#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1QA	712	hgsc.bcm.edu	37	1	22965369	22965369	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:22965369C>A	ENST00000374642.3	+	3	411	c.207C>A	c.(205-207)gaC>gaA	p.D69E	C1QA_ENST00000402322.1_Missense_Mutation_p.D69E	NM_015991.2	NP_057075.1	P02745	C1QA_HUMAN	complement component 1, q subcomponent, A chain	69	Collagen-like.				cell-cell signaling (GO:0007267)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)	collagen trimer (GO:0005581)|complement component C1 complex (GO:0005602)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|liver(1)|lung(3)|skin(1)	6		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.41e-27)|Colorectal(126;1.52e-07)|COAD - Colon adenocarcinoma(152;1.12e-05)|GBM - Glioblastoma multiforme(114;1.63e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000541)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.197)	Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	TTAAAGGAGACCAGGGGGAAC	0.642																																					p.D69E		Atlas-SNP	.											.	C1QA	31	.	0			c.C207A						.						6.0	8.0	8.0					1																	22965369		2141	4246	6387	SO:0001583	missense	712	exon3			AGGAGACCAGGGG	AF135157	CCDS226.1	1p36.3-p34.1	2014-09-17	2006-02-09		ENSG00000173372	ENSG00000173372		"""Complement system"""	1241	protein-coding gene	gene with protein product		120550	"""complement component 1, q subcomponent, alpha polypeptide"""			1537612	Standard	NM_015991		Approved		uc001bfy.3	P02745	OTTHUMG00000002893	ENST00000374642.3:c.207C>A	chr1.hg19:g.22965369C>A	ENSP00000363773:p.Asp69Glu	62.0	0.0		63.0	10.0	NM_015991	B2R4X2|Q5T963	Missense_Mutation	SNP	ENST00000374642.3	hg19	CCDS226.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.57|12.57	1.977597|1.977597	0.34848|0.34848	.|.	.|.	ENSG00000173372|ENSG00000173372	ENST00000374642;ENST00000438241;ENST00000402322|ENST00000339353	D;D;D|.	0.90197|.	-2.63;-2.63;-2.63|.	5.48|5.48	1.98|1.98	0.26296|0.26296	.|.	.|0.489945	.|0.15948	.|N	.|0.236865	T|T	0.27027|0.27027	0.0662|0.0662	L|L	0.35542|0.35542	1.07|1.07	0.20403|0.20403	N|N	0.999905|0.999905	P|.	0.37207|.	0.587|.	B|.	0.39027|.	0.288|.	T|T	0.17258|0.17258	-1.0375|-1.0375	9|7	0.09590|0.46703	T|T	0.72|0.11	1.8948|1.8948	3.7723|3.7723	0.08646|0.08646	0.1698:0.4398:0.0:0.3904|0.1698:0.4398:0.0:0.3904	.|.	69|.	P02745|.	C1QA_HUMAN|.	E|N	69|67	ENSP00000363773:D69E;ENSP00000416841:D69E;ENSP00000385564:D69E|.	ENSP00000363773:D69E|ENSP00000341271:T67N	D|T	+|+	3|2	2|0	C1QA|C1QA	22837956|22837956	0.000000|0.000000	0.05858|0.05858	0.447000|0.447000	0.26932|0.26932	0.917000|0.917000	0.54804|0.54804	-0.036000|-0.036000	0.12185|0.12185	0.239000|0.239000	0.21243|0.21243	0.561000|0.561000	0.74099|0.74099	GAC|ACC	.	.		0.642	C1QA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008087.2	NM_015991	
RNF11	26994	hgsc.bcm.edu	37	1	51702468	51702468	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:51702468T>A	ENST00000242719.3	+	1	526	c.40T>A	c.(40-42)Tcc>Acc	p.S14T	RP11-296A18.3_ENST00000366181.2_lincRNA|RNF11_ENST00000494873.1_3'UTR	NM_014372.4	NP_055187.1	Q9Y3C5	RNF11_HUMAN	ring finger protein 11	14					protein autoubiquitination (GO:0051865)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.0?(2)		large_intestine(1)	1						GGATGACATCTCCCTGCTTCA	0.642																																					p.S14T		Atlas-SNP	.											.	RNF11	10	.	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)	c.T40A						.						53.0	46.0	48.0					1																	51702468		2203	4300	6503	SO:0001583	missense	26994	exon1			GACATCTCCCTGC	AB024703	CCDS556.1	1p32	2013-01-09			ENSG00000123091	ENSG00000123091		"""RING-type (C3HC4) zinc fingers"""	10056	protein-coding gene	gene with protein product		612598				10673045, 10810093	Standard	NM_014372		Approved	CGI-123, Sid1669p, MGC51169	uc001csi.4	Q9Y3C5	OTTHUMG00000008190	ENST00000242719.3:c.40T>A	chr1.hg19:g.51702468T>A	ENSP00000242719:p.Ser14Thr	227.0	0.0		216.0	44.0	NM_014372	A8KAI2|Q5T7R8	Missense_Mutation	SNP	ENST00000242719.3	hg19	CCDS556.1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.529623	0.85706	.	.	ENSG00000123091	ENST00000242719	T	0.18016	2.24	4.64	4.64	0.57946	.	0.174863	0.52532	D	0.000075	T	0.28234	0.0697	L	0.55990	1.75	0.80722	D	1	P	0.47191	0.891	P	0.53006	0.715	T	0.01185	-1.1425	10	0.34782	T	0.22	-1.3414	14.1633	0.65461	0.0:0.0:0.0:1.0	.	14	Q9Y3C5	RNF11_HUMAN	T	14	ENSP00000242719:S14T	ENSP00000242719:S14T	S	+	1	0	RNF11	51475056	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.513000	0.73742	2.073000	0.62155	0.454000	0.30748	TCC	.	.		0.642	RNF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022419.1	NM_014372	
SPAG17	200162	hgsc.bcm.edu	37	1	118635840	118635840	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:118635840A>T	ENST00000336338.5	-	8	1177	c.1112T>A	c.(1111-1113)cTt>cAt	p.L371H		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	371						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		AACATTAATAAGCTGCATGCT	0.408																																					p.L371H		Atlas-SNP	.											.	SPAG17	263	.	0			c.T1112A						.						114.0	105.0	108.0					1																	118635840		2203	4300	6503	SO:0001583	missense	200162	exon8			TTAATAAGCTGCA		CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.1112T>A	chr1.hg19:g.118635840A>T	ENSP00000337804:p.Leu371His	117.0	0.0		173.0	13.0	NM_206996	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	ENST00000336338.5	hg19	CCDS899.1	.	.	.	.	.	.	.	.	.	.	A	16.58	3.162470	0.57368	.	.	ENSG00000155761	ENST00000336338	T	0.72167	-0.63	5.64	5.64	0.86602	.	0.059501	0.64402	D	0.000003	T	0.81059	0.4744	M	0.79475	2.455	0.34293	D	0.683427	D	0.89917	1.0	D	0.83275	0.996	D	0.85133	0.0976	10	0.87932	D	0	.	15.8528	0.78947	1.0:0.0:0.0:0.0	.	371	Q6Q759	SPG17_HUMAN	H	371	ENSP00000337804:L371H	ENSP00000337804:L371H	L	-	2	0	SPAG17	118437363	1.000000	0.71417	0.874000	0.34290	0.228000	0.25075	7.742000	0.85008	2.141000	0.66446	0.482000	0.46254	CTT	.	.		0.408	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033723.1	NM_206996	
NOTCH2NL	388677	hgsc.bcm.edu	37	1	145273364	145273364	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:145273364C>G	ENST00000369340.3	+	4	662	c.218C>G	c.(217-219)tCt>tGt	p.S73C	RP11-458D21.5_ENST00000468030.1_Missense_Mutation_p.S73C|NOTCH2NL_ENST00000344859.3_Missense_Mutation_p.S73C|NOTCH2NL_ENST00000362074.6_Missense_Mutation_p.S73C			Q7Z3S9	NT2NL_HUMAN	notch 2 N-terminal like	73	EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	27						TGCTTTGTGTCTCGACCTTGC	0.547																																					p.S73C		Atlas-SNP	.											.	NOTCH2NL	100	.	0			c.C218G						.						511.0	464.0	480.0					1																	145273364		2203	4300	6503	SO:0001583	missense	388677	exon3			TTGTGTCTCGACC		CCDS72880.1	1q21.2	2010-06-24	2010-06-24		ENSG00000213240	ENSG00000213240			31862	protein-coding gene	gene with protein product			"""Notch homolog 2 (Drosophila) N-terminal like"""			14673143	Standard	NM_203458		Approved	N2N	uc001emn.4	Q7Z3S9	OTTHUMG00000013754	ENST00000369340.3:c.218C>G	chr1.hg19:g.145273364C>G	ENSP00000358346:p.Ser73Cys	2643.0	0.0		3638.0	161.0	NM_203458	Q5BKT8|Q5VTG9|Q5XG84|Q6P192|Q8NC23|Q8WUQ9|Q96FY1	Missense_Mutation	SNP	ENST00000369340.3	hg19	CCDS909.1	.	.	.	.	.	.	.	.	.	.	C	11.00	1.509632	0.27036	.	.	ENSG00000213240	ENST00000362074;ENST00000344859;ENST00000369340	D;D;D	0.92397	-3.03;-3.03;-3.03	2.75	1.77	0.24775	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.93746	0.8001	M	0.89968	3.075	0.25140	N	0.990501	D;D	0.67145	0.99;0.996	P;P	0.62649	0.847;0.905	D	0.86894	0.2050	9	0.72032	D	0.01	.	8.4516	0.32873	0.2347:0.7653:0.0:0.0	.	73;73	Q7Z3S9-2;Q7Z3S9	.;NT2NL_HUMAN	C	73	ENSP00000354929:S73C;ENSP00000344557:S73C;ENSP00000358346:S73C	ENSP00000344557:S73C	S	+	2	0	NOTCH2NL	143984721	0.993000	0.37304	0.886000	0.34754	0.179000	0.23085	2.225000	0.42954	0.434000	0.26340	0.394000	0.25966	TCT	.	.		0.547	NOTCH2NL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000038546.1	NM_203458	
TTC24	164118	hgsc.bcm.edu	37	1	156551507	156551507	+	Silent	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:156551507C>T	ENST00000368237.3	+	1	351	c.351C>T	c.(349-351)ggC>ggT	p.G117G	TTC24_ENST00000368236.3_Silent_p.G117G			A2A3L6	TTC24_HUMAN	tetratricopeptide repeat domain 24	117										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|prostate(1)	20	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCGACACGGCGACCAATGTT	0.637																																					p.G117G		Atlas-SNP	.											TTC24,NS,carcinoma,0,1	TTC24	46	.	0			c.C351T						.						42.0	50.0	47.0					1																	156551507		692	1591	2283	SO:0001819	synonymous_variant	164118	exon2			ACACGGCGACCAA		CCDS53379.1	1q22	2013-01-10			ENSG00000187862	ENSG00000187862		"""Tetratricopeptide (TTC) repeat domain containing"""	32348	protein-coding gene	gene with protein product							Standard	NM_001105669		Approved		uc021pbf.1	A2A3L6	OTTHUMG00000033202	ENST00000368237.3:c.351C>T	chr1.hg19:g.156551507C>T		136.0	0.0		228.0	30.0	NM_001105669	Q5T3H7	Silent	SNP	ENST00000368237.3	hg19	CCDS53379.1																																																																																			.	.		0.637	TTC24-006	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000158547.1	XM_089384	
KIF21B	23046	hgsc.bcm.edu	37	1	200959773	200959773	+	Silent	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:200959773C>A	ENST00000422435.2	-	19	3082	c.2766G>T	c.(2764-2766)cgG>cgT	p.R922R	KIF21B_ENST00000332129.2_Silent_p.R922R|KIF21B_ENST00000461742.2_Silent_p.R922R|KIF21B_ENST00000360529.5_Silent_p.R922R	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	922					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						TGTCAATGATCCGTCGCTCCA	0.562																																					p.R922R		Atlas-SNP	.											.	KIF21B	208	.	0			c.G2766T						.						94.0	88.0	90.0					1																	200959773		2203	4300	6503	SO:0001819	synonymous_variant	23046	exon19			AATGATCCGTCGC	BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2766G>T	chr1.hg19:g.200959773C>A		95.0	0.0		183.0	20.0	NM_017596	B2RP62|B7ZMI0|Q5T4J3	Silent	SNP	ENST00000422435.2	hg19	CCDS58056.1																																																																																			.	.		0.562	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000382635.1	XM_371332	
LYST	1130	hgsc.bcm.edu	37	1	235940366	235940366	+	Silent	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:235940366G>A	ENST00000389794.3	-	17	5631	c.5457C>T	c.(5455-5457)gcC>gcT	p.A1819A	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Silent_p.A1819A			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1819					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TTCTTACCCTGGCAAAGAGAA	0.338																																					p.A1819A		Atlas-SNP	.											.	LYST	370	.	0			c.C5457T						.						65.0	67.0	66.0					1																	235940366		2202	4300	6502	SO:0001819	synonymous_variant	1130	exon17			TACCCTGGCAAAG	U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5457C>T	chr1.hg19:g.235940366G>A		52.0	0.0		68.0	4.0	NM_000081	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	ENST00000389794.3	hg19	CCDS31062.1																																																																																			.	.		0.338	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097533.5		
DNAH7	56171	hgsc.bcm.edu	37	2	196740508	196740508	+	Silent	SNP	G	G	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr2:196740508G>T	ENST00000312428.6	-	38	6277	c.6177C>A	c.(6175-6177)ccC>ccA	p.P2059P		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2059	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						GTAACTCAATGGGAGGTTGAG	0.408																																					p.P2059P		Atlas-SNP	.											.	DNAH7	512	.	0			c.C6177A						.						103.0	95.0	98.0					2																	196740508		1877	4105	5982	SO:0001819	synonymous_variant	56171	exon38			CTCAATGGGAGGT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6177C>A	chr2.hg19:g.196740508G>T		193.0	0.0		201.0	44.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	ENST00000312428.6	hg19	CCDS42794.1																																																																																			.	.		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
TRIP12	9320	hgsc.bcm.edu	37	2	230632438	230632438	+	Silent	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr2:230632438T>A	ENST00000283943.5	-	41	5989	c.5811A>T	c.(5809-5811)acA>acT	p.T1937T	TRIP12_ENST00000389044.4_Silent_p.T1985T|TRIP12_ENST00000389045.3_Silent_p.T1667T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1937	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTCGGACAATTGTCAAAGGTG	0.373																																					p.T1937T		Atlas-SNP	.											.	TRIP12	207	.	0			c.A5811T						.						100.0	101.0	101.0					2																	230632438		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon41			GACAATTGTCAAA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5811A>T	chr2.hg19:g.230632438T>A		71.0	0.0		88.0	4.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.373	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
SNED1	25992	hgsc.bcm.edu	37	2	242004719	242004719	+	Silent	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr2:242004719C>T	ENST00000310397.8	+	21	2718	c.2718C>T	c.(2716-2718)ctC>ctT	p.L906L	SNED1_ENST00000405547.3_Silent_p.L906L|SNED1_ENST00000342631.6_Silent_p.L906L|SNED1_ENST00000401884.1_Silent_p.L906L|AC005237.4_ENST00000458377.1_RNA	NM_001080437.1	NP_001073906.1	Q8TER0	SNED1_HUMAN	sushi, nidogen and EGF-like domains 1	906					cell-matrix adhesion (GO:0007160)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	24		all_cancers(19;7.48e-31)|all_epithelial(40;1.35e-12)|Breast(86;0.000148)|Renal(207;0.00528)|Ovarian(221;0.104)|Esophageal squamous(248;0.131)|all_lung(227;0.17)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;6.46e-32)|all cancers(36;6.23e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.1e-14)|Kidney(56;6.35e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.98e-08)|BRCA - Breast invasive adenocarcinoma(100;3.66e-06)|Lung(119;0.00072)|LUSC - Lung squamous cell carcinoma(224;0.00553)|Colorectal(34;0.0162)|COAD - Colon adenocarcinoma(134;0.109)		CTGAAGAGCTCTTCCCACCGA	0.617																																					p.L906L		Atlas-SNP	.											.	SNED1	76	.	0			c.C2718T						.						23.0	27.0	26.0					2																	242004719		1978	4158	6136	SO:0001819	synonymous_variant	25992	exon21			AGAGCTCTTCCCA	AK074062	CCDS46562.1	2q37.3	2014-01-28			ENSG00000162804	ENSG00000162804		"""Fibronectin type III domain containing"""	24696	protein-coding gene	gene with protein product						12477932	Standard	NM_001080437		Approved	FLJ00133, SST3, Snep	uc002wah.1	Q8TER0	OTTHUMG00000151803	ENST00000310397.8:c.2718C>T	chr2.hg19:g.242004719C>T		81.0	0.0		112.0	13.0	NM_001080437	B5MDC3|B7WNK6|B7WPM0|Q336F4|Q336F5|Q8N369|Q8TEP7	Silent	SNP	ENST00000310397.8	hg19	CCDS46562.1																																																																																			.	.		0.617	SNED1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323935.2	XM_059482	
COL7A1	1294	hgsc.bcm.edu	37	3	48610139	48610139	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr3:48610139T>A	ENST00000328333.8	-	87	6972	c.6865A>T	c.(6865-6867)Aaa>Taa	p.K2289*	COL7A1_ENST00000454817.1_Nonsense_Mutation_p.K2257*	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	2289	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGTTCTCCTTTAGGTCCGACA	0.627																																					p.K2289X		Atlas-SNP	.											.	COL7A1	320	.	0			c.A6865T						.						24.0	30.0	28.0					3																	48610139		2200	4296	6496	SO:0001587	stop_gained	1294	exon87			CTCCTTTAGGTCC	L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.6865A>T	chr3.hg19:g.48610139T>A	ENSP00000332371:p.Lys2289*	139.0	0.0		152.0	19.0	NM_000094	Q14054|Q16507	Nonsense_Mutation	SNP	ENST00000328333.8	hg19	CCDS2773.1	.	.	.	.	.	.	.	.	.	.	T	46	12.575030	0.99679	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	.	.	.	6.06	6.06	0.98353	.	0.000000	0.49916	D	0.000138	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.1837	0.72982	0.0:0.0:0.0:1.0	.	.	.	.	X	2289;2257	.	ENSP00000332371:K2289X	K	-	1	0	COL7A1	48585143	1.000000	0.71417	1.000000	0.80357	0.187000	0.23431	3.430000	0.52807	2.322000	0.78497	0.528000	0.53228	AAA	.	.		0.627	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257519.1	NM_000094	
KBTBD8	84541	hgsc.bcm.edu	37	3	67054129	67054129	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr3:67054129A>T	ENST00000417314.2	+	3	787	c.738A>T	c.(736-738)gaA>gaT	p.E246D	KBTBD8_ENST00000469661.1_3'UTR|KBTBD8_ENST00000295568.4_Missense_Mutation_p.E220D|KBTBD8_ENST00000460576.1_Intron			Q8NFY9	KBTB8_HUMAN	kelch repeat and BTB (POZ) domain containing 8	246	BACK.					cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(4)|ovary(2)|prostate(1)	20		Lung NSC(201;0.0765)		BRCA - Breast invasive adenocarcinoma(55;6.02e-06)|KIRC - Kidney renal clear cell carcinoma(39;0.105)|Kidney(39;0.125)		CTCTGATGGAAGATACCTTTA	0.403																																					p.E246D		Atlas-SNP	.											.	KBTBD8	101	.	0			c.A738T						.						97.0	109.0	105.0					3																	67054129		2203	4300	6503	SO:0001583	missense	84541	exon3			GATGGAAGATACC	AF385438	CCDS2906.1, CCDS2906.2	3p14	2013-01-08			ENSG00000163376	ENSG00000163376		"""BTB/POZ domain containing"""	30691	protein-coding gene	gene with protein product	"""T-cell activation kelch repeat protein"""					11347906	Standard	NM_032505		Approved	TA-KRP, KIAA1842	uc003dmy.3	Q8NFY9	OTTHUMG00000158779	ENST00000417314.2:c.738A>T	chr3.hg19:g.67054129A>T	ENSP00000401878:p.Glu246Asp	65.0	0.0		53.0	12.0	NM_032505	B4DTW6|Q96JI5	Missense_Mutation	SNP	ENST00000417314.2	hg19	CCDS2906.2	.	.	.	.	.	.	.	.	.	.	A	8.216	0.801378	0.16397	.	.	ENSG00000163376	ENST00000295568;ENST00000417314	T;T	0.68765	-0.35;-0.35	4.82	3.65	0.41850	BTB/Kelch-associated (2);	0.096458	0.64402	D	0.000001	T	0.33498	0.0865	N	0.01649	-0.78	0.42321	D	0.992254	B	0.09022	0.002	B	0.10450	0.005	T	0.08764	-1.0706	10	0.44086	T	0.13	.	3.8885	0.09108	0.6678:0.1311:0.0745:0.1265	.	246	Q8NFY9	KBTB8_HUMAN	D	220;246	ENSP00000295568:E220D;ENSP00000401878:E246D	ENSP00000295568:E220D	E	+	3	2	KBTBD8	67136819	0.978000	0.34361	1.000000	0.80357	0.995000	0.86356	0.232000	0.17891	0.777000	0.33496	0.445000	0.29226	GAA	.	.		0.403	KBTBD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352189.1	NM_032505	
CASR	846	hgsc.bcm.edu	37	3	122003472	122003472	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr3:122003472C>T	ENST00000490131.1	+	7	3043	c.2671C>T	c.(2671-2673)Cgc>Tgc	p.R891C	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.R901C|CASR_ENST00000296154.5_Missense_Mutation_p.R891C	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	891	Interaction with RNF19A.				anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)	p.R891G(1)		NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	CACGCTGCGCCGCAGCAACGT	0.627																																					p.R901C		Atlas-SNP	.											CASR,NS,carcinoma,-1,1	CASR	190	.	1	Substitution - Missense(1)	lung(1)	c.C2701T						.						30.0	31.0	31.0					3																	122003472		2203	4298	6501	SO:0001583	missense	846	exon7			CTGCGCCGCAGCA	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2671C>T	chr3.hg19:g.122003472C>T	ENSP00000418685:p.Arg891Cys	55.0	0.0		37.0	2.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	hg19	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	C	25.4	4.634258	0.87660	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89343	-2.5;-2.5;-2.5	5.89	5.89	0.94794	.	0.051500	0.85682	D	0.000000	D	0.90283	0.6961	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	P;P	0.60117	0.869;0.791	D	0.91266	0.5040	10	0.87932	D	0	.	19.2448	0.93898	0.0:1.0:0.0:0.0	.	901;891	E7ENE0;P41180	.;CASR_HUMAN	C	891;901;891	ENSP00000418685:R891C;ENSP00000420194:R901C;ENSP00000296154:R891C	ENSP00000296154:R891C	R	+	1	0	CASR	123486162	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.666000	0.83877	2.793000	0.96121	0.561000	0.74099	CGC	.	.		0.627	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
IGSF10	285313	hgsc.bcm.edu	37	3	151166486	151166486	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr3:151166486C>A	ENST00000282466.3	-	4	1282	c.1283G>T	c.(1282-1284)tGg>tTg	p.W428L		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	428					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TTGCATTAACCAAGAGGGATC	0.428																																					p.W428L		Atlas-SNP	.											.	IGSF10	279	.	0			c.G1283T						.						117.0	107.0	111.0					3																	151166486		2203	4300	6503	SO:0001583	missense	285313	exon4			ATTAACCAAGAGG	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.1283G>T	chr3.hg19:g.151166486C>A	ENSP00000282466:p.Trp428Leu	62.0	0.0		81.0	13.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Missense_Mutation	SNP	ENST00000282466.3	hg19	CCDS3160.1	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407204	0.83230	.	.	ENSG00000152580	ENST00000282466	D	0.96265	-3.96	5.08	5.08	0.68730	.	0.000000	0.44097	D	0.000499	D	0.98040	0.9354	M	0.81802	2.56	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	D	0.97943	1.0327	10	0.39692	T	0.17	.	18.4741	0.90785	0.0:1.0:0.0:0.0	.	428	Q6WRI0	IGS10_HUMAN	L	428	ENSP00000282466:W428L	ENSP00000282466:W428L	W	-	2	0	IGSF10	152649176	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.487000	0.81328	2.378000	0.81104	0.555000	0.69702	TGG	.	.		0.428	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
ZNF732	654254	hgsc.bcm.edu	37	4	289878	289878	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr4:289878C>A	ENST00000419098.1	-	2	80	c.70G>T	c.(70-72)Gcc>Tcc	p.A24S		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	24	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TTCTGCTGGGCAGGGTCCAGG	0.418																																					p.A23S		Atlas-SNP	.											.	ZNF732	117	.	0			c.G67T						.						33.0	32.0	32.0					4																	289878		692	1590	2282	SO:0001583	missense	654254	exon1			GCTGGGCAGGGTC	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.70G>T	chr4.hg19:g.289878C>A	ENSP00000415774:p.Ala24Ser	175.0	0.0		178.0	8.0	NM_001137608		Missense_Mutation	SNP	ENST00000419098.1	hg19	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	C	3.894	-0.023332	0.07634	.	.	ENSG00000186777	ENST00000419098	T	0.02258	4.37	1.22	-2.43	0.06522	Krueppel-associated box (4);	.	.	.	.	T	0.03263	0.0095	M	0.65677	2.01	0.09310	N	1	B	0.32350	0.366	B	0.37692	0.256	T	0.36939	-0.9727	9	0.42905	T	0.14	.	2.9027	0.05711	0.0:0.4666:0.2847:0.2487	.	24	B4DXR9	ZN732_HUMAN	S	24	ENSP00000415774:A24S	ENSP00000415774:A24S	A	-	1	0	ZNF732	279878	0.000000	0.05858	0.085000	0.20634	0.087000	0.18053	-1.157000	0.03157	-0.694000	0.05113	-0.680000	0.03767	GCC	.	.		0.418	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ZNF732	654254	hgsc.bcm.edu	37	4	289881	289881	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr4:289881G>T	ENST00000419098.1	-	2	77	c.67C>A	c.(67-69)Cct>Act	p.P23T		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	23	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TGCTGGGCAGGGTCCAGGCAT	0.413																																					p.P22T		Atlas-SNP	.											.	ZNF732	117	.	0			c.C64A						.						35.0	33.0	34.0					4																	289881		692	1590	2282	SO:0001583	missense	654254	exon1			GGGCAGGGTCCAG	AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.67C>A	chr4.hg19:g.289881G>T	ENSP00000415774:p.Pro23Thr	168.0	0.0		170.0	8.0	NM_001137608		Missense_Mutation	SNP	ENST00000419098.1	hg19	CCDS46990.1	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.337467	0.00224	.	.	ENSG00000186777	ENST00000419098	T	0.02472	4.28	1.22	1.22	0.21188	Krueppel-associated box (4);	.	.	.	.	T	0.02888	0.0086	L	0.56340	1.77	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.49771	-0.8904	9	0.08599	T	0.76	.	5.3307	0.15930	0.0:0.0:1.0:0.0	.	23	B4DXR9	ZN732_HUMAN	T	23	ENSP00000415774:P23T	ENSP00000415774:P23T	P	-	1	0	ZNF732	279881	0.000000	0.05858	0.122000	0.21767	0.125000	0.20455	-0.620000	0.05565	0.300000	0.22699	0.305000	0.20034	CCT	.	.		0.413	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000357937.2	NM_001137608	
ATP10D	57205	hgsc.bcm.edu	37	4	47517533	47517533	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr4:47517533T>C	ENST00000273859.3	+	3	600	c.331T>C	c.(331-333)Tgg>Cgg	p.W111R	ATP10D_ENST00000504445.1_Missense_Mutation_p.W111R	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	111					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						TGTCCTGAACTGGGTACCTTT	0.438																																					p.W111R		Atlas-SNP	.											.	ATP10D	168	.	0			c.T331C						.						168.0	157.0	161.0					4																	47517533		2203	4300	6503	SO:0001583	missense	57205	exon3			CTGAACTGGGTAC	AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.331T>C	chr4.hg19:g.47517533T>C	ENSP00000273859:p.Trp111Arg	180.0	0.0		142.0	18.0	NM_020453	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	ENST00000273859.3	hg19	CCDS3476.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.371132	0.82573	.	.	ENSG00000145246	ENST00000273859;ENST00000504445	T;T	0.80566	-1.39;-1.39	5.38	5.38	0.77491	ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.88804	0.6536	M	0.74881	2.28	0.52099	D	0.999947	D;D	0.89917	0.994;1.0	P;D	0.74674	0.837;0.984	D	0.90062	0.4157	10	0.72032	D	0.01	-10.1816	14.5555	0.68097	0.0:0.0:0.0:1.0	.	111;111	Q9P241;Q6PEW3	AT10D_HUMAN;.	R	111	ENSP00000273859:W111R;ENSP00000420909:W111R	ENSP00000273859:W111R	W	+	1	0	ATP10D	47212290	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.671000	0.83941	2.032000	0.59987	0.533000	0.62120	TGG	.	.		0.438	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216900.1	NM_020453	
FRAS1	80144	hgsc.bcm.edu	37	4	79238646	79238646	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr4:79238646C>A	ENST00000325942.6	+	17	2384	c.1944C>A	c.(1942-1944)gaC>gaA	p.D648E	FRAS1_ENST00000264899.6_Missense_Mutation_p.D648E|FRAS1_ENST00000264895.6_Missense_Mutation_p.D648E	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	648					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						TCTACTCTGACCATGGAGTCT	0.512																																					p.D648E		Atlas-SNP	.											.	FRAS1	779	.	0			c.C1944A						.						67.0	71.0	70.0					4																	79238646		2024	4202	6226	SO:0001583	missense	80144	exon17			CTCTGACCATGGA	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.1944C>A	chr4.hg19:g.79238646C>A	ENSP00000326330:p.Asp648Glu	84.0	0.0		93.0	16.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	8.989|8.989|8.989	0.977324|0.977324|0.977324	0.18812|0.18812|0.18812	.|.|.	.|.|.	ENSG00000138759|ENSG00000138759|ENSG00000138759	ENST00000325942;ENST00000264895;ENST00000264899|ENST00000508900|ENST00000502446	T;T;T|.|.	0.76186|.|.	-1.0;-1.0;-1.0|.|.	5.71|5.71|5.71	-0.445|-0.445|-0.445	0.12242|0.12242|0.12242	Growth factor, receptor (1);|.|.	0.358875|.|.	0.31102|.|.	N|.|.	0.008242|.|.	T|T|T	0.36608|0.36608|0.36608	0.0973|0.0973|0.0973	L|L|L	0.57536|0.57536|0.57536	1.79|1.79|1.79	0.09310|0.09310|0.09310	N|N|N	0.999998|0.999998|0.999998	P;P;D;B|.|.	0.54772|.|.	0.781;0.781;0.968;0.434|.|.	P;P;P;B|.|.	0.52793|.|.	0.54;0.459;0.709;0.325|.|.	T|T|T	0.35375|0.35375|0.35375	-0.9791|-0.9791|-0.9791	10|5|5	0.48119|.|.	T|.|.	0.1|.|.	.|.|.	1.5182|1.5182|1.5182	0.02510|0.02510|0.02510	0.1444:0.2729:0.1416:0.4412|0.1444:0.2729:0.1416:0.4412|0.1444:0.2729:0.1416:0.4412	.|.|.	648;648;648;648|.|.	E9PHH6;Q86XX4;E7EWM9;A2RRR8|.|.	.;FRAS1_HUMAN;.;.|.|.	E|T|N	648|491|577	ENSP00000326330:D648E;ENSP00000264895:D648E;ENSP00000264899:D648E|.|.	ENSP00000264895:D648E|.|.	D|P|T	+|+|+	3|1|2	2|0|0	FRAS1|FRAS1|FRAS1	79457670|79457670|79457670	0.014000|0.014000|0.014000	0.17966|0.17966|0.17966	0.013000|0.013000|0.013000	0.15412|0.15412|0.15412	0.015000|0.015000|0.015000	0.08874|0.08874|0.08874	-0.286000|-0.286000|-0.286000	0.08399|0.08399|0.08399	0.063000|0.063000|0.063000	0.16370|0.16370|0.16370	0.561000|0.561000|0.561000	0.74099|0.74099|0.74099	GAC|CCA|ACC	.	.		0.512	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
SLC6A3	6531	hgsc.bcm.edu	37	5	1409893	1409893	+	Silent	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr5:1409893G>A	ENST00000270349.9	-	10	1468	c.1341C>T	c.(1339-1341)ctC>ctT	p.L447L	SLC6A3_ENST00000453492.2_Silent_p.L447L	NM_001044.4	NP_001035.1	Q01959	SC6A3_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 3	447					adenohypophysis development (GO:0021984)|aging (GO:0007568)|cation transmembrane transport (GO:0098655)|cell death (GO:0008219)|dopamine biosynthetic process (GO:0042416)|dopamine catabolic process (GO:0042420)|dopamine transport (GO:0015872)|lactation (GO:0007595)|locomotory behavior (GO:0007626)|monoamine transport (GO:0015844)|neurotransmitter biosynthetic process (GO:0042136)|positive regulation of multicellular organism growth (GO:0040018)|prepulse inhibition (GO:0060134)|regulation of dopamine metabolic process (GO:0042053)|response to cAMP (GO:0051591)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|sensory perception of smell (GO:0007608)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	axon (GO:0030424)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine transmembrane transporter activity (GO:0005329)|dopamine:sodium symporter activity (GO:0005330)|drug binding (GO:0008144)|monoamine transmembrane transporter activity (GO:0008504)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(19)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	38			OV - Ovarian serous cystadenocarcinoma(19;0.00928)|all cancers(22;0.0262)		Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Benzatropine(DB00245)|Benzphetamine(DB00865)|Bupropion(DB01156)|Chloroprocaine(DB01161)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Cocaine(DB00907)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Diethylpropion(DB00937)|Diphenylpyraline(DB01146)|Dopamine(DB00988)|Duloxetine(DB00476)|Ephedra(DB01363)|Escitalopram(DB01175)|Fencamfamine(DB01463)|Imipramine(DB00458)|Ioflupane I 123(DB08824)|Lisdexamfetamine(DB01255)|Loxapine(DB00408)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Mirtazapine(DB00370)|Modafinil(DB00745)|Nefazodone(DB01149)|Pethidine(DB00454)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Procaine(DB00721)|Pseudoephedrine(DB00852)|Sertraline(DB01104)|Sibutramine(DB01105)|Trimipramine(DB00726)|Venlafaxine(DB00285)	AGAGCGTGAAGAGCTCACGGT	0.592																																					p.L447L		Atlas-SNP	.											.	SLC6A3	102	.	0			c.C1341T						.						209.0	151.0	170.0					5																	1409893		2203	4300	6503	SO:0001819	synonymous_variant	6531	exon10			CGTGAAGAGCTCA		CCDS3863.1	5p15.3	2013-07-19	2013-07-19		ENSG00000142319	ENSG00000142319		"""Solute carriers"""	11049	protein-coding gene	gene with protein product	"""dopamine transporter"""	126455	"""solute carrier family 6 (neurotransmitter transporter, dopamine), member 3"", ""dopamine transporter 1"""	DAT1		1406597	Standard	NM_001044		Approved	DAT	uc003jck.3	Q01959	OTTHUMG00000131016	ENST00000270349.9:c.1341C>T	chr5.hg19:g.1409893G>A		169.0	0.0		198.0	35.0	NM_001044	A2RUN4|Q14996	Silent	SNP	ENST00000270349.9	hg19	CCDS3863.1																																																																																			.	.		0.592	SLC6A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253650.3	NM_001044	
PCDHGC5	56097	hgsc.bcm.edu	37	5	140869878	140869878	+	Silent	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr5:140869878C>T	ENST00000252087.1	+	1	1071	c.1071C>T	c.(1069-1071)aaC>aaT	p.N357N	PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGC4_ENST00000306593.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	357	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.N357K(2)		breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTTTGGCCAACCCTGTCCTAG	0.542																																					p.N357N		Atlas-SNP	.											PCDHGC5_ENST00000252087,NS,carcinoma,0,2	PCDHGC5	199	.	2	Substitution - Missense(2)	lung(2)	c.C1071T						.						93.0	94.0	93.0					5																	140869878		2203	4300	6503	SO:0001819	synonymous_variant	56097	exon1			GGCCAACCCTGTC	AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1071C>T	chr5.hg19:g.140869878C>T		138.0	0.0		151.0	37.0	NM_018929	Q9Y5C2	Silent	SNP	ENST00000252087.1	hg19	CCDS4263.1																																																																																			.	.		0.542	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251819.1	NM_018929	
RIMS2	9699	hgsc.bcm.edu	37	8	104897822	104897822	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr8:104897822G>T	ENST00000436393.2	+	2	570	c.329G>T	c.(328-330)cGc>cTc	p.R110L	RIMS2_ENST00000522174.1_3'UTR|RIMS2_ENST00000507740.1_Missense_Mutation_p.R140L|RIMS2_ENST00000262231.10_Missense_Mutation_p.R140L|RIMS2_ENST00000406091.3_Missense_Mutation_p.R332L			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	363	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.R140L(2)|p.R368L(1)|p.R110L(1)|p.R332L(1)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TACCAGTCACGCTACCGAAGT	0.463										HNSCC(12;0.0054)																											p.R332L		Atlas-SNP	.											RIMS2_ENST00000507740,NS,carcinoma,0,5	RIMS2	1357	.	5	Substitution - Missense(5)	lung(5)	c.G995T						.						97.0	96.0	96.0					8																	104897822		2029	4177	6206	SO:0001583	missense	9699	exon4			AGTCACGCTACCG	AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.329G>T	chr8.hg19:g.104897822G>T	ENSP00000390665:p.Arg110Leu	85.0	0.0		94.0	12.0	NM_001100117	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	ENST00000436393.2	hg19		.	.	.	.	.	.	.	.	.	.	G	28.1	4.889240	0.91889	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000515551;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95	5.32	5.32	0.75619	.	.	.	.	.	T	0.66954	0.2842	M	0.76574	2.34	0.80722	D	1	D;D;D;D;D	0.89917	0.998;0.994;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.99;0.988;0.999;0.997;0.999	T	0.70684	-0.4804	9	0.87932	D	0	.	18.9862	0.92771	0.0:0.0:1.0:0.0	.	363;110;140;140;332	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	L	332;363;332;363;140;140;140;140;110	ENSP00000427018:R332L;ENSP00000384892:R332L;ENSP00000425205:R140L;ENSP00000262231:R140L;ENSP00000423559:R140L;ENSP00000386228:R140L;ENSP00000390665:R110L	ENSP00000262231:R140L	R	+	2	0	RIMS2	104966998	1.000000	0.71417	0.999000	0.59377	0.981000	0.71138	9.615000	0.98356	2.479000	0.83701	0.467000	0.42956	CGC	.	.		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000367217.1	NM_001100117	
TEK	7010	hgsc.bcm.edu	37	9	27206595	27206595	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr9:27206595G>C	ENST00000380036.4	+	15	2822	c.2380G>C	c.(2380-2382)Gtg>Ctg	p.V794L	TEK_ENST00000519097.1_Missense_Mutation_p.V646L|TEK_ENST00000406359.4_Missense_Mutation_p.V751L	NM_000459.3	NP_000450	Q02763	TIE2_HUMAN	TEK tyrosine kinase, endothelial	794					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|definitive hemopoiesis (GO:0060216)|endochondral ossification (GO:0001958)|endothelial cell proliferation (GO:0001935)|glomerulus vasculature development (GO:0072012)|heart development (GO:0007507)|heart trabecula formation (GO:0060347)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of inflammatory response (GO:0050728)|organ regeneration (GO:0031100)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|protein autophosphorylation (GO:0046777)|protein oligomerization (GO:0051259)|regulation of endothelial cell apoptotic process (GO:2000351)|regulation of establishment or maintenance of cell polarity (GO:0032878)|regulation of vascular permeability (GO:0043114)|response to cAMP (GO:0051591)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|sprouting angiogenesis (GO:0002040)|substrate adhesion-dependent cell spreading (GO:0034446)|Tie signaling pathway (GO:0048014)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor activity (GO:0004872)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(3)|central_nervous_system(3)|kidney(1)|lung(2)|ovary(3)|skin(3)	15		all_neural(11;7.57e-10)|Myeloproliferative disorder(762;0.0255)		Lung(218;4.08e-05)|LUSC - Lung squamous cell carcinoma(38;0.00027)	Ponatinib(DB08901)|Regorafenib(DB08896)|Vandetanib(DB05294)	AGAACCAGCTGTGCAGTTCAA	0.408																																					p.V794L		Atlas-SNP	.											.	TEK	250	.	0			c.G2380C						.						57.0	57.0	57.0					9																	27206595		2203	4300	6503	SO:0001583	missense	7010	exon15			CCAGCTGTGCAGT	L06139	CCDS6519.1, CCDS75825.1	9p21	2013-02-11	2008-07-31		ENSG00000120156	ENSG00000120156		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	11724	protein-coding gene	gene with protein product		600221	"""venous malformations, multiple cutaneous and mucosal"""	VMCM		1312667, 7833915	Standard	XM_005251561		Approved	TIE2, TIE-2, VMCM1, CD202b	uc003zqi.4	Q02763	OTTHUMG00000019712	ENST00000380036.4:c.2380G>C	chr9.hg19:g.27206595G>C	ENSP00000369375:p.Val794Leu	101.0	0.0		109.0	12.0	NM_000459	A8K6W0|B4DH20|B4DHD3|D3DRK5|E7EWI2|Q5TCU2|Q8IV34	Missense_Mutation	SNP	ENST00000380036.4	hg19	CCDS6519.1	.	.	.	.	.	.	.	.	.	.	G	3.020	-0.202071	0.06219	.	.	ENSG00000120156	ENST00000519097;ENST00000380036;ENST00000406359	T;T;T	0.72615	-0.65;-0.66;-0.67	5.9	5.01	0.66863	.	0.000000	0.46145	D	0.000305	T	0.57198	0.2037	L	0.29908	0.895	0.49798	D	0.999821	B;B;B;B	0.21606	0.002;0.001;0.004;0.058	B;B;B;B	0.14578	0.002;0.007;0.007;0.011	T	0.54153	-0.8336	10	0.07813	T	0.8	.	16.8258	0.85930	0.0:0.2412:0.7588:0.0	.	646;827;751;794	E7EWI2;Q59HG2;B4DHD3;Q02763	.;.;.;TIE2_HUMAN	L	646;794;751	ENSP00000430686:V646L;ENSP00000369375:V794L;ENSP00000383977:V751L	ENSP00000369375:V794L	V	+	1	0	TEK	27196595	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.125000	0.57931	1.501000	0.48654	0.637000	0.83480	GTG	.	.		0.408	TEK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051965.3		
VPS13A	23230	hgsc.bcm.edu	37	9	79983032	79983032	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr9:79983032A>C	ENST00000360280.3	+	62	8793	c.8533A>C	c.(8533-8535)Ata>Cta	p.I2845L	VPS13A_ENST00000376634.4_Missense_Mutation_p.I2845L|VPS13A_ENST00000357409.5_Missense_Mutation_p.I2845L|VPS13A_ENST00000376636.3_Missense_Mutation_p.I2806L	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2845					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GTCTGAAGTCATAAGACACTA	0.338																																					p.I2845L		Atlas-SNP	.											.	VPS13A	735	.	0			c.A8533C						.						69.0	64.0	66.0					9																	79983032		2202	4295	6497	SO:0001583	missense	23230	exon62			GAAGTCATAAGAC	AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.8533A>C	chr9.hg19:g.79983032A>C	ENSP00000353422:p.Ile2845Leu	44.0	0.0		44.0	8.0	NM_001018038	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	ENST00000360280.3	hg19	CCDS6655.1	.	.	.	.	.	.	.	.	.	.	A	14.80	2.642606	0.47153	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16	5.93	-0.554	0.11811	.	0.257926	0.43747	D	0.000528	T	0.68412	0.2998	L	0.55834	1.745	0.80722	D	1	B;B;B;B	0.30455	0.029;0.28;0.239;0.121	B;B;B;B	0.29176	0.025;0.077;0.099;0.085	T	0.57271	-0.7840	9	.	.	.	.	11.5912	0.50947	0.6216:0.0:0.3784:0.0	.	2806;2845;2845;2845	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	L	2845;2806;2845;2845	ENSP00000365821:I2845L;ENSP00000365823:I2806L;ENSP00000353422:I2845L;ENSP00000349985:I2845L	.	I	+	1	0	VPS13A	79172852	0.616000	0.27035	0.986000	0.45419	0.907000	0.53573	0.238000	0.18004	-0.325000	0.08577	-0.375000	0.07067	ATA	.	.		0.338	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000052753.2	NM_015186	
MED27	9442	hgsc.bcm.edu	37	9	134738510	134738510	+	Silent	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr9:134738510G>A	ENST00000292035.5	-	7	804	c.741C>T	c.(739-741)acC>acT	p.T247T	MED27_ENST00000357028.2_Silent_p.T211T	NM_004269.3	NP_004260.2	Q6P2C8	MED27_HUMAN	mediator complex subunit 27	247					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(5)|skin(1)|urinary_tract(1)	18		Myeloproliferative disorder(178;0.206)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000193)		GCAGGGCAGTGGTGGCATGGT	0.532																																					p.T247T	Colon(41;784 923 6932 42329 52483)	Atlas-SNP	.											.	MED27	37	.	0			c.C741T						.						72.0	64.0	67.0					9																	134738510		2203	4300	6503	SO:0001819	synonymous_variant	9442	exon7			GGCAGTGGTGGCA	AF104252	CCDS6945.1, CCDS59153.1, CCDS69689.1	9q34.13	2008-02-05	2007-07-30	2007-07-30	ENSG00000160563	ENSG00000160563			2377	protein-coding gene	gene with protein product		605044	"""cofactor required for Sp1 transcriptional activation, subunit 8, 34kDa"""	CRSP8		9989412	Standard	NM_004269		Approved	TRAP37, CRSP34	uc004cbe.2	Q6P2C8	OTTHUMG00000020833	ENST00000292035.5:c.741C>T	chr9.hg19:g.134738510G>A		159.0	0.0		180.0	32.0	NM_004269	O95401|Q4F964|Q5VTA4|Q5VTA5|Q9BU57|Q9NYR4|V9GYV9	Silent	SNP	ENST00000292035.5	hg19	CCDS6945.1																																																																																			.	.		0.532	MED27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054770.2	NM_004269	
RPL7A	6130	hgsc.bcm.edu	37	9	136216457	136216457	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr9:136216457G>A	ENST00000323345.6	+	3	206	c.176G>A	c.(175-177)cGc>cAc	p.R59H	SNORD24_ENST00000383884.1_RNA|MED22_ENST00000476080.1_5'Flank|RPL7A_ENST00000315731.4_Silent_p.P3P|SNORD36C_ENST00000516733.1_RNA|RPL7A_ENST00000463740.1_3'UTR|SNORD36A_ENST00000362874.1_RNA|SURF1_ENST00000495952.1_5'Flank|MED22_ENST00000344469.5_5'Flank|MED22_ENST00000343730.5_5'Flank|SNORD36B_ENST00000363961.1_RNA|MED22_ENST00000491289.1_5'Flank|MED22_ENST00000371999.1_5'Flank|MED22_ENST00000471524.1_5'Flank	NM_000972.2	NP_000963.1	P62424	RL7A_HUMAN	ribosomal protein L7a	59					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosome biogenesis (GO:0042254)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(1)|lung(3)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(145;4.93e-07)|Epithelial(140;4.09e-06)|all cancers(34;3.78e-05)		AAATGGCCCCGCTATATCAGG	0.542																																					p.R59H		Atlas-SNP	.											.	RPL7A	9	.	0			c.G176A						.						47.0	51.0	49.0					9																	136216457		2203	4297	6500	SO:0001583	missense	6130	exon3			GGCCCCGCTATAT	BC005128	CCDS6965.1	9q34	2011-04-06			ENSG00000148303	ENSG00000148303		"""L ribosomal proteins"""	10364	protein-coding gene	gene with protein product	"""surfeit 3"", ""PLA-X polypeptide"", ""surfeit locus protein 3"", ""60S ribosomal protein L7a"", "";"", ""thyroid hormone receptor uncoupling protein"""	185640				2403926, 2966065	Standard	NM_000972		Approved	SURF3, TRUP, L7A	uc004cde.1	P62424	OTTHUMG00000020864	ENST00000323345.6:c.176G>A	chr9.hg19:g.136216457G>A	ENSP00000361076:p.Arg59His	112.0	0.0		170.0	43.0	NM_000972	P11518|Q5T8U4	Missense_Mutation	SNP	ENST00000323345.6	hg19	CCDS6965.1	.	.	.	.	.	.	.	.	.	.	G	4.509	0.094398	0.08632	.	.	ENSG00000148303	ENST00000323345;ENST00000426651	T;T	0.56444	0.46;0.84	4.03	3.12	0.35913	.	0.000000	0.85682	D	0.000000	T	0.33352	0.0860	N	0.12182	0.205	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.07501	-1.0769	10	0.40728	T	0.16	.	12.1047	0.53805	0.0:0.0:0.8272:0.1728	.	59	P62424	RL7A_HUMAN	H	59;86	ENSP00000361076:R59H;ENSP00000416638:R86H	ENSP00000361076:R59H	R	+	2	0	RPL7A	135206278	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	5.826000	0.69293	0.691000	0.31592	-0.823000	0.03104	CGC	.	.		0.542	RPL7A-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054869.1	NM_000972	
BICC1	80114	hgsc.bcm.edu	37	10	60573612	60573612	+	Missense_Mutation	SNP	G	G	C	rs111922761	byFrequency	TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr10:60573612G>C	ENST00000373886.3	+	18	2403	c.2399G>C	c.(2398-2400)cGg>cCg	p.R800P	BICC1_ENST00000263103.1_Missense_Mutation_p.R426P	NM_001080512.1	NP_001073981.1	Q9H694	BICC1_HUMAN	BicC family RNA binding protein 1	800					multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	44						TCCCTTTCACGGTCCAACAGT	0.458																																					p.R800P		Atlas-SNP	.											.	BICC1	121	.	0			c.G2399C						.						151.0	140.0	144.0					10																	60573612		2203	4300	6503	SO:0001583	missense	80114	exon18			TTTCACGGTCCAA	AK026129	CCDS31206.1	10q21.3	2014-09-17	2014-02-03		ENSG00000122870	ENSG00000122870		"""Sterile alpha motif (SAM) domain containing"""	19351	protein-coding gene	gene with protein product		614295	"""bicaudal C homolog 1 (Drosophila)"""				Standard	XM_005270166		Approved		uc001jki.1	Q9H694	OTTHUMG00000018271	ENST00000373886.3:c.2399G>C	chr10.hg19:g.60573612G>C	ENSP00000362993:p.Arg800Pro	199.0	0.0		248.0	45.0	NM_001080512		Missense_Mutation	SNP	ENST00000373886.3	hg19	CCDS31206.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337866	0.81911	.	.	ENSG00000122870	ENST00000373886;ENST00000263103	T;T	0.49139	1.6;0.79	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.64438	0.2598	L	0.50333	1.59	0.58432	D	0.999997	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.995	T	0.57670	-0.7771	10	0.33940	T	0.23	-16.3176	18.4528	0.90710	0.0:0.0:1.0:0.0	.	720;800	E7EU62;Q9H694	.;BICC1_HUMAN	P	800;426	ENSP00000362993:R800P;ENSP00000263103:R426P	ENSP00000263103:R426P	R	+	2	0	BICC1	60243618	1.000000	0.71417	0.973000	0.42090	0.778000	0.44026	9.313000	0.96297	2.793000	0.96121	0.563000	0.77884	CGG	.	G|0.992;A|0.008		0.458	BICC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048150.2	NM_025044	
OAT	4942	hgsc.bcm.edu	37	10	126089485	126089485	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr10:126089485C>T	ENST00000368845.5	-	9	1175	c.1083G>A	c.(1081-1083)atG>atA	p.M361I	OAT_ENST00000539214.1_Missense_Mutation_p.M223I|OAT_ENST00000467675.1_5'Flank	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	361					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	AAGGTAGCTTCATGAGTTCAT	0.313																																					p.M361I		Atlas-SNP	.											.	OAT	25	.	0			c.G1083A						.						90.0	83.0	86.0					10																	126089485		2203	4299	6502	SO:0001583	missense	4942	exon9			TAGCTTCATGAGT	BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.1083G>A	chr10.hg19:g.126089485C>T	ENSP00000357838:p.Met361Ile	118.0	0.0		144.0	31.0	NM_000274	D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Missense_Mutation	SNP	ENST00000368845.5	hg19	CCDS7639.1	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299342	0.40694	.	.	ENSG00000065154	ENST00000539214;ENST00000368845	D;D	0.85484	-1.99;-1.99	4.97	4.04	0.47022	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.194639	0.64402	D	0.000004	T	0.73659	0.3615	N	0.10972	0.075	0.36605	D	0.87488	B	0.10296	0.003	B	0.09377	0.004	T	0.72966	-0.4131	10	0.52906	T	0.07	-23.6061	15.9362	0.79712	0.0:0.8642:0.1358:0.0	.	361	P04181	OAT_HUMAN	I	223;361	ENSP00000439042:M223I;ENSP00000357838:M361I	ENSP00000357838:M361I	M	-	3	0	OAT	126079475	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.789000	0.38724	1.357000	0.45904	0.655000	0.94253	ATG	.	.		0.313	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050863.1	NM_000274	
CFAP46	54777	hgsc.bcm.edu	37	10	134731941	134731941	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr10:134731941C>A	ENST00000368586.5	-	16	2042	c.1942G>T	c.(1942-1944)Gac>Tac	p.D648Y	TTC40_ENST00000368582.2_Missense_Mutation_p.D648Y	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CGCAGCAGGTCGGGGCACACC	0.642																																					p.D648Y		Atlas-SNP	.											.	TTC40	100	.	0			c.G1942T						.																																			SO:0001583	missense	54777	exon16			GCAGGTCGGGGCA																												ENST00000368586.5:c.1942G>T	chr10.hg19:g.134731941C>A	ENSP00000357575:p.Asp648Tyr	225.0	0.0		217.0	50.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	8.828	0.939322	0.18281	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.50277	2.75;0.75	3.68	0.417	0.16421	.	.	.	.	.	T	0.39279	0.1072	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.41052	-0.9530	6	0.87932	D	0	.	2.21	0.03945	0.2429:0.429:0.0:0.328	.	.	.	.	Y	648	ENSP00000357575:D648Y;ENSP00000357571:D648Y	ENSP00000357571:D648Y	D	-	1	0	C10orf93	134581931	0.006000	0.16342	0.015000	0.15790	0.020000	0.10135	-0.002000	0.12924	-0.029000	0.13827	0.563000	0.77884	GAC	.	.		0.642	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
SYVN1	84447	hgsc.bcm.edu	37	11	64900425	64900425	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr11:64900425A>C	ENST00000377190.3	-	4	440	c.346T>G	c.(346-348)Ttc>Gtc	p.F116V	SYVN1_ENST00000307289.6_Missense_Mutation_p.F116V|SYVN1_ENST00000294256.8_Missense_Mutation_p.F116V|SYVN1_ENST00000526060.1_Missense_Mutation_p.F116V|SYVN1_ENST00000526121.1_5'Flank	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	116					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						AGCCAGTGGAAACATTTGAGG	0.557																																					p.F116V		Atlas-SNP	.											.	SYVN1	55	.	0			c.T346G						.						49.0	48.0	49.0					11																	64900425		2201	4297	6498	SO:0001583	missense	84447	exon4			AGTGGAAACATTT	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.346T>G	chr11.hg19:g.64900425A>C	ENSP00000366395:p.Phe116Val	154.0	0.0		176.0	28.0	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	hg19	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	A	23.2	4.384128	0.82792	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	T;T;T;T;T;T	0.68624	-0.34;-0.34;-0.34;-0.34;-0.34;-0.34	5.38	5.38	0.77491	.	0.059221	0.64402	N	0.000002	D	0.84329	0.5448	M	0.91612	3.225	0.80722	D	1	D;D;D	0.76494	0.999;0.997;0.998	D;D;D	0.74674	0.984;0.93;0.948	D	0.87353	0.2339	10	0.59425	D	0.04	-16.4399	13.3305	0.60483	1.0:0.0:0.0:0.0	.	116;116;116	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	V	116;116;116;116;116;56;101	ENSP00000366395:F116V;ENSP00000294256:F116V;ENSP00000302035:F116V;ENSP00000436984:F116V;ENSP00000431215:F56V;ENSP00000431720:F101V	ENSP00000294256:F116V	F	-	1	0	SYVN1	64657001	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	8.790000	0.91844	2.026000	0.59711	0.460000	0.39030	TTC	.	.		0.557	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
C11orf73	51501	hgsc.bcm.edu	37	11	86048470	86048470	+	Silent	SNP	A	A	G	rs376891384		TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr11:86048470A>G	ENST00000278483.3	+	3	544	c.318A>G	c.(316-318)ccA>ccG	p.P106P	C11orf73_ENST00000533986.1_Silent_p.P106P|C11orf73_ENST00000530208.1_3'UTR	NM_016401.3	NP_057485.2	Q53FT3	HIKES_HUMAN	chromosome 11 open reading frame 73	106					cellular response to heat (GO:0034605)|Golgi organization (GO:0007030)|lung development (GO:0030324)|protein import into nucleus (GO:0006606)|protein transport (GO:0015031)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	Hsp70 protein binding (GO:0030544)|protein transporter activity (GO:0008565)			kidney(1)|large_intestine(1)|urinary_tract(1)	3		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				TCCGAACTCCATCTGTTGCTC	0.403																																					p.P106P		Atlas-SNP	.											.	C11orf73	9	.	0			c.A318G						.	A		2,4402	4.2+/-10.8	0,2,2200	176.0	165.0	169.0		318	0.2	1.0	11		169	0,8598		0,0,4299	no	coding-synonymous	C11orf73	NM_016401.3		0,2,6499	GG,GA,AA		0.0,0.0454,0.0154		106/198	86048470	2,13000	2202	4299	6501	SO:0001819	synonymous_variant	51501	exon3			AACTCCATCTGTT	BC015991	CCDS8275.1	11q14.2	2013-03-12			ENSG00000149196	ENSG00000149196			26938	protein-coding gene	gene with protein product		614908				11042152, 22541429	Standard	NM_016401		Approved	HSPC138, HSPC179, Hikeshi, OPI10	uc001pbu.3	Q53FT3	OTTHUMG00000167212	ENST00000278483.3:c.318A>G	chr11.hg19:g.86048470A>G		132.0	0.0		155.0	35.0	NM_016401	Q8WVE8|Q9NVQ2|Q9NZZ1|Q9P022|Q9P0N1	Silent	SNP	ENST00000278483.3	hg19	CCDS8275.1																																																																																			.	.		0.403	C11orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393747.1	NM_016401	
TMEM218	219854	hgsc.bcm.edu	37	11	124971201	124971201	+	Splice_Site	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr11:124971201T>A	ENST00000279968.4	-	4	434		c.e4-2		TMEM218_ENST00000529583.1_Splice_Site|TMEM218_ENST00000531909.1_Splice_Site|TMEM218_ENST00000527271.1_Splice_Site|TMEM218_ENST00000526175.1_Splice_Site|TMEM218_ENST00000527766.1_Splice_Site|TMEM218_ENST00000455225.1_Splice_Site|TMEM218_ENST00000532407.1_Splice_Site|TMEM218_ENST00000528724.1_Splice_Site|TMEM218_ENST00000531262.1_Splice_Site|TMEM218_ENST00000529609.1_Intron|TMEM218_ENST00000532156.1_Intron			A2RU14	TM218_HUMAN	transmembrane protein 218							integral component of membrane (GO:0016021)				breast(1)|large_intestine(2)|lung(1)|prostate(1)	5						ACAGAGAACCTGGGGTTAAAA	0.408																																					.		Atlas-SNP	.											.	TMEM218	14	.	0			c.216-2A>T						.						50.0	47.0	48.0					11																	124971201		2201	4299	6500	SO:0001630	splice_region_variant	219854	exon5			AGAACCTGGGGTT		CCDS31715.1	11q24.2	2008-08-08			ENSG00000150433	ENSG00000150433			27344	protein-coding gene	gene with protein product							Standard	NM_001258238		Approved		uc031qeu.1	A2RU14		ENST00000279968.4:c.111-2A>T	chr11.hg19:g.124971201T>A		38.0	0.0		33.0	9.0	NM_001258242	B7ZM48	Splice_Site	SNP	ENST00000279968.4	hg19	CCDS31715.1	.	.	.	.	.	.	.	.	.	.	T	17.63	3.436543	0.62955	.	.	ENSG00000150433	ENST00000455225;ENST00000531909;ENST00000528724;ENST00000532407;ENST00000279968;ENST00000526175;ENST00000527766;ENST00000529583;ENST00000527271;ENST00000524373;ENST00000533273;ENST00000529530	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1434	0.59448	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TMEM218	124476411	1.000000	0.71417	0.996000	0.52242	0.849000	0.48306	4.489000	0.60309	2.072000	0.62099	0.533000	0.62120	.	.	.		0.408	TMEM218-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000386849.1	NM_001080546	Intron
TMTC1	83857	hgsc.bcm.edu	37	12	29920979	29920979	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr12:29920979G>A	ENST00000539277.1	-	2	390	c.332C>T	c.(331-333)cCa>cTa	p.P111L	TMTC1_ENST00000552618.1_Missense_Mutation_p.P111L|TMTC1_ENST00000551659.1_Missense_Mutation_p.P111L|TMTC1_ENST00000381224.2_Missense_Mutation_p.P3L|TMTC1_ENST00000256062.5_Missense_Mutation_p.P3L	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	111						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					AAAGTAGAATGGGTTCATACC	0.343																																					p.P111L		Atlas-SNP	.											.	TMTC1	147	.	0			c.C332T						.						58.0	53.0	55.0					12																	29920979		2203	4300	6503	SO:0001583	missense	83857	exon2			TAGAATGGGTTCA		CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.332C>T	chr12.hg19:g.29920979G>A	ENSP00000442046:p.Pro111Leu	77.0	0.0		80.0	11.0	NM_001193451	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	ENST00000539277.1	hg19	CCDS53772.1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.787163	0.90367	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	D;D;D;D;T	0.94232	-2.12;-3.38;-3.38;-3.38;-0.27	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.96713	0.8927	M	0.84585	2.705	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.70935	0.971;0.847	D	0.96817	0.9601	9	.	.	.	-13.9925	15.7586	0.78058	0.0:0.0:1.0:0.0	.	3;111	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	L	3;111;111;111;3	ENSP00000256062:P3L;ENSP00000448112:P111L;ENSP00000449043:P111L;ENSP00000442046:P111L;ENSP00000370622:P3L	.	P	-	2	0	TMTC1	29812246	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.122000	0.89584	2.500000	0.84329	0.655000	0.94253	CCA	.	.		0.343	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000403509.1	NM_031920	
DTX3	196403	hgsc.bcm.edu	37	12	58001298	58001298	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr12:58001298C>T	ENST00000548198.1	+	3	2156	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	DTX3_ENST00000551632.1_Missense_Mutation_p.R221W|ARHGEF25_ENST00000333972.7_5'Flank|DTX3_ENST00000548804.1_Missense_Mutation_p.R218W|DTX3_ENST00000337737.3_Missense_Mutation_p.R218W			Q8N9I9	DTX3_HUMAN	deltex 3, E3 ubiquitin ligase	218					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(6)|urinary_tract(1)	12	Melanoma(17;0.122)					CCAGAATGGGCGGATGCTGGT	0.632																																					p.R218W		Atlas-SNP	.											.	DTX3	27	.	0			c.C652T						.						49.0	53.0	52.0					12																	58001298		1967	4136	6103	SO:0001583	missense	196403	exon5			AATGGGCGGATGC	AK094385	CCDS41800.1, CCDS66410.1	12q13.2	2014-01-28	2014-01-28			ENSG00000178498		"""RING-type (C3HC4) zinc fingers"""	24457	protein-coding gene	gene with protein product		613142	"""deltex 3 homolog (Drosophila)"", ""deltex homolog 3 (Drosophila)"""			12670957	Standard	XM_005268697		Approved	FLJ34766, RNF154	uc001sow.1	Q8N9I9		ENST00000548198.1:c.652C>T	chr12.hg19:g.58001298C>T	ENSP00000447873:p.Arg218Trp	249.0	0.0		407.0	63.0	NM_178502	Q53ZZ2|Q8NAU6|Q8NDS8	Missense_Mutation	SNP	ENST00000548198.1	hg19	CCDS41800.1	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321079	0.60634	.	.	ENSG00000178498	ENST00000548804;ENST00000337737;ENST00000548198;ENST00000551632;ENST00000550300	T;T;T;T;T	0.50548	1.91;1.91;1.91;1.91;0.74	4.29	2.27	0.28462	.	0.288167	0.29814	N	0.011127	T	0.59321	0.2185	L	0.60455	1.87	0.36011	D	0.83809	D	0.76494	0.999	D	0.65684	0.937	T	0.68473	-0.5399	10	0.72032	D	0.01	-11.1105	10.6065	0.45398	0.4482:0.5518:0.0:0.0	.	218	Q8N9I9	DTX3_HUMAN	W	218;218;218;221;6	ENSP00000449294:R218W;ENSP00000338050:R218W;ENSP00000447873:R218W;ENSP00000448696:R221W;ENSP00000446996:R6W	ENSP00000338050:R218W	R	+	1	2	DTX3	56287565	0.352000	0.24895	1.000000	0.80357	0.998000	0.95712	0.576000	0.23744	0.904000	0.36572	0.561000	0.74099	CGG	.	.		0.632	DTX3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000407848.1	NM_178502	
ANO4	121601	hgsc.bcm.edu	37	12	101490394	101490394	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr12:101490394T>A	ENST00000392977.3	+	19	2029	c.1819T>A	c.(1819-1821)Tcc>Acc	p.S607T	ANO4_ENST00000299222.9_Missense_Mutation_p.S127T|ANO4_ENST00000392979.3_Missense_Mutation_p.S572T|ANO4_ENST00000550015.1_Missense_Mutation_p.S127T			Q32M45	ANO4_HUMAN	anoctamin 4	607					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TCTGAACAGCTCCACATTTTA	0.493										HNSCC(74;0.22)																											p.S572T		Atlas-SNP	.											.	ANO4	183	.	0			c.T1714A						.						130.0	117.0	121.0					12																	101490394		2203	4300	6503	SO:0001583	missense	121601	exon18			AACAGCTCCACAT	AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1819T>A	chr12.hg19:g.101490394T>A	ENSP00000376703:p.Ser607Thr	127.0	0.0		172.0	23.0	NM_178826	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	ENST00000392977.3	hg19		.	.	.	.	.	.	.	.	.	.	T	29.9	5.045246	0.93685	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.83792	0.5331	M	0.86953	2.85	0.80722	D	1	D;D;D	0.71674	0.992;0.998;0.997	P;D;D	0.76071	0.832;0.987;0.978	D	0.85858	0.1408	10	0.52906	T	0.07	.	15.773	0.78187	0.0:0.0:0.0:1.0	.	127;607;572	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	T	572;127;607;127	ENSP00000376705:S572T;ENSP00000299222:S127T;ENSP00000376703:S607T;ENSP00000450192:S127T	ENSP00000299222:S127T	S	+	1	0	ANO4	100014525	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.015000	0.88690	2.207000	0.71202	0.460000	0.39030	TCC	.	.		0.493	ANO4-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000409295.1	NM_178826	
DUOX2	50506	hgsc.bcm.edu	37	15	45391660	45391660	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr15:45391660C>T	ENST00000603300.1	-	26	3638	c.3436G>A	c.(3436-3438)Gca>Aca	p.A1146T	DUOX2_ENST00000389039.6_Missense_Mutation_p.A1146T	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1146	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		ACATTGACTGCGTGGCCAGCA	0.537																																					p.A1146T		Atlas-SNP	.											.	DUOX2	137	.	0			c.G3436A						.						78.0	63.0	68.0					15																	45391660		2198	4298	6496	SO:0001583	missense	50506	exon26			TGACTGCGTGGCC	AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3436G>A	chr15.hg19:g.45391660C>T	ENSP00000475084:p.Ala1146Thr	81.0	0.0		92.0	16.0	NM_014080	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	ENST00000603300.1	hg19	CCDS10117.1	.	.	.	.	.	.	.	.	.	.	C	13.76	2.332291	0.41297	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.44	5.44	0.79542	Flavoprotein transmembrane component (1);	0.431830	0.25695	N	0.028918	T	0.25158	0.0611	L	0.31926	0.97	0.09310	N	1	B	0.32203	0.36	B	0.29862	0.108	T	0.20571	-1.0271	9	0.52906	T	0.07	-1.6056	7.0218	0.24918	0.2895:0.63:0.0:0.0806	.	1146	Q9NRD8	DUOX2_HUMAN	T	1146	.	ENSP00000373691:A1146T	A	-	1	0	DUOX2	43178952	0.001000	0.12720	0.336000	0.25522	0.590000	0.36582	0.892000	0.28322	2.561000	0.86390	0.563000	0.77884	GCA	.	.		0.537	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_014080	
TSC2	7249	hgsc.bcm.edu	37	16	2134406	2134406	+	Nonsense_Mutation	SNP	C	C	T	rs397514935		TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr16:2134406C>T	ENST00000219476.3	+	34	4813	c.4183C>T	c.(4183-4185)Cag>Tag	p.Q1395*	TSC2_ENST00000439673.2_Nonsense_Mutation_p.Q1292*|TSC2_ENST00000401874.2_Nonsense_Mutation_p.Q1328*|TSC2_ENST00000350773.4_Nonsense_Mutation_p.Q1372*|TSC2_ENST00000353929.4_Nonsense_Mutation_p.Q1352*|TSC2_ENST00000568454.1_Nonsense_Mutation_p.Q1339*|TSC2_ENST00000382538.6_Nonsense_Mutation_p.Q1280*	NM_000548.3	NP_000539.2	P49815	TSC2_HUMAN	tuberous sclerosis 2	1395					acute-phase response (GO:0006953)|cell cycle arrest (GO:0007050)|cell projection organization (GO:0030030)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of Ras GTPase activity (GO:0032320)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein import into nucleus (GO:0006606)|protein kinase B signaling (GO:0043491)|protein localization (GO:0008104)|regulation of cell cycle (GO:0051726)|regulation of endocytosis (GO:0030100)|regulation of insulin receptor signaling pathway (GO:0046626)|response to hypoxia (GO:0001666)|vesicle-mediated transport (GO:0016192)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|TSC1-TSC2 complex (GO:0033596)	GTPase activator activity (GO:0005096)|phosphatase binding (GO:0019902)|protein homodimerization activity (GO:0042803)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(3)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(7)|soft_tissue(1)	56		Hepatocellular(780;0.0202)				GCAGACTCTGCAGGACATCCT	0.677			"""D, Mis, N, F, S"""			"""hamartoma, renal cell"""			Tuberous Sclerosis																												p.Q1395X		Atlas-SNP	.	yes	Rec		Tuberous sclerosis 2	16	16p13.3	7249	tuberous sclerosis 2 gene		"""E, O"""	.	TSC2	364	.	0			c.C4183T						.						31.0	32.0	31.0					16																	2134406		2188	4297	6485	SO:0001587	stop_gained	7249	exon34	Familial Cancer Database	TS, Tuberous Sclerosis Complex, TSC, Bourneville-Pringle disease	ACTCTGCAGGACA	AB014460	CCDS10458.1, CCDS45384.1, CCDS58408.1	16p13.3	2014-09-17			ENSG00000103197	ENSG00000103197			12363	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 160"""	191092		TSC4		1303246, 7558029	Standard	NM_001077183		Approved	tuberin, LAM, PPP1R160	uc002con.3	P49815	OTTHUMG00000128745	ENST00000219476.3:c.4183C>T	chr16.hg19:g.2134406C>T	ENSP00000219476:p.Gln1395*	84.0	0.0		60.0	14.0	NM_000548	A7E2E2|B4DIL8|B4DIQ7|B4DRN2|B7Z2B8|C9J378|O75275|Q4LE71|Q8TAZ1	Nonsense_Mutation	SNP	ENST00000219476.3	hg19	CCDS10458.1	.	.	.	.	.	.	.	.	.	.	C	42	9.275497	0.99122	.	.	ENSG00000103197	ENST00000219476;ENST00000401874;ENST00000353929;ENST00000439673;ENST00000382538;ENST00000350773	.	.	.	5.03	5.03	0.67393	.	0.076992	0.56097	D	0.000036	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-24.6107	18.3399	0.90302	0.0:1.0:0.0:0.0	.	.	.	.	X	1395;1329;1352;1292;1280;1372	.	ENSP00000219476:Q1395X	Q	+	1	0	TSC2	2074407	1.000000	0.71417	0.984000	0.44739	0.400000	0.30750	7.328000	0.79160	2.350000	0.79820	0.484000	0.47621	CAG	.	.		0.677	TSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000250657.2	NM_000548	
SEZ6L2	26470	hgsc.bcm.edu	37	16	29889651	29889651	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr16:29889651C>T	ENST00000308713.5	-	10	2196	c.1669G>A	c.(1669-1671)Gtg>Atg	p.V557M	SEZ6L2_ENST00000537485.1_Missense_Mutation_p.V513M|SEZ6L2_ENST00000346932.5_Missense_Mutation_p.V443M|SEZ6L2_ENST00000350527.3_Missense_Mutation_p.V487M	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	557	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TGGACGTGCACGCCCCACACG	0.607																																					p.V557M		Atlas-SNP	.											.	SEZ6L2	137	.	0			c.G1669A						.						130.0	102.0	111.0					16																	29889651		2197	4300	6497	SO:0001583	missense	26470	exon10			CGTGCACGCCCCA	AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.1669G>A	chr16.hg19:g.29889651C>T	ENSP00000312550:p.Val557Met	120.0	0.0		125.0	34.0	NM_001243332	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Missense_Mutation	SNP	ENST00000308713.5	hg19	CCDS10659.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.046680	0.93740	.	.	ENSG00000174938	ENST00000350527;ENST00000308713;ENST00000346932;ENST00000537485	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.42	4.45	0.53987	CUB (5);	0.160446	0.29417	N	0.012211	T	0.32971	0.0847	M	0.76727	2.345	0.09310	N	0.999992	P;P;P;P;P;P	0.52170	0.932;0.728;0.709;0.938;0.914;0.951	B;B;B;B;B;B	0.40659	0.284;0.336;0.128;0.258;0.267;0.326	T	0.36529	-0.9744	10	0.87932	D	0	.	9.049	0.36365	0.0:0.1349:0.457:0.4081	.	513;557;443;487;557;487	F5H293;B7Z5L4;Q9BW82;Q6UXD5-2;Q6UXD5;Q6UXD5-3	.;.;.;.;SE6L2_HUMAN;.	M	487;557;443;513	ENSP00000310206:V487M;ENSP00000312550:V557M;ENSP00000319215:V443M;ENSP00000439412:V513M	ENSP00000312550:V557M	V	-	1	0	SEZ6L2	29797152	0.995000	0.38212	0.997000	0.53966	0.851000	0.48451	0.679000	0.25291	0.660000	0.30964	-0.120000	0.15030	GTG	.	.		0.607	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255154.2	NM_012410	
RBL2	5934	hgsc.bcm.edu	37	16	53524210	53524210	+	Nonstop_Mutation	SNP	T	T	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr16:53524210T>C	ENST00000262133.6	+	22	3555	c.3418T>C	c.(3418-3420)Tga>Cga	p.*1140R	RBL2_ENST00000379935.4_3'UTR|RBL2_ENST00000544545.1_Nonstop_Mutation_p.*519R	NM_005611.3	NP_005602.3	Q08999	RBL2_HUMAN	retinoblastoma-like 2	0					chromatin modification (GO:0016568)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of lipid kinase activity (GO:0043550)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						TGGTTCCCACTGAGGTTAGTC	0.408																																					p.X1140R		Atlas-SNP	.											.	RBL2	115	.	0			c.T3418C						.						99.0	96.0	97.0					16																	53524210		2198	4300	6498	SO:0001578	stop_lost	5934	exon22			TCCCACTGAGGTT	X74594	CCDS10748.1	16q12.2	2014-03-11	2014-03-11		ENSG00000103479	ENSG00000103479			9894	protein-coding gene	gene with protein product		180203				8361765, 8643454	Standard	NM_005611		Approved	Rb2, p130	uc002ehi.4	Q08999	OTTHUMG00000133198	ENST00000262133.6:c.3418T>C	chr16.hg19:g.53524210T>C	ENSP00000262133:p.*1140Argext*2	115.0	0.0		106.0	23.0	NM_005611	B7Z913|Q15073|Q16084|Q8NE70|Q92812	Missense_Mutation	SNP	ENST00000262133.6	hg19	CCDS10748.1	.	.	.	.	.	.	.	.	.	.	T	19.52	3.843610	0.71488	.	.	ENSG00000103479	ENST00000262133;ENST00000379935;ENST00000544545	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3113	0.74035	0.0:0.0:0.0:1.0	.	.	.	.	R	1140;850;519	.	.	X	+	1	0	RBL2	52081711	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.806000	0.75195	2.263000	0.75096	0.533000	0.62120	TGA	.	.		0.408	RBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256908.3	NM_005611	
PPAP2C	8612	hgsc.bcm.edu	37	19	288111	288111	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:288111C>T	ENST00000269812.3	-	2	162	c.113G>A	c.(112-114)tGc>tAc	p.C38Y	PPAP2C_ENST00000434325.2_5'UTR|PPAP2C_ENST00000327790.3_Missense_Mutation_p.C59Y	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	38					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTCATCCCCGCAGTAAAATCC	0.602																																					p.C59Y		Atlas-SNP	.											.	PPAP2C	38	.	0			c.G176A						.						158.0	124.0	135.0					19																	288111		2203	4300	6503	SO:0001583	missense	8612	exon2			TCCCCGCAGTAAA	AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.113G>A	chr19.hg19:g.288111C>T	ENSP00000269812:p.Cys38Tyr	245.0	0.0		272.0	38.0	NM_177543	A6NLV0|E9PAY8	Missense_Mutation	SNP	ENST00000269812.3	hg19	CCDS12023.1	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019691	0.54576	.	.	ENSG00000141934	ENST00000269812;ENST00000327790	T;T	0.74526	-0.85;-0.85	4.7	4.7	0.59300	.	0.054186	0.85682	D	0.000000	D	0.88930	0.6571	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.991	D	0.91643	0.5328	10	0.87932	D	0	-1.2756	16.6041	0.84824	0.0:1.0:0.0:0.0	.	38;59	O43688;O43688-2	LPP2_HUMAN;.	Y	38;59	ENSP00000269812:C38Y;ENSP00000329697:C59Y	ENSP00000269812:C38Y	C	-	2	0	PPAP2C	239111	1.000000	0.71417	0.778000	0.31720	0.050000	0.14768	7.105000	0.77031	2.335000	0.79485	0.650000	0.86243	TGC	.	.		0.602	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451777.2		
ZBTB7A	51341	hgsc.bcm.edu	37	19	4055085	4055085	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:4055085C>T	ENST00000322357.4	-	2	424	c.146G>A	c.(145-147)cGc>cAc	p.R49H	ZBTB7A_ENST00000601588.1_Missense_Mutation_p.R49H	NM_015898.2	NP_056982.1	O95365	ZBT7A_HUMAN	zinc finger and BTB domain containing 7A	49	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	14		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.014)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCACCGAGCGGTGCGTGGG	0.657																																					p.R49H		Atlas-SNP	.											ZBTB7A,NS,carcinoma,0,1	ZBTB7A	35	.	0			c.G146A						.						41.0	43.0	42.0					19																	4055085		2201	4299	6500	SO:0001583	missense	51341	exon2			ACCGAGCGGTGCG	AF000561	CCDS12119.1	19p13.3	2013-01-08		2005-04-07		ENSG00000178951		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	18078	protein-coding gene	gene with protein product	"""zinc finger and BTB domain containing 7A, HIV-1 inducer of short transcripts binding protein"", ""lymphoma related factor"""	605878	"""zinc finger and BTB domain containing 7"""	ZBTB7		9973611, 9927193	Standard	NM_015898		Approved	FBI-1, LRF, DKFZp547O146, pokemon, ZNF857A	uc002lzi.3	O95365		ENST00000322357.4:c.146G>A	chr19.hg19:g.4055085C>T	ENSP00000323670:p.Arg49His	28.0	0.0		9.0	3.0	NM_015898	D6W619|O00456|Q14D41|Q5XG86	Missense_Mutation	SNP	ENST00000322357.4	hg19	CCDS12119.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.309759	0.81247	.	.	ENSG00000178951	ENST00000322357	T	0.75367	-0.93	4.79	4.79	0.61399	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.91932	0.7445	H	0.98738	4.315	0.52501	D	0.999956	D	0.89917	1.0	D	0.80764	0.994	D	0.95394	0.8484	10	0.87932	D	0	.	16.794	0.85597	0.0:1.0:0.0:0.0	.	49	O95365	ZBT7A_HUMAN	H	49	ENSP00000323670:R49H	ENSP00000323670:R49H	R	-	2	0	ZBTB7A	4006085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.760000	0.62235	2.202000	0.70862	0.462000	0.41574	CGC	.	.		0.657	ZBTB7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457621.2	NM_015898	
OR10H1	26539	hgsc.bcm.edu	37	19	15917988	15917988	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:15917988C>T	ENST00000334920.2	-	1	948	c.860G>A	c.(859-861)aGc>aAc	p.S287N		NM_013940.2	NP_039228.1	Q9Y4A9	O10H1_HUMAN	olfactory receptor, family 10, subfamily H, member 1	287						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(8)|ovary(4)|skin(2)|urinary_tract(1)	29						GATGATGGGGCTGAGGAAGGG	0.502																																					p.S287N		Atlas-SNP	.											.	OR10H1	59	.	0			c.G860A						.						82.0	70.0	74.0					19																	15917988		2203	4297	6500	SO:0001583	missense	26539	exon1			ATGGGGCTGAGGA	AC004510	CCDS12335.1	19p13.1	2012-08-09				ENSG00000186723		"""GPCR / Class A : Olfactory receptors"""	8172	protein-coding gene	gene with protein product							Standard	NM_013940		Approved		uc002nbq.2	Q9Y4A9		ENST00000334920.2:c.860G>A	chr19.hg19:g.15917988C>T	ENSP00000335596:p.Ser287Asn	304.0	0.0		310.0	54.0	NM_013940	Q6IFQ2|Q96R59	Missense_Mutation	SNP	ENST00000334920.2	hg19	CCDS12335.1	.	.	.	.	.	.	.	.	.	.	.	9.595	1.127093	0.20959	.	.	ENSG00000186723	ENST00000334920	T	0.19532	2.14	5.06	5.06	0.68205	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000012	T	0.08935	0.0221	N	0.00109	-2.105	0.35034	D	0.75906	D	0.89917	1.0	D	0.91635	0.999	T	0.46871	-0.9160	10	0.02654	T	1	.	9.5425	0.39260	0.0:0.9034:0.0:0.0966	.	287	Q9Y4A9	O10H1_HUMAN	N	287	ENSP00000335596:S287N	ENSP00000335596:S287N	S	-	2	0	OR10H1	15778988	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.321000	0.65846	2.346000	0.79739	0.643000	0.83706	AGC	.	.		0.502	OR10H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000460364.1		
ZNF529	57711	hgsc.bcm.edu	37	19	37045633	37045633	+	Silent	SNP	A	A	G			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:37045633A>G	ENST00000591340.1	-	4	332	c.174T>C	c.(172-174)tcT>tcC	p.S58S	ZNF529_ENST00000334116.7_5'UTR	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					TCCTCTGAGCAGAATCCAGAT	0.408																																					p.S58S		Atlas-SNP	.											.	ZNF529	82	.	0			c.T174C						.						119.0	105.0	110.0					19																	37045633		692	1591	2283	SO:0001819	synonymous_variant	57711	exon5			CTGAGCAGAATCC	AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.174T>C	chr19.hg19:g.37045633A>G		146.0	0.0		148.0	35.0	NM_001145649	K7EKE1|Q9H731|Q9HCF7	Silent	SNP	ENST00000591340.1	hg19	CCDS54256.1																																																																																			.	.		0.408	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452730.1	NM_020951	
ZNF780B	163131	hgsc.bcm.edu	37	19	40540905	40540905	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:40540905C>T	ENST00000434248.1	-	5	1926	c.1861G>A	c.(1861-1863)Gcc>Acc	p.A621T	ZNF780B_ENST00000221355.6_Missense_Mutation_p.A473T	NM_001005851.2	NP_001005851.1	Q9Y6R6	Z780B_HUMAN	zinc finger protein 780B	621					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	23	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					AGACTGAAGGCCTTGCCACAT	0.413																																					p.A621T		Atlas-SNP	.											.	ZNF780B	143	.	0			c.G1861A						.						116.0	122.0	120.0					19																	40540905		2203	4300	6503	SO:0001583	missense	163131	exon5			TGAAGGCCTTGCC	AK127063	CCDS46077.1	19q13.2	2013-01-08	2006-08-15	2006-08-15	ENSG00000128000	ENSG00000128000		"""Zinc fingers, C2H2-type"", ""-"""	33109	protein-coding gene	gene with protein product			"""zinc finger protein 779"""	ZNF779			Standard	NM_001005851		Approved		uc002omu.3	Q9Y6R6	OTTHUMG00000155118	ENST00000434248.1:c.1861G>A	chr19.hg19:g.40540905C>T	ENSP00000391641:p.Ala621Thr	134.0	0.0		144.0	26.0	NM_001005851	B9EH00	Missense_Mutation	SNP	ENST00000434248.1	hg19	CCDS46077.1	.	.	.	.	.	.	.	.	.	.	c	13.68	2.308746	0.40895	.	.	ENSG00000128000	ENST00000434248;ENST00000221355	T;T	0.16897	2.31;2.31	2.56	2.56	0.30785	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.18882	0.0453	N	0.12502	0.225	0.22489	N	0.999058	D	0.89917	1.0	D	0.91635	0.999	T	0.12863	-1.0531	9	0.33940	T	0.23	.	5.1106	0.14808	0.0:0.83:0.0:0.17	.	621	Q9Y6R6	Z780B_HUMAN	T	621;473	ENSP00000391641:A621T;ENSP00000221355:A473T	ENSP00000221355:A473T	A	-	1	0	ZNF780B	45232745	0.000000	0.05858	0.323000	0.25347	0.505000	0.33919	-0.732000	0.04904	1.259000	0.44117	0.462000	0.41574	GCC	.	.		0.413	ZNF780B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338466.1	NM_001005851	
NLRP7	199713	hgsc.bcm.edu	37	19	55450802	55450802	+	Missense_Mutation	SNP	C	C	T	rs146205567		TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:55450802C>T	ENST00000590030.1	-	3	1425	c.1385G>A	c.(1384-1386)gGc>gAc	p.G462D	NLRP7_ENST00000446217.1_Missense_Mutation_p.G490D|NLRP7_ENST00000592784.1_Missense_Mutation_p.G462D|NLRP7_ENST00000448121.2_Missense_Mutation_p.G462D|NLRP7_ENST00000588756.1_Missense_Mutation_p.G462D|NLRP7_ENST00000340844.2_Missense_Mutation_p.G462D|NLRP7_ENST00000328092.5_Missense_Mutation_p.G462D			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	462	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.						ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		GGAGTAGCAGCCTTTGGAGAC	0.622																																					p.G462D		Atlas-SNP	.											.	NLRP7	411	.	0			c.G1385A						.						37.0	36.0	36.0					19																	55450802		2203	4297	6500	SO:0001583	missense	199713	exon4			TAGCAGCCTTTGG	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1385G>A	chr19.hg19:g.55450802C>T	ENSP00000465520:p.Gly462Asp	162.0	0.0		220.0	29.0	NM_001127255	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	hg19	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	7.834	0.720554	0.15372	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217;ENST00000399724	T;T;T;T	0.73897	-0.73;-0.73;-0.79;-0.76	1.81	-1.81	0.07882	.	0.517197	0.14640	N	0.307281	T	0.47414	0.1444	N	0.12182	0.205	0.18873	N	0.999983	B;B;B;B	0.29301	0.156;0.092;0.156;0.241	B;B;B;B	0.34242	0.06;0.086;0.086;0.178	T	0.40627	-0.9553	10	0.11182	T	0.66	.	2.718	0.05193	0.0:0.3924:0.2553:0.3522	.	490;462;462;462	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	D	462;462;462;490;229	ENSP00000329568:G462D;ENSP00000409137:G462D;ENSP00000339491:G462D;ENSP00000414273:G490D	ENSP00000329568:G462D	G	-	2	0	NLRP7	60142614	0.005000	0.15991	0.042000	0.18584	0.110000	0.19582	0.000000	0.12993	-0.426000	0.07360	-0.448000	0.05591	GGC	.	C|1.000;A|0.000		0.622	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
ZNF446	55663	hgsc.bcm.edu	37	19	58991841	58991841	+	Silent	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr19:58991841C>T	ENST00000594369.1	+	7	1482	c.1101C>T	c.(1099-1101)acC>acT	p.T367T	ZNF446_ENST00000335841.4_3'UTR|ZNF446_ENST00000596341.1_Silent_p.T316T	NM_017908.2	NP_060378.1	Q9NWS9	ZN446_HUMAN	zinc finger protein 446	367					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	8		all_cancers(17;1.81e-17)|all_epithelial(17;1.21e-12)|Lung NSC(17;2.8e-05)|all_lung(17;0.000139)|Colorectal(82;0.000147)|Renal(17;0.00528)|all_neural(62;0.0133)|Ovarian(87;0.156)|Medulloblastoma(540;0.232)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0164)|Lung(386;0.179)		GGCTAGCCACCGGGGAAAGCA	0.662																																					p.T367T		Atlas-SNP	.											.	ZNF446	22	.	0			c.C1101T						.						27.0	28.0	28.0					19																	58991841		2202	4300	6502	SO:0001819	synonymous_variant	55663	exon7			AGCCACCGGGGAA		CCDS12982.1	19q13.43	2013-01-09				ENSG00000083838		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	21036	protein-coding gene	gene with protein product							Standard	NM_017908		Approved	ZKSCAN20, FLJ20626, ZSCAN52	uc002qsz.3	Q9NWS9		ENST00000594369.1:c.1101C>T	chr19.hg19:g.58991841C>T		123.0	0.0		92.0	4.0	NM_017908		Silent	SNP	ENST00000594369.1	hg19	CCDS12982.1																																																																																			.	.		0.662	ZNF446-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000467052.1	NM_017908	
LAMA5	3911	hgsc.bcm.edu	37	20	60887087	60887087	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr20:60887087G>A	ENST00000252999.3	-	70	9590	c.9524C>T	c.(9523-9525)tCc>tTc	p.S3175F	LAMA5_ENST00000492698.1_5'Flank	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	3175	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CTGCTGCAGGGACACCTGGCA	0.647																																					p.S3175F		Atlas-SNP	.											.	LAMA5	268	.	0			c.C9524T						.						48.0	51.0	50.0					20																	60887087		2202	4296	6498	SO:0001583	missense	3911	exon70			TGCAGGGACACCT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.9524C>T	chr20.hg19:g.60887087G>A	ENSP00000252999:p.Ser3175Phe	61.0	0.0		57.0	16.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	g	11.14	1.550027	0.27652	.	.	ENSG00000130702	ENST00000252999	T	0.78707	-1.2	4.62	3.67	0.42095	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.573613	0.19055	N	0.123932	T	0.73923	0.3649	M	0.65498	2.005	0.80722	D	1	B	0.12013	0.005	B	0.12156	0.007	T	0.71830	-0.4474	10	0.37606	T	0.19	.	11.7433	0.51804	0.0879:0.0:0.9121:0.0	.	3175	O15230	LAMA5_HUMAN	F	3175	ENSP00000252999:S3175F	ENSP00000252999:S3175F	S	-	2	0	LAMA5	60320482	0.998000	0.40836	0.999000	0.59377	0.327000	0.28475	1.211000	0.32382	2.118000	0.64928	0.556000	0.70494	TCC	.	.		0.647	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382426	24382426	+	IGR	SNP	G	G	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrX:24382426G>C								AC004552.1 (15403 upstream) : PDK3 (100911 downstream)																							tgctgctgctgctcctgctcc	0.627																																					p.A517P		Atlas-SNP	.											.	.	.	.	0			c.G1549C						.						2.0	2.0	2.0					X																	24382426		1073	2483	3556	SO:0001628	intergenic_variant	100130302	exon1			GCTGCTGCTCCTG																													chrX.hg19:g.24382426G>C		198.0	0.0		241.0	12.0	NM_001136234		Missense_Mutation	SNP		hg19																																																																																				.	.	0	0.627								
BMP15	9210	hgsc.bcm.edu	37	X	50658924	50658924	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrX:50658924T>A	ENST00000252677.3	+	2	496	c.496T>A	c.(496-498)Tcc>Acc	p.S166T		NM_005448.2	NP_005439.2	O95972	BMP15_HUMAN	bone morphogenetic protein 15	166					female gamete generation (GO:0007292)|granulosa cell development (GO:0060016)|ovarian follicle development (GO:0001541)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(1)	26	Ovarian(276;0.236)					CCACTTCCCTTCCTCAGAAGG	0.483																																					p.S166T		Atlas-SNP	.											.	BMP15	62	.	0			c.T496A						.						103.0	81.0	88.0					X																	50658924		2203	4299	6502	SO:0001583	missense	9210	exon2			TTCCCTTCCTCAG	AF082349	CCDS14334.1	Xp11.2	2013-02-06			ENSG00000130385	ENSG00000130385		"""Bone morphogenetic proteins"""	1068	protein-coding gene	gene with protein product		300247				9849956	Standard	NM_005448		Approved	GDF9B	uc011mnw.2	O95972	OTTHUMG00000021525	ENST00000252677.3:c.496T>A	chrX.hg19:g.50658924T>A	ENSP00000252677:p.Ser166Thr	315.0	0.0		379.0	56.0	NM_005448	Q17RM6|Q5JST1|Q9UMS1	Missense_Mutation	SNP	ENST00000252677.3	hg19	CCDS14334.1	.	.	.	.	.	.	.	.	.	.	t	3.406	-0.121129	0.06838	.	.	ENSG00000130385	ENST00000252677	T	0.79749	-1.3	4.69	-4.9	0.03094	.	0.490054	0.23213	N	0.050643	T	0.69124	0.3076	M	0.72118	2.19	0.09310	N	1	P	0.43231	0.801	B	0.37780	0.258	T	0.66830	-0.5824	10	0.11794	T	0.64	.	9.3461	0.38109	0.0:0.6047:0.1455:0.2498	.	166	O95972	BMP15_HUMAN	T	166	ENSP00000252677:S166T	ENSP00000252677:S166T	S	+	1	0	BMP15	50675664	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.586000	0.05787	-0.754000	0.04715	-0.538000	0.04264	TCC	.	.		0.483	BMP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056572.1	NM_005448	
DNASE1L1	1774	hgsc.bcm.edu	37	X	153633194	153633194	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrX:153633194T>C	ENST00000393638.1	-	4	572	c.286A>G	c.(286-288)Atg>Gtg	p.M96V	DNASE1L1_ENST00000369809.1_Missense_Mutation_p.M96V	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	96					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TACGTCTCCATGTAGGTGCTG	0.627																																					p.M96V		Atlas-SNP	.											.	DNASE1L1	20	.	0			c.A286G						.						35.0	32.0	33.0					X																	153633194		2202	4300	6502	SO:0001583	missense	1774	exon4			TCTCCATGTAGGT	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.286A>G	chrX.hg19:g.153633194T>C	ENSP00000377255:p.Met96Val	233.0	0.0		293.0	58.0	NM_006730	D3DWW7|Q5HY41	Missense_Mutation	SNP	ENST00000393638.1	hg19	CCDS14747.1	.	.	.	.	.	.	.	.	.	.	T	5.453	0.268755	0.10349	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585;ENST00000451865;ENST00000424626	T;T;T;T;T;T;T;T	0.79749	0.75;0.75;0.75;0.75;0.75;0.75;-1.3;1.49	4.31	3.13	0.36017	Endonuclease/exonuclease/phosphatase (2);	0.565616	0.17688	N	0.165394	T	0.77685	0.4167	M	0.62723	1.935	0.09310	N	0.999996	B	0.28820	0.224	B	0.33846	0.171	T	0.67530	-0.5647	10	0.59425	D	0.04	-2.9377	8.3694	0.32406	0.0:0.1087:0.0:0.8913	.	96	P49184	DNSL1_HUMAN	V	96	ENSP00000358824:M96V;ENSP00000377255:M96V;ENSP00000014935:M96V;ENSP00000358823:M96V;ENSP00000358822:M96V;ENSP00000309168:M96V;ENSP00000393346:M96V;ENSP00000393000:M96V	ENSP00000014935:M96V	M	-	1	0	DNASE1L1	153286388	1.000000	0.71417	0.854000	0.33618	0.179000	0.23085	0.729000	0.26028	0.001000	0.14605	-1.912000	0.00520	ATG	.	.		0.627	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080928.2		
MPP1	4354	hgsc.bcm.edu	37	X	154010040	154010040	+	Silent	SNP	C	C	T			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrX:154010040C>T	ENST00000369534.3	-	10	1131	c.984G>A	c.(982-984)ggG>ggA	p.G328G	MPP1_ENST00000462825.1_5'Flank|MPP1_ENST00000413259.3_Silent_p.G298G|MPP1_ENST00000393531.1_Silent_p.G308G	NM_001166460.1|NM_001166461.1|NM_002436.3	NP_001159932.1|NP_001159933.1|NP_002427.1	Q00013	EM55_HUMAN	membrane protein, palmitoylated 1, 55kDa	328	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.|Interaction with MPP5.				nucleotide phosphorylation (GO:0046939)|regulation of neutrophil chemotaxis (GO:0090022)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cortical cytoskeleton (GO:0030863)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(9)|ovary(2)|prostate(1)	21	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGTACTCCTTCCCATCTTCCT	0.507																																					p.G328G		Atlas-SNP	.											.	MPP1	52	.	0			c.G984A						.						258.0	206.0	223.0					X																	154010040		2203	4300	6503	SO:0001819	synonymous_variant	4354	exon10			CTCCTTCCCATCT		CCDS14762.1, CCDS55544.1, CCDS55545.1	Xq28	2008-03-04	2002-08-29		ENSG00000130830	ENSG00000130830			7219	protein-coding gene	gene with protein product		305360	"""membrane protein, palmitoylated 1 (55kD)"""	DXS552E		1713685	Standard	NM_002436		Approved	PEMP	uc004fmp.2	Q00013	OTTHUMG00000024244	ENST00000369534.3:c.984G>A	chrX.hg19:g.154010040C>T		254.0	0.0		361.0	65.0	NM_002436	B4DZV5|G3XAI1|Q2TSB6|Q5J7V5	Silent	SNP	ENST00000369534.3	hg19	CCDS14762.1																																																																																			.	.		0.507	MPP1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000061191.3	NM_002436	
MT-ND4	4538	hgsc.bcm.edu	37	M	11825	11825	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrM:11825G>A	ENST00000361381.2	+	1	1066	c.1066G>A	c.(1066-1068)Gct>Act	p.A356T	MT-ND5_ENST00000361567.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03905	NU4M_HUMAN	mitochondrially encoded NADH dehydrogenase 4	356					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|prostate(1)	13						TCCCACTAATAGCTTTTTGAT	0.458																																					p.A356T		Atlas-SNP	.											.	.	.	.	0			c.G1066A						.																																			SO:0001583	missense	0	exon1			CTAATAGCTTTTT			mitochondria	2014-02-03	2005-02-15	2005-02-16	ENSG00000198886	ENSG00000198886	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7459	protein-coding gene	gene with protein product	"""complex I ND4 subunit"", ""NADH-ubiquinone oxidoreductase chain 4"""	516003	"""NADH dehydrogenase 4"", ""Leber optic neuropathy"""	MTND4, LHON		8103501	Standard			Approved	ND4, NAD4		P03905		ENST00000361381.2:c.1066G>A	chrM.hg19:g.11825G>A	ENSP00000354961:p.Ala356Thr	11.0	0.0		33.0	31.0	ENST00000361381	Q6RL39|Q6RQN9|Q8HNR8	Missense_Mutation	SNP	ENST00000361381.2	hg19																																																																																				.	.		0.458	MT-ND4-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024035	
MT-ND5	4540	hgsc.bcm.edu	37	M	13917	13917	+	Silent	SNP	A	A	G			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrM:13917A>G	ENST00000361567.2	+	1	1581	c.1581A>G	c.(1579-1581)ggA>ggG	p.G527G	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	527					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						AACATACTCGGATTCTACCCT	0.443																																					p.G527G		Atlas-SNP	.											.	.	.	.	0			c.A1581G						.																																			SO:0001819	synonymous_variant	0	exon1			ACTCGGATTCTAC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1581A>G	chrM.hg19:g.13917A>G		7.0	0.0		31.0	18.0	ENST00000361567	Q34773|Q8WCY3	Silent	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.443	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
MT-ND5	4540	hgsc.bcm.edu	37	M	14063	14063	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chrM:14063T>C	ENST00000361567.2	+	1	1727	c.1727T>C	c.(1726-1728)aTc>aCc	p.I576T	MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	576					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CACCTCCATCATCACCTCAAC	0.433																																					p.I576T		Atlas-SNP	.											.	.	.	.	0			c.T1727C						.																																			SO:0001583	missense	0	exon1			CCATCATCACCTC			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1727T>C	chrM.hg19:g.14063T>C	ENSP00000354813:p.Ile576Thr	15.0	0.0		36.0	5.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.433	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
PGS1	9489	hgsc.bcm.edu	37	17	76395500	76395500	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr17:76395500delT	ENST00000262764.6	+	5	609	c.583delT	c.(583-585)tttfs	p.F195fs	PGS1_ENST00000588281.1_3'UTR|PGS1_ENST00000329897.7_Frame_Shift_Del_p.F60fs|SNORA30_ENST00000363193.1_RNA	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1	195					cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			AGTCTCCCTCTTTCACACGCC	0.602																																					p.L194fs	Esophageal Squamous(45;182 1126 10685 43198)	Atlas-Indel,Pindel	.											.	PGS1	30	.	0			c.582delC						.						91.0	96.0	95.0					17																	76395500		2093	4197	6290	SO:0001589	frameshift_variant	9489	exon5			.		CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.583delT	chr17.hg19:g.76395500delT	ENSP00000262764:p.Phe195fs	124.0	0.0		176.0	46.0	NM_024419	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	Frame_Shift_Del	DEL	ENST00000262764.6	hg19	CCDS42391.1																																																																																			.	.		0.602	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437301.1	NM_024419	
STAT5B	6777	hgsc.bcm.edu	37	17	40384099	40384100	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr17:40384099_40384100insG	ENST00000293328.3	-	2	214_215	c.46_47insC	c.(46-48)catfs	p.H16fs		NM_012448.3	NP_036580.2	P51692	STA5B_HUMAN	signal transducer and activator of transcription 5B	16					2-oxoglutarate metabolic process (GO:0006103)|acute-phase response (GO:0006953)|allantoin metabolic process (GO:0000255)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|liver development (GO:0001889)|luteinization (GO:0001553)|natural killer cell differentiation (GO:0001779)|negative regulation of apoptotic process (GO:0043066)|negative regulation of erythrocyte differentiation (GO:0045647)|oxaloacetate metabolic process (GO:0006107)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of cellular component movement (GO:0051272)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell proliferation (GO:0032819)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone metabolic process (GO:0042448)|prolactin signaling pathway (GO:0038161)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to lipopolysaccharide (GO:0032496)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription from RNA polymerase II promoter (GO:0006366)|valine metabolic process (GO:0006573)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|glucocorticoid receptor binding (GO:0035259)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_cancers(22;4.15e-07)|all_epithelial(22;2.83e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.135)	Dasatinib(DB01254)	TTGCATCTGATGAAGGGCTTCT	0.436																																					p.H16fs		Atlas-Indel,Pindel	.											.	STAT5B	89	.	0			c.47_48insC						.																																			SO:0001589	frameshift_variant	6777	exon2			.	BC065227	CCDS11423.1	17q11.2	2014-09-17			ENSG00000173757	ENSG00000173757		"""SH2 domain containing"""	11367	protein-coding gene	gene with protein product		604260				8631883	Standard	NM_012448		Approved		uc002hzh.3	P51692	OTTHUMG00000150724	ENST00000293328.3:c.47dupC	chr17.hg19:g.40384100_40384100dupG	ENSP00000293328:p.His16fs	199.0	0.0		242.0	48.0	NM_012448	Q8WWS8	Frame_Shift_Ins	INS	ENST00000293328.3	hg19	CCDS11423.1																																																																																			.	.		0.436	STAT5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319797.1	NM_012448	
AKT3	10000	hgsc.bcm.edu	37	1	243800994	243800994	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr1:243800994delC	ENST00000366539.1	-	6	680	c.480delG	c.(478-480)gggfs	p.G160fs	AKT3_ENST00000336199.5_Frame_Shift_Del_p.G160fs|AKT3_ENST00000263826.5_Frame_Shift_Del_p.G160fs|AKT3_ENST00000366540.1_Frame_Shift_Del_p.G160fs			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	160	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AAATAACTTTCCCAAAAGTGC	0.279																																					p.K161fs		Atlas-Indel,Pindel	.											.	AKT3	177	.	0			c.481delA						.						96.0	94.0	95.0					1																	243800994		2201	4297	6498	SO:0001589	frameshift_variant	10000	exon6			.	AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.480delG	chr1.hg19:g.243800994delC	ENSP00000355497:p.Gly160fs	31.0	0.0		59.0	22.0	NM_001206729	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Frame_Shift_Del	DEL	ENST00000366539.1	hg19	CCDS31077.1																																																																																			.	.		0.279	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096479.1	NM_181690	
ADNP	23394	hgsc.bcm.edu	37	20	49508933	49508934	+	Frame_Shift_Del	DEL	TT	TT	-	rs140169338	byFrequency	TCGA-DD-A4NH-01A-11D-A27I-10	TCGA-DD-A4NH-10A-01D-A27I-10	TT	TT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7d6e688d-9606-497f-93d0-ab5238450020	2aa64a1b-06d8-4074-ad24-b2c108738bd2	g.chr20:49508933_49508934delTT	ENST00000396029.3	-	5	2884_2885	c.2317_2318delAA	c.(2317-2319)aagfs	p.K773fs	ADNP_ENST00000349014.3_Frame_Shift_Del_p.K773fs|ADNP_ENST00000371602.4_Frame_Shift_Del_p.K773fs|ADNP_ENST00000396032.3_Frame_Shift_Del_p.K773fs	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	773					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GTTGAAATACTTTGTTAGAAAG	0.426																																					p.773_773del		Atlas-Indel,Pindel	.											.	ADNP	106	.	0			c.2318_2319del						.																																			SO:0001589	frameshift_variant	23394	exon5			.	AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2317_2318delAA	chr20.hg19:g.49508933_49508934delTT	ENSP00000379346:p.Lys773fs	180.0	0.0		201.0	43.0	NM_015339	E1P5Y2|O94881|Q5BKU2|Q9UG34	Frame_Shift_Del	DEL	ENST00000396029.3	hg19	CCDS13433.1																																																																																			.	.		0.426	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079705.2	NM_181442	
