2; also found in patients with cone-rod dystrophy). {ECO:0000269|PubMed:11536077, ECO:0000269|PubMed:24903488, ECO:0000269|PubMed:9662398}.		cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						AAGTTTTCCCGGCTCTTTGAA	0.493																																					p.R283L		Atlas-SNP	.											CNGA3,colon,carcinoma,+1,1	CNGA3	118	.	0			c.G848T	GRCh37	CM980375	CNGA3	M	rs104893614	.						84.0	79.0	81.0					2																	99012481		2203	4300	6503	SO:0001583	missense	1261	exon8			TTTCCCGGCTCTT	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.848G>T	chr2.hg19:g.99012481G>T	ENSP00000272602:p.Arg283Leu	180.0	1.0		238.0	125.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	hg19	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474010	0.84640	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.99515	-6.06;-6.06;-6.06;-6.06	5.15	5.15	0.70609	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	H	0.96970	3.915	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.998;1.0;0.995	D	0.97335	0.9953	10	0.87932	D	0	.	17.5731	0.87940	0.0:0.0:1.0:0.0	.	287;265;283	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	L	283;265;283;287	ENSP00000377140:R283L;ENSP00000410070:R265L;ENSP00000272602:R283L;ENSP00000386761:R287L	ENSP00000272602:R283L	R	+	2	0	CNGA3	98378913	0.999000	0.42202	1.000000	0.80357	0.972000	0.66771	9.263000	0.95617	2.677000	0.91161	0.563000	0.77884	CGG	.	G|1.000;A|0.000		0.493	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
STEAP3	55240	hgsc.bcm.edu	37	2	120005536	120005536	+	Silent	SNP	A	A	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:120005536A>T	ENST00000354888.5	+	4	1278	c.774A>T	c.(772-774)acA>acT	p.T258T	STEAP3_ENST00000393106.2_Silent_p.T258T|STEAP3_ENST00000450943.2_Silent_p.T258T|STEAP3_ENST00000409811.1_Silent_p.T258T|STEAP3-AS1_ENST00000454260.1_RNA|STEAP3_ENST00000393108.2_Silent_p.T258T|STEAP3_ENST00000393107.2_Silent_p.T258T|STEAP3_ENST00000425223.2_Silent_p.T258T|STEAP3_ENST00000393110.2_Silent_p.T268T	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	258					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						TCAACACCACACTGCCGTGCG	0.622																																					p.T268T		Atlas-SNP	.											.	STEAP3	44	.	0			c.A804T						.						107.0	102.0	104.0					2																	120005536		2203	4300	6503	SO:0001819	synonymous_variant	55240	exon4			CACCACACTGCCG	AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.774A>T	chr2.hg19:g.120005536A>T		43.0	0.0		57.0	27.0	NM_182915	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Silent	SNP	ENST00000354888.5	hg19	CCDS2125.1																																																																																			.	.		0.622	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254193.1	NM_018234	
LRP1B	53353	hgsc.bcm.edu	37	2	141747101	141747101	+	Splice_Site	SNP	C	C	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:141747101C>G	ENST00000389484.3	-	17	3741	c.2770G>C	c.(2770-2772)Gcc>Ccc	p.A924P		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	924					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAACCTTTACCTGTGCAAGTT	0.393										TSP Lung(27;0.18)																											p.A924P	Colon(99;50 2074 2507 20106)	Atlas-SNP	.											LRP1B,right_upper_lobe,carcinoma,0,1	LRP1B	1315	.	0			c.G2770C						.						122.0	117.0	119.0					2																	141747101		2203	4300	6503	SO:0001630	splice_region_variant	53353	exon17			CTTTACCTGTGCA	AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.2770+1G>C	chr2.hg19:g.141747101C>G		42.0	1.0		77.0	31.0	NM_018557	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	ENST00000389484.3	hg19	CCDS2182.1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.245185	0.80024	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.91068	-2.78	5.69	5.69	0.88448	.	0.000000	0.64402	U	0.000001	D	0.87087	0.6090	N	0.04090	-0.28	0.80722	D	1	D	0.57257	0.979	P	0.55222	0.771	D	0.86281	0.1667	9	.	.	.	.	20.181	0.98201	0.0:1.0:0.0:0.0	.	924	Q9NZR2	LRP1B_HUMAN	P	924;862	ENSP00000374135:A924P	.	A	-	1	0	LRP1B	141463571	1.000000	0.71417	1.000000	0.80357	0.288000	0.27193	7.727000	0.84838	2.840000	0.97914	0.655000	0.94253	GCC	.	.		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254736.2	NM_018557	Missense_Mutation
PLA2R1	22925	hgsc.bcm.edu	37	2	160807872	160807872	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr2:160807872C>A	ENST00000283243.7	-	24	3725	c.3519G>T	c.(3517-3519)tgG>tgT	p.W1173C	PLA2R1_ENST00000392771.1_Missense_Mutation_p.W1173C	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1173	C-type lectin 7. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)	p.W1173*(1)	PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ACAGTCCAATCCAGTGGGCAT	0.468																																					p.W1173C		Atlas-SNP	.											PLA2R1,trunk,malignant_melanoma,0,1	PLA2R1	153	.	1	Substitution - Nonsense(1)	skin(1)	c.G3519T						.						183.0	168.0	173.0					2																	160807872		2203	4300	6503	SO:0001583	missense	22925	exon24			TCCAATCCAGTGG	U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3519G>T	chr2.hg19:g.160807872C>A	ENSP00000283243:p.Trp1173Cys	182.0	0.0		200.0	86.0	NM_001195641	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	ENST00000283243.7	hg19	CCDS33309.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.267346	0.80469	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.54071	0.59;0.59	5.88	5.88	0.94601	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.85682	D	0.000000	D	0.83774	0.5327	H	0.97491	4.015	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88760	0.3256	10	0.87932	D	0	.	20.2366	0.98359	0.0:1.0:0.0:0.0	.	1173;1173;1173	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	C	1173	ENSP00000283243:W1173C;ENSP00000376524:W1173C	ENSP00000283243:W1173C	W	-	3	0	PLA2R1	160516118	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.163000	0.77524	2.792000	0.96026	0.557000	0.71058	TGG	.	.		0.468	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333820.1		
DNAH12	201625	hgsc.bcm.edu	37	3	57475398	57475398	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr3:57475398A>T	ENST00000351747.2	-	12	1532	c.1352T>A	c.(1351-1353)cTc>cAc	p.L451H	DNAH12_ENST00000389536.4_Missense_Mutation_p.L451H	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	451	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GGCAAGACTGAGAAATTTTTC	0.303																																					p.L451H		Atlas-SNP	.											.	DNAH12	182	.	0			c.T1352A						.						45.0	34.0	37.0					3																	57475398		692	1590	2282	SO:0001583	missense	201625	exon12			AGACTGAGAAATT	U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.1352T>A	chr3.hg19:g.57475398A>T	ENSP00000295937:p.Leu451His	39.0	0.0		49.0	18.0	NM_178504	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	ENST00000351747.2	hg19		.	.	.	.	.	.	.	.	.	.	A	13.24	2.178049	0.38511	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536	T;T;T	0.21543	2.16;2.0;3.66	5.42	4.24	0.50183	.	0.330734	0.28166	N	0.016350	T	0.15219	0.0367	N	0.24115	0.695	0.80722	D	1	B	0.26876	0.162	B	0.33890	0.172	T	0.10109	-1.0644	10	0.18710	T	0.47	.	11.2534	0.49039	0.9259:0.0:0.0741:0.0	.	451	Q6ZR08	DYH12_HUMAN	H	451	ENSP00000295937:L451H;ENSP00000418137:L451H;ENSP00000374187:L451H	ENSP00000295937:L451H	L	-	2	0	DNAH12	57450438	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.944000	0.40263	2.058000	0.61347	0.533000	0.62120	CTC	.	.		0.303	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_178504	
SHOX2	6474	hgsc.bcm.edu	37	3	157820590	157820590	+	Silent	SNP	C	C	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr3:157820590C>G	ENST00000425436.3	-	2	457	c.432G>C	c.(430-432)cgG>cgC	p.R144R	SHOX2_ENST00000483851.2_Silent_p.R144R|SHOX2_ENST00000554685.1_5'UTR|SHOX2_ENST00000441443.2_Silent_p.R15R|SHOX2_ENST00000490689.2_Silent_p.R15R|SHOX2_ENST00000389589.4_Silent_p.R168R	NM_001163678.1|NM_006884.3	NP_001157150.1|NP_006875.2	O60902	SHOX2_HUMAN	short stature homeobox 2	144					cardiac atrium morphogenesis (GO:0003209)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte development (GO:0002063)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic skeletal joint morphogenesis (GO:0060272)|heart development (GO:0007507)|heart valve development (GO:0003170)|muscle tissue morphogenesis (GO:0060415)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|osteoblast differentiation (GO:0001649)|positive regulation of axonogenesis (GO:0050772)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of skeletal muscle fiber development (GO:0048743)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of chondrocyte differentiation (GO:0032330)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(10)|skin(3)|upper_aerodigestive_tract(1)	20			Lung(72;0.00318)|LUSC - Lung squamous cell carcinoma(72;0.0043)			TGAAATTGGTCCGACTTCGCC	0.567																																					p.R168R		Atlas-SNP	.											.	SHOX2	84	.	0			c.G504C						.						186.0	151.0	163.0					3																	157820590		2203	4300	6503	SO:0001819	synonymous_variant	6474	exon3			ATTGGTCCGACTT	AJ002368	CCDS33884.1, CCDS43164.1, CCDS33884.2, CCDS54664.1	3q25.32	2011-06-20			ENSG00000168779	ENSG00000168779		"""Homeoboxes / PRD class"""	10854	protein-coding gene	gene with protein product		602504				9482898, 9466998	Standard	NM_006884		Approved	SHOT, OG12X, OG12	uc003fbs.3	O60902	OTTHUMG00000158755	ENST00000425436.3:c.432G>C	chr3.hg19:g.157820590C>G		178.0	0.0		225.0	110.0	NM_003030	O60465|O60467|O60903	Silent	SNP	ENST00000425436.3	hg19	CCDS43164.1	.	.	.	.	.	.	.	.	.	.	C	9.984	1.228986	0.22542	.	.	ENSG00000168779	ENST00000555977	.	.	.	5.49	4.62	0.57501	.	.	.	.	.	T	0.62146	0.2404	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60291	-0.7292	4	.	.	.	.	10.6737	0.45772	0.0:0.7959:0.1323:0.0718	.	.	.	.	H	48	.	.	D	-	1	0	SHOX2	159303284	0.930000	0.31532	1.000000	0.80357	0.986000	0.74619	0.108000	0.15396	1.320000	0.45209	-0.140000	0.14226	GAC	.	.		0.567	SHOX2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352057.2		
SENP2	59343	hgsc.bcm.edu	37	3	185332412	185332412	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr3:185332412G>C	ENST00000296257.5	+	11	1234	c.994G>C	c.(994-996)Ggc>Cgc	p.G332R	SENP2_ENST00000545472.1_Missense_Mutation_p.G322R|SENP2_ENST00000427465.2_Missense_Mutation_p.G156R	NM_021627.2	NP_067640.2	Q9HC62	SENP2_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 2	332					cellular protein metabolic process (GO:0044267)|dorsal/ventral axis specification (GO:0009950)|heart development (GO:0007507)|labyrinthine layer development (GO:0060711)|mRNA transport (GO:0051028)|negative regulation of chromatin binding (GO:0035562)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of protein binding (GO:0032091)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-translational protein modification (GO:0043687)|protein desumoylation (GO:0016926)|protein sumoylation (GO:0016925)|protein transport (GO:0015031)|regulation of DNA endoreduplication (GO:0032875)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of Wnt signaling pathway (GO:0030111)|spongiotrophoblast layer development (GO:0060712)|trophoblast giant cell differentiation (GO:0060707)|Wnt signaling pathway (GO:0016055)	cytoplasmic vesicle (GO:0031410)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	SUMO-specific protease activity (GO:0016929)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|skin(3)	12	all_cancers(143;1.28e-10)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;1.31e-21)			ACTCCGCCTGGGCAGTGGAAG	0.458																																					p.G332R		Atlas-SNP	.											.	SENP2	88	.	0			c.G994C						.						78.0	76.0	77.0					3																	185332412		2203	4300	6503	SO:0001583	missense	59343	exon11			CGCCTGGGCAGTG	AF151697	CCDS33902.1	3q28	2005-08-17	2005-08-17		ENSG00000163904	ENSG00000163904			23116	protein-coding gene	gene with protein product		608261	"""SUMO1/sentrin/SMT3 specific protease 2"""			11896061, 11489887	Standard	XM_005247690		Approved	SMT3IP2, KIAA1331, DKFZp762A2316, AXAM2	uc003fpn.3	Q9HC62	OTTHUMG00000156658	ENST00000296257.5:c.994G>C	chr3.hg19:g.185332412G>C	ENSP00000296257:p.Gly332Arg	150.0	0.0		225.0	91.0	NM_021627	B4DQ42|Q8IW97|Q96SR2|Q9P2L5	Missense_Mutation	SNP	ENST00000296257.5	hg19	CCDS33902.1	.	.	.	.	.	.	.	.	.	.	G	19.08	3.757549	0.69648	.	.	ENSG00000163904	ENST00000545472;ENST00000296257;ENST00000437107;ENST00000427465;ENST00000444509	T;T;T;T	0.30981	1.94;1.95;1.97;1.51	5.46	5.46	0.80206	.	0.073866	0.50627	D	0.000111	T	0.37544	0.1007	N	0.19112	0.55	0.41142	D	0.985961	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.05869	-1.0859	10	0.12430	T	0.62	-6.0382	16.619	0.84925	0.0:0.0:1.0:0.0	.	322;332	B4DQ42;Q9HC62	.;SENP2_HUMAN	R	322;332;203;156;39	ENSP00000439653:G322R;ENSP00000296257:G332R;ENSP00000394562:G156R;ENSP00000399201:G39R	ENSP00000296257:G332R	G	+	1	0	SENP2	186815106	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.182000	0.65059	2.734000	0.93682	0.655000	0.94253	GGC	.	.		0.458	SENP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345159.1	NM_021627	
LCORL	254251	hgsc.bcm.edu	37	4	17886148	17886148	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr4:17886148G>A	ENST00000382226.5	-	7	1112	c.1004C>T	c.(1003-1005)tCa>tTa	p.S335L	LCORL_ENST00000382224.1_Missense_Mutation_p.S251L|LCORL_ENST00000539056.1_Intron|LCORL_ENST00000326877.4_Intron	NM_001166139.1	NP_001159611.1	Q8N3X6	LCORL_HUMAN	ligand dependent nuclear receptor corepressor-like	335					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(1)|prostate(1)	4						GTCCTTATATGAATAACTATC	0.393																																					p.S335L		Atlas-SNP	.											.	LCORL	60	.	0			c.C1004T						.						95.0	79.0	84.0					4																	17886148		692	1590	2282	SO:0001583	missense	254251	exon7			TTATATGAATAAC		CCDS3425.1, CCDS54749.1	4p15.32	2006-06-14			ENSG00000178177	ENSG00000178177			30776	protein-coding gene	gene with protein product		611799				12560079	Standard	NM_153686		Approved	MLR1, FLJ30696	uc021xmr.1	Q8N3X6	OTTHUMG00000128538	ENST00000382226.5:c.1004C>T	chr4.hg19:g.17886148G>A	ENSP00000371661:p.Ser335Leu	55.0	0.0		67.0	15.0	NM_001166139	Q96NK1	Missense_Mutation	SNP	ENST00000382226.5	hg19	CCDS54749.1	.	.	.	.	.	.	.	.	.	.	G	11.11	1.540920	0.27563	.	.	ENSG00000178177	ENST00000382224;ENST00000382226	.	.	.	5.34	5.34	0.76211	.	0.545546	0.19569	N	0.111135	T	0.40791	0.1131	N	0.08118	0	0.44816	D	0.997821	.	.	.	.	.	.	T	0.39603	-0.9606	7	0.42905	T	0.14	.	12.716	0.57115	0.0755:0.0:0.9245:0.0	.	.	.	.	L	251;335	.	ENSP00000371659:S251L	S	-	2	0	LCORL	17495246	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.904000	0.63279	2.664000	0.90586	0.655000	0.94253	TCA	.	.		0.393	LCORL-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_153686	
AASDH	132949	hgsc.bcm.edu	37	4	57244474	57244474	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr4:57244474T>G	ENST00000205214.6	-	4	688	c.508A>C	c.(508-510)Ata>Cta	p.I170L	AASDH_ENST00000513376.1_Missense_Mutation_p.I70L|AASDH_ENST00000451613.1_Missense_Mutation_p.I170L|AASDH_ENST00000510762.1_5'UTR|AASDH_ENST00000502617.1_Missense_Mutation_p.I170L|AASDH_ENST00000602986.1_Missense_Mutation_p.I17L|AASDH_ENST00000434343.2_Intron	NM_181806.2	NP_861522.2	Q4L235	ACSF4_HUMAN	aminoadipate-semialdehyde dehydrogenase	170					fatty acid metabolic process (GO:0006631)		acid-thiol ligase activity (GO:0016878)|ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	40	Glioma(25;0.08)|all_neural(26;0.101)	all_hematologic(202;0.0017)				TCAGAACTTATGCTTTTTATT	0.363																																					p.I170L		Atlas-SNP	.											.	AASDH	101	.	0			c.A508C						.						144.0	127.0	133.0					4																	57244474		2203	4300	6503	SO:0001583	missense	132949	exon4			AACTTATGCTTTT	AF516672	CCDS3504.1, CCDS68705.1, CCDS68706.1, CCDS75126.1, CCDS75127.1	4q12	2010-12-14			ENSG00000157426	ENSG00000157426	1.2.1.31	"""Acyl-CoA synthetase family"""	23993	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 4"""	614365				15865210, 12712191, 17762044	Standard	XM_005265721		Approved	NRPS998, LYS2, ACSF4	uc003hbn.3	Q4L235	OTTHUMG00000128841	ENST00000205214.6:c.508A>C	chr4.hg19:g.57244474T>G	ENSP00000205214:p.Ile170Leu	109.0	0.0		108.0	46.0	NM_181806	A5D8V3|A5PL22|Q63HK2|Q63HR7|Q6IPP8|Q6TFZ6|Q7Z5Y3|Q96BW4|Q9P064	Missense_Mutation	SNP	ENST00000205214.6	hg19	CCDS3504.1	.	.	.	.	.	.	.	.	.	.	T	3.624	-0.076847	0.07184	.	.	ENSG00000157426	ENST00000205214;ENST00000513376;ENST00000451613;ENST00000503808;ENST00000502617	T;T;T;T	0.46451	0.87;1.2;2.92;0.87	5.54	-11.1	0.00147	AMP-dependent synthetase/ligase (1);	2.811710	0.00824	N	0.001603	T	0.15652	0.0377	N	0.04705	-0.18	0.09310	N	1	B;B;B;B	0.06786	0.0;0.001;0.0;0.0	B;B;B;B	0.08055	0.001;0.002;0.0;0.003	T	0.08722	-1.0708	10	0.17832	T	0.49	5.9387	4.5148	0.11930	0.1769:0.4522:0.0901:0.2809	.	17;170;170;170	E9PH98;Q4L235-4;Q4L235-3;Q4L235	.;.;.;ACSF4_HUMAN	L	170;70;170;17;170	ENSP00000205214:I170L;ENSP00000423760:I70L;ENSP00000409656:I170L;ENSP00000421171:I170L	ENSP00000205214:I170L	I	-	1	0	AASDH	56939231	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.565000	0.02150	-2.426000	0.00560	-3.672000	0.00025	ATA	.	.		0.363	AASDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250780.1	NM_181806	
HMGCS1	3157	hgsc.bcm.edu	37	5	43297200	43297200	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr5:43297200T>C	ENST00000325110.6	-	5	849	c.643A>G	c.(643-645)Ata>Gta	p.I215V	HMGCS1_ENST00000433297.2_Missense_Mutation_p.I215V	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	215					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						CCATCTACTATAGGATATTCA	0.408																																					p.I215V		Atlas-SNP	.											.	HMGCS1	33	.	0			c.A643G						.						142.0	144.0	143.0					5																	43297200		2203	4300	6503	SO:0001583	missense	3157	exon5			CTACTATAGGATA		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.643A>G	chr5.hg19:g.43297200T>C	ENSP00000322706:p.Ile215Val	91.0	0.0		121.0	54.0	NM_001098272	B2RDL8	Missense_Mutation	SNP	ENST00000325110.6	hg19	CCDS34154.1	.	.	.	.	.	.	.	.	.	.	T	5.960	0.361052	0.11296	.	.	ENSG00000112972	ENST00000325110;ENST00000433297;ENST00000545275	T;T	0.73789	-0.78;-0.78	5.96	0.595	0.17490	Hydroxymethylglutaryl-coenzyme A synthase C-terminal (1);Thiolase-like (1);	0.148550	0.64402	N	0.000009	T	0.36826	0.0981	N	0.01015	-1.05	0.33260	D	0.559621	B	0.02656	0.0	B	0.01281	0.0	T	0.48990	-0.8985	10	0.02654	T	1	-21.6477	10.3788	0.44099	0.0:0.7213:0.0:0.2787	.	215	Q01581	HMCS1_HUMAN	V	215;215;204	ENSP00000322706:I215V;ENSP00000399402:I215V	ENSP00000322706:I215V	I	-	1	0	HMGCS1	43332957	0.684000	0.27642	0.694000	0.30210	0.991000	0.79684	1.248000	0.32827	0.097000	0.17492	0.533000	0.62120	ATA	.	.		0.408	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
ACOT12	134526	hgsc.bcm.edu	37	5	80628350	80628350	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr5:80628350T>C	ENST00000307624.3	-	13	1365	c.1337A>G	c.(1336-1338)gAc>gGc	p.D446G	ACOT12_ENST00000508234.1_5'UTR	NM_130767.2	NP_570123.1	Q8WYK0	ACO12_HUMAN	acyl-CoA thioesterase 12	446	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				acetyl-CoA metabolic process (GO:0006084)|acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)|pyruvate metabolic process (GO:0006090)	cytosol (GO:0005829)	acetyl-CoA hydrolase activity (GO:0003986)|ATP binding (GO:0005524)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)	23		Lung NSC(167;0.0176)|all_lung(232;0.0205)|Ovarian(174;0.135)		OV - Ovarian serous cystadenocarcinoma(54;1.37e-45)|Epithelial(54;1.25e-39)|all cancers(79;5.01e-34)		TTTGGGTTTGTCATCATTCAG	0.398																																					p.D446G		Atlas-SNP	.											.	ACOT12	57	.	0			c.A1337G						.						166.0	136.0	146.0					5																	80628350		2203	4300	6503	SO:0001583	missense	134526	exon13			GGTTTGTCATCAT	AB078619	CCDS4055.1	5q14.1	2011-09-13			ENSG00000172497	ENSG00000172497		"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	24436	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 15"""	614315				16103133, 16940157	Standard	NM_130767		Approved	Cach, THEAL, STARD15	uc003khl.4	Q8WYK0	OTTHUMG00000131305	ENST00000307624.3:c.1337A>G	chr5.hg19:g.80628350T>C	ENSP00000303246:p.Asp446Gly	76.0	0.0		100.0	42.0	NM_130767	B3KVK9|Q5FWE9	Missense_Mutation	SNP	ENST00000307624.3	hg19	CCDS4055.1	.	.	.	.	.	.	.	.	.	.	T	2.930	-0.221319	0.06061	.	.	ENSG00000172497	ENST00000307624	T	0.78003	-1.14	5.55	3.15	0.36227	Lipid-binding START (2);START-like domain (1);	0.359428	0.30667	N	0.009126	T	0.63058	0.2479	L	0.39020	1.185	0.33951	D	0.644393	B	0.06786	0.001	B	0.11329	0.006	T	0.59542	-0.7435	10	0.15499	T	0.54	-4.9178	7.3925	0.26917	0.0:0.1802:0.0:0.8198	.	446	Q8WYK0	ACO12_HUMAN	G	446	ENSP00000303246:D446G	ENSP00000303246:D446G	D	-	2	0	ACOT12	80664106	0.921000	0.31238	0.878000	0.34440	0.205000	0.24178	1.362000	0.34148	1.049000	0.40321	0.459000	0.35465	GAC	.	.		0.398	ACOT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254074.1	NM_130767	
EPB41L4A	64097	hgsc.bcm.edu	37	5	111643179	111643179	+	Silent	SNP	C	C	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr5:111643179C>G	ENST00000261486.5	-	2	384	c.108G>C	c.(106-108)acG>acC	p.T36T		NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	36	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		CGGAACCTTTCGTTGACTTCT	0.383																																					p.T36T		Atlas-SNP	.											.	EPB41L4A	130	.	0			c.G108C						.						91.0	85.0	87.0					5																	111643179		1861	4100	5961	SO:0001819	synonymous_variant	64097	exon2			ACCTTTCGTTGAC	AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.108G>C	chr5.hg19:g.111643179C>G		72.0	0.0		102.0	47.0	NM_022140	A4FUI6	Silent	SNP	ENST00000261486.5	hg19	CCDS43350.1																																																																																			.	.		0.383	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370969.1		
CDKN1A	1026	hgsc.bcm.edu	37	6	36652323	36652323	+	Splice_Site	SNP	G	G	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr6:36652323G>C	ENST00000405375.1	+	2	680	c.445G>C	c.(445-447)Gat>Cat	p.D149H	CDKN1A_ENST00000244741.5_Splice_Site_p.D149H|CDKN1A_ENST00000373711.2_Splice_Site_p.D149H|CDKN1A_ENST00000448526.2_Splice_Site_p.D183H	NM_001220778.1	NP_001207707.1	P38936	CDN1A_HUMAN	cyclin-dependent kinase inhibitor 1A (p21, Cip1)	149			D -> G (in dbSNP:rs1801724).		cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to ionizing radiation (GO:0071479)|cellular senescence (GO:0090398)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of gene expression (GO:0010629)|negative regulation of phosphorylation (GO:0042326)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ regeneration (GO:0031100)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of DNA biosynthetic process (GO:2000278)|regulation of protein import into nucleus, translocation (GO:0033158)|response to arsenic-containing substance (GO:0046685)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to hyperoxia (GO:0055093)|response to organonitrogen compound (GO:0010243)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|stress-induced premature senescence (GO:0090400)	cyclin-dependent protein kinase holoenzyme complex (GO:0000307)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCNA-p21 complex (GO:0070557)	cyclin-dependent protein kinase activating kinase activity (GO:0019912)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|lung(3)|ovary(1)|urinary_tract(5)	15						CAGCATGACAGGTGCGGACAT	0.597																																					p.D149H		Atlas-SNP	.											.	CDKN1A	27	.	0			c.G445C						.						46.0	49.0	48.0					6																	36652323		2203	4300	6503	SO:0001630	splice_region_variant	1026	exon2			ATGACAGGTGCGG	U03106	CCDS4824.1	6p21.1	2009-01-21			ENSG00000124762	ENSG00000124762			1784	protein-coding gene	gene with protein product		116899		CDKN1			Standard	NM_000389		Approved	P21, CIP1, WAF1, SDI1, CAP20, p21CIP1, p21Cip1/Waf1	uc021yzb.1	P38936	OTTHUMG00000014603	ENST00000405375.1:c.445+1G>C	chr6.hg19:g.36652323G>C		55.0	0.0		154.0	116.0	NM_001220778	Q14010|Q6FI05|Q9BUT4	Missense_Mutation	SNP	ENST00000405375.1	hg19	CCDS4824.1	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070817	0.76301	.	.	ENSG00000124762	ENST00000448526;ENST00000244741;ENST00000405375;ENST00000373711	T;T;T;T	0.76060	-0.99;-0.99;-0.99;-0.99	5.08	5.08	0.68730	.	0.000000	0.49916	D	0.000129	T	0.77003	0.4067	L	0.47190	1.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.75631	-0.3251	9	.	.	.	-14.614	13.8526	0.63506	0.0:0.0:1.0:0.0	.	183;149	B4DQP9;P38936	.;CDN1A_HUMAN	H	183;149;149;149	ENSP00000409259:D183H;ENSP00000244741:D149H;ENSP00000384849:D149H;ENSP00000362815:D149H	.	D	+	1	0	CDKN1A	36760301	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.849000	0.69465	2.644000	0.89710	0.561000	0.74099	GAT	.	.		0.597	CDKN1A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040354.1	NM_078467	Missense_Mutation
TREML2	79865	hgsc.bcm.edu	37	6	41166123	41166123	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr6:41166123C>T	ENST00000483722.1	-	2	285	c.100G>A	c.(100-102)Ggg>Agg	p.G34R		NM_024807.2	NP_079083.2	Q5T2D2	TRML2_HUMAN	triggering receptor expressed on myeloid cells-like 2	34	Ig-like V-type.				T cell activation (GO:0042110)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)	18	Ovarian(28;0.0418)|Colorectal(47;0.196)					AGAGTCTCCCCTTCAAGGAGC	0.493																																					p.G34R		Atlas-SNP	.											.	TREML2	41	.	0			c.G100A						.						127.0	130.0	129.0					6																	41166123		2203	4300	6503	SO:0001583	missense	79865	exon2			TCTCCCCTTCAAG	AK023755	CCDS4853.1, CCDS4853.2	6p21.1	2013-01-11	2004-04-14	2004-04-16	ENSG00000112195	ENSG00000112195		"""Immunoglobulin superfamily / V-set domain containing"""	21092	protein-coding gene	gene with protein product	"""TREM-like transcript 2"""	609715	"""chromosome 6 open reading frame 76"""	C6orf76		12645956	Standard	NM_024807		Approved	FLJ13693, TLT2, dJ238O23.1	uc010jxm.1	Q5T2D2	OTTHUMG00000016349	ENST00000483722.1:c.100G>A	chr6.hg19:g.41166123C>T	ENSP00000418767:p.Gly34Arg	55.0	0.0		157.0	7.0	NM_024807	Q08AP8|Q08AP9|Q8IWY0|Q9H8E9	Missense_Mutation	SNP	ENST00000483722.1	hg19	CCDS4853.2	.	.	.	.	.	.	.	.	.	.	.	14.59	2.581804	0.46006	.	.	ENSG00000112195	ENST00000483722	D	0.81499	-1.5	4.75	4.75	0.60458	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000044	D	0.86623	0.5977	M	0.75085	2.285	0.40423	D	0.979861	D	0.89917	1.0	D	0.97110	1.0	D	0.88269	0.2928	10	0.72032	D	0.01	-23.1011	13.6225	0.62144	0.0:1.0:0.0:0.0	.	34	Q5T2D2	TRML2_HUMAN	R	34	ENSP00000418767:G34R	ENSP00000418767:G34R	G	-	1	0	TREML2	41274101	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	3.388000	0.52509	2.344000	0.79699	0.563000	0.77884	GGG	.	.		0.493	TREML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043756.3	NM_024807	
PRDM13	59336	hgsc.bcm.edu	37	6	100062539	100062539	+	Silent	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr6:100062539T>C	ENST00000369215.4	+	4	2333	c.2028T>C	c.(2026-2028)ccT>ccC	p.P676P		NM_021620.3	NP_067633.2	Q9H4Q3	PRD13_HUMAN	PR domain containing 13	676					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurogenesis (GO:0022008)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(9)|prostate(1)	17		all_cancers(76;1.64e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0128)|Colorectal(196;0.069)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0598)		CCCCGGAGCCTGGGGATCCCA	0.692																																					p.P676P		Atlas-SNP	.											.	PRDM13	65	.	0			c.T2028C						.						20.0	24.0	23.0					6																	100062539		1764	3846	5610	SO:0001819	synonymous_variant	59336	exon4			GGAGCCTGGGGAT	AY004253	CCDS43487.1	6q16.2	2012-03-28			ENSG00000112238	ENSG00000112238			13998	protein-coding gene	gene with protein product							Standard	NM_021620		Approved		uc003pqg.1	Q9H4Q3	OTTHUMG00000015269	ENST00000369215.4:c.2028T>C	chr6.hg19:g.100062539T>C		32.0	0.0		28.0	6.0	NM_021620	Q5TGC1|Q5TGC2	Silent	SNP	ENST00000369215.4	hg19	CCDS43487.1																																																																																			.	.		0.692	PRDM13-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041619.2		
EZR	7430	hgsc.bcm.edu	37	6	159206580	159206580	+	Silent	SNP	G	G	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr6:159206580G>T	ENST00000367075.3	-	5	396	c.228C>A	c.(226-228)ctC>ctA	p.L76L	EZR_ENST00000337147.7_Silent_p.L76L|EZR_ENST00000476189.1_5'UTR|EZR_ENST00000392177.4_Silent_p.L44L	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	76	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		ACTTGAACTGGAGGGGATTCT	0.537			T	ROS1	NSCLC																																p.L76L		Atlas-SNP	.		Dom	yes		6	6q25.3	7430	ezrin		E	.	EZR	44	.	0			c.C228A						.						68.0	63.0	65.0					6																	159206580		2203	4300	6503	SO:0001819	synonymous_variant	7430	exon4			GAACTGGAGGGGA	AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.228C>A	chr6.hg19:g.159206580G>T		128.0	0.0		202.0	78.0	NM_003379	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Silent	SNP	ENST00000367075.3	hg19	CCDS5258.1																																																																																			.	.		0.537	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042878.1	NM_003379	
GPR85	54329	hgsc.bcm.edu	37	7	112723996	112723996	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr7:112723996G>T	ENST00000297146.3	-	3	1384	c.781C>A	c.(781-783)Caa>Aaa	p.Q261K	GPR85_ENST00000424100.1_Missense_Mutation_p.Q261K|GPR85_ENST00000487573.1_5'Flank|GPR85_ENST00000501255.2_Missense_Mutation_p.Q261K|GPR85_ENST00000449591.1_Missense_Mutation_p.Q261K	NM_001146266.1	NP_001139738.1	P60893	GPR85_HUMAN	G protein-coupled receptor 85	261					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	17						TTTGCATTTTGCCTGATGCCC	0.483																																					p.Q261K		Atlas-SNP	.											.	GPR85	49	.	0			c.C781A						.						139.0	151.0	147.0					7																	112723996		2203	4300	6503	SO:0001583	missense	54329	exon3			CATTTTGCCTGAT	AF250237	CCDS5758.1	7q31	2012-08-21			ENSG00000164604	ENSG00000164604		"""GPCR / Class A : Orphans"""	4536	protein-coding gene	gene with protein product		605188				10978537, 10833454	Standard	NM_018970		Approved	SREB2	uc003vgp.1	P60893	OTTHUMG00000156933	ENST00000297146.3:c.781C>A	chr7.hg19:g.112723996G>T	ENSP00000297146:p.Gln261Lys	82.0	0.0		97.0	20.0	NM_001146265	Q9JHI6|Q9NPD1	Missense_Mutation	SNP	ENST00000297146.3	hg19	CCDS5758.1	.	.	.	.	.	.	.	.	.	.	G	12.60	1.987347	0.35036	.	.	ENSG00000164604	ENST00000501255;ENST00000297146;ENST00000424100;ENST00000449591	T;T;T;T	0.36699	1.24;1.24;1.24;1.24	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.36908	0.0984	L	0.44542	1.39	0.80722	D	1	B	0.14805	0.011	B	0.26693	0.072	T	0.08166	-1.0735	10	0.27082	T	0.32	.	19.8176	0.96576	0.0:0.0:1.0:0.0	.	261	P60893	GPR85_HUMAN	K	261	ENSP00000445808:Q261K;ENSP00000297146:Q261K;ENSP00000396763:Q261K;ENSP00000401178:Q261K	ENSP00000297146:Q261K	Q	-	1	0	GPR85	112511232	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.765000	0.95021	0.650000	0.86243	CAA	.	.		0.483	GPR85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346650.2		
KIAA1549	57670	hgsc.bcm.edu	37	7	138602612	138602612	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr7:138602612C>A	ENST00000422774.1	-	2	1808	c.1760G>T	c.(1759-1761)aGt>aTt	p.S587I	KIAA1549_ENST00000242365.4_Missense_Mutation_p.S537I|KIAA1549_ENST00000440172.1_Missense_Mutation_p.S587I			Q9HCM3	K1549_HUMAN	KIAA1549	587	Ser-rich.					integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CGTAAAAACACTCGGGTCTCT	0.458			O	BRAF	pilocytic astrocytoma																																p.S587I	NSCLC(119;1534 1718 44213 46230 50068)	Atlas-SNP	.		Dom	yes		7	7q34	57670	KIAA1549		O	.	KIAA1549	314	.	0			c.G1760T						.						65.0	67.0	67.0					7																	138602612		1954	4137	6091	SO:0001583	missense	57670	exon2			AAAACACTCGGGT		CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.1760G>T	chr7.hg19:g.138602612C>A	ENSP00000416040:p.Ser587Ile	104.0	0.0		129.0	61.0	NM_020910	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	ENST00000422774.1	hg19	CCDS56513.1	.	.	.	.	.	.	.	.	.	.	C	10.35	1.325024	0.24080	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.26373	1.74;1.75;1.74	3.97	-2.86	0.05717	.	0.972477	0.08440	N	0.945558	T	0.13927	0.0337	N	0.19112	0.55	0.09310	N	1	P;P	0.39157	0.531;0.662	B;B	0.37304	0.125;0.246	T	0.20240	-1.0281	10	0.46703	T	0.11	.	5.8241	0.18544	0.0:0.2031:0.5028:0.2942	.	587;587	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	I	587;537;587	ENSP00000406661:S587I;ENSP00000242365:S537I;ENSP00000416040:S587I	ENSP00000242365:S537I	S	-	2	0	KIAA1549	138253152	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.807000	0.04520	-0.572000	0.06006	-0.188000	0.12872	AGT	.	.		0.458	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000348092.1		
CHD7	55636	hgsc.bcm.edu	37	8	61749438	61749438	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr8:61749438G>A	ENST00000423902.2	+	17	4531	c.4052G>A	c.(4051-4053)aGa>aAa	p.R1351K	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	1351	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GCTATCGACAGATTCTCCAAA	0.488																																					p.R1351K		Atlas-SNP	.											.	CHD7	534	.	0			c.G4052A						.						172.0	168.0	169.0					8																	61749438		2012	4192	6204	SO:0001583	missense	55636	exon17			TCGACAGATTCTC	AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.4052G>A	chr8.hg19:g.61749438G>A	ENSP00000392028:p.Arg1351Lys	99.0	0.0		144.0	62.0	NM_017780	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	ENST00000423902.2	hg19	CCDS47865.1	.	.	.	.	.	.	.	.	.	.	G	35	5.597348	0.96602	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.75154	-0.91	5.79	5.79	0.91817	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.82875	0.5132	L	0.41415	1.275	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.83705	0.0184	10	0.87932	D	0	-15.0825	20.0411	0.97590	0.0:0.0:1.0:0.0	.	1351	Q9P2D1	CHD7_HUMAN	K	1351	ENSP00000392028:R1351K	ENSP00000307304:R1351K	R	+	2	0	CHD7	61911992	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	9.869000	0.99810	2.739000	0.93911	0.655000	0.94253	AGA	.	.		0.488	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383468.2	XM_098762	
ZFHX4	79776	hgsc.bcm.edu	37	8	77618153	77618153	+	Silent	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr8:77618153C>T	ENST00000521891.2	+	2	2278	c.1830C>T	c.(1828-1830)ggC>ggT	p.G610G	ZFHX4_ENST00000518282.1_Silent_p.G610G|ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000455469.2_Silent_p.G610G|ZFHX4_ENST00000050961.6_Silent_p.G610G	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	610					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GCTCACCGGGCAGTGGCATCG	0.577										HNSCC(33;0.089)																											p.G610G		Atlas-SNP	.											.	ZFHX4	878	.	0			c.C1830T						.						74.0	80.0	78.0					8																	77618153		2085	4211	6296	SO:0001819	synonymous_variant	79776	exon2			ACCGGGCAGTGGC		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1830C>T	chr8.hg19:g.77618153C>T		92.0	0.0		110.0	60.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Silent	SNP	ENST00000521891.2	hg19	CCDS47878.2																																																																																			.	.		0.577	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
COL22A1	169044	hgsc.bcm.edu	37	8	139824126	139824126	+	Silent	SNP	G	G	A	rs548885226	byFrequency	TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr8:139824126G>A	ENST00000303045.6	-	9	1811	c.1365C>T	c.(1363-1365)ccC>ccT	p.P455P	COL22A1_ENST00000435777.1_Silent_p.P455P	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	455	Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GCTGGGGTGGGGGTGGAGGTG	0.602										HNSCC(7;0.00092)																											p.P455P		Atlas-SNP	.											.	COL22A1	390	.	0			c.C1365T						.						16.0	16.0	16.0					8																	139824126		2200	4289	6489	SO:0001819	synonymous_variant	169044	exon9			GGGTGGGGGTGGA	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1365C>T	chr8.hg19:g.139824126G>A		18.0	0.0		31.0	6.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	hg19	CCDS6376.1																																																																																			.	.		0.602	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
FAM205A	259308	hgsc.bcm.edu	37	9	34726986	34726986	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr9:34726986C>A	ENST00000378788.3	-	4	291		c.e4-1			NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A							integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						CCAGCCCTGGCTAGGAAGGGA	0.532																																					.		Atlas-SNP	.											.	FAM205A	45	.	0			c.252-1G>T						.						2.0	2.0	2.0					9																	34726986		605	1355	1960	SO:0001630	splice_region_variant	259308	exon5			CCCTGGCTAGGAA		CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.252-1G>T	chr9.hg19:g.34726986C>A		36.0	0.0		43.0	21.0	NM_001141917	A8MVW7	Splice_Site	SNP	ENST00000378788.3	hg19	CCDS55305.1	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174674	0.57692	.	.	ENSG00000205108	ENST00000378788	.	.	.	4.17	4.17	0.49024	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.1615	0.54107	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RP11-195F19.10	34716986	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	3.254000	0.51477	2.303000	0.77524	0.650000	0.86243	.	.	.		0.532	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001150.2	NM_001141917	Intron
CUBN	8029	hgsc.bcm.edu	37	10	17026254	17026254	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr10:17026254A>G	ENST00000377833.4	-	30	4440	c.4375T>C	c.(4375-4377)Tct>Cct	p.S1459P		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	1459	CUB 9. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	ATTCTGGGAGAGTGGAAATCG	0.448																																					p.S1459P		Atlas-SNP	.											.	CUBN	515	.	0			c.T4375C						.						80.0	77.0	78.0					10																	17026254		2203	4300	6503	SO:0001583	missense	8029	exon30			TGGGAGAGTGGAA	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.4375T>C	chr10.hg19:g.17026254A>G	ENSP00000367064:p.Ser1459Pro	89.0	0.0		122.0	45.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	A	17.14	3.314155	0.60414	.	.	ENSG00000107611	ENST00000377833	T	0.33438	1.41	5.96	0.561	0.17285	CUB (5);	0.310980	0.23466	N	0.047874	T	0.39358	0.1075	M	0.82923	2.615	0.80722	D	1	P	0.43231	0.801	B	0.41619	0.361	T	0.53436	-0.8439	10	0.66056	D	0.02	.	14.7668	0.69646	0.5262:0.4738:0.0:0.0	.	1459	O60494	CUBN_HUMAN	P	1459	ENSP00000367064:S1459P	ENSP00000367064:S1459P	S	-	1	0	CUBN	17066260	0.005000	0.15991	0.961000	0.40146	0.960000	0.62799	0.129000	0.15830	-0.137000	0.11455	-0.316000	0.08728	TCT	.	.		0.448	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
MYOZ1	58529	hgsc.bcm.edu	37	10	75391726	75391726	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr10:75391726T>C	ENST00000359322.4	-	6	1226	c.862A>G	c.(862-864)Att>Gtt	p.I288V	RP11-464F9.22_ENST00000609434.1_lincRNA	NM_021245.3	NP_067068.1			myozenin 1											central_nervous_system(1)|large_intestine(5)|lung(2)|ovary(2)|skin(2)	12	Prostate(51;0.0112)					GGGATGCCAATATCCACGTTG	0.517																																					p.I288V		Atlas-SNP	.											.	MYOZ1	24	.	0			c.A862G						.						81.0	80.0	80.0					10																	75391726		2203	4300	6503	SO:0001583	missense	58529	exon6			TGCCAATATCCAC	AF240633	CCDS7330.1	10q22.1	2008-07-03	2002-01-10	2002-01-11	ENSG00000177791	ENSG00000177791			13752	protein-coding gene	gene with protein product	"""calsarcin-2"""	605603	"""myozenin"""	MYOZ		11171996, 10984498	Standard	NM_021245		Approved	FATZ, CS-2	uc001jur.4	Q9NP98	OTTHUMG00000018466	ENST00000359322.4:c.862A>G	chr10.hg19:g.75391726T>C	ENSP00000352272:p.Ile288Val	115.0	0.0		167.0	8.0	NM_021245		Missense_Mutation	SNP	ENST00000359322.4	hg19	CCDS7330.1	.	.	.	.	.	.	.	.	.	.	T	11.18	1.562961	0.27915	.	.	ENSG00000177791	ENST00000359322	T	0.63580	-0.05	6.06	-0.764	0.11027	.	0.502966	0.23189	N	0.050926	T	0.41743	0.1172	L	0.36672	1.1	0.25549	N	0.987101	B	0.02656	0.0	B	0.04013	0.001	T	0.23154	-1.0196	10	0.10902	T	0.67	-1.8793	7.0617	0.25129	0.0:0.3859:0.1216:0.4925	.	288	Q9NP98	MYOZ1_HUMAN	V	288	ENSP00000352272:I288V	ENSP00000352272:I288V	I	-	1	0	MYOZ1	75061732	0.291000	0.24352	0.970000	0.41538	0.983000	0.72400	-0.352000	0.07701	-0.079000	0.12707	-0.256000	0.11100	ATT	.	.		0.517	MYOZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048654.1		
PTEN	5728	hgsc.bcm.edu	37	10	89717712	89717712	+	Missense_Mutation	SNP	C	C	G	rs587782350		TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr10:89717712C>G	ENST00000371953.3	+	7	2094	c.737C>G	c.(736-738)cCg>cGg	p.P246R	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	246	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.		P -> L (in CWS1 and BRRS). {ECO:0000269|PubMed:10400993}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.P246L(7)|p.R55fs*1(5)|p.L247fs*10(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.L247fs*11(1)|p.L247fs*12(1)|p.G165_*404del(1)|p.?(1)|p.F243fs*9(1)|p.P246fs*11(1)|p.P246_L247insGP(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		TTCCCTCAGCCGTTACCTGTG	0.418		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																											p.P246R		Atlas-SNP	.	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	PTEN,NS,carcinoma,-1,8	PTEN	3652	.	62	Whole gene deletion(37)|Deletion - Frameshift(10)|Substitution - Missense(7)|Insertion - Frameshift(5)|Deletion - In frame(1)|Insertion - In frame(1)|Unknown(1)	prostate(16)|central_nervous_system(14)|haematopoietic_and_lymphoid_tissue(8)|skin(8)|lung(5)|breast(3)|ovary(3)|urinary_tract(2)|upper_aerodigestive_tract(1)|soft_tissue(1)|endometrium(1)	c.C737G	GRCh37	CM991083	PTEN	M		.						136.0	117.0	124.0					10																	89717712		2203	4300	6503	SO:0001583	missense	5728	exon7	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	CTCAGCCGTTACC	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.737C>G	chr10.hg19:g.89717712C>G	ENSP00000361021:p.Pro246Arg	193.0	0.0		139.0	110.0	NM_000314	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Missense_Mutation	SNP	ENST00000371953.3	hg19	CCDS31238.1	.	.	.	.	.	.	.	.	.	.	C	26.8	4.768419	0.90020	.	.	ENSG00000171862	ENST00000371953	D	0.85702	-2.02	5.15	5.15	0.70609	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.103668	0.64402	D	0.000002	D	0.89701	0.6791	L	0.59436	1.845	0.80722	D	1	D	0.59767	0.986	P	0.59595	0.86	D	0.89005	0.3424	9	.	.	.	-5.2284	18.6161	0.91303	0.0:1.0:0.0:0.0	.	246	P60484	PTEN_HUMAN	R	246	ENSP00000361021:P246R	.	P	+	2	0	PTEN	89707692	1.000000	0.71417	0.961000	0.40146	0.992000	0.81027	7.452000	0.80683	2.380000	0.81148	0.585000	0.79938	CCG	.	.		0.418	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049241.1	NM_000314	
OR5M3	219482	hgsc.bcm.edu	37	11	56237770	56237770	+	Silent	SNP	A	A	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr11:56237770A>G	ENST00000312240.2	-	1	244	c.204T>C	c.(202-204)gaT>gaC	p.D68D		NM_001004742.2	NP_001004742.2	Q8NGP4	OR5M3_HUMAN	olfactory receptor, family 5, subfamily M, member 3	68						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(7)|lung(15)|ovary(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	37	Esophageal squamous(21;0.00448)					AAAACCACACATCAACAAATG	0.388																																					p.D68D		Atlas-SNP	.											.	OR5M3	103	.	0			c.T204C						.						114.0	101.0	105.0					11																	56237770		2201	4296	6497	SO:0001819	synonymous_variant	219482	exon1			CCACACATCAACA	AB065746	CCDS31532.1	11q11	2012-08-09			ENSG00000174937	ENSG00000174937		"""GPCR / Class A : Olfactory receptors"""	14806	protein-coding gene	gene with protein product							Standard	NM_001004742		Approved		uc010rjk.2	Q8NGP4	OTTHUMG00000166875	ENST00000312240.2:c.204T>C	chr11.hg19:g.56237770A>G		247.0	0.0		435.0	67.0	NM_001004742	B2RNM7|Q6IEW4|Q96RC0	Silent	SNP	ENST00000312240.2	hg19	CCDS31532.1																																																																																			.	.		0.388	OR5M3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391639.1	NM_001004742	
GLYAT	10249	hgsc.bcm.edu	37	11	58491955	58491955	+	Silent	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr11:58491955C>T	ENST00000344743.3	-	2	156	c.15G>A	c.(13-15)ttG>ttA	p.L5L	GLYAT_ENST00000278400.3_Silent_p.L5L|GLYAT_ENST00000529732.1_Silent_p.L5L	NM_201648.2	NP_964011.2	Q6IB77	GLYAT_HUMAN	glycine-N-acyltransferase	5					acyl-CoA metabolic process (GO:0006637)|glycine metabolic process (GO:0006544)|monocarboxylic acid metabolic process (GO:0032787)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glycine N-acyltransferase activity (GO:0047961)|glycine N-benzoyltransferase activity (GO:0047962)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|autonomic_ganglia(1)|kidney(1)|large_intestine(3)|lung(8)|skin(1)|urinary_tract(1)	16		Breast(21;0.0044)|all_epithelial(135;0.0157)			Glycine(DB00145)	GGGCACCTTGCAATGGTAACA	0.438																																					p.L5L		Atlas-SNP	.											.,1	GLYAT	53	.	0			c.G15A						.						105.0	106.0	106.0					11																	58491955		2201	4295	6496	SO:0001819	synonymous_variant	10249	exon2			ACCTTGCAATGGT	AF023466	CCDS7970.1, CCDS7971.1	11q12.1	2008-03-11					2.3.1.13		13734	protein-coding gene	gene with protein product		607424					Standard	NM_201648		Approved	GAT, ACGNAT	uc001nnb.3	Q6IB77		ENST00000344743.3:c.15G>A	chr11.hg19:g.58491955C>T		27.0	0.0		76.0	21.0	NM_005838	O14833|Q96QK7	Silent	SNP	ENST00000344743.3	hg19	CCDS7970.1																																																																																			.	.		0.438	GLYAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394593.1		
SSH3	54961	hgsc.bcm.edu	37	11	67077629	67077629	+	Missense_Mutation	SNP	C	C	T	rs370197853		TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr11:67077629C>T	ENST00000308127.4	+	13	1680	c.1502C>T	c.(1501-1503)cCg>cTg	p.P501L	SSH3_ENST00000308298.7_Intron|SSH3_ENST00000376757.5_Intron	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	501					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			CCACCTCTTCCGCCAGAACCT	0.617																																					p.P501L		Atlas-SNP	.											.	SSH3	54	.	0			c.C1502T						.	C	LEU/PRO	0,4400		0,0,2200	64.0	70.0	68.0		1502	3.7	0.7	11		68	1,8589	1.2+/-3.3	0,1,4294	no	missense	SSH3	NM_017857.3	98	0,1,6494	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	501/660	67077629	1,12989	2200	4295	6495	SO:0001583	missense	54961	exon13			CTCTTCCGCCAGA	AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1502C>T	chr11.hg19:g.67077629C>T	ENSP00000312081:p.Pro501Leu	53.0	0.0		121.0	38.0	NM_017857	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	ENST00000308127.4	hg19	CCDS8157.1	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778533	0.49786	0.0	1.16E-4	ENSG00000172830	ENST00000308127;ENST00000527821	T;T	0.19532	3.67;2.14	4.65	3.72	0.42706	.	0.201018	0.25172	N	0.032584	T	0.11965	0.0291	N	0.19112	0.55	0.80722	D	1	P;P	0.47106	0.89;0.824	B;B	0.36719	0.231;0.116	T	0.05699	-1.0869	10	0.51188	T	0.08	-18.832	10.4151	0.44316	0.2098:0.7902:0.0:0.0	.	355;501	Q8TE77-3;Q8TE77	.;SSH3_HUMAN	L	501;204	ENSP00000312081:P501L;ENSP00000433902:P204L	ENSP00000312081:P501L	P	+	2	0	SSH3	66834205	0.005000	0.15991	0.727000	0.30756	0.982000	0.71751	0.398000	0.20899	1.062000	0.40625	0.555000	0.69702	CCG	.	.		0.617	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393167.1	NM_018276	
CD4	920	hgsc.bcm.edu	37	12	6927621	6927621	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr12:6927621G>T	ENST00000011653.4	+	8	1449	c.1191G>T	c.(1189-1191)atG>atT	p.M397I		NM_000616.4|NM_001195015.2|NM_001195016.2|NM_001195017.2	NP_000607.1|NP_001181944.1|NP_001181945.1|NP_001181946.1	P01730	CD4_HUMAN	CD4 molecule	397					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cytokine production (GO:0001816)|defense response to Gram-negative bacterium (GO:0050829)|entry into host cell (GO:0030260)|enzyme linked receptor protein signaling pathway (GO:0007167)|immune response (GO:0006955)|induction by virus of host cell-cell fusion (GO:0006948)|innate immune response (GO:0045087)|maintenance of protein location in cell (GO:0032507)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase activity (GO:0045860)|protein palmitoleylation (GO:0045234)|regulation of defense response to virus by virus (GO:0050690)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)|T cell selection (GO:0045058)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome (GO:0005769)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|enzyme binding (GO:0019899)|extracellular matrix structural constituent (GO:0005201)|glycoprotein binding (GO:0001948)|MHC class II protein binding (GO:0042289)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|zinc ion binding (GO:0008270)	p.M397I(1)		breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	23		Myeloproliferative disorder(1001;0.0122)			Antithymocyte globulin(DB00098)	TGCAGCCAATGGCCCTGATTG	0.627																																					p.M397I		Atlas-SNP	.											CD4,NS,carcinoma,0,1	CD4	47	.	1	Substitution - Missense(1)	lung(1)	c.G1191T						.						85.0	78.0	80.0					12																	6927621		2203	4300	6503	SO:0001583	missense	920	exon8			GCCAATGGCCCTG	M35160	CCDS8562.1	12p13.31	2013-01-11	2006-03-28		ENSG00000010610	ENSG00000010610		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	1678	protein-coding gene	gene with protein product		186940	"""CD4 antigen (p55)"", ""T-cell surface glycoprotein CD4"""				Standard	NM_000616		Approved		uc001qqv.2	P01730	OTTHUMG00000168514	ENST00000011653.4:c.1191G>T	chr12.hg19:g.6927621G>T	ENSP00000011653:p.Met397Ile	43.0	0.0		44.0	26.0	NM_000616	B2R737|D3DUS5|Q4ZGK2|Q5U066|Q9UDE5	Missense_Mutation	SNP	ENST00000011653.4	hg19	CCDS8562.1	.	.	.	.	.	.	.	.	.	.	G	8.289	0.817381	0.16607	.	.	ENSG00000010610	ENST00000011653	T	0.21361	2.01	3.66	1.8	0.24995	.	0.690196	0.14121	N	0.340009	T	0.13713	0.0332	L	0.36672	1.1	0.09310	N	0.999999	B;P	0.35328	0.444;0.495	B;B	0.31442	0.052;0.13	T	0.15607	-1.0431	10	0.41790	T	0.15	-6.2454	5.9876	0.19442	0.2457:0.0:0.7543:0.0	.	218;397	B0AZV7;P01730	.;CD4_HUMAN	I	397	ENSP00000011653:M397I	ENSP00000011653:M397I	M	+	3	0	CD4	6797882	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.036000	0.12185	0.333000	0.23563	-0.258000	0.10820	ATG	.	.		0.627	CD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399978.1	NM_000616	
CCDC184	387856	hgsc.bcm.edu	37	12	48577984	48577984	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr12:48577984G>C	ENST00000316554.3	+	1	619	c.79G>C	c.(79-81)Gca>Cca	p.A27P		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		27						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						CACCGTGCCGGCAGTGGGGGA	0.647																																					p.A27P		Atlas-SNP	.											.	C12orf68	11	.	0			c.G79C						.						46.0	55.0	52.0					12																	48577984		2203	4299	6502	SO:0001583	missense	387856	exon1			GTGCCGGCAGTGG																												ENST00000316554.3:c.79G>C	chr12.hg19:g.48577984G>C	ENSP00000320849:p.Ala27Pro	23.0	0.0		15.0	6.0	NM_001013635	Q96MK5|Q96N39	Missense_Mutation	SNP	ENST00000316554.3	hg19	CCDS31785.1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.428343	0.25726	.	.	ENSG00000177875	ENST00000316554	T	0.57752	0.38	4.97	4.08	0.47627	.	0.000000	0.51477	D	0.000093	T	0.50803	0.1637	N	0.08118	0	0.34301	D	0.684382	D	0.76494	0.999	D	0.85130	0.997	T	0.66152	-0.5995	10	0.87932	D	0	-20.2082	10.6866	0.45846	0.0:0.0:0.8096:0.1904	.	27	Q52MB2	CL068_HUMAN	P	27	ENSP00000320849:A27P	ENSP00000320849:A27P	A	+	1	0	C12orf68	46864251	0.998000	0.40836	0.993000	0.49108	0.610000	0.37248	2.864000	0.48404	1.306000	0.44926	-0.158000	0.13435	GCA	.	.		0.647	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406514.1		
LUM	4060	hgsc.bcm.edu	37	12	91498002	91498002	+	Silent	SNP	G	G	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr12:91498002G>A	ENST00000266718.4	-	3	1411	c.957C>T	c.(955-957)acC>acT	p.T319T	LUM_ENST00000548071.1_5'UTR	NM_002345.3	NP_002336.1	P51884	LUM_HUMAN	lumican	319					carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to growth factor (GO:0070848)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrillar collagen trimer (GO:0005583)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	24						GTGGAAGACTGGTTTCTGAGA	0.388																																					p.T319T		Atlas-SNP	.											.	LUM	65	.	0			c.C957T						.						117.0	111.0	113.0					12																	91498002		2203	4300	6503	SO:0001819	synonymous_variant	4060	exon3			AAGACTGGTTTCT	BT006707	CCDS9038.1	12q21.33	2014-06-13			ENSG00000139329			"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	6724	protein-coding gene	gene with protein product	"""lumican proteoglycan"""	600616		LDC		7558030	Standard	NM_002345		Approved	SLRR2D	uc001tbm.3	P51884	OTTHUMG00000170074	ENST00000266718.4:c.957C>T	chr12.hg19:g.91498002G>A		64.0	0.0		89.0	4.0	NM_002345	B2R6R5|Q96QM7	Silent	SNP	ENST00000266718.4	hg19	CCDS9038.1																																																																																			.	.		0.388	LUM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407150.2	NM_002345	
ATP8A2	51761	hgsc.bcm.edu	37	13	26145823	26145823	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr13:26145823T>C	ENST00000381655.2	+	18	1797	c.1655T>C	c.(1654-1656)aTa>aCa	p.I552T	ATP8A2_ENST00000255283.8_Missense_Mutation_p.I512T|ATP8A2_ENST00000491840.1_3'UTR	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	512					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TCAGTCATCATAGAAGCGGTG	0.423																																					p.I552T		Atlas-SNP	.											.	ATP8A2	181	.	0			c.T1655C						.						136.0	131.0	133.0					13																	26145823		1950	4143	6093	SO:0001583	missense	51761	exon18			TCATCATAGAAGC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.1655T>C	chr13.hg19:g.26145823T>C	ENSP00000371070:p.Ile552Thr	69.0	0.0		63.0	28.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Missense_Mutation	SNP	ENST00000381655.2	hg19	CCDS41873.1	.	.	.	.	.	.	.	.	.	.	T	17.81	3.479606	0.63849	.	.	ENSG00000132932	ENST00000381655;ENST00000255283;ENST00000544544	T;T	0.68181	-0.31;-0.31	4.42	4.42	0.53409	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	T	0.82001	0.4942	M	0.84846	2.72	0.58432	D	0.999992	P;D;D;P	0.71674	0.954;0.979;0.998;0.92	P;P;D;P	0.68192	0.904;0.905;0.956;0.833	D	0.85529	0.1208	10	0.87932	D	0	.	13.7782	0.63066	0.0:0.0:0.0:1.0	.	512;332;512;512	B7Z880;F5GZN5;Q9NTI2-3;Q9NTI2	.;.;.;AT8A2_HUMAN	T	552;512;332	ENSP00000371070:I552T;ENSP00000255283:I512T	ENSP00000255283:I512T	I	+	2	0	ATP8A2	25043823	1.000000	0.71417	0.996000	0.52242	0.614000	0.37383	6.407000	0.73280	1.985000	0.57927	0.533000	0.62120	ATA	.	.		0.423	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
GNPTG	84572	hgsc.bcm.edu	37	16	1400190	1400190	+	5'Flank	SNP	C	C	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr16:1400190C>G	ENST00000204679.4	+	0	0				TSR3_ENST00000007390.2_Missense_Mutation_p.G191A	NM_032520.4	NP_115909.1	Q9UJJ9	GNPTG_HUMAN	N-acetylglucosamine-1-phosphate transferase, gamma subunit						carbohydrate phosphorylation (GO:0046835)|N-glycan processing to lysosome (GO:0016256)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)	protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	7		Hepatocellular(780;0.0893)				GAAGCCCTTGCCCCATTTAAA	0.582																																					p.G191A		Atlas-SNP	.											.	.	.	.	0			c.G572C						.						42.0	42.0	42.0					16																	1400190		2197	4298	6495	SO:0001631	upstream_gene_variant	115939	exon4			CCCTTGCCCCATT	BC014592	CCDS10436.1	16p13.3	2009-04-17		2004-10-01	ENSG00000090581	ENSG00000090581			23026	protein-coding gene	gene with protein product	"""GlcNAc-phosphotransferase gamma-subunit"""	607838	"""N-acetylglucosamine-1-phosphotransferase, gamma subunit"", ""chromosome 16 open reading frame 27"""	GNPTAG, C16orf27		10712439	Standard	NM_032520		Approved	CAB56184, c316G12.3	uc002clm.3	Q9UJJ9	OTTHUMG00000047835		chr16.hg19:g.1400190C>G	Exception_encountered	19.0	0.0		26.0	11.0	NM_001001410	B2R556|Q6XYD7|Q96L13	Missense_Mutation	SNP	ENST00000204679.4	hg19	CCDS10436.1	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342791	0.61073	.	.	ENSG00000007520	ENST00000007390	.	.	.	5.12	5.12	0.69794	Domain of unknown function DUF367 (2);	0.000000	0.85682	D	0.000000	D	0.83454	0.5258	M	0.84948	2.725	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86432	0.1761	9	0.87932	D	0	-29.85	16.0339	0.80608	0.0:1.0:0.0:0.0	.	191	Q9UJK0	TSR3_HUMAN	A	191	.	ENSP00000007390:G191A	G	-	2	0	C16orf42	1340191	1.000000	0.71417	1.000000	0.80357	0.032000	0.12392	5.719000	0.68462	2.374000	0.81015	0.561000	0.74099	GGC	.	.		0.582	GNPTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109058.2	NM_032520	
MYH8	4626	hgsc.bcm.edu	37	17	10304673	10304673	+	Silent	SNP	G	G	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr17:10304673G>A	ENST00000403437.2	-	24	3121	c.3027C>T	c.(3025-3027)acC>acT	p.T1009T	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1009					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GGTCATCCAGGGTCTGCTGGT	0.458									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.T1009T		Atlas-SNP	.											.	MYH8	346	.	0			c.C3027T						.						155.0	153.0	154.0					17																	10304673		2203	4300	6503	SO:0001819	synonymous_variant	4626	exon24	Familial Cancer Database	Carney Complex Variant	ATCCAGGGTCTGC		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3027C>T	chr17.hg19:g.10304673G>A		80.0	0.0		111.0	51.0	NM_002472	Q14910	Silent	SNP	ENST00000403437.2	hg19	CCDS11153.1																																																																																			.	.		0.458	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
MYH4	4622	hgsc.bcm.edu	37	17	10352333	10352333	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr17:10352333C>A	ENST00000255381.2	-	31	4323	c.4213G>T	c.(4213-4215)Gaa>Taa	p.E1405*	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1405					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ACATGTTCTTCTGCATCCTGC	0.458																																					p.E1405X		Atlas-SNP	.											.	MYH4	349	.	0			c.G4213T						.						66.0	61.0	63.0					17																	10352333		2203	4300	6503	SO:0001587	stop_gained	4622	exon31			GTTCTTCTGCATC		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.4213G>T	chr17.hg19:g.10352333C>A	ENSP00000255381:p.Glu1405*	55.0	0.0		75.0	24.0	NM_017533		Nonsense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	C	43	10.139128	0.99345	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.11	5.11	0.69529	.	0.000000	0.37761	U	0.001955	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.8931	0.92413	0.0:1.0:0.0:0.0	.	.	.	.	X	1405	.	ENSP00000255381:E1405X	E	-	1	0	MYH4	10293058	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	7.773000	0.85462	2.553000	0.86117	0.555000	0.69702	GAA	.	.		0.458	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
ITGB3	3690	hgsc.bcm.edu	37	17	45361990	45361990	+	Silent	SNP	A	A	G			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr17:45361990A>G	ENST00000559488.1	+	4	559	c.543A>G	c.(541-543)gcA>gcG	p.A181A	ITGB3_ENST00000571680.1_Silent_p.A181A|ITGB3_ENST00000560629.1_Missense_Mutation_p.I170V|ITGB3_ENST00000435993.2_Silent_p.A134A	NM_000212.2	NP_000203.2	P05106	ITB3_HUMAN	integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61)	181	VWFA.				activation of protein kinase activity (GO:0032147)|angiogenesis involved in wound healing (GO:0060055)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mesodermal cell differentiation (GO:0048333)|negative chemotaxis (GO:0050919)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein folding (GO:0006457)|regulation of bone resorption (GO:0045124)|smooth muscle cell migration (GO:0014909)|substrate adhesion-dependent cell spreading (GO:0034446)|tube development (GO:0035295)|viral entry into host cell (GO:0046718)|wound healing (GO:0042060)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|melanosome (GO:0042470)|microvillus membrane (GO:0031528)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|receptor complex (GO:0043235)|ruffle membrane (GO:0032587)	cell adhesion molecule binding (GO:0050839)|extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|identical protein binding (GO:0042802)|platelet-derived growth factor receptor binding (GO:0005161)|protease binding (GO:0002020)|protein disulfide isomerase activity (GO:0003756)|receptor activity (GO:0004872)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	39					Abciximab(DB00054)|Antithymocyte globulin(DB00098)|Eptifibatide(DB00063)|Tirofiban(DB00775)	GCTTCGGGGCATTTGTGGACA	0.552																																					p.A181A		Atlas-SNP	.											.	ITGB3	157	.	0			c.A543G						.						121.0	126.0	124.0					17																	45361990		2203	4300	6503	SO:0001819	synonymous_variant	3690	exon4			CGGGGCATTTGTG		CCDS11511.1	17q21.32	2014-09-17			ENSG00000259207	ENSG00000259207		"""CD molecules"", ""Integrins"""	6156	protein-coding gene	gene with protein product	"""platelet glycoprotein IIIa"""	173470		GP3A		2454952	Standard	NM_000212		Approved	CD61, GPIIIa	uc002ilj.3	P05106	OTTHUMG00000171956	ENST00000559488.1:c.543A>G	chr17.hg19:g.45361990A>G		122.0	0.0		136.0	49.0	NM_000212	A0PJW2|D3DXJ8|O15495|Q12806|Q13413|Q14648|Q16499	Silent	SNP	ENST00000559488.1	hg19	CCDS11511.1																																																																																			.	.		0.552	ITGB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416111.3	NM_000212	
DNMT1	1786	hgsc.bcm.edu	37	19	10286294	10286295	+	Splice_Site	DNP	GC	GC	AA			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G|C	G|C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr19:10286294_10286295GC>AA	ENST00000340748.4	-	6	757	c.522_522GC>TT	c.(520-522)ggGC>ggTTc	p.G174G	DNMT1_ENST00000359526.4_Splice_Site_p.G190G|DNMT1_ENST00000540357.1_Splice_Site_p.G174G			P26358	DNMT1_HUMAN	DNA (cytosine-5-)-methyltransferase 1	174	Interaction with DNMT3B.|Interaction with PCNA.|Interaction with the PRC2/EED-EZH2 complex. {ECO:0000250}.				cellular response to amino acid stimulus (GO:0071230)|chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|gene silencing (GO:0016458)|maintenance of DNA methylation (GO:0010216)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|positive regulation of histone H3-K4 methylation (GO:0051571)|regulation of cell proliferation (GO:0042127)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|replication fork (GO:0005657)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA binding (GO:0003677)|DNA-methyltransferase activity (GO:0009008)|methyl-CpG binding (GO:0008327)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|kidney(5)|large_intestine(21)|lung(11)|ovary(2)|pancreas(1)|prostate(10)|skin(5)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(20;1.59e-09)|Epithelial(33;2.86e-06)|all cancers(31;6.68e-06)		Azacitidine(DB00928)|Decitabine(DB01262)|Flucytosine(DB01099)|Procainamide(DB01035)	GTTTGGCAGGGCTGTCACACAC	0.515																																					p.G190G|.		Atlas-SNP	.											.	DNMT1	148	.	0			c.C570T|c.522-1G>T						.																																			SO:0001630	splice_region_variant	1786	exon7			GGCAGGGCTGTCA|GCAGGGCTGTCAC	X63692	CCDS12228.1, CCDS45958.1	19p13.2	2014-09-17				ENSG00000130816	2.1.1.37		2976	protein-coding gene	gene with protein product		126375		DNMT		1594447	Standard	NM_001379		Approved	MCMT, CXXC9	uc010xlc.2	P26358		ENST00000340748.4:c.522_522delinsAA	chr19.hg19:g.10286294_10286295delinsAA		94.0|96.0	0.0		158.0|156.0	62.0|61.0	NM_001130823|NM_001379	A0AV63|B7ZLW6|Q9UHG5|Q9ULA2|Q9UMZ6	Silent|Splice_Site	SNP	ENST00000340748.4	hg19	CCDS12228.1																																																																																			.	.		0.515	DNMT1-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451166.1	NM_001379	Silent
ZSWIM4	65249	hgsc.bcm.edu	37	19	13936368	13936368	+	Silent	SNP	C	C	T			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr19:13936368C>T	ENST00000254323.2	+	11	2058	c.1869C>T	c.(1867-1869)gaC>gaT	p.D623D	ZSWIM4_ENST00000440752.2_Silent_p.D457D	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	623							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			ACCCAGGAGACCCCAAGTGGC	0.622																																					p.D623D		Atlas-SNP	.											.	ZSWIM4	69	.	0			c.C1869T						.						91.0	93.0	92.0					19																	13936368		2203	4300	6503	SO:0001819	synonymous_variant	65249	exon11			AGGAGACCCCAAG	AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1869C>T	chr19.hg19:g.13936368C>T		73.0	0.0		112.0	55.0	NM_023072		Silent	SNP	ENST00000254323.2	hg19	CCDS32924.1																																																																																			.	.		0.622	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457457.1	XM_031342	
UNC13A	23025	hgsc.bcm.edu	37	19	17758169	17758169	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr19:17758169G>A	ENST00000519716.2	-	17	1948	c.1949C>T	c.(1948-1950)gCg>gTg	p.A650V	UNC13A_ENST00000252773.7_Missense_Mutation_p.A650V|UNC13A_ENST00000552293.1_Missense_Mutation_p.A650V|UNC13A_ENST00000428389.2_Missense_Mutation_p.A738V|UNC13A_ENST00000550896.1_Missense_Mutation_p.A648V|UNC13A_ENST00000551649.1_Missense_Mutation_p.A650V	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	650					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CTTGGTCACCGCGAAGATCTC	0.597																																					p.A650V		Atlas-SNP	.											.	UNC13A	299	.	0			c.C1949T						.						65.0	69.0	68.0					19																	17758169		2134	4269	6403	SO:0001583	missense	23025	exon16			GTCACCGCGAAGA	AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1949C>T	chr19.hg19:g.17758169G>A	ENSP00000429562:p.Ala650Val	77.0	0.0		106.0	59.0	NM_001080421	E5RHY9	Missense_Mutation	SNP	ENST00000519716.2	hg19	CCDS46013.2	.	.	.	.	.	.	.	.	.	.	G	13.59	2.281348	0.40394	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05;-0.05;-0.05	3.76	3.76	0.43208	.	0.325270	0.27406	U	0.019517	T	0.35941	0.0949	N	0.03608	-0.345	0.35689	D	0.814717	B	0.11235	0.004	B	0.09377	0.004	T	0.40365	-0.9567	10	0.40728	T	0.16	-23.5748	9.6831	0.40082	0.0:0.2137:0.7863:0.0	.	650	Q9UPW8	UN13A_HUMAN	V	650;738;650;650;650;648	ENSP00000429562:A650V;ENSP00000400409:A738V;ENSP00000252773:A650V;ENSP00000447236:A650V;ENSP00000447572:A650V;ENSP00000446831:A648V	ENSP00000252773:A650V	A	-	2	0	UNC13A	17619169	0.923000	0.31300	0.986000	0.45419	0.967000	0.64934	2.077000	0.41557	1.812000	0.52913	0.313000	0.20887	GCG	.	.		0.597	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000376169.2	XM_038604	
RTEL1	51750	hgsc.bcm.edu	37	20	62324187	62324187	+	Silent	SNP	C	C	T	rs535831345		TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr20:62324187C>T	ENST00000360203.5	+	29	3007	c.2682C>T	c.(2680-2682)gaC>gaT	p.D894D	RTEL1_ENST00000508582.2_Silent_p.D918D|RTEL1_ENST00000318100.4_Silent_p.D894D|RTEL1_ENST00000370018.3_Silent_p.D894D|RTEL1_ENST00000370003.1_Silent_p.D139D|RTEL1-TNFRSF6B_ENST00000482936.1_Silent_p.D894D					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			CACAGACGGACAGGGCCAAGC	0.627													C|||	1	0.000199681	0.0	0.0	5008	,	,		17078	0.001		0.0	False		,,,				2504	0.0				p.D918D		Atlas-SNP	.											.	RTEL1	114	.	0			c.C2754T						.						60.0	53.0	55.0					20																	62324187		2188	4287	6475	SO:0001819	synonymous_variant	51750	exon29			GACGGACAGGGCC	AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.2682C>T	chr20.hg19:g.62324187C>T		66.0	0.0		86.0	44.0	NM_032957		Silent	SNP	ENST00000360203.5	hg19																																																																																				.	.		0.627	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000289781.1	NM_032957	
NCF4	4689	hgsc.bcm.edu	37	22	37271708	37271708	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr22:37271708G>C	ENST00000248899.6	+	8	825	c.641G>C	c.(640-642)gGa>gCa	p.G214A	NCF4_ENST00000397147.4_Missense_Mutation_p.G214A	NM_000631.4	NP_000622.2	Q15080	NCF4_HUMAN	neutrophil cytosolic factor 4, 40kDa	214	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|interaction with host (GO:0051701)|oxidation-reduction process (GO:0055114)|phagosome maturation (GO:0090382)|positive regulation of catalytic activity (GO:0043085)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|membrane (GO:0016020)|NADPH oxidase complex (GO:0043020)|phagolysosome (GO:0032010)	phosphatidylinositol-3-phosphate binding (GO:0032266)|protein dimerization activity (GO:0046983)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			cervix(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16					Dextromethorphan(DB00514)	ACTGTCCGGGGAGCCACGGGC	0.597																																					p.G214A		Atlas-SNP	.											.	NCF4	66	.	0			c.G641C						.						56.0	51.0	53.0					22																	37271708		2203	4300	6503	SO:0001583	missense	4689	exon8			TCCGGGGAGCCAC	X77094	CCDS13934.1, CCDS13935.1	22q13.1	2014-09-17	2002-08-29		ENSG00000100365	ENSG00000100365			7662	protein-coding gene	gene with protein product	"""neutrophil NADPH oxidase factor 4"""	601488	"""neutrophil cytosolic factor 4 (40kD)"""			8839867	Standard	NM_013416		Approved	p40phox, SH3PXD4	uc003apy.4	Q15080	OTTHUMG00000150548	ENST00000248899.6:c.641G>C	chr22.hg19:g.37271708G>C	ENSP00000248899:p.Gly214Ala	36.0	0.0		41.0	20.0	NM_000631	A8K4F9|O60808|Q86U56|Q9BU98|Q9NP45	Missense_Mutation	SNP	ENST00000248899.6	hg19	CCDS13934.1	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784470	0.49997	.	.	ENSG00000100365	ENST00000447071;ENST00000248899;ENST00000397147	T;T;T	0.42900	0.96;0.96;0.96	4.45	3.43	0.39272	Src homology-3 domain (4);	0.161554	0.52532	D	0.000061	T	0.58424	0.2121	M	0.90425	3.115	0.26018	N	0.981908	P;P	0.49961	0.93;0.67	P;B	0.53313	0.723;0.403	T	0.54735	-0.8249	10	0.41790	T	0.15	-11.5148	8.3181	0.32113	0.249:0.0:0.751:0.0	.	214;214	A8K4F9;Q15080	.;NCF4_HUMAN	A	111;214;214	ENSP00000414958:G111A;ENSP00000248899:G214A;ENSP00000380334:G214A	ENSP00000248899:G214A	G	+	2	0	NCF4	35601654	1.000000	0.71417	0.814000	0.32528	0.954000	0.61252	3.831000	0.55776	1.005000	0.39183	0.650000	0.86243	GGA	.	.		0.597	NCF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318863.1	NM_000631	
MT-ND5	4540	hgsc.bcm.edu	37	M	13255	13255	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chrM:13255T>C	ENST00000361567.2	+	1	919	c.919T>C	c.(919-921)Tca>Cca	p.S307P	MT-TE_ENST00000387459.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TR_ENST00000387439.1_RNA|MT-TP_ENST00000387461.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	307					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCTTCTCCACTTCAAGTCAAC	0.448																																					p.S307P		Atlas-SNP	.											.	.	.	.	0			c.T919C						.																																			SO:0001583	missense	0	exon1			TCCACTTCAAGTC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.919T>C	chrM.hg19:g.13255T>C	ENSP00000354813:p.Ser307Pro	96.0	0.0		24.0	21.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.448	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
NXF2	56001	hgsc.bcm.edu	37	X	101573497	101573497	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chrX:101573497delC	ENST00000372758.1	+	13	1570	c.720delC	c.(718-720)gacfs	p.D240fs	NXF2_ENST00000372763.1_Frame_Shift_Del_p.D152fs|NXF2_ENST00000330252.5_Frame_Shift_Del_p.D240fs|NXF2_ENST00000372757.1_Frame_Shift_Del_p.D240fs|NXF2_ENST00000395088.2_Frame_Shift_Del_p.D240fs			Q9GZY0	NXF2_HUMAN	nuclear RNA export factor 2	240					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(2)|lung(2)	4						TCCGCTTTGACCCAGGTAAGG	0.532																																					p.D240fs		Atlas-INDEL	.											.	NXF2B	20	.	0			c.719delA						.						2.0	4.0	3.0					X																	101573497		755	1760	2515	SO:0001589	frameshift_variant	728343	exon9			.	AJ277526	CCDS14497.1	Xq22.1	2011-05-25			ENSG00000185554				8072	protein-coding gene	gene with protein product	"""cancer/testis antigen 39"", ""TAP like protein 2"""	300315				11073998, 11279525	Standard	NM_022053		Approved	CT39, TAPL-2	uc004eix.4	Q9GZY0		ENST00000372758.1:c.720delC	chrX.hg19:g.101573497delC	ENSP00000361844:p.Asp240fs	606.0	0.0		990.0	141.0	NM_001099686	Q9BXU4|Q9NSS1|Q9NX66	Frame_Shift_Del	DEL	ENST00000372758.1	hg19	CCDS14497.1																																																																																			.	.		0.532	NXF2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057618.1	NM_017809	
RB1	5925	hgsc.bcm.edu	37	13	48919320	48919321	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr13:48919320_48919321insA	ENST00000267163.4	+	4	623_624	c.485_486insA	c.(484-489)ttcagcfs	p.FS162fs		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	162					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(6)|p.F162fs*13(1)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	TTTGCACTCTTCAGCAAATTGG	0.282		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																											p.F162fs		Atlas-INDEL	.	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	RB1_ENST00000267163,colon,carcinoma,-1,2	RB1	1068	.	22	Whole gene deletion(15)|Unknown(6)|Complex - frameshift(1)	bone(11)|breast(6)|eye(2)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.485_486insA						.																																			SO:0001589	frameshift_variant	5925	exon4	Familial Cancer Database		.	M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	Exception_encountered	chr13.hg19:g.48919320_48919321insA	ENSP00000267163:p.Phe162fs	40.0	0.0		32.0	26.0	NM_000321	A8K5E3|P78499|Q5VW46|Q8IZL4	Frame_Shift_Ins	INS	ENST00000267163.4	hg19	CCDS31973.1																																																																																			.	.		0.282	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000044884.1		
CTSG	1511	hgsc.bcm.edu	37	14	25044580	25044580	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr14:25044580delG	ENST00000216336.2	-	2	130	c.94delC	c.(94-96)cgcfs	p.R32fs		NM_001911.2	NP_001902.1	P08311	CATG_HUMAN	cathepsin G	32	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|defense response to fungus (GO:0050832)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|immune response (GO:0006955)|negative regulation of growth of symbiont in host (GO:0044130)|neutrophil mediated killing of gram-positive bacterium (GO:0070946)|positive regulation of immune response (GO:0050778)|proteolysis (GO:0006508)|response to lipopolysaccharide (GO:0032496)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	heparin binding (GO:0008201)|peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			autonomic_ganglia(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)|urinary_tract(1)	25				GBM - Glioblastoma multiforme(265;0.0269)		ATGTAGGGGCGGGAGTGGGGC	0.562																																					p.R32fs		Atlas-Indel,Pindel	.											CTSG,NS,carcinoma,0,1	CTSG	63	.	0			c.95delG						.						111.0	112.0	112.0					14																	25044580		2203	4300	6503	SO:0001589	frameshift_variant	1511	exon2			.	M16117	CCDS9631.1	14q12	2013-02-25			ENSG00000100448	ENSG00000100448		"""Cathepsins"", ""Endogenous ligands"""	2532	protein-coding gene	gene with protein product		116830				2569462	Standard	NM_001911		Approved	CG	uc001wpq.3	P08311	OTTHUMG00000140182	ENST00000216336.2:c.94delC	chr14.hg19:g.25044580delG	ENSP00000216336:p.Arg32fs	38.0	0.0		73.0	34.0	NM_001911	Q6IBJ6|Q9UCA5|Q9UCU6	Frame_Shift_Del	DEL	ENST00000216336.2	hg19	CCDS9631.1																																																																																			.	.		0.562	CTSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276536.2	NM_001911	
SPAG6	9576	hgsc.bcm.edu	37	10	22700061	22700070	+	Frame_Shift_Del	DEL	ATACATCAAC	ATACATCAAC	-	rs541658599		TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	ATACATCAAC	ATACATCAAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr10:22700061_22700070delATACATCAAC	ENST00000376624.3	+	10	1558_1567	c.1416_1425delATACATCAAC	c.(1414-1425)gaatacatcaacfs	p.EYIN472fs	SPAG6_ENST00000490361.1_3'UTR|SPAG6_ENST00000538630.1_Frame_Shift_Del_p.EYIN447fs|SPAG6_ENST00000376601.1_Frame_Shift_Del_p.EYIN233fs|RP11-301N24.3_ENST00000422675.1_RNA|SPAG6_ENST00000313311.6_Intron|SPAG6_ENST00000376603.2_Frame_Shift_Del_p.EYIN548fs	NM_001253855.1|NM_012443.3	NP_001240784.1|NP_036575.1	O75602	SPAG6_HUMAN	sperm associated antigen 6	472					cell projection organization (GO:0030030)|spermatid development (GO:0007286)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|prostate(1)|skin(2)	27						TCCTTCAAGAATACATCAACAGTATTAACA	0.39																																					p.472_475del		Atlas-Indel,Pindel	.											.	SPAG6	90	.	0			c.1415_1424del						.																																			SO:0001589	frameshift_variant	9576	exon10			.	AF079363	CCDS7139.1, CCDS7140.1, CCDS58071.1, CCDS73072.1	10p12.31	2014-01-21			ENSG00000077327	ENSG00000077327		"""Armadillo repeat containing"""	11215	protein-coding gene	gene with protein product	"""axoneme central apparatus protein"""	605730				10493827	Standard	NM_012443		Approved	Repro-SA-1, pf16, CT141	uc001iri.3	O75602	OTTHUMG00000017808	ENST00000376624.3:c.1416_1425delATACATCAAC	chr10.hg19:g.22700061_22700070delATACATCAAC	ENSP00000365811:p.Glu472fs	76.0	0.0		60.0	17.0	NM_012443	A8K1I8|B4DXZ4|Q5VUX5|Q5VUX6|Q5VUX7|Q6FI74|Q8NHQ6	Frame_Shift_Del	DEL	ENST00000376624.3	hg19	CCDS7139.1																																																																																			.	.		0.390	SPAG6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047187.1		
KNTC1	9735	hgsc.bcm.edu	37	12	123055421	123055433	+	Splice_Site	DEL	TTTCAGATAATTC	TTTCAGATAATTC	-			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	TTTCAGATAATTC	TTTCAGATAATTC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr12:123055421_123055433delTTTCAGATAATTC	ENST00000333479.7	+	23	2037_2048	c.1860_1871delTTTCAGATAATTC	c.(1858-1872)catttcagataattc>cac	p.FR*F621fs	KNTC1_ENST00000450485.2_Splice_Site_p.FR*F584fs	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	621					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		AATCTATTTCAGATAATTCTTGCAAAATGGTTG	0.291																																					p.621_622del		Atlas-INDEL	.											.	KNTC1	182	.	0			c.1861_1866del						.																																			SO:0001630	splice_region_variant	9735	exon23			.		CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.1861-1TTTCAGATAATTC>-	chr12.hg19:g.123055421_123055433delTTTCAGATAATTC		99.0	0.0		65.0	16.0	NM_014708	A7E2C4|B3KSG2	In_Frame_Del	DEL	ENST00000333479.7	hg19	CCDS45002.1																																																																																			.	.		0.291	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396110.2		Frame_Shift_Del
CEP120	153241	hgsc.bcm.edu	37	5	122722352	122722353	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	AT	AT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr5:122722352_122722353delAT	ENST00000306467.5	-	10	1743_1744	c.1439_1440delAT	c.(1438-1440)tatfs	p.Y480fs	CEP120_ENST00000306481.6_Frame_Shift_Del_p.Y454fs|CEP120_ENST00000328236.5_Frame_Shift_Del_p.Y480fs			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	480					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						CAAAGAATGGATATGAGTACCT	0.307																																					p.480_481del		Atlas-Indel,Pindel	.											.	CEP120	72	.	0			c.1440_1441del						.																																			SO:0001589	frameshift_variant	153241	exon11			.	AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.1439_1440delAT	chr5.hg19:g.122722354_122722355delAT	ENSP00000303058:p.Tyr480fs	57.0	0.0		65.0	29.0	NM_153223	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Frame_Shift_Del	DEL	ENST00000306467.5	hg19	CCDS4134.2																																																																																			.	.		0.307	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250899.2	NM_153223	
AGAP2	116986	hgsc.bcm.edu	37	12	58121724	58121738	+	In_Frame_Del	DEL	ACCTTGCTGCTCTCA	ACCTTGCTGCTCTCA	-			TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	ACCTTGCTGCTCTCA	ACCTTGCTGCTCTCA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr12:58121724_58121738delACCTTGCTGCTCTCA	ENST00000547588.1	-	15	2747_2761	c.2748_2762delTGAGAGCAGCAAGGT	c.(2746-2763)tgtgagagcagcaaggtc>tgc	p.ESSKV917del	AGAP2-AS1_ENST00000542466.2_3'UTR|AGAP2_ENST00000257897.3_In_Frame_Del_p.ESSKV561del|RP11-571M6.8_ENST00000548410.2_RNA	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	917					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)	p.V565I(1)		breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						TCTTACCTTGACCTTGCTGCTCTCACAGCATTGCA	0.595																																					p.917_921del		Pindel	.											.	AGAP2	167	.	1	Substitution - Missense(1)	central_nervous_system(1)	c.2749_2763del						.																																			SO:0001651	inframe_deletion	116986	exon15			.	AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.2748_2762delTGAGAGCAGCAAGGT	chr12.hg19:g.58121724_58121738delACCTTGCTGCTCTCA	ENSP00000449241:p.Glu917_Val921del	66.0	0.0		75.0	20.0	NM_001122772	A8K9F7|O00578|Q548E0|Q8IWU3	In_Frame_Del	DEL	ENST00000547588.1	hg19	CCDS44932.1																																																																																			.	.		0.595	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408367.1	NM_014770	
ZNF512B	57473	hgsc.bcm.edu	37	20	62597492	62597583	+	Splice_Site	DEL	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	-	rs200518817|rs376642783|rs540039560|rs200940725|rs371234637|rs139142804|rs146666443	byFrequency	TCGA-DD-A4NE-01A-11D-A27I-10	TCGA-DD-A4NE-11A-11D-A27I-10	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	GACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	343fcbc2-f30c-4ffa-a0b3-f5bb21e5e70b	2f595b57-7cf4-4499-bec6-497a4e241e01	g.chr20:62597492_62597583delGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT	ENST00000450537.1	-	5	1005_1095	c.945_1035delAGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTCGGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTC	c.(943-1035)agagggaggaacagtggtaagaaaaggtatgggggctcgtcccaggtcggggaggaacagtggtaagaaaaggtatgggggctcgtcccaggt>ag	p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs	ZNF512B_ENST00000217130.3_Splice_Site_p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs|ZNF512B_ENST00000369888.1_Splice_Site_p.RGRNSGKKRYGGSSQVGEEQW*EKVWGLVPG315fs			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	315					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					GAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCTGTGGCACGAGGTGCTTTGTTCTCCGACCTGGTCAGCAGCACCATTTTGCAGGGCGGTGTGTGTCTGCTGATAGCAA	0.575																																					p.338_345del		Pindel	.											.	ZNF512B	72	.	0			c.1012_1034del						.																																			SO:0001630	splice_region_variant	57473	exon5			.	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1034+1AGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTCGGGGAGGAACAGTGGTAAGAAAAGGTATGGGGGCTCGTCCCAGGTC>-	chr20.hg19:g.62597492_62597583delGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCCGACCTGGGACGAGCCCCCATACCTTTTCTTACCACTGTTCCTCCCT		111.0	0.0		211.0	19.0	NM_020713	Q08AK9|Q9ULM4	Frame_Shift_Del	DEL	ENST00000450537.1	hg19	CCDS13548.1																																																																																			.	.		0.575	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	Frame_Shift_Del
