#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
MAN1C1	57134	hgsc.bcm.edu	37	1	25944335	25944335	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:25944335G>A	ENST00000374332.4	+	1	377	c.47G>A	c.(46-48)gGg>gAg	p.G16E	MAN1C1_ENST00000263979.3_5'Flank	NM_020379.2	NP_065112.1	Q9NR34	MA1C1_HUMAN	mannosidase, alpha, class 1C, member 1	16					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(7)|pancreas(1)|prostate(1)|skin(2)	25		Colorectal(325;3.78e-05)|Lung NSC(340;0.000181)|all_lung(284;0.000245)|Renal(390;0.000714)|Ovarian(437;0.00159)|Breast(348;0.0156)|Myeloproliferative disorder(586;0.0257)|all_neural(195;0.0515)|Esophageal squamous(538;0.232)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0574)|OV - Ovarian serous cystadenocarcinoma(117;2.46e-25)|Colorectal(126;1.15e-07)|COAD - Colon adenocarcinoma(152;4.31e-06)|STAD - Stomach adenocarcinoma(196;0.00125)|BRCA - Breast invasive adenocarcinoma(304;0.00141)|KIRC - Kidney renal clear cell carcinoma(1967;0.00146)|GBM - Glioblastoma multiforme(114;0.0149)|READ - Rectum adenocarcinoma(331;0.0803)		TCCCCGTGGGGGCTGCGGCTG	0.692																																					p.G16E		Atlas-SNP	.											.	MAN1C1	48	.	0			c.G47A						.						14.0	17.0	16.0					1																	25944335		2173	4257	6430	SO:0001583	missense	57134	exon1			CGTGGGGGCTGCG	AF261655	CCDS265.1	1p35	2008-02-05			ENSG00000117643	ENSG00000117643			19080	protein-coding gene	gene with protein product						10915796	Standard	XM_005245945		Approved	HMIC	uc001bkm.2	Q9NR34	OTTHUMG00000004417	ENST00000374332.4:c.47G>A	chr1.hg19:g.25944335G>A	ENSP00000363452:p.Gly16Glu	69.0	0.0		53.0	20.0	NM_020379	A6NNE2|B2RNP2|Q9Y545	Missense_Mutation	SNP	ENST00000374332.4	hg19	CCDS265.1	.	.	.	.	.	.	.	.	.	.	g	21.8	4.196335	0.78902	.	.	ENSG00000117643	ENST00000374332	D	0.98280	-4.84	3.83	2.88	0.33553	.	0.000000	0.46758	U	0.000272	D	0.96800	0.8955	L	0.29908	0.895	0.80722	D	1	D	0.63880	0.993	P	0.57371	0.819	D	0.95174	0.8293	10	0.46703	T	0.11	.	9.1786	0.37127	0.0:0.2226:0.7774:0.0	.	16	Q9NR34	MA1C1_HUMAN	E	16	ENSP00000363452:G16E	ENSP00000363452:G16E	G	+	2	0	MAN1C1	25816922	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	2.847000	0.48270	0.790000	0.33803	0.546000	0.68486	GGG	.	.		0.692	MAN1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012828.3	NM_020379	
ARHGEF2	9181	hgsc.bcm.edu	37	1	155932460	155932460	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:155932460C>T	ENST00000361247.4	-	9	1124	c.1025G>A	c.(1024-1026)tGc>tAc	p.C342Y	ARHGEF2_ENST00000313695.7_Missense_Mutation_p.C314Y|ARHGEF2_ENST00000462460.2_Missense_Mutation_p.C387Y|ARHGEF2_ENST00000313667.4_Missense_Mutation_p.C341Y|ARHGEF2_ENST00000368316.1_Missense_Mutation_p.C314Y|ARHGEF2_ENST00000368315.4_Missense_Mutation_p.C343Y|ARHGEF2_ENST00000477754.2_Intron	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	342	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTGGCGGCTGCAGAACTCCGA	0.537																																					p.C342Y	Melanoma(178;35 2768 6610 28839)	Atlas-SNP	.											.	ARHGEF2	81	.	0			c.G1025A						.						65.0	66.0	66.0					1																	155932460		2203	4300	6503	SO:0001583	missense	9181	exon9			CGGCTGCAGAACT	AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1025G>A	chr1.hg19:g.155932460C>T	ENSP00000354837:p.Cys342Tyr	181.0	0.0		287.0	22.0	NM_001162383	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Missense_Mutation	SNP	ENST00000361247.4	hg19	CCDS53376.1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659865	0.88154	.	.	ENSG00000116584	ENST00000313695;ENST00000361247;ENST00000368315;ENST00000368316;ENST00000435736;ENST00000543433;ENST00000313667	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.08	5.08	0.68730	Dbl homology (DH) domain (5);	0.000000	0.52532	D	0.000072	D	0.83326	0.5230	M	0.91140	3.18	0.80722	D	1	D;D;P;D	0.76494	0.999;0.984;0.77;0.966	D;D;B;P	0.76071	0.987;0.954;0.424;0.879	D	0.86301	0.1680	10	0.87932	D	0	-27.6171	16.3414	0.83083	0.0:1.0:0.0:0.0	.	387;386;342;341	B7Z977;D3DVA5;Q92974;Q92974-2	.;.;ARHG2_HUMAN;.	Y	314;342;343;314;387;315;341	ENSP00000315325:C314Y;ENSP00000354837:C342Y;ENSP00000357298:C343Y;ENSP00000357299:C314Y;ENSP00000314787:C341Y	ENSP00000314787:C341Y	C	-	2	0	ARHGEF2	154199084	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.156000	0.77453	2.803000	0.96430	0.609000	0.83330	TGC	.	.		0.537	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046204.2	NM_004723	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156937793	156937793	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:156937793A>C	ENST00000361409.2	-	10	1571	c.829T>G	c.(829-831)Tca>Gca	p.S277A	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.S317A	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	277					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCACCGGTTGAGGGGACTGCT	0.582																																					p.S317A		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.T949G						.						54.0	51.0	52.0					1																	156937793		2203	4300	6503	SO:0001583	missense	9826	exon11			CGGTTGAGGGGAC	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.829T>G	chr1.hg19:g.156937793A>C	ENSP00000354644:p.Ser277Ala	152.0	0.0		173.0	37.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	hg19	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	A	6.104	0.387446	0.11581	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.66280	-0.2;-0.13	4.81	-3.32	0.04973	.	1.665720	0.03587	N	0.231258	T	0.09992	0.0245	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.03296	-1.1051	10	0.06757	T	0.87	0.9157	0.1917	0.00135	0.2972:0.2247:0.2488:0.2292	.	277;317	O15085;O15085-2	ARHGB_HUMAN;.	A	317;277	ENSP00000357177:S317A;ENSP00000354644:S277A	ENSP00000354644:S277A	S	-	1	0	ARHGEF11	155204417	0.000000	0.05858	0.000000	0.03702	0.355000	0.29361	0.242000	0.18087	-1.007000	0.03408	-1.313000	0.01306	TCA	.	.		0.582	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
FCRL5	83416	hgsc.bcm.edu	37	1	157494326	157494326	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:157494326A>T	ENST00000361835.3	-	10	2139	c.1982T>A	c.(1981-1983)cTc>cAc	p.L661H	FCRL5_ENST00000368191.3_Missense_Mutation_p.L576H|FCRL5_ENST00000356953.4_Missense_Mutation_p.L661H|FCRL5_ENST00000368190.3_Missense_Mutation_p.L661H|FCRL5_ENST00000461387.1_5'Flank	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	661	Ig-like C2-type 7.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				CCTGAAGGTGAGGATGGGACG	0.507																																					p.L661H		Atlas-SNP	.											.	FCRL5	177	.	0			c.T1982A						.						49.0	54.0	52.0					1																	157494326		2203	4300	6503	SO:0001583	missense	83416	exon10			AAGGTGAGGATGG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1982T>A	chr1.hg19:g.157494326A>T	ENSP00000354691:p.Leu661His	140.0	0.0		271.0	16.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	hg19	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	A	16.97	3.269824	0.59540	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191	T;T;T;T	0.03951	3.75;3.75;3.75;3.75	4.69	4.69	0.59074	Immunoglobulin-like (1);	17.269200	0.00597	U	0.000372	T	0.27663	0.0680	H	0.97131	3.945	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;1.0;1.0	D;D;D;D	0.81914	0.987;0.951;0.995;0.995	T	0.15093	-1.0449	10	0.72032	D	0.01	.	10.7093	0.45973	1.0:0.0:0.0:0.0	.	576;661;661;661	F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9	.;.;.;FCRL5_HUMAN	H	661;661;661;576	ENSP00000354691:L661H;ENSP00000349434:L661H;ENSP00000357173:L661H;ENSP00000357174:L576H	ENSP00000349434:L661H	L	-	2	0	FCRL5	155760950	0.998000	0.40836	0.224000	0.23877	0.013000	0.08279	4.168000	0.58216	2.097000	0.63578	0.454000	0.30748	CTC	.	.		0.507	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
SERPINC1	462	hgsc.bcm.edu	37	1	173880936	173880936	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:173880936C>T	ENST00000367698.3	-	3	743		c.e3+1		SERPINC1_ENST00000494024.1_5'Flank	NM_000488.3	NP_000479.1	P01008	ANT3_HUMAN	serpin peptidase inhibitor, clade C (antithrombin), member 1						blood coagulation (GO:0007596)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of inflammatory response (GO:0050728)|regulation of blood coagulation, intrinsic pathway (GO:2000266)|regulation of proteolysis (GO:0030162)|response to nutrient (GO:0007584)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(15)|ovary(1)	25					Ardeparin(DB00407)|Dalteparin(DB06779)|Enoxaparin(DB01225)|Fondaparinux sodium(DB00569)|Heparin(DB01109)|Nadroparin(DB08813)|Sulodexide(DB06271)|Tinzaparin(DB06822)	CTGCAACTCACCTTGAAGTCC	0.498																																					.		Atlas-SNP	.											.	SERPINC1	57	.	0			c.624+1G>A						.						116.0	103.0	108.0					1																	173880936		2203	4300	6503	SO:0001630	splice_region_variant	462	exon4			AACTCACCTTGAA	X68793	CCDS1313.1	1q25.1	2014-02-18	2005-08-18		ENSG00000117601	ENSG00000117601		"""Serine (or cysteine) peptidase inhibitors"""	775	protein-coding gene	gene with protein product	"""antithrombin III"", ""signal peptide antithrombin part 1"", ""coding sequence signal peptide antithrombin part 1"", ""antithrombin (aa 375-432)"""	107300	"""serine (or cysteine) proteinase inhibitor, clade C (antithrombin), member 1"""	AT3		3979120, 24172014	Standard	NM_000488		Approved	ATIII, MGC22579	uc001gjt.3	P01008	OTTHUMG00000037276	ENST00000367698.3:c.624+1G>A	chr1.hg19:g.173880936C>T		126.0	0.0		180.0	71.0	NM_000488	B2R6P0|P78439|P78447|Q13815|Q5TC78|Q7KZ43|Q7KZ97|Q9UC78	Splice_Site	SNP	ENST00000367698.3	hg19	CCDS1313.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.705364	0.89018	.	.	ENSG00000117601	ENST00000367698	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7525	0.96273	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SERPINC1	172147559	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	7.487000	0.81328	2.669000	0.90835	0.591000	0.81541	.	.	.		0.498	SERPINC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090734.1	NM_000488	Intron
NPL	80896	hgsc.bcm.edu	37	1	182794948	182794948	+	Silent	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:182794948C>G	ENST00000367553.1	+	11	815	c.771C>G	c.(769-771)gtC>gtG	p.V257V	NPL_ENST00000367554.3_Silent_p.V238V|NPL_ENST00000367555.1_Silent_p.V213V|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000367552.2_Silent_p.V213V|NPL_ENST00000258317.2_Silent_p.V257V	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	257					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						ACTTTGTTGTCAAACTAGGTA	0.348																																					p.S229X		Atlas-SNP	.											.	NPL	55	.	0			c.C686G						.						154.0	162.0	159.0					1																	182794948		2203	4300	6503	SO:0001819	synonymous_variant	80896	exon11			TGTTGTCAAACTA	AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.771C>G	chr1.hg19:g.182794948C>G		20.0	0.0		44.0	5.0	NM_001200052	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Nonsense_Mutation	SNP	ENST00000367553.1	hg19	CCDS1350.1																																																																																			.	.		0.348	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085463.1	NM_030769	
PFKFB2	5208	hgsc.bcm.edu	37	1	207241653	207241653	+	Splice_Site	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:207241653C>T	ENST00000367080.3	+	10	1110	c.986C>T	c.(985-987)gCt>gTt	p.A329V	PFKFB2_ENST00000541914.1_Splice_Site_p.A143V|PFKFB2_ENST00000411990.2_Splice_Site_p.A231V|PFKFB2_ENST00000545806.1_Splice_Site_p.A296V|PFKFB2_ENST00000367079.2_Splice_Site_p.A329V	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	329	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					GAGATTGATGCTGTGAGTAGG	0.463																																					p.A329V		Atlas-SNP	.											.	PFKFB2	70	.	0			c.C986T						.						70.0	67.0	68.0					1																	207241653		2203	4300	6503	SO:0001630	splice_region_variant	5208	exon10			TTGATGCTGTGAG		CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.987+1C>T	chr1.hg19:g.207241653C>T		48.0	0.0		89.0	6.0	NM_001018053	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Missense_Mutation	SNP	ENST00000367080.3	hg19	CCDS31004.1	.	.	.	.	.	.	.	.	.	.	C	35	5.420605	0.96111	.	.	ENSG00000123836	ENST00000411990;ENST00000367080;ENST00000367079;ENST00000545806;ENST00000541914	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.67	4.77	0.60923	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	T	0.79764	0.4502	L	0.52126	1.63	0.80722	D	1	P;D;D;D	0.89917	0.855;0.996;1.0;0.979	B;P;D;P	0.79784	0.381;0.679;0.993;0.722	T	0.81678	-0.0824	10	0.87932	D	0	.	13.6914	0.62549	0.0:0.9261:0.0:0.0739	.	143;231;329;329	B4DI16;B4DY91;Q5VVQ3;O60825	.;.;.;F262_HUMAN	V	231;329;329;296;143	ENSP00000408717:A231V;ENSP00000356047:A329V;ENSP00000356046:A329V;ENSP00000439420:A296V;ENSP00000440878:A143V	ENSP00000356046:A329V	A	+	2	0	PFKFB2	205308276	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.755000	0.85180	1.414000	0.47017	0.650000	0.86243	GCT	.	.		0.463	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087838.1		Missense_Mutation
USH2A	7399	hgsc.bcm.edu	37	1	216040372	216040372	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:216040372A>G	ENST00000307340.3	-	44	9208	c.8822T>C	c.(8821-8823)aTc>aCc	p.I2941T	USH2A_ENST00000366943.2_Missense_Mutation_p.I2941T	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2941	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCTCACGTCGATGGCTGTGTG	0.453										HNSCC(13;0.011)																											p.I2941T		Atlas-SNP	.											.	USH2A	1168	.	0			c.T8822C						.						166.0	136.0	146.0					1																	216040372		2203	4300	6503	SO:0001583	missense	7399	exon44			ACGTCGATGGCTG	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8822T>C	chr1.hg19:g.216040372A>G	ENSP00000305941:p.Ile2941Thr	127.0	0.0		218.0	22.0	NM_206933	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.436146	0.83885	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.59502	0.26;0.26	5.72	4.56	0.56223	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.142993	0.30949	N	0.008560	T	0.59569	0.2203	M	0.77103	2.36	0.19300	N	0.999976	P	0.39717	0.684	B	0.38378	0.272	T	0.58278	-0.7664	10	0.72032	D	0.01	.	12.7915	0.57537	0.8631:0.1368:0.0:0.0	.	2941	O75445	USH2A_HUMAN	T	2941	ENSP00000305941:I2941T;ENSP00000355910:I2941T	ENSP00000305941:I2941T	I	-	2	0	USH2A	214106995	0.996000	0.38824	0.357000	0.25798	0.840000	0.47671	3.970000	0.56824	0.952000	0.37798	0.455000	0.32223	ATC	.	.		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
USH2A	7399	hgsc.bcm.edu	37	1	216371756	216371756	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:216371756C>T	ENST00000307340.3	-	18	4368	c.3982G>A	c.(3982-3984)Ggc>Agc	p.G1328S	USH2A_ENST00000366942.3_Missense_Mutation_p.G1328S|USH2A_ENST00000366943.2_Missense_Mutation_p.G1328S|RP5-1099E6.3_ENST00000420867.1_RNA	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	1328	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		GGCTCCAAGCCAGTGATGGTT	0.453										HNSCC(13;0.011)																											p.G1328S		Atlas-SNP	.											.	USH2A	1168	.	0			c.G3982A						.						138.0	128.0	131.0					1																	216371756		2203	4300	6503	SO:0001583	missense	7399	exon18			CCAAGCCAGTGAT	AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.3982G>A	chr1.hg19:g.216371756C>T	ENSP00000305941:p.Gly1328Ser	115.0	0.0		191.0	13.0	NM_007123	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	ENST00000307340.3	hg19	CCDS31025.1	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850455	0.71719	.	.	ENSG00000042781	ENST00000307340;ENST00000366943;ENST00000366942	T;T;T	0.61274	0.12;0.34;0.34	5.69	5.69	0.88448	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.309756	0.22942	N	0.053763	T	0.66376	0.2783	M	0.76433	2.335	0.35137	D	0.768545	P;P	0.45715	0.837;0.865	P;P	0.49999	0.628;0.61	T	0.73927	-0.3828	10	0.36615	T	0.2	.	13.0738	0.59075	0.0:0.9268:0.0:0.0732	.	1328;1328	O75445-2;O75445	.;USH2A_HUMAN	S	1328	ENSP00000305941:G1328S;ENSP00000355910:G1328S;ENSP00000355909:G1328S	ENSP00000305941:G1328S	G	-	1	0	USH2A	214438379	0.788000	0.28762	0.989000	0.46669	0.449000	0.32228	2.716000	0.47219	2.688000	0.91661	0.650000	0.86243	GGC	.	.		0.453	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128138.1	NM_007123	
EPRS	2058	hgsc.bcm.edu	37	1	220174520	220174520	+	Missense_Mutation	SNP	C	C	A	rs374231493		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:220174520C>A	ENST00000366923.3	-	17	2410	c.2141G>T	c.(2140-2142)gGg>gTg	p.G714V		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	714	Glutamate--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TTCCTTTGACCCTGATGTTGG	0.378																																					p.G714V		Atlas-SNP	.											.	EPRS	140	.	0			c.G2141T						.						167.0	149.0	155.0					1																	220174520		2203	4300	6503	SO:0001583	missense	2058	exon17			TTTGACCCTGATG	X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.2141G>T	chr1.hg19:g.220174520C>A	ENSP00000355890:p.Gly714Val	123.0	0.0		249.0	65.0	NM_004446	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	ENST00000366923.3	hg19	CCDS31027.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.783887	0.90282	.	.	ENSG00000136628	ENST00000366923;ENST00000536921;ENST00000435048	T	0.06768	3.26	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.29817	0.0745	M	0.67397	2.05	0.80722	D	1	D;P;D;D	0.89917	1.0;0.819;0.995;0.991	D;P;P;P	0.76575	0.988;0.614;0.788;0.858	T	0.00581	-1.1660	10	0.62326	D	0.03	-22.932	19.3764	0.94512	0.0:1.0:0.0:0.0	.	738;721;721;714	E7EMN0;F5H7I7;Q3KQZ8;P07814	.;.;.;SYEP_HUMAN	V	714;721;738	ENSP00000355890:G714V	ENSP00000355890:G714V	G	-	2	0	EPRS	218241143	1.000000	0.71417	0.995000	0.50966	0.931000	0.56810	6.907000	0.75724	2.590000	0.87494	0.563000	0.77884	GGG	.	.		0.378	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091133.2	NM_004446	
ACTN2	88	hgsc.bcm.edu	37	1	236850058	236850058	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:236850058G>A	ENST00000366578.4	+	1	251	c.85G>A	c.(85-87)Gac>Aac	p.D29N	ACTN2_ENST00000492634.1_3'UTR|ACTN2_ENST00000542672.1_Missense_Mutation_p.D29N	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	29	Actin-binding.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			GTGGGACCGCGACCTGCTCCT	0.692																																					p.D29N		Atlas-SNP	.											.	ACTN2	191	.	0			c.G85A						.						48.0	43.0	45.0					1																	236850058		2203	4300	6503	SO:0001583	missense	88	exon1			GACCGCGACCTGC	BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.85G>A	chr1.hg19:g.236850058G>A	ENSP00000355537:p.Asp29Asn	92.0	0.0		157.0	11.0	NM_001103	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Missense_Mutation	SNP	ENST00000366578.4	hg19	CCDS1613.1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.247493	0.80024	.	.	ENSG00000077522	ENST00000542672;ENST00000366578	T;T	0.60299	0.2;0.2	3.81	2.86	0.33363	Calponin homology domain (1);	0.000000	0.85682	D	0.000000	T	0.49915	0.1585	L	0.58583	1.82	0.80722	D	1	P;P	0.39157	0.662;0.649	B;B	0.31869	0.137;0.057	T	0.56751	-0.7927	10	0.87932	D	0	.	13.0662	0.59034	0.0:0.163:0.837:0.0	.	29;29	B2RCS5;P35609	.;ACTN2_HUMAN	N	29	ENSP00000443495:D29N;ENSP00000355537:D29N	ENSP00000355537:D29N	D	+	1	0	ACTN2	234916681	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.711000	0.91396	0.757000	0.33036	0.462000	0.41574	GAC	.	.		0.692	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000096628.1	NM_001103	
NLRP3	114548	hgsc.bcm.edu	37	1	247599337	247599337	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:247599337A>G	ENST00000336119.3	+	6	3310	c.2564A>G	c.(2563-2565)cAt>cGt	p.H855R	NLRP3_ENST00000391827.2_Missense_Mutation_p.H798R|NLRP3_ENST00000366497.2_Intron|NLRP3_ENST00000348069.2_Intron|NLRP3_ENST00000366496.2_Intron|NLRP3_ENST00000391828.3_Missense_Mutation_p.H855R	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	855					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			AGCACCAGCCATTCCCTGACC	0.483																																					p.H855R		Atlas-SNP	.											.	NLRP3	286	.	0			c.A2564G						.						128.0	111.0	117.0					1																	247599337		2203	4300	6503	SO:0001583	missense	114548	exon6			CCAGCCATTCCCT	AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.2564A>G	chr1.hg19:g.247599337A>G	ENSP00000337383:p.His855Arg	138.0	0.0		277.0	48.0	NM_004895	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	ENST00000336119.3	hg19	CCDS1632.1	.	.	.	.	.	.	.	.	.	.	a	0.828	-0.746385	0.03065	.	.	ENSG00000162711	ENST00000391828;ENST00000336119;ENST00000391827	T;T;T	0.45668	0.89;0.89;0.89	3.63	-4.55	0.03441	.	1.030140	0.07791	N	0.954965	T	0.16041	0.0386	N	0.04373	-0.215	0.09310	N	1	B;B;B	0.12013	0.0;0.0;0.005	B;B;B	0.04013	0.0;0.0;0.001	T	0.20974	-1.0259	10	0.20046	T	0.44	.	5.4132	0.16360	0.3316:0.2976:0.3708:0.0	.	835;798;855	B7ZKS9;Q96P20-4;Q96P20	.;.;NALP3_HUMAN	R	855;855;798	ENSP00000375704:H855R;ENSP00000337383:H855R;ENSP00000375703:H798R	ENSP00000337383:H855R	H	+	2	0	NLRP3	245665960	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.700000	0.05081	-1.155000	0.02822	-2.766000	0.00121	CAT	.	.		0.483	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097740.1	NM_004895	
OR1C1	26188	hgsc.bcm.edu	37	1	247921053	247921053	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:247921053C>A	ENST00000408896.2	-	1	929	c.656G>T	c.(655-657)gGa>gTa	p.G219V		NM_012353.2	NP_036485.2	Q15619	OR1C1_HUMAN	olfactory receptor, family 1, subfamily C, member 1	219					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(32)|skin(2)|upper_aerodigestive_tract(1)	46	all_cancers(71;4.34e-05)|all_epithelial(71;1.13e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0786)|Lung NSC(105;0.0858)	all_cancers(173;0.0247)	OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GAAGATAAGTCCATAAGATAC	0.483																																					p.G219V		Atlas-SNP	.											.	OR1C1	86	.	0			c.G656T						.						55.0	54.0	54.0					1																	247921053		2021	4195	6216	SO:0001583	missense	26188	exon1			ATAAGTCCATAAG	X89674	CCDS41481.1	1q44	2012-08-09			ENSG00000221888	ENSG00000221888		"""GPCR / Class A : Olfactory receptors"""	8182	protein-coding gene	gene with protein product						9119360	Standard	NM_012353		Approved	TPCR27, HSTPCR27	uc010pza.2	Q15619	OTTHUMG00000040198	ENST00000408896.2:c.656G>T	chr1.hg19:g.247921053C>A	ENSP00000386138:p.Gly219Val	119.0	0.0		180.0	39.0	NM_012353	B9EIR9|Q5VVD2|Q6IF97|Q8NGZ1|Q96R83	Missense_Mutation	SNP	ENST00000408896.2	hg19	CCDS41481.1	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.788307	0.00628	.	.	ENSG00000221888	ENST00000408896	T	0.00017	9.09	3.22	-2.25	0.06888	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	N	0.02368	-0.58	0.09310	N	1	B	0.10296	0.003	B	0.20184	0.028	T	0.03354	-1.1045	9	0.36615	T	0.2	.	12.9735	0.58525	0.8047:0.1953:0.0:0.0	.	219	Q15619	OR1C1_HUMAN	V	219	ENSP00000386138:G219V	ENSP00000386138:G219V	G	-	2	0	OR1C1	245987676	0.000000	0.05858	0.026000	0.17262	0.096000	0.18686	0.360000	0.20250	-0.166000	0.10890	-0.293000	0.09583	GGA	.	.		0.483	OR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096855.1		
LTBP1	4052	hgsc.bcm.edu	37	2	33246001	33246001	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:33246001T>C	ENST00000404816.2	+	3	944	c.591T>C	c.(589-591)aaT>aaC	p.N197N	LTBP1_ENST00000354476.3_Silent_p.N197N			Q14766	LTBP1_HUMAN	latent transforming growth factor beta binding protein 1	197	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				extracellular matrix organization (GO:0030198)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(13)|lung(60)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(3)	108	all_hematologic(175;0.115)	Medulloblastoma(90;0.215)				CATGTCAGAATGGAGGGATGT	0.483																																					p.N197N		Atlas-SNP	.											.	LTBP1	317	.	0			c.T591C						.						197.0	202.0	200.0					2																	33246001		2202	4298	6500	SO:0001819	synonymous_variant	4052	exon3			TCAGAATGGAGGG		CCDS33177.1, CCDS33178.1, CCDS33177.2, CCDS33178.2, CCDS54344.1, CCDS54345.1	2p22-p21	2008-05-23			ENSG00000049323	ENSG00000049323		"""Latent transforming growth factor, beta binding proteins"""	6714	protein-coding gene	gene with protein product	"""TGF-beta1-BP-1"""	150390				2350783, 11104663	Standard	NM_206943		Approved		uc021vft.1	Q14766	OTTHUMG00000152118	ENST00000404816.2:c.591T>C	chr2.hg19:g.33246001T>C		85.0	0.0		133.0	8.0	NM_206943	A1L3V1|P22064|Q53SD8|Q53SF3|Q53SG1|Q59HF7|Q8TD95	Silent	SNP	ENST00000404816.2	hg19	CCDS33177.2																																																																																			.	.		0.483	LTBP1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326227.2	NM_206943	
SOS1	6654	hgsc.bcm.edu	37	2	39249927	39249927	+	Missense_Mutation	SNP	T	T	C	rs397517149		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:39249927T>C	ENST00000426016.1	-	11	1728	c.1642A>G	c.(1642-1644)Agt>Ggt	p.S548G	SOS1_ENST00000395038.2_Missense_Mutation_p.S548G|SOS1_ENST00000472480.1_5'Flank|SOS1_ENST00000402219.2_Missense_Mutation_p.S548G			Q07889	SOS1_HUMAN	son of sevenless homolog 1 (Drosophila)	548	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.		S -> R (in NS4). {ECO:0000269|PubMed:17143282, ECO:0000269|PubMed:17143285, ECO:0000269|PubMed:21387466}.		apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|Ras protein signal transduction (GO:0007265)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	DNA binding (GO:0003677)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|liver(1)|lung(29)|ovary(4)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	75		all_hematologic(82;0.21)				TCCAGTGTACTCCGGTACTGT	0.383									Noonan syndrome																												p.S548G		Atlas-SNP	.											.	SOS1	134	.	0			c.A1642G	GRCh37	CM070280	SOS1	M		.						141.0	135.0	137.0					2																	39249927		2203	4300	6503	SO:0001583	missense	6654	exon10	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	GTGTACTCCGGTA	L13857	CCDS1802.1	2p21	2014-09-17	2002-11-05		ENSG00000115904	ENSG00000115904		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11187	protein-coding gene	gene with protein product		182530	"""gingival fibromatosis, hereditary, 1"""	GINGF		8276400, 10995566	Standard	NM_005633		Approved	HGF, GF1	uc002rrk.4	Q07889	OTTHUMG00000102109	ENST00000426016.1:c.1642A>G	chr2.hg19:g.39249927T>C	ENSP00000387784:p.Ser548Gly	69.0	0.0		123.0	43.0	NM_005633	A8K2G3|B4DXG2	Missense_Mutation	SNP	ENST00000426016.1	hg19	CCDS1802.1	.	.	.	.	.	.	.	.	.	.	T	17.92	3.506634	0.64410	.	.	ENSG00000115904	ENST00000426016;ENST00000402219;ENST00000543698;ENST00000395038;ENST00000263879	D;D;D	0.88201	-2.35;-2.35;-2.35	5.78	5.78	0.91487	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	D	0.93861	0.8036	M	0.77820	2.39	0.80722	D	1	D;D	0.65815	0.995;0.994	D;P	0.64042	0.921;0.813	D	0.94446	0.7663	10	0.72032	D	0.01	.	16.1027	0.81194	0.0:0.0:0.0:1.0	.	280;548	F5GX06;Q07889	.;SOS1_HUMAN	G	548;548;280;548;548	ENSP00000387784:S548G;ENSP00000384675:S548G;ENSP00000378479:S548G	ENSP00000263879:S548G	S	-	1	0	SOS1	39103431	0.794000	0.28838	1.000000	0.80357	0.924000	0.55760	1.386000	0.34419	2.198000	0.70561	0.455000	0.32223	AGT	.	.		0.383	SOS1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219948.3	NM_005633	
NRXN1	9378	hgsc.bcm.edu	37	2	50464017	50464017	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:50464017C>A	ENST00000406316.2	-	18	4932	c.3456G>T	c.(3454-3456)ctG>ctT	p.L1152L	NRXN1_ENST00000402717.3_Silent_p.L1144L|NRXN1_ENST00000401710.1_Silent_p.L170L|NRXN1_ENST00000342183.5_Silent_p.L117L|NRXN1_ENST00000401669.2_Silent_p.L1152L|NRXN1_ENST00000405472.3_Silent_p.L1144L|NRXN1_ENST00000404971.1_Silent_p.L1192L|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000406859.3_Silent_p.L1152L	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1152	Laminin G-like 6. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			AACCTATGGCCAGTCTGTCTG	0.468																																					p.L1192L		Atlas-SNP	.											NRXN1_ENST00000536085,NS,carcinoma,0,3	NRXN1	1118	.	0			c.G3576T						.						132.0	118.0	123.0					2																	50464017		2203	4300	6503	SO:0001819	synonymous_variant	9378	exon19			TATGGCCAGTCTG	AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.3456G>T	chr2.hg19:g.50464017C>A		196.0	1.0		268.0	71.0	NM_001135659	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	ENST00000406316.2	hg19	CCDS54360.1																																																																																			.	.		0.468	NRXN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325291.2		
B3GNT2	10678	hgsc.bcm.edu	37	2	62449528	62449528	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:62449528A>T	ENST00000301998.4	+	2	425	c.173A>T	c.(172-174)tAc>tTc	p.Y58F	B3GNT2_ENST00000405767.1_Missense_Mutation_p.Y58F	NM_006577.5	NP_006568.2	Q9NY97	B3GN2_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2	58					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)	18	Lung NSC(7;0.031)|all_lung(7;0.0634)		LUSC - Lung squamous cell carcinoma(7;3.55e-06)|Epithelial(17;0.0963)			CCCGAGGCATACTGGAACCGA	0.502																																					p.Y58F		Atlas-SNP	.											.	B3GNT2	34	.	0			c.A173T						.						146.0	171.0	162.0					2																	62449528		2203	4300	6503	SO:0001583	missense	10678	exon2			AGGCATACTGGAA	AB049584	CCDS1870.1	2p15	2013-02-19	2006-04-12	2006-04-12	ENSG00000170340	ENSG00000170340		"""Beta 3-glycosyltransferases"""	15629	protein-coding gene	gene with protein product		605581	"""UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 1"""	B3GNT1		9892646, 11042166	Standard	NM_006577		Approved	B3GNT-2, BETA3GNT, B3GN-T2, B3GN-T1	uc002sbs.3	Q9NY97	OTTHUMG00000129444	ENST00000301998.4:c.173A>T	chr2.hg19:g.62449528A>T	ENSP00000305595:p.Tyr58Phe	101.0	0.0		115.0	12.0	NM_006577	Q54AC1|Q9NQQ9|Q9NQR0|Q9NUT9	Missense_Mutation	SNP	ENST00000301998.4	hg19	CCDS1870.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.988060	0.35036	.	.	ENSG00000170340	ENST00000301998;ENST00000405767	T;T	0.26373	1.74;1.74	6.02	6.02	0.97574	.	0.120536	0.64402	D	0.000019	T	0.27731	0.0682	L	0.58428	1.81	0.58432	D	0.999996	B	0.09022	0.002	B	0.08055	0.003	T	0.07347	-1.0777	10	0.17369	T	0.5	.	16.5446	0.84426	1.0:0.0:0.0:0.0	.	58	Q9NY97	B3GN2_HUMAN	F	58	ENSP00000305595:Y58F;ENSP00000384692:Y58F	ENSP00000305595:Y58F	Y	+	2	0	B3GNT2	62303032	1.000000	0.71417	0.921000	0.36526	0.827000	0.46813	3.663000	0.54518	2.311000	0.77944	0.533000	0.62120	TAC	.	.		0.502	B3GNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251606.2	NM_006577	
DQX1	165545	hgsc.bcm.edu	37	2	74754135	74754135	+	5'Flank	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:74754135T>C	ENST00000404568.3	-	0	0				HTRA2_ENST00000352222.3_5'Flank|DQX1_ENST00000393951.2_5'Flank|HTRA2_ENST00000258080.3_5'Flank|AUP1_ENST00000377526.3_Missense_Mutation_p.K377E|DQX1_ENST00000495597.1_5'Flank	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1							nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						CAGGAAGACTTGGCAAATGTT	0.532																																					p.K377E		Atlas-SNP	.											.	AUP1	29	.	0			c.A1129G						.						52.0	54.0	54.0					2																	74754135		1948	4141	6089	SO:0001631	upstream_gene_variant	550	exon11			AAGACTTGGCAAA	AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965		chr2.hg19:g.74754135T>C	Exception_encountered	54.0	0.0		105.0	5.0	NM_181575	Q6B017|Q8NAM8	Missense_Mutation	SNP	ENST00000404568.3	hg19	CCDS1949.2	.	.	.	.	.	.	.	.	.	.	T	21.8	4.202405	0.79127	.	.	ENSG00000115307	ENST00000377526;ENST00000258081	.	.	.	5.36	5.36	0.76844	.	0.159108	0.56097	D	0.000029	T	0.66247	0.2770	L	0.54323	1.7	0.51012	D	0.999902	D;D;D	0.61080	0.988;0.989;0.986	P;P;P	0.58520	0.76;0.775;0.84	T	0.69292	-0.5183	9	0.72032	D	0.01	-15.7148	11.6678	0.51383	0.0:0.0:0.0:1.0	.	434;443;377	E7EU18;Q9Y679;Q9Y679-2	.;AUP1_HUMAN;.	E	377;441	.	ENSP00000258081:K441E	K	-	1	0	AUP1	74607643	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.088000	0.71371	2.246000	0.74042	0.533000	0.62120	AAG	.	.		0.532	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252230.3	NM_133637	
IL1RL2	8808	hgsc.bcm.edu	37	2	102836404	102836404	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:102836404A>G	ENST00000264257.2	+	8	1044	c.918A>G	c.(916-918)aaA>aaG	p.K306K	IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000539491.1_Silent_p.K306K|IL1RL2_ENST00000441515.2_Silent_p.K188K	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	306	Ig-like C2-type 3.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TGGAAGTGAAAATGGAAGATT	0.398																																					p.K306K		Atlas-SNP	.											.	IL1RL2	118	.	0			c.A918G						.						131.0	116.0	121.0					2																	102836404		2203	4300	6503	SO:0001819	synonymous_variant	8808	exon8			AGTGAAAATGGAA	U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.918A>G	chr2.hg19:g.102836404A>G		93.0	0.0		156.0	65.0	NM_003854	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Silent	SNP	ENST00000264257.2	hg19	CCDS2056.1																																																																																			.	.		0.398	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253290.1	NM_003854	
GLI2	2736	hgsc.bcm.edu	37	2	121747481	121747481	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:121747481T>A	ENST00000452319.1	+	14	4051	c.3991T>A	c.(3991-3993)Tcc>Acc	p.S1331T	GLI2_ENST00000361492.4_Missense_Mutation_p.S1331T|GLI2_ENST00000314490.11_Intron					GLI family zinc finger 2											NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(24)|ovary(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(3;0.0496)	Prostate(154;0.0623)				CCTGGCAGCCTCCATGAGCCA	0.662																																					p.S1331T		Atlas-SNP	.											.	GLI2	187	.	0			c.T3991A						.						19.0	20.0	19.0					2																	121747481		2200	4294	6494	SO:0001583	missense	2736	exon13			GCAGCCTCCATGA		CCDS33283.1	2q14	2013-01-25	2009-03-05		ENSG00000074047	ENSG00000074047		"""Zinc fingers, C2H2-type"""	4318	protein-coding gene	gene with protein product	"""tax-responsive element-2 holding protein"", ""tax helper protein 1"", ""tax helper protein 2"""	165230	"""GLI-Kruppel family member GLI2"", ""glioma-associated oncogene family zinc finger 2"""			2850480, 9557682	Standard	NM_005270		Approved	THP2, HPE9, THP1	uc010flp.3	P10070	OTTHUMG00000153741	ENST00000452319.1:c.3991T>A	chr2.hg19:g.121747481T>A	ENSP00000390436:p.Ser1331Thr	162.0	0.0		181.0	10.0	NM_005270		Missense_Mutation	SNP	ENST00000452319.1	hg19	CCDS33283.1	.	.	.	.	.	.	.	.	.	.	T	7.290	0.610783	0.14066	.	.	ENSG00000074047	ENST00000452319;ENST00000361492	T;T	0.14391	2.51;2.51	4.35	-7.44	0.01379	.	0.674730	0.15033	N	0.284344	T	0.03520	0.0101	N	0.08118	0	0.33388	D	0.575745	B;B	0.06786	0.0;0.001	B;B	0.04013	0.0;0.001	T	0.34950	-0.9808	9	.	.	.	.	1.2355	0.01952	0.1733:0.2848:0.1717:0.3702	.	1331;986	P10070;P10070-2	GLI2_HUMAN;.	T	1331	ENSP00000390436:S1331T;ENSP00000354586:S1331T	.	S	+	1	0	GLI2	121463951	0.000000	0.05858	0.000000	0.03702	0.958000	0.62258	-2.077000	0.01371	-1.744000	0.01338	-0.415000	0.06103	TCC	.	.		0.662	GLI2-009	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332293.3	NM_005270	
ACVR2A	92	hgsc.bcm.edu	37	2	148657133	148657133	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:148657133C>T	ENST00000241416.7	+	3	1006	c.370C>T	c.(370-372)Cag>Tag	p.Q124*	AC009480.3_ENST00000402410.2_RNA|ACVR2A_ENST00000404590.1_Nonsense_Mutation_p.Q124*|ACVR2A_ENST00000535787.1_Nonsense_Mutation_p.Q16*	NM_001278579.1|NM_001278580.1|NM_001616.3	NP_001265508.1|NP_001265509.1|NP_001607.1	P27037	AVR2A_HUMAN	activin A receptor, type IIA	124					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|determination of left/right symmetry (GO:0007368)|embryonic skeletal system development (GO:0048706)|gastrulation with mouth forming second (GO:0001702)|mesoderm development (GO:0007498)|penile erection (GO:0043084)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of protein phosphorylation (GO:0001934)|regulation of BMP signaling pathway (GO:0030510)|regulation of nitric-oxide synthase activity (GO:0050999)|Sertoli cell proliferation (GO:0060011)|sperm ejaculation (GO:0042713)|spermatogenesis (GO:0007283)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|inhibin-betaglycan-ActRII complex (GO:0034673)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|coreceptor activity (GO:0015026)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(5)|large_intestine(14)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(8)	45				BRCA - Breast invasive adenocarcinoma(221;0.0969)		GGAAGTCACACAGCGTAAGTT	0.373																																					p.Q124X		Atlas-SNP	.											.	ACVR2A	125	.	0			c.C370T						.						152.0	160.0	157.0					2																	148657133		2202	4300	6502	SO:0001587	stop_gained	92	exon3			GTCACACAGCGTA		CCDS33301.1, CCDS63030.1	2q22.2-q23.3	2008-02-05	2005-05-10	2005-05-10	ENSG00000121989	ENSG00000121989			173	protein-coding gene	gene with protein product		102581	"""activin A receptor, type II"""	ACVR2		1314589, 10702675	Standard	NM_001278579		Approved	ACTRII	uc002twh.3	P27037	OTTHUMG00000150603	ENST00000241416.7:c.370C>T	chr2.hg19:g.148657133C>T	ENSP00000241416:p.Gln124*	19.0	0.0		55.0	17.0	NM_001616	B2RAB8|B4DWQ2|D3DP85|Q53TH4|Q6NWV2|Q92474	Nonsense_Mutation	SNP	ENST00000241416.7	hg19	CCDS33301.1	.	.	.	.	.	.	.	.	.	.	C	40	8.231984	0.98717	.	.	ENSG00000121989	ENST00000241416;ENST00000535787;ENST00000404590	.	.	.	5.56	4.63	0.57726	.	0.426594	0.27572	N	0.018763	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	14.7454	0.69488	0.1435:0.8564:0.0:0.0	.	.	.	.	X	124;16;124	.	ENSP00000241416:Q124X	Q	+	1	0	ACVR2A	148373603	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.585000	0.36600	2.771000	0.95319	0.650000	0.86243	CAG	.	.		0.373	ACVR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319051.1	NM_001616	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098968	178098968	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:178098968T>G	ENST00000397062.3	-	2	631	c.77A>C	c.(76-78)cAa>cCa	p.Q26P	NFE2L2_ENST00000423513.1_Missense_Mutation_p.Q10P|NFE2L2_ENST00000446151.2_Missense_Mutation_p.Q10P|NFE2L2_ENST00000464747.1_Missense_Mutation_p.Q10P|NFE2L2_ENST00000397063.4_Missense_Mutation_p.Q10P	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	26					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q26P(1)|p.Q26L(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			ATCTATATCTTGCCTCCAAAG	0.348			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.Q26P		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,-1,2	NFE2L2	225	.	2	Substitution - Missense(2)	lung(2)	c.A77C						.						59.0	53.0	55.0					2																	178098968		1842	4098	5940	SO:0001583	missense	4780	exon2			ATATCTTGCCTCC		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.77A>C	chr2.hg19:g.178098968T>G	ENSP00000380252:p.Gln26Pro	34.0	0.0		64.0	4.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	19.38	3.816192	0.70912	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000449627;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4;1.4;1.4	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;1.0;0.999	D;D;D;D	0.85130	0.996;0.986;0.997;0.996	T	0.72959	-0.4133	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	10;10;10;26	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	P	10;26;10;10;10;10;10	ENSP00000380253:Q10P;ENSP00000380252:Q26P;ENSP00000411575:Q10P;ENSP00000391590:Q10P;ENSP00000400073:Q10P;ENSP00000412191:Q10P;ENSP00000410015:Q10P	ENSP00000380252:Q26P	Q	-	2	0	NFE2L2	177807214	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.698000	0.84413	2.210000	0.71456	0.460000	0.39030	CAA	.	.		0.348	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
COL5A2	1290	hgsc.bcm.edu	37	2	189927932	189927932	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:189927932C>T	ENST00000374866.3	-	27	2109	c.1835G>A	c.(1834-1836)gGg>gAg	p.G612E		NM_000393.3	NP_000384.2	P05997	CO5A2_HUMAN	collagen, type V, alpha 2	612					axon guidance (GO:0007411)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|negative regulation of endodermal cell differentiation (GO:1903225)|skeletal system development (GO:0001501)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			NS(3)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(53)|ovary(3)|prostate(2)|skin(6)|urinary_tract(3)	95			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.127)			GCCCATGCTCCCGGGCTGCCC	0.522																																					p.G612E		Atlas-SNP	.											.	COL5A2	230	.	0			c.G1835A						.						81.0	92.0	88.0					2																	189927932		2203	4300	6503	SO:0001583	missense	1290	exon27			ATGCTCCCGGGCT	Y14690	CCDS33350.1	2q14-q32	2014-09-17			ENSG00000204262	ENSG00000204262		"""Collagens"""	2210	protein-coding gene	gene with protein product	"""AB collagen"""	120190				1572660	Standard	NM_000393		Approved		uc002uqk.3	P05997	OTTHUMG00000149842	ENST00000374866.3:c.1835G>A	chr2.hg19:g.189927932C>T	ENSP00000364000:p.Gly612Glu	19.0	0.0		41.0	14.0	NM_000393	P78440|Q13908|Q53WR4|Q59GR4|Q6LDJ5|Q7KZ55|Q86XF6|Q96QB0|Q96QB3	Missense_Mutation	SNP	ENST00000374866.3	hg19	CCDS33350.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648970	0.87958	.	.	ENSG00000204262	ENST00000374866;ENST00000452536	D	0.99619	-6.28	4.56	4.56	0.56223	.	0.000000	0.46442	D	0.000283	D	0.99768	0.9905	H	0.95950	3.745	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.96884	0.9648	9	.	.	.	.	17.7045	0.88304	0.0:1.0:0.0:0.0	.	252;612	Q5PR22;P05997	.;CO5A2_HUMAN	E	612;252	ENSP00000364000:G612E	.	G	-	2	0	COL5A2	189636177	1.000000	0.71417	0.990000	0.47175	0.925000	0.55904	7.445000	0.80570	2.244000	0.73946	0.467000	0.42956	GGG	.	.		0.522	COL5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313523.1	NM_000393	
HIBCH	26275	hgsc.bcm.edu	37	2	191159323	191159323	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:191159323T>C	ENST00000359678.5	-	4	547	c.253A>G	c.(253-255)Att>Gtt	p.I85V	HIBCH_ENST00000392332.3_Missense_Mutation_p.I85V	NM_014362.3|NM_198047.2	NP_055177.2|NP_932164.1	Q6NVY1	HIBCH_HUMAN	3-hydroxyisobutyryl-CoA hydrolase	85					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|valine catabolic process (GO:0006574)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	3-hydroxyisobutyryl-CoA hydrolase activity (GO:0003860)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|lung(5)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	13			OV - Ovarian serous cystadenocarcinoma(117;0.000586)|Epithelial(96;0.0286)|all cancers(119;0.0814)			CCCTTTATAATGATCAGGAAA	0.393																																					p.I85V		Atlas-SNP	.											.	HIBCH	28	.	0			c.A253G						.						83.0	79.0	81.0					2																	191159323		2203	4300	6503	SO:0001583	missense	26275	exon4			TTATAATGATCAG	U66669	CCDS2304.1, CCDS46475.1	2q32.3	2010-04-29	2010-04-29		ENSG00000198130	ENSG00000198130	3.1.2.4		4908	protein-coding gene	gene with protein product		610690	"""3-hydroxyisobutyryl-Coenzyme A hydrolase"""			8824301	Standard	NM_014362		Approved		uc002uru.3	Q6NVY1	OTTHUMG00000132673	ENST00000359678.5:c.253A>G	chr2.hg19:g.191159323T>C	ENSP00000352706:p.Ile85Val	57.0	0.0		81.0	8.0	NM_014362	D3DPI4|Q53GA8|Q53GF2|Q53RF7|Q53TC6|Q92931|Q9BS94	Missense_Mutation	SNP	ENST00000359678.5	hg19	CCDS2304.1	.	.	.	.	.	.	.	.	.	.	T	12.51	1.959275	0.34565	.	.	ENSG00000198130	ENST00000392332;ENST00000359678;ENST00000409934	T;T;T	0.67523	-0.26;-0.27;-0.26	5.43	2.93	0.34026	Crotonase, core (1);	0.095807	0.64402	D	0.000001	T	0.48114	0.1482	N	0.17564	0.495	0.80722	D	1	B;B	0.19817	0.01;0.039	B;B	0.24701	0.055;0.025	T	0.20605	-1.0270	10	0.23891	T	0.37	-0.3131	10.6221	0.45487	0.0:0.0:0.3037:0.6963	.	85;85	Q6NVY1-2;Q6NVY1	.;HIBCH_HUMAN	V	85;85;139	ENSP00000376144:I85V;ENSP00000352706:I85V;ENSP00000387247:I139V	ENSP00000352706:I85V	I	-	1	0	HIBCH	190867568	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	1.434000	0.34958	0.314000	0.23086	0.460000	0.39030	ATT	.	.		0.393	HIBCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255933.1		
STRADB	55437	hgsc.bcm.edu	37	2	202344880	202344880	+	Silent	SNP	C	C	T	rs568127362	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:202344880C>T	ENST00000194530.3	+	12	1604	c.1239C>T	c.(1237-1239)gaC>gaT	p.D413D	STRADB_ENST00000392249.2_3'UTR	NM_001206864.1|NM_018571.5	NP_001193793.1|NP_061041.2	Q9C0K7	STRAB_HUMAN	STE20-related kinase adaptor beta	413					activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|cell morphogenesis (GO:0000902)|insulin receptor signaling pathway (GO:0008286)|JNK cascade (GO:0007254)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			breast(1)|large_intestine(2)|lung(5)|prostate(1)|skin(3)|stomach(1)	13						ATGAAAAAGACTCATACTGGG	0.393													C|||	61	0.0121805	0.0144	0.0144	5008	,	,		17652	0.004		0.0169	False		,,,				2504	0.0112				p.D413D		Atlas-SNP	.											.	STRADB	33	.	0			c.C1239T						.						139.0	139.0	139.0					2																	202344880		2203	4300	6503	SO:0001819	synonymous_variant	55437	exon12			AAAAGACTCATAC	AB038950	CCDS2348.1, CCDS56161.1	2q33.1	2010-09-30	2008-09-15	2008-09-15	ENSG00000082146	ENSG00000082146			13205	protein-coding gene	gene with protein product		607333	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 2"""	ALS2CR2		11161814, 14511394	Standard	NM_018571		Approved	CALS-21, PAPK, ILPIPA, ILPIP	uc002uyd.4	Q9C0K7	OTTHUMG00000132831	ENST00000194530.3:c.1239C>T	chr2.hg19:g.202344880C>T		85.0	0.0		144.0	7.0	NM_018571	Q5BKY7|Q9P1L0	Silent	SNP	ENST00000194530.3	hg19	CCDS2348.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.510128	0.00984	.	.	ENSG00000082146	ENST00000415688	.	.	.	5.32	-3.37	0.04898	.	.	.	.	.	T	0.22044	0.0531	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31420	-0.9944	4	.	.	.	.	5.6468	0.17594	0.2111:0.3213:0.0:0.4677	.	.	.	.	F	84	.	.	L	+	1	0	STRADB	202053125	0.000000	0.05858	0.000000	0.03702	0.191000	0.23601	-0.169000	0.09911	-0.631000	0.05560	-0.142000	0.14014	CTC	.	.		0.393	STRADB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256297.1	NM_018571	
OBSL1	23363	hgsc.bcm.edu	37	2	220432567	220432567	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:220432567C>A	ENST00000404537.1	-	3	1463	c.1407G>T	c.(1405-1407)ccG>ccT	p.P469P	OBSL1_ENST00000265318.4_Silent_p.P469P|OBSL1_ENST00000491370.1_5'Flank|OBSL1_ENST00000603926.1_Silent_p.P469P|OBSL1_ENST00000373873.4_Silent_p.P469P|OBSL1_ENST00000373876.1_Silent_p.P469P|OBSL1_ENST00000289656.3_Silent_p.P56P	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	469					cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		GGCAGATGACCGGCAGCTCCT	0.632																																					p.P469P		Atlas-SNP	.											OBSL1_ENST00000404537,NS,carcinoma,0,1	OBSL1	120	.	0			c.G1407T						.						44.0	49.0	47.0					2																	220432567		2152	4258	6410	SO:0001819	synonymous_variant	23363	exon3			GATGACCGGCAGC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1407G>T	chr2.hg19:g.220432567C>A		257.0	1.0		276.0	109.0	NM_001173431	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	ENST00000404537.1	hg19	CCDS46520.1																																																																																			.	.		0.632	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
TRIP12	9320	hgsc.bcm.edu	37	2	230632438	230632438	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:230632438T>A	ENST00000283943.5	-	41	5989	c.5811A>T	c.(5809-5811)acA>acT	p.T1937T	TRIP12_ENST00000389044.4_Silent_p.T1985T|TRIP12_ENST00000389045.3_Silent_p.T1667T	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1937	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TTCGGACAATTGTCAAAGGTG	0.373																																					p.T1937T		Atlas-SNP	.											.	TRIP12	207	.	0			c.A5811T						.						100.0	101.0	101.0					2																	230632438		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon41			GACAATTGTCAAA	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5811A>T	chr2.hg19:g.230632438T>A		37.0	0.0		71.0	18.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.373	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
DLEC1	9940	hgsc.bcm.edu	37	3	38138132	38138132	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:38138132A>T	ENST00000308059.6	+	15	2265	c.2244A>T	c.(2242-2244)aaA>aaT	p.K748N	DLEC1_ENST00000346219.3_Missense_Mutation_p.K748N|DLEC1_ENST00000452631.2_Missense_Mutation_p.K748N					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		TCGAGGTGAAAGGCTCAGTAG	0.483																																					p.K748N		Atlas-SNP	.											.	DLEC1	278	.	0			c.A2244T						.						138.0	134.0	135.0					3																	38138132		1935	4144	6079	SO:0001583	missense	9940	exon15			GGTGAAAGGCTCA	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.2244A>T	chr3.hg19:g.38138132A>T	ENSP00000308597:p.Lys748Asn	90.0	0.0		133.0	48.0	NM_007337		Missense_Mutation	SNP	ENST00000308059.6	hg19	CCDS2672.2	.	.	.	.	.	.	.	.	.	.	A	19.51	3.841067	0.71488	.	.	ENSG00000008226	ENST00000308059;ENST00000346219;ENST00000452631	T;T;T	0.06449	3.32;3.3;3.55	4.93	-1.51	0.08664	.	0.064020	0.64402	D	0.000012	T	0.18800	0.0451	M	0.77103	2.36	0.50632	D	0.999888	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70716	0.97;0.954;0.97	T	0.00641	-1.1631	10	0.56958	D	0.05	-18.6292	9.586	0.39517	0.5995:0.0:0.4005:0.0	.	748;748;748	F8W6T4;Q9Y238-3;Q9Y238	.;.;DLEC1_HUMAN	N	748	ENSP00000308597:K748N;ENSP00000315914:K748N;ENSP00000410427:K748N	ENSP00000308597:K748N	K	+	3	2	DLEC1	38113136	1.000000	0.71417	0.988000	0.46212	0.919000	0.55068	1.179000	0.31993	-0.202000	0.10268	0.533000	0.62120	AAA	.	.		0.483	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
SCN5A	6331	hgsc.bcm.edu	37	3	38622799	38622799	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:38622799C>T	ENST00000333535.4	-	17	3000	c.2851G>A	c.(2851-2853)Gat>Aat	p.D951N	SCN5A_ENST00000451551.2_Missense_Mutation_p.D951N|SCN5A_ENST00000413689.1_Missense_Mutation_p.D951N|SCN5A_ENST00000414099.2_Missense_Mutation_p.D951N|SCN5A_ENST00000443581.1_Missense_Mutation_p.D951N|SCN5A_ENST00000425664.1_Missense_Mutation_p.D951N|SCN5A_ENST00000450102.2_Missense_Mutation_p.D951N|SCN5A_ENST00000423572.2_Missense_Mutation_p.D951N|SCN5A_ENST00000455624.2_Missense_Mutation_p.D951N|SCN5A_ENST00000449557.2_Missense_Mutation_p.D951N			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	951					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CTGTCCTCATCAGGGGCTGTG	0.587																																					p.D951N		Atlas-SNP	.											.	SCN5A	634	.	0			c.G2851A						.						37.0	39.0	38.0					3																	38622799		2107	4254	6361	SO:0001583	missense	6331	exon17			CCTCATCAGGGGC	AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2851G>A	chr3.hg19:g.38622799C>T	ENSP00000328968:p.Asp951Asn	219.0	0.0		316.0	29.0	NM_001160160	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	ENST00000333535.4	hg19	CCDS46796.1	.	.	.	.	.	.	.	.	.	.	C	21.4	4.146333	0.77888	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.96685	-3.99;-4.02;-4.02;-4.0;-4.02;-3.99;-4.02;-4.09;-4.0;-4.0	4.59	4.59	0.56863	.	0.057015	0.64402	D	0.000002	D	0.98099	0.9373	M	0.83012	2.62	0.58432	D	0.999993	D;D;D;D;D;D;D	0.76494	0.998;0.997;0.999;0.998;0.998;0.995;0.999	P;D;D;P;P;P;D	0.77004	0.82;0.989;0.913;0.82;0.82;0.894;0.913	D	0.99050	1.0827	10	0.72032	D	0.01	.	17.6188	0.88075	0.0:1.0:0.0:0.0	.	951;951;951;951;951;951;951	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	N	951	ENSP00000398962:D951N;ENSP00000398266:D951N;ENSP00000410257:D951N;ENSP00000388797:D951N;ENSP00000397915:D951N;ENSP00000416634:D951N;ENSP00000328968:D951N;ENSP00000399524:D951N;ENSP00000403355:D951N;ENSP00000413996:D951N	ENSP00000328968:D951N	D	-	1	0	SCN5A	38597803	1.000000	0.71417	0.646000	0.29493	0.416000	0.31233	7.651000	0.83577	2.399000	0.81585	0.655000	0.94253	GAT	.	.		0.587	SCN5A-014	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000377958.1	NM_198056	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P|CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	chr3.hg19:g.41266110A>C	ENSP00000344456:p.His36Pro	182.0	0.0		283.0	83.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
DHX30	22907	hgsc.bcm.edu	37	3	47888778	47888778	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:47888778G>A	ENST00000445061.1	+	12	2352	c.1945G>A	c.(1945-1947)Gca>Aca	p.A649T	MIR1226_ENST00000408658.1_RNA|DHX30_ENST00000457607.1_Missense_Mutation_p.A677T|DHX30_ENST00000348968.4_Missense_Mutation_p.A621T|DHX30_ENST00000446256.2_Missense_Mutation_p.A610T	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	649						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		GGATGAATGCGCACTCGATTT	0.612																																					p.A649T		Atlas-SNP	.											DHX30,NS,malignant_melanoma,0,1	DHX30	101	.	0			c.G1945A						.						181.0	144.0	157.0					3																	47888778		2203	4300	6503	SO:0001583	missense	22907	exon12			GAATGCGCACTCG	AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.1945G>A	chr3.hg19:g.47888778G>A	ENSP00000405620:p.Ala649Thr	248.0	1.0		298.0	20.0	NM_138615	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Missense_Mutation	SNP	ENST00000445061.1	hg19	CCDS2759.1	.	.	.	.	.	.	.	.	.	.	G	8.312	0.822347	0.16678	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	T;T;T;T	0.02606	4.23;4.23;4.23;4.23	4.23	3.35	0.38373	.	0.502267	0.21404	N	0.075093	T	0.02047	0.0064	N	0.12961	0.28	0.09310	N	1	B;B	0.17852	0.024;0.015	B;B	0.16722	0.003;0.016	T	0.47736	-0.9094	10	0.15066	T	0.55	.	11.3391	0.49523	0.0894:0.0:0.9106:0.0	.	649;610	Q7L2E3;Q7L2E3-3	DHX30_HUMAN;.	T	610;649;621;677	ENSP00000392601:A610T;ENSP00000405620:A649T;ENSP00000343442:A621T;ENSP00000394682:A677T	ENSP00000343442:A621T	A	+	1	0	DHX30	47863782	0.941000	0.31946	0.015000	0.15790	0.858000	0.48976	2.798000	0.47884	0.967000	0.38186	0.462000	0.41574	GCA	.	.		0.612	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257495.2	NM_138615	
ITIH1	3697	hgsc.bcm.edu	37	3	52824922	52824922	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:52824922A>G	ENST00000273283.2	+	20	2503	c.2479A>G	c.(2479-2481)Acg>Gcg	p.T827A	ITIH1_ENST00000537050.1_Missense_Mutation_p.T539A|ITIH1_ENST00000542827.1_3'UTR|ITIH1_ENST00000405128.3_Missense_Mutation_p.T193A|ITIH1_ENST00000540715.1_Missense_Mutation_p.T685A	NM_002215.3	NP_002206.2	P19827	ITIH1_HUMAN	inter-alpha-trypsin inhibitor heavy chain 1	827	Hyaluronan-binding.				hyaluronan metabolic process (GO:0030212)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(16)|lung(18)|ovary(4)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	52				BRCA - Breast invasive adenocarcinoma(193;7.04e-05)|Kidney(197;0.000659)|KIRC - Kidney renal clear cell carcinoma(197;0.000795)|OV - Ovarian serous cystadenocarcinoma(275;0.0498)		GTCAGCCCGGACGCACGGGCT	0.622																																					p.T827A		Atlas-SNP	.											.	ITIH1	108	.	0			c.A2479G						.						90.0	85.0	87.0					3																	52824922		2203	4300	6503	SO:0001583	missense	3697	exon20			GCCCGGACGCACG		CCDS2864.1, CCDS54595.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055957	ENSG00000055957			6166	protein-coding gene	gene with protein product		147270	"""inter-alpha (globulin) inhibitor, H1 polypeptide"""			1385302, 10100603	Standard	NM_002215		Approved	H1P, IATIH, ITIH	uc003dfs.3	P19827	OTTHUMG00000150312	ENST00000273283.2:c.2479A>G	chr3.hg19:g.52824922A>G	ENSP00000273283:p.Thr827Ala	152.0	0.0		152.0	45.0	NM_002215	A8K9N5|B2RAH9|B7Z558|B7Z8C0|F5H165|F5H7Y8|P78455|Q01746|Q562G1	Missense_Mutation	SNP	ENST00000273283.2	hg19	CCDS2864.1	.	.	.	.	.	.	.	.	.	.	A	15.43	2.832067	0.50845	.	.	ENSG00000055957	ENST00000273283;ENST00000540715;ENST00000537050;ENST00000428133;ENST00000405128	T;T;T;T;T	0.11821	2.74;2.74;2.74;2.74;2.74	5.75	5.75	0.90469	Inter-alpha-trypsin inhibitor heavy chain, C-terminal (1);	0.171869	0.52532	D	0.000071	T	0.24661	0.0598	L	0.45744	1.44	0.36445	D	0.865709	B;D;P;D	0.65815	0.324;0.995;0.953;0.995	B;D;P;D	0.68039	0.219;0.93;0.76;0.955	T	0.18209	-1.0344	10	0.19590	T	0.45	-16.1011	9.4056	0.38460	0.9202:0.0:0.0798:0.0	.	685;193;428;827	F5H165;B5MCP1;Q9P1C5;P19827	.;.;.;ITIH1_HUMAN	A	827;685;539;380;193	ENSP00000273283:T827A;ENSP00000443973:T685A;ENSP00000443847:T539A;ENSP00000395836:T380A;ENSP00000384589:T193A	ENSP00000273283:T827A	T	+	1	0	ITIH1	52799962	1.000000	0.71417	0.994000	0.49952	0.877000	0.50540	6.084000	0.71335	2.195000	0.70347	0.533000	0.62120	ACG	.	.		0.622	ITIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317522.1	NM_002215	
PARP14	54625	hgsc.bcm.edu	37	3	122418685	122418685	+	Silent	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:122418685A>T	ENST00000474629.2	+	6	1550	c.1284A>T	c.(1282-1284)acA>acT	p.T428T		NM_017554.2	NP_060024.2	Q460N5	PAR14_HUMAN	poly (ADP-ribose) polymerase family, member 14	428					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(2)|breast(5)|cervix(2)|endometrium(7)|kidney(5)|large_intestine(8)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	50				GBM - Glioblastoma multiforme(114;0.0531)		AGTTTGATACACTTAAGGAGA	0.353																																					p.T428T		Atlas-SNP	.											.	PARP14	242	.	0			c.A1284T						.						112.0	107.0	109.0					3																	122418685		1875	4112	5987	SO:0001819	synonymous_variant	54625	exon6			TGATACACTTAAG	AB033094	CCDS46894.1	3q21	2010-02-16			ENSG00000173193	ENSG00000173193		"""Poly (ADP-ribose) polymerases"""	29232	protein-coding gene	gene with protein product		610028				15273990	Standard	NM_017554		Approved	KIAA1268, pART8	uc003efq.4	Q460N5	OTTHUMG00000159552	ENST00000474629.2:c.1284A>T	chr3.hg19:g.122418685A>T		87.0	0.0		140.0	31.0	NM_017554	B4E2H0|Q460N4|Q8J027|Q9H9X9|Q9NV60|Q9ULF2	Silent	SNP	ENST00000474629.2	hg19	CCDS46894.1																																																																																			.	.		0.353	PARP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356173.2	NM_017554	
ITGB5	3693	hgsc.bcm.edu	37	3	124592297	124592297	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:124592297T>C	ENST00000296181.4	-	2	448	c.152A>G	c.(151-153)aAa>aGa	p.K51R		NM_002213.3	NP_002204.2	P18084	ITB5_HUMAN	integrin, beta 5	51	PSI.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|epithelial cell-cell adhesion (GO:0090136)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|stress fiber assembly (GO:0043149)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell leading edge (GO:0031252)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alphav-beta5 complex (GO:0034684)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	30				GBM - Glioblastoma multiforme(114;0.163)		ACATACCTCTTTGGAGCACCA	0.483																																					p.K51R		Atlas-SNP	.											.	ITGB5	66	.	0			c.A152G						.						252.0	236.0	241.0					3																	124592297		2203	4300	6503	SO:0001583	missense	3693	exon2			ACCTCTTTGGAGC	J05633	CCDS3030.1	3q21.2	2010-03-23			ENSG00000082781	ENSG00000082781		"""Integrins"""	6160	protein-coding gene	gene with protein product		147561				2211615	Standard	NM_002213		Approved		uc003eho.3	P18084	OTTHUMG00000159432	ENST00000296181.4:c.152A>G	chr3.hg19:g.124592297T>C	ENSP00000296181:p.Lys51Arg	147.0	0.0		172.0	9.0	NM_002213	B0LPF8|B2RD70	Missense_Mutation	SNP	ENST00000296181.4	hg19	CCDS3030.1	.	.	.	.	.	.	.	.	.	.	T	14.59	2.580171	0.46006	.	.	ENSG00000082781	ENST00000296181	D	0.92699	-3.09	5.04	2.36	0.29203	Integrin beta subunit, N-terminal (2);	0.224693	0.47093	N	0.000258	D	0.87849	0.6281	L	0.60067	1.865	0.34810	D	0.737612	B	0.11235	0.004	B	0.13407	0.009	T	0.82583	-0.0385	10	0.38643	T	0.18	.	6.8438	0.23977	0.0:0.2278:0.0:0.7722	.	51	P18084	ITB5_HUMAN	R	51	ENSP00000296181:K51R	ENSP00000296181:K51R	K	-	2	0	ITGB5	126074987	1.000000	0.71417	0.998000	0.56505	0.971000	0.66376	2.262000	0.43285	0.300000	0.22699	0.379000	0.24179	AAA	.	.		0.483	ITGB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355286.3	NM_002213	
ATP13A5	344905	hgsc.bcm.edu	37	3	193029676	193029676	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:193029676A>G	ENST00000342358.4	-	20	2491	c.2374T>C	c.(2374-2376)Tgt>Cgt	p.C792R	ATP13A5-AS1_ENST00000414634.1_RNA|ATP13A5_ENST00000495496.1_5'UTR	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	792						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)	p.C792R(1)		NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		AAATGGTAACAGCTTCCTCCT	0.393																																					p.C792R		Atlas-SNP	.											ATP13A5,NS,carcinoma,0,1	ATP13A5	171	.	1	Substitution - Missense(1)	lung(1)	c.T2374C						.						145.0	133.0	137.0					3																	193029676		2203	4300	6503	SO:0001583	missense	344905	exon20			GGTAACAGCTTCC	AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2374T>C	chr3.hg19:g.193029676A>G	ENSP00000341942:p.Cys792Arg	92.0	0.0		176.0	29.0	NM_198505	Q6UWS4|Q6ZWL0	Missense_Mutation	SNP	ENST00000342358.4	hg19	CCDS33914.1	.	.	.	.	.	.	.	.	.	.	A	6.688	0.495628	0.12762	.	.	ENSG00000187527	ENST00000342358	D	0.83837	-1.77	5.44	-5.59	0.02505	HAD-like domain (1);	1.552730	0.03177	N	0.171566	T	0.65176	0.2666	N	0.24115	0.695	0.09310	N	0.999997	B	0.17268	0.021	B	0.15052	0.012	T	0.48031	-0.9070	10	0.25106	T	0.35	2.2476	0.4128	0.00444	0.2148:0.264:0.1666:0.3546	.	792	Q4VNC0	AT135_HUMAN	R	792	ENSP00000341942:C792R	ENSP00000341942:C792R	C	-	1	0	ATP13A5	194512370	0.000000	0.05858	0.004000	0.12327	0.192000	0.23643	-1.208000	0.03005	-0.555000	0.06142	0.528000	0.53228	TGT	.	.		0.393	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343012.1	NM_198505	
NRROS	375387	hgsc.bcm.edu	37	3	196387008	196387008	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr3:196387008C>T	ENST00000328557.4	+	3	697	c.494C>T	c.(493-495)gCg>gTg	p.A165V		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	165					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GTGTCCCTGGCGGGGAACACC	0.647																																					p.A165V		Atlas-SNP	.											.	LRRC33	91	.	0			c.C494T						.						36.0	36.0	36.0					3																	196387008		2203	4300	6503	SO:0001583	missense	375387	exon3			CCCTGGCGGGGAA	AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.494C>T	chr3.hg19:g.196387008C>T	ENSP00000328625:p.Ala165Val	70.0	0.0		93.0	50.0	NM_198565		Missense_Mutation	SNP	ENST00000328557.4	hg19	CCDS3319.1	.	.	.	.	.	.	.	.	.	.	C	15.82	2.944793	0.53079	.	.	ENSG00000174004	ENST00000328557	T	0.57752	0.38	5.97	4.19	0.49359	.	0.114073	0.64402	D	0.000009	T	0.39835	0.1093	L	0.35793	1.09	0.80722	D	1	B	0.30973	0.302	B	0.30105	0.111	T	0.30534	-0.9975	10	0.62326	D	0.03	.	7.0601	0.25121	0.1304:0.678:0.1255:0.066	.	165	Q86YC3	LRC33_HUMAN	V	165	ENSP00000328625:A165V	ENSP00000328625:A165V	A	+	2	0	LRRC33	197871405	0.999000	0.42202	0.730000	0.30809	0.196000	0.23810	3.964000	0.56780	0.865000	0.35603	-0.140000	0.14226	GCG	.	.		0.647	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340676.1	NM_198565	
PDCL2	132954	hgsc.bcm.edu	37	4	56422846	56422846	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:56422846T>A	ENST00000295645.4	-	6	706	c.604A>T	c.(604-606)Ata>Tta	p.I202L		NM_152401.2	NP_689614.2	Q8N4E4	PDCL2_HUMAN	phosducin-like 2	202	Thioredoxin fold. {ECO:0000250}.									endometrium(1)|kidney(1)|lung(4)|ovary(1)	7	Lung NSC(11;0.00256)|Glioma(25;0.08)|all_epithelial(27;0.0863)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(4;1.69e-07)|Lung(4;1.03e-06)|Epithelial(7;0.00669)			TCAGTCTGTATTGCTCCAACT	0.318																																					p.I202L		Atlas-SNP	.											.	PDCL2	21	.	0			c.A604T						.						99.0	87.0	91.0					4																	56422846		1835	4077	5912	SO:0001583	missense	132954	exon6			TCTGTATTGCTCC	BC034431	CCDS47059.1	4q12	2008-02-05			ENSG00000163440	ENSG00000163440			29524	protein-coding gene	gene with protein product		611676				12424248	Standard	NM_152401		Approved	GCPHLP	uc003hbb.3	Q8N4E4	OTTHUMG00000160674	ENST00000295645.4:c.604A>T	chr4.hg19:g.56422846T>A	ENSP00000295645:p.Ile202Leu	72.0	0.0		87.0	25.0	NM_152401	A8MWA2|B9ZVQ9	Missense_Mutation	SNP	ENST00000295645.4	hg19	CCDS47059.1	.	.	.	.	.	.	.	.	.	.	T	14.19	2.462565	0.43736	.	.	ENSG00000163440	ENST00000295645	T	0.27557	1.66	5.81	3.4	0.38934	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.077906	0.56097	D	0.000040	T	0.24044	0.0582	L	0.39566	1.225	0.35652	D	0.811824	B	0.12013	0.005	B	0.30401	0.115	T	0.18272	-1.0342	10	0.14252	T	0.57	-5.8095	8.1421	0.31089	0.0:0.2964:0.0:0.7036	.	202	Q8N4E4	PDCL2_HUMAN	L	202	ENSP00000295645:I202L	ENSP00000295645:I202L	I	-	1	0	PDCL2	56117603	0.969000	0.33509	1.000000	0.80357	0.995000	0.86356	0.763000	0.26517	0.475000	0.27415	0.528000	0.53228	ATA	.	.		0.318	PDCL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361659.1	NM_152401	
BBS7	55212	hgsc.bcm.edu	37	4	122747089	122747089	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:122747089T>C	ENST00000264499.4	-	19	2257	c.2074A>G	c.(2074-2076)Aaa>Gaa	p.K692E	CCNA2_ENST00000274026.5_5'Flank	NM_176824.2	NP_789794.1	Q8IWZ6	BBS7_HUMAN	Bardet-Biedl syndrome 7	692					brain development (GO:0007420)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|digestive tract morphogenesis (GO:0048546)|eye development (GO:0001654)|fat cell differentiation (GO:0045444)|heart looping (GO:0001947)|limb development (GO:0060173)|melanosome transport (GO:0032402)|nonmotile primary cilium assembly (GO:0035058)|palate development (GO:0060021)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|smoothened signaling pathway (GO:0007224)|visual perception (GO:0007601)	axoneme (GO:0005930)|BBSome (GO:0034464)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						AGGGGTACTTTAGTTTTTACA	0.318									Bardet-Biedl syndrome																												p.K692E		Atlas-SNP	.											.	BBS7	61	.	0			c.A2074G						.						86.0	90.0	89.0					4																	122747089		2203	4299	6502	SO:0001583	missense	55212	exon19	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	GTACTTTAGTTTT	AF521644	CCDS3724.1, CCDS54799.1	4q27	2013-01-08			ENSG00000138686	ENSG00000138686			18758	protein-coding gene	gene with protein product		607590					Standard	NM_176824		Approved	FLJ10715, BBS2L1	uc003ied.3	Q8IWZ6	OTTHUMG00000133076	ENST00000264499.4:c.2074A>G	chr4.hg19:g.122747089T>C	ENSP00000264499:p.Lys692Glu	18.0	0.0		37.0	10.0	NM_176824	Q4W5P8|Q8N581|Q9NVI4	Missense_Mutation	SNP	ENST00000264499.4	hg19	CCDS3724.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394128	0.83011	.	.	ENSG00000138686	ENST00000264499;ENST00000507814	T;T	0.77750	-1.12;-1.12	5.81	5.81	0.92471	.	0.049340	0.85682	D	0.000000	D	0.88051	0.6333	M	0.85945	2.785	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.88443	0.3043	10	0.42905	T	0.14	-15.727	16.1773	0.81862	0.0:0.0:0.0:1.0	.	692	Q8IWZ6	BBS7_HUMAN	E	692;115	ENSP00000264499:K692E;ENSP00000423250:K115E	ENSP00000264499:K692E	K	-	1	0	BBS7	122966539	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	6.070000	0.71220	2.217000	0.71921	0.482000	0.46254	AAA	.	.		0.318	BBS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256716.1		
MARCH6	10299	hgsc.bcm.edu	37	5	10403536	10403536	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:10403536T>A	ENST00000274140.5	+	15	1347	c.1215T>A	c.(1213-1215)acT>acA	p.T405T	MARCH6_ENST00000449913.2_Silent_p.T357T|MARCH6_ENST00000503788.1_Silent_p.T300T|MARCH6_ENST00000510792.1_Silent_p.T103T	NM_005885.3	NP_005876.2	O60337	MARH6_HUMAN	membrane-associated ring finger (C3HC4) 6, E3 ubiquitin protein ligase	405					protein K48-linked ubiquitination (GO:0070936)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin conjugating enzyme binding (GO:0031624)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(35)|ovary(1)|urinary_tract(3)	54						TTGATGCTACTCTGAAAGATC	0.413																																					p.T405T		Atlas-SNP	.											.	MARCH6	89	.	0			c.T1215A						.						139.0	127.0	131.0					5																	10403536		2203	4300	6503	SO:0001819	synonymous_variant	10299	exon15			TGCTACTCTGAAA	AB011169	CCDS34135.1, CCDS59487.1, CCDS59488.1	5p15.2	2013-01-09	2012-02-23		ENSG00000145495	ENSG00000145495		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	30550	protein-coding gene	gene with protein product		613297	"""membrane-associated ring finger (C3HC4) 6"""			14722266	Standard	NM_001270660		Approved	TEB4, MARCH-VI, RNF176	uc003jet.2	O60337	OTTHUMG00000162027	ENST00000274140.5:c.1215T>A	chr5.hg19:g.10403536T>A		108.0	0.0		176.0	12.0	NM_005885	A5PKZ4|B4DKJ2|B4DT33|D3DTC8|O14670|Q86X77	Silent	SNP	ENST00000274140.5	hg19	CCDS34135.1																																																																																			.	.		0.413	MARCH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366919.2	NM_005885	
NUDT12	83594	hgsc.bcm.edu	37	5	102895039	102895039	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:102895039C>T	ENST00000230792.2	-	3	433	c.337G>A	c.(337-339)Gaa>Aaa	p.E113K	NUDT12_ENST00000507423.1_Missense_Mutation_p.E95K	NM_031438.2	NP_113626.1	Q9BQG2	NUD12_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 12	113					NAD catabolic process (GO:0019677)|NADP catabolic process (GO:0006742)	nucleus (GO:0005634)|peroxisome (GO:0005777)	metal ion binding (GO:0046872)|NAD+ diphosphatase activity (GO:0000210)|NADH pyrophosphatase activity (GO:0035529)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|urinary_tract(1)	12		all_cancers(142;6.38e-08)|all_epithelial(76;1.99e-10)|Prostate(80;0.0138)|Lung NSC(167;0.0212)|Colorectal(57;0.0247)|all_lung(232;0.0283)|Ovarian(225;0.0423)		Epithelial(69;9.3e-13)|COAD - Colon adenocarcinoma(37;0.0221)		TCTTCCACTTCATTCGTTAGG	0.398																																					p.E113K		Atlas-SNP	.											.	NUDT12	27	.	0			c.G337A						.						62.0	66.0	65.0					5																	102895039		2202	4298	6500	SO:0001583	missense	83594	exon3			CCACTTCATTCGT	AL136592	CCDS4096.1, CCDS75284.1	5q15	2013-01-10			ENSG00000112874	ENSG00000112874		"""Nudix motif containing"", ""Ankyrin repeat domain containing"""	18826	protein-coding gene	gene with protein product	"""nucleoside diphosphate linked moiety X-type motif 12"""	609232				11230166	Standard	XM_005272095		Approved	DKFZP761I172	uc003koi.3	Q9BQG2	OTTHUMG00000128739	ENST00000230792.2:c.337G>A	chr5.hg19:g.102895039C>T	ENSP00000230792:p.Glu113Lys	67.0	0.0		143.0	35.0	NM_031438	B3KUW2|Q8TAL7	Missense_Mutation	SNP	ENST00000230792.2	hg19	CCDS4096.1	.	.	.	.	.	.	.	.	.	.	C	8.284	0.816167	0.16607	.	.	ENSG00000112874	ENST00000230792;ENST00000507423	T;T	0.16897	3.52;2.31	6.16	5.2	0.72013	Ankyrin repeat-containing domain (1);	0.896444	0.10080	N	0.718600	T	0.09069	0.0224	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.23332	-1.0191	10	0.13470	T	0.59	-6.0657	10.2597	0.43419	0.0:0.7645:0.1415:0.094	.	95;113	E7EM93;Q9BQG2	.;NUD12_HUMAN	K	113;95	ENSP00000230792:E113K;ENSP00000424521:E95K	ENSP00000230792:E113K	E	-	1	0	NUDT12	102922938	0.016000	0.18221	0.654000	0.29608	0.305000	0.27757	1.315000	0.33608	2.937000	0.99478	0.650000	0.86243	GAA	.	.		0.398	NUDT12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250650.1	NM_031438	
FBN2	2201	hgsc.bcm.edu	37	5	127674670	127674670	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:127674670A>G	ENST00000508053.1	-	32	4401	c.3427T>C	c.(3427-3429)Ttc>Ctc	p.F1143L	FBN2_ENST00000262464.4_Missense_Mutation_p.F1143L|FBN2_ENST00000507835.1_5'UTR|FBN2_ENST00000508989.1_Missense_Mutation_p.F1110L			P35556	FBN2_HUMAN	fibrillin 2	1143	EGF-like 16; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		TAGCCTTCGAAGCACTCGCAC	0.498																																					p.F1143L		Atlas-SNP	.											.	FBN2	858	.	0			c.T3427C						.						107.0	87.0	94.0					5																	127674670		2203	4300	6503	SO:0001583	missense	2201	exon26			CTTCGAAGCACTC	U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.3427T>C	chr5.hg19:g.127674670A>G	ENSP00000424571:p.Phe1143Leu	219.0	0.0		326.0	21.0	NM_001999	B4DU01|Q59ES6	Missense_Mutation	SNP	ENST00000508053.1	hg19	CCDS34222.1	.	.	.	.	.	.	.	.	.	.	A	16.85	3.235757	0.58886	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.86627	-2.15;-2.15;-2.15	5.13	5.13	0.70059	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.73265	0.3565	N	0.04787	-0.16	0.48762	D	0.999701	B;P	0.39216	0.101;0.664	B;B	0.38194	0.267;0.26	T	0.73892	-0.3839	10	0.10377	T	0.69	.	15.396	0.74794	1.0:0.0:0.0:0.0	.	1110;1143	D6RJI3;P35556	.;FBN2_HUMAN	L	1143;1143;1110	ENSP00000262464:F1143L;ENSP00000424571:F1143L;ENSP00000425596:F1110L	ENSP00000262464:F1143L	F	-	1	0	FBN2	127702569	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.860000	0.69546	2.274000	0.75844	0.477000	0.44152	TTC	.	.		0.498	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371618.2	NM_001999	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140856170	140856170	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:140856170G>T	ENST00000308177.3	+	1	591	c.487G>T	c.(487-489)Gat>Tat	p.D163Y	PCDHGA6_ENST00000517434.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB6_ENST00000520790.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	163	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D163N(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACGATCCCGATGTGGGAAG	0.567																																					p.D163Y		Atlas-SNP	.											PCDHGC3_ENST00000308177,bladder,carcinoma,0,2	PCDHGC3	173	.	2	Substitution - Missense(2)	urinary_tract(2)	c.G487T						.						53.0	56.0	55.0					5																	140856170		2203	4300	6503	SO:0001583	missense	5098	exon1			GATCCCGATGTGG	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.487G>T	chr5.hg19:g.140856170G>T	ENSP00000312070:p.Asp163Tyr	197.0	2.0		274.0	27.0	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	hg19	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.156846	0.78114	.	.	ENSG00000240184	ENST00000308177	T	0.74737	-0.87	5.27	5.27	0.74061	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.93145	0.7817	H	0.99740	4.74	0.48452	D	0.999655	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96057	0.9036	9	0.87932	D	0	.	19.0821	0.93186	0.0:0.0:1.0:0.0	.	163;163	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	Y	163	ENSP00000312070:D163Y	ENSP00000312070:D163Y	D	+	1	0	PCDHGC3	140836354	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.652000	0.98499	2.722000	0.93159	0.655000	0.94253	GAT	.	.		0.567	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
C1QTNF2	114898	hgsc.bcm.edu	37	5	159797621	159797621	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:159797621C>A	ENST00000393975.3	-	1	27	c.24G>T	c.(22-24)ccG>ccT	p.P8P		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	0					activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCAGAGCGTCGGCCCCAGGC	0.687																																					p.P8P		Atlas-SNP	.											.	C1QTNF2	33	.	0			c.G24T						.						14.0	17.0	16.0					5																	159797621		1838	4041	5879	SO:0001819	synonymous_variant	114898	exon1			GAGCGTCGGCCCC	AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.24G>T	chr5.hg19:g.159797621C>A		18.0	0.0		39.0	14.0	NM_031908		Silent	SNP	ENST00000393975.3	hg19	CCDS4351.2																																																																																			.	.		0.687	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252672.2		
HK3	3101	hgsc.bcm.edu	37	5	176318451	176318451	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:176318451G>A	ENST00000292432.5	-	3	288	c.197C>T	c.(196-198)gCc>gTc	p.A66V		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	66	Hexokinase type-1 1.|Regulatory.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGCAGGGCTGGCCTGTCCCCT	0.622																																					p.A66V		Atlas-SNP	.											.	HK3	210	.	0			c.C197T						.						95.0	93.0	94.0					5																	176318451		2203	4300	6503	SO:0001583	missense	3101	exon3			GGGCTGGCCTGTC		CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.197C>T	chr5.hg19:g.176318451G>A	ENSP00000292432:p.Ala66Val	110.0	0.0		143.0	11.0	NM_002115	Q8N1E7	Missense_Mutation	SNP	ENST00000292432.5	hg19	CCDS4407.1	.	.	.	.	.	.	.	.	.	.	G	8.237	0.805956	0.16467	.	.	ENSG00000160883	ENST00000292432	D	0.98926	-5.24	4.7	0.41	0.16387	Hexokinase, N-terminal (1);	1.279450	0.05344	N	0.530644	D	0.96334	0.8804	L	0.34521	1.04	0.09310	N	1	B	0.06786	0.001	B	0.19666	0.026	D	0.90777	0.4676	10	0.62326	D	0.03	.	7.5648	0.27872	0.0794:0.0:0.4673:0.4532	.	66	P52790	HXK3_HUMAN	V	66	ENSP00000292432:A66V	ENSP00000292432:A66V	A	-	2	0	HK3	176251057	0.004000	0.15560	0.000000	0.03702	0.015000	0.08874	0.413000	0.21148	-0.164000	0.10927	0.561000	0.74099	GCC	.	.		0.622	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253428.1		
OR2Y1	134083	hgsc.bcm.edu	37	5	180166721	180166721	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr5:180166721A>C	ENST00000307832.2	-	1	378	c.338T>G	c.(337-339)gTg>gGg	p.V113G		NM_001001657.1	NP_001001657.1	Q8NGV0	OR2Y1_HUMAN	olfactory receptor, family 2, subfamily Y, member 1	113						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20	all_cancers(89;1.25e-05)|all_epithelial(37;4.36e-06)|Renal(175;0.000159)|Lung NSC(126;0.00317)|all_lung(126;0.0041)|Breast(19;0.114)	all_cancers(40;0.0834)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACCAGGAGCACACACTCTGT	0.597																																					p.V113G		Atlas-SNP	.											.	OR2Y1	49	.	0			c.T338G						.						75.0	63.0	67.0					5																	180166721		2203	4300	6503	SO:0001583	missense	134083	exon1			AGGAGCACACACT	AB065676	CCDS34323.1	5q35	2012-08-09			ENSG00000174339	ENSG00000174339		"""GPCR / Class A : Olfactory receptors"""	14837	protein-coding gene	gene with protein product							Standard	NM_001001657		Approved		uc003mmf.1	Q8NGV0	OTTHUMG00000162237	ENST00000307832.2:c.338T>G	chr5.hg19:g.180166721A>C	ENSP00000312403:p.Val113Gly	105.0	0.0		141.0	13.0	NM_001001657	B9EIP1|Q6IFB1|Q96R16	Missense_Mutation	SNP	ENST00000307832.2	hg19	CCDS34323.1	.	.	.	.	.	.	.	.	.	.	a	10.38	1.333295	0.24167	.	.	ENSG00000174339	ENST00000307832	T	0.01474	4.85	4.41	3.22	0.36961	GPCR, rhodopsin-like superfamily (1);	0.376195	0.19865	N	0.104328	T	0.04272	0.0118	L	0.46567	1.45	0.09310	N	1	D	0.56746	0.977	P	0.55577	0.779	T	0.27157	-1.0082	10	0.87932	D	0	.	8.7168	0.34416	0.83:0.0:0.0:0.17	.	113	Q8NGV0	OR2Y1_HUMAN	G	113	ENSP00000312403:V113G	ENSP00000312403:V113G	V	-	2	0	OR2Y1	180099327	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	0.998000	0.29744	0.800000	0.34041	0.418000	0.28097	GTG	.	.		0.597	OR2Y1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368059.2	XM_068682	
HIST1H1B	3009	hgsc.bcm.edu	37	6	27834746	27834746	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:27834746T>C	ENST00000331442.3	-	1	613	c.562A>G	c.(562-564)Aag>Gag	p.K188E		NM_005322.2	NP_005313.1	P16401	H15_HUMAN	histone cluster 1, H1b	188					chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleosome assembly (GO:0006334)|positive regulation of cell growth (GO:0030307)|positive regulation of histone H3-K9 methylation (GO:0051574)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nuclear heterochromatin (GO:0005720)|nucleosome (GO:0000786)	chromatin DNA binding (GO:0031490)|histone deacetylase binding (GO:0042826)|poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(12)|prostate(2)|upper_aerodigestive_tract(2)	24						GCAGGACTCTTGGTTGCCTTT	0.582																																					p.K188E		Atlas-SNP	.											.	HIST1H1B	54	.	0			c.A562G						.						76.0	75.0	75.0					6																	27834746		2203	4300	6503	SO:0001583	missense	3009	exon1			GACTCTTGGTTGC	AF531304	CCDS4635.1	6p22.1	2012-05-04	2006-10-11	2003-02-14	ENSG00000184357	ENSG00000184357		"""Histones / Replication-dependent"""	4719	protein-coding gene	gene with protein product		142711	"""H1 histone family, member 5"", ""histone 1, H1b"""	H1F5		9031620, 9119399, 12408966	Standard	NM_005322		Approved	H1.5, H1b, H1s-3	uc003njx.3	P16401	OTTHUMG00000016139	ENST00000331442.3:c.562A>G	chr6.hg19:g.27834746T>C	ENSP00000330074:p.Lys188Glu	90.0	0.0		138.0	30.0	NM_005322	Q14529|Q3MJ42	Missense_Mutation	SNP	ENST00000331442.3	hg19	CCDS4635.1	.	.	.	.	.	.	.	.	.	.	T	13.50	2.255589	0.39896	.	.	ENSG00000184357	ENST00000331442	T	0.20069	2.1	5.19	5.19	0.71726	.	0.053885	0.64402	D	0.000001	T	0.05640	0.0148	N	0.08118	0	0.58432	D	0.999994	P	0.38473	0.633	B	0.33799	0.17	T	0.17623	-1.0363	10	0.72032	D	0.01	-5.6055	14.5461	0.68032	0.0:0.0:0.0:1.0	.	188	P16401	H15_HUMAN	E	188	ENSP00000330074:K188E	ENSP00000330074:K188E	K	-	1	0	HIST1H1B	27942725	1.000000	0.71417	0.857000	0.33713	0.041000	0.13682	4.536000	0.60636	2.103000	0.63969	0.533000	0.62120	AAG	.	.		0.582	HIST1H1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043371.1	NM_005322	
TNXB	7148	hgsc.bcm.edu	37	6	32036335	32036335	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:32036335G>C	ENST00000375244.3	-	17	6253	c.6052C>G	c.(6052-6054)Ctg>Gtg	p.L2018V	TNXB_ENST00000375247.2_Missense_Mutation_p.L2018V			P22105	TENX_HUMAN	tenascin XB	2100	Fibronectin type-III 12. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TACTGGACCAGGAAGTGGTCA	0.617																																					p.L2018V		Atlas-SNP	.											.	TNXB	553	.	0			c.C6052G						.						42.0	46.0	45.0					6																	32036335		2005	4172	6177	SO:0001583	missense	7148	exon17			GGACCAGGAAGTG	X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.6052C>G	chr6.hg19:g.32036335G>C	ENSP00000364393:p.Leu2018Val	163.0	0.0		239.0	37.0	NM_019105	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	ENST00000375244.3	hg19		.	.	.	.	.	.	.	.	.	.	G	9.639	1.138385	0.21123	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.57107	0.42;0.42	5.33	-0.283	0.12874	.	0.809168	0.10468	N	0.671168	T	0.13372	0.0324	N	0.21324	0.655	0.19300	N	0.999979	B	0.22003	0.063	B	0.21360	0.034	T	0.25676	-1.0125	10	0.25751	T	0.34	.	4.2941	0.10892	0.0774:0.3566:0.3359:0.2301	.	2018	P22105-3	.	V	2018	ENSP00000364393:L2018V;ENSP00000364396:L2018V	ENSP00000364393:L2018V	L	-	1	2	TNXB	32144313	0.001000	0.12720	0.999000	0.59377	0.647000	0.38526	-1.333000	0.02667	0.183000	0.20059	0.655000	0.94253	CTG	.	.		0.617	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000268927.2	NM_019105	
NFYA	4800	hgsc.bcm.edu	37	6	41048594	41048594	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:41048594G>A	ENST00000341376.6	+	3	321	c.120G>A	c.(118-120)caG>caA	p.Q40Q	OARD1_ENST00000480585.1_Intron|NFYA_ENST00000353205.5_Intron	NM_002505.4	NP_002496.1	P23511	NFYA_HUMAN	nuclear transcription factor Y, alpha	40	Gln-rich.				cellular lipid metabolic process (GO:0044255)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription from RNA polymerase II promoter (GO:0006366)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|large_intestine(4)|lung(2)|urinary_tract(1)	9	Ovarian(28;0.0418)|Colorectal(47;0.196)					CTGAGGCCCAGGTGGCATCCG	0.532																																					p.Q40Q		Atlas-SNP	.											.	NFYA	33	.	0			c.G120A						.						103.0	95.0	98.0					6																	41048594		2203	4300	6503	SO:0001819	synonymous_variant	4800	exon3			GGCCCAGGTGGCA		CCDS4849.1, CCDS4850.1	6p21.3	2008-11-11			ENSG00000001167	ENSG00000001167			7804	protein-coding gene	gene with protein product		189903				1774067, 9612081	Standard	NM_002505		Approved	HAP2, CBF-B, NF-YA	uc003opo.3	P23511	OTTHUMG00000014669	ENST00000341376.6:c.120G>A	chr6.hg19:g.41048594G>A		70.0	0.0		134.0	42.0	NM_002505	Q8IXU0	Silent	SNP	ENST00000341376.6	hg19	CCDS4849.1																																																																																			.	.		0.532	NFYA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040496.1		
AARS2	57505	hgsc.bcm.edu	37	6	44273478	44273478	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:44273478G>A	ENST00000244571.4	-	10	1348	c.1346C>T	c.(1345-1347)cCc>cTc	p.P449L	TMEM151B_ENST00000438774.2_Intron|RP11-444E17.6_ENST00000505802.1_Intron	NM_020745.3	NP_065796			alanyl-tRNA synthetase 2, mitochondrial											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(3)|skin(2)|stomach(1)	34	Hepatocellular(11;0.00908)|all_lung(25;0.0101)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CATGTCCAAGGGGAGTCCCAG	0.552																																					p.P449L		Atlas-SNP	.											.	AARS2	77	.	0			c.C1346T						.						110.0	111.0	111.0					6																	44273478		2203	4300	6503	SO:0001583	missense	57505	exon10			TCCAAGGGGAGTC	AB033096	CCDS34464.1	6p21.1	2012-10-26	2012-10-26	2007-02-23	ENSG00000124608	ENSG00000124608	6.1.1.7	"""Aminoacyl tRNA synthetases / Class II"""	21022	protein-coding gene	gene with protein product	"""alanine tRNA ligase 2, mitochondrial"""	612035	"""alanyl-tRNA synthetase like"", ""alanyl-tRNA synthetase 2, mitochondrial (putative)"""	AARSL		15779907, 21549344	Standard	NM_020745		Approved	KIAA1270, bA444E17.1	uc010jza.1	Q5JTZ9	OTTHUMG00000014766	ENST00000244571.4:c.1346C>T	chr6.hg19:g.44273478G>A	ENSP00000244571:p.Pro449Leu	211.0	0.0		339.0	90.0	NM_020745		Missense_Mutation	SNP	ENST00000244571.4	hg19	CCDS34464.1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.413354	0.83449	.	.	ENSG00000124608	ENST00000244571	D	0.82255	-1.59	4.62	4.62	0.57501	Alanyl-tRNA synthetase, class IIc, anti-codon-binding domain (1);Alanyl-tRNA synthetase, class IIc, core domain (1);Alanyl-tRNA synthetase, class IIc, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.93132	0.7813	H	0.95402	3.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94982	0.8126	10	0.87932	D	0	-24.2296	16.622	0.84933	0.0:0.0:1.0:0.0	.	449	Q5JTZ9	SYAM_HUMAN	L	449	ENSP00000244571:P449L	ENSP00000244571:P449L	P	-	2	0	AARS2	44381456	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	9.538000	0.98072	2.395000	0.81488	0.655000	0.94253	CCC	.	.		0.552	AARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040741.2	NM_020745	
DOPEY1	23033	hgsc.bcm.edu	37	6	83866961	83866961	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:83866961T>C	ENST00000349129.2	+	35	6925	c.6665T>C	c.(6664-6666)cTg>cCg	p.L2222P	DOPEY1_ENST00000369739.3_Missense_Mutation_p.L2213P|DOPEY1_ENST00000484282.1_3'UTR|DOPEY1_ENST00000237163.5_Intron	NM_015018.3	NP_055833.2	Q5JWR5	DOP1_HUMAN	dopey family member 1	2222					protein transport (GO:0015031)					breast(4)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(16)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	67		all_cancers(76;2.29e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00203)		BRCA - Breast invasive adenocarcinoma(397;0.053)		CAAGTGTTCCTGTTTTTCAGA	0.388																																					p.L2222P		Atlas-SNP	.											.	DOPEY1	190	.	0			c.T6665C						.						165.0	148.0	154.0					6																	83866961		2203	4300	6503	SO:0001583	missense	23033	exon35			TGTTCCTGTTTTT	AK027030	CCDS4996.1, CCDS64467.1	6q15	2013-03-05	2006-02-02	2006-02-02	ENSG00000083097	ENSG00000083097			21194	protein-coding gene	gene with protein product			"""KIAA1117"""	KIAA1117		16301316, 16303751, 10931277	Standard	NM_015018		Approved	dJ202D23.2	uc011dyy.2	Q5JWR5	OTTHUMG00000016365	ENST00000349129.2:c.6665T>C	chr6.hg19:g.83866961T>C	ENSP00000195654:p.Leu2222Pro	78.0	0.0		106.0	7.0	NM_015018	Q86XV1|Q9H5J5|Q9NSL4|Q9UPN5|Q9Y414	Missense_Mutation	SNP	ENST00000349129.2	hg19	CCDS4996.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.349059	0.82132	.	.	ENSG00000083097	ENST00000349129	T	0.52754	0.65	6.02	6.02	0.97574	.	0.072326	0.56097	D	0.000023	T	0.63943	0.2554	M	0.74467	2.265	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.997;0.997;0.997	T	0.68926	-0.5280	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	2113;2213;2222	E1P545;B2RWN9;Q5JWR5	.;.;DOP1_HUMAN	P	2222	ENSP00000195654:L2222P	ENSP00000195654:L2222P	L	+	2	0	DOPEY1	83923680	1.000000	0.71417	1.000000	0.80357	0.838000	0.47535	7.698000	0.84413	2.304000	0.77564	0.528000	0.53228	CTG	.	.		0.388	DOPEY1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043785.2	NM_015018	
OLIG3	167826	hgsc.bcm.edu	37	6	137815097	137815097	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr6:137815097T>C	ENST00000367734.2	-	1	434	c.211A>G	c.(211-213)Aaa>Gaa	p.K71E		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	71					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		TTCTTGATTTTGTACTTGCTG	0.597																																					p.K71E		Atlas-SNP	.											.	OLIG3	34	.	0			c.A211G						.						122.0	108.0	113.0					6																	137815097		2203	4300	6503	SO:0001583	missense	167826	exon1			TGATTTTGTACTT	AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.211A>G	chr6.hg19:g.137815097T>C	ENSP00000356708:p.Lys71Glu	100.0	0.0		130.0	7.0	NM_175747	Q8N8Q0	Missense_Mutation	SNP	ENST00000367734.2	hg19	CCDS5186.1	.	.	.	.	.	.	.	.	.	.	T	20.5	4.002738	0.74932	.	.	ENSG00000177468	ENST00000367734	T	0.72505	-0.66	5.44	4.25	0.50352	.	0.000000	0.85682	D	0.000000	T	0.59985	0.2234	L	0.29908	0.895	0.58432	D	0.999997	D	0.63880	0.993	P	0.55923	0.787	T	0.65768	-0.6088	10	0.62326	D	0.03	-0.0868	11.6284	0.51160	0.1335:0.0:0.0:0.8665	.	71	Q7RTU3	OLIG3_HUMAN	E	71	ENSP00000356708:K71E	ENSP00000356708:K71E	K	-	1	0	OLIG3	137856790	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.182000	0.71995	0.850000	0.35239	0.482000	0.46254	AAA	.	.		0.597	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042405.1	NM_175747	
SUN1	23353	hgsc.bcm.edu	37	7	905675	905675	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:905675T>G	ENST00000405266.1	+	17	2086	c.2062T>G	c.(2062-2064)Ttc>Gtc	p.F688V	SUN1_ENST00000452783.2_Missense_Mutation_p.F548V|SUN1_ENST00000389574.3_Missense_Mutation_p.F568V|SUN1_ENST00000456758.2_Missense_Mutation_p.F840V|SUN1_ENST00000425407.2_Missense_Mutation_p.F568V|SUN1_ENST00000413514.2_Missense_Mutation_p.F449V|SUN1_ENST00000401592.1_Missense_Mutation_p.F651V			O94901	SUN1_HUMAN	Sad1 and UNC84 domain containing 1	678	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				cytoskeletal anchoring at nuclear membrane (GO:0090286)|nuclear envelope organization (GO:0006998)|nuclear matrix anchoring at nuclear membrane (GO:0090292)	acrosomal membrane (GO:0002080)|integral component of nuclear inner membrane (GO:0005639)|nuclear envelope (GO:0005635)|SUN-KASH complex (GO:0034993)				NS(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(17)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GCTGTGGTACTTCTCGCAGTC	0.562																																					p.F651V		Atlas-SNP	.											.	SUN1	157	.	0			c.T1951G						.						89.0	93.0	92.0					7																	905675		2084	4207	6291	SO:0001583	missense	23353	exon16			TGGTACTTCTCGC	AF202724	CCDS43533.1, CCDS47525.1, CCDS55078.1, CCDS55079.1, CCDS55080.1	7p22.3	2010-01-27	2010-01-27	2010-01-27	ENSG00000164828	ENSG00000164828			18587	protein-coding gene	gene with protein product	"""Sad1 unc-84 domain protein 1"""	607723	"""unc-84 homolog A (C. elegans)"""	UNC84A		11593002	Standard	NM_001130965		Approved	KIAA0810, FLJ12407	uc021zym.1	O94901	OTTHUMG00000151426	ENST00000405266.1:c.2062T>G	chr7.hg19:g.905675T>G	ENSP00000384116:p.Phe688Val	82.0	0.0		189.0	87.0	NM_001130965	A5PL20|B3KMV7|B4DZF7|B7WNY4|B7WP53|E9PDU4|E9PF23|F8WD13|Q96CZ7|Q9HA14|Q9UH98	Missense_Mutation	SNP	ENST00000405266.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	22.1|22.1	4.239995|4.239995	0.79912|0.79912	.|.	.|.	ENSG00000164828|ENSG00000164828	ENST00000456758;ENST00000389574;ENST00000452783;ENST00000405266;ENST00000401592;ENST00000297445;ENST00000425407;ENST00000429178;ENST00000413514|ENST00000433212	T;T;T;T;T;T;T;T|.	0.43294|.	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95|.	4.94|4.94	4.94|4.94	0.65067|0.65067	Sad1/UNC-like, C-terminal (2);|.	0.252686|.	0.48286|.	D|.	0.000195|.	T|T	0.76300|0.76300	0.3968|0.3968	M|M	0.81682|0.81682	2.555|2.555	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D|.	0.89917|.	0.999;0.999;0.996;1.0;0.994;0.994|.	D;D;D;D;P;P|.	0.78314|.	0.985;0.985;0.955;0.991;0.904;0.899|.	T|T	0.78578|0.78578	-0.2150|-0.2150	10|5	0.44086|.	T|.	0.13|.	-27.9778|-27.9778	14.6072|14.6072	0.68489|0.68489	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	449;548;651;840;678;568|.	E7EP45;E9PDU4;E9PF23;A4D2Q0;O94901;O94901-5|.	.;.;.;.;SUN1_HUMAN;.|.	V|R	840;568;548;688;651;678;568;576;449|499	ENSP00000388743:F840V;ENSP00000374225:F568V;ENSP00000413439:F548V;ENSP00000384116:F688V;ENSP00000384015:F651V;ENSP00000392309:F568V;ENSP00000409909:F576V;ENSP00000389313:F449V|.	ENSP00000297445:F678V|.	F|L	+|+	1|2	0|0	SUN1|SUN1	872201|872201	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.974000|0.974000	0.67602|0.67602	2.548000|2.548000	0.45794|0.45794	1.859000|1.859000	0.53934|0.53934	0.533000|0.533000	0.62120|0.62120	TTC|CTT	.	.		0.562	SUN1-001	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000322566.1	NM_025154	
SDK1	221935	hgsc.bcm.edu	37	7	4091432	4091432	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:4091432A>T	ENST00000404826.2	+	19	3020	c.2881A>T	c.(2881-2883)Aca>Tca	p.T961S	SDK1_ENST00000389531.3_Missense_Mutation_p.T961S	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	961	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		GCCTCCCAGCACACCTCAGCT	0.527																																					p.T961S		Atlas-SNP	.											.	SDK1	361	.	0			c.A2881T						.						129.0	120.0	123.0					7																	4091432		2203	4300	6503	SO:0001583	missense	221935	exon19			CCCAGCACACCTC	AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.2881A>T	chr7.hg19:g.4091432A>T	ENSP00000385899:p.Thr961Ser	127.0	0.0		193.0	16.0	NM_152744	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	ENST00000404826.2	hg19	CCDS34590.1	.	.	.	.	.	.	.	.	.	.	A	0.015	-1.556530	0.00910	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.52983	0.64;0.64	5.62	-3.18	0.05186	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.437089	0.22169	N	0.063673	T	0.16171	0.0389	N	0.11651	0.15	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.09377	0.004;0.001	T	0.27706	-1.0066	10	0.02654	T	1	.	3.7836	0.08690	0.2295:0.3866:0.2959:0.088	.	961;961	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	S	961	ENSP00000385899:T961S;ENSP00000374182:T961S	ENSP00000374182:T961S	T	+	1	0	SDK1	4057958	0.000000	0.05858	0.002000	0.10522	0.586000	0.36452	-0.103000	0.10940	-0.443000	0.07180	-0.256000	0.11100	ACA	.	.		0.527	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323702.1	NM_152744	
VWDE	221806	hgsc.bcm.edu	37	7	12409576	12409576	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:12409576C>A	ENST00000275358.3	-	12	2544	c.2356G>T	c.(2356-2358)Gat>Tat	p.D786Y		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	786						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TGCTGTACATCCTCAGCATGG	0.498																																					p.D786Y		Atlas-SNP	.											.	VWDE	123	.	0			c.G2356T						.						86.0	69.0	74.0					7																	12409576		692	1591	2283	SO:0001583	missense	221806	exon12			GTACATCCTCAGC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2356G>T	chr7.hg19:g.12409576C>A	ENSP00000275358:p.Asp786Tyr	112.0	0.0		158.0	65.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.231088	0.39399	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.82893	-1.66	4.93	4.05	0.47172	.	0.782162	0.11761	N	0.532120	T	0.80914	0.4715	L	0.51422	1.61	0.09310	N	0.999999	P	0.45283	0.855	B	0.42214	0.38	T	0.71540	-0.4562	10	0.62326	D	0.03	.	13.1308	0.59380	0.0:0.9229:0.0:0.0771	.	786	Q8N2E2	VWDE_HUMAN	Y	786;240	ENSP00000275358:D786Y	ENSP00000275358:D786Y	D	-	1	0	VWDE	12376101	0.035000	0.19736	0.404000	0.26397	0.301000	0.27625	2.668000	0.46816	1.312000	0.45043	0.655000	0.94253	GAT	.	.		0.498	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
LRRC72	100506049	hgsc.bcm.edu	37	7	16598540	16598540	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:16598540A>G	ENST00000401542.2	+	5	400	c.343A>G	c.(343-345)Ata>Gta	p.I115V		NM_001195280.1	NP_001182209.1	A6NJI9	LRC72_HUMAN	leucine rich repeat containing 72	115																	TTCATTGCATATACTCCTGCT	0.284																																					p.I115V		Atlas-SNP	.											.	.	.	.	0			c.A343G						.																																			SO:0001583	missense	100506049	exon5			TTGCATATACTCC		CCDS56464.1	7p21.1	2011-10-07			ENSG00000205858	ENSG00000205858			42972	protein-coding gene	gene with protein product							Standard	NM_001195280		Approved		uc022aaf.1	A6NJI9	OTTHUMG00000152446	ENST00000401542.2:c.343A>G	chr7.hg19:g.16598540A>G	ENSP00000384971:p.Ile115Val	158.0	0.0		300.0	69.0	NM_001195280		Missense_Mutation	SNP	ENST00000401542.2	hg19	CCDS56464.1	.	.	.	.	.	.	.	.	.	.	A	0.381	-0.928951	0.02359	.	.	ENSG00000205858	ENST00000401542	T	0.53857	0.6	5.67	2.0	0.26442	.	.	.	.	.	T	0.35941	0.0949	N	0.20445	0.575	0.09310	N	1	.	.	.	.	.	.	T	0.23119	-1.0197	7	0.24483	T	0.36	-5.7839	8.0372	0.30499	0.7722:0.0:0.2278:0.0	.	.	.	.	V	115	ENSP00000384971:I115V	ENSP00000384971:I115V	I	+	1	0	AC005014.4	16565065	0.024000	0.19004	0.003000	0.11579	0.031000	0.12232	0.203000	0.17315	0.167000	0.19631	-0.441000	0.05720	ATA	.	.		0.284	LRRC72-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326249.2		
HDAC9	9734	hgsc.bcm.edu	37	7	18688299	18688299	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:18688299T>A	ENST00000432645.2	+	10	1451	c.1451T>A	c.(1450-1452)aTg>aAg	p.M484K	HDAC9_ENST00000456174.2_Missense_Mutation_p.M456K|HDAC9_ENST00000524023.1_Missense_Mutation_p.M407K|HDAC9_ENST00000405010.3_Missense_Mutation_p.M484K|HDAC9_ENST00000428307.2_Missense_Mutation_p.M440K|HDAC9_ENST00000401921.1_Missense_Mutation_p.M443K|HDAC9_ENST00000406451.4_Missense_Mutation_p.M484K|HDAC9_ENST00000406072.1_Missense_Mutation_p.M471K|HDAC9_ENST00000441542.2_Missense_Mutation_p.M487K|HDAC9_ENST00000417496.2_Missense_Mutation_p.M482K	NM_058176.2	NP_478056.1	Q9UKV0	HDAC9_HUMAN	histone deacetylase 9	484					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|regulation of skeletal muscle fiber development (GO:0048742)|regulation of striated muscle cell differentiation (GO:0051153)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|histone deacetylase complex (GO:0000118)|histone methyltransferase complex (GO:0035097)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(18)|liver(2)|lung(37)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	82	all_lung(11;0.187)				Valproic Acid(DB00313)	CAGATCCACATGAACAAAGTA	0.463																																					p.M487K		Atlas-SNP	.											.	HDAC9	560	.	0			c.T1460A						.						36.0	37.0	37.0					7																	18688299		2021	4180	6201	SO:0001583	missense	9734	exon10			TCCACATGAACAA	AF124924	CCDS47553.1, CCDS47554.1, CCDS47555.1, CCDS47557.1, CCDS56465.1, CCDS56466.1, CCDS56467.1, CCDS56468.1, CCDS75565.1	7p21.1	2008-05-15			ENSG00000048052	ENSG00000048052			14065	protein-coding gene	gene with protein product		606543				10523670, 10487760	Standard	NM_178425		Approved	KIAA0744, HDAC, MITR, HD7, HDAC7B	uc003sui.3	Q9UKV0	OTTHUMG00000152487	ENST00000432645.2:c.1451T>A	chr7.hg19:g.18688299T>A	ENSP00000410337:p.Met484Lys	78.0	0.0		144.0	42.0	NM_178425	A7E2F3|B7Z4I4|B7Z917|B7Z928|B7Z940|C9JS87|E7EX34|F8W9E0|O94845|O95028|Q2M2R6|Q86SL1|Q86US3	Missense_Mutation	SNP	ENST00000432645.2	hg19	CCDS47555.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102219	0.56183	.	.	ENSG00000048052	ENST00000417496;ENST00000262069;ENST00000405010;ENST00000406451;ENST00000428307;ENST00000406072;ENST00000401921;ENST00000432645;ENST00000441542;ENST00000456174;ENST00000524023;ENST00000341009	T;T;T;T;T;T;T;T;T;T	0.58060	0.94;0.95;0.36;0.95;0.95;0.37;0.36;0.36;0.97;0.95	5.28	5.28	0.74379	.	0.121996	0.36972	N	0.002306	T	0.60379	0.2264	L	0.50333	1.59	0.58432	D	0.999996	P;B;D;B;D;D;B;P;D;D;B;D;P;P	0.57899	0.851;0.337;0.978;0.289;0.963;0.978;0.013;0.774;0.981;0.967;0.013;0.981;0.61;0.665	B;B;P;B;B;P;B;B;P;B;B;P;B;B	0.53593	0.11;0.099;0.647;0.045;0.444;0.647;0.01;0.101;0.73;0.439;0.01;0.73;0.201;0.103	T	0.64993	-0.6276	10	0.87932	D	0	-18.3526	15.2052	0.73173	0.0:0.0:0.0:1.0	.	407;456;484;471;482;484;487;443;487;484;456;484;484;462	E7EX34;C9JS87;Q9UKV0-4;B5MCF1;B7Z917;Q9UKV0-2;Q68D71;Q9UKV0-6;Q9UKV0-7;Q9UKV0;B7Z928;Q9UKV0-5;Q9UKV0-3;Q8N879	.;.;.;.;.;.;.;.;.;HDAC9_HUMAN;.;.;.;.	K	482;485;484;484;440;471;443;484;487;456;407;484	ENSP00000401669:M482K;ENSP00000384382:M484K;ENSP00000384657:M484K;ENSP00000395655:M440K;ENSP00000384017:M471K;ENSP00000383912:M443K;ENSP00000410337:M484K;ENSP00000408617:M487K;ENSP00000388568:M456K;ENSP00000430036:M407K	ENSP00000262069:M485K	M	+	2	0	HDAC9	18654824	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.503000	0.81632	2.005000	0.58758	0.455000	0.32223	ATG	.	.		0.463	HDAC9-023	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000376176.1		
IGF2BP3	10643	hgsc.bcm.edu	37	7	23353255	23353255	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:23353255A>G	ENST00000258729.3	-	13	1769	c.1413T>C	c.(1411-1413)taT>taC	p.Y471Y		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	471					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						TAATTTTTCCATAAATTCTTC	0.378																																					p.Y471Y		Atlas-SNP	.											.	IGF2BP3	71	.	0			c.T1413C						.						79.0	76.0	77.0					7																	23353255		2203	4300	6503	SO:0001819	synonymous_variant	10643	exon13			TTTTCCATAAATT	AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1413T>C	chr7.hg19:g.23353255A>G		35.0	0.0		81.0	38.0	NM_006547	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Silent	SNP	ENST00000258729.3	hg19	CCDS5382.1																																																																																			.	.		0.378	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250243.2	NM_006547	
SEMA3A	10371	hgsc.bcm.edu	37	7	83643576	83643576	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:83643576A>G	ENST00000265362.4	-	7	1073	c.759T>C	c.(757-759)gaT>gaC	p.D253D	SEMA3A_ENST00000436949.1_Silent_p.D253D	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	253	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGTGTTCTCCATCTATTGCAT	0.398																																					p.D253D		Atlas-SNP	.											.	SEMA3A	121	.	0			c.T759C						.						115.0	111.0	112.0					7																	83643576		2203	4300	6503	SO:0001819	synonymous_variant	10371	exon7			TTCTCCATCTATT	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.759T>C	chr7.hg19:g.83643576A>G		64.0	0.0		100.0	46.0	NM_006080		Silent	SNP	ENST00000265362.4	hg19	CCDS5599.1																																																																																			.	.		0.398	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
PSMC2	5701	hgsc.bcm.edu	37	7	102988211	102988211	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:102988211A>C	ENST00000435765.1	+	2	464	c.53A>C	c.(52-54)gAc>gCc	p.D18A	PSMC2_ENST00000292644.3_Missense_Mutation_p.D18A|DNAJC2_ENST00000379263.3_5'Flank|PSMC2_ENST00000544811.1_5'UTR|DNAJC2_ENST00000412522.1_5'Flank	NM_002803.3	NP_002794.1	P35998	PRS7_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 2	18					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|osteoblast differentiation (GO:0001649)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	21						GATGAGAAGGACGACAAGCCC	0.587																																					p.D18A		Atlas-SNP	.											.	PSMC2	38	.	0			c.A53C						.						132.0	113.0	119.0					7																	102988211		2203	4300	6503	SO:0001583	missense	5701	exon1			AGAAGGACGACAA	D11094	CCDS5731.1	7q22.1-q22.3	2010-04-21			ENSG00000161057	ENSG00000161057		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9548	protein-coding gene	gene with protein product	"""proteasome 26S subunit, ATPase, 2"", ""mammalian suppressor of sgv-1 of yeast"", ""protease 26S subunit 7"", ""putative protein product of Nbla10058"""	154365				9473509, 1377363	Standard	NM_002803		Approved	MSS1, S7, Nbla10058	uc003vbs.3	P35998	OTTHUMG00000157206	ENST00000435765.1:c.53A>C	chr7.hg19:g.102988211A>C	ENSP00000391211:p.Asp18Ala	155.0	0.0		181.0	79.0	NM_001204453	A4D0Q1|B7Z5E2|Q3LIA5|Q9UDI3	Missense_Mutation	SNP	ENST00000435765.1	hg19	CCDS5731.1	.	.	.	.	.	.	.	.	.	.	A	16.79	3.220807	0.58560	.	.	ENSG00000161057	ENST00000457587;ENST00000425206;ENST00000435765;ENST00000292644	D;D	0.94417	-3.42;-3.42	4.34	4.34	0.51931	.	0.280303	0.40222	N	0.001155	D	0.91466	0.7306	L	0.52126	1.63	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	D	0.88373	0.2996	10	0.30854	T	0.27	-2.853	13.6346	0.62215	1.0:0.0:0.0:0.0	.	18	P35998	PRS7_HUMAN	A	18	ENSP00000391211:D18A;ENSP00000292644:D18A	ENSP00000292644:D18A	D	+	2	0	PSMC2	102775447	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	5.812000	0.69194	1.950000	0.56595	0.533000	0.62120	GAC	.	.		0.587	PSMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347922.1	NM_002803	
DOCK4	9732	hgsc.bcm.edu	37	7	111517084	111517084	+	Splice_Site	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:111517084A>G	ENST00000437633.1	-	17	2001		c.e17+1		DOCK4_ENST00000476846.1_Splice_Site|DOCK4_ENST00000428084.1_Splice_Site	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4						cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				ATTATACATTACCATTTTGTG	0.328																																					.		Atlas-SNP	.											.	DOCK4	365	.	0			c.1744+2T>C						.						53.0	51.0	52.0					7																	111517084		1823	4075	5898	SO:0001630	splice_region_variant	9732	exon18			TACATTACCATTT		CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.1744+1T>C	chr7.hg19:g.111517084A>G		41.0	0.0		87.0	6.0	NM_014705	O14584|O94824|Q8NB45	Splice_Site	SNP	ENST00000437633.1	hg19	CCDS47688.1	.	.	.	.	.	.	.	.	.	.	A	19.92	3.915907	0.73098	.	.	ENSG00000128512	ENST00000352877;ENST00000423057;ENST00000428084;ENST00000437633;ENST00000445943;ENST00000342288;ENST00000544250	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DOCK4	111304320	1.000000	0.71417	1.000000	0.80357	0.901000	0.52897	8.950000	0.93019	2.367000	0.80283	0.528000	0.53228	.	.	.		0.328	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338369.4	NM_014705	Intron
CADPS2	93664	hgsc.bcm.edu	37	7	122526154	122526154	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:122526154C>G	ENST00000449022.2	-	1	257	c.238G>C	c.(238-240)Gag>Cag	p.E80Q	CADPS2_ENST00000412584.2_Missense_Mutation_p.E80Q|CADPS2_ENST00000334010.7_Missense_Mutation_p.E80Q|CADPS2_ENST00000313070.7_Missense_Mutation_p.E80Q	NM_017954.10	NP_060424.9	Q86UW7	CAPS2_HUMAN	Ca++-dependent secretion activator 2	80					cellular response to starvation (GO:0009267)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasmic membrane-bounded vesicle (GO:0016023)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(26)|ovary(2)	43						ATCCTCCGCTCCTGCTCATCG	0.701																																					p.E80Q		Atlas-SNP	.											.	CADPS2	116	.	0			c.G238C						.						13.0	19.0	17.0					7																	122526154		2173	4266	6439	SO:0001583	missense	93664	exon1			TCCGCTCCTGCTC		CCDS47691.1, CCDS55158.1	7q31.32	2013-01-10	2008-08-28		ENSG00000081803	ENSG00000081803		"""Pleckstrin homology (PH) domain containing"""	16018	protein-coding gene	gene with protein product		609978	"""Ca++-dependent activator protein for secretion 2"""				Standard	NM_017954		Approved		uc010lkq.3	Q86UW7	OTTHUMG00000157093	ENST00000449022.2:c.238G>C	chr7.hg19:g.122526154C>G	ENSP00000398481:p.Glu80Gln	94.0	0.0		143.0	29.0	NM_001167940	A4D0X3|B7ZM56|Q658Q2|Q7Z5T7|Q8IZW9|Q8N7M4|Q9H6P4|Q9HCI1|Q9NWK8	Missense_Mutation	SNP	ENST00000449022.2	hg19	CCDS55158.1	.	.	.	.	.	.	.	.	.	.	C	19.91	3.914146	0.72983	.	.	ENSG00000081803	ENST00000313070;ENST00000334010;ENST00000420900;ENST00000545465;ENST00000412584;ENST00000449022	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	4.71	4.71	0.59529	.	0.074039	0.51477	D	0.000087	T	0.81889	0.4918	M	0.69185	2.1	0.58432	D	0.999997	B;B	0.17038	0.02;0.003	B;B	0.17722	0.019;0.004	T	0.80238	-0.1465	10	0.54805	T	0.06	-5.8539	15.1488	0.72681	0.0:1.0:0.0:0.0	.	80;80	Q86UW7-2;Q86UW7	.;CAPS2_HUMAN	Q	80;80;80;47;80;80	ENSP00000325581:E80Q;ENSP00000333940:E80Q;ENSP00000400401:E80Q;ENSP00000398481:E80Q	ENSP00000325581:E80Q	E	-	1	0	CADPS2	122313390	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.225000	0.58600	2.123000	0.65237	0.508000	0.49915	GAG	.	.		0.701	CADPS2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000347414.2	NM_017954	
MGAM	8972	hgsc.bcm.edu	37	7	141764227	141764227	+	Silent	SNP	T	T	C	rs3087317	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr7:141764227T>C	ENST00000549489.2	+	37	4484	c.4389T>C	c.(4387-4389)tgT>tgC	p.C1463C	MGAM_ENST00000475668.2_Silent_p.C1463C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1463	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	AGACCCTTTGTATGGAGAGTC	0.567													N|||	8	0.00159744	0.0045	0.0	5008	,	,		18881	0.0		0.0	False		,,,				2504	0.002				p.C1463C		Atlas-SNP	.											.	MGAM	767	.	0			c.T4389C						.						33.0	35.0	35.0					7																	141764227		1968	4170	6138	SO:0001819	synonymous_variant	8972	exon37			CCTTTGTATGGAG	AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4389T>C	chr7.hg19:g.141764227T>C		102.0	0.0		158.0	11.0	NM_004668	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	ENST00000549489.2	hg19	CCDS47727.1																																																																																			.	.		0.567	MGAM-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000351244.3		
PCM1	5108	hgsc.bcm.edu	37	8	17815276	17815276	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:17815276A>G	ENST00000519253.1	+	13	2283	c.2032A>G	c.(2032-2034)Atg>Gtg	p.M678V	PCM1_ENST00000524226.1_Missense_Mutation_p.M679V|PCM1_ENST00000325083.8_Missense_Mutation_p.M678V			Q15154	PCM1_HUMAN	pericentriolar material 1	678					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		TCTTGTTGCTATGGTACAGGT	0.323			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																p.M678V		Atlas-SNP	.		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	.	PCM1	120	.	0			c.A2032G						.						92.0	89.0	89.0					8																	17815276		1871	4116	5987	SO:0001583	missense	5108	exon13			GTTGCTATGGTAC		CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2032A>G	chr8.hg19:g.17815276A>G	ENSP00000431099:p.Met678Val	98.0	0.0		69.0	8.0	NM_006197	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Missense_Mutation	SNP	ENST00000519253.1	hg19		.	.	.	.	.	.	.	.	.	.	A	14.28	2.488814	0.44249	.	.	ENSG00000078674	ENST00000325083;ENST00000517730;ENST00000519253;ENST00000524226	T;T;T;T	0.28454	3.52;2.61;1.61;1.61	5.25	4.08	0.47627	.	0.000000	0.85682	D	0.000000	T	0.41143	0.1146	L	0.52364	1.645	0.80722	D	1	B;P;B;B	0.40834	0.433;0.73;0.433;0.433	B;P;B;B	0.53224	0.164;0.721;0.164;0.164	T	0.10543	-1.0625	10	0.30854	T	0.27	-9.2044	12.1868	0.54243	0.8718:0.0:0.0:0.1282	.	678;717;679;678	E7ETA6;E7EV93;E7EV56;Q15154	.;.;.;PCM1_HUMAN	V	678;717;678;679	ENSP00000327077:M678V;ENSP00000428131:M717V;ENSP00000431099:M678V;ENSP00000430521:M679V	ENSP00000327077:M678V	M	+	1	0	PCM1	17859556	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.609000	0.67661	1.074000	0.40909	0.477000	0.44152	ATG	.	.		0.323	PCM1-003	NOVEL	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000374800.1	NM_006197	
PDLIM2	64236	hgsc.bcm.edu	37	8	22442575	22442575	+	Missense_Mutation	SNP	T	T	A	rs2294049		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:22442575T>A	ENST00000397760.4	+	5	761	c.361T>A	c.(361-363)Tcc>Acc	p.S121T	PDLIM2_ENST00000409141.1_Missense_Mutation_p.S121T|PDLIM2_ENST00000339162.7_Missense_Mutation_p.S121T|PDLIM2_ENST00000409417.1_Missense_Mutation_p.S121T|PDLIM2_ENST00000448520.1_3'UTR|PDLIM2_ENST00000397761.2_Missense_Mutation_p.S121T|PDLIM2_ENST00000308354.7_Missense_Mutation_p.S371T|PDLIM2_ENST00000265810.4_Missense_Mutation_p.S121T			Q96JY6	PDLI2_HUMAN	PDZ and LIM domain 2 (mystique)	121	Ser-rich.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|urinary_tract(1)	9		Prostate(55;0.0421)|Breast(100;0.102)|all_epithelial(46;0.142)		BRCA - Breast invasive adenocarcinoma(99;0.00579)|Colorectal(74;0.0152)|COAD - Colon adenocarcinoma(73;0.0626)		CTTAAGGTCCTCCTACTCCAG	0.647																																					p.S371T		Atlas-SNP	.											.	PDLIM2	42	.	0			c.T1111A						.						79.0	76.0	77.0					8																	22442575		2203	4300	6503	SO:0001583	missense	64236	exon5			AGGTCCTCCTACT	AY007729	CCDS34860.1, CCDS6032.1, CCDS34861.1, CCDS6032.2	8p21.3	2012-06-27			ENSG00000120913	ENSG00000120913			13992	protein-coding gene	gene with protein product		609722					Standard	NM_021630		Approved		uc003xby.4	Q96JY6	OTTHUMG00000164270	ENST00000397760.4:c.361T>A	chr8.hg19:g.22442575T>A	ENSP00000380867:p.Ser121Thr	192.0	0.0		192.0	12.0	NM_021630	D3DSR5|J3KNH4|Q7Z584|Q86WM8|Q8WZ29|Q9H4L9|Q9H7I2	Missense_Mutation	SNP	ENST00000397760.4	hg19		.	.	.	.	.	.	.	.	.	.	T	9.292	1.050862	0.19827	.	.	ENSG00000120913	ENST00000456545;ENST00000308354;ENST00000452226;ENST00000397760;ENST00000339162;ENST00000381194;ENST00000397761;ENST00000436754;ENST00000426493;ENST00000429812;ENST00000409141;ENST00000265810;ENST00000409417	T;T;T;T;T;T;T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41;2.41	5.52	0.299	0.15771	.	0.278041	0.28821	N	0.014026	T	0.13243	0.0321	L	0.48362	1.52	0.19300	N	0.999979	P;P;P;P	0.40731	0.728;0.728;0.455;0.455	B;B;B;B	0.39339	0.297;0.168;0.081;0.081	T	0.13980	-1.0489	10	0.36615	T	0.2	-14.5621	7.1977	0.25862	0.0:0.0846:0.3846:0.5308	rs2294049;rs2294049	121;121;121;121	Q96JY6-3;Q96JY6-4;Q96JY6;C9JS55	.;.;PDLI2_HUMAN;.	T	121;371;121;121;121;121;121;121;121;121;121;121;121	ENSP00000401992:S121T;ENSP00000312634:S371T;ENSP00000394376:S121T;ENSP00000380867:S121T;ENSP00000342035:S121T;ENSP00000380868:S121T;ENSP00000397738:S121T;ENSP00000392920:S121T;ENSP00000407643:S121T;ENSP00000386868:S121T;ENSP00000265810:S121T;ENSP00000387084:S121T	ENSP00000265810:S121T	S	+	1	0	PDLIM2	22498520	0.234000	0.23783	0.167000	0.22817	0.236000	0.25371	0.037000	0.13840	-0.169000	0.10834	0.533000	0.62120	TCC	.	T|1.000;|0.000		0.647	PDLIM2-202	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000334167.1		
RBM12B	389677	hgsc.bcm.edu	37	8	94747568	94747568	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:94747568T>C	ENST00000399300.2	-	3	1284	c.1071A>G	c.(1069-1071)ccA>ccG	p.P357P	RBM12B_ENST00000517700.1_Silent_p.P357P|RBM12B_ENST00000520961.1_Intron|RP11-10N23.4_ENST00000517998.1_RNA	NM_203390.2	NP_976324.2	Q8IXT5	RB12B_HUMAN	RNA binding motif protein 12B	357	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(7)|ovary(2)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	30	Breast(36;4.14e-07)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			TTCTAGAAATTGGATCAATAT	0.368																																					p.P357P		Atlas-SNP	.											.	RBM12B	78	.	0			c.A1071G						.						95.0	92.0	93.0					8																	94747568		1853	4086	5939	SO:0001819	synonymous_variant	389677	exon3			AGAAATTGGATCA		CCDS43755.1	8q22	2014-05-20			ENSG00000183808	ENSG00000183808		"""RNA binding motif (RRM) containing"""	32310	protein-coding gene	gene with protein product							Standard	NM_203390		Approved		uc003yfz.3	Q8IXT5	OTTHUMG00000164317	ENST00000399300.2:c.1071A>G	chr8.hg19:g.94747568T>C		33.0	0.0		78.0	4.0	NM_203390	A8MYB5	Silent	SNP	ENST00000399300.2	hg19	CCDS43755.1																																																																																			.	.		0.368	RBM12B-007	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383603.1	NM_203390	
POU5F1B	5462	hgsc.bcm.edu	37	8	128428181	128428181	+	Missense_Mutation	SNP	G	G	T	rs551358165		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:128428181G>T	ENST00000465342.2	+	2	1227	c.70G>T	c.(70-72)Ggg>Tgg	p.G24W	CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.G24W|CASC8_ENST00000502082.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	24				WGA -> GGP (in Ref. 5; ADE48566/ ADE48597). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						TGGGCCATGGGGGGCGGAGCC	0.701																																					p.G24W		Atlas-SNP	.											.	POU5F1B	32	.	0			c.G70T						.						2.0	4.0	3.0					8																	128428181		506	1360	1866	SO:0001583	missense	5462	exon1			CCATGGGGGGCGG	AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.70G>T	chr8.hg19:g.128428181G>T	ENSP00000419298:p.Gly24Trp	11.0	0.0		19.0	4.0	NM_001159542	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	ENST00000465342.2	hg19	CCDS55274.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.451068	0.26074	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	D;D	0.81579	-1.51;-1.51	1.21	-1.52	0.08637	.	0.000000	0.36854	N	0.002366	D	0.82884	0.5134	M	0.66939	2.045	0.09310	N	1	D	0.89917	1.0	D	0.87578	0.998	T	0.71932	-0.4443	10	0.87932	D	0	.	1.7722	0.03014	0.2475:0.0:0.4295:0.323	.	24	Q06416	P5F1B_HUMAN	W	24	ENSP00000419298:G24W;ENSP00000375557:G24W	ENSP00000375557:G24W	G	+	1	0	POU5F1B	128497363	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.233000	0.02934	-0.394000	0.07727	0.121000	0.15741	GGG	.	.		0.701	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349649.2	NM_001159542	
PTP4A3	11156	hgsc.bcm.edu	37	8	142435203	142435203	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr8:142435203A>T	ENST00000521578.1	+	3	1106	c.161A>T	c.(160-162)gAc>gTc	p.D54V	PTP4A3_ENST00000520105.1_Missense_Mutation_p.D54V|PTP4A3_ENST00000524028.1_Intron|PTP4A3_ENST00000329397.1_Missense_Mutation_p.D54V|PTP4A3_ENST00000349124.1_Missense_Mutation_p.D54V			O75365	TP4A3_HUMAN	protein tyrosine phosphatase type IVA, member 3	54					peptidyl-tyrosine dephosphorylation (GO:0035335)	endosome (GO:0005768)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			endometrium(2)|large_intestine(1)|lung(3)	6	all_cancers(97;2.55e-15)|all_epithelial(106;1.39e-13)|Lung NSC(106;2.07e-05)|all_lung(105;2.89e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0474)			GTGACCTATGACAAAACGCCG	0.672																																					p.D54V		Atlas-SNP	.											.	PTP4A3	19	.	0			c.A161T						.						138.0	104.0	116.0					8																	142435203		2202	4300	6502	SO:0001583	missense	11156	exon2			CCTATGACAAAAC	AF041434	CCDS6382.1, CCDS6383.1	8q24.3	2011-06-09				ENSG00000184489		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9636	protein-coding gene	gene with protein product		606449					Standard	NM_032611		Approved	PRL-3, PRL-R, PRL3	uc003ywg.1	O75365		ENST00000521578.1:c.161A>T	chr8.hg19:g.142435203A>T	ENSP00000428976:p.Asp54Val	69.0	0.0		127.0	26.0	NM_032611	Q8IVN5|Q99849|Q9BTW5	Missense_Mutation	SNP	ENST00000521578.1	hg19	CCDS6383.1	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361180	0.61403	.	.	ENSG00000184489	ENST00000521578;ENST00000520105;ENST00000523147;ENST00000329397;ENST00000349124	D;T;D;T	0.83755	-1.76;0.74;-1.76;0.74	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.93588	0.7953	H	0.96048	3.76	0.80722	D	1	D;P	0.89917	1.0;0.951	D;D	0.87578	0.998;0.942	D	0.95282	0.8387	10	0.87932	D	0	-6.4064	13.5462	0.61705	1.0:0.0:0.0:0.0	.	54;54	O75365-2;O75365	.;TP4A3_HUMAN	V	54	ENSP00000428976:D54V;ENSP00000428758:D54V;ENSP00000332274:D54V;ENSP00000331730:D54V	ENSP00000332274:D54V	D	+	2	0	PTP4A3	142504385	1.000000	0.71417	0.999000	0.59377	0.149000	0.21700	5.160000	0.64929	1.945000	0.56424	0.402000	0.26972	GAC	.	.		0.672	PTP4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378977.1	NM_032611	
ROR2	4920	hgsc.bcm.edu	37	9	94495598	94495598	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:94495598G>C	ENST00000375708.3	-	6	941	c.743C>G	c.(742-744)cCg>cGg	p.P248R	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.P108R	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	248	FZ. {ECO:0000255|PROSITE- ProRule:PRU00090}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CAGCTCACGCGGCTTGGGTGT	0.647																																					p.P248R		Atlas-SNP	.											.	ROR2	167	.	0			c.C743G						.						42.0	40.0	41.0					9																	94495598		2203	4300	6503	SO:0001583	missense	4920	exon6			TCACGCGGCTTGG	M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.743C>G	chr9.hg19:g.94495598G>C	ENSP00000364860:p.Pro248Arg	25.0	0.0		26.0	10.0	NM_004560	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	ENST00000375708.3	hg19	CCDS6691.1	.	.	.	.	.	.	.	.	.	.	G	14.48	2.547936	0.45383	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	T;T	0.78816	0.48;-1.21	4.37	3.43	0.39272	Frizzled domain (2);Kringle (1);	0.180958	0.25906	N	0.027526	T	0.69269	0.3092	N	0.24115	0.695	0.48571	D	0.999679	B;B;B	0.28512	0.035;0.004;0.214	B;B;B	0.37422	0.088;0.013;0.249	T	0.66548	-0.5896	10	0.27785	T	0.31	.	15.6817	0.77373	0.0:0.1492:0.8508:0.0	.	248;248;108	A1L4F5;Q01974;B1APY4	.;ROR2_HUMAN;.	R	108;248	ENSP00000364867:P108R;ENSP00000364860:P248R	ENSP00000364860:P248R	P	-	2	0	ROR2	93535419	0.951000	0.32395	0.996000	0.52242	0.937000	0.57800	1.499000	0.35671	2.271000	0.75665	0.511000	0.50034	CCG	.	.		0.647	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053040.1		
OR13C8	138802	hgsc.bcm.edu	37	9	107331510	107331510	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:107331510C>A	ENST00000335040.1	+	1	62	c.62C>A	c.(61-63)cCa>cAa	p.P21Q		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	21						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						TCTGCCCACCCAAAGCTCCAG	0.418																																					p.P21Q		Atlas-SNP	.											.	OR13C8	77	.	0			c.C62A						.						158.0	158.0	158.0					9																	107331510		2203	4300	6503	SO:0001583	missense	138802	exon1			CCCACCCAAAGCT		CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.62C>A	chr9.hg19:g.107331510C>A	ENSP00000334068:p.Pro21Gln	51.0	0.0		55.0	11.0	NM_001004483	Q5VVG0|Q96R44	Missense_Mutation	SNP	ENST00000335040.1	hg19	CCDS35090.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888628	0.52014	.	.	ENSG00000186943	ENST00000335040	T	0.00428	7.44	4.97	4.97	0.65823	.	0.000000	0.56097	D	0.000024	T	0.01092	0.0036	M	0.73753	2.245	0.31297	N	0.688721	D	0.67145	0.996	D	0.66196	0.942	T	0.37957	-0.9683	10	0.72032	D	0.01	.	16.1185	0.81325	0.0:1.0:0.0:0.0	.	21	Q8NGS7	O13C8_HUMAN	Q	21	ENSP00000334068:P21Q	ENSP00000334068:P21Q	P	+	2	0	OR13C8	106371331	0.000000	0.05858	0.997000	0.53966	0.724000	0.41520	-0.220000	0.09215	2.741000	0.93983	0.655000	0.94253	CCA	.	.		0.418	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053480.1		
NUP188	23511	hgsc.bcm.edu	37	9	131762026	131762026	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr9:131762026A>T	ENST00000372577.2	+	34	3806	c.3785A>T	c.(3784-3786)aAg>aTg	p.K1262M		NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1262					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						ACAGAGGACAAGGACAGCATG	0.587																																					p.K1262M		Atlas-SNP	.											.	NUP188	140	.	0			c.A3785T						.						90.0	76.0	81.0					9																	131762026		2203	4300	6503	SO:0001583	missense	23511	exon34			AGGACAAGGACAG	D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.3785A>T	chr9.hg19:g.131762026A>T	ENSP00000361658:p.Lys1262Met	136.0	0.0		138.0	9.0	NM_015354	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Missense_Mutation	SNP	ENST00000372577.2	hg19	CCDS35156.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.376764	0.82682	.	.	ENSG00000095319	ENST00000356693;ENST00000372577	T	0.35236	1.32	5.28	5.28	0.74379	.	0.052075	0.85682	D	0.000000	T	0.47764	0.1463	M	0.65975	2.015	0.52099	D	0.999947	B;D	0.58620	0.233;0.983	B;P	0.50231	0.062;0.635	T	0.53401	-0.8444	10	0.72032	D	0.01	-1.0364	14.3743	0.66862	1.0:0.0:0.0:0.0	.	595;1262	E9PET9;Q5SRE5	.;NU188_HUMAN	M	1151;1262	ENSP00000361658:K1262M	ENSP00000349125:K1151M	K	+	2	0	NUP188	130801847	1.000000	0.71417	1.000000	0.80357	0.856000	0.48823	6.259000	0.72494	2.000000	0.58554	0.460000	0.39030	AAG	.	.		0.587	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054529.2		
CHAT	1103	hgsc.bcm.edu	37	10	50863255	50863255	+	Silent	SNP	C	C	T	rs201580702	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:50863255C>T	ENST00000337653.2	+	12	1902	c.1749C>T	c.(1747-1749)gcC>gcT	p.A583A	CHAT_ENST00000395562.2_Silent_p.A501A|CHAT_ENST00000395559.2_Silent_p.A465A|CHAT_ENST00000455728.2_Silent_p.A465A|CHAT_ENST00000351556.3_Silent_p.A465A|CHAT_ENST00000339797.1_Silent_p.A465A	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	583					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	TTGTGAGAGCCGTGACTGACC	0.632																																					p.A583A		Atlas-SNP	.											.	CHAT	162	.	0			c.C1749T						.						66.0	62.0	64.0					10																	50863255		2203	4300	6503	SO:0001819	synonymous_variant	1103	exon12			GAGAGCCGTGACT	AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.1749C>T	chr10.hg19:g.50863255C>T		120.0	0.0		192.0	61.0	NM_020549	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Silent	SNP	ENST00000337653.2	hg19	CCDS7232.1																																																																																			.	C|0.999;G|0.001		0.632	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047997.1	NM_020549	
PLCE1	51196	hgsc.bcm.edu	37	10	95791740	95791740	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:95791740G>A	ENST00000371380.3	+	1	1172	c.937G>A	c.(937-939)Gac>Aac	p.D313N	PLCE1_ENST00000260766.3_Missense_Mutation_p.D313N			Q9P212	PLCE1_HUMAN	phospholipase C, epsilon 1	313					activation of MAPK activity (GO:0000187)|calcium-mediated signaling (GO:0019722)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|diacylglycerol biosynthetic process (GO:0006651)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerulus development (GO:0032835)|heart development (GO:0007507)|inositol phosphate metabolic process (GO:0043647)|inositol phosphate-mediated signaling (GO:0048016)|lipid catabolic process (GO:0016042)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|phospholipid metabolic process (GO:0006644)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of GTPase activity (GO:0043547)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of protein kinase activity (GO:0045859)|regulation of Ras protein signal transduction (GO:0046578)|regulation of smooth muscle contraction (GO:0006940)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|guanyl-nucleotide exchange factor activity (GO:0005085)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|Ras GTPase binding (GO:0017016)|receptor signaling protein activity (GO:0005057)			liver(1)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	8		Colorectal(252;0.0458)				TGTAGAAGAAGACGCTTTTAA	0.383																																					p.D313N		Atlas-SNP	.											.	PLCE1	543	.	0			c.G937A						.						125.0	123.0	124.0					10																	95791740		1860	4089	5949	SO:0001583	missense	51196	exon2			GAAGAAGACGCTT		CCDS41552.1, CCDS53555.1	10q23	2010-02-22			ENSG00000138193	ENSG00000138193	3.1.4.11		17175	protein-coding gene	gene with protein product	"""nephrosis type 3"""	608414				11022047, 11022048	Standard	NM_016341		Approved	KIAA1516, PLCE, NPHS3	uc001kjk.3	Q9P212	OTTHUMG00000018789	ENST00000371380.3:c.937G>A	chr10.hg19:g.95791740G>A	ENSP00000360431:p.Asp313Asn	77.0	0.0		84.0	8.0	NM_016341	A6NGW0|A6NLA1|A7MBN7|A8K1D7|B9EIJ6|Q1X6H8|Q5VWL4|Q5VWL5|Q9H9X8|Q9HBX6|Q9HC53|Q9UHV3	Missense_Mutation	SNP	ENST00000371380.3	hg19	CCDS41552.1	.	.	.	.	.	.	.	.	.	.	G	15.71	2.912625	0.52439	.	.	ENSG00000138193	ENST00000260766;ENST00000371380	T;T	0.70631	-0.5;-0.5	5.28	5.28	0.74379	Ras guanine nucleotide exchange factor, domain (1);	0.280907	0.25288	N	0.031748	T	0.66761	0.2822	N	0.24115	0.695	0.80722	D	1	D;D	0.56035	0.974;0.974	P;P	0.47981	0.563;0.563	T	0.72100	-0.4392	10	0.66056	D	0.02	.	18.9486	0.92632	0.0:0.0:1.0:0.0	.	313;313	B7ZM61;Q9P212	.;PLCE1_HUMAN	N	313	ENSP00000260766:D313N;ENSP00000360431:D313N	ENSP00000260766:D313N	D	+	1	0	PLCE1	95781730	1.000000	0.71417	0.864000	0.33941	0.079000	0.17450	7.224000	0.78042	2.479000	0.83701	0.655000	0.94253	GAC	.	.		0.383	PLCE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049469.3	NM_016341	
DOCK1	1793	hgsc.bcm.edu	37	10	129216713	129216713	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr10:129216713G>T	ENST00000280333.6	+	45	4646	c.4537G>T	c.(4537-4539)Gat>Tat	p.D1513Y		NM_001380.3	NP_001371.1	Q14185	DOCK1_HUMAN	dedicator of cytokinesis 1	1513	DHR-2.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|hematopoietic progenitor cell differentiation (GO:0002244)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|phagocytosis, engulfment (GO:0006911)|positive regulation of GTPase activity (GO:0043547)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			NS(2)|breast(1)|central_nervous_system(7)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(10)|lung(15)|ovary(4)|prostate(3)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	72		all_epithelial(44;2.3e-07)|all_lung(145;0.00466)|Lung NSC(174;0.00685)|Colorectal(57;0.0107)|Renal(717;0.0113)|Breast(234;0.0492)|all_neural(114;0.108)|all_hematologic(284;0.14)		BRCA - Breast invasive adenocarcinoma(275;0.0221)|Colorectal(40;0.115)		GCAGCACCTGGATGACCCCAG	0.572																																					p.D1513Y		Atlas-SNP	.											.	DOCK1	188	.	0			c.G4537T						.						68.0	81.0	77.0					10																	129216713		2202	4300	6502	SO:0001583	missense	1793	exon45			CACCTGGATGACC	D50857	CCDS73222.1	10q26.13-q26.3	2009-10-28			ENSG00000150760	ENSG00000150760			2987	protein-coding gene	gene with protein product	"""DOwnstream of CrK"""	601403	"""dedicator of cyto-kinesis 1"""			8657152, 8661160	Standard	XM_006717681		Approved	DOCK180, ced5	uc001ljt.3	Q14185	OTTHUMG00000019249	ENST00000280333.6:c.4537G>T	chr10.hg19:g.129216713G>T	ENSP00000280333:p.Asp1513Tyr	77.0	0.0		96.0	33.0	NM_001380	A9Z1Z5	Missense_Mutation	SNP	ENST00000280333.6	hg19		.	.	.	.	.	.	.	.	.	.	G	12.63	1.994854	0.35226	.	.	ENSG00000150760	ENST00000280333	T	0.03801	3.8	4.8	2.88	0.33553	.	0.286549	0.37012	N	0.002294	T	0.02727	0.0082	N	0.08118	0	0.33355	D	0.571548	B;B;B	0.34015	0.018;0.435;0.085	B;B;B	0.37508	0.011;0.252;0.094	T	0.29305	-1.0016	10	0.56958	D	0.05	.	3.9981	0.09568	0.2509:0.207:0.5421:0.0	.	1513;1579;1513	B2RUU3;A8MU08;Q14185	.;.;DOCK1_HUMAN	Y	1513	ENSP00000280333:D1513Y	ENSP00000280333:D1513Y	D	+	1	0	DOCK1	129106703	0.953000	0.32496	0.989000	0.46669	0.982000	0.71751	2.780000	0.47742	1.230000	0.43646	0.555000	0.69702	GAT	.	.		0.572	DOCK1-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000050979.2	NM_001380	
SLC22A18AS	5003	hgsc.bcm.edu	37	11	2920824	2920824	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:2920824C>G	ENST00000533594.1	-	3	604	c.108G>C	c.(106-108)agG>agC	p.R36S	SLC22A18_ENST00000312221.5_5'Flank|SLC22A18_ENST00000347936.2_5'Flank|SLC22A18AS_ENST00000455942.2_Intron|SLC22A18_ENST00000449793.2_5'Flank|SLC22A18_ENST00000380574.1_5'Flank	NM_007105.2	NP_009036.2	Q8N1D0	BWR1B_HUMAN	solute carrier family 22 (organic cation transporter), member 18 antisense	36										NS(1)|endometrium(2)	3						AAAGCCGCTTCCTCTGGAGGA	0.577																																					p.R36S		Atlas-SNP	.											.	SLC22A18AS	7	.	0			c.G108C						.						53.0	47.0	49.0					11																	2920824		692	1591	2283	SO:0001583	missense	5003	exon3			CCGCTTCCTCTGG	AF035407	CCDS7739.1	11p15.5	2011-02-10	2005-08-23	2005-08-23	ENSG00000254827	ENSG00000254827			10965	protein-coding gene	gene with protein product		603240	"""solute carrier family 22 (organic cation transporter), member 1-like antisense"""	BWSCR1B, ORCTL2S, SLC22A1LS		9570947, 9520460, 15175115	Standard	NM_007105		Approved	BWR1B, p27-BWR1B	uc001lwv.4	Q8N1D0	OTTHUMG00000010038	ENST00000533594.1:c.108G>C	chr11.hg19:g.2920824C>G	ENSP00000433282:p.Arg36Ser	49.0	0.0		66.0	17.0	NM_007105	E9PLK8|O43563	Missense_Mutation	SNP	ENST00000533594.1	hg19	CCDS7739.1	.	.	.	.	.	.	.	.	.	.	C	6.737	0.504739	0.12822	.	.	ENSG00000254827	ENST00000533594	T	0.39056	1.1	2.4	-4.81	0.03180	.	.	.	.	.	T	0.17831	0.0428	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15065	-1.0450	9	0.87932	D	0	.	3.1875	0.06606	0.2076:0.1753:0.5005:0.1166	.	36	E9PLK8	.	S	36	ENSP00000433282:R36S	ENSP00000433282:R36S	R	-	3	2	SLC22A18AS	2877400	0.006000	0.16342	0.000000	0.03702	0.111000	0.19643	-0.598000	0.05706	-1.680000	0.01450	-0.651000	0.03910	AGG	.	.		0.577	SLC22A18AS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000027771.3	NM_007105	
DNHD1	144132	hgsc.bcm.edu	37	11	6566625	6566625	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:6566625A>G	ENST00000527990.2	+	19	4456	c.4456A>G	c.(4456-4458)Aag>Gag	p.K1486E	DNHD1_ENST00000254579.6_Missense_Mutation_p.K1486E			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1486					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCAACTGCCCAAGCAAAACAA	0.577																																					p.K1486E		Atlas-SNP	.											.	DNHD1	198	.	0			c.A4456G						.						32.0	33.0	33.0					11																	6566625		692	1591	2283	SO:0001583	missense	144132	exon21			CTGCCCAAGCAAA	AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.4456A>G	chr11.hg19:g.6566625A>G	ENSP00000436180:p.Lys1486Glu	156.0	0.0		181.0	47.0	NM_144666	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	ENST00000527990.2	hg19	CCDS44532.1	.	.	.	.	.	.	.	.	.	.	A	0.005	-2.196522	0.00299	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.26067	1.76;1.76	4.91	2.92	0.33932	.	1.021260	0.07825	N	0.960421	T	0.07503	0.0189	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.26155	-1.0111	10	0.02654	T	1	.	7.5823	0.27972	0.149:0.5261:0.3249:0.0	.	1486	Q96M86	DNHD1_HUMAN	E	1486	ENSP00000254579:K1486E;ENSP00000436180:K1486E	ENSP00000254579:K1486E	K	+	1	0	DNHD1	6523201	0.015000	0.18098	0.088000	0.20740	0.003000	0.03518	1.633000	0.37113	1.264000	0.44198	-0.619000	0.04042	AAG	.	.		0.577	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384673.2	NM_144666	
PIK3C2A	5286	hgsc.bcm.edu	37	11	17141377	17141377	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:17141377C>T	ENST00000265970.7	-	15	2801	c.2802G>A	c.(2800-2802)tgG>tgA	p.W934*	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_Nonsense_Mutation_p.W554*	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	934	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						ACAATGCAGGCCACTGGTGAA	0.368																																					p.W934X		Atlas-SNP	.											.	PIK3C2A	148	.	0			c.G2802A						.						124.0	126.0	125.0					11																	17141377		2200	4293	6493	SO:0001587	stop_gained	5286	exon15			TGCAGGCCACTGG	Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.2802G>A	chr11.hg19:g.17141377C>T	ENSP00000265970:p.Trp934*	94.0	0.0		116.0	40.0	NM_002645	B0LPH2|B4E2G4|Q14CQ9	Nonsense_Mutation	SNP	ENST00000265970.7	hg19	CCDS7824.1	.	.	.	.	.	.	.	.	.	.	C	38	6.764357	0.97821	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.337	18.4903	0.90844	0.0:1.0:0.0:0.0	.	.	.	.	X	934;554	.	ENSP00000265970:W934X	W	-	3	0	PIK3C2A	17097953	1.000000	0.71417	1.000000	0.80357	0.446000	0.32137	7.435000	0.80391	2.363000	0.80096	0.585000	0.79938	TGG	.	.		0.368	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387553.1	NM_002645	
CAPRIN1	4076	hgsc.bcm.edu	37	11	34101204	34101204	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:34101204G>A	ENST00000341394.4	+	7	907	c.718G>A	c.(718-720)Gtt>Att	p.V240I	CAPRIN1_ENST00000389645.3_Missense_Mutation_p.V240I|CAPRIN1_ENST00000530820.1_Missense_Mutation_p.V240I|CAPRIN1_ENST00000532820.1_Missense_Mutation_p.V240I|CAPRIN1_ENST00000529307.1_Missense_Mutation_p.V159I	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	240					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				TGTTGAGCGTGTTTTTCAGTC	0.423																																					p.V240I		Atlas-SNP	.											.	CAPRIN1	110	.	0			c.G718A						.						94.0	92.0	93.0					11																	34101204		2202	4298	6500	SO:0001583	missense	4076	exon7			GAGCGTGTTTTTC	BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.718G>A	chr11.hg19:g.34101204G>A	ENSP00000340329:p.Val240Ile	82.0	0.0		72.0	19.0	NM_203364	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Missense_Mutation	SNP	ENST00000341394.4	hg19	CCDS31453.1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.974305	0.34848	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	T;T;T;T;T	0.30182	1.54;1.54;1.54;1.54;1.54	5.56	4.43	0.53597	.	0.104805	0.64402	D	0.000004	T	0.10809	0.0264	N	0.08118	0	0.44395	D	0.9973	B;B	0.15930	0.015;0.008	B;B	0.15484	0.01;0.013	T	0.30650	-0.9971	10	0.02654	T	1	-6.4504	4.1179	0.10090	0.3154:0.0:0.6846:0.0	.	240;240	Q14444;Q14444-2	CAPR1_HUMAN;.	I	240;240;240;240;159	ENSP00000340329:V240I;ENSP00000374296:V240I;ENSP00000434150:V240I;ENSP00000434204:V240I;ENSP00000431581:V159I	ENSP00000340329:V240I	V	+	1	0	CAPRIN1	34057780	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.115000	0.57865	2.779000	0.95612	0.637000	0.83480	GTT	.	.		0.423	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000388680.2	NM_005898	
ACCSL	390110	hgsc.bcm.edu	37	11	44073229	44073229	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:44073229T>A	ENST00000378832.1	+	5	788	c.732T>A	c.(730-732)tcT>tcA	p.S244S		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	244					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						GCTGCTGCTCTGTCTTCTGTG	0.498																																					p.S244S		Atlas-SNP	.											.	ACCSL	57	.	0			c.T732A						.						311.0	302.0	305.0					11																	44073229		2104	4217	6321	SO:0001819	synonymous_variant	390110	exon5			CTGCTCTGTCTTC		CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.732T>A	chr11.hg19:g.44073229T>A		152.0	0.0		234.0	10.0	NM_001031854		Silent	SNP	ENST00000378832.1	hg19	CCDS41636.1																																																																																			.	.		0.498	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389717.1	NM_001031854	
SPI1	6688	hgsc.bcm.edu	37	11	47381502	47381502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:47381502G>T	ENST00000378538.3	-	3	454	c.232C>A	c.(232-234)Ccc>Acc	p.P78T	SPI1_ENST00000533030.1_Intron|SPI1_ENST00000227163.4_Missense_Mutation_p.P79T|SPI1_ENST00000533968.1_Missense_Mutation_p.P78T	NM_001080547.1|NM_003120.2	NP_001074016.1|NP_003111.2	P17947	SPI1_HUMAN	Spi-1 proto-oncogene	78					anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|erythrocyte differentiation (GO:0030218)|granulocyte differentiation (GO:0030851)|histone H3 acetylation (GO:0043966)|hypermethylation of CpG island (GO:0044027)|lymphocyte differentiation (GO:0030098)|lymphoid progenitor cell differentiation (GO:0002320)|macrophage differentiation (GO:0030225)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of histone H4 acetylation (GO:0090241)|negative regulation of MHC class II biosynthetic process (GO:0045347)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of erythrocyte differentiation (GO:0045646)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|somatic stem cell maintenance (GO:0035019)	nuclear chromatin (GO:0000790)	core promoter binding (GO:0001047)|NFAT protein binding (GO:0051525)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(4)|ovary(1)	8				Lung(87;0.0967)		AGCTGCGGGGGCTGCACGCTC	0.632																																					p.P79T		Atlas-SNP	.											.	SPI1	21	.	0			c.C235A						.						52.0	44.0	47.0					11																	47381502		2201	4298	6499	SO:0001583	missense	6688	exon3			GCGGGGGCTGCAC	X52056	CCDS7933.2, CCDS44591.1	11p12-p11.22	2014-06-25	2014-06-25		ENSG00000066336	ENSG00000066336			11241	protein-coding gene	gene with protein product	"""hematopoietic transcription factor PU.1"", ""31 kDa transforming protein"""	165170	"""spleen focus forming virus (SFFV) proviral integration oncogene"""			1693183	Standard	NM_003120		Approved	PU.1, SPI-A, OF, SFPI1, SPI-1	uc001nfb.1	P17947	OTTHUMG00000150150	ENST00000378538.3:c.232C>A	chr11.hg19:g.47381502G>T	ENSP00000367799:p.Pro78Thr	23.0	0.0		28.0	9.0	NM_001080547		Missense_Mutation	SNP	ENST00000378538.3	hg19	CCDS7933.2	.	.	.	.	.	.	.	.	.	.	G	11.36	1.617186	0.28801	.	.	ENSG00000066336	ENST00000378538;ENST00000227163;ENST00000533968	T;T;T	0.46819	0.86;0.86;0.86	3.59	2.66	0.31614	.	0.190216	0.47093	D	0.000247	T	0.59676	0.2211	M	0.65975	2.015	0.39020	D	0.959725	D;B;B	0.76494	0.999;0.003;0.035	D;B;B	0.69479	0.964;0.008;0.029	T	0.60459	-0.7259	10	0.09843	T	0.71	-13.8829	13.3339	0.60505	0.0:0.1594:0.8406:0.0	.	78;78;79	F5H3K6;P17947;P17947-2	.;SPI1_HUMAN;.	T	78;79;78	ENSP00000367799:P78T;ENSP00000227163:P79T;ENSP00000438846:P78T	ENSP00000227163:P79T	P	-	1	0	SPI1	47338078	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.392000	0.34486	0.821000	0.34540	0.655000	0.94253	CCC	.	.		0.632	SPI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316571.1	NM_003120	
SLC22A8	9376	hgsc.bcm.edu	37	11	62768191	62768191	+	Splice_Site	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:62768191C>A	ENST00000336232.2	-	3	573		c.e3+1		SLC22A8_ENST00000535878.1_Splice_Site|SLC22A8_ENST00000545207.1_Splice_Site|SLC22A8_ENST00000311438.8_Splice_Site|SLC22A8_ENST00000430500.2_Splice_Site|SLC22A8_ENST00000542795.1_Splice_Site	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8						glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	CCATGTCTCACCTGTCAGACA	0.567																																					.		Atlas-SNP	.											.	SLC22A8	60	.	0			c.437+1G>T						.						127.0	92.0	104.0					11																	62768191		2201	4298	6499	SO:0001630	splice_region_variant	9376	exon4			GTCTCACCTGTCA	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.437+1G>T	chr11.hg19:g.62768191C>A		125.0	0.0		184.0	8.0	NM_004254	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Splice_Site	SNP	ENST00000336232.2	hg19	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594840	0.46318	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	.	.	.	4.45	4.45	0.53987	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7761	0.57448	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC22A8	62524767	1.000000	0.71417	1.000000	0.80357	0.588000	0.36517	6.022000	0.70839	2.456000	0.83038	0.313000	0.20887	.	.	.		0.567	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	Intron
SPCS2	9789	hgsc.bcm.edu	37	11	74676881	74676881	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:74676881C>A	ENST00000263672.6	+	3	311	c.272C>A	c.(271-273)tCc>tAc	p.S91Y	SPCS2_ENST00000528265.1_Intron|SPCS2_ENST00000530257.1_Intron|RNU6-216P_ENST00000363282.1_RNA|SPCS2_ENST00000526361.1_Intron	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)	91					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						TGTACAATCTCCTGTTTCTTT	0.393																																					p.S91Y		Atlas-SNP	.											.	SPCS2	17	.	0			c.C272A						.						142.0	132.0	135.0					11																	74676881		1799	4040	5839	SO:0001583	missense	9789	exon3			CAATCTCCTGTTT	D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517	ENST00000263672.6:c.272C>A	chr11.hg19:g.74676881C>A	ENSP00000263672:p.Ser91Tyr	66.0	0.0		68.0	22.0	NM_014752	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	Missense_Mutation	SNP	ENST00000263672.6	hg19	CCDS44681.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.495202	0.85069	.	.	ENSG00000118363	ENST00000263672;ENST00000532972;ENST00000526883	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.79551	0.4465	M	0.80616	2.505	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	T	0.81422	-0.0940	9	0.62326	D	0.03	-1.6163	14.9491	0.71057	0.0:1.0:0.0:0.0	.	91	Q15005	SPCS2_HUMAN	Y	91;122;95	.	ENSP00000263672:S91Y	S	+	2	0	SPCS2	74354529	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.048000	0.76606	2.665000	0.90641	0.563000	0.77884	TCC	.	.		0.393	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000384587.1	NM_014752	
NXPE2	120406	hgsc.bcm.edu	37	11	114577377	114577377	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr11:114577377A>C	ENST00000389586.4	+	6	1595	c.1405A>C	c.(1405-1407)Att>Ctt	p.I469L	NXPE2_ENST00000375475.5_Intron	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2	469						integral component of membrane (GO:0016021)											GGCCATCAATATTCAAAAGGC	0.443																																					p.I469L		Atlas-SNP	.											.	.	.	.	0			c.A1405C						.						69.0	57.0	61.0					11																	114577377		692	1591	2283	SO:0001583	missense	120406	exon6			ATCAATATTCAAA	AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293	ENST00000389586.4:c.1405A>C	chr11.hg19:g.114577377A>C	ENSP00000374237:p.Ile469Leu	125.0	0.0		147.0	8.0	NM_182495	Q2NKI8	Missense_Mutation	SNP	ENST00000389586.4	hg19	CCDS44738.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.128198	0.56721	.	.	ENSG00000204361	ENST00000389586	T	0.20881	2.04	5.37	-8.12	0.01078	.	0.463681	0.15942	N	0.237143	T	0.14141	0.0342	L	0.54323	1.7	0.53688	D	0.999979	P	0.36753	0.568	B	0.34093	0.175	T	0.09143	-1.0688	10	0.51188	T	0.08	.	9.6192	0.39710	0.1837:0.0:0.6095:0.2068	.	469	Q96DL1	FA55B_HUMAN	L	469	ENSP00000374237:I469L	ENSP00000374237:I469L	I	+	1	0	FAM55B	114082587	0.025000	0.19082	0.017000	0.16124	0.996000	0.88848	-0.015000	0.12634	-1.517000	0.01780	0.454000	0.30748	ATT	.	.		0.443	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399181.1	NM_182495	
GPR19	2842	hgsc.bcm.edu	37	12	12815347	12815347	+	Silent	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:12815347T>C	ENST00000540510.1	-	2	228	c.36A>G	c.(34-36)ccA>ccG	p.P12P	GPR19_ENST00000332427.2_Silent_p.P12P			P46093	GPR4_HUMAN	G protein-coupled receptor 19	0					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	17		Prostate(47;0.0802)		BRCA - Breast invasive adenocarcinoma(232;0.048)		TAATCAAATGTGGCTTGCTGT	0.438																																					p.P12P		Atlas-SNP	.											.	GPR19	47	.	0			c.A36G						.						113.0	109.0	110.0					12																	12815347		2203	4300	6503	SO:0001819	synonymous_variant	2842	exon4			CAAATGTGGCTTG		CCDS8652.1	12p12.3	2014-01-30				ENSG00000183150		"""GPCR / Class A : Orphans"""	4473	protein-coding gene	gene with protein product		602927					Standard	NM_006143		Approved		uc001raq.2	Q15760		ENST00000540510.1:c.36A>G	chr12.hg19:g.12815347T>C		60.0	0.0		66.0	9.0	NM_006143	A8K3T3|B0M0K1|Q6NWM4	Silent	SNP	ENST00000540510.1	hg19	CCDS8652.1																																																																																			.	.		0.438	GPR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400662.1	NM_006143	
CCDC91	55297	hgsc.bcm.edu	37	12	28459739	28459739	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:28459739A>G	ENST00000545336.1	+	8	751	c.332A>G	c.(331-333)aAa>aGa	p.K111R	CCDC91_ENST00000381256.1_Missense_Mutation_p.K111R|CCDC91_ENST00000539107.1_Missense_Mutation_p.K111R|CCDC91_ENST00000540401.1_3'UTR|CCDC91_ENST00000306172.5_Missense_Mutation_p.K81R|CCDC91_ENST00000381259.1_Missense_Mutation_p.K111R			Q7Z6B0	CCD91_HUMAN	coiled-coil domain containing 91	111					protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|skin(1)	22	Acute lymphoblastic leukemia(23;0.00718)|all_hematologic(23;0.0113)|Lung SC(9;0.184)					ACTGATGAAAAAAGTAATGGA	0.353																																					p.K111R		Atlas-SNP	.											.	CCDC91	63	.	0			c.A332G						.						89.0	94.0	93.0					12																	28459739		2203	4300	6503	SO:0001583	missense	55297	exon4			ATGAAAAAAGTAA	AK093152	CCDS8716.1	12p11.22	2006-03-17				ENSG00000123106			24855	protein-coding gene	gene with protein product	"""GGA binding partner"""					12808037	Standard	XM_005253413		Approved	p56, FLJ11088, DKFZp779L1558	uc001riq.3	Q7Z6B0		ENST00000545336.1:c.332A>G	chr12.hg19:g.28459739A>G	ENSP00000438040:p.Lys111Arg	52.0	0.0		77.0	28.0	NM_018318	B3KSA3|C9JR07|Q68D43|Q6IA78|Q8NEN7|Q9NUW9	Missense_Mutation	SNP	ENST00000545336.1	hg19	CCDS8716.1	.	.	.	.	.	.	.	.	.	.	A	10.19	1.282892	0.23392	.	.	ENSG00000123106	ENST00000539107;ENST00000536442;ENST00000545336;ENST00000545737;ENST00000381259;ENST00000381256;ENST00000306172	T;T;T;T;T;T;T	0.32988	1.44;1.45;1.44;1.45;1.44;1.44;1.43	5.26	4.17	0.49024	.	0.875326	0.09820	N	0.751623	T	0.17365	0.0417	N	0.14661	0.345	0.21697	N	0.999587	B;B	0.30281	0.144;0.275	B;B	0.27796	0.048;0.083	T	0.23261	-1.0193	10	0.16896	T	0.51	-2.348	8.7619	0.34680	0.7525:0.2475:0.0:0.0	.	111;81	Q7Z6B0;Q7Z6B0-2	CCD91_HUMAN;.	R	111;111;111;111;111;111;81	ENSP00000440513:K111R;ENSP00000445660:K111R;ENSP00000438040:K111R;ENSP00000442544:K111R;ENSP00000370658:K111R;ENSP00000370655:K111R;ENSP00000305075:K81R	ENSP00000305075:K81R	K	+	2	0	CCDC91	28351006	1.000000	0.71417	0.999000	0.59377	0.945000	0.59286	2.074000	0.41529	1.092000	0.41356	0.528000	0.53228	AAA	.	.		0.353	CCDC91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402447.1	NM_018318	
CAPRIN2	65981	hgsc.bcm.edu	37	12	30863308	30863308	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:30863308G>A	ENST00000298892.5	-	17	3512	c.2762C>T	c.(2761-2763)aCc>aTc	p.T921I	CAPRIN2_ENST00000417045.1_3'UTR|CAPRIN2_ENST00000251071.5_Missense_Mutation_p.T971I|CAPRIN2_ENST00000308433.5_Missense_Mutation_p.T637I|CAPRIN2_ENST00000395805.2_3'UTR	NM_023925.3	NP_076414.2			caprin family member 2											breast(1)|central_nervous_system(1)|endometrium(8)|kidney(4)|large_intestine(13)|lung(16)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	48	all_lung(12;1.13e-09)|Lung NSC(12;7.98e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0355)|Lung SC(12;0.0905)|Esophageal squamous(101;0.233)					ATCCACAGGGGTCATGCTACG	0.542																																					p.T971I		Atlas-SNP	.											.	CAPRIN2	109	.	0			c.C2912T						.						227.0	230.0	229.0					12																	30863308		2203	4300	6503	SO:0001583	missense	65981	exon18			ACAGGGGTCATGC	AY074491	CCDS8720.1, CCDS41766.1, CCDS41766.2, CCDS55816.1	12p11	2010-08-03	2007-03-27	2007-03-27	ENSG00000110888	ENSG00000110888			21259	protein-coding gene	gene with protein product		610375	"""C1q domain containing 1"""	C1QDC1		11347906, 14764709	Standard	NM_001002259		Approved	EEG1, FLJ22569, FLJ11391, caprin-2, RNG140	uc001rji.1	Q6IMN6	OTTHUMG00000169185	ENST00000298892.5:c.2762C>T	chr12.hg19:g.30863308G>A	ENSP00000298892:p.Thr921Ile	128.0	0.0		184.0	16.0	NM_001002259		Missense_Mutation	SNP	ENST00000298892.5	hg19	CCDS8720.1	.	.	.	.	.	.	.	.	.	.	G	23.3	4.400459	0.83120	.	.	ENSG00000110888	ENST00000298892;ENST00000251071;ENST00000308433	T;T;T	0.76316	-0.65;-0.71;-1.01	5.7	4.76	0.60689	.	0.237281	0.43579	D	0.000548	T	0.77150	0.4088	N	0.19112	0.55	0.36693	D	0.879683	D;D	0.71674	0.997;0.998	P;D	0.65323	0.852;0.934	T	0.81673	-0.0826	10	0.72032	D	0.01	-8.9208	11.2018	0.48745	0.0:0.1374:0.7202:0.1424	.	971;921	Q6IMN6;Q6IMN6-2	CAPR2_HUMAN;.	I	921;971;637	ENSP00000298892:T921I;ENSP00000251071:T971I;ENSP00000309785:T637I	ENSP00000251071:T971I	T	-	2	0	CAPRIN2	30754575	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.337000	0.72958	2.682000	0.91365	0.655000	0.94253	ACC	.	.		0.542	CAPRIN2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000402778.1	NM_023925	
GALNT6	11226	hgsc.bcm.edu	37	12	51758078	51758078	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:51758078C>T	ENST00000543196.2	-	5	1081	c.876G>A	c.(874-876)gtG>gtA	p.V292V	GALNT6_ENST00000356317.3_Silent_p.V292V			Q8NCL4	GALT6_HUMAN	polypeptide N-acetylgalactosaminyltransferase 6	292					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			endometrium(2)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	27						GGCTCACCACCACTGTCTTGT	0.607																																					p.V292V		Atlas-SNP	.											.	GALNT6	63	.	0			c.G876A						.						77.0	73.0	74.0					12																	51758078		2203	4300	6503	SO:0001819	synonymous_variant	11226	exon6			CACCACCACTGTC	Y08565	CCDS8813.1	12q13	2014-03-13	2014-03-13		ENSG00000139629	ENSG00000139629		"""Glycosyltransferase family 2 domain containing"""	4128	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 6"""	605148	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 6 (GalNAc-T6)"""			10464263	Standard	NM_007210		Approved	GalNAc-T6	uc001ryl.1	Q8NCL4		ENST00000543196.2:c.876G>A	chr12.hg19:g.51758078C>T		174.0	0.0		219.0	65.0	NM_007210	Q8IYH4|Q9H6G2|Q9UIV5	Silent	SNP	ENST00000543196.2	hg19	CCDS8813.1																																																																																			.	.		0.607	GALNT6-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000469735.1	NM_007210	
KRT3	3850	hgsc.bcm.edu	37	12	53189359	53189359	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:53189359G>A	ENST00000417996.2	-	1	542	c.468C>T	c.(466-468)ggC>ggT	p.G156G	KRT3_ENST00000309505.3_Silent_p.G156G	NM_057088.2	NP_476429.2	P12035	K2C3_HUMAN	keratin 3	156	Gly-rich.|Head.				epithelial cell differentiation (GO:0030855)|intermediate filament cytoskeleton organization (GO:0045104)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			NS(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|skin(1)	23						CACCAGGACTGCCCAAGCTGC	0.622																																					p.G156G		Atlas-SNP	.											.	KRT3	65	.	0			c.C468T						.						116.0	157.0	143.0					12																	53189359		2203	4300	6503	SO:0001819	synonymous_variant	3850	exon1			AGGACTGCCCAAG		CCDS44895.1	12q13.13	2013-01-16			ENSG00000186442	ENSG00000186442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6440	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 3"", ""cytokeratin 3"""	148043				7510223, 16831889	Standard	NM_057088		Approved	CK3, K3	uc001say.3	P12035	OTTHUMG00000169799	ENST00000417996.2:c.468C>T	chr12.hg19:g.53189359G>A		118.0	0.0		174.0	65.0	NM_057088	A6NIS2|Q701L8	Silent	SNP	ENST00000417996.2	hg19	CCDS44895.1																																																																																			.	.		0.622	KRT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405930.1	NM_057088	
PTPRB	5787	hgsc.bcm.edu	37	12	70988332	70988332	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:70988332C>T	ENST00000261266.5	-	4	806	c.777G>A	c.(775-777)ggG>ggA	p.G259G	PTPRB_ENST00000538708.1_Silent_p.G259G|PTPRB_ENST00000451516.2_Silent_p.G259G|PTPRB_ENST00000334414.6_Silent_p.G477G|PTPRB_ENST00000551525.1_Silent_p.G476G|PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000550857.1_Silent_p.G259G|PTPRB_ENST00000550358.1_Silent_p.G477G	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	259	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			CAGGGGTCAGCCCGTGAAAAG	0.507																																					p.G477G		Atlas-SNP	.											.	PTPRB	676	.	0			c.G1431A						.						152.0	150.0	151.0					12																	70988332		2004	4193	6197	SO:0001819	synonymous_variant	5787	exon6			GGTCAGCCCGTGA	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.777G>A	chr12.hg19:g.70988332C>T		222.0	0.0		290.0	82.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	hg19	CCDS44944.1																																																																																			.	.		0.507	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
UTP20	27340	hgsc.bcm.edu	37	12	101748856	101748856	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr12:101748856G>T	ENST00000261637.4	+	41	5528	c.5354G>T	c.(5353-5355)gGg>gTg	p.G1785V		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1785					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						ACCATAACCGGGGATATTCTC	0.433																																					p.G1785V		Atlas-SNP	.											.	UTP20	222	.	0			c.G5354T						.						52.0	53.0	53.0					12																	101748856		2203	4300	6503	SO:0001583	missense	27340	exon41			TAACCGGGGATAT	AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5354G>T	chr12.hg19:g.101748856G>T	ENSP00000261637:p.Gly1785Val	57.0	0.0		91.0	4.0	NM_014503	Q9H3H4	Missense_Mutation	SNP	ENST00000261637.4	hg19	CCDS9081.1	.	.	.	.	.	.	.	.	.	.	G	8.233	0.805105	0.16467	.	.	ENSG00000120800	ENST00000261637	T	0.17054	2.3	5.79	4.9	0.64082	Armadillo-type fold (1);	0.555608	0.21383	N	0.075436	T	0.11196	0.0273	N	0.25647	0.755	0.48632	D	0.999683	B	0.19817	0.039	B	0.19391	0.025	T	0.13899	-1.0492	10	0.27785	T	0.31	-18.1894	7.4785	0.27391	0.0861:0.1689:0.745:0.0	.	1785	O75691	UTP20_HUMAN	V	1785	ENSP00000261637:G1785V	ENSP00000261637:G1785V	G	+	2	0	UTP20	100272987	0.996000	0.38824	1.000000	0.80357	0.358000	0.29455	1.285000	0.33261	2.733000	0.93635	0.655000	0.94253	GGG	.	.		0.433	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000408242.1	NM_014503	
ATP8A2	51761	hgsc.bcm.edu	37	13	26586735	26586735	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:26586735C>A	ENST00000381655.2	+	36	3586	c.3444C>A	c.(3442-3444)ggC>ggA	p.G1148G	ATP8A2_ENST00000255283.8_Silent_p.G1083G	NM_016529.4	NP_057613.4	Q9NTI2	AT8A2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8A, member 2	1108					aging (GO:0007568)|axonogenesis (GO:0007409)|detection of light stimulus involved in visual perception (GO:0050908)|eating behavior (GO:0042755)|inner ear morphogenesis (GO:0042472)|involuntary skeletal muscle contraction (GO:0003011)|negative regulation of cell proliferation (GO:0008285)|neurofilament cytoskeleton organization (GO:0060052)|neuromuscular process controlling posture (GO:0050884)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phospholipid translocation (GO:0061092)|response to auditory stimulus (GO:0010996)|retina layer formation (GO:0010842)|skin development (GO:0043588)	cell projection (GO:0042995)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(17)|lung(31)|ovary(4)|skin(3)|stomach(1)|urinary_tract(1)	72		Breast(139;0.0201)|Lung SC(185;0.0225)		all cancers(112;0.043)|OV - Ovarian serous cystadenocarcinoma(117;0.0748)|Epithelial(112;0.079)		TGTTCCGGGGCAGCTCCCTGC	0.687																																					p.G1148G		Atlas-SNP	.											.	ATP8A2	181	.	0			c.C3444A						.						9.0	10.0	9.0					13																	26586735		1761	3878	5639	SO:0001819	synonymous_variant	51761	exon36			CCGGGGCAGCTCC	AL137256	CCDS41873.1	13q12	2010-04-20	2010-03-31		ENSG00000132932	ENSG00000132932	3.6.3.1	"""ATPases / P-type"""	13533	protein-coding gene	gene with protein product		605870	"""ATPase, aminophospholipid transporter-like, Class I, type 8A, member 2"", ""ATPase, aminophospholipid transporter-like, class I, type 8A, member 2"""			11015572, 19778899	Standard	NM_016529		Approved	ATPIB, ML-1	uc001uqk.3	Q9NTI2	OTTHUMG00000016611	ENST00000381655.2:c.3444C>A	chr13.hg19:g.26586735C>A		38.0	0.0		61.0	35.0	NM_016529	Q9H527|Q9NPU6|Q9NTL2|Q9NYM3	Silent	SNP	ENST00000381655.2	hg19	CCDS41873.1																																																																																			.	.		0.687	ATP8A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044236.2	NM_016529	
TEX26	122046	hgsc.bcm.edu	37	13	31549019	31549019	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:31549019G>A	ENST00000380473.3	+	7	858	c.845G>A	c.(844-846)tGt>tAt	p.C282Y	RP11-252M21.6_ENST00000433788.1_RNA|TEX26_ENST00000530916.1_3'UTR	NM_152325.1	NP_689538.1	Q8N6G2	TEX26_HUMAN	testis expressed 26	282																	CGTACTCACTGTGACACTAAC	0.303																																					p.C282Y		Atlas-SNP	.											.	.	.	.	0			c.G845A						.						60.0	55.0	57.0					13																	31549019		2194	4294	6488	SO:0001583	missense	122046	exon7			CTCACTGTGACAC	BC030277	CCDS9339.1	13q12.3	2012-02-06	2012-02-06	2012-02-06	ENSG00000175664	ENSG00000175664			28622	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 26"""	C13orf26		12477932	Standard	NM_152325		Approved	MGC40178	uc001uti.3	Q8N6G2	OTTHUMG00000016682	ENST00000380473.3:c.845G>A	chr13.hg19:g.31549019G>A	ENSP00000369840:p.Cys282Tyr	58.0	0.0		101.0	20.0	NM_152325		Missense_Mutation	SNP	ENST00000380473.3	hg19	CCDS9339.1	.	.	.	.	.	.	.	.	.	.	G	1.967	-0.437424	0.04636	.	.	ENSG00000175664	ENST00000380473	T	0.41400	1.0	4.09	2.11	0.27256	.	0.722447	0.13951	N	0.351502	T	0.22742	0.0549	L	0.29908	0.895	0.09310	N	1	B	0.20550	0.046	B	0.17722	0.019	T	0.30679	-0.9970	10	0.02654	T	1	-1.8397	5.5663	0.17173	0.2927:0.0:0.7073:0.0	.	282	Q8N6G2	CM026_HUMAN	Y	282	ENSP00000369840:C282Y	ENSP00000369840:C282Y	C	+	2	0	C13orf26	30447019	0.750000	0.28316	0.106000	0.21319	0.035000	0.12851	0.213000	0.17521	0.535000	0.28714	0.655000	0.94253	TGT	.	.		0.303	TEX26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044380.2	NM_152325	
KBTBD7	84078	hgsc.bcm.edu	37	13	41766715	41766715	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:41766715T>C	ENST00000379483.3	-	1	1987	c.1679A>G	c.(1678-1680)cAg>cGg	p.Q560R		NM_032138.4	NP_115514.2	Q8WVZ9	KBTB7_HUMAN	kelch repeat and BTB (POZ) domain containing 7	560										central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(8)|ovary(4)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24		Lung NSC(96;0.000105)|Breast(139;0.00715)|Prostate(109;0.0233)|Lung SC(185;0.0367)		all cancers(112;6.21e-09)|Epithelial(112;6.99e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000196)|GBM - Glioblastoma multiforme(144;0.000857)|BRCA - Breast invasive adenocarcinoma(63;0.0669)		ATTGACAATCTGGTAGTTGTG	0.433																																					p.Q560R		Atlas-SNP	.											.	KBTBD7	60	.	0			c.A1679G						.						172.0	169.0	170.0					13																	41766715		2203	4300	6503	SO:0001583	missense	84078	exon1			ACAATCTGGTAGT	AL136782	CCDS9377.1	13q13.3	2013-01-08			ENSG00000120696	ENSG00000120696		"""BTB/POZ domain containing"""	25266	protein-coding gene	gene with protein product						11230166	Standard	NM_032138		Approved	DKFZP434E2318	uc001uxw.1	Q8WVZ9	OTTHUMG00000016789	ENST00000379483.3:c.1679A>G	chr13.hg19:g.41766715T>C	ENSP00000368797:p.Gln560Arg	155.0	0.0		187.0	52.0	NM_032138	B5TZ86|Q5T6Y7|Q8NB99|Q9H0I6	Missense_Mutation	SNP	ENST00000379483.3	hg19	CCDS9377.1	.	.	.	.	.	.	.	.	.	.	T	0.010	-1.755143	0.00663	.	.	ENSG00000120696	ENST00000379483;ENST00000501885	T	0.65732	-0.17	5.37	5.37	0.77165	Kelch-type beta propeller (1);	0.000000	0.64402	U	0.000001	T	0.45696	0.1355	N	0.21448	0.665	0.50171	D	0.999852	B	0.06786	0.001	B	0.06405	0.002	T	0.37709	-0.9694	10	0.12103	T	0.63	.	13.3145	0.60399	0.0:0.0:0.0:1.0	.	560	Q8WVZ9	KBTB7_HUMAN	R	560;462	ENSP00000368797:Q560R	ENSP00000368797:Q560R	Q	-	2	0	KBTBD7	40664715	1.000000	0.71417	1.000000	0.80357	0.121000	0.20230	6.520000	0.73773	2.023000	0.59567	0.455000	0.32223	CAG	.	.		0.433	KBTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044660.1	NM_032138	
DGKH	160851	hgsc.bcm.edu	37	13	42763420	42763420	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:42763420G>T	ENST00000337343.4	+	15	1908	c.1887G>T	c.(1885-1887)agG>agT	p.R629S	DGKH_ENST00000498255.2_3'UTR|DGKH_ENST00000379274.2_Missense_Mutation_p.R493S|DGKH_ENST00000261491.5_Missense_Mutation_p.R629S|DGKH_ENST00000540693.1_Missense_Mutation_p.R629S|DGKH_ENST00000538674.1_Missense_Mutation_p.R384S|DGKH_ENST00000536612.1_Missense_Mutation_p.R493S	NM_178009.3	NP_821077.1	Q86XP1	DGKH_HUMAN	diacylglycerol kinase, eta	629					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|endosome (GO:0005768)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(2)|endometrium(3)|kidney(5)|large_intestine(11)|lung(9)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43		Lung NSC(96;1.02e-05)|Prostate(109;0.0168)|Lung SC(185;0.0262)|Breast(139;0.0709)|Hepatocellular(98;0.114)		OV - Ovarian serous cystadenocarcinoma(117;5.88e-05)|GBM - Glioblastoma multiforme(144;0.000935)|BRCA - Breast invasive adenocarcinoma(63;0.109)		AAGCAGTGAGGCAAGTCATTG	0.438																																					p.R629S		Atlas-SNP	.											.	DGKH	106	.	0			c.G1887T						.						76.0	73.0	74.0					13																	42763420		2203	4300	6503	SO:0001583	missense	160851	exon16			AGTGAGGCAAGTC	AB078967	CCDS9381.1, CCDS9382.1, CCDS55898.1	13q13.3	2013-01-10			ENSG00000102780	ENSG00000102780		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2854	protein-coding gene	gene with protein product		604071				8702685	Standard	XM_005266271		Approved	DGKeta	uc001uyl.2	Q86XP1	OTTHUMG00000016804	ENST00000337343.4:c.1887G>T	chr13.hg19:g.42763420G>T	ENSP00000337572:p.Arg629Ser	88.0	0.0		116.0	31.0	NM_001204504	A2A2W7|A6NFX7|B4DZ34|Q5VZW0|Q6PI56|Q86XP2|Q8N3N0|Q8N7J9	Missense_Mutation	SNP	ENST00000337343.4	hg19	CCDS9381.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.995550	0.74703	.	.	ENSG00000102780	ENST00000540693;ENST00000337343;ENST00000261491;ENST00000379274;ENST00000536612;ENST00000538674	D;T;D;D;D;T	0.82711	-1.64;-1.46;-1.64;-1.59;-1.6;1.61	5.72	4.88	0.63580	.	0.000000	0.85682	D	0.000000	D	0.89305	0.6677	M	0.71581	2.175	0.58432	D	0.999991	D;D;D;P	0.71674	0.998;0.998;0.995;0.884	D;D;D;P	0.72075	0.956;0.976;0.91;0.54	D	0.89801	0.3975	10	0.66056	D	0.02	.	11.7184	0.51668	0.1415:0.0:0.8585:0.0	.	384;493;629;629	F5GYP2;Q86XP1-3;Q86XP1-2;Q86XP1	.;.;.;DGKH_HUMAN	S	629;629;629;493;493;384	ENSP00000440823:R629S;ENSP00000337572:R629S;ENSP00000261491:R629S;ENSP00000368576:R493S;ENSP00000445114:R493S;ENSP00000441308:R384S	ENSP00000261491:R629S	R	+	3	2	DGKH	41661420	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.368000	0.52357	1.419000	0.47118	0.655000	0.94253	AGG	.	.		0.438	DGKH-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044699.2	NM_178009	
UPF3A	65110	hgsc.bcm.edu	37	13	115052106	115052106	+	Splice_Site	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:115052106T>C	ENST00000375299.3	+	5	687		c.e5+2		UPF3A_ENST00000351487.5_Splice_Site|UPF3A_ENST00000475218.2_Splice_Site	NM_023011.3	NP_075387.1	Q9H1J1	REN3A_HUMAN	UPF3 regulator of nonsense transcripts homolog A (yeast)						gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleocytoplasmic transport (GO:0006913)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	16	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)	OV - Ovarian serous cystadenocarcinoma(48;0.195)|Epithelial(10;0.2)		AGCTCATTGGTCTGTTTTGCT	0.408																																					.		Atlas-SNP	.											.	UPF3A	47	.	0			c.532+2T>C						.						52.0	48.0	49.0					13																	115052106		2203	4300	6503	SO:0001630	splice_region_variant	65110	exon4			CATTGGTCTGTTT	AF318575	CCDS9543.1, CCDS9544.1	13q34	2010-04-30			ENSG00000169062	ENSG00000169062			20332	protein-coding gene	gene with protein product		605530				11113196, 11163187	Standard	NM_023011		Approved	RENT3A, UPF3, HUPF3A	uc001vup.3	Q9H1J1	OTTHUMG00000017403	ENST00000375299.3:c.631+2T>C	chr13.hg19:g.115052106T>C		175.0	0.0		237.0	23.0	NM_080687	A2A366|Q5T8C3|Q5T8C9|Q7Z6N3|Q86YK1|Q9BZI8	Splice_Site	SNP	ENST00000375299.3	hg19	CCDS9543.1	.	.	.	.	.	.	.	.	.	.	T	13.34	2.207740	0.39003	.	.	ENSG00000169062	ENST00000375299;ENST00000351487;ENST00000543577	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1071	0.72329	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	UPF3A	114070208	1.000000	0.71417	1.000000	0.80357	0.283000	0.27025	7.172000	0.77604	1.978000	0.57642	0.459000	0.35465	.	.	.		0.408	UPF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045968.2		Intron
RNF31	55072	hgsc.bcm.edu	37	14	24618693	24618693	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:24618693G>T	ENST00000324103.6	+	6	1030	c.710G>T	c.(709-711)tGt>tTt	p.C237F	PSME2_ENST00000471700.2_5'Flank|RP11-468E2.4_ENST00000558468.1_5'Flank|PSME2_ENST00000216802.5_5'Flank|RNF31_ENST00000559275.1_Missense_Mutation_p.C86F|PSME2_ENST00000560410.1_5'Flank|RNF31_ENST00000382687.3_Missense_Mutation_p.C86F	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	237	Polyubiquitin-binding.				CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		CAGGCCCTGTGTCCAGCCTGT	0.637																																					p.C237F		Atlas-SNP	.											.	RNF31	95	.	0			c.G710T						.						88.0	93.0	91.0					14																	24618693		2094	4219	6313	SO:0001583	missense	55072	exon6			CCCTGTGTCCAGC	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.710G>T	chr14.hg19:g.24618693G>T	ENSP00000315112:p.Cys237Phe	106.0	0.0		151.0	44.0	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.185324	0.78677	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.80214	-1.35;-1.31	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	D	0.89005	0.6592	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.994;0.997	D	0.89095	0.3485	10	0.87932	D	0	-21.2105	19.0767	0.93165	0.0:0.0:1.0:0.0	.	52;237;86	B3KV71;Q96EP0;Q96EP0-3	.;RNF31_HUMAN;.	F	237;86	ENSP00000315112:C237F;ENSP00000372134:C86F	ENSP00000315112:C237F	C	+	2	0	RNF31	23688533	1.000000	0.71417	0.924000	0.36721	0.629000	0.37895	6.467000	0.73547	2.808000	0.96608	0.655000	0.94253	TGT	.	.		0.637	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
GPR135	64582	hgsc.bcm.edu	37	14	59930690	59930690	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:59930690C>A	ENST00000395116.1	-	1	1370	c.1255G>T	c.(1255-1257)Ggc>Tgc	p.G419C		NM_022571.5	NP_072093.2	Q8IZ08	GP135_HUMAN	G protein-coupled receptor 135	419						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(108;0.134)		AGACCCGGGCCCTGGCTGGGC	0.637																																					p.G419C		Atlas-SNP	.											GPR135,NS,carcinoma,0,1	GPR135	26	.	0			c.G1255T						.						40.0	34.0	36.0					14																	59930690		2203	4300	6503	SO:0001583	missense	64582	exon1			CCGGGCCCTGGCT	AY288418	CCDS9738.1	14q23.1	2012-08-21			ENSG00000181619	ENSG00000181619		"""GPCR / Class A : Orphans"""	19991	protein-coding gene	gene with protein product		607970				14623098	Standard	NM_022571		Approved	HUMNPIIY20, PAFR	uc010apj.3	Q8IZ08	OTTHUMG00000140325	ENST00000395116.1:c.1255G>T	chr14.hg19:g.59930690C>A	ENSP00000378548:p.Gly419Cys	87.0	1.0		88.0	30.0	NM_022571	Q7Z604|Q86SM3|Q8NH39	Missense_Mutation	SNP	ENST00000395116.1	hg19	CCDS9738.1	.	.	.	.	.	.	.	.	.	.	c	18.23	3.578961	0.65878	.	.	ENSG00000181619	ENST00000395116	T	0.63580	-0.05	4.89	1.93	0.25924	.	0.456851	0.20560	U	0.089927	T	0.51753	0.1693	L	0.27053	0.805	0.38467	D	0.947369	D	0.57257	0.979	P	0.46975	0.533	T	0.56780	-0.7922	10	0.52906	T	0.07	-7.6514	11.5851	0.50914	0.0:0.6903:0.2352:0.0745	.	419	Q8IZ08	GP135_HUMAN	C	419	ENSP00000378548:G419C	ENSP00000378548:G419C	G	-	1	0	GPR135	59000443	0.450000	0.25697	0.031000	0.17742	0.138000	0.21146	0.794000	0.26958	0.659000	0.30945	0.651000	0.88453	GGC	.	.		0.637	GPR135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276941.1	NM_022571	
SYNE2	23224	hgsc.bcm.edu	37	14	64457170	64457170	+	Silent	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:64457170A>G	ENST00000344113.4	+	20	2567	c.2355A>G	c.(2353-2355)gcA>gcG	p.A785A	SYNE2_ENST00000554584.1_Silent_p.A785A|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Silent_p.A785A	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	785					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGCTTATGGCAAGAAGTGAAG	0.338																																					p.A785A		Atlas-SNP	.											.	SYNE2	577	.	0			c.A2355G						.						92.0	88.0	89.0					14																	64457170		1835	4098	5933	SO:0001819	synonymous_variant	23224	exon20			TATGGCAAGAAGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.2355A>G	chr14.hg19:g.64457170A>G		139.0	0.0		144.0	18.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.338	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
FLRT2	23768	hgsc.bcm.edu	37	14	86089799	86089799	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr14:86089799C>G	ENST00000330753.4	+	2	2708	c.1941C>G	c.(1939-1941)taC>taG	p.Y647*	FLRT2_ENST00000554746.1_Nonsense_Mutation_p.Y647*	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	647					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		ACATGCGATACTGCAACAGCA	0.507																																					p.Y647X		Atlas-SNP	.											.	FLRT2	168	.	0			c.C1941G						.						204.0	208.0	207.0					14																	86089799		2189	4266	6455	SO:0001587	stop_gained	23768	exon2			GCGATACTGCAAC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1941C>G	chr14.hg19:g.86089799C>G	ENSP00000332879:p.Tyr647*	92.0	0.0		94.0	6.0	NM_013231	A0AV84|B7ZLP3	Nonsense_Mutation	SNP	ENST00000330753.4	hg19	CCDS9877.1	.	.	.	.	.	.	.	.	.	.	C	45	11.932692	0.99618	.	.	ENSG00000185070	ENST00000330753;ENST00000554746;ENST00000535800	.	.	.	6.06	6.06	0.98353	.	0.154928	0.48286	D	0.000182	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.7132	14.7494	0.69513	0.0:0.9315:0.0:0.0685	.	.	.	.	X	647;647;300	.	ENSP00000332879:Y647X	Y	+	3	2	FLRT2	85159552	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.311000	0.51919	2.880000	0.98712	0.650000	0.86243	TAC	.	.		0.507	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
SNRPN	6638	hgsc.bcm.edu	37	15	25221503	25221503	+	Silent	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:25221503G>T	ENST00000400100.1	+	9	1097	c.207G>T	c.(205-207)ctG>ctT	p.L69L	SNRPN_ENST00000400097.1_Silent_p.L69L|SNRPN_ENST00000346403.6_Silent_p.L69L|SNURF_ENST00000338094.6_3'UTR|SNRPN_ENST00000400098.1_Silent_p.L69L|SNRPN_ENST00000444203.2_Silent_p.L73L|SNRPN_ENST00000390687.4_Silent_p.L69L|SNURF_ENST00000551312.2_Intron|SNRPN_ENST00000577565.1_Silent_p.L69L|SNRPN_ENST00000554227.2_Silent_p.L73L	NM_022807.2	NP_073718.1	P63162	RSMN_HUMAN	small nuclear ribonucleoprotein polypeptide N	69					response to hormone (GO:0009725)|RNA splicing (GO:0008380)	small nuclear ribonucleoprotein complex (GO:0030532)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U2 snRNP (GO:0005686)	RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(2)	24		all_cancers(20;9.33e-22)|Breast(32;0.000625)		all cancers(64;3.38e-08)|Epithelial(43;3.45e-07)|BRCA - Breast invasive adenocarcinoma(123;0.000207)|GBM - Glioblastoma multiforme(186;0.125)		TTTTGGGTCTGGTGTTGCTGC	0.453									Prader-Willi syndrome																												p.L69L		Atlas-SNP	.											SNRPN,NS,carcinoma,0,2	SNRPN	58	.	0			c.G207T						.						93.0	100.0	98.0					15																	25221503		1926	4134	6060	SO:0001819	synonymous_variant	6638	exon9	Familial Cancer Database	Prader-Labhart-Willi syndrome	GGGTCTGGTGTTG	L80005	CCDS10017.1	15q11.2	2013-07-16			ENSG00000128739	ENSG00000128739			11164	protein-coding gene	gene with protein product	"""tissue-specific splicing protein"", ""SM protein N"", ""small nuclear ribonucleoprotein N"""	182279	"""Prader-Willi syndrome chromosome region"""	PWCR		1533223	Standard	NM_022805		Approved	SMN, SM-D, HCERN3, SNRNP-N, SNURF-SNRPN, RT-LI	uc001ywt.1	P63162	OTTHUMG00000129180	ENST00000400100.1:c.207G>T	chr15.hg19:g.25221503G>T		128.0	1.0		157.0	7.0	NM_022807	B3KVR1|P14648|P17135|Q0D2Q5	Silent	SNP	ENST00000400100.1	hg19	CCDS10017.1																																																																																			.	.		0.453	SNRPN-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413849.10	NM_003097	
SLC12A1	6557	hgsc.bcm.edu	37	15	48533795	48533795	+	Splice_Site	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:48533795A>G	ENST00000558405.1	+	9	1313	c.1299A>G	c.(1297-1299)gtA>gtG	p.V433V	SLC12A1_ENST00000396577.3_Splice_Site_p.V433V|SLC12A1_ENST00000380993.3_Splice_Site_p.V433V			Q13621	S12A1_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 1	433					cell death (GO:0008219)|chemical homeostasis (GO:0048878)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|kidney development (GO:0001822)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:potassium:chloride symporter activity (GO:0008511)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|prostate(2)|skin(1)	59		all_lung(180;0.00219)		all cancers(107;1.76e-09)|GBM - Glioblastoma multiforme(94;1.48e-06)	Bumetanide(DB00887)|Chlormerodrin(DB00534)|Chlorthalidone(DB00310)|Ethacrynic acid(DB00903)|Furosemide(DB00695)|Hydroflumethiazide(DB00774)|Methyclothiazide(DB00232)|Potassium Chloride(DB00761)|Quinethazone(DB01325)|Torasemide(DB00214)|Trichlormethiazide(DB01021)	CAATTTGTGTAGGTAAGTGGT	0.433																																					p.V433V		Atlas-SNP	.											.	SLC12A1	243	.	0			c.A1299G						.						205.0	190.0	195.0					15																	48533795		2198	4297	6495	SO:0001630	splice_region_variant	6557	exon10			TTGTGTAGGTAAG		CCDS10129.2, CCDS53940.1	15q15-q21	2013-07-18	2013-07-18		ENSG00000074803	ENSG00000074803		"""Solute carriers"""	10910	protein-coding gene	gene with protein product		600839				8640224	Standard	NM_000338		Approved	NKCC2	uc010bem.3	Q13621	OTTHUMG00000131495	ENST00000558405.1:c.1300+1A>G	chr15.hg19:g.48533795A>G		100.0	0.0		167.0	58.0	NM_001184832	A8JYA2|E9PDW4	Silent	SNP	ENST00000558405.1	hg19	CCDS10129.2																																																																																			.	.		0.433	SLC12A1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000417131.1		Silent
SHC4	399694	hgsc.bcm.edu	37	15	49254841	49254841	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:49254841G>T	ENST00000332408.4	-	1	800	c.372C>A	c.(370-372)gaC>gaA	p.D124E		NM_203349.3	NP_976224.3	Q6S5L8	SHC4_HUMAN	SHC (Src homology 2 domain containing) family, member 4	124	CH2.				apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|positive regulation of cell proliferation (GO:0008284)|regulation of gene expression (GO:0010468)|stem cell differentiation (GO:0048863)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(2)|large_intestine(8)|lung(11)|ovary(3)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)	29		all_lung(180;0.00466)		all cancers(107;9.4e-08)|GBM - Glioblastoma multiforme(94;5.94e-07)		TGGAACCTGGGTCCCGGCTTT	0.607																																					p.D124E		Atlas-SNP	.											.	SHC4	70	.	0			c.C372A						.						49.0	50.0	49.0					15																	49254841		2197	4295	6492	SO:0001583	missense	399694	exon1			ACCTGGGTCCCGG	AY358250	CCDS10130.1	15q21.1-q21.2	2013-02-14			ENSG00000185634	ENSG00000185634		"""SH2 domain containing"""	16743	protein-coding gene	gene with protein product	"""rai-like protein"""						Standard	NM_203349		Approved	RaLP	uc001zxb.1	Q6S5L8	OTTHUMG00000131513	ENST00000332408.4:c.372C>A	chr15.hg19:g.49254841G>T	ENSP00000329668:p.Asp124Glu	68.0	0.0		100.0	37.0	NM_203349	Q6UXQ3|Q8IYW3	Missense_Mutation	SNP	ENST00000332408.4	hg19	CCDS10130.1	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.201489	0.01581	.	.	ENSG00000185634	ENST00000332408	T	0.04603	3.59	4.67	-4.35	0.03656	.	0.539396	0.16931	N	0.193641	T	0.01835	0.0058	N	0.08118	0	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.45934	-0.9227	10	0.11485	T	0.65	-18.6904	7.3232	0.26540	0.3112:0.5173:0.1715:0.0	.	124	Q6S5L8	SHC4_HUMAN	E	124	ENSP00000329668:D124E	ENSP00000329668:D124E	D	-	3	2	SHC4	47042133	0.000000	0.05858	0.108000	0.21378	0.114000	0.19823	-2.692000	0.00830	-0.785000	0.04522	-0.165000	0.13383	GAC	.	.		0.607	SHC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254371.1	NM_203349	
SCAPER	49855	hgsc.bcm.edu	37	15	76994169	76994169	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:76994169C>G	ENST00000563290.1	-	20	2533	c.2438G>C	c.(2437-2439)gGg>gCg	p.G813A	SCAPER_ENST00000538941.2_Missense_Mutation_p.G567A|SCAPER_ENST00000324767.7_Missense_Mutation_p.G813A			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	813						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						GTGTTTTCTCCCTTTAACATG	0.353																																					p.G813A		Atlas-SNP	.											.	SCAPER	160	.	0			c.G2438C						.						87.0	85.0	85.0					15																	76994169		1857	4126	5983	SO:0001583	missense	49855	exon19			TTTCTCCCTTTAA	AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2438G>C	chr15.hg19:g.76994169C>G	ENSP00000454973:p.Gly813Ala	52.0	0.0		63.0	17.0	NM_020843	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	ENST00000563290.1	hg19	CCDS53962.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.315415	0.81358	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.71103	-0.54;-0.54	5.49	5.49	0.81192	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.82678	0.5089	M	0.65975	2.015	0.80722	D	1	D;D	0.62365	0.991;0.987	D;P	0.66196	0.942;0.834	T	0.82141	-0.0604	10	0.46703	T	0.11	.	19.3857	0.94555	0.0:1.0:0.0:0.0	.	812;567	Q9BY12;F5H7X8	SCAPE_HUMAN;.	A	813;567;835	ENSP00000326924:G813A;ENSP00000442190:G567A	ENSP00000303560:G835A	G	-	2	0	SCAPER	74781224	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	7.234000	0.78134	2.596000	0.87737	0.557000	0.71058	GGG	.	.		0.353	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419698.1	NM_020843	
RASGRF1	5923	hgsc.bcm.edu	37	15	79350802	79350802	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:79350802C>T	ENST00000419573.3	-	3	679	c.405G>A	c.(403-405)gaG>gaA	p.E135E	RASGRF1_ENST00000558480.2_Silent_p.E135E|RASGRF1_ENST00000560334.1_5'UTR	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	135					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ATGCCTCATGCTCTGTGGCGA	0.572																																					p.E135E		Atlas-SNP	.											.	RASGRF1	168	.	0			c.G405A						.						121.0	100.0	107.0					15																	79350802		2196	4293	6489	SO:0001819	synonymous_variant	5923	exon3			CTCATGCTCTGTG	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.405G>A	chr15.hg19:g.79350802C>T		97.0	0.0		154.0	46.0	NM_001145648	F8VPA5|H0YKF2|J3KQP9|Q16027	Silent	SNP	ENST00000419573.3	hg19	CCDS10309.1																																																																																			.	.		0.572	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
AP3B2	8120	hgsc.bcm.edu	37	15	83357541	83357541	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr15:83357541C>G	ENST00000261722.3	-	4	514	c.307G>C	c.(307-309)Gag>Cag	p.E103Q	AP3B2_ENST00000535348.1_Intron|AP3B2_ENST00000542200.1_Missense_Mutation_p.E103Q|RP11-752G15.3_ENST00000560650.1_RNA|AP3B2_ENST00000561455.1_5'UTR|AP3B2_ENST00000535359.1_Missense_Mutation_p.E103Q	NM_004644.3	NP_004635.2	Q13367	AP3B2_HUMAN	adaptor-related protein complex 3, beta 2 subunit	103					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|intracellular protein transport (GO:0006886)|post-Golgi vesicle-mediated transport (GO:0006892)	AP-3 adaptor complex (GO:0030123)|COPI-coated vesicle (GO:0030137)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(4)|endometrium(1)|kidney(1)|large_intestine(4)|lung(21)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(2)	41			BRCA - Breast invasive adenocarcinoma(143;0.229)			TCTTGCTGCTCCTCAGCGTAG	0.602																																					p.E103Q		Atlas-SNP	.											.	AP3B2	103	.	0			c.G307C						.						78.0	84.0	82.0					15																	83357541		2117	4237	6354	SO:0001583	missense	8120	exon4			GCTGCTCCTCAGC	U37673	CCDS45331.1, CCDS61736.1, CCDS61737.1	15q	2008-07-07			ENSG00000103723	ENSG00000103723			567	protein-coding gene	gene with protein product		602166				7671305, 1851215	Standard	NM_004644		Approved	NAPTB	uc010uoh.2	Q13367	OTTHUMG00000168009	ENST00000261722.3:c.307G>C	chr15.hg19:g.83357541C>G	ENSP00000261722:p.Glu103Gln	152.0	0.0		170.0	31.0	NM_004644	A4Z4T7|B7ZKR7|B7ZKS0|O14808|Q52LY8	Missense_Mutation	SNP	ENST00000261722.3	hg19	CCDS45331.1	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225169	0.79576	.	.	ENSG00000103723	ENST00000261722;ENST00000535359;ENST00000541693;ENST00000542200;ENST00000535513	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.76	5.76	0.90799	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.108228	0.64402	N	0.000007	T	0.33702	0.0872	L	0.31476	0.935	0.80722	D	1	P;P;B	0.40000	0.698;0.592;0.236	B;P;B	0.45276	0.222;0.475;0.349	T	0.02294	-1.1181	10	0.42905	T	0.14	-24.8029	19.5631	0.95380	0.0:1.0:0.0:0.0	.	103;103;103	F5H0E6;B7ZKS0;Q13367	.;.;AP3B2_HUMAN	Q	103;103;59;103;103	ENSP00000261722:E103Q;ENSP00000440984:E103Q;ENSP00000441961:E59Q;ENSP00000440719:E103Q	ENSP00000261722:E103Q	E	-	1	0	AP3B2	81154595	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	7.693000	0.84214	2.710000	0.92621	0.655000	0.94253	GAG	.	.		0.602	AP3B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397463.1		
ACSM2A	123876	hgsc.bcm.edu	37	16	20494379	20494379	+	Splice_Site	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:20494379G>A	ENST00000573854.1	+	13	1623		c.e13-1		ACSM2A_ENST00000575690.1_Splice_Site|ACSM2A_ENST00000396104.2_Splice_Site|ACSM2A_ENST00000417235.2_Splice_Site|ACSM2A_ENST00000219054.6_Splice_Site|ACSM2A_ENST00000536134.1_Splice_Site	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A						fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CTTTTTTGCAGGTGGTGAAGG	0.498																																					.		Atlas-SNP	.											.	ACSM2A	120	.	0			c.1510-1G>A						.						195.0	177.0	183.0					16																	20494379		2203	4300	6503	SO:0001630	splice_region_variant	123876	exon14			TTTGCAGGTGGTG	AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1510-1G>A	chr16.hg19:g.20494379G>A		137.0	0.0		199.0	46.0	NM_001010845	B3KTT9|O75202	Splice_Site	SNP	ENST00000573854.1	hg19	CCDS32401.1	.	.	.	.	.	.	.	.	.	.	G	11.43	1.636470	0.29068	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	.	.	.	3.26	3.26	0.37387	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.417	0.67158	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACSM2A	20401880	1.000000	0.71417	0.927000	0.36925	0.359000	0.29487	7.884000	0.87274	1.507000	0.48752	0.305000	0.20034	.	.	.		0.498	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000436764.1	NM_001010845	Intron
TNRC6A	27327	hgsc.bcm.edu	37	16	24834929	24834929	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:24834929T>G	ENST00000395799.3	+	25	5819	c.5690T>G	c.(5689-5691)cTc>cGc	p.L1897R	TNRC6A_ENST00000432286.2_Missense_Mutation_p.L375R|TNRC6A_ENST00000315183.7_Missense_Mutation_p.L1848R	NM_014494.2	NP_055309.2	Q8NDV7	TNR6A_HUMAN	trinucleotide repeat containing 6A	1897	Sufficient for interaction with AGO2.				cellular response to starvation (GO:0009267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(13)|kidney(5)|large_intestine(13)|liver(1)|lung(20)|ovary(3)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64				GBM - Glioblastoma multiforme(48;0.0394)		CGGACCGATCTCAATCACTGG	0.612																																					p.L1897R		Atlas-SNP	.											.	TNRC6A	171	.	0			c.T5690G						.						114.0	113.0	114.0					16																	24834929		2197	4300	6497	SO:0001583	missense	27327	exon25			CCGATCTCAATCA	U80739	CCDS10624.2	16p11.2	2009-09-22	2004-12-17	2004-12-17	ENSG00000090905	ENSG00000090905		"""Trinucleotide (CAG) repeat containing"""	11969	protein-coding gene	gene with protein product		610739	"""trinucleotide repeat containing 6"""	TNRC6		9225980	Standard	NM_014494		Approved	CAGH26, KIAA1460, GW182	uc002dmm.3	Q8NDV7	OTTHUMG00000096999	ENST00000395799.3:c.5690T>G	chr16.hg19:g.24834929T>G	ENSP00000379144:p.Leu1897Arg	122.0	0.0		138.0	27.0	NM_014494	C9JAR8|O15408|Q658L5|Q6NVB5|Q8NEZ0|Q8TBT8|Q8TCR0|Q9NV59|Q9P268	Missense_Mutation	SNP	ENST00000395799.3	hg19	CCDS10624.2	.	.	.	.	.	.	.	.	.	.	t	8.042	0.764075	0.15914	.	.	ENSG00000090905	ENST00000315183;ENST00000395799;ENST00000432286	T;T	0.13089	2.63;2.62	5.64	5.64	0.86602	.	0.227351	0.39341	N	0.001385	T	0.15089	0.0364	L	0.39898	1.24	0.33298	D	0.564448	D;B	0.54207	0.965;0.412	P;B	0.47981	0.563;0.121	T	0.16808	-1.0390	10	0.21540	T	0.41	-0.1468	10.9817	0.47499	0.0:0.0724:0.0:0.9276	.	1848;1897	Q8NDV7-6;Q8NDV7	.;TNR6A_HUMAN	R	1848;1897;375	ENSP00000326900:L1848R;ENSP00000379144:L1897R	ENSP00000326900:L1848R	L	+	2	0	TNRC6A	24742430	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.545000	0.60698	2.132000	0.65825	0.529000	0.55759	CTC	.	.		0.612	TNRC6A-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000214081.1	NM_020847	
TGFB1I1	7041	hgsc.bcm.edu	37	16	31487440	31487440	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:31487440C>A	ENST00000394863.3	+	8	952	c.822C>A	c.(820-822)ttC>ttA	p.F274L	TGFB1I1_ENST00000361773.3_Missense_Mutation_p.F257L|TGFB1I1_ENST00000394858.2_Missense_Mutation_p.F257L|TGFB1I1_ENST00000567607.1_Missense_Mutation_p.F257L	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	274	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						GAGCCCCCTTCTGCCCCGAGT	0.677																																					p.F274L		Atlas-SNP	.											.	TGFB1I1	60	.	0			c.C822A						.						66.0	59.0	61.0					16																	31487440		2197	4300	6497	SO:0001583	missense	7041	exon8			CCCCTTCTGCCCC	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.822C>A	chr16.hg19:g.31487440C>A	ENSP00000378332:p.Phe274Leu	63.0	0.0		76.0	19.0	NM_001042454	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	hg19	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767115	0.69878	.	.	ENSG00000140682	ENST00000394863;ENST00000361773;ENST00000394858	D;D;D	0.87412	-2.25;-2.25;-2.25	5.4	2.06	0.26882	Zinc finger, LIM-type (4);	0.054439	0.85682	D	0.000000	T	0.77198	0.4095	N	0.16066	0.365	0.46774	D	0.999196	B	0.26445	0.149	B	0.36766	0.232	T	0.66364	-0.5942	10	0.39692	T	0.17	.	7.5762	0.27937	0.0:0.623:0.0:0.377	.	274	O43294	TGFI1_HUMAN	L	274;257;257	ENSP00000378332:F274L;ENSP00000355117:F257L;ENSP00000378327:F257L	ENSP00000355117:F257L	F	+	3	2	TGFB1I1	31394941	0.999000	0.42202	1.000000	0.80357	0.988000	0.76386	0.719000	0.25881	0.240000	0.21263	0.655000	0.94253	TTC	.	.		0.677	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
PSKH1	5681	hgsc.bcm.edu	37	16	67943502	67943502	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:67943502G>T	ENST00000291041.5	+	2	1020	c.850G>T	c.(850-852)Ggc>Tgc	p.G284C		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	284	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		GTGGGCGCTGGGCGTCATTGC	0.567																																					p.G284C		Atlas-SNP	.											.	PSKH1	28	.	0			c.G850T						.						98.0	83.0	88.0					16																	67943502		2198	4300	6498	SO:0001583	missense	5681	exon2			GCGCTGGGCGTCA	M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.850G>T	chr16.hg19:g.67943502G>T	ENSP00000291041:p.Gly284Cys	104.0	0.0		130.0	38.0	NM_006742	Q9NY19	Missense_Mutation	SNP	ENST00000291041.5	hg19	CCDS10851.1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253978	0.80135	.	.	ENSG00000159792	ENST00000291041	D	0.82167	-1.58	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.95642	0.8583	H	0.99379	4.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97744	1.0210	10	0.87932	D	0	-17.3627	18.8712	0.92315	0.0:0.0:1.0:0.0	.	284	P11801	KPSH1_HUMAN	C	284	ENSP00000291041:G284C	ENSP00000291041:G284C	G	+	1	0	PSKH1	66501003	1.000000	0.71417	0.909000	0.35828	0.685000	0.39939	9.869000	0.99810	2.561000	0.86390	0.655000	0.94253	GGC	.	.		0.567	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268882.3	NM_006742	
PDPR	55066	hgsc.bcm.edu	37	16	70170122	70170122	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr16:70170122G>A	ENST00000288050.4	+	10	1980	c.1023G>A	c.(1021-1023)agG>agA	p.R341R	PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000398122.3_Silent_p.R241R|PDPR_ENST00000568530.1_Silent_p.R341R	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	341					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		CCCTTCTGAGGAGGATGCCAG	0.463																																					p.R341R		Atlas-SNP	.											.	PDPR	66	.	0			c.G1023A						.						31.0	34.0	33.0					16																	70170122		1875	4116	5991	SO:0001819	synonymous_variant	55066	exon10			TCTGAGGAGGATG		CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1023G>A	chr16.hg19:g.70170122G>A		148.0	0.0		158.0	7.0	NM_017990	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Silent	SNP	ENST00000288050.4	hg19	CCDS45520.1																																																																																			.	.		0.463	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434502.1	NM_017990	
MYBBP1A	10514	hgsc.bcm.edu	37	17	4446343	4446343	+	Silent	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:4446343G>A	ENST00000254718.4	-	20	3063	c.2757C>T	c.(2755-2757)acC>acT	p.T919T	MYBBP1A_ENST00000381556.2_Silent_p.T919T			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	919					cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						GGTAGAGGGCGGTGGGGGAGT	0.667																																					p.T919T		Atlas-SNP	.											MYBBP1A,right_upper_lobe,carcinoma,0,1	MYBBP1A	69	.	0			c.C2757T						.						50.0	59.0	56.0					17																	4446343		2203	4300	6503	SO:0001819	synonymous_variant	10514	exon20			GAGGGCGGTGGGG	AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.2757C>T	chr17.hg19:g.4446343G>A		54.0	0.0		85.0	7.0	NM_014520	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Silent	SNP	ENST00000254718.4	hg19	CCDS11046.1																																																																																			.	.		0.667	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000207488.2	NM_014520	
ZBTB4	57659	hgsc.bcm.edu	37	17	7370078	7370078	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:7370078C>T	ENST00000311403.4	-	3	382	c.43G>A	c.(43-45)Gcc>Acc	p.A15T	ZBTB4_ENST00000380599.4_Missense_Mutation_p.A15T	NM_020899.3	NP_065950.2	Q9P1Z0	ZBTB4_HUMAN	zinc finger and BTB domain containing 4	15					cellular response to DNA damage stimulus (GO:0006974)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyl-CpG binding (GO:0008327)|methyl-CpNpG binding (GO:0010428)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(7)|ovary(3)|prostate(3)|skin(6)	36		Colorectal(1115;3.46e-05)|Myeloproliferative disorder(207;0.0255)		COAD - Colon adenocarcinoma(228;4.1e-06)|READ - Rectum adenocarcinoma(115;0.0642)		CGCAGGACGGCGGGGGCATGG	0.657																																					p.A15T		Atlas-SNP	.											.	ZBTB4	163	.	0			c.G43A						.						20.0	17.0	18.0					17																	7370078		2199	4299	6498	SO:0001583	missense	57659	exon3			GGACGGCGGGGGC	AB040971	CCDS11107.1	17p13.2	2013-01-09			ENSG00000174282	ENSG00000174282		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	23847	protein-coding gene	gene with protein product		612308				12477932	Standard	NM_020899		Approved	KIAA1538, KAISO-L1, ZNF903	uc002ghd.4	Q9P1Z0	OTTHUMG00000108137	ENST00000311403.4:c.43G>A	chr17.hg19:g.7370078C>T	ENSP00000307858:p.Ala15Thr	40.0	0.0		45.0	13.0	NM_001128833	B3KVL6|Q7Z697|Q86XJ4|Q8N4V8	Missense_Mutation	SNP	ENST00000311403.4	hg19	CCDS11107.1	.	.	.	.	.	.	.	.	.	.	C	4.358	0.065871	0.08388	.	.	ENSG00000174282	ENST00000311403;ENST00000380599	T;T	0.70282	-0.47;-0.47	5.0	5.0	0.66597	BTB/POZ fold (2);	0.178800	0.37483	N	0.002077	T	0.46795	0.1411	N	0.05230	-0.09	0.34910	D	0.747394	D	0.58620	0.983	P	0.44422	0.449	T	0.54873	-0.8228	10	0.25106	T	0.35	-16.4127	6.3793	0.21525	0.1828:0.7267:0.0:0.0905	.	15	Q9P1Z0	ZBTB4_HUMAN	T	15	ENSP00000307858:A15T;ENSP00000369973:A15T	ENSP00000307858:A15T	A	-	1	0	ZBTB4	7310802	0.121000	0.22262	0.850000	0.33497	0.302000	0.27658	0.590000	0.23954	2.605000	0.88082	0.561000	0.74099	GCC	.	.		0.657	ZBTB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226940.2	NM_020899	
PER1	5187	hgsc.bcm.edu	37	17	8047144	8047144	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:8047144T>C	ENST00000317276.4	-	19	2749	c.2512A>G	c.(2512-2514)Aaa>Gaa	p.K838E	PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Missense_Mutation_p.K815E	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	838					circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CGCTTGGCTTTGGATCGGCAG	0.672			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.K838E		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.A2512G						.						43.0	52.0	49.0					17																	8047144		2203	4300	6503	SO:0001583	missense	5187	exon19			TGGCTTTGGATCG	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2512A>G	chr17.hg19:g.8047144T>C	ENSP00000314420:p.Lys838Glu	36.0	0.0		41.0	6.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	hg19	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191104	0.58017	.	.	ENSG00000179094	ENST00000317276	T	0.16743	2.32	5.24	5.24	0.73138	.	0.197963	0.42053	D	0.000767	T	0.15739	0.0379	L	0.35854	1.095	0.80722	D	1	P	0.47409	0.895	B	0.41236	0.351	T	0.01553	-1.1326	10	0.54805	T	0.06	-7.4453	13.0668	0.59038	0.0:0.0:0.0:1.0	.	838	O15534	PER1_HUMAN	E	838	ENSP00000314420:K838E	ENSP00000314420:K838E	K	-	1	0	PER1	7987869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.189000	0.58358	1.982000	0.57802	0.460000	0.39030	AAA	.	.		0.672	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
SUPT6H	6830	hgsc.bcm.edu	37	17	27023949	27023949	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:27023949G>A	ENST00000314616.6	+	30	4341	c.4058G>A	c.(4057-4059)gGt>gAt	p.G1353D	SUPT6H_ENST00000347486.4_Missense_Mutation_p.G1353D	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1353	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ATGGACCAGGGTGATGTGATT	0.498																																					p.G1353D		Atlas-SNP	.											.	SUPT6H	165	.	0			c.G4058A						.						169.0	140.0	150.0					17																	27023949		2203	4300	6503	SO:0001583	missense	6830	exon30			ACCAGGGTGATGT	U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4058G>A	chr17.hg19:g.27023949G>A	ENSP00000319104:p.Gly1353Asp	183.0	0.0		265.0	91.0	NM_003170	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Missense_Mutation	SNP	ENST00000314616.6	hg19	CCDS32596.1	.	.	.	.	.	.	.	.	.	.	G	34	5.399209	0.96030	.	.	ENSG00000109111	ENST00000314616	D	0.81739	-1.53	5.94	5.94	0.96194	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.93426	0.7903	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94444	0.7661	10	0.87932	D	0	-18.8388	20.3594	0.98849	0.0:0.0:1.0:0.0	.	1353	Q7KZ85	SPT6H_HUMAN	D	1353	ENSP00000319104:G1353D	ENSP00000319104:G1353D	G	+	2	0	SUPT6H	24048076	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.359000	0.97115	2.816000	0.96949	0.563000	0.77884	GGT	.	.		0.498	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446422.2	NM_003170	
TEX2	55852	hgsc.bcm.edu	37	17	62248484	62248484	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:62248484A>T	ENST00000583097.1	-	7	2819	c.2647T>A	c.(2647-2649)Ttc>Atc	p.F883I	TEX2_ENST00000584379.1_Missense_Mutation_p.F883I|TEX2_ENST00000258991.3_Missense_Mutation_p.F890I			Q8IWB9	TEX2_HUMAN	testis expressed 2	883					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TAAGGCTTGAAGGCCTGGAGG	0.448																																					p.F890I		Atlas-SNP	.											.	TEX2	89	.	0			c.T2668A						.						130.0	106.0	114.0					17																	62248484		2203	4300	6503	SO:0001583	missense	55852	exon7			GCTTGAAGGCCTG	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.2647T>A	chr17.hg19:g.62248484A>T	ENSP00000462665:p.Phe883Ile	131.0	0.0		219.0	30.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	A	17.10	3.302815	0.60195	.	.	ENSG00000136478	ENST00000258991	T	0.42900	0.96	6.03	6.03	0.97812	Domain of unknown function DUF2404 (1);	0.052460	0.85682	D	0.000000	T	0.42040	0.1185	N	0.22421	0.69	0.58432	D	0.999998	P;P	0.42375	0.778;0.719	P;P	0.48738	0.452;0.588	T	0.25779	-1.0122	10	0.41790	T	0.15	-21.5077	16.5602	0.84551	1.0:0.0:0.0:0.0	.	890;883	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	I	890	ENSP00000258991:F890I	ENSP00000258991:F890I	F	-	1	0	TEX2	59602216	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	8.932000	0.92897	2.313000	0.78055	0.454000	0.30748	TTC	.	.		0.448	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
KIF19	124602	hgsc.bcm.edu	37	17	72342641	72342641	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:72342641G>T	ENST00000389916.4	+	8	1040	c.902G>T	c.(901-903)aGc>aTc	p.S301I		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	301	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						TATCGCGACAGCAAGCTCACC	0.577																																					p.S301I		Atlas-SNP	.											.	KIF19	102	.	0			c.G902T						.						68.0	42.0	51.0					17																	72342641		2049	3985	6034	SO:0001583	missense	124602	exon8			GCGACAGCAAGCT	AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.902G>T	chr17.hg19:g.72342641G>T	ENSP00000374566:p.Ser301Ile	168.0	0.0		303.0	166.0	NM_153209	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Missense_Mutation	SNP	ENST00000389916.4	hg19	CCDS32718.2	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803380	0.90623	.	.	ENSG00000196169	ENST00000551294;ENST00000389916	D;D	0.86297	-2.1;-2.1	5.8	5.8	0.92144	Kinesin, motor domain (4);	.	.	.	.	D	0.97081	0.9046	H	0.99726	4.73	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.98541	1.0632	9	0.87932	D	0	.	19.7033	0.96063	0.0:0.0:1.0:0.0	.	301;259;259;301	Q2TAC6;F8VW50;Q2TAC6-3;Q2TAC6-2	KIF19_HUMAN;.;.;.	I	259;301	ENSP00000449134:S259I;ENSP00000374566:S301I	ENSP00000374566:S301I	S	+	2	0	KIF19	69854236	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	6.141000	0.71744	2.764000	0.94973	0.556000	0.70494	AGC	.	.		0.577	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319644.2	NM_153209	
ACTG1	71	hgsc.bcm.edu	37	17	79479128	79479128	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:79479128C>A	ENST00000575842.1	-	2	590	c.164G>T	c.(163-165)gGc>gTc	p.G55V	AC139149.1_ENST00000584254.1_RNA|ACTG1_ENST00000575087.1_Missense_Mutation_p.G55V|ACTG1_ENST00000573283.1_Missense_Mutation_p.G55V|RP13-766D20.2_ENST00000430912.1_RNA|ACTG1_ENST00000331925.2_Missense_Mutation_p.G55V			P63261	ACTG_HUMAN	actin, gamma 1	55					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component movement (GO:0006928)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|platelet aggregation (GO:0070527)|retina homeostasis (GO:0001895)|sarcomere organization (GO:0045214)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|membrane (GO:0016020)|myofibril (GO:0030016)|nucleus (GO:0005634)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|lung(8)|ovary(2)|prostate(5)|urinary_tract(1)	29	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0547)			GGCCTCGTCGCCCACGTAGGA	0.642																																					p.G55V		Atlas-SNP	.											.	ACTG1	55	.	0			c.G164T						.						65.0	64.0	65.0					17																	79479128		2203	4300	6503	SO:0001583	missense	71	exon3			TCGTCGCCCACGT		CCDS11782.1	17q25	2010-04-23	2004-05-19		ENSG00000184009	ENSG00000184009			144	protein-coding gene	gene with protein product		102560	"""deafness, autosomal dominant 20; deafness, autosomal dominant 26"""	ACTG, DFNA20, DFNA26		14684684	Standard	NM_001614		Approved		uc002kal.2	P63261		ENST00000575842.1:c.164G>T	chr17.hg19:g.79479128C>A	ENSP00000458162:p.Gly55Val	43.0	0.0		68.0	16.0	NM_001614	A8K7C2|P02571|P14104|P99022|Q5U032|Q96E67	Missense_Mutation	SNP	ENST00000575842.1	hg19	CCDS11782.1	.	.	.	.	.	.	.	.	.	.	C	16.85	3.237185	0.58886	.	.	ENSG00000184009	ENST00000331925;ENST00000447294	D	0.96459	-4.02	3.88	3.88	0.44766	Actin, conserved site (1);	0.000000	0.64402	U	0.000001	D	0.99004	0.9660	H	0.99573	4.635	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98686	1.0694	10	0.87932	D	0	.	14.8003	0.69909	0.0:1.0:0.0:0.0	.	55	P63261	ACTG_HUMAN	V	55	ENSP00000331514:G55V	ENSP00000331514:G55V	G	-	2	0	ACTG1	77093723	1.000000	0.71417	0.995000	0.50966	0.966000	0.64601	7.227000	0.78070	2.007000	0.58848	0.563000	0.77884	GGC	.	.		0.642	ACTG1-012	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000439935.2	NM_001614	
CEP76	79959	hgsc.bcm.edu	37	18	12699183	12699183	+	Silent	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:12699183C>T	ENST00000262127.2	-	4	540	c.315G>A	c.(313-315)cgG>cgA	p.R105R	CEP76_ENST00000423709.2_Intron|CEP76_ENST00000586887.1_Intron|PSMG2_ENST00000585331.2_Intron	NM_024899.2	NP_079175.2	Q8TAP6	CEP76_HUMAN	centrosomal protein 76kDa	105					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of centriole replication (GO:0046599)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|protein complex (GO:0043234)				endometrium(1)|kidney(3)|large_intestine(5)|lung(7)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						AAAGATACCTCCGTGTTGGAT	0.353																																					p.R105R		Atlas-SNP	.											.	CEP76	45	.	0			c.G315A						.						84.0	84.0	84.0					18																	12699183		2203	4300	6503	SO:0001819	synonymous_variant	79959	exon4			ATACCTCCGTGTT	BC026307	CCDS11861.1, CCDS62390.1	18p11.21	2014-02-20	2005-12-01	2005-12-01	ENSG00000101624	ENSG00000101624			25727	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 9"""	C18orf9		14654843	Standard	NM_024899		Approved	HsT1705, FLJ12542	uc002kri.4	Q8TAP6	OTTHUMG00000131701	ENST00000262127.2:c.315G>A	chr18.hg19:g.12699183C>T		65.0	0.0		104.0	24.0	NM_024899	B0YJB2|B4DXG5|B4DZW1|Q658N5|Q9H9U7	Silent	SNP	ENST00000262127.2	hg19	CCDS11861.1																																																																																			.	.		0.353	CEP76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254611.1	NM_024899	
DSG4	147409	hgsc.bcm.edu	37	18	28971168	28971168	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:28971168A>C	ENST00000308128.4	+	7	947	c.812A>C	c.(811-813)aAa>aCa	p.K271T	RP11-534N16.1_ENST00000578477.1_RNA|DSG4_ENST00000359747.4_Missense_Mutation_p.K271T|RP11-534N16.1_ENST00000581452.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.		Missing (in HYPT6). {ECO:0000269|PubMed:12705872, ECO:0000269|PubMed:15191570}.		anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			ACCTTAGAGAAAACTTCAGTA	0.403																																					p.K271T		Atlas-SNP	.											.	DSG4	343	.	0			c.A812C						.						131.0	117.0	122.0					18																	28971168		2203	4300	6503	SO:0001583	missense	147409	exon7			TAGAGAAAACTTC	AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.812A>C	chr18.hg19:g.28971168A>C	ENSP00000311859:p.Lys271Thr	50.0	0.0		93.0	30.0	NM_001134453	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	ENST00000308128.4	hg19	CCDS11897.1	.	.	.	.	.	.	.	.	.	.	A	11.89	1.774648	0.31411	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.60920	0.15;0.15	5.9	4.75	0.60458	Cadherin (3);Cadherin-like (1);	0.000000	0.36972	N	0.002316	T	0.47395	0.1443	L	0.33753	1.03	0.32633	N	0.521715	P;B	0.36392	0.551;0.255	B;B	0.37550	0.253;0.122	T	0.59172	-0.7504	10	0.44086	T	0.13	.	11.8916	0.52633	0.9319:0.0:0.0681:0.0	.	271;271	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	T	271	ENSP00000311859:K271T;ENSP00000352785:K271T	ENSP00000311859:K271T	K	+	2	0	DSG4	27225166	1.000000	0.71417	0.999000	0.59377	0.872000	0.50106	5.965000	0.70387	1.061000	0.40601	0.482000	0.46254	AAA	.	.		0.403	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254941.1	NM_177986	
DSG2	1829	hgsc.bcm.edu	37	18	29115251	29115251	+	Silent	SNP	T	T	C	rs367548984		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:29115251T>C	ENST00000261590.8	+	10	1508	c.1299T>C	c.(1297-1299)gaT>gaC	p.D433D		NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	433	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			AATTAGAAGATAGAGATAATT	0.308																																					p.D433D		Atlas-SNP	.											.	DSG2	115	.	0			c.T1299C						.	T		1,3575		0,1,1787	38.0	35.0	36.0		1299	-4.4	0.0	18		36	0,8102		0,0,4051	no	coding-synonymous	DSG2	NM_001943.3		0,1,5838	CC,CT,TT		0.0,0.028,0.0086		433/1119	29115251	1,11677	1788	4051	5839	SO:0001819	synonymous_variant	1829	exon10			AGAAGATAGAGAT	Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.1299T>C	chr18.hg19:g.29115251T>C		88.0	0.0		81.0	19.0	NM_001943	Q4KKU6	Silent	SNP	ENST00000261590.8	hg19	CCDS42423.1																																																																																			.	.		0.308	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447506.1	NM_001943	
RPRD1A	55197	hgsc.bcm.edu	37	18	33573185	33573185	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr18:33573185A>G	ENST00000399022.4	-	7	1039	c.868T>C	c.(868-870)Tct>Cct	p.S290P	RPRD1A_ENST00000337059.5_Missense_Mutation_p.S254P|RPRD1A_ENST00000357384.4_Missense_Mutation_p.S290P|RPRD1A_ENST00000590898.1_Missense_Mutation_p.S254P|RPRD1A_ENST00000588737.1_Missense_Mutation_p.S254P	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	290					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						GGCAATCGAGATAAGTCTGGC	0.537																																					p.S290P		Atlas-SNP	.											.	RPRD1A	30	.	0			c.T868C						.						110.0	100.0	103.0					18																	33573185		2203	4300	6503	SO:0001583	missense	55197	exon7			ATCGAGATAAGTC	AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.868T>C	chr18.hg19:g.33573185A>G	ENSP00000381984:p.Ser290Pro	101.0	0.0		127.0	40.0	NM_018170	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Missense_Mutation	SNP	ENST00000399022.4	hg19	CCDS11917.1	.	.	.	.	.	.	.	.	.	.	A	20.7	4.040668	0.75732	.	.	ENSG00000141425	ENST00000399022;ENST00000357384;ENST00000337059	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.76572	0.4006	M	0.66939	2.045	0.80722	D	1	D;D	0.76494	0.99;0.999	P;D	0.74348	0.811;0.983	T	0.78163	-0.2311	9	0.56958	D	0.05	-10.0903	14.0823	0.64932	1.0:0.0:0.0:0.0	.	290;254	Q96P16;Q96P16-3	RPR1A_HUMAN;.	P	290;290;254	.	ENSP00000337476:S254P	S	-	1	0	RPRD1A	31827183	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.157000	0.94714	2.218000	0.71995	0.533000	0.62120	TCT	.	.		0.537	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255802.1	NM_018170	
TUBB4A	10382	hgsc.bcm.edu	37	19	6495192	6495193	+	Missense_Mutation	DNP	CC	CC	GG	rs201070507		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:6495192_6495193CC>GG	ENST00000264071.2	-	4	1688_1689	c.1317_1318GG>CC	c.(1315-1320)gcGGag>gcCCag	p.E440Q	CTD-2396E7.9_ENST00000599292.1_RNA|TUBB4A_ENST00000540257.1_Missense_Mutation_p.E440Q|CTD-2396E7.10_ENST00000596027.1_RNA			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	440					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										ACCTCCTCCTCCGCCTCCTCCT	0.624																																					p.E440Q|p.A439A		Atlas-SNP	.											.	.	.	.	0			c.G1318C|c.G1317C						.																																			SO:0001583	missense	10382	exon4			CCTCCTCCGCCTC|CTCCTCCGCCTCC	AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.1317_1318delinsGG	chr19.hg19:g.6495192_6495193delinsGG	ENSP00000264071:p.Glu440Gln	142.0	0.0		164.0|165.0	35.0|38.0	NM_006087	B3KQP4|Q969E5	Missense_Mutation|Silent	SNP	ENST00000264071.2	hg19	CCDS12168.1																																																																																			.	.|C|0.999;T|0.001		0.624	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457841.1	NM_006087	
C3	718	hgsc.bcm.edu	37	19	6693493	6693493	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:6693493T>C	ENST00000245907.6	-	25	3252	c.3160A>G	c.(3160-3162)Acc>Gcc	p.T1054A		NM_000064.2	NP_000055.2	P01024	CO3_HUMAN	complement component 3	1054					complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|fatty acid metabolic process (GO:0006631)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of activation of membrane attack complex (GO:0001970)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic cell clearance (GO:2000427)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of glucose transport (GO:0010828)|positive regulation of lipid storage (GO:0010884)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|regulation of immune response (GO:0050776)|regulation of triglyceride biosynthetic process (GO:0010866)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	C5L2 anaphylatoxin chemotactic receptor binding (GO:0031715)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(5)|endometrium(7)|kidney(6)|large_intestine(18)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)	72				GBM - Glioblastoma multiforme(1328;1.36e-05)|Lung(535;0.00661)	Intravenous Immunoglobulin(DB00028)	AGCTGCTGGGTGTACCCTGCA	0.652																																					p.T1054A		Atlas-SNP	.											.	C3	192	.	0			c.A3160G						.						36.0	33.0	34.0					19																	6693493		2202	4300	6502	SO:0001583	missense	718	exon25			GCTGGGTGTACCC	J04763	CCDS32883.1	19p13.3-p13.2	2014-09-17			ENSG00000125730	ENSG00000125730	3.4.21.43	"""Complement system"", ""Endogenous ligands"""	1318	protein-coding gene	gene with protein product	"""C3a anaphylatoxin"", ""complement component C3a"", ""complement component C3b"", ""prepro-C3"""	120700					Standard	NM_000064		Approved	CPAMD1, ARMD9, C3a, C3b	uc002mfm.3	P01024	OTTHUMG00000150335	ENST00000245907.6:c.3160A>G	chr19.hg19:g.6693493T>C	ENSP00000245907:p.Thr1054Ala	29.0	0.0		40.0	21.0	NM_000064	A7E236	Missense_Mutation	SNP	ENST00000245907.6	hg19	CCDS32883.1	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.450423	0.01080	.	.	ENSG00000125730	ENST00000245907	T	0.31510	1.49	5.52	2.25	0.28309	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.309452	0.39020	N	0.001481	T	0.14399	0.0348	N	0.20881	0.62	0.09310	N	0.999998	B	0.11235	0.004	B	0.12156	0.007	T	0.16958	-1.0385	10	0.16896	T	0.51	.	1.7163	0.02902	0.1373:0.1575:0.1423:0.5629	.	1054	P01024	CO3_HUMAN	A	1054	ENSP00000245907:T1054A	ENSP00000245907:T1054A	T	-	1	0	C3	6644493	0.567000	0.26626	0.998000	0.56505	0.235000	0.25334	0.338000	0.19858	0.461000	0.27071	-0.280000	0.10049	ACC	.	.		0.652	C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317636.2	NM_000064	
ZNF99	7652	hgsc.bcm.edu	37	19	22940609	22940610	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:22940609_22940610CC>AA	ENST00000596209.1	-	4	2191_2192	c.2101_2102GG>TT	c.(2101-2103)GGa>TTa	p.G701L	CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.G610L	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99	701					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				GGGTTTCTTTCCAGTATGAATT	0.361																																					p.G701V|p.G701X		Atlas-SNP	.											.	ZNF99	273	.	0			c.G2102T|c.G2101T						.																																			SO:0001583	missense	7652	exon4			TTCTTTCCAGTAT|TCTTTCCAGTATG	BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4		ENST00000596209.1:c.2101_2102delinsAA	chr19.hg19:g.22940609_22940610delinsAA	ENSP00000472969:p.Gly701Leu	21.0	0.0		33.0	9.0	NM_001080409	M0R335	Missense_Mutation|Nonsense_Mutation	SNP	ENST00000596209.1	hg19	CCDS59369.1																																																																																			.	.		0.361	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000464591.1	XM_065124	
SARS2	54938	hgsc.bcm.edu	37	19	39421333	39421333	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:39421333C>T	ENST00000221431.6	-	1	203	c.44G>A	c.(43-45)cGt>cAt	p.R15H	SARS2_ENST00000430193.3_Missense_Mutation_p.R15H|SARS2_ENST00000594171.1_5'Flank|SARS2_ENST00000600042.1_Missense_Mutation_p.R15H|CTC-360G5.8_ENST00000599996.1_Intron|MRPS12_ENST00000407800.2_5'Flank|MRPS12_ENST00000402029.3_5'Flank|MRPS12_ENST00000308018.4_5'UTR|SARS2_ENST00000448145.2_Intron	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	15					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			GAACCCCCGACGAGTCAGCAA	0.602											OREG0025455	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R15H		Atlas-SNP	.											.	SARS2	33	.	0			c.G44A						.						40.0	38.0	39.0					19																	39421333		2203	4299	6502	SO:0001583	missense	54938	exon1			CCCCGACGAGTCA	AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.44G>A	chr19.hg19:g.39421333C>T	ENSP00000221431:p.Arg15His	56.0	0.0	885	67.0	33.0	NM_001145901	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	ENST00000221431.6	hg19	CCDS33017.1	.	.	.	.	.	.	.	.	.	.	C	16.10	3.028488	0.54790	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000455102	T;T;T	0.56941	0.44;0.43;1.28	5.35	-0.894	0.10563	.	1.643000	0.02821	N	0.125534	T	0.44095	0.1277	L	0.44542	1.39	.	.	.	B;B;B	0.21753	0.06;0.019;0.019	B;B;B	0.12837	0.008;0.001;0.001	T	0.34129	-0.9841	9	0.59425	D	0.04	.	5.3226	0.15889	0.1352:0.3443:0.4405:0.08	.	15;15;15	B4DJP6;B4DE10;Q9NP81	.;.;SYSM_HUMAN	H	15	ENSP00000406754:R15H;ENSP00000221431:R15H;ENSP00000414954:R15H	ENSP00000221431:R15H	R	-	2	0	FBXO17	44113173	0.000000	0.05858	0.000000	0.03702	0.209000	0.24338	-0.042000	0.12063	-0.065000	0.13021	-0.140000	0.14226	CGT	.	.		0.602	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000463139.1	NM_017827	
ZNF180	7733	hgsc.bcm.edu	37	19	44980916	44980916	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:44980916T>A	ENST00000221327.4	-	5	2063	c.1782A>T	c.(1780-1782)gtA>gtT	p.V594V	ZNF180_ENST00000592529.1_Silent_p.V567V|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000585514.1_5'Flank|ZNF180_ENST00000391956.4_Silent_p.V569V	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	594					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				TTCTCTGATGTACAACAAGAA	0.418																																					p.V594V	Esophageal Squamous(180;1353 2003 32862 46574 49854)	Atlas-SNP	.											.	ZNF180	103	.	0			c.A1782T						.						108.0	110.0	109.0					19																	44980916		2203	4300	6503	SO:0001819	synonymous_variant	7733	exon5			CTGATGTACAACA	AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1782A>T	chr19.hg19:g.44980916T>A		62.0	0.0		92.0	39.0	NM_013256	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	ENST00000221327.4	hg19	CCDS12639.1																																																																																			.	.		0.418	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000451601.1	NM_013256	
KCNA7	3743	hgsc.bcm.edu	37	19	49573780	49573780	+	Missense_Mutation	SNP	G	G	A	rs376824241		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:49573780G>A	ENST00000221444.1	-	2	1266	c.911C>T	c.(910-912)aCg>aTg	p.T304M		NM_031886.2	NP_114092.2	Q96RP8	KCNA7_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 7	304					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|skin(2)	11		all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_epithelial(76;3.83e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000397)|OV - Ovarian serous cystadenocarcinoma(262;0.000519)|GBM - Glioblastoma multiforme(486;0.00541)|Epithelial(262;0.0441)	Dalfampridine(DB06637)	GGCCCGAAGCGTCTGGCCCAA	0.577																																					p.T304M	Colon(74;686 1235 3793 23366 48562)	Atlas-SNP	.											KCNA7,NS,carcinoma,0,1	KCNA7	30	.	0			c.C911T						.	G	MET/THR	0,4406		0,0,2203	59.0	57.0	57.0		911	4.5	1.0	19		57	1,8599	1.2+/-3.3	0,1,4299	no	missense	KCNA7	NM_031886.2	81	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	304/457	49573780	1,13005	2203	4300	6503	SO:0001583	missense	3743	exon2			CGAAGCGTCTGGC	AF315818	CCDS12755.1	19q13.3	2012-07-05				ENSG00000104848		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6226	protein-coding gene	gene with protein product		176268				16382104	Standard	NM_031886		Approved	Kv1.7, HAK6	uc002pmg.3	Q96RP8		ENST00000221444.1:c.911C>T	chr19.hg19:g.49573780G>A	ENSP00000221444:p.Thr304Met	115.0	1.0		133.0	10.0	NM_031886	A1KYX7|Q9BYS4	Missense_Mutation	SNP	ENST00000221444.1	hg19	CCDS12755.1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437991	0.83885	0.0	1.16E-4	ENSG00000104848	ENST00000221444	D	0.98512	-4.97	4.54	4.54	0.55810	Ion transport (1);	0.101147	0.64402	D	0.000003	D	0.99381	0.9782	H	0.97940	4.11	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	D	0.98294	1.0515	10	0.87932	D	0	.	16.4224	0.83771	0.0:0.0:1.0:0.0	.	304	Q96RP8	KCNA7_HUMAN	M	304	ENSP00000221444:T304M	ENSP00000221444:T304M	T	-	2	0	KCNA7	54265592	1.000000	0.71417	0.954000	0.39281	0.994000	0.84299	9.820000	0.99359	2.264000	0.75181	0.491000	0.48974	ACG	.	.		0.577	KCNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466263.1	NM_031886	
ZNF347	84671	hgsc.bcm.edu	37	19	53644386	53644386	+	Silent	SNP	T	T	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:53644386T>A	ENST00000334197.7	-	5	1763	c.1695A>T	c.(1693-1695)ggA>ggT	p.G565G	ZNF347_ENST00000601804.1_Intron|ZNF347_ENST00000452676.2_Silent_p.G566G|ZNF347_ENST00000601469.2_Silent_p.G566G	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	565					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AAGGTTTTTCTCCAGTATGGA	0.408																																					p.G566G	Melanoma(64;205 1597 17324 45721)	Atlas-SNP	.											ZNF347,NS,carcinoma,0,1	ZNF347	87	.	0			c.A1698T						.						156.0	149.0	152.0					19																	53644386		2203	4300	6503	SO:0001819	synonymous_variant	84671	exon5			TTTTTCTCCAGTA	AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1695A>T	chr19.hg19:g.53644386T>A		90.0	0.0		104.0	6.0	NM_001172675	B3KU77|B9EG59|G5E9N4|Q8TCN1	Silent	SNP	ENST00000334197.7	hg19	CCDS33097.1																																																																																			.	.		0.408	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000464170.1	NM_032584	
LENG8	114823	hgsc.bcm.edu	37	19	54967843	54967843	+	Silent	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:54967843C>A	ENST00000326764.5	+	11	1953	c.1474C>A	c.(1474-1476)Cga>Aga	p.R492R	LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8	455										breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		CAAGCGCAGTCGAAAGAAGAT	0.677																																					p.R492R		Atlas-SNP	.											.	LENG8	73	.	0			c.C1474A						.						16.0	21.0	19.0					19																	54967843		2196	4291	6487	SO:0001819	synonymous_variant	114823	exon11			CGCAGTCGAAAGA	AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.1474C>A	chr19.hg19:g.54967843C>A		60.0	0.0		93.0	29.0	NM_052925	B0VJY9|Q8IZ27|Q8NCX6	Silent	SNP	ENST00000326764.5	hg19	CCDS12894.1																																																																																			.	.		0.677	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000140523.2	NM_052925	
SYT5	6861	hgsc.bcm.edu	37	19	55686689	55686689	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr19:55686689C>A	ENST00000354308.3	-	6	928	c.559G>T	c.(559-561)Ggg>Tgg	p.G187W	SYT5_ENST00000592935.1_5'Flank|SYT5_ENST00000537500.1_Missense_Mutation_p.G187W|CTD-2587H24.5_ENST00000591665.1_RNA|SYT5_ENST00000590851.1_Missense_Mutation_p.G184W	NM_003180.2	NP_003171.2	O00445	SYT5_HUMAN	synaptotagmin V	187	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium ion-dependent exocytosis (GO:0017156)|energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|dense core granule (GO:0031045)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|transporter activity (GO:0005215)			kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	18			BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0452)		ACCCTGCCCCCCAGCTCCACG	0.617																																					p.G187W		Atlas-SNP	.											.	SYT5	45	.	0			c.G559T						.						35.0	30.0	32.0					19																	55686689		2202	4300	6502	SO:0001583	missense	6861	exon6			TGCCCCCCAGCTC	X96783	CCDS12919.1, CCDS74455.1	19q13.42	2014-07-02			ENSG00000129990	ENSG00000129990		"""Synaptotagmins"""	11513	protein-coding gene	gene with protein product	"""synaptotagmin 5"""	600782				9177789	Standard	XM_006723338		Approved		uc002qjn.1	O00445	OTTHUMG00000180669	ENST00000354308.3:c.559G>T	chr19.hg19:g.55686689C>A	ENSP00000346265:p.Gly187Trp	35.0	0.0		56.0	12.0	NM_003180	B3KWJ8|B7Z300|Q86X72	Missense_Mutation	SNP	ENST00000354308.3	hg19	CCDS12919.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016193	0.93404	.	.	ENSG00000129990	ENST00000537500;ENST00000354308;ENST00000543844	T;T	0.69435	-0.4;-0.4	4.26	4.26	0.50523	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);Synaptotagmin (1);	0.000000	0.85682	D	0.000000	T	0.76877	0.4049	L	0.46947	1.48	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.97110	0.995;1.0;0.995	T	0.79490	-0.1782	10	0.66056	D	0.02	.	16.3268	0.82986	0.0:1.0:0.0:0.0	.	184;187;187	B7Z300;Q4FD32;O00445	.;.;SYT5_HUMAN	W	187;187;184	ENSP00000442896:G187W;ENSP00000346265:G187W	ENSP00000346265:G187W	G	-	1	0	SYT5	60378501	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.861000	0.69553	2.329000	0.79093	0.555000	0.69702	GGG	.	.		0.617	SYT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452501.1	NM_003180	
NCOA6	23054	hgsc.bcm.edu	37	20	33334661	33334661	+	Missense_Mutation	SNP	T	T	G	rs17092079	byFrequency	TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:33334661T>G	ENST00000374796.2	-	11	5434	c.2864A>C	c.(2863-2865)aAc>aCc	p.N955T	NCOA6_ENST00000359003.2_Missense_Mutation_p.N955T			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	955	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.		N -> S (in dbSNP:rs17092079). {ECO:0000269|PubMed:10567404, ECO:0000269|PubMed:10681503, ECO:0000269|PubMed:10823961, ECO:0000269|PubMed:10866662, ECO:0000269|PubMed:8724849}.		brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						GTTATCCAAGTTAATTCCTTG	0.418																																					p.N955T		Atlas-SNP	.											.	NCOA6	219	.	0			c.A2864C						.						93.0	91.0	92.0					20																	33334661		2203	4300	6503	SO:0001583	missense	23054	exon10			TCCAAGTTAATTC	AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2864A>C	chr20.hg19:g.33334661T>G	ENSP00000363929:p.Asn955Thr	59.0	0.0		58.0	6.0	NM_014071	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	ENST00000374796.2	hg19	CCDS13241.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.939720	0.73557	.	.	ENSG00000198646	ENST00000374796;ENST00000359003	T;T	0.23552	1.9;1.9	5.89	4.73	0.59995	.	0.163888	0.42420	D	0.000713	T	0.14227	0.0344	N	0.19112	0.55	0.36170	P	0.15127199999999996	B	0.22346	0.068	B	0.13407	0.009	T	0.12218	-1.0556	9	0.26408	T	0.33	-6.7525	7.6213	0.28187	0.0:0.0698:0.2543:0.6758	.	955	Q14686	NCOA6_HUMAN	T	955	ENSP00000363929:N955T;ENSP00000351894:N955T	ENSP00000351894:N955T	N	-	2	0	NCOA6	32798322	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.065000	0.30592	2.246000	0.74042	0.533000	0.62120	AAC	.	T|0.927;C|0.073		0.418	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078811.2	NM_014071	
ATP9A	10079	hgsc.bcm.edu	37	20	50273555	50273555	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:50273555G>T	ENST00000338821.5	-	14	1692	c.1428C>A	c.(1426-1428)aaC>aaA	p.N476K	ATP9A_ENST00000311637.5_Missense_Mutation_p.N340K|ATP9A_ENST00000402822.1_Missense_Mutation_p.N355K	NM_006045.1	NP_006036.1	O75110	ATP9A_HUMAN	ATPase, class II, type 9A	476					phospholipid translocation (GO:0045332)	early endosome (GO:0005769)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)	p.N476N(1)		breast(2)|cervix(2)|endometrium(6)|kidney(1)|large_intestine(10)|lung(18)|ovary(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CAGTCACACCGTTGGACTCAT	0.617																																					p.N476K		Atlas-SNP	.											ATP9A,colon,carcinoma,0,1	ATP9A	135	.	1	Substitution - coding silent(1)	large_intestine(1)	c.C1428A						.						113.0	83.0	93.0					20																	50273555		2203	4300	6503	SO:0001583	missense	10079	exon14			CACACCGTTGGAC	AB014511	CCDS33489.1	20q13.2	2010-04-20	2007-09-19		ENSG00000054793	ENSG00000054793		"""ATPases / P-type"""	13540	protein-coding gene	gene with protein product		609126	"""ATPase, Class II, type 9A"""			9734811, 11015572	Standard	NM_006045		Approved	KIAA0611, ATPIIA	uc002xwg.1	O75110	OTTHUMG00000032751	ENST00000338821.5:c.1428C>A	chr20.hg19:g.50273555G>T	ENSP00000342481:p.Asn476Lys	152.0	0.0		209.0	22.0	NM_006045	E1P5Y3|E1P5Y4|Q5TFW5|Q5TFW6|Q5TFW9|Q6ZMF3|Q9NQK6|Q9NQK7	Missense_Mutation	SNP	ENST00000338821.5	hg19	CCDS33489.1	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375881	0.42105	.	.	ENSG00000054793	ENST00000311637;ENST00000338821;ENST00000402822	D;D;D	0.96011	-3.88;-3.88;-3.88	5.02	-5.71	0.02413	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86781	0.6015	N	0.04768	-0.165	0.58432	D	0.999997	B;P	0.46512	0.325;0.879	B;P	0.44597	0.072;0.454	T	0.81874	-0.0732	10	0.32370	T	0.25	-27.125	13.0906	0.59166	0.5748:0.0:0.4252:0.0	.	355;476	O75110-2;O75110	.;ATP9A_HUMAN	K	340;476;355	ENSP00000309086:N340K;ENSP00000342481:N476K;ENSP00000385875:N355K	ENSP00000309086:N340K	N	-	3	2	ATP9A	49706962	0.932000	0.31603	0.799000	0.32177	0.299000	0.27559	-0.051000	0.11885	-0.976000	0.03542	-1.595000	0.00837	AAC	.	.		0.617	ATP9A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106494.1	NM_006045	
KRTAP6-3	337968	hgsc.bcm.edu	37	21	31964987	31964987	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr21:31964987G>C	ENST00000391624.1	+	1	229	c.202G>C	c.(202-204)Ggc>Cgc	p.G68R	KRTAP22-2_ENST00000382830.2_5'Flank	NM_181605.3	NP_853636.3	Q3LI67	KRA63_HUMAN	keratin associated protein 6-3	68						intermediate filament (GO:0005882)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(7)	10						tggctacagaggcctggactg	0.602																																					p.G75R		Atlas-SNP	.											.	KRTAP6-3	30	.	0			c.G223C						.						53.0	64.0	61.0					21																	31964987		2203	4300	6503	SO:0001583	missense	337968	exon1			TACAGAGGCCTGG	AP001708		21q22.1	2012-04-19			ENSG00000212938	ENSG00000212938		"""Keratin associated proteins"""	18933	protein-coding gene	gene with protein product						12359730	Standard	NM_181605		Approved	KAP6.3	uc002yom.3	Q3LI67	OTTHUMG00000057791	ENST00000391624.1:c.202G>C	chr21.hg19:g.31964987G>C	ENSP00000375482:p.Gly68Arg	132.0	0.0		175.0	13.0	NM_181605	A4IF26	Missense_Mutation	SNP	ENST00000391624.1	hg19		.	.	.	.	.	.	.	.	.	.	G	0.204	-1.042036	0.01997	.	.	ENSG00000212938	ENST00000391624	T	0.32023	1.47	3.62	-4.04	0.04010	.	.	.	.	.	T	0.13372	0.0324	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.26710	-1.0095	9	0.87932	D	0	.	6.1497	0.20304	0.2934:0.1799:0.5267:0.0	.	68	Q3LI67	KRA63_HUMAN	R	68	ENSP00000375482:G68R	ENSP00000375482:G68R	G	+	1	0	KRTAP6-3	30886858	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.584000	0.05800	-0.714000	0.04975	-1.295000	0.01343	GGC	.	.		0.602	KRTAP6-3-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000128243.2	NM_181605	
SEZ6L	23544	hgsc.bcm.edu	37	22	26706735	26706735	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:26706735C>A	ENST00000248933.6	+	7	1709	c.1614C>A	c.(1612-1614)aaC>aaA	p.N538K	SEZ6L_ENST00000402979.1_Missense_Mutation_p.N311K|SEZ6L_ENST00000529632.2_Missense_Mutation_p.N538K|SEZ6L_ENST00000360929.3_Missense_Mutation_p.N538K|SEZ6L_ENST00000403121.1_Missense_Mutation_p.N311K|SEZ6L_ENST00000404234.3_Missense_Mutation_p.N538K|SEZ6L_ENST00000343706.4_Missense_Mutation_p.N538K			Q9BYH1	SE6L1_HUMAN	seizure related 6 homolog (mouse)-like	538	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)				breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(35)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	80						GCGAAGGCAACACCATCCGCA	0.582																																					p.N538K		Atlas-SNP	.											.	SEZ6L	174	.	0			c.C1614A						.						146.0	114.0	125.0					22																	26706735		2203	4300	6503	SO:0001583	missense	23544	exon7			AGGCAACACCATC	AL050253	CCDS13833.1, CCDS54508.1, CCDS54510.1, CCDS54511.1, CCDS74837.1	22q12.1	2008-05-14	2001-11-28		ENSG00000100095	ENSG00000100095			10763	protein-coding gene	gene with protein product		607021	"""seizure related gene 6 (mouse)-like"""				Standard	NM_021115		Approved		uc003acb.3	Q9BYH1	OTTHUMG00000150870	ENST00000248933.6:c.1614C>A	chr22.hg19:g.26706735C>A	ENSP00000248933:p.Asn538Lys	182.0	0.0		194.0	58.0	NM_021115	A0AUW7|B0QYG4|B0QYG5|B7ZLJ6|G8JLP3|O95917|Q5THY5|Q6IBZ4|Q6UXD4|Q9NUI3|Q9NUI4|Q9NUI5|Q9Y2E1|Q9Y3J6	Missense_Mutation	SNP	ENST00000248933.6	hg19	CCDS13833.1	.	.	.	.	.	.	.	.	.	.	C	1.004	-0.689938	0.03328	.	.	ENSG00000100095	ENST00000404234;ENST00000529632;ENST00000360929;ENST00000248933;ENST00000343706;ENST00000403121;ENST00000402979	T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.04	-3.65	0.04502	CUB (5);	0.757438	0.11620	N	0.545850	T	0.29620	0.0739	M	0.78456	2.415	0.20563	N	0.999886	B;B;B;B;B;B;B	0.31274	0.125;0.149;0.109;0.317;0.317;0.149;0.149	B;B;B;B;B;B;B	0.31390	0.129;0.079;0.049;0.108;0.108;0.079;0.079	T	0.29088	-1.0023	10	0.25751	T	0.34	.	2.7657	0.05319	0.1145:0.3387:0.1123:0.4345	.	538;538;311;538;538;538;538	B7ZLJ8;B7ZLJ6;B0QYH4;Q9BYH1-5;Q9BYH1-4;B0QYG3;Q9BYH1	.;.;.;.;.;.;SE6L1_HUMAN	K	538;538;538;538;538;311;311	ENSP00000384772:N538K;ENSP00000437037:N538K;ENSP00000354185:N538K;ENSP00000248933:N538K;ENSP00000342661:N538K;ENSP00000384838:N311K;ENSP00000384733:N311K	ENSP00000248933:N538K	N	+	3	2	SEZ6L	25036735	0.007000	0.16637	0.000000	0.03702	0.065000	0.16274	0.181000	0.16880	-0.192000	0.10432	0.561000	0.74099	AAC	.	.		0.582	SEZ6L-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000320359.3		
NEFH	4744	hgsc.bcm.edu	37	22	29885446	29885446	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:29885446C>A	ENST00000310624.6	+	4	1850	c.1817C>A	c.(1816-1818)tCc>tAc	p.S606Y		NM_021076.3	NP_066554.2	P12036	NFH_HUMAN	neurofilament, heavy polypeptide	606	30 X 6 AA repeats of K-S-P-[AEPV]-[EAK]- [AEVK].|Tail.				axon development (GO:0061564)|axonogenesis (GO:0007409)|cell death (GO:0008219)|cell projection assembly (GO:0030031)|microtubule cytoskeleton organization (GO:0000226)|neurofilament bundle assembly (GO:0033693)|peripheral nervous system neuron axonogenesis (GO:0048936)|regulation of organelle transport along microtubule (GO:1902513)	axon (GO:0030424)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|neurofilament (GO:0005883)	dynein binding (GO:0045502)|kinesin binding (GO:0019894)|microtubule binding (GO:0008017)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|skin(3)	30						AAGGCCAAGtccccagtgaag	0.562																																					p.S606Y		Atlas-SNP	.											.	NEFH	178	.	0			c.C1817A						.						66.0	63.0	64.0					22																	29885446		2203	4300	6503	SO:0001583	missense	4744	exon4			CCAAGTCCCCAGT		CCDS13858.1	22q12.2	2013-01-16	2008-09-19		ENSG00000100285	ENSG00000100285		"""Intermediate filaments type IV"""	7737	protein-coding gene	gene with protein product		162230	"""neurofilament, heavy polypeptide 200kDa"""				Standard	NM_021076		Approved		uc003afo.3	P12036	OTTHUMG00000151155	ENST00000310624.6:c.1817C>A	chr22.hg19:g.29885446C>A	ENSP00000311997:p.Ser606Tyr	155.0	0.0		217.0	61.0	NM_021076	B4DYY4|Q96HF8|Q9UJS7|Q9UQ14	Missense_Mutation	SNP	ENST00000310624.6	hg19	CCDS13858.1	.	.	.	.	.	.	.	.	.	.	C	14.18	2.457677	0.43634	.	.	ENSG00000100285	ENST00000328842;ENST00000310624	T	0.42900	0.96	5.81	4.79	0.61399	.	0.137016	0.34088	N	0.004264	T	0.55289	0.1911	M	0.68952	2.095	0.33210	D	0.553233	D	0.71674	0.998	D	0.66196	0.942	T	0.67280	-0.5710	10	0.87932	D	0	.	6.2363	0.20764	0.1565:0.6961:0.0:0.1474	.	606	P12036	NFH_HUMAN	Y	606	ENSP00000311997:S606Y	ENSP00000311997:S606Y	S	+	2	0	NEFH	28215446	0.134000	0.22483	0.984000	0.44739	0.598000	0.36846	1.971000	0.40530	2.747000	0.94245	0.650000	0.86243	TCC	.	.		0.562	NEFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321553.2	NM_021076	
GRAMD4	23151	hgsc.bcm.edu	37	22	47073042	47073042	+	Splice_Site	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr22:47073042A>T	ENST00000406902.1	+	19	1845		c.e19-1		GRAMD4_ENST00000408031.1_Splice_Site|GRAMD4_ENST00000361034.3_Splice_Site			Q6IC98	GRAM4_HUMAN	GRAM domain containing 4						apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)	12		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|BRCA - Breast invasive adenocarcinoma(115;0.166)		CTTCCCTGCCAGCCGCTCGTG	0.627																																					.		Atlas-SNP	.											.	GRAMD4	53	.	0			c.1633-2A>T						.						97.0	87.0	90.0					22																	47073042		2202	4300	6502	SO:0001630	splice_region_variant	23151	exon18			CCTGCCAGCCGCT		CCDS33672.1	22q13.31	2008-03-03			ENSG00000075240	ENSG00000075240			29113	protein-coding gene	gene with protein product	"""death-inducing-protein"""	613691				15565177	Standard	NM_015124		Approved	KIAA0767, DIP	uc003bhx.3	Q6IC98	OTTHUMG00000150402	ENST00000406902.1:c.1633-1A>T	chr22.hg19:g.47073042A>T		71.0	0.0		93.0	6.0	NM_015124	A9IN51|A9IN57|Q68EN0|Q9UGE6|Q9Y4B9	Splice_Site	SNP	ENST00000406902.1	hg19	CCDS33672.1	.	.	.	.	.	.	.	.	.	.	.	16.55	3.154112	0.57259	.	.	ENSG00000075240	ENST00000406902;ENST00000361034;ENST00000408031	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0257	0.58814	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRAMD4	45451706	1.000000	0.71417	0.998000	0.56505	0.553000	0.35397	6.328000	0.72915	1.748000	0.51833	0.374000	0.22700	.	.	.		0.627	GRAMD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317969.1	NM_015124	Intron
CHM	1121	hgsc.bcm.edu	37	X	85302520	85302520	+	Missense_Mutation	SNP	G	G	A	rs201252021		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrX:85302520G>A	ENST00000357749.2	-	1	46	c.17C>T	c.(16-18)cCt>cTt	p.P6L	CHM_ENST00000537751.1_5'UTR|CHM_ENST00000358786.4_Missense_Mutation_p.P6L|CHM_ENST00000467744.2_5'Flank	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	6					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				AAACTCCGAAGGGAGAGTATC	0.458																																					p.P6L		Atlas-SNP	.											.	CHM	57	.	0			c.C17T	GRCh37	CD022133	CHM	D		.						123.0	72.0	89.0					X																	85302520		2203	4300	6503	SO:0001583	missense	1121	exon1			TCCGAAGGGAGAG	X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.17C>T	chrX.hg19:g.85302520G>A	ENSP00000350386:p.Pro6Leu	154.0	0.0		188.0	117.0	NM_001145414	A1L4D2|O43732	Missense_Mutation	SNP	ENST00000357749.2	hg19	CCDS14454.1	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677800	0.68042	.	.	ENSG00000188419	ENST00000357749;ENST00000358786	T;T	0.61627	0.09;0.09	5.06	4.19	0.49359	.	0.130770	0.53938	D	0.000060	T	0.74966	0.3786	M	0.76002	2.32	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	T	0.78489	-0.2184	10	0.87932	D	0	-10.0809	14.3456	0.66662	0.0:0.1453:0.8547:0.0	.	6;6	A1L4D2;P24386	.;RAE1_HUMAN	L	6	ENSP00000350386:P6L;ENSP00000362228:P6L	ENSP00000350386:P6L	P	-	2	0	CHM	85189176	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	4.355000	0.59424	1.096000	0.41439	0.600000	0.82982	CCT	.	.		0.458	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057396.3	NM_000390	
MT-ND1	4535	hgsc.bcm.edu	37	M	3434	3434	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrM:3434A>T	ENST00000361390.2	+	1	128	c.128A>T	c.(127-129)tAc>tTc	p.Y43F	MT-CO1_ENST00000361624.2_5'Flank|MT-TA_ENST00000387392.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TF_ENST00000387314.1_RNA|MT-RNR1_ENST00000389680.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND2_ENST00000361453.3_5'Flank			P03886	NU1M_HUMAN	mitochondrially encoded NADH dehydrogenase 1	43					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(13)|kidney(17)|lung(2)|prostate(1)	34					Desflurane(DB01189)|Halothane(DB01159)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Sevoflurane(DB01236)	TGTAGGCCCCTACGGGCTACT	0.498																																					p.Y43F		Atlas-SNP	.											.	.	.	.	0			c.A128T						.																																			SO:0001583	missense	10625	exon1			GCCCCTACGGGCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198888	ENSG00000198888	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7455	protein-coding gene	gene with protein product	"""complex I ND1 subunit"", ""NADH-ubiquinone oxidoreductase chain 1"""	516000	"""NADH dehydrogenase 1"""	MTND1			Standard			Approved	ND1, NAD1		P03886		ENST00000361390.2:c.128A>T	chrM.hg19:g.3434A>T	ENSP00000354687:p.Tyr43Phe	8.0	0.0		12.0	8.0	ENST00000361390	C0JKH6|Q37523	Missense_Mutation	SNP	ENST00000361390.2	hg19																																																																																				.	.		0.498	MT-ND1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024026	
MT-CO1	4512	hgsc.bcm.edu	37	M	6321	6321	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chrM:6321G>A	ENST00000361624.2	+	1	418	c.418G>A	c.(418-420)Gga>Aga	p.G140R	MT-TA_ENST00000387392.1_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-ATP8_ENST00000361851.1_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TK_ENST00000387421.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	140					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						ACTCCCACCCTGGAGCCTCCG	0.502																																					p.G140X		Atlas-SNP	.											.	.	.	.	0			c.G418A						.																																			SO:0001583	missense	5742	exon1			CACCCTGGAGCCT			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.418G>A	chrM.hg19:g.6321G>A	ENSP00000354499:p.Gly140Arg	7.0	0.0		37.0	10.0	ENST00000361624	Q34770	Nonsense_Mutation	SNP	ENST00000361624.2	hg19																																																																																				.	.		0.502	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024028	
ALB	213	hgsc.bcm.edu	37	4	74283832	74283834	+	In_Frame_Del	DEL	GTG	GTG	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	GTG	GTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr4:74283832_74283834delGTG	ENST00000503124.1	+	10	1213_1215	c.1006_1008delGTG	c.(1006-1008)gtgdel	p.V336del	ALB_ENST00000415165.2_In_Frame_Del_p.V294del|ALB_ENST00000401494.3_In_Frame_Del_p.V371del|ALB_ENST00000295897.4_In_Frame_Del_p.V486del|ALB_ENST00000509063.1_In_Frame_Del_p.V486del|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			CCAGTTATGTGTGTTGCATGAGA	0.419																																					p.485_486del		Atlas-Indel,Pindel	.											.	ALB	132	.	0			c.1455_1457del						.																																			SO:0001651	inframe_deletion	213	exon12			.	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.1006_1008delGTG	chr4.hg19:g.74283832_74283834delGTG	ENSP00000421027:p.Val336del	55.0	0.0		96.0	20.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	In_Frame_Del	DEL	ENST00000503124.1	hg19																																																																																				.	.		0.419	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
NUFIP1	26747	hgsc.bcm.edu	37	13	45563368	45563368	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr13:45563368delG	ENST00000379161.4	-	1	250	c.204delC	c.(202-204)cccfs	p.P68fs	RP11-321C24.1_ENST00000437748.2_lincRNA|GPALPP1_ENST00000361121.2_5'Flank|GPALPP1_ENST00000379151.4_5'Flank	NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	68	Pro-rich.				box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		GGGCCTCCATGGGGGGCTGCG	0.672																																					p.M69fs		Atlas-INDEL	.											.	NUFIP1	41	.	0			c.205delA						.						15.0	18.0	17.0					13																	45563368		2198	4292	6490	SO:0001589	frameshift_variant	26747	exon1			.	AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.204delC	chr13.hg19:g.45563368delG	ENSP00000368459:p.Pro68fs	38.0	0.0		36.0	11.0	NM_012345	Q8WVM5|Q96SG1	Frame_Shift_Del	DEL	ENST00000379161.4	hg19	CCDS9393.1																																																																																			.	.		0.672	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044755.2	NM_012345	
PECR	55825	hgsc.bcm.edu	37	2	216946374	216946397	+	In_Frame_Del	DEL	CGATGCCCGTGGCCCCGCCGGTGA	CGATGCCCGTGGCCCCGCCGGTGA	-	rs370096306|rs201164160		TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	CGATGCCCGTGGCCCCGCCGGTGA	CGATGCCCGTGGCCCCGCCGGTGA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr2:216946374_216946397delCGATGCCCGTGGCCCCGCCGGTGA	ENST00000265322.7	-	1	142_165	c.68_91delTCACCGGCGGGGCCACGGGCATCG	c.(67-93)gtcaccggcggggccacgggcatcgga>gga	p.VTGGATGI23del	PECR_ENST00000497889.1_5'UTR|TMEM169_ENST00000437356.2_5'Flank|TMEM169_ENST00000454545.1_5'Flank|TMEM169_ENST00000295658.4_5'Flank|TMEM169_ENST00000406027.2_5'Flank	NM_018441.5	NP_060911.2	Q9BY49	PECR_HUMAN	peroxisomal trans-2-enoyl-CoA reductase	23					fatty acid biosynthetic process (GO:0006633)|oxidation-reduction process (GO:0055114)|phytol metabolic process (GO:0033306)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	receptor binding (GO:0005102)|trans-2-enoyl-CoA reductase (NADPH) activity (GO:0019166)			endometrium(2)|kidney(1)|liver(1)|lung(9)|stomach(1)	14		Renal(323;0.0327)		Epithelial(149;3.8e-06)|all cancers(144;0.000272)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Adenine(DB00173)	ATGGCTTTTCCGATGCCCGTGGCCCCGCCGGTGACGATGGCCAC	0.674																																					p.23_31del		Atlas-Indel,Pindel	.											.	PECR	22	.	0			c.69_92del						.																																			SO:0001651	inframe_deletion	55825	exon1			.	AF119841	CCDS33375.1	2q35	2011-09-14			ENSG00000115425	ENSG00000115425	1.3.1.38	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	18281	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 29C, member 1"""	605843				10811639, 11669066, 19027726	Standard	NM_018441		Approved	HSA250303, TERP, SDR29C1	uc002vft.3	Q9BY49	OTTHUMG00000154825	ENST00000265322.7:c.68_91delTCACCGGCGGGGCCACGGGCATCG	chr2.hg19:g.216946374_216946397delCGATGCCCGTGGCCCCGCCGGTGA	ENSP00000265322:p.Val23_Ile30del	183.0	0.0		226.0	42.0	NM_018441	B2RE42|Q53TC4|Q6IAK9|Q9NRD4|Q9NY60|Q9P1A4	In_Frame_Del	DEL	ENST00000265322.7	hg19	CCDS33375.1																																																																																			.	.		0.674	PECR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337277.1	NM_018441	
NUP133	55746	hgsc.bcm.edu	37	1	229596501	229596502	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr1:229596501_229596502insA	ENST00000261396.3	-	20	2791_2792	c.2700_2701insT	c.(2698-2703)tttctcfs	p.L901fs	NUP133_ENST00000537506.1_Frame_Shift_Ins_p.L885fs	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	901					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				CAACGGAAGAGAAAGTCTGAAA	0.337																																					p.L901fs		Atlas-Indel,Pindel	.											.	NUP133	111	.	0			c.2701_2702insT						.																																			SO:0001589	frameshift_variant	55746	exon20			.		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.2701dupT	chr1.hg19:g.229596504_229596504dupA	ENSP00000261396:p.Leu901fs	65.0	0.0		130.0	33.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Frame_Shift_Ins	INS	ENST00000261396.3	hg19	CCDS1579.1																																																																																			.	.		0.337	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
ANKFY1	51479	hgsc.bcm.edu	37	17	4086813	4086825	+	Frame_Shift_Del	DEL	GAGCCCAGCAGCT	GAGCCCAGCAGCT	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	GAGCCCAGCAGCT	GAGCCCAGCAGCT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr17:4086813_4086825delGAGCCCAGCAGCT	ENST00000341657.4	-	14	1855_1867	c.1820_1832delAGCTGCTGGGCTC	c.(1819-1833)cagctgctgggctctfs	p.QLLGS607fs	CYB5D2_ENST00000573984.1_Intron|ANKFY1_ENST00000573722.1_5'Flank|ANKFY1_ENST00000570535.1_Frame_Shift_Del_p.QLLGS649fs|Y_RNA_ENST00000516003.1_RNA|ANKFY1_ENST00000574367.1_Frame_Shift_Del_p.QLLGS607fs	NM_016376.3	NP_057460.3	Q9P2R3	ANFY1_HUMAN	ankyrin repeat and FYVE domain containing 1	607					endosomal vesicle fusion (GO:0034058)|endosome localization (GO:0032439)|Golgi to lysosome transport (GO:0090160)|positive regulation of pinocytosis (GO:0048549)|retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|macropinosome (GO:0044354)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phosphatidylinositol phosphate binding (GO:1901981)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|liver(1)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						GGCGGCTCCAGAGCCCAGCAGCTGGGCTGCGAT	0.592																																					p.649_653del		Pindel	.											.	ANKFY1	81	.	0			c.1947_1959del						.																																			SO:0001589	frameshift_variant	51479	exon14			.	AB033081	CCDS42236.1, CCDS58502.1	17p13.3	2013-01-10			ENSG00000185722	ENSG00000185722		"""Zinc fingers, FYVE domain containing"", ""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	20763	protein-coding gene	gene with protein product		607927				10940552, 17273843	Standard	NM_016376		Approved	ANKHZN, KIAA1255, ZFYVE14, BTBD23	uc002fxn.3	Q9P2R3	OTTHUMG00000177727	ENST00000341657.4:c.1820_1832delAGCTGCTGGGCTC	chr17.hg19:g.4086813_4086825delGAGCCCAGCAGCT	ENSP00000343362:p.Gln607fs	83.0	0.0		85.0	13.0	NM_001257999	A8KA65|Q5RKV4|Q9ULG5	Frame_Shift_Del	DEL	ENST00000341657.4	hg19																																																																																				.	.		0.592	ANKFY1-008	KNOWN	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000438702.1	NM_016376	
NCOA3	8202	hgsc.bcm.edu	37	20	46255749	46255749	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-A4NI-01A-11D-A27I-10	TCGA-DD-A4NI-10A-01D-A27I-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c154a63e-d2e1-4abb-83fe-62a5a5a70b33	63af893a-b381-43ba-8feb-c3221799df94	g.chr20:46255749delT	ENST00000371998.3	+	6	552	c.361delT	c.(361-363)ttgfs	p.L121fs	NCOA3_ENST00000372004.3_Frame_Shift_Del_p.L121fs|NCOA3_ENST00000497292.1_3'UTR|NCOA3_ENST00000341724.6_Frame_Shift_Del_p.L121fs|NCOA3_ENST00000371997.3_Frame_Shift_Del_p.L121fs			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	121	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						ATTTTAGGCATTGGATGGTTT	0.363																																					p.A120fs		Pindel	.											.	NCOA3	156	.	0			c.360delA						.						131.0	122.0	125.0					20																	46255749		2203	4300	6503	SO:0001589	frameshift_variant	8202	exon6			.	AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.361delT	chr20.hg19:g.46255749delT	ENSP00000361066:p.Leu121fs	156.0	0.0		248.0	52.0	NM_181659	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Frame_Shift_Del	DEL	ENST00000371998.3	hg19	CCDS13407.1																																																																																			.	.		0.363	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080405.1	NM_006534	
