#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
TNFRSF25	8718	hgsc.bcm.edu	37	1	6524732	6524732	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:6524732A>T	ENST00000356876.3	-	4	430	c.343T>A	c.(343-345)Tgt>Agt	p.C115S	TNFRSF25_ENST00000461703.2_5'UTR|TNFRSF25_ENST00000348333.3_Missense_Mutation_p.C70S|TNFRSF25_ENST00000377782.3_Missense_Mutation_p.C115S|TNFRSF25_ENST00000351748.3_Intron|TNFRSF25_ENST00000351959.5_Missense_Mutation_p.C115S	NM_003790.2|NM_148967.1	NP_003781.1|NP_683868.1	Q93038	TNR25_HUMAN	tumor necrosis factor receptor superfamily, member 25	115					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|central_nervous_system(2)|endometrium(1)|lung(4)|prostate(1)|stomach(1)	10	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;1.7e-35)|all_epithelial(116;2.78e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|Colorectal(325;4.47e-05)|all_hematologic(16;0.00014)|Breast(487;0.000688)|Renal(390;0.0007)|Acute lymphoblastic leukemia(12;0.00157)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0448)		Epithelial(90;4.58e-35)|GBM - Glioblastoma multiforme(13;3.06e-27)|Colorectal(212;6.01e-08)|COAD - Colon adenocarcinoma(227;1.3e-05)|Kidney(185;4.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000871)|BRCA - Breast invasive adenocarcinoma(365;0.00105)|STAD - Stomach adenocarcinoma(132;0.00158)|READ - Rectum adenocarcinoma(331;0.0419)		TTACAGCCACAGCGGGTGTCG	0.617																																					p.C115S		Atlas-SNP	.											.	TNFRSF25	22	.	0			c.T343A						.						46.0	48.0	47.0					1																	6524732		2203	4300	6503	SO:0001583	missense	8718	exon4			AGCCACAGCGGGT	U72763	CCDS71.1, CCDS72.1, CCDS73.1, CCDS74.1, CCDS75.1	1p36.2	2008-02-05	2002-12-20	2002-12-20	ENSG00000215788	ENSG00000215788		"""Tumor necrosis factor receptor superfamily"""	11910	protein-coding gene	gene with protein product		603366	"""tumor necrosis factor receptor superfamily, member 12 (translocating chain-association membrane protein)"""	TNFRSF12		9052839, 8934525	Standard	NM_003790		Approved	DR3, TRAMP, WSL-1, LARD, WSL-LR, DDR3, TR3, APO-3	uc001anh.3	Q93038	OTTHUMG00000000831	ENST00000356876.3:c.343T>A	chr1.hg19:g.6524732A>T	ENSP00000349341:p.Cys115Ser	94.0	0.0		69.0	21.0	NM_148966	B1ALX2|B1ALX3|B7ZLL7|O00275|O00276|O00277|O00278|O00279|O00280|O14865|O14866|P78507|P78515|Q17RU4|Q92983|Q93036|Q93037|Q99722|Q99830|Q99831|Q9BY86|Q9UME0|Q9UME1|Q9UME5	Missense_Mutation	SNP	ENST00000356876.3	hg19	CCDS71.1	.	.	.	.	.	.	.	.	.	.	A	24.8	4.575606	0.86645	.	.	ENSG00000215788	ENST00000356876;ENST00000377782;ENST00000351959;ENST00000348333	D;D;D;D	0.97066	-4.23;-4.23;-4.23;-4.23	5.5	5.5	0.81552	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.350783	0.20537	U	0.090386	D	0.98620	0.9538	M	0.91140	3.18	0.53688	D	0.999976	P;D;P;D	0.89917	0.952;1.0;0.892;1.0	P;D;P;D	0.91635	0.789;0.999;0.851;0.998	D	0.99160	1.0861	10	0.49607	T	0.09	0.8167	12.9857	0.58590	1.0:0.0:0.0:0.0	.	115;70;115;115	Q93038-11;Q93038-9;Q93038-10;Q93038	.;.;.;TNR25_HUMAN	S	115;115;115;70	ENSP00000349341:C115S;ENSP00000367013:C115S;ENSP00000337713:C115S;ENSP00000314451:C70S	ENSP00000314451:C70S	C	-	1	0	TNFRSF25	6447319	0.980000	0.34600	0.996000	0.52242	0.682000	0.39822	5.651000	0.67951	2.065000	0.61736	0.519000	0.50382	TGT	.	.		0.617	TNFRSF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000002259.1	NM_148965	
TNFRSF8	943	hgsc.bcm.edu	37	1	12183820	12183820	+	Silent	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:12183820G>A	ENST00000263932.2	+	10	1311	c.1089G>A	c.(1087-1089)acG>acA	p.T363T	TNFRSF8_ENST00000417814.2_Silent_p.T252T|TNFRSF8_ENST00000413146.2_5'Flank	NM_001243.3|NM_001281430.1	NP_001234.2|NP_001268359.1	P28908	TNR8_HUMAN	tumor necrosis factor receptor superfamily, member 8	363	Pro/Ser/Thr-rich.				cellular response to mechanical stimulus (GO:0071260)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of TRAIL biosynthetic process (GO:0045556)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	27	Ovarian(185;0.249)	Lung NSC(185;8.71e-05)|all_lung(284;9.89e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.66e-06)|COAD - Colon adenocarcinoma(227;0.000261)|BRCA - Breast invasive adenocarcinoma(304;0.000304)|Kidney(185;0.000777)|KIRC - Kidney renal clear cell carcinoma(229;0.00261)|STAD - Stomach adenocarcinoma(313;0.0073)|READ - Rectum adenocarcinoma(331;0.0649)	Brentuximab vedotin(DB08870)	CCAGTAAGACGCTGCCCATCC	0.632																																					p.T363T		Atlas-SNP	.											.	TNFRSF8	70	.	0			c.G1089A						.						37.0	29.0	32.0					1																	12183820		2200	4295	6495	SO:0001819	synonymous_variant	943	exon10			TAAGACGCTGCCC	M83554	CCDS144.1, CCDS59989.1	1p36	2008-02-05			ENSG00000120949	ENSG00000120949		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11923	protein-coding gene	gene with protein product		153243		CD30, D1S166E		1330892, 1310894	Standard	XM_006711049		Approved	KI-1	uc001atq.3	P28908	OTTHUMG00000001827	ENST00000263932.2:c.1089G>A	chr1.hg19:g.12183820G>A		114.0	0.0		77.0	31.0	NM_001243	B1AN79|B9EGD9|D3YTD8|Q6P4D9	Silent	SNP	ENST00000263932.2	hg19	CCDS144.1																																																																																			.	.		0.632	TNFRSF8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000005130.1		
CLCNKA	1187	hgsc.bcm.edu	37	1	16358337	16358337	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:16358337A>T	ENST00000331433.4	+	16	1774	c.1755A>T	c.(1753-1755)acA>acT	p.T585T	CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000375692.1_Splice_Site_p.T585T|CLCNKA_ENST00000420078.1_Splice_Site_p.T585T|CLCNKA_ENST00000439316.2_Splice_Site_p.T542T			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka	585	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	TGGAGAGCACAGGTGCCCAGC	0.612																																					p.T585T		Atlas-SNP	.											.	CLCNKA	56	.	0			c.A1755T						.						90.0	68.0	75.0					1																	16358337		2202	4300	6502	SO:0001630	splice_region_variant	1187	exon16			GAGCACAGGTGCC		CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.1756+1A>T	chr1.hg19:g.16358337A>T		129.0	0.0		84.0	63.0	NM_004070	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	Silent	SNP	ENST00000331433.4	hg19	CCDS167.1																																																																																			.	.		0.612	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026326.1		Silent
LAPTM5	7805	hgsc.bcm.edu	37	1	31210494	31210494	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:31210494A>T	ENST00000294507.3	-	6	637	c.563T>A	c.(562-564)aTg>aAg	p.M188K	MIR4420_ENST00000583944.1_RNA	NM_006762.2	NP_006753.1	Q13571	LAPM5_HUMAN	lysosomal protein transmembrane 5	188					transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)				large_intestine(2)|lung(7)|skin(1)	10		Colorectal(325;0.0199)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0966)|Medulloblastoma(700;0.151)|Ovarian(437;0.192)		STAD - Stomach adenocarcinoma(196;0.0196)|READ - Rectum adenocarcinoma(331;0.0649)		AAAGATGATCATCATCTTGAT	0.517																																					p.M188K		Atlas-SNP	.											.	LAPTM5	30	.	0			c.T563A						.						216.0	187.0	197.0					1																	31210494		2203	4300	6503	SO:0001583	missense	7805	exon6			ATGATCATCATCT	U51240	CCDS337.1	1p34	2009-07-20	2009-07-20		ENSG00000162511	ENSG00000162511			29612	protein-coding gene	gene with protein product		601476	"""lysosomal multispanning membrane protein 5"""			8661146, 12527926	Standard	NM_006762		Approved		uc001bsc.2	Q13571	OTTHUMG00000003707	ENST00000294507.3:c.563T>A	chr1.hg19:g.31210494A>T	ENSP00000294507:p.Met188Lys	86.0	0.0		46.0	21.0	NM_006762	Q13240|Q14698|Q3KP54	Missense_Mutation	SNP	ENST00000294507.3	hg19	CCDS337.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.071777	0.76301	.	.	ENSG00000162511	ENST00000294507;ENST00000424259	T	0.50277	0.75	5.52	5.52	0.82312	.	0.060246	0.64402	D	0.000002	T	0.65322	0.2680	M	0.67953	2.075	0.39571	D	0.969277	D	0.76494	0.999	D	0.75484	0.986	T	0.70193	-0.4939	10	0.72032	D	0.01	-47.5065	12.049	0.53495	1.0:0.0:0.0:0.0	.	188	Q13571	LAPM5_HUMAN	K	188	ENSP00000294507:M188K	ENSP00000294507:M188K	M	-	2	0	LAPTM5	30983081	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	3.545000	0.53648	2.091000	0.63221	0.460000	0.39030	ATG	.	.		0.517	LAPTM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000010463.1	NM_006762	
MACF1	23499	hgsc.bcm.edu	37	1	39823516	39823516	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:39823516A>T	ENST00000372915.3	+	44	11996	c.11909A>T	c.(11908-11910)aAg>aTg	p.K3970M	MACF1_ENST00000361689.2_Missense_Mutation_p.K1903M|MACF1_ENST00000476350.1_3'UTR|MACF1_ENST00000545844.1_Missense_Mutation_p.K1903M|MACF1_ENST00000564288.1_Missense_Mutation_p.K3965M|MACF1_ENST00000317713.7_Missense_Mutation_p.K1903M|MACF1_ENST00000567887.1_Missense_Mutation_p.K4002M|MACF1_ENST00000289893.4_Missense_Mutation_p.K2405M|MACF1_ENST00000539005.1_Missense_Mutation_p.K1903M			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	3970					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			AACTTAGTAAAGGACAAGTTG	0.433																																					p.K1903M		Atlas-SNP	.											.	MACF1	909	.	0			c.A5708T						.						72.0	68.0	70.0					1																	39823516		2203	4300	6503	SO:0001583	missense	23499	exon41			TAGTAAAGGACAA	AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.11909A>T	chr1.hg19:g.39823516A>T	ENSP00000362006:p.Lys3970Met	66.0	0.0		46.0	18.0	NM_012090	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	ENST00000372915.3	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.82|19.82	3.897807|3.897807	0.72639|0.72639	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.36157|.	1.27;1.27;1.27;1.27;1.27;1.27|.	6.07|6.07	3.63|3.63	0.41609|0.41609	.|.	0.190103|0.190103	0.37012|0.37012	N|N	0.002284|0.002284	T|T	0.58495|0.58495	0.2126|0.2126	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.47545|.	0.897;0.738;0.725;0.878|.	P;P;P;P|.	0.61003|.	0.707;0.69;0.601;0.882|.	T|T	0.54997|0.54997	-0.8209|-0.8209	10|6	0.72032|.	D|.	0.01|.	.|.	10.2536|10.2536	0.43383|0.43383	0.758:0.176:0.066:0.0|0.758:0.176:0.066:0.0	.|.	3970;1903;1903;1868|.	Q9UPN3;F8W8Q1;Q9UPN3-2;Q9UPN3-3|.	MACF1_HUMAN;.;.;.|.	M|N	1903;3970;1903;1903;1903;2405|1036	ENSP00000439537:K1903M;ENSP00000362006:K3970M;ENSP00000354573:K1903M;ENSP00000313438:K1903M;ENSP00000444364:K1903M;ENSP00000289893:K2405M|.	ENSP00000289893:K2405M|.	K|K	+|+	2|3	0|2	MACF1|MACF1	39596103|39596103	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	3.066000|3.066000	0.50002|0.50002	1.112000|1.112000	0.41740|0.41740	-0.274000|-0.274000	0.10170|0.10170	AAG|AAA	.	.		0.433	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000392096.1	NM_033044	
GLIS1	148979	hgsc.bcm.edu	37	1	53995547	53995547	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:53995547A>T	ENST00000312233.2	-	4	1440	c.874T>A	c.(874-876)Tac>Aac	p.Y292N		NM_147193.2	NP_671726.2			GLIS family zinc finger 1											endometrium(3)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(3)|urinary_tract(4)	24						TGGCACAGGTACGGCTTCTCG	0.637																																					p.Y292N		Atlas-SNP	.											.	GLIS1	52	.	0			c.T874A						.						71.0	74.0	73.0					1																	53995547		2203	4300	6503	SO:0001583	missense	148979	exon4			ACAGGTACGGCTT	AK093474	CCDS582.1	1p32.3	2008-02-05			ENSG00000174332	ENSG00000174332		"""Zinc fingers, C2H2-type"""	29525	protein-coding gene	gene with protein product		610378				12042312, 14500813	Standard	NM_147193		Approved	FLJ36155	uc001cvr.1	Q8NBF1	OTTHUMG00000008079	ENST00000312233.2:c.874T>A	chr1.hg19:g.53995547A>T	ENSP00000309653:p.Tyr292Asn	50.0	0.0		36.0	17.0	NM_147193		Missense_Mutation	SNP	ENST00000312233.2	hg19	CCDS582.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.486978	0.84854	.	.	ENSG00000174332	ENST00000312233	T	0.69306	-0.39	4.58	4.58	0.56647	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43579	D	0.000544	T	0.76357	0.3976	L	0.46819	1.47	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.79225	-0.1891	10	0.87932	D	0	.	14.2651	0.66113	1.0:0.0:0.0:0.0	.	292	Q8NBF1	GLIS1_HUMAN	N	292	ENSP00000309653:Y292N	ENSP00000309653:Y292N	Y	-	1	0	GLIS1	53768135	1.000000	0.71417	0.909000	0.35828	0.870000	0.49936	9.287000	0.95975	1.842000	0.53543	0.402000	0.26972	TAC	.	.		0.637	GLIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022109.1	NM_147193	
C8B	732	hgsc.bcm.edu	37	1	57411614	57411614	+	Missense_Mutation	SNP	T	T	A	rs373750492		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:57411614T>A	ENST00000371237.4	-	7	1051	c.985A>T	c.(985-987)Agc>Tgc	p.S329C	C8B_ENST00000535057.1_Missense_Mutation_p.S267C|C8B_ENST00000543257.1_Missense_Mutation_p.S277C	NM_000066.2	NP_000057	P07358	CO8B_HUMAN	complement component 8, beta polypeptide	329	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|membrane attack complex (GO:0005579)|vesicle (GO:0031982)				breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(20)|ovary(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	52						TCCCCGTAGCTGTACTCCAGG	0.493																																					p.S329C		Atlas-SNP	.											.	C8B	107	.	0			c.A985T						.						86.0	83.0	84.0					1																	57411614		2203	4300	6503	SO:0001583	missense	732	exon7			CGTAGCTGTACTC	M16973	CCDS30730.1, CCDS60151.1, CCDS60152.1	1p32.2	2014-09-17			ENSG00000021852	ENSG00000021852		"""Complement system"""	1353	protein-coding gene	gene with protein product		120960					Standard	NM_000066		Approved		uc001cyp.3	P07358	OTTHUMG00000008305	ENST00000371237.4:c.985A>T	chr1.hg19:g.57411614T>A	ENSP00000360281:p.Ser329Cys	162.0	0.0		96.0	28.0	NM_000066	A1L4K7	Missense_Mutation	SNP	ENST00000371237.4	hg19	CCDS30730.1	.	.	.	.	.	.	.	.	.	.	T	15.48	2.847163	0.51164	.	.	ENSG00000021852	ENST00000371237;ENST00000543257;ENST00000535057	D;D;D	0.84800	-1.9;-1.9;-1.9	4.71	-0.517	0.11947	Membrane attack complex component/perforin (MACPF) domain (3);	0.491866	0.25561	N	0.029821	D	0.87732	0.6251	M	0.75447	2.3	0.37609	D	0.920877	P;P;D	0.54207	0.911;0.911;0.965	P;P;P	0.56398	0.518;0.518;0.797	D	0.86666	0.1907	10	0.72032	D	0.01	-6.7146	9.3374	0.38058	0.0:0.4023:0.0:0.5977	.	277;267;329	F5H7G1;F5GY80;P07358	.;.;CO8B_HUMAN	C	329;277;267	ENSP00000360281:S329C;ENSP00000442548:S277C;ENSP00000440113:S267C	ENSP00000360281:S329C	S	-	1	0	C8B	57184202	0.933000	0.31639	0.807000	0.32361	0.816000	0.46133	0.733000	0.26087	-0.263000	0.09378	-1.054000	0.02325	AGC	.	.		0.493	C8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022886.2		
UBE2U	148581	hgsc.bcm.edu	37	1	64676461	64676461	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:64676461T>A	ENST00000371076.3	+	4	522	c.278T>A	c.(277-279)tTg>tAg	p.L93*		NM_152489.1	NP_689702.1	Q5VVX9	UBE2U_HUMAN	ubiquitin-conjugating enzyme E2U (putative)	93					protein ubiquitination (GO:0016567)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			large_intestine(3)|lung(2)|skin(1)	6						ATAGACTTTTTGGACAACCCT	0.308																																					p.L93X		Atlas-SNP	.											.	UBE2U	16	.	0			c.T278A						.						85.0	80.0	82.0					1																	64676461		2203	4300	6503	SO:0001587	stop_gained	148581	exon4			ACTTTTTGGACAA	BC029895	CCDS627.1	1p31.3	2008-02-05			ENSG00000177414	ENSG00000177414		"""Ubiquitin-conjugating enzymes E2"""	28559	protein-coding gene	gene with protein product						12477932	Standard	NM_152489		Approved	MGC35130	uc001dbn.1	Q5VVX9	OTTHUMG00000009023	ENST00000371076.3:c.278T>A	chr1.hg19:g.64676461T>A	ENSP00000360116:p.Leu93*	414.0	0.0		264.0	97.0	NM_152489	Q8N1D4	Nonsense_Mutation	SNP	ENST00000371076.3	hg19	CCDS627.1	.	.	.	.	.	.	.	.	.	.	T	26.4	4.734771	0.89482	.	.	ENSG00000177414	ENST00000371077;ENST00000371076	.	.	.	5.5	5.5	0.81552	.	0.000000	0.43579	D	0.000547	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.989	0.53163	0.0:0.0:0.0:1.0	.	.	.	.	X	93	.	ENSP00000360116:L93X	L	+	2	0	UBE2U	64449049	1.000000	0.71417	1.000000	0.80357	0.087000	0.18053	4.425000	0.59875	2.082000	0.62665	0.459000	0.35465	TTG	.	.		0.308	UBE2U-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025005.1	NM_152489	
ERICH3	127254	hgsc.bcm.edu	37	1	75038865	75038865	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:75038865T>A	ENST00000326665.5	-	14	2747	c.2529A>T	c.(2527-2529)gcA>gcT	p.A843A	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		843	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTTCTGCTTCTGCTGCTCCCT	0.557																																					p.A843A		Atlas-SNP	.											.	C1orf173	380	.	0			c.A2529T						.						114.0	107.0	109.0					1																	75038865		2203	4300	6503	SO:0001819	synonymous_variant	127254	exon14			TGCTTCTGCTGCT																												ENST00000326665.5:c.2529A>T	chr1.hg19:g.75038865T>A		81.0	0.0		40.0	22.0	NM_001002912	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Silent	SNP	ENST00000326665.5	hg19	CCDS30755.1																																																																																			.	.		0.557	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026516.1		
ZZZ3	26009	hgsc.bcm.edu	37	1	78098739	78098739	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:78098739T>A	ENST00000370801.3	-	5	776	c.301A>T	c.(301-303)Ata>Tta	p.I101L	ZZZ3_ENST00000476275.1_5'Flank|ZZZ3_ENST00000370798.1_Intron	NM_015534.4	NP_056349.1	Q8IYH5	ZZZ3_HUMAN	zinc finger, ZZ-type containing 3	101					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(1)|stomach(1)|urinary_tract(2)	39						CAATTTTCTATAGCCTGCCTT	0.388																																					p.I101L		Atlas-SNP	.											.	ZZZ3	80	.	0			c.A301T						.						240.0	247.0	245.0					1																	78098739		2203	4300	6503	SO:0001583	missense	26009	exon5			TTTCTATAGCCTG	AL080063	CCDS677.1	1p31.1	2012-08-13			ENSG00000036549	ENSG00000036549		"""Zinc fingers, ZZ-type"""	24523	protein-coding gene	gene with protein product	"""ATAC component 1 homolog (Drosophila)"""					16428443, 21304275	Standard	NM_015534		Approved	DKFZP564I052, ATAC1	uc001dhq.3	Q8IYH5	OTTHUMG00000009652	ENST00000370801.3:c.301A>T	chr1.hg19:g.78098739T>A	ENSP00000359837:p.Ile101Leu	77.0	0.0		53.0	16.0	NM_015534	B7WPC6|Q6N004|Q6N070|Q8IYP0|Q8IYR1|Q8TEK4|Q9Y4U0	Missense_Mutation	SNP	ENST00000370801.3	hg19	CCDS677.1	.	.	.	.	.	.	.	.	.	.	T	6.675	0.493206	0.12702	.	.	ENSG00000036549	ENST00000370801	.	.	.	5.55	0.304	0.15796	.	0.834054	0.11063	N	0.603772	T	0.05456	0.0144	N	0.01352	-0.895	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.38972	-0.9636	8	.	.	.	.	6.0723	0.19895	0.0:0.4928:0.2351:0.2721	.	101;101;101	Q8IYH5-4;Q8IYH5;Q8IYH5-2	.;ZZZ3_HUMAN;.	L	101	.	.	I	-	1	0	ZZZ3	77871327	0.900000	0.30661	0.984000	0.44739	0.987000	0.75469	-0.109000	0.10840	-0.123000	0.11745	-0.248000	0.11899	ATA	.	.		0.388	ZZZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026615.1	NM_015534	
PTGFR	5737	hgsc.bcm.edu	37	1	78958823	78958823	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:78958823A>T	ENST00000370757.3	+	2	632	c.395A>T	c.(394-396)gAg>gTg	p.E132V	PTGFR_ENST00000370758.1_Missense_Mutation_p.E132V|PTGFR_ENST00000370756.3_Missense_Mutation_p.E132V	NM_000959.3	NP_000950.1	P43088	PF2R_HUMAN	prostaglandin F receptor (FP)	132					calcium-mediated signaling using intracellular calcium source (GO:0035584)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|parturition (GO:0007567)|response to lipopolysaccharide (GO:0032496)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	prostaglandin F receptor activity (GO:0004958)			breast(6)|endometrium(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	33				Colorectal(170;0.248)	Bimatoprost(DB00905)|Dinoprost Tromethamine(DB01160)|Latanoprost(DB00654)|Tafluprost(DB08819)|Travoprost(DB00287)	ATGGCCATTGAGCGGTGTATT	0.403																																					p.E132V		Atlas-SNP	.											.	PTGFR	121	.	0			c.A395T						.						157.0	146.0	150.0					1																	78958823		2203	4300	6503	SO:0001583	missense	5737	exon2			CCATTGAGCGGTG	AF004021	CCDS686.1, CCDS30759.1	1p31.1	2012-08-08			ENSG00000122420	ENSG00000122420		"""GPCR / Class A : Prostanoid receptors"""	9600	protein-coding gene	gene with protein product		600563				8300593, 7759114	Standard	XM_006710781		Approved	FP	uc001din.3	P43088	OTTHUMG00000009644	ENST00000370757.3:c.395A>T	chr1.hg19:g.78958823A>T	ENSP00000359793:p.Glu132Val	137.0	0.0		89.0	29.0	NM_000959	A8K9Y0|Q2KHP3|Q6RYQ6|Q9P1X4	Missense_Mutation	SNP	ENST00000370757.3	hg19	CCDS686.1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.327374	0.81690	.	.	ENSG00000122420	ENST00000370758;ENST00000370757;ENST00000370756	T;T;T	0.74737	-0.87;-0.87;-0.87	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.84261	0.5433	M	0.78049	2.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.86441	0.1767	10	0.87932	D	0	-16.2877	16.5479	0.84454	1.0:0.0:0.0:0.0	.	132;132	P43088;P43088-2	PF2R_HUMAN;.	V	132	ENSP00000359794:E132V;ENSP00000359793:E132V;ENSP00000359792:E132V	ENSP00000359792:E132V	E	+	2	0	PTGFR	78731411	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.962000	0.93254	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.403	PTGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026582.1	NM_000959	
ABCA4	24	hgsc.bcm.edu	37	1	94508911	94508911	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:94508911T>A	ENST00000370225.3	-	21	3257	c.3171A>T	c.(3169-3171)gaA>gaT	p.E1057D		NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1057	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		CCTGAGCCTCTTCATTCCGCT	0.592																																					p.E1057D		Atlas-SNP	.											.	ABCA4	275	.	0			c.A3171T						.						100.0	87.0	92.0					1																	94508911		2203	4300	6503	SO:0001583	missense	24	exon21			AGCCTCTTCATTC	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.3171A>T	chr1.hg19:g.94508911T>A	ENSP00000359245:p.Glu1057Asp	66.0	0.0		49.0	24.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	T	11.80	1.747941	0.30955	.	.	ENSG00000198691	ENST00000370225	D	0.93659	-3.26	5.83	0.92	0.19397	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.149319	0.64402	D	0.000013	T	0.71745	0.3376	N	0.16790	0.44	0.80722	D	1	B	0.06786	0.001	B	0.14023	0.01	T	0.59332	-0.7474	10	0.21014	T	0.42	.	4.7768	0.13184	0.1288:0.296:0.0:0.5752	.	1057	P78363	ABCA4_HUMAN	D	1057	ENSP00000359245:E1057D	ENSP00000359245:E1057D	E	-	3	2	ABCA4	94281499	0.614000	0.27017	0.989000	0.46669	0.956000	0.61745	-0.019000	0.12546	-0.080000	0.12685	-0.326000	0.08463	GAA	.	.		0.592	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
ABCA4	24	hgsc.bcm.edu	37	1	94577058	94577058	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:94577058G>T	ENST00000370225.3	-	3	324	c.238C>A	c.(238-240)Ccc>Acc	p.P80T	ABCA4_ENST00000535735.1_Missense_Mutation_p.P80T	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	80					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		TGAAAACAGGGATTGTTCACA	0.493																																					p.P80T		Atlas-SNP	.											.	ABCA4	275	.	0			c.C238A						.						71.0	69.0	70.0					1																	94577058		2203	4300	6503	SO:0001583	missense	24	exon3			AACAGGGATTGTT	U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.238C>A	chr1.hg19:g.94577058G>T	ENSP00000359245:p.Pro80Thr	156.0	0.0		75.0	31.0	NM_000350	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	ENST00000370225.3	hg19	CCDS747.1	.	.	.	.	.	.	.	.	.	.	G	21.5	4.155031	0.78114	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.99287	-5.69;-5.69	5.62	5.62	0.85841	.	0.056575	0.64402	D	0.000001	D	0.99217	0.9728	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.985	D;P	0.97110	1.0;0.845	D	0.99813	1.1042	10	0.32370	T	0.25	.	18.4977	0.90870	0.0:0.0:1.0:0.0	.	80;80	F5H6E5;P78363	.;ABCA4_HUMAN	T	80	ENSP00000359245:P80T;ENSP00000437682:P80T	ENSP00000359245:P80T	P	-	1	0	ABCA4	94349646	1.000000	0.71417	1.000000	0.80357	0.802000	0.45316	9.423000	0.97461	2.671000	0.90904	0.644000	0.83932	CCC	.	.		0.493	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029320.1	NM_000350	
KCNA2	3737	hgsc.bcm.edu	37	1	111146551	111146551	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:111146551T>A	ENST00000485317.1	-	3	1527	c.854A>T	c.(853-855)cAg>cTg	p.Q285L	KCNA2_ENST00000525120.1_5'Flank|KCNA2_ENST00000316361.4_Missense_Mutation_p.Q285L|KCNA2_ENST00000440270.1_Missense_Mutation_p.Q285L|KCNA2_ENST00000369770.3_Missense_Mutation_p.Q285L			P16389	KCNA2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 2	285					optic nerve structural organization (GO:0021633)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			endometrium(1)|kidney(1)|large_intestine(6)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	32		all_cancers(81;5.55e-06)|all_epithelial(167;1.87e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Colorectal(144;0.00878)|Lung(183;0.0234)|all cancers(265;0.0492)|Epithelial(280;0.0529)|COAD - Colon adenocarcinoma(174;0.131)|LUSC - Lung squamous cell carcinoma(189;0.133)|READ - Rectum adenocarcinoma(129;0.191)	Dalfampridine(DB06637)	CATGGCCTGCTGGCCTTGCTG	0.512																																					p.Q285L	Pancreas(18;568 735 10587 23710 36357)	Atlas-SNP	.											.	KCNA2	61	.	0			c.A854T						.						105.0	105.0	105.0					1																	111146551		2203	4300	6503	SO:0001583	missense	3737	exon3			GCCTGCTGGCCTT	L02752	CCDS827.1, CCDS55625.1	1p13	2012-07-05			ENSG00000177301	ENSG00000177301		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6220	protein-coding gene	gene with protein product		176262				16382104	Standard	NM_004974		Approved	Kv1.2, HK4	uc009wfw.3	P16389	OTTHUMG00000011567	ENST00000485317.1:c.854A>T	chr1.hg19:g.111146551T>A	ENSP00000433109:p.Gln285Leu	95.0	0.0		71.0	30.0	NM_001204269	Q86XG6	Missense_Mutation	SNP	ENST00000485317.1	hg19	CCDS827.1	.	.	.	.	.	.	.	.	.	.	T	18.85	3.711369	0.68730	.	.	ENSG00000177301	ENST00000369770;ENST00000485317;ENST00000440270;ENST00000316361	D;D;D;D	0.97430	-4.38;-4.14;-4.14;-4.14	5.87	5.87	0.94306	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.96543	0.8872	L	0.37850	1.14	0.80722	D	1	D;P	0.60575	0.988;0.695	D;B	0.63793	0.918;0.345	D	0.96946	0.9691	10	0.48119	T	0.1	.	16.2806	0.82678	0.0:0.0:0.0:1.0	.	285;285	Q86XG6;P16389	.;KCNA2_HUMAN	L	285	ENSP00000358785:Q285L;ENSP00000433109:Q285L;ENSP00000415257:Q285L;ENSP00000314520:Q285L	ENSP00000314520:Q285L	Q	-	2	0	KCNA2	110948074	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.991000	0.88244	2.248000	0.74166	0.533000	0.62120	CAG	.	.		0.512	KCNA2-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128001.2	NM_004974	
CD101	9398	hgsc.bcm.edu	37	1	117556032	117556032	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:117556032A>T	ENST00000256652.4	+	4	904	c.846A>T	c.(844-846)aaA>aaT	p.K282N	CD101_ENST00000369470.1_Missense_Mutation_p.K282N	NM_001256106.1|NM_001256109.1|NM_001256111.1|NM_004258.4	NP_001243035.1|NP_001243038.1|NP_001243040.1|NP_004249.2	Q93033	IGSF2_HUMAN	CD101 molecule	282	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(14)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						TCCCAGTGAAAGATTTTCAAG	0.483																																					p.K282N		Atlas-SNP	.											.	CD101	95	.	0			c.A846T						.						126.0	134.0	132.0					1																	117556032		2203	4300	6503	SO:0001583	missense	9398	exon4			AGTGAAAGATTTT	Z33642	CCDS891.1	1p13	2013-01-29	2009-10-27	2009-10-27	ENSG00000134256	ENSG00000134256		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5949	protein-coding gene	gene with protein product		604516	"""immunoglobulin superfamily, member 2"""	IGSF2		7722300	Standard	NM_004258		Approved	V7	uc010oxb.2	Q93033	OTTHUMG00000012029	ENST00000256652.4:c.846A>T	chr1.hg19:g.117556032A>T	ENSP00000256652:p.Lys282Asn	73.0	0.0		52.0	21.0	NM_001256109	Q15856	Missense_Mutation	SNP	ENST00000256652.4	hg19	CCDS891.1	.	.	.	.	.	.	.	.	.	.	A	14.93	2.683324	0.47991	.	.	ENSG00000134256	ENST00000256652;ENST00000369470	T;T	0.03524	3.9;3.9	6.06	3.78	0.43462	Immunoglobulin-like (1);	0.711521	0.13188	N	0.406983	T	0.00875	0.0029	N	0.17082	0.46	0.25613	N	0.986485	B	0.06786	0.001	B	0.06405	0.002	T	0.48340	-0.9044	10	0.39692	T	0.17	-2.9633	6.8982	0.24267	0.8265:0.0:0.1735:0.0	.	282	Q93033	IGSF2_HUMAN	N	282	ENSP00000256652:K282N;ENSP00000358482:K282N	ENSP00000256652:K282N	K	+	3	2	CD101	117357555	0.077000	0.21312	0.975000	0.42487	0.995000	0.86356	0.280000	0.18790	1.121000	0.41925	0.533000	0.62120	AAA	.	.		0.483	CD101-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033274.1	NM_004258	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144868114	144868114	+	Silent	SNP	G	G	T	rs376826439		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:144868114G>T	ENST00000369354.3	-	33	5514	c.5325C>A	c.(5323-5325)gcC>gcA	p.A1775A	PDE4DIP_ENST00000369359.4_Silent_p.A1911A|PDE4DIP_ENST00000369356.4_Silent_p.A1775A|PDE4DIP_ENST00000524974.1_5'UTR|PDE4DIP_ENST00000313382.9_Silent_p.A1669A|PDE4DIP_ENST00000530740.1_Silent_p.A1860A|RP4-791M13.4_ENST00000532137.1_RNA			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1775					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.A1775A(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AGGAAGAGTCGGCTTCCAAGT	0.537			T	PDGFRB	MPD																																p.A1775A		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	PDE4DIP,pharynx,carcinoma,0,1	PDE4DIP	817	.	1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)	c.C5325A						.						134.0	140.0	138.0					1																	144868114		2203	4296	6499	SO:0001819	synonymous_variant	9659	exon33			AGAGTCGGCTTCC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5325C>A	chr1.hg19:g.144868114G>T		154.0	0.0		194.0	18.0	NM_014644	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Silent	SNP	ENST00000369354.3	hg19	CCDS30824.1																																																																																			.	.		0.537	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
ANKRD35	148741	hgsc.bcm.edu	37	1	145555806	145555806	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:145555806T>A	ENST00000355594.4	+	2	241	c.154T>A	c.(154-156)Tcg>Acg	p.S52T	ANKRD35_ENST00000544626.1_Missense_Mutation_p.S52T	NM_144698.3	NP_653299.4	Q8N283	ANR35_HUMAN	ankyrin repeat domain 35	52										NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|large_intestine(9)|lung(16)|ovary(4)|prostate(3)|skin(2)|urinary_tract(1)	47	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					CAAGCTTGACTCGAATGGCCA	0.592																																					p.S52T	Melanoma(9;127 754 22988 51047)	Atlas-SNP	.											.	ANKRD35	96	.	0			c.T154A						.						59.0	64.0	62.0					1																	145555806		2203	4300	6503	SO:0001583	missense	148741	exon2			CTTGACTCGAATG	AK091120	CCDS72867.1, CCDS72868.1	1q21.1	2013-01-10			ENSG00000198483	ENSG00000198483		"""Ankyrin repeat domain containing"""	26323	protein-coding gene	gene with protein product							Standard	NM_144698		Approved	FLJ25124	uc001eob.1	Q8N283	OTTHUMG00000013743	ENST00000355594.4:c.154T>A	chr1.hg19:g.145555806T>A	ENSP00000347802:p.Ser52Thr	143.0	0.0		263.0	68.0	NM_144698	A6NEU0|B4DL62|Q3MJ10|Q96LS3	Missense_Mutation	SNP	ENST00000355594.4	hg19	CCDS919.1	.	.	.	.	.	.	.	.	.	.	T	14.15	2.449333	0.43531	.	.	ENSG00000198483	ENST00000355594;ENST00000544626	T;T	0.53857	0.6;1.35	5.62	0.27	0.15635	Ankyrin repeat-containing domain (4);	0.327512	0.22221	N	0.062947	T	0.16811	0.0404	L	0.35288	1.05	0.23454	N	0.997641	P	0.36354	0.549	B	0.37550	0.253	T	0.21895	-1.0232	10	0.22109	T	0.4	-1.1405	6.7434	0.23449	0.0:0.0856:0.4757:0.4386	.	52	Q8N283	ANR35_HUMAN	T	52	ENSP00000347802:S52T;ENSP00000442671:S52T	ENSP00000347802:S52T	S	+	1	0	ANKRD35	144267163	0.921000	0.31238	0.798000	0.32154	0.565000	0.35776	0.509000	0.22707	0.069000	0.16605	0.533000	0.62120	TCG	.	.		0.592	ANKRD35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000038515.1	NM_144698	
GJA5	2702	hgsc.bcm.edu	37	1	147231300	147231300	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:147231300T>A	ENST00000271348.2	-	2	208	c.47A>T	c.(46-48)aAg>aTg	p.K16M	GJA5_ENST00000369237.1_Missense_Mutation_p.K16M|RP11-433J22.2_ENST00000428911.1_RNA	NM_005266.5	NP_005257.2	P36382	CXA5_HUMAN	gap junction protein, alpha 5, 40kDa	16					angiogenesis (GO:0001525)|artery morphogenesis (GO:0048844)|atrial cardiac muscle cell action potential (GO:0086014)|atrial septum development (GO:0003283)|AV node cell to bundle of His cell communication by electrical coupling (GO:0086053)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|gap junction assembly (GO:0016264)|mitral valve development (GO:0003174)|outflow tract morphogenesis (GO:0003151)|pulmonary valve formation (GO:0003193)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|transmembrane transport (GO:0055085)|ventricular septum development (GO:0003281)	connexon complex (GO:0005922)|gap junction (GO:0005921)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)	gap junction channel activity involved in AV node cell-bundle of His cell electrical coupling (GO:0086077)|gap junction channel activity involved in cardiac conduction electrical coupling (GO:0086075)|gap junction hemi-channel activity (GO:0055077)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	20	all_hematologic(923;0.0276)		LUSC - Lung squamous cell carcinoma(543;0.202)			GGTCGAGTGCTTGTGTACTTC	0.542																																					p.K16M		Atlas-SNP	.											.	GJA5	64	.	0			c.A47T						.						92.0	99.0	96.0					1																	147231300		2203	4300	6503	SO:0001583	missense	2702	exon2			GAGTGCTTGTGTA		CCDS929.1	1q21.1	2008-02-05	2007-01-16		ENSG00000143140	ENSG00000265107		"""Ion channels / Gap junction proteins (connexins)"""	4279	protein-coding gene	gene with protein product	"""connexin 40"""	121013	"""gap junction protein, alpha 5, 40kD (connexin 40)"", ""gap junction protein, alpha 5, 40kDa (connexin 40)"""				Standard	NM_005266		Approved	CX40	uc001eps.1	P36382	OTTHUMG00000014020	ENST00000271348.2:c.47A>T	chr1.hg19:g.147231300T>A	ENSP00000271348:p.Lys16Met	73.0	0.0		113.0	13.0	NM_005266	Q5T3B6|Q5U0N6	Missense_Mutation	SNP	ENST00000271348.2	hg19	CCDS929.1	.	.	.	.	.	.	.	.	.	.	T	18.16	3.561812	0.65538	.	.	ENSG00000143140	ENST00000271348;ENST00000369237;ENST00000430508	D;D;D	0.99186	-5.53;-5.53;-5.53	4.97	4.97	0.65823	Connexin, N-terminal (1);	0.051337	0.85682	D	0.000000	D	0.99171	0.9713	M	0.83223	2.63	0.53005	D	0.999965	D	0.69078	0.997	D	0.70227	0.968	D	0.99537	1.0962	10	0.87932	D	0	.	14.8539	0.70319	0.0:0.0:0.0:1.0	.	16	P36382	CXA5_HUMAN	M	16	ENSP00000271348:K16M;ENSP00000358240:K16M;ENSP00000407645:K16M	ENSP00000271348:K16M	K	-	2	0	GJA5	145697924	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	6.017000	0.70805	2.090000	0.63153	0.460000	0.39030	AAG	.	.		0.542	GJA5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039422.2	NM_181703	
PLEKHO1	51177	hgsc.bcm.edu	37	1	150123217	150123217	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150123217A>T	ENST00000369124.4	+	2	424	c.146A>T	c.(145-147)aAa>aTa	p.K49I	PLEKHO1_ENST00000479194.1_3'UTR|PLEKHO1_ENST00000025469.6_Missense_Mutation_p.K49I|PLEKHO1_ENST00000369126.1_De_novo_Start_OutOfFrame	NM_016274.4	NP_057358.2	Q53GL0	PKHO1_HUMAN	pleckstrin homology domain containing, family O member 1	49	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|skin(2)	22	Lung NSC(24;7.78e-28)|Breast(34;0.00211)|Ovarian(49;0.0265)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTGGTGCTGAAAGGGGACCAG	0.562																																					p.K49I		Atlas-SNP	.											.	PLEKHO1	37	.	0			c.A146T						.						127.0	132.0	130.0					1																	150123217		2203	4300	6503	SO:0001583	missense	51177	exon2			TGCTGAAAGGGGA	AF073836	CCDS945.1	1q21.2	2013-01-10			ENSG00000023902	ENSG00000023902		"""Pleckstrin homology (PH) domain containing"""	24310	protein-coding gene	gene with protein product		608335				10799509	Standard	NM_016274		Approved	CKIP-1, OC120	uc001ett.3	Q53GL0	OTTHUMG00000012510	ENST00000369124.4:c.146A>T	chr1.hg19:g.150123217A>T	ENSP00000358120:p.Lys49Ile	244.0	0.0		444.0	45.0	NM_016274	Q336K5|Q8IZ51|Q9NRV3|Q9UL48	Missense_Mutation	SNP	ENST00000369124.4	hg19	CCDS945.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.000021	0.74818	.	.	ENSG00000023902	ENST00000025469;ENST00000369124	T;T	0.17854	2.25;2.25	3.46	2.34	0.29019	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.231148	0.42420	D	0.000706	T	0.17023	0.0409	M	0.65975	2.015	0.44275	D	0.997131	D	0.53462	0.96	P	0.57776	0.827	T	0.01725	-1.1287	10	0.45353	T	0.12	-6.9587	6.1411	0.20261	0.791:0.0:0.209:0.0	.	49	Q53GL0	PKHO1_HUMAN	I	49	ENSP00000025469:K49I;ENSP00000358120:K49I	ENSP00000025469:K49I	K	+	2	0	PLEKHO1	148389841	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	1.615000	0.36922	0.718000	0.32166	0.459000	0.35465	AAA	.	.		0.562	PLEKHO1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034962.1	NM_016274	
HORMAD1	84072	hgsc.bcm.edu	37	1	150686584	150686584	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150686584A>T	ENST00000361824.2	-	5	361	c.256T>A	c.(256-258)Tat>Aat	p.Y86N	HORMAD1_ENST00000368993.2_Missense_Mutation_p.Y86N|HORMAD1_ENST00000368995.4_Missense_Mutation_p.Y15N|HORMAD1_ENST00000476530.1_5'UTR|HORMAD1_ENST00000322343.7_Missense_Mutation_p.Y86N	NM_032132.4	NP_115508.2	Q86X24	HORM1_HUMAN	HORMA domain containing 1	86	HORMA. {ECO:0000255|PROSITE- ProRule:PRU00109}.				blastocyst development (GO:0001824)|meiotic DNA double-strand break formation (GO:0042138)|meiotic nuclear division (GO:0007126)|meiotic recombination checkpoint (GO:0051598)|meiotic sister chromatid cohesion (GO:0051177)|oogenesis (GO:0048477)|regulation of homologous chromosome segregation (GO:0060629)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(3)	16	all_cancers(9;3.23e-52)|all_epithelial(9;4.68e-43)|all_lung(15;5.74e-35)|Lung NSC(24;2.09e-31)|Breast(34;0.0009)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;2.32e-23)|all cancers(9;5.21e-23)|OV - Ovarian serous cystadenocarcinoma(6;6.72e-15)|BRCA - Breast invasive adenocarcinoma(12;0.000479)|LUSC - Lung squamous cell carcinoma(543;0.171)			AAAGCATCATAACATCCTAGC	0.264																																					p.Y86N		Atlas-SNP	.											.	HORMAD1	59	.	0			c.T256A						.						52.0	60.0	58.0					1																	150686584		2194	4271	6465	SO:0001583	missense	84072	exon5			CATCATAACATCC	AL136755	CCDS967.1, CCDS55633.1	1q21.2	2009-03-09			ENSG00000143452	ENSG00000143452			25245	protein-coding gene	gene with protein product	"""cancer/testis antigen 46"""	609824				11230166, 15999985	Standard	NM_032132		Approved	DKFZP434A1315, CT46	uc001evk.2	Q86X24	OTTHUMG00000035005	ENST00000361824.2:c.256T>A	chr1.hg19:g.150686584A>T	ENSP00000355167:p.Tyr86Asn	531.0	0.0		905.0	222.0	NM_001199829	A6NMK2|B3KUK1|Q4G114|Q5T5I3|Q5T5I4|Q5T5I5|Q6FIC1|Q9H0K8	Missense_Mutation	SNP	ENST00000361824.2	hg19	CCDS967.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308364	0.81247	.	.	ENSG00000143452	ENST00000368995;ENST00000368993;ENST00000368992;ENST00000540570;ENST00000322343;ENST00000361824;ENST00000368987;ENST00000442853	T;T;T;T	0.55588	0.51;1.42;1.39;1.42	5.52	5.52	0.82312	DNA-binding HORMA (4);	0.050252	0.85682	D	0.000000	T	0.63873	0.2548	M	0.66297	2.02	0.51482	D	0.999929	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.999;0.99	T	0.68047	-0.5512	10	0.59425	D	0.04	-14.7869	14.4815	0.67587	1.0:0.0:0.0:0.0	.	15;86;86	Q86X24-4;Q86X24-2;Q86X24	.;.;HORM1_HUMAN	N	15;86;15;15;86;86;15;15	ENSP00000357991:Y15N;ENSP00000357989:Y86N;ENSP00000326489:Y86N;ENSP00000355167:Y86N	ENSP00000326489:Y86N	Y	-	1	0	HORMAD1	148953208	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.672000	0.91181	2.100000	0.63781	0.383000	0.25322	TAT	.	.		0.264	HORMAD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000084722.1	NM_032132	
ANXA9	8416	hgsc.bcm.edu	37	1	150956829	150956829	+	Missense_Mutation	SNP	A	A	T	rs7536645	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150956829A>T	ENST00000368947.4	+	6	816	c.340A>T	c.(340-342)Aca>Tca	p.T114S	ANXA9_ENST00000474997.1_3'UTR	NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	114			T -> A (in dbSNP:rs7536645).		single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GCTGCAGCCCACAGCCCAGTT	0.567																																					p.T114S		Atlas-SNP	.											.	ANXA9	28	.	0			c.A340T						.						106.0	101.0	102.0					1																	150956829		2203	4300	6503	SO:0001583	missense	8416	exon6			CAGCCCACAGCCC	AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.340A>T	chr1.hg19:g.150956829A>T	ENSP00000357943:p.Thr114Ser	106.0	0.0		174.0	24.0	NM_003568	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Missense_Mutation	SNP	ENST00000368947.4	hg19	CCDS975.2	.	.	.	.	.	.	.	.	.	.	A	8.392	0.839917	0.16891	.	.	ENSG00000143412	ENST00000368947	T	0.04758	3.56	5.0	-2.45	0.06481	.	0.635660	0.16333	N	0.219039	T	0.00724	0.0024	N	0.17764	0.52	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.46541	-0.9184	10	0.32370	T	0.25	.	1.102	0.01686	0.4177:0.153:0.2735:0.1558	.	114	O76027	ANXA9_HUMAN	S	114	ENSP00000357943:T114S	ENSP00000357943:T114S	T	+	1	0	ANXA9	149223453	0.000000	0.05858	0.073000	0.20177	0.047000	0.14425	-0.205000	0.09411	-0.277000	0.09193	-1.177000	0.01723	ACA	.	A|0.978;G|0.022		0.567	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084895.2	NM_003568	
ANXA9	8416	hgsc.bcm.edu	37	1	150957133	150957133	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150957133C>G	ENST00000368947.4	+	7	929	c.453C>G	c.(451-453)tgC>tgG	p.C151W		NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	151					single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGCAGGAGTGCCTGGCAGTCT	0.542																																					p.C151W		Atlas-SNP	.											.	ANXA9	28	.	0			c.C453G						.						46.0	44.0	45.0					1																	150957133		2203	4300	6503	SO:0001583	missense	8416	exon7			GGAGTGCCTGGCA	AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.453C>G	chr1.hg19:g.150957133C>G	ENSP00000357943:p.Cys151Trp	47.0	0.0		103.0	15.0	NM_003568	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Missense_Mutation	SNP	ENST00000368947.4	hg19	CCDS975.2	.	.	.	.	.	.	.	.	.	.	C	12.95	2.091772	0.36952	.	.	ENSG00000143412	ENST00000368947	T	0.03272	3.99	5.25	3.35	0.38373	.	0.142017	0.49916	D	0.000138	T	0.06645	0.0170	L	0.56769	1.78	0.58432	D	0.999998	D	0.76494	0.999	D	0.73380	0.98	T	0.05037	-1.0910	10	0.87932	D	0	.	8.3046	0.32034	0.0:0.8078:0.0:0.1921	.	151	O76027	ANXA9_HUMAN	W	151	ENSP00000357943:C151W	ENSP00000357943:C151W	C	+	3	2	ANXA9	149223757	1.000000	0.71417	1.000000	0.80357	0.254000	0.26022	0.657000	0.24963	1.336000	0.45506	0.655000	0.94253	TGC	.	.		0.542	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084895.2	NM_003568	
PRUNE	58497	hgsc.bcm.edu	37	1	151006513	151006513	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:151006513A>T	ENST00000271620.3	+	8	1321	c.1165A>T	c.(1165-1167)Agg>Tgg	p.R389W	PRUNE_ENST00000368937.1_Missense_Mutation_p.R154W|BNIPL_ENST00000368931.3_5'Flank|PRUNE_ENST00000368934.1_Missense_Mutation_p.R154W|BNIPL_ENST00000295294.7_5'Flank|PRUNE_ENST00000271619.8_Missense_Mutation_p.R177W|PRUNE_ENST00000368936.1_Missense_Mutation_p.R207W|PRUNE_ENST00000368935.1_Missense_Mutation_p.R104W	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	389						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			GGAATTGGACAGGGCAAGTAA	0.552																																					p.R389W		Atlas-SNP	.											.	PRUNE	40	.	0			c.A1165T						.						103.0	91.0	95.0					1																	151006513		2203	4300	6503	SO:0001583	missense	58497	exon8			TTGGACAGGGCAA	U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.1165A>T	chr1.hg19:g.151006513A>T	ENSP00000271620:p.Arg389Trp	171.0	0.0		258.0	27.0	NM_021222	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	ENST00000271620.3	hg19	CCDS977.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823762	0.71143	.	.	ENSG00000143363	ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000431193;ENST00000368936;ENST00000368935;ENST00000368934	T;T;T;T;T;T;T	0.34667	1.4;1.35;1.35;1.38;1.35;1.37;1.35	5.35	2.96	0.34315	.	0.264276	0.33515	N	0.004834	T	0.13286	0.0322	N	0.08118	0	0.25591	N	0.986696	D;P	0.56968	0.978;0.953	P;P	0.57371	0.819;0.715	T	0.08249	-1.0731	9	.	.	.	.	6.8309	0.23909	0.7678:0.1519:0.0803:0.0	.	177;389	E9PCU1;Q86TP1	.;PRUNE_HUMAN	W	389;322;177;154;154;207;104;154	ENSP00000271620:R389W;ENSP00000271619:R177W;ENSP00000357933:R154W;ENSP00000392632:R154W;ENSP00000357932:R207W;ENSP00000357931:R104W;ENSP00000357930:R154W	.	R	+	1	2	PRUNE	149273137	0.992000	0.36948	0.998000	0.56505	0.956000	0.61745	2.665000	0.46791	0.527000	0.28560	0.533000	0.62120	AGG	.	.		0.552	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084885.1	NM_021222	
PI4KB	5298	hgsc.bcm.edu	37	1	151278812	151278812	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:151278812G>A	ENST00000368873.1	-	5	1378	c.1210C>T	c.(1210-1212)Ctt>Ttt	p.L404F	PI4KB_ENST00000368875.2_Missense_Mutation_p.L416F|PI4KB_ENST00000368872.1_Missense_Mutation_p.L389F|PI4KB_ENST00000368874.4_Missense_Mutation_p.L389F|PI4KB_ENST00000271657.5_Missense_Mutation_p.L416F|PI4KB_ENST00000529142.1_Missense_Mutation_p.L72F			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	404					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TCACATTCAAGGACTTCCACA	0.493																																					p.L416F	Colon(154;765 1838 9854 28443 37492)	Atlas-SNP	.											.	PI4KB	76	.	0			c.C1246T						.						54.0	52.0	53.0					1																	151278812		2203	4300	6503	SO:0001583	missense	5298	exon6			ATTCAAGGACTTC	AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.1210C>T	chr1.hg19:g.151278812G>A	ENSP00000357867:p.Leu404Phe	113.0	0.0		252.0	35.0	NM_002651	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Missense_Mutation	SNP	ENST00000368873.1	hg19		.	.	.	.	.	.	.	.	.	.	G	34	5.366319	0.95900	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000529142;ENST00000368872;ENST00000430800;ENST00000489223	D;D;D;D;D;D;T;T	0.81499	-1.5;-1.5;-1.5;-1.5;-1.5;-1.5;1.89;1.89	5.88	5.88	0.94601	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	D	0.89897	0.6848	M	0.84683	2.71	0.80722	D	1	P;D;D	0.76494	0.781;0.999;0.997	B;D;D	0.74023	0.358;0.982;0.954	D	0.90408	0.4407	10	0.72032	D	0.01	-11.117	18.8019	0.92022	0.0:0.0:1.0:0.0	.	404;389;72	Q9UBF8;Q9UBF8-2;Q9UBF8-3	PI4KB_HUMAN;.;.	F	389;416;416;404;72;389;72;72	ENSP00000357868:L389F;ENSP00000357869:L416F;ENSP00000271657:L416F;ENSP00000357867:L404F;ENSP00000433149:L72F;ENSP00000357866:L389F;ENSP00000413599:L72F;ENSP00000431501:L72F	ENSP00000271657:L416F	L	-	1	0	PI4KB	149545436	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.119000	0.94362	2.779000	0.95612	0.650000	0.86243	CTT	.	.		0.493	PI4KB-002	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000034400.3	NM_002651	
HRNR	388697	hgsc.bcm.edu	37	1	152191860	152191860	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:152191860A>T	ENST00000368801.2	-	3	2320	c.2245T>A	c.(2245-2247)Tct>Act	p.S749T	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	749					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TAGCTGGAAGACAAACCTGAG	0.567																																					p.S749T		Atlas-SNP	.											.	HRNR	403	.	0			c.T2245A						.						173.0	170.0	171.0					1																	152191860		2203	4300	6503	SO:0001583	missense	388697	exon3			TGGAAGACAAACC	AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2245T>A	chr1.hg19:g.152191860A>T	ENSP00000357791:p.Ser749Thr	79.0	0.0		166.0	19.0	NM_001009931	Q5DT20|Q5U1F4	Missense_Mutation	SNP	ENST00000368801.2	hg19	CCDS30859.1	.	.	.	.	.	.	.	.	.	.	-	5.261	0.233680	0.09969	.	.	ENSG00000197915	ENST00000368801	T	0.02974	4.09	2.65	-0.0682	0.13757	.	.	.	.	.	T	0.00608	0.0020	L	0.36672	1.1	0.09310	N	1	B	0.27951	0.195	B	0.23018	0.043	T	0.47368	-0.9123	9	0.17832	T	0.49	.	2.4479	0.04510	0.6202:0.0:0.1459:0.2339	.	749	Q86YZ3	HORN_HUMAN	T	749	ENSP00000357791:S749T	ENSP00000357791:S749T	S	-	1	0	HRNR	150458484	0.016000	0.18221	0.000000	0.03702	0.004000	0.04260	0.229000	0.17833	-0.145000	0.11294	-0.451000	0.05528	TCT	.	.		0.567	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000034016.1	XM_373868	
FLG	2312	hgsc.bcm.edu	37	1	152283807	152283807	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:152283807T>A	ENST00000368799.1	-	3	3590	c.3555A>T	c.(3553-3555)gtA>gtT	p.V1185V	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1185	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CAGATCTATCTACCGATTGCT	0.592									Ichthyosis																												p.V1185V		Atlas-SNP	.											.	FLG	900	.	0			c.A3555T						.						347.0	352.0	350.0					1																	152283807		2203	4300	6503	SO:0001819	synonymous_variant	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	TCTATCTACCGAT	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.3555A>T	chr1.hg19:g.152283807T>A		123.0	0.0		195.0	21.0	NM_002016	Q01720|Q5T583|Q9UC71	Silent	SNP	ENST00000368799.1	hg19	CCDS30860.1																																																																																			.	.		0.592	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
FLG	2312	hgsc.bcm.edu	37	1	152285144	152285144	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:152285144G>C	ENST00000368799.1	-	3	2253	c.2218C>G	c.(2218-2220)Cga>Gga	p.R740G	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000392688.2_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	740	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTGGACCCTCGGTGTCCACTG	0.572									Ichthyosis																												p.R740G		Atlas-SNP	.											.	FLG	900	.	0			c.C2218G						.						357.0	373.0	367.0					1																	152285144		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	ACCCTCGGTGTCC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.2218C>G	chr1.hg19:g.152285144G>C	ENSP00000357789:p.Arg740Gly	86.0	0.0		124.0	14.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	hg19	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	-	6.492	0.458958	0.12342	.	.	ENSG00000143631	ENST00000368799	T	0.01725	4.67	4.17	-4.32	0.03688	.	.	.	.	.	T	0.00580	0.0019	L	0.56769	1.78	0.09310	N	1	P	0.39665	0.682	B	0.33799	0.17	T	0.43750	-0.9372	9	0.33141	T	0.24	-6.6813	4.0775	0.09911	0.0855:0.1226:0.2438:0.548	.	740	P20930	FILA_HUMAN	G	740	ENSP00000357789:R740G	ENSP00000357789:R740G	R	-	1	2	FLG	150551768	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.683000	0.00835	-0.570000	0.06022	-0.462000	0.05337	CGA	.	.		0.572	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
S100A3	6274	hgsc.bcm.edu	37	1	153520241	153520241	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:153520241A>T	ENST00000368713.3	-	3	419	c.223T>A	c.(223-225)Tat>Aat	p.Y75N	S100A4_ENST00000368714.1_Intron|S100A4_ENST00000368716.4_5'Flank|S100A4_ENST00000368715.1_5'Flank|S100A4_ENST00000354332.4_5'Flank|S100A4_ENST00000481009.1_5'Flank|S100A3_ENST00000368712.1_Missense_Mutation_p.Y75N	NM_002960.1	NP_002951.1	P33764	S10A3_HUMAN	S100 calcium binding protein A3	75	EF-hand 2.					cytoplasm (GO:0005737)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|liver(1)|lung(1)	3	all_lung(78;5.98e-32)|Lung NSC(65;2.27e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GAGCGCACATACTCCACAAAG	0.552																																					p.Y75N		Atlas-SNP	.											.	S100A3	7	.	0			c.T223A						.						240.0	204.0	216.0					1																	153520241		2203	4300	6503	SO:0001583	missense	6274	exon3			GCACATACTCCAC	BC012893	CCDS1043.1	1q21	2008-02-05	2001-11-28		ENSG00000188015	ENSG00000188015		"""S100 calcium binding proteins"""	10493	protein-coding gene	gene with protein product		176992	"""S100 calcium-binding protein A3"""	S100E		8341667	Standard	NM_002960		Approved		uc001fca.1	P33764	OTTHUMG00000013550	ENST00000368713.3:c.223T>A	chr1.hg19:g.153520241A>T	ENSP00000357702:p.Tyr75Asn	131.0	0.0		225.0	39.0	NM_002960	D3DV51|Q6FGE4	Missense_Mutation	SNP	ENST00000368713.3	hg19	CCDS1043.1	.	.	.	.	.	.	.	.	.	.	A	18.86	3.713123	0.68730	.	.	ENSG00000188015	ENST00000368713;ENST00000368712	T;T	0.16597	2.33;2.33	4.85	4.85	0.62838	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.155014	0.44483	D	0.000441	T	0.27134	0.0665	M	0.84511	2.7	0.58432	D	0.999994	D	0.61080	0.989	P	0.55011	0.766	T	0.14924	-1.0455	10	0.87932	D	0	.	11.1049	0.48197	1.0:0.0:0.0:0.0	.	75	P33764	S10A3_HUMAN	N	75	ENSP00000357702:Y75N;ENSP00000357701:Y75N	ENSP00000357701:Y75N	Y	-	1	0	S100A3	151786865	1.000000	0.71417	0.894000	0.35097	0.686000	0.39977	5.494000	0.66905	1.926000	0.55796	0.533000	0.62120	TAT	.	.		0.552	S100A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000037726.1	NM_002960	
NUP210L	91181	hgsc.bcm.edu	37	1	154130187	154130187	+	5'Flank	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:154130187T>C	ENST00000368559.3	-	0	0				NUP210L_ENST00000271854.3_5'Flank|TPM3_ENST00000341372.3_Silent_p.K200K|TPM3_ENST00000341485.5_Silent_p.K209K|TPM3_ENST00000271850.7_Silent_p.K262K|TPM3_ENST00000368533.3_Silent_p.K225K|TPM3_ENST00000328159.4_3'UTR|TPM3_ENST00000330188.9_Silent_p.K225K|TPM3_ENST00000469717.1_5'UTR|TPM3_ENST00000302206.5_Silent_p.K135K	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like						Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CTTTGGTGCATTTCAGTTTAT	0.483																																					p.K225K		Atlas-SNP	.											.	TPM3	46	.	0			c.A675G						.						98.0	103.0	101.0					1																	154130187		2203	4300	6503	SO:0001631	upstream_gene_variant	7170	exon8			GGTGCATTTCAGT	AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852		chr1.hg19:g.154130187T>C	Exception_encountered	44.0	0.0		58.0	14.0	NM_153649	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Silent	SNP	ENST00000368559.3	hg19	CCDS41399.1																																																																																			.	.		0.483	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087270.3	NM_207308	
UBAP2L	9898	hgsc.bcm.edu	37	1	154226401	154226401	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:154226401A>T	ENST00000361546.2	+	14	1732	c.1690A>T	c.(1690-1692)Aac>Tac	p.N564Y	AL590431.1_ENST00000517008.1_RNA|UBAP2L_ENST00000271877.7_Missense_Mutation_p.N575Y|UBAP2L_ENST00000428931.1_Missense_Mutation_p.N564Y|UBAP2L_ENST00000343815.6_Missense_Mutation_p.N564Y			Q14157	UBP2L_HUMAN	ubiquitin associated protein 2-like	564					binding of sperm to zona pellucida (GO:0007339)		poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(20)|ovary(1)|prostate(1)|urinary_tract(2)	50	all_lung(78;1.09e-30)|Lung NSC(65;1.66e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AATTTCATCTAACCAGAGTCA	0.418																																					p.N564Y		Atlas-SNP	.											.	UBAP2L	197	.	0			c.A1690T						.						82.0	78.0	79.0					1																	154226401		2203	4300	6503	SO:0001583	missense	9898	exon15			TCATCTAACCAGA	BC003170	CCDS1063.1, CCDS44229.1, CCDS72925.1	1q21.3	2008-02-05			ENSG00000143569	ENSG00000143569			29877	protein-coding gene	gene with protein product						8590280, 11230159	Standard	NM_014847		Approved	NICE-4, KIAA0144	uc001fep.4	Q14157	OTTHUMG00000035983	ENST00000361546.2:c.1690A>T	chr1.hg19:g.154226401A>T	ENSP00000355343:p.Asn564Tyr	101.0	0.0		183.0	46.0	NM_001127320	B4E0U8|Q5VU75|Q5VU76|Q9BTU3|Q9UGL2|Q9UGL3|Q9UGL4|Q9UGL5	Missense_Mutation	SNP	ENST00000361546.2	hg19	CCDS1063.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112221	0.77210	.	.	ENSG00000143569	ENST00000343815;ENST00000428931;ENST00000456955;ENST00000433006;ENST00000271877;ENST00000361546	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	4.84	4.84	0.62591	.	0.392298	0.26883	N	0.022006	T	0.11239	0.0274	N	0.24115	0.695	0.43226	D	0.995117	P;D;P;P;P	0.64830	0.86;0.994;0.856;0.856;0.91	B;P;P;P;B	0.56865	0.446;0.808;0.648;0.648;0.446	T	0.05517	-1.0880	10	0.54805	T	0.06	-2.6009	13.7512	0.62908	1.0:0.0:0.0:0.0	.	478;575;557;564;564	B4DZJ6;F8W726;Q14157-4;Q14157-1;Q14157	.;.;.;.;UBP2L_HUMAN	Y	564;564;60;60;575;564	ENSP00000345308:N564Y;ENSP00000389445:N564Y;ENSP00000271877:N575Y;ENSP00000355343:N564Y	ENSP00000271877:N575Y	N	+	1	0	UBAP2L	152493025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.348000	0.73009	2.032000	0.59987	0.533000	0.62120	AAC	.	.		0.418	UBAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087673.1	NM_014847	
TDRD10	126668	hgsc.bcm.edu	37	1	154517399	154517399	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:154517399T>A	ENST00000368480.3	+	11	1011	c.926T>A	c.(925-927)cTg>cAg	p.L309Q	TDRD10_ENST00000479937.1_3'UTR|TDRD10_ENST00000368482.4_Missense_Mutation_p.L309Q			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	309	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATCCCACCCCTGACTCAGCCA	0.537																																					p.L309Q		Atlas-SNP	.											.	TDRD10	48	.	0			c.T926A						.						139.0	122.0	128.0					1																	154517399		2203	4300	6503	SO:0001583	missense	126668	exon11			CACCCCTGACTCA	AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.926T>A	chr1.hg19:g.154517399T>A	ENSP00000357465:p.Leu309Gln	80.0	0.0		119.0	14.0	NM_182499	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Missense_Mutation	SNP	ENST00000368480.3	hg19	CCDS41406.1	.	.	.	.	.	.	.	.	.	.	T	15.25	2.778374	0.49786	.	.	ENSG00000163239	ENST00000368482;ENST00000368480	T;T	0.08896	3.04;3.04	3.63	2.44	0.29823	Maternal tudor protein (1);	0.000000	0.40222	N	0.001159	T	0.05410	0.0143	L	0.32530	0.975	0.24931	N	0.991912	D;D	0.89917	1.0;0.999	D;D	0.74674	0.984;0.973	T	0.29458	-1.0011	10	0.23891	T	0.37	-7.4813	5.7039	0.17897	0.0:0.1304:0.0:0.8696	.	309;309	Q5VZ19;Q5VZ19-2	TDR10_HUMAN;.	Q	309	ENSP00000357467:L309Q;ENSP00000357465:L309Q	ENSP00000357465:L309Q	L	+	2	0	TDRD10	152784023	0.190000	0.23276	0.239000	0.24122	0.778000	0.44026	0.769000	0.26604	0.435000	0.26365	0.528000	0.53228	CTG	.	.		0.537	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000090700.2	NM_182499	
ADAR	103	hgsc.bcm.edu	37	1	154561139	154561139	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:154561139T>A	ENST00000368474.4	-	10	2972	c.2773A>T	c.(2773-2775)Agt>Tgt	p.S925C	ADAR_ENST00000292205.5_Missense_Mutation_p.S968C|ADAR_ENST00000368471.3_Missense_Mutation_p.S630C	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	925	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.				adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		ATTAACTCACTGTAGAGAAAC	0.388																																					p.S925C		Atlas-SNP	.											.	ADAR	113	.	0			c.A2773T						.						95.0	94.0	94.0					1																	154561139		2203	4300	6503	SO:0001583	missense	103	exon10			ACTCACTGTAGAG	BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.2773A>T	chr1.hg19:g.154561139T>A	ENSP00000357459:p.Ser925Cys	94.0	0.0		154.0	20.0	NM_001111	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	ENST00000368474.4	hg19	CCDS1071.1	.	.	.	.	.	.	.	.	.	.	T	18.61	3.660738	0.67700	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.94457	-3.43;-3.43;-3.43;-3.43	5.19	4.05	0.47172	Adenosine deaminase/editase (3);	0.280867	0.43260	D	0.000591	D	0.95996	0.8696	M	0.79805	2.47	0.58432	D	0.999998	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.936;0.965;0.998	D	0.95956	0.8958	10	0.87932	D	0	-16.9448	8.4381	0.32799	0.0:0.0763:0.1432:0.7805	.	880;899;925	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	C	968;925;630;894	ENSP00000292205:S968C;ENSP00000357459:S925C;ENSP00000357456:S630C;ENSP00000431794:S894C	ENSP00000292205:S968C	S	-	1	0	ADAR	152827763	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.896000	0.56266	2.176000	0.68965	0.455000	0.32223	AGT	.	.		0.388	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000090691.2	NM_001111	
ASH1L	55870	hgsc.bcm.edu	37	1	155450303	155450303	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:155450303T>A	ENST00000368346.3	-	3	2997	c.2358A>T	c.(2356-2358)acA>acT	p.T786T	ASH1L_ENST00000392403.3_Silent_p.T786T			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	786					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GAGATGGAGCTGTGGATTTGC	0.413																																					p.T786T		Atlas-SNP	.											.	ASH1L	279	.	0			c.A2358T						.						153.0	151.0	151.0					1																	155450303		2203	4298	6501	SO:0001819	synonymous_variant	55870	exon3			TGGAGCTGTGGAT	AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2358A>T	chr1.hg19:g.155450303T>A		208.0	0.0		327.0	35.0	NM_018489	Q59GP1|Q5T714|Q5T715|Q9P2C7	Silent	SNP	ENST00000368346.3	hg19																																																																																				.	.		0.413	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000039400.1	NM_018489	
IQGAP3	128239	hgsc.bcm.edu	37	1	156517962	156517962	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:156517962T>A	ENST00000361170.2	-	19	2217	c.2207A>T	c.(2206-2208)cAg>cTg	p.Q736L		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	736	IQ 1. {ECO:0000255|PROSITE- ProRule:PRU00116}.				activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGCCTGGAGCTGGATAACAAA	0.577																																					p.Q736L		Atlas-SNP	.											.	IQGAP3	146	.	0			c.A2207T						.						43.0	43.0	43.0					1																	156517962		2203	4300	6503	SO:0001583	missense	128239	exon19			TGGAGCTGGATAA	AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.2207A>T	chr1.hg19:g.156517962T>A	ENSP00000354451:p.Gln736Leu	92.0	0.0		188.0	33.0	NM_178229	Q5T3H8	Missense_Mutation	SNP	ENST00000361170.2	hg19	CCDS1144.1	.	.	.	.	.	.	.	.	.	.	T	10.02	1.235563	0.22626	.	.	ENSG00000183856	ENST00000361170	T	0.69435	-0.4	4.32	-0.566	0.11767	.	0.604741	0.16984	N	0.191599	T	0.30039	0.0752	L	0.31476	0.935	0.26785	N	0.969529	B	0.23185	0.081	B	0.21917	0.037	T	0.25467	-1.0131	10	0.46703	T	0.11	-0.8431	9.2591	0.37601	0.0:0.4856:0.0:0.5144	.	736	Q86VI3	IQGA3_HUMAN	L	736	ENSP00000354451:Q736L	ENSP00000354451:Q736L	Q	-	2	0	IQGAP3	154784586	0.007000	0.16637	0.173000	0.22940	0.578000	0.36192	-0.782000	0.04643	-0.286000	0.09076	0.459000	0.35465	CAG	.	.		0.577	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080657.1	NM_178229	
BCAN	63827	hgsc.bcm.edu	37	1	156617431	156617431	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:156617431T>A	ENST00000329117.5	+	4	934	c.598T>A	c.(598-600)Tat>Aat	p.Y200N	RP11-284F21.10_ENST00000605886.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.Y200N|RP11-284F21.7_ENST00000448869.1_RNA	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	200	Link 1. {ECO:0000255|PROSITE- ProRule:PRU00323}.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCTTGGGGGCTATGAGCAATG	0.642																																					p.Y200N		Atlas-SNP	.											.	BCAN	174	.	0			c.T598A						.						78.0	81.0	80.0					1																	156617431		2203	4300	6503	SO:0001583	missense	63827	exon4			GGGGGCTATGAGC	BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	ENST00000329117.5:c.598T>A	chr1.hg19:g.156617431T>A	ENSP00000331210:p.Tyr200Asn	28.0	0.0		51.0	6.0	NM_198427	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Missense_Mutation	SNP	ENST00000329117.5	hg19	CCDS1149.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.112124	0.77210	.	.	ENSG00000132692	ENST00000329117;ENST00000457777;ENST00000424639;ENST00000361588	T;T;T;T	0.09073	3.02;3.02;3.02;3.02	4.28	4.28	0.50868	C-type lectin fold (1);Link (5);C-type lectin-like (1);	0.000000	0.53938	D	0.000047	T	0.21227	0.0511	M	0.82517	2.595	0.52099	D	0.999949	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.01914	-1.1248	10	0.87932	D	0	-2.1451	12.3748	0.55273	0.0:0.0:0.0:1.0	.	200;200	Q96GW7;Q96GW7-2	PGCB_HUMAN;.	N	200;200;98;200	ENSP00000331210:Y200N;ENSP00000389898:Y200N;ENSP00000401709:Y98N;ENSP00000354925:Y200N	ENSP00000331210:Y200N	Y	+	1	0	BCAN	154884055	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.058000	0.71126	1.782000	0.52362	0.374000	0.22700	TAT	.	.		0.642	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000081844.2	NM_021948	
ARHGEF11	9826	hgsc.bcm.edu	37	1	156939079	156939079	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:156939079T>A	ENST00000361409.2	-	9	1442	c.700A>T	c.(700-702)Agt>Tgt	p.S234C	ARHGEF11_ENST00000368194.3_Missense_Mutation_p.S274C	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	234					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTCACCTCACTGAGGGAAGGA	0.567																																					p.S274C		Atlas-SNP	.											.	ARHGEF11	168	.	0			c.A820T						.						45.0	36.0	39.0					1																	156939079		2203	4299	6502	SO:0001583	missense	9826	exon10			CCTCACTGAGGGA	AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.700A>T	chr1.hg19:g.156939079T>A	ENSP00000354644:p.Ser234Cys	105.0	0.0		179.0	18.0	NM_198236	D3DVD0|Q5VY40|Q6PFW2	Missense_Mutation	SNP	ENST00000361409.2	hg19	CCDS1162.1	.	.	.	.	.	.	.	.	.	.	T	15.78	2.934432	0.52866	.	.	ENSG00000132694	ENST00000368194;ENST00000361409	T;T	0.69561	-0.41;-0.41	4.89	-0.0762	0.13723	.	0.093451	0.46758	D	0.000272	T	0.36468	0.0968	L	0.29908	0.895	0.80722	D	1	B;P	0.37914	0.251;0.611	B;B	0.36289	0.038;0.221	T	0.35525	-0.9785	10	0.72032	D	0.01	-2.1015	12.3396	0.55087	0.0:0.0845:0.0:0.9155	.	234;274	O15085;O15085-2	ARHGB_HUMAN;.	C	274;234	ENSP00000357177:S274C;ENSP00000354644:S234C	ENSP00000354644:S234C	S	-	1	0	ARHGEF11	155205703	0.988000	0.35896	0.648000	0.29521	0.981000	0.71138	0.802000	0.27069	-0.102000	0.12197	0.533000	0.62120	AGT	.	.		0.567	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000098931.1	NM_198236	
CD5L	922	hgsc.bcm.edu	37	1	157804379	157804379	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:157804379A>T	ENST00000368174.4	-	4	632	c.536T>A	c.(535-537)cTg>cAg	p.L179Q	CD5L_ENST00000484609.1_5'Flank	NM_005894.2	NP_005885.1	O43866	CD5L_HUMAN	CD5 molecule-like	179	SRCR 2. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	scavenger receptor activity (GO:0005044)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	52	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			CCCACATCCCAGCTGCCGGCA	0.582																																					p.L179Q		Atlas-SNP	.											.	CD5L	112	.	0			c.T536A						.						90.0	84.0	86.0					1																	157804379		2203	4300	6503	SO:0001583	missense	922	exon4			CATCCCAGCTGCC	U82812	CCDS1171.1	1q21-q23	2008-02-05	2006-03-28		ENSG00000073754	ENSG00000073754			1690	protein-coding gene	gene with protein product		602592	"""apoptosis inhibitor 6"", ""CD5 antigen-like (scavenger receptor cysteine rich family)"""	API6		9045627	Standard	NM_005894		Approved	Spalpha	uc001frk.4	O43866	OTTHUMG00000022440	ENST00000368174.4:c.536T>A	chr1.hg19:g.157804379A>T	ENSP00000357156:p.Leu179Gln	47.0	0.0		121.0	42.0	NM_005894	A8K7M5|Q6UX63	Missense_Mutation	SNP	ENST00000368174.4	hg19	CCDS1171.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.949902	0.73787	.	.	ENSG00000073754	ENST00000368174	T	0.58060	0.36	5.13	5.13	0.70059	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	0.207580	0.24191	N	0.040713	T	0.78000	0.4215	H	0.97340	3.985	0.39200	D	0.963129	D	0.89917	1.0	D	0.81914	0.995	D	0.85848	0.1402	10	0.87932	D	0	.	12.9409	0.58342	1.0:0.0:0.0:0.0	.	179	O43866	CD5L_HUMAN	Q	179	ENSP00000357156:L179Q	ENSP00000357156:L179Q	L	-	2	0	CD5L	156071003	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	8.554000	0.90689	2.150000	0.67090	0.533000	0.62120	CTG	.	.		0.582	CD5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058346.1	NM_005894	
OR6P1	128366	hgsc.bcm.edu	37	1	158532685	158532685	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:158532685G>A	ENST00000334632.1	-	1	709	c.710C>T	c.(709-711)gCc>gTc	p.A237V		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	237						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						AGTGGAAAAGGCTTTGTGGCG	0.532																																					p.A237V		Atlas-SNP	.											.	OR6P1	47	.	0			c.C710T						.						127.0	105.0	112.0					1																	158532685		692	1591	2283	SO:0001583	missense	128366	exon1			GAAAAGGCTTTGT	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.710C>T	chr1.hg19:g.158532685G>A	ENSP00000334721:p.Ala237Val	82.0	0.0		187.0	58.0	NM_001160325	Q6IFR9	Missense_Mutation	SNP	ENST00000334632.1	hg19	CCDS53391.1	.	.	.	.	.	.	.	.	.	.	G	16.11	3.030422	0.54790	.	.	ENSG00000186440	ENST00000334632	T	0.00342	8.03	5.11	5.11	0.69529	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	D	0.000305	T	0.00496	0.0016	M	0.76938	2.355	0.41431	D	0.987866	D	0.76494	0.999	D	0.68483	0.958	T	0.78738	-0.2087	10	0.72032	D	0.01	.	17.4637	0.87626	0.0:0.0:1.0:0.0	.	237	Q8NGX9	OR6P1_HUMAN	V	237	ENSP00000334721:A237V	ENSP00000334721:A237V	A	-	2	0	OR6P1	156799309	1.000000	0.71417	0.998000	0.56505	0.017000	0.09413	6.714000	0.74692	2.657000	0.90304	0.591000	0.81541	GCC	.	.		0.532	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
FCRLB	127943	hgsc.bcm.edu	37	1	161693276	161693276	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:161693276A>T	ENST00000367948.2	+	5	387	c.172A>T	c.(172-174)Agc>Tgc	p.S58C	FCRLB_ENST00000367944.3_Missense_Mutation_p.S51C|FCRLB_ENST00000367946.3_Missense_Mutation_p.S58C|FCRLB_ENST00000392158.1_Missense_Mutation_p.S58C|FCRLB_ENST00000367945.1_Missense_Mutation_p.S51C|FCRLB_ENST00000336830.5_Missense_Mutation_p.S58C			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	58	Ig-like C2-type 1.				negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			CCAGCCCATCAGCACTCTCTG	0.547																																					p.S58C		Atlas-SNP	.											.	FCRLB	35	.	0			c.A172T						.						133.0	126.0	129.0					1																	161693276		2203	4300	6503	SO:0001583	missense	127943	exon3			CCCATCAGCACTC	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.172A>T	chr1.hg19:g.161693276A>T	ENSP00000356925:p.Ser58Cys	153.0	0.0		283.0	40.0	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Missense_Mutation	SNP	ENST00000367948.2	hg19	CCDS30927.1	.	.	.	.	.	.	.	.	.	.	A	19.23	3.786991	0.70337	.	.	ENSG00000162746	ENST00000367948;ENST00000367946;ENST00000367945;ENST00000336830;ENST00000367944;ENST00000392158	T;T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55;2.55	5.76	4.61	0.57282	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.647571	0.14906	N	0.291553	T	0.19886	0.0478	M	0.75447	2.3	0.28651	N	0.906669	D;D;D;D;D	0.76494	0.999;0.993;0.996;0.993;0.975	D;P;P;P;P	0.63192	0.912;0.8;0.855;0.8;0.739	T	0.10847	-1.0612	10	0.87932	D	0	.	9.874	0.41191	0.8282:0.1718:0.0:0.0	.	51;51;58;58;58	Q6BAA4-3;Q6BAA4-5;Q6BAA4-2;Q6BAA4-4;Q6BAA4	.;.;.;.;FCRLB_HUMAN	C	58;58;51;58;51;58	ENSP00000356925:S58C;ENSP00000356923:S58C;ENSP00000356922:S51C;ENSP00000338598:S58C;ENSP00000356921:S51C;ENSP00000375999:S58C	ENSP00000338598:S58C	S	+	1	0	FCRLB	159959900	0.984000	0.35163	0.902000	0.35471	0.974000	0.67602	1.834000	0.39171	0.964000	0.38108	0.533000	0.62120	AGC	.	.		0.547	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
ILDR2	387597	hgsc.bcm.edu	37	1	166927035	166927035	+	Missense_Mutation	SNP	T	T	A	rs138041277		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:166927035T>A	ENST00000271417.3	-	2	405	c.350A>T	c.(349-351)tAc>tTc	p.Y117F	ILDR2_ENST00000529387.1_Missense_Mutation_p.Y117F|ILDR2_ENST00000469934.2_Missense_Mutation_p.Y117F|ILDR2_ENST00000528703.1_Missense_Mutation_p.Y117F|ILDR2_ENST00000529071.1_Missense_Mutation_p.Y117F|ILDR2_ENST00000526687.1_Missense_Mutation_p.Y117F|ILDR2_ENST00000525740.1_Missense_Mutation_p.Y117F	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	117	Ig-like V-type.				cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						TCTGCCCCTGTAGAAATCTCC	0.473																																					p.Y117F		Atlas-SNP	.											.	ILDR2	79	.	0			c.A350T						.						67.0	68.0	68.0					1																	166927035		2203	4300	6503	SO:0001583	missense	387597	exon2			CCCCTGTAGAAAT	AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.350A>T	chr1.hg19:g.166927035T>A	ENSP00000271417:p.Tyr117Phe	101.0	0.0		172.0	24.0	NM_199351		Missense_Mutation	SNP	ENST00000271417.3	hg19	CCDS1256.1	.	.	.	.	.	.	.	.	.	.	T	24.0	4.484617	0.84854	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000529387;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T;T;T	0.01505	4.82;4.82;4.82;4.82;4.82;4.82;4.82	6.03	6.03	0.97812	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	M	0.77486	2.375	0.58432	D	0.999999	D	0.76494	0.999	D	0.78314	0.991	T	0.02781	-1.1111	10	0.87932	D	0	.	16.5655	0.84588	0.0:0.0:0.0:1.0	.	117	Q71H61	ILDR2_HUMAN	F	117	ENSP00000271417:Y117F;ENSP00000436120:Y117F;ENSP00000431316:Y117F;ENSP00000437008:Y117F;ENSP00000436882:Y117F;ENSP00000434273:Y117F;ENSP00000432750:Y117F	ENSP00000271417:Y117F	Y	-	2	0	ILDR2	165193659	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.033000	0.88852	2.302000	0.77476	0.533000	0.62120	TAC	.	T|1.000;C|0.000		0.473	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082880.2	NM_199351	
NME7	29922	hgsc.bcm.edu	37	1	169200018	169200018	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:169200018T>C	ENST00000367811.3	-	10	1184	c.928A>G	c.(928-930)Atg>Gtg	p.M310V	NME7_ENST00000472647.1_Missense_Mutation_p.M274V	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	310					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TGAATCTCCATTGCTACACAA	0.313																																					p.M310V		Atlas-SNP	.											.	NME7	34	.	0			c.A928G						.						88.0	82.0	84.0					1																	169200018		2203	4299	6502	SO:0001583	missense	29922	exon10			TCTCCATTGCTAC	AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.928A>G	chr1.hg19:g.169200018T>C	ENSP00000356785:p.Met310Val	455.0	0.0		949.0	117.0	NM_013330	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	ENST00000367811.3	hg19	CCDS1277.1	.	.	.	.	.	.	.	.	.	.	T	12.14	1.849787	0.32699	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.55760	0.5;0.5	5.65	-11.3	0.00108	.	0.646940	0.16510	N	0.211261	T	0.20414	0.0491	L	0.56769	1.78	0.32853	D	0.506970	B	0.02656	0.0	B	0.24155	0.051	T	0.02925	-1.1093	9	0.49607	T	0.09	-0.7583	9.0524	0.36385	0.2051:0.0684:0.6032:0.1233	.	310	Q9Y5B8	NDK7_HUMAN	V	274;310	ENSP00000433341:M274V;ENSP00000356785:M310V	ENSP00000356785:M310V	M	-	1	0	NME7	167466642	0.821000	0.29204	0.089000	0.20774	0.933000	0.57130	-0.063000	0.11655	-2.106000	0.00841	-1.341000	0.01249	ATG	.	.		0.313	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083688.1	NM_013330	
MROH9	80133	hgsc.bcm.edu	37	1	170916672	170916672	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:170916672T>A	ENST00000367758.3	+	3	129	c.30T>A	c.(28-30)agT>agA	p.S10R	MROH9_ENST00000367759.4_Missense_Mutation_p.S10R	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	10																	GGCTAGAGAGTAGTCTCCAGA	0.383																																					p.S10R		Atlas-SNP	.											.	.	.	.	0			c.T30A						.						140.0	129.0	132.0					1																	170916672		1870	4109	5979	SO:0001583	missense	80133	exon3			AGAGAGTAGTCTC	AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.30T>A	chr1.hg19:g.170916672T>A	ENSP00000356732:p.Ser10Arg	104.0	0.0		190.0	35.0	NM_025063	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	ENST00000367758.3	hg19	CCDS41436.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347508	0.24426	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.17691	3.9;2.26	2.82	-2.36	0.06663	.	3.192640	0.02365	U	0.077284	T	0.02119	0.0066	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.009;0.009	B;B	0.12156	0.007;0.007	T	0.38329	-0.9666	10	0.66056	D	0.02	0.0083	0.2964	0.00266	0.2036:0.2705:0.2079:0.3179	.	10;10	F5GWX6;Q5TGP6	.;CA129_HUMAN	R	10	ENSP00000356733:S10R;ENSP00000356732:S10R	ENSP00000356732:S10R	S	+	3	2	C1orf129	169183296	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-1.884000	0.01622	-0.548000	0.06199	-0.349000	0.07799	AGT	.	.		0.383	MROH9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000099327.1	NM_025063	
PIGC	5279	hgsc.bcm.edu	37	1	172411330	172411330	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:172411330T>A	ENST00000367728.1	-	1	1896	c.433A>T	c.(433-435)Agc>Tgc	p.S145C	PIGC_ENST00000484368.1_Intron|PIGC_ENST00000344529.4_Missense_Mutation_p.S145C|C1orf105_ENST00000367727.4_Intron|PIGC_ENST00000258324.1_Missense_Mutation_p.S145C			Q92535	PIGC_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class C	145					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)			breast(1)|endometrium(1)|kidney(1)|lung(1)	4						GTGTCAGTGCTGACAGACTCT	0.488																																					p.S145C		Atlas-SNP	.											.	PIGC	24	.	0			c.A433T						.						59.0	54.0	56.0					1																	172411330		2203	4300	6503	SO:0001583	missense	5279	exon2			CAGTGCTGACAGA	BC006539	CCDS1302.1	1q23-q25	2013-02-26	2006-06-28		ENSG00000135845	ENSG00000135845	2.4.1.198	"""Phosphatidylinositol glycan anchor biosynthesis"""	8960	protein-coding gene	gene with protein product	"""phosphatidylinositol N-acetylglucosaminyltransferase"""	601730	"""phosphatidylinositol glycan, class C"""			8806613, 9325057	Standard	NM_153747		Approved		uc001gio.3	Q92535	OTTHUMG00000034751	ENST00000367728.1:c.433A>T	chr1.hg19:g.172411330T>A	ENSP00000356702:p.Ser145Cys	153.0	0.0		252.0	38.0	NM_153747	O14491	Missense_Mutation	SNP	ENST00000367728.1	hg19	CCDS1302.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.196441	0.78902	.	.	ENSG00000135845	ENST00000344529;ENST00000367728;ENST00000258324	T;T;T	0.61627	0.09;0.09;0.09	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.75376	0.3841	M	0.89785	3.06	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81865	-0.0736	10	0.87932	D	0	0.0372	13.6827	0.62496	0.0:0.0:0.0:1.0	.	145	Q92535	PIGC_HUMAN	C	145	ENSP00000356701:S145C;ENSP00000356702:S145C;ENSP00000258324:S145C	ENSP00000258324:S145C	S	-	1	0	PIGC	170677953	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.528000	0.81941	1.917000	0.55516	0.528000	0.53228	AGC	.	.		0.488	PIGC-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084068.1	NM_153747	
RC3H1	149041	hgsc.bcm.edu	37	1	173934198	173934198	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:173934198T>A	ENST00000367696.2	-	10	1746	c.1395A>T	c.(1393-1395)caA>caT	p.Q465H	RC3H1_ENST00000258349.4_Missense_Mutation_p.Q465H|RC3H1_ENST00000367694.2_Missense_Mutation_p.Q465H			Q5TC82	RC3H1_HUMAN	ring finger and CCCH-type domains 1	465					B cell homeostasis (GO:0001782)|cytoplasmic mRNA processing body assembly (GO:0033962)|lymph node development (GO:0048535)|negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of germinal center formation (GO:0002635)|negative regulation of T-helper cell differentiation (GO:0045623)|nuclear-transcribed mRNA catabolic process (GO:0000956)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|posttranscriptional regulation of gene expression (GO:0010608)|protein ubiquitination (GO:0016567)|regulation of germinal center formation (GO:0002634)|regulation of mRNA stability (GO:0043488)|regulation of T cell receptor signaling pathway (GO:0050856)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	50						CCTCATTAAGTTGACCCAAAG	0.438																																					p.Q465H		Atlas-SNP	.											.	RC3H1	110	.	0			c.A1395T						.						86.0	81.0	83.0					1																	173934198		2203	4300	6503	SO:0001583	missense	149041	exon9			ATTAAGTTGACCC	AK093501	CCDS30940.1, CCDS72987.1	1q25.1	2013-01-18	2010-09-15		ENSG00000135870	ENSG00000135870		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	29434	protein-coding gene	gene with protein product	"""KIAA2025 protein"""	609424	"""ring finger and CCCH-type zinc finger domains 1"""			15917799	Standard	XM_005244918		Approved	KIAA2025, roquin, RP5-1198E17.5, RNF198	uc001gju.4	Q5TC82	OTTHUMG00000037275	ENST00000367696.2:c.1395A>T	chr1.hg19:g.173934198T>A	ENSP00000356669:p.Gln465His	111.0	0.0		230.0	27.0	NM_172071	B3KVK1|Q5W180|Q5W181|Q8IVE6|Q8N9V1	Missense_Mutation	SNP	ENST00000367696.2	hg19	CCDS30940.1	.	.	.	.	.	.	.	.	.	.	T	18.98	3.737968	0.69304	.	.	ENSG00000135870	ENST00000367696;ENST00000258349;ENST00000367694	T;T;T	0.45668	0.89;0.89;0.89	5.8	-8.88	0.00789	.	0.075071	0.56097	N	0.000030	T	0.42245	0.1194	L	0.44542	1.39	0.47778	D	0.999518	D;D;D;D	0.71674	0.996;0.996;0.998;0.996	D;D;D;D	0.75484	0.953;0.986;0.979;0.93	T	0.66881	-0.5811	10	0.22706	T	0.39	-6.2429	10.0172	0.42022	0.096:0.3044:0.0:0.5996	.	465;465;465;465	B9EGU6;B7ZMB3;Q5TC82-2;Q5TC82	.;.;.;RC3H1_HUMAN	H	465	ENSP00000356669:Q465H;ENSP00000258349:Q465H;ENSP00000356667:Q465H	ENSP00000258349:Q465H	Q	-	3	2	RC3H1	172200821	0.891000	0.30450	0.601000	0.28877	0.985000	0.73830	0.002000	0.13061	-2.058000	0.00895	-0.899000	0.02877	CAA	.	.		0.438	RC3H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090733.2	NM_172071	
NPHS2	7827	hgsc.bcm.edu	37	1	179530443	179530443	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:179530443A>T	ENST00000367615.4	-	3	500	c.432T>A	c.(430-432)ccT>ccA	p.P144P	NPHS2_ENST00000367616.4_Silent_p.P144P	NM_014625.2	NP_055440.1	Q9NP85	PODO_HUMAN	nephrosis 2, idiopathic, steroid-resistant (podocin)	144					actin cytoskeleton reorganization (GO:0031532)|excretion (GO:0007588)|metanephric glomerular visceral epithelial cell development (GO:0072249)	cell-cell junction (GO:0005911)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)				NS(1)|endometrium(1)|large_intestine(3)|lung(10)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	20						TGGCTCTTCCAGGAAGCAGAT	0.373																																					p.P144P		Atlas-SNP	.											.	NPHS2	46	.	0			c.T432A						.						141.0	159.0	153.0					1																	179530443		2203	4300	6503	SO:0001819	synonymous_variant	7827	exon3			TCTTCCAGGAAGC	AJ279254	CCDS1331.1, CCDS72988.1	1q25-q31	2014-06-27			ENSG00000116218	ENSG00000116218			13394	protein-coding gene	gene with protein product		604766				8589695, 10742096	Standard	XM_005245483		Approved	SRN1, PDCN	uc001gmq.4	Q9NP85	OTTHUMG00000035252	ENST00000367615.4:c.432T>A	chr1.hg19:g.179530443A>T		245.0	0.0		489.0	74.0	NM_014625	B1AM32|B1AM33|Q8N6Q5	Silent	SNP	ENST00000367615.4	hg19	CCDS1331.1																																																																																			.	.		0.373	NPHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085283.1		
RGSL1	353299	hgsc.bcm.edu	37	1	182443327	182443327	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:182443327A>T	ENST00000294854.8	+	6	1101	c.1081A>T	c.(1081-1083)Atc>Ttc	p.I361F	RGSL1_ENST00000542961.1_Missense_Mutation_p.I396F	NM_001137669.1	NP_001131141.1	A5PLK6	RGSL_HUMAN	regulator of G-protein signaling like 1	361					termination of G-protein coupled receptor signaling pathway (GO:0038032)	integral component of membrane (GO:0016021)				central_nervous_system(2)|skin(4)	6						TCAGAAGGCCATCAAGCAAAG	0.507																																					p.I361F	Ovarian(71;11 616 11292 12944 18021 32289 33994 41738 46526)	Atlas-SNP	.											.	RGSL1	111	.	0			c.A1081T						.						123.0	104.0	110.0					1																	182443327		692	1591	2283	SO:0001583	missense	353299	exon6			AAGGCCATCAAGC	AF510428	CCDS58049.1	1q25	2013-04-02	2007-08-14		ENSG00000121446	ENSG00000121446			18636	protein-coding gene	gene with protein product		611012	"""regulator of G-protein signalling like 1"", ""regulator of G-protein signaling like 2"", ""regulator of G-protein signalling like 2"""	RGSL2		12801632	Standard	NM_001137669		Approved		uc009wxw.3	A5PLK6	OTTHUMG00000035217	ENST00000294854.8:c.1081A>T	chr1.hg19:g.182443327A>T	ENSP00000457748:p.Ile361Phe	154.0	0.0		282.0	33.0	NM_001137669	A2A2Z0|A6PVM2|A6PVM3|Q0VAJ4|Q0VAJ5|Q6ZRL0|Q86UV0|Q9H084	Missense_Mutation	SNP	ENST00000294854.8	hg19	CCDS58049.1																																																																																			.	.		0.507	RGSL1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320710.3	NM_181572	
DHX9	1660	hgsc.bcm.edu	37	1	182836162	182836162	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:182836162A>T	ENST00000367549.3	+	14	1651	c.1541A>T	c.(1540-1542)cAt>cTt	p.H514L		NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	514	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						GATGAAATACATGAAAGAGAT	0.323																																					p.H514L	Colon(69;210 1162 3697 13559 39565)	Atlas-SNP	.											.	DHX9	114	.	0			c.A1541T						.						150.0	136.0	140.0					1																	182836162		1829	4080	5909	SO:0001583	missense	1660	exon14			AAATACATGAAAG	L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.1541A>T	chr1.hg19:g.182836162A>T	ENSP00000356520:p.His514Leu	68.0	0.0		169.0	23.0	NM_001357	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Missense_Mutation	SNP	ENST00000367549.3	hg19	CCDS41444.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.509870	0.85282	.	.	ENSG00000135829	ENST00000399175;ENST00000367549	T	0.62364	0.03	5.36	5.36	0.76844	DEAD-like helicase (2);DNA/RNA helicase, ATP-dependent, DEAH-box type, conserved site (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.88647	0.6493	H	0.99740	4.74	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93532	0.6870	10	0.72032	D	0.01	.	15.0124	0.71560	1.0:0.0:0.0:0.0	.	514	Q08211	DHX9_HUMAN	L	514	ENSP00000356520:H514L	ENSP00000356520:H514L	H	+	2	0	DHX9	181102785	1.000000	0.71417	0.982000	0.44146	0.989000	0.77384	8.421000	0.90259	2.033000	0.60031	0.482000	0.46254	CAT	.	.		0.323	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000085522.2	NM_030588	
HMCN1	83872	hgsc.bcm.edu	37	1	186034407	186034407	+	Silent	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:186034407G>T	ENST00000271588.4	+	49	7780	c.7551G>T	c.(7549-7551)ggG>ggT	p.G2517G	HMCN1_ENST00000367492.2_Silent_p.G2517G	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2517	Ig-like C2-type 23.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ACAAAGATGGGCAGCCCCTCC	0.398																																					p.G2517G		Atlas-SNP	.											.	HMCN1	797	.	0			c.G7551T						.						64.0	62.0	62.0					1																	186034407		2203	4300	6503	SO:0001819	synonymous_variant	83872	exon49			AGATGGGCAGCCC	AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.7551G>T	chr1.hg19:g.186034407G>T		60.0	0.0		131.0	24.0	NM_031935	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Silent	SNP	ENST00000271588.4	hg19	CCDS30956.1																																																																																			.	.		0.398	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000131848.1	NM_031935	
PRG4	10216	hgsc.bcm.edu	37	1	186275482	186275482	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:186275482A>C	ENST00000445192.2	+	7	676	c.631A>C	c.(631-633)Aaa>Caa	p.K211Q	PRG4_ENST00000367484.3_Missense_Mutation_p.K170Q|PRG4_ENST00000367486.3_Missense_Mutation_p.K168Q|PRG4_ENST00000367483.4_Missense_Mutation_p.K170Q|PRG4_ENST00000367485.4_Missense_Mutation_p.K118Q	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	211					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AACTAAAAAGAAACCTACCCC	0.358																																					p.K211Q		Atlas-SNP	.											.	PRG4	259	.	0			c.A631C						.						133.0	138.0	136.0					1																	186275482		2203	4300	6503	SO:0001583	missense	10216	exon7			AAAAAGAAACCTA	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.631A>C	chr1.hg19:g.186275482A>C	ENSP00000399679:p.Lys211Gln	142.0	0.0		245.0	32.0	NM_005807	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Missense_Mutation	SNP	ENST00000445192.2	hg19	CCDS1369.1	.	.	.	.	.	.	.	.	.	.	A	1.708	-0.499759	0.04291	.	.	ENSG00000116690	ENST00000367486;ENST00000367484;ENST00000533951;ENST00000367482;ENST00000367483;ENST00000367485;ENST00000445192	T;T;T;T;T;T	0.52295	2.91;3.53;0.67;3.47;3.35;3.53	4.07	1.43	0.22495	.	0.142736	0.31438	U	0.007649	T	0.44477	0.1295	M	0.61703	1.905	0.09310	N	1	P;P;P;P	0.42518	0.782;0.782;0.675;0.782	P;P;B;B	0.46172	0.506;0.506;0.246;0.428	T	0.27434	-1.0074	10	0.25106	T	0.35	-0.6262	5.8859	0.18882	0.7841:0.0:0.2159:0.0	.	77;118;211;170	Q92954-4;Q92954-3;Q92954;Q92954-2	.;.;PRG4_HUMAN;.	Q	168;170;120;77;170;118;211	ENSP00000356456:K168Q;ENSP00000356454:K170Q;ENSP00000431330:K120Q;ENSP00000356453:K170Q;ENSP00000356455:K118Q;ENSP00000399679:K211Q	ENSP00000356452:K77Q	K	+	1	0	PRG4	184542105	0.037000	0.19845	0.457000	0.27056	0.100000	0.18952	0.993000	0.29680	0.045000	0.15804	0.383000	0.25322	AAA	.	.		0.358	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PTGS2	5743	hgsc.bcm.edu	37	1	186644523	186644523	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:186644523A>T	ENST00000367468.5	-	9	1399	c.1263T>A	c.(1261-1263)gcT>gcA	p.A421A	PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	421					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	TCCTACCACCAGCAACCTGTG	0.393																																					p.A421A		Atlas-SNP	.											.	PTGS2	144	.	0			c.T1263A						.						77.0	75.0	76.0					1																	186644523		2203	4300	6503	SO:0001819	synonymous_variant	5743	exon9			ACCACCAGCAACC	D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.1263T>A	chr1.hg19:g.186644523A>T		115.0	0.0		280.0	34.0	NM_000963	A8K802|Q16876	Silent	SNP	ENST00000367468.5	hg19	CCDS1371.1																																																																																			.	.		0.393	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086157.2	NM_000963	
BRINP3	339479	hgsc.bcm.edu	37	1	190068155	190068155	+	Missense_Mutation	SNP	G	G	T	rs560983384		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:190068155G>T	ENST00000367462.3	-	8	1525	c.1294C>A	c.(1294-1296)Cag>Aag	p.Q432K	BRINP3_ENST00000534846.1_Missense_Mutation_p.Q330K	NM_199051.1	NP_950252.1	Q76B58	BRNP3_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 3	432					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)											CAGACCACCTGGTCATTCGGA	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17138	0.0		0.0	False		,,,				2504	0.0				p.Q432K		Atlas-SNP	.											.	FAM5C	343	.	0			c.C1294A						.						56.0	44.0	48.0					1																	190068155		2203	4300	6503	SO:0001583	missense	339479	exon8			CCACCTGGTCATT	AB111893	CCDS1373.1	1q31.1	2013-09-18	2013-09-18	2013-09-18	ENSG00000162670	ENSG00000162670			22393	protein-coding gene	gene with protein product			"""family with sequence similarity 5, member C"""	FAM5C		16018821, 15193423	Standard	NM_199051		Approved	DBCCR1L, DBCCR1L1	uc001gse.1	Q76B58	OTTHUMG00000035533	ENST00000367462.3:c.1294C>A	chr1.hg19:g.190068155G>T	ENSP00000356432:p.Gln432Lys	180.0	0.0		257.0	37.0	NM_199051	B3KVP1|B7Z260|O95726|Q2M330	Missense_Mutation	SNP	ENST00000367462.3	hg19	CCDS1373.1	.	.	.	.	.	.	.	.	.	.	G	17.82	3.483590	0.63962	.	.	ENSG00000162670	ENST00000367462;ENST00000534846	D;D	0.87334	-2.24;-2.24	5.65	5.65	0.86999	.	0.056763	0.64402	D	0.000001	D	0.84365	0.5456	L	0.47716	1.5	0.49130	D	0.99975	B;B	0.27732	0.187;0.055	B;B	0.27500	0.08;0.015	T	0.81342	-0.0976	10	0.42905	T	0.14	.	17.2216	0.86959	0.0:0.0:1.0:0.0	.	330;432	B7Z260;Q76B58	.;FAM5C_HUMAN	K	432;330	ENSP00000356432:Q432K;ENSP00000438022:Q330K	ENSP00000356432:Q432K	Q	-	1	0	FAM5C	188334778	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.353000	0.97080	2.656000	0.90262	0.591000	0.81541	CAG	.	.		0.597	BRINP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086278.1	NM_199051	
RGS2	5997	hgsc.bcm.edu	37	1	192778220	192778220	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:192778220T>A	ENST00000235382.5	+	1	50	c.19T>A	c.(19-21)Ttg>Atg	p.L7M	RGS2_ENST00000483295.1_3'UTR	NM_002923.3	NP_002914.1	P41220	RGS2_HUMAN	regulator of G-protein signaling 2	7					brown fat cell differentiation (GO:0050873)|cell cycle (GO:0007049)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of phospholipase activity (GO:0010519)|positive regulation of cardiac muscle contraction (GO:0060452)|positive regulation of microtubule polymerization (GO:0031116)|regulation of adrenergic receptor signaling pathway (GO:0071877)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of translation (GO:0006417)|relaxation of cardiac muscle (GO:0055119)|relaxation of vascular smooth muscle (GO:0060087)|spermatogenesis (GO:0007283)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			large_intestine(3)|lung(1)|urinary_tract(1)	5						TGCTATGTTCTTGGCTGTTCA	0.587																																					p.L7M	Pancreas(71;51 2183 4981)	Atlas-SNP	.											.	RGS2	19	.	0			c.T19A						.						167.0	148.0	155.0					1																	192778220		2203	4300	6503	SO:0001583	missense	5997	exon1			ATGTTCTTGGCTG	L13463	CCDS1377.1	1q31	2014-06-19	2014-06-19		ENSG00000116741	ENSG00000116741		"""Regulators of G-protein signaling"", ""Endogenous ligands"""	9998	protein-coding gene	gene with protein product		600861	"""regulator of G-protein signalling 2, 24kD"", ""regulator of G-protein signalling 2, 24kDa"", ""regulator of G-protein signaling 2, 24kDa"""	G0S8		8179820	Standard	NM_002923		Approved		uc001gsl.3	P41220	OTTHUMG00000035600	ENST00000235382.5:c.19T>A	chr1.hg19:g.192778220T>A	ENSP00000235382:p.Leu7Met	430.0	0.0		798.0	117.0	NM_002923	Q6I9U5	Missense_Mutation	SNP	ENST00000235382.5	hg19	CCDS1377.1	.	.	.	.	.	.	.	.	.	.	T	11.65	1.702766	0.30232	.	.	ENSG00000116741	ENST00000235382	T	0.73681	-0.77	4.44	0.0971	0.14493	.	0.346810	0.22981	N	0.053308	T	0.55273	0.1910	N	0.24115	0.695	0.28770	N	0.900439	B	0.15473	0.013	B	0.12837	0.008	T	0.43718	-0.9374	10	0.36615	T	0.2	.	7.988	0.30224	0.0:0.5996:0.0:0.4004	.	7	P41220	RGS2_HUMAN	M	7	ENSP00000235382:L7M	ENSP00000235382:L7M	L	+	1	2	RGS2	191044843	0.041000	0.20044	0.998000	0.56505	0.577000	0.36160	-1.541000	0.02198	-0.068000	0.12953	-0.462000	0.05337	TTG	.	.		0.587	RGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086396.1	NM_002923	
ZBTB41	360023	hgsc.bcm.edu	37	1	197169358	197169358	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:197169358C>A	ENST00000367405.4	-	1	314	c.246G>T	c.(244-246)caG>caT	p.Q82H	CRB1_ENST00000535699.1_5'Flank|ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	82					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						ATGGTTGCTTCTGCCTATCAT	0.353																																					p.Q82H		Atlas-SNP	.											.	ZBTB41	116	.	0			c.G246T						.						61.0	63.0	62.0					1																	197169358		2203	4300	6503	SO:0001583	missense	360023	exon1			TTGCTTCTGCCTA		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.246G>T	chr1.hg19:g.197169358C>A	ENSP00000356375:p.Gln82His	68.0	0.0		150.0	14.0	NM_194314	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	ENST00000367405.4	hg19	CCDS30960.1	.	.	.	.	.	.	.	.	.	.	C	11.91	1.780718	0.31502	.	.	ENSG00000177888	ENST00000367405	T	0.68624	-0.34	4.96	4.96	0.65561	BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.41605	D	0.000849	T	0.54532	0.1864	N	0.16656	0.425	0.38528	D	0.948905	B	0.15141	0.012	B	0.23150	0.044	T	0.53592	-0.8417	10	0.40728	T	0.16	.	18.2007	0.89836	0.0:1.0:0.0:0.0	.	82	Q5SVQ8	ZBT41_HUMAN	H	82	ENSP00000356375:Q82H	ENSP00000356375:Q82H	Q	-	3	2	ZBTB41	195435981	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	1.931000	0.40134	2.265000	0.75225	0.305000	0.20034	CAG	.	.		0.353	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
CRB1	23418	hgsc.bcm.edu	37	1	197403940	197403940	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:197403940A>T	ENST00000367400.3	+	9	3082	c.2947A>T	c.(2947-2949)Agg>Tgg	p.R983W	CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367399.2_Missense_Mutation_p.R871W|CRB1_ENST00000535699.1_Missense_Mutation_p.R959W|CRB1_ENST00000544212.1_Missense_Mutation_p.R464W|CRB1_ENST00000367397.1_Missense_Mutation_p.R364W	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	983	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TTTCAGAACAAGGGATGCAAA	0.333																																					p.R983W		Atlas-SNP	.											.	CRB1	284	.	0			c.A2947T						.						75.0	79.0	78.0					1																	197403940		2203	4300	6503	SO:0001583	missense	23418	exon9			AGAACAAGGGATG		CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.2947A>T	chr1.hg19:g.197403940A>T	ENSP00000356370:p.Arg983Trp	195.0	0.0		329.0	56.0	NM_201253	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	ENST00000367400.3	hg19	CCDS1390.1	.	.	.	.	.	.	.	.	.	.	A	12.79	2.044633	0.36085	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26;-1.26	5.34	1.49	0.22878	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.87079	0.6088	M	0.81341	2.54	0.09310	N	0.999998	D;D;D;D	0.76494	0.998;0.996;0.994;0.999	P;D;D;D	0.66716	0.891;0.928;0.946;0.934	T	0.79771	-0.1663	9	0.42905	T	0.14	.	15.4999	0.75691	0.3525:0.6475:0.0:0.0	.	959;871;632;983	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	W	959;983;871;464;364;632	ENSP00000438786:R959W;ENSP00000356370:R983W;ENSP00000356369:R871W;ENSP00000444556:R464W;ENSP00000356367:R364W	ENSP00000356367:R364W	R	+	1	2	CRB1	195670563	0.872000	0.30054	0.138000	0.22173	0.301000	0.27625	2.036000	0.41165	-0.008000	0.14320	0.533000	0.62120	AGG	.	.		0.333	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086565.2	NM_201253	
CAMSAP2	23271	hgsc.bcm.edu	37	1	200818090	200818090	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:200818090A>T	ENST00000236925.4	+	12	2275	c.2226A>T	c.(2224-2226)ccA>ccT	p.P742P	CAMSAP2_ENST00000413307.2_Silent_p.P715P|CAMSAP2_ENST00000358823.2_Silent_p.P731P			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	742					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										CACAAATTCCAGAAGAAACAG	0.453																																					p.P731P		Atlas-SNP	.											.	.	.	.	0			c.A2193T						.						72.0	79.0	76.0					1																	200818090		2203	4300	6503	SO:0001819	synonymous_variant	23271	exon11			AATTCCAGAAGAA	AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.2226A>T	chr1.hg19:g.200818090A>T		190.0	0.0		370.0	57.0	NM_203459	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Silent	SNP	ENST00000236925.4	hg19																																																																																				.	.		0.453	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000086956.2	NM_203459	
NFASC	23114	hgsc.bcm.edu	37	1	204945893	204945893	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:204945893G>T	ENST00000401399.1	+	15	2000	c.1801G>T	c.(1801-1803)Gac>Tac	p.D601Y	NFASC_ENST00000539706.1_Missense_Mutation_p.D612Y|NFASC_ENST00000404907.1_Missense_Mutation_p.D612Y|NFASC_ENST00000367170.4_Missense_Mutation_p.D601Y|NFASC_ENST00000339876.6_Missense_Mutation_p.D601Y|NFASC_ENST00000367169.4_Missense_Mutation_p.D601Y|NFASC_ENST00000360049.4_Missense_Mutation_p.D612Y|NFASC_ENST00000338586.6_Missense_Mutation_p.D601Y|NFASC_ENST00000367171.4_Missense_Mutation_p.D601Y|NFASC_ENST00000403080.1_Missense_Mutation_p.D601Y|NFASC_ENST00000338515.6_Missense_Mutation_p.D601Y|NFASC_ENST00000367172.4_Missense_Mutation_p.D601Y|NFASC_ENST00000513543.1_Missense_Mutation_p.D612Y|NFASC_ENST00000404076.1_Missense_Mutation_p.D595Y			O94856	NFASC_HUMAN	neurofascin	601	Ig-like C2-type 6.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			GCTAGACCAAGACCTGGCCAA	0.622																																					p.D612Y		Atlas-SNP	.											NFASC_ENST00000403080,caecum,carcinoma,0,3	NFASC	396	.	0			c.G1834T						.						191.0	156.0	168.0					1																	204945893		2203	4300	6503	SO:0001583	missense	23114	exon16			GACCAAGACCTGG	AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.1801G>T	chr1.hg19:g.204945893G>T	ENSP00000385637:p.Asp601Tyr	99.0	0.0		194.0	35.0	NM_015090	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	ENST00000401399.1	hg19	CCDS53460.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.2|23.2	4.391065|4.391065	0.82902|0.82902	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000403080;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393|ENST00000367173	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.	0.68479|.	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33|.	5.19|5.19	4.27|4.27	0.50696|0.50696	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.107759|.	0.40640|.	N|.	0.001054|.	T|T	0.76485|0.76485	0.3994|0.3994	M|M	0.83692|0.83692	2.655|2.655	0.80722|0.80722	D|D	1|1	D;D;D;D;D;D;D|.	0.76494|.	0.998;0.983;0.986;0.997;0.999;0.994;0.984|.	D;D;D;D;P;D;P|.	0.73380|.	0.98;0.94;0.917;0.95;0.854;0.917;0.894|.	T|T	0.78807|0.78807	-0.2059|-0.2059	10|5	0.66056|.	D|.	0.02|.	.|.	13.7779|13.7779	0.63066|0.63066	0.0766:0.0:0.9234:0.0|0.0766:0.0:0.9234:0.0	.|.	601;612;612;601;601;612;601|.	O94856;O94856-11;O94856-8;F8W791;O94856-9;O94856-3;O94856-2|.	NFASC_HUMAN;.;.;.;.;.;.|.	Y|N	601;601;601;601;601;601;612;612;612;601;601;595;601;612;612;588|570	ENSP00000356140:D601Y;ENSP00000356139:D601Y;ENSP00000356138:D601Y;ENSP00000342128:D601Y;ENSP00000344786:D601Y;ENSP00000343509:D601Y;ENSP00000438614:D612Y;ENSP00000353154:D612Y;ENSP00000356137:D601Y;ENSP00000384875:D601Y;ENSP00000385676:D595Y;ENSP00000385637:D601Y;ENSP00000384061:D612Y;ENSP00000425908:D612Y;ENSP00000415031:D588Y|.	ENSP00000295776:D612Y|.	D|K	+|+	1|3	0|2	NFASC|NFASC	203212516|203212516	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.958000|0.958000	0.62258|0.62258	6.590000|6.590000	0.74085|0.74085	2.433000|2.433000	0.82419|0.82419	0.561000|0.561000	0.74099|0.74099	GAC|AAG	.	.		0.622	NFASC-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000131237.1	NM_001005388	
LEMD1	93273	hgsc.bcm.edu	37	1	205353472	205353472	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:205353472A>T	ENST00000367153.4	-	5	393	c.291T>A	c.(289-291)acT>acA	p.T97T	LEMD1_ENST00000367151.2_Silent_p.T56T|LEMD1_ENST00000476884.1_5'UTR|LEMD1_ENST00000367152.1_Silent_p.T56T|LEMD1_ENST00000367149.3_Intron|LEMD1-AS1_ENST00000447832.1_RNA|LEMD1_ENST00000391936.2_Intron|LEMD1_ENST00000367154.1_Intron	NM_001199050.1	NP_001185979.1	Q68G75	LEMD1_HUMAN	LEM domain containing 1	97						integral component of membrane (GO:0016021)				breast(1)|lung(2)	3	Breast(84;0.247)		BRCA - Breast invasive adenocarcinoma(75;0.0938)			CTTTGCGTTTAGTGGTGGAAG	0.338																																					p.T97T		Atlas-SNP	.											.	LEMD1	21	.	0			c.T291A						.																																			SO:0001819	synonymous_variant	93273	exon5			GCGTTTAGTGGTG		CCDS30986.1, CCDS55677.1, CCDS55678.1, CCDS55679.1	1q32.1	2009-03-25			ENSG00000186007	ENSG00000186007			18725	protein-coding gene	gene with protein product	"""cancer/testis antigen 50"""	610480				15254688	Standard	NM_001199050		Approved	LEMP-1, CT50	uc001hcj.2	Q68G75	OTTHUMG00000037201	ENST00000367153.4:c.291T>A	chr1.hg19:g.205353472A>T		94.0	0.0		192.0	31.0	NM_001199050	Q6L9T9|Q6L9U0|Q6L9U1|Q6L9U2|Q6L9U3|Q6L9U4	Silent	SNP	ENST00000367153.4	hg19	CCDS55679.1																																																																																			.	.		0.338	LEMD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090401.1	NM_001001552	
SLC26A9	115019	hgsc.bcm.edu	37	1	205898402	205898402	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:205898402A>T	ENST00000367135.3	-	7	913	c.800T>A	c.(799-801)gTg>gAg	p.V267E	SLC26A9_ENST00000367134.2_Missense_Mutation_p.V267E|SLC26A9_ENST00000340781.4_Missense_Mutation_p.V267E	NM_052934.3	NP_443166.1	Q7LBE3	S26A9_HUMAN	solute carrier family 26 (anion exchanger), member 9	267					anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|positive regulation of gene expression (GO:0010628)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	anion:anion antiporter activity (GO:0015301)|ATPase binding (GO:0051117)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride channel activity (GO:0005254)|secondary active sulfate transmembrane transporter activity (GO:0008271)			NS(1)|breast(3)|endometrium(11)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|skin(7)|urinary_tract(5)	52	Breast(84;0.201)		BRCA - Breast invasive adenocarcinoma(75;0.0458)			CTTCACCAGCACCAGGAAGGC	0.522																																					p.V267E		Atlas-SNP	.											.	SLC26A9	176	.	0			c.T800A						.						191.0	177.0	182.0					1																	205898402		2203	4300	6503	SO:0001583	missense	115019	exon7			ACCAGCACCAGGA	AF331525	CCDS30989.1, CCDS30990.1	1q32.1	2013-07-18	2013-07-18		ENSG00000174502	ENSG00000174502		"""Solute carriers"""	14469	protein-coding gene	gene with protein product	"""anion transporter/exchanger-9"""	608481	"""solute carrier family 26, member 9"""			11834742	Standard	NM_134325		Approved		uc001hdp.3	Q7LBE3	OTTHUMG00000036001	ENST00000367135.3:c.800T>A	chr1.hg19:g.205898402A>T	ENSP00000356103:p.Val267Glu	134.0	0.0		222.0	130.0	NM_134325	A7E2V6|B1AVM8|B1AVM9|B7ZKK2|Q96PK9|Q96RN0	Missense_Mutation	SNP	ENST00000367135.3	hg19	CCDS30990.1	.	.	.	.	.	.	.	.	.	.	A	15.87	2.960497	0.53400	.	.	ENSG00000174502	ENST00000340781;ENST00000367135;ENST00000367134	D;D;D	0.93247	-3.19;-3.19;-3.19	5.6	4.45	0.53987	Sulphate transporter (1);	0.157726	0.38605	N	0.001634	D	0.92773	0.7702	M	0.69823	2.125	0.38878	D	0.956832	P;P	0.43542	0.627;0.81	B;B	0.44224	0.327;0.444	D	0.92227	0.5789	10	0.59425	D	0.04	.	11.3861	0.49787	0.9275:0.0:0.0725:0.0	.	267;267	Q7LBE3;B1AVM8	S26A9_HUMAN;.	E	267	ENSP00000341682:V267E;ENSP00000356103:V267E;ENSP00000356102:V267E	ENSP00000341682:V267E	V	-	2	0	SLC26A9	204165025	1.000000	0.71417	0.994000	0.49952	0.525000	0.34531	6.072000	0.71238	0.914000	0.36822	0.459000	0.35465	GTG	.	.		0.522	SLC26A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087742.1	NM_052934	
CR1	1378	hgsc.bcm.edu	37	1	207753643	207753643	+	Missense_Mutation	SNP	C	C	G	rs141954836	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:207753643C>G	ENST00000367049.4	+	30	4995	c.4995C>G	c.(4993-4995)aaC>aaG	p.N1665K	CR1_ENST00000400960.2_Missense_Mutation_p.N1215K|CR1_ENST00000367051.1_Missense_Mutation_p.N1215K|CR1_ENST00000367052.1_Missense_Mutation_p.N1215K|CR1_ENST00000367053.1_Missense_Mutation_p.N1215K|RP11-78B10.2_ENST00000596003.1_RNA|RP11-78B10.2_ENST00000597497.1_RNA	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	1215	Sushi 26. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						ATCAGGACAACTTTTCACCTG	0.562																																					p.N1665K		Atlas-SNP	.											.	CR1	354	.	0			c.C4995G						.						128.0	130.0	129.0					1																	207753643		1975	4168	6143	SO:0001583	missense	1378	exon30			GGACAACTTTTCA	Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.4995C>G	chr1.hg19:g.207753643C>G	ENSP00000356016:p.Asn1665Lys	152.0	0.0		268.0	36.0	NM_000651	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	ENST00000367049.4	hg19	CCDS44308.1	.	.	.	.	.	.	.	.	.	.	C	2.842	-0.240298	0.05944	.	.	ENSG00000203710	ENST00000367052;ENST00000367051;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049	T;T;T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11;-0.11;-0.11	4.34	-2.85	0.05734	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.35480	0.0933	L	0.28014	0.82	0.09310	N	1	B;B;B	0.15141	0.012;0.0;0.001	B;B;B	0.19946	0.027;0.001;0.003	T	0.28902	-1.0029	9	0.07175	T	0.84	.	0.6283	0.00789	0.2643:0.3355:0.1299:0.2703	.	1215;1215;1665	Q5SR44;P17927;E9PDY4	.;CR1_HUMAN;.	K	1215;1215;1215;1215;765;1665	ENSP00000356019:N1215K;ENSP00000356018:N1215K;ENSP00000356020:N1215K;ENSP00000383744:N1215K;ENSP00000436139:N765K;ENSP00000356016:N1665K	ENSP00000356016:N1665K	N	+	3	2	CR1	205820266	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	-0.014000	0.12656	-0.504000	0.06577	-2.454000	0.00207	AAC	.	C|0.999;A|0.001		0.562	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382527.1	NM_000573	
VASH2	79805	hgsc.bcm.edu	37	1	213146157	213146157	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:213146157A>G	ENST00000517399.1	+	5	733	c.733A>G	c.(733-735)Aag>Gag	p.K245E	VASH2_ENST00000366967.2_Missense_Mutation_p.K141E|VASH2_ENST00000366965.2_Missense_Mutation_p.K201E|VASH2_ENST00000271776.4_3'UTR|VASH2_ENST00000366966.2_Missense_Mutation_p.K180E|VASH2_ENST00000366968.4_Missense_Mutation_p.K180E|VASH2_ENST00000366964.3_Missense_Mutation_p.K103E			Q86V25	VASH2_HUMAN	vasohibin 2	245					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)	cytoplasm (GO:0005737)				endometrium(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(81;0.00479)|all cancers(67;0.00844)|GBM - Glioblastoma multiforme(131;0.0496)|Epithelial(68;0.0986)		CACAGTCAAGAAGGTCAAGAT	0.507																																					p.K201E		Atlas-SNP	.											.	VASH2	55	.	0			c.A601G						.						119.0	105.0	110.0					1																	213146157		2203	4300	6503	SO:0001583	missense	79805	exon4			GTCAAGAAGGTCA	AK022567	CCDS1511.1, CCDS44315.1, CCDS44316.1, CCDS73026.1	1q23	2008-02-05			ENSG00000143494	ENSG00000143494			25723	protein-coding gene	gene with protein product		610471				16528006	Standard	XR_247041		Approved	FLJ12505	uc001hjw.3	Q86V25	OTTHUMG00000036925	ENST00000517399.1:c.733A>G	chr1.hg19:g.213146157A>G	ENSP00000428324:p.Lys245Glu	99.0	0.0		142.0	10.0	NM_024749	B4DYZ5|Q2VT46|Q5VTE7|Q5VTE9|Q7Z6E3|Q8IZ24|Q9H9W5	Missense_Mutation	SNP	ENST00000517399.1	hg19	CCDS1511.1	.	.	.	.	.	.	.	.	.	.	A	16.40	3.112809	0.56398	.	.	ENSG00000143494	ENST00000366966;ENST00000366964;ENST00000366968;ENST00000366965;ENST00000366967;ENST00000517399	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.73481	0.3592	L	0.58583	1.82	0.52501	D	0.999956	B;D	0.64830	0.031;0.994	B;P	0.61397	0.028;0.888	T	0.75479	-0.3303	9	0.54805	T	0.06	-14.3872	15.4812	0.75528	1.0:0.0:0.0:0.0	.	245;201	Q86V25;Q86V25-5	VASH2_HUMAN;.	E	180;103;180;201;141;245	.	ENSP00000355931:K103E	K	+	1	0	VASH2	211212780	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.893000	0.75649	2.118000	0.64928	0.533000	0.62120	AAG	.	.		0.507	VASH2-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381686.1	NM_024749	
KCNK2	3776	hgsc.bcm.edu	37	1	215408460	215408460	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:215408460A>G	ENST00000444842.2	+	7	1403	c.1253A>G	c.(1252-1254)gAg>gGg	p.E418G	KCNK2_ENST00000391895.2_Missense_Mutation_p.E414G|KCNK2_ENST00000391894.2_Missense_Mutation_p.E403G	NM_001017425.2|NM_014217.3	NP_001017425.2|NP_055032.1	O95069	KCNK2_HUMAN	potassium channel, subfamily K, member 2	418	Essential for chloroform and halothane sensitivity. {ECO:0000250}.|Required for basal channel activity. {ECO:0000250}.				G-protein coupled receptor signaling pathway (GO:0007186)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|potassium ion leak channel activity (GO:0022841)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|upper_aerodigestive_tract(1)	30				OV - Ovarian serous cystadenocarcinoma(81;0.0399)|all cancers(67;0.0556)|GBM - Glioblastoma multiforme(131;0.068)	Dofetilide(DB00204)|Dronedarone(DB04855)	GCTGGTGAAGAGATTGCTGTG	0.458																																					p.E418G		Atlas-SNP	.											.	KCNK2	135	.	0			c.A1253G						.						147.0	143.0	144.0					1																	215408460		2203	4300	6503	SO:0001583	missense	3776	exon7			GTGAAGAGATTGC	AF004711	CCDS31024.1, CCDS41466.1, CCDS41467.1	1q41	2012-03-07			ENSG00000082482	ENSG00000082482		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6277	protein-coding gene	gene with protein product		603219				9721223, 16382106	Standard	NM_001017424		Approved	K2p2.1, TREK-1	uc001hkr.4	O95069	OTTHUMG00000037017	ENST00000444842.2:c.1253A>G	chr1.hg19:g.215408460A>G	ENSP00000394033:p.Glu418Gly	42.0	0.0		76.0	6.0	NM_001017425	A1Z1V3|A8K618|B2RCS4|B7ZL56|D3DTA5|Q5DP47|Q5DP48|Q9NRT2|Q9UNE3	Missense_Mutation	SNP	ENST00000444842.2	hg19	CCDS41467.1	.	.	.	.	.	.	.	.	.	.	A	17.06	3.293107	0.60086	.	.	ENSG00000082482	ENST00000391895;ENST00000391894;ENST00000444842	T;T;T	0.25250	1.81;1.83;1.81	5.63	5.63	0.86233	.	0.567905	0.19602	N	0.110374	T	0.18718	0.0449	N	0.24115	0.695	0.58432	D	0.999998	B;P;B	0.37525	0.447;0.598;0.447	B;B;B	0.30646	0.118;0.099;0.118	T	0.04946	-1.0916	10	0.87932	D	0	.	15.8309	0.78749	1.0:0.0:0.0:0.0	.	403;418;414	O95069-2;O95069;O95069-3	.;KCNK2_HUMAN;.	G	414;403;418	ENSP00000375765:E414G;ENSP00000375764:E403G;ENSP00000394033:E418G	ENSP00000375764:E403G	E	+	2	0	KCNK2	213475083	1.000000	0.71417	0.986000	0.45419	0.989000	0.77384	8.901000	0.92560	2.149000	0.67028	0.402000	0.26972	GAG	.	.		0.458	KCNK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089856.2	NM_014217	
BPNT1	10380	hgsc.bcm.edu	37	1	220253130	220253130	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:220253130T>A	ENST00000469520.2	-	3	508	c.59A>T	c.(58-60)cAa>cTa	p.Q20L	BPNT1_ENST00000482136.1_Intron|BPNT1_ENST00000354807.3_Missense_Mutation_p.Q20L|BPNT1_ENST00000414869.2_Missense_Mutation_p.Q20L|BPNT1_ENST00000322067.7_Missense_Mutation_p.Q20L|BPNT1_ENST00000544404.1_Intron			O95861	BPNT1_HUMAN	3'(2'), 5'-bisphosphate nucleotidase 1	20					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|dephosphorylation (GO:0016311)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|phosphatidylinositol phosphorylation (GO:0046854)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	3'(2'),5'-bisphosphate nucleotidase activity (GO:0008441)|inositol-1,4-bisphosphate 1-phosphatase activity (GO:0004441)|magnesium ion binding (GO:0000287)			breast(1)|endometrium(1)|large_intestine(1)|lung(9)|ovary(1)|skin(1)	14				GBM - Glioblastoma multiforme(131;0.0558)		TCCTGCCTTTTGAGCAATAGA	0.403																																					p.Q20L		Atlas-SNP	.											.	BPNT1	29	.	0			c.A59T						.						131.0	118.0	122.0					1																	220253130		1929	4129	6058	SO:0001583	missense	10380	exon2			GCCTTTTGAGCAA	AF125042	CCDS41469.1, CCDS65787.1, CCDS65788.1	1q42	2008-02-05			ENSG00000162813	ENSG00000162813	3.1.3.7		1096	protein-coding gene	gene with protein product		604053				10224133	Standard	XM_005272998		Approved		uc001hma.3	O95861	OTTHUMG00000037435	ENST00000469520.2:c.59A>T	chr1.hg19:g.220253130T>A	ENSP00000446828:p.Gln20Leu	132.0	0.0		240.0	21.0	NM_006085	A8K7C8|B4DPS5|B4DUS9|D3DTA9|Q8WVL5|Q9UGJ3	Missense_Mutation	SNP	ENST00000469520.2	hg19	CCDS41469.1	.	.	.	.	.	.	.	.	.	.	T	16.08	3.020929	0.54576	.	.	ENSG00000162813	ENST00000322067;ENST00000469520;ENST00000354807;ENST00000302686;ENST00000414869;ENST00000463953;ENST00000498791;ENST00000498237	T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.51	5.51	0.81932	.	0.155025	0.53938	D	0.000044	T	0.34048	0.0884	N	0.25647	0.755	0.80722	D	1	B;P;B	0.35944	0.021;0.529;0.078	B;B;B	0.29524	0.103;0.069;0.089	T	0.22103	-1.0226	10	0.48119	T	0.1	.	14.6341	0.68676	0.0:0.0:0.0:1.0	.	20;20;20	B4DUS9;A6NF51;O95861	.;.;BPNT1_HUMAN	L	20	ENSP00000318852:Q20L;ENSP00000446828:Q20L;ENSP00000346862:Q20L;ENSP00000410348:Q20L;ENSP00000446953:Q20L;ENSP00000446850:Q20L;ENSP00000449883:Q20L	ENSP00000307087:Q20L	Q	-	2	0	BPNT1	218319753	0.988000	0.35896	0.990000	0.47175	0.994000	0.84299	3.449000	0.52950	2.112000	0.64535	0.472000	0.43445	CAA	.	.		0.403	BPNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091137.2	NM_006085	
MIA3	375056	hgsc.bcm.edu	37	1	222801852	222801852	+	Silent	SNP	A	A	T	rs375042330		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:222801852A>T	ENST00000344922.5	+	4	1315	c.1290A>T	c.(1288-1290)tcA>tcT	p.S430S	MIA3_ENST00000344441.6_Silent_p.S430S|MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Silent_p.S430S	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	430					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		AACCACAGTCAGCAACAGATT	0.378																																					p.S430S		Atlas-SNP	.											.	MIA3	167	.	0			c.A1290T						.						122.0	117.0	119.0					1																	222801852		1927	4129	6056	SO:0001819	synonymous_variant	375056	exon4			ACAGTCAGCAACA		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.1290A>T	chr1.hg19:g.222801852A>T		298.0	0.0		578.0	78.0	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Silent	SNP	ENST00000344922.5	hg19	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	A	11.15	1.555053	0.27739	.	.	ENSG00000154305	ENST00000354906	T	0.20069	2.1	4.52	2.07	0.26955	.	.	.	.	.	T	0.26340	0.0643	.	.	.	0.36132	D	0.846227	.	.	.	.	.	.	T	0.17167	-1.0378	6	0.51188	T	0.08	.	6.6651	0.23037	0.7613:0.1548:0.0839:0.0	.	.	.	.	C	13	ENSP00000355062:S13C	ENSP00000355062:S13C	S	+	1	0	MIA3	220868475	0.000000	0.05858	0.005000	0.12908	0.649000	0.38597	0.735000	0.26115	0.292000	0.22492	0.254000	0.18369	AGC	.	.		0.378	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
WNT3A	89780	hgsc.bcm.edu	37	1	228246857	228246857	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:228246857C>T	ENST00000284523.1	+	4	828	c.750C>T	c.(748-750)cgC>cgT	p.R250R	WNT3A_ENST00000366753.2_Silent_p.R250R	NM_033131.3	NP_149122.1	P56704	WNT3A_HUMAN	wingless-type MMTV integration site family, member 3A	250					axis elongation involved in somitogenesis (GO:0090245)|axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac muscle cell fate commitment (GO:0061317)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cellular response to retinoic acid (GO:0071300)|COP9 signalosome assembly (GO:0010387)|dorsal/ventral neural tube patterning (GO:0021904)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hemopoiesis (GO:0030097)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|mammary gland development (GO:0030879)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron projection development (GO:0010977)|neuron differentiation (GO:0030182)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesodermal cell fate commitment (GO:0048343)|platelet aggregation (GO:0070527)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of canonical Wnt signaling pathway involved in controlling type B pancreatic cell proliferation (GO:2000081)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of collateral sprouting in absence of injury (GO:0048697)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dermatome development (GO:0061184)|positive regulation of mesodermal cell fate specification (GO:0048337)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of receptor internalization (GO:0002092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|regulation of microtubule cytoskeleton organization (GO:0070507)|skeletal muscle cell differentiation (GO:0035914)|spinal cord association neuron differentiation (GO:0021527)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)	cell surface (GO:0009986)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)|transcription coactivator activity (GO:0003713)			kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		Prostate(94;0.0405)				GGGAGTCCCGCGGCTGGGTGG	0.657																																					p.R250R		Atlas-SNP	.											.	WNT3A	40	.	0			c.C750T						.						47.0	50.0	49.0					1																	228246857		2203	4300	6503	SO:0001819	synonymous_variant	89780	exon4			GTCCCGCGGCTGG	AB060284	CCDS1564.1	1q42	2013-02-28			ENSG00000154342	ENSG00000154342		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	15983	protein-coding gene	gene with protein product		606359				11414706	Standard	NM_033131		Approved		uc001hrq.2	P56704	OTTHUMG00000037593	ENST00000284523.1:c.750C>T	chr1.hg19:g.228246857C>T		117.0	0.0		187.0	17.0	NM_033131	Q3SY79|Q3SY80|Q969P2	Silent	SNP	ENST00000284523.1	hg19	CCDS1564.1																																																																																			.	.		0.657	WNT3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000091648.1	NM_033131	
GJC2	57165	hgsc.bcm.edu	37	1	228345591	228345591	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:228345591G>C	ENST00000366714.2	+	2	307	c.132G>C	c.(130-132)gaG>gaC	p.E44D		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	44					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				TGGGCGGCGAGGCCATCTACT	0.647																																					p.E44D		Atlas-SNP	.											.	GJC2	20	.	0			c.G132C						.						69.0	49.0	56.0					1																	228345591		2203	4300	6503	SO:0001583	missense	57165	exon2			CGGCGAGGCCATC	AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.132G>C	chr1.hg19:g.228345591G>C	ENSP00000355675:p.Glu44Asp	255.0	0.0		434.0	53.0	NM_020435	O43440|Q7Z7J2|Q8IWJ9	Missense_Mutation	SNP	ENST00000366714.2	hg19	CCDS1569.1	.	.	.	.	.	.	.	.	.	.	G	13.64	2.297074	0.40694	.	.	ENSG00000198835	ENST00000366714	D	0.99239	-5.61	4.06	3.14	0.36123	Connexin, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99017	0.9664	L	0.61387	1.9	0.48511	D	0.999663	D	0.71674	0.998	D	0.76575	0.988	D	0.99257	1.0889	10	0.72032	D	0.01	.	10.1024	0.42513	0.1715:0.0:0.8285:0.0	.	44	Q5T442	CXG2_HUMAN	D	44	ENSP00000355675:E44D	ENSP00000355675:E44D	E	+	3	2	GJC2	226412214	1.000000	0.71417	0.995000	0.50966	0.623000	0.37688	3.757000	0.55212	0.929000	0.37192	0.313000	0.20887	GAG	.	.		0.647	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095985.1	NM_020435	
OBSCN	84033	hgsc.bcm.edu	37	1	228521428	228521428	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:228521428A>T	ENST00000422127.1	+	59	16045	c.16001A>T	c.(16000-16002)tAt>tTt	p.Y5334F	OBSCN_ENST00000366707.4_Missense_Mutation_p.Y2968F|OBSCN_ENST00000570156.2_Missense_Mutation_p.Y6291F|OBSCN_ENST00000284548.11_Missense_Mutation_p.Y5334F|OBSCN_ENST00000366709.4_Missense_Mutation_p.Y2453F	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5334	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				TATGCAGCCTATATCAGCAAT	0.617																																					p.Y6291F		Atlas-SNP	.											.	OBSCN	2142	.	0			c.A18872T						.						39.0	43.0	42.0					1																	228521428		2038	4195	6233	SO:0001583	missense	84033	exon70			CAGCCTATATCAG	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.16001A>T	chr1.hg19:g.228521428A>T	ENSP00000409493:p.Tyr5334Phe	89.0	0.0		127.0	17.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	A	12.86	2.065667	0.36470	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23	5.62	3.26	0.37387	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.081740	0.50627	D	0.000101	T	0.39911	0.1096	N	0.08118	0	0.30604	N	0.760253	B;B	0.25048	0.117;0.096	B;B	0.29524	0.103;0.062	T	0.33599	-0.9862	10	0.11182	T	0.66	.	5.9489	0.19234	0.6156:0.0:0.0736:0.3107	.	5334;5334	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	F	5334;5334;2968;2453	ENSP00000284548:Y5334F;ENSP00000409493:Y5334F;ENSP00000355668:Y2968F;ENSP00000355670:Y2453F	ENSP00000284548:Y5334F	Y	+	2	0	OBSCN	226588051	1.000000	0.71417	0.844000	0.33320	0.004000	0.04260	4.646000	0.61411	0.395000	0.25257	-0.250000	0.11733	TAT	.	.		0.617	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
OBSCN	84033	hgsc.bcm.edu	37	1	228552712	228552712	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:228552712T>A	ENST00000422127.1	+	81	18916	c.18872T>A	c.(18871-18873)cTc>cAc	p.L6291H	OBSCN_ENST00000366707.4_Missense_Mutation_p.L3925H|OBSCN_ENST00000570156.2_Missense_Mutation_p.L7248H	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6291					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CAGCCCCTCCTCCACGAAGGC	0.662																																					p.L7248H		Atlas-SNP	.											.	OBSCN	2142	.	0			c.T21743A						.						15.0	22.0	20.0					1																	228552712		2064	4185	6249	SO:0001583	missense	84033	exon92			CCCTCCTCCACGA	AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.18872T>A	chr1.hg19:g.228552712T>A	ENSP00000409493:p.Leu6291His	321.0	0.0		574.0	70.0	NM_001271223	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	ENST00000422127.1	hg19	CCDS58065.1	.	.	.	.	.	.	.	.	.	.	T	13.22	2.170768	0.38315	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.61392	0.11;0.12	3.51	0.168	0.15012	.	.	.	.	.	T	0.28167	0.0695	N	0.08118	0	0.09310	N	1	P	0.42785	0.79	B	0.37550	0.253	T	0.10776	-1.0615	9	0.27082	T	0.32	.	3.1674	0.06540	0.0:0.4915:0.2269:0.2816	.	6291	Q5VST9	OBSCN_HUMAN	H	6291;3925	ENSP00000409493:L6291H;ENSP00000355668:L3925H	ENSP00000355668:L3925H	L	+	2	0	OBSCN	226619335	0.000000	0.05858	0.003000	0.11579	0.053000	0.15095	0.606000	0.24194	0.287000	0.22375	-0.415000	0.06103	CTC	.	.		0.662	OBSCN-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_052843	
TRIM67	440730	hgsc.bcm.edu	37	1	231299389	231299389	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:231299389A>T	ENST00000366653.5	+	1	674	c.674A>T	c.(673-675)cAg>cTg	p.Q225L	TRIM67_ENST00000366652.2_Missense_Mutation_p.Q225L|TRIM67_ENST00000444294.3_Missense_Mutation_p.Q225L|TRIM67_ENST00000449018.3_Missense_Mutation_p.Q185L			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	225					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				CTCTGCGAGCAGTGCGACGTC	0.741																																					p.Q225L		Atlas-SNP	.											.	TRIM67	160	.	0			c.A674T						.						5.0	7.0	7.0					1																	231299389		1571	2918	4489	SO:0001583	missense	440730	exon1			GCGAGCAGTGCGA	AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.674A>T	chr1.hg19:g.231299389A>T	ENSP00000355613:p.Gln225Leu	39.0	0.0		68.0	10.0	NM_001004342	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	ENST00000366653.5	hg19	CCDS44333.1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.198485	0.79015	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.73152	-0.72;-0.63;-0.57;-0.72	4.37	4.37	0.52481	Zinc finger, B-box (2);	0.201896	0.43579	N	0.000543	D	0.82291	0.5005	M	0.70842	2.15	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.84604	0.0674	10	0.72032	D	0.01	.	13.7092	0.62659	1.0:0.0:0.0:0.0	.	225	Q6ZTA4	TRI67_HUMAN	L	225;225;185;225	ENSP00000412124:Q225L;ENSP00000355612:Q225L;ENSP00000400163:Q185L;ENSP00000355613:Q225L	ENSP00000355612:Q225L	Q	+	2	0	TRIM67	229366012	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.613000	0.74192	1.824000	0.53156	0.402000	0.26972	CAG	.	.		0.741	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000092649.3	NM_001004342	
RYR2	6262	hgsc.bcm.edu	37	1	237551411	237551411	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:237551411T>A	ENST00000366574.2	+	10	1018	c.701T>A	c.(700-702)cTc>cAc	p.L234H	RYR2_ENST00000542537.1_Missense_Mutation_p.L218H|RYR2_ENST00000360064.6_Missense_Mutation_p.L232H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	234	MIR 3. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GGTGATGTCCTCAGGTTGCTG	0.488																																					p.L234H		Atlas-SNP	.											.	RYR2	1273	.	0			c.T701A						.						123.0	119.0	120.0					1																	237551411		2035	4194	6229	SO:0001583	missense	6262	exon10			ATGTCCTCAGGTT	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.701T>A	chr1.hg19:g.237551411T>A	ENSP00000355533:p.Leu234His	80.0	0.0		153.0	18.0	NM_001035	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.370754	0.61624	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.92446	-3.04;-3.04;-3.04	5.33	5.33	0.75918	MIR motif (2);MIR (2);	0.000000	0.52532	D	0.000065	D	0.95714	0.8606	M	0.83483	2.645	0.80722	D	1	D	0.67145	0.996	D	0.68192	0.956	D	0.96151	0.9108	10	0.87932	D	0	.	12.8175	0.57673	0.0:0.0:0.0:1.0	.	234	Q92736	RYR2_HUMAN	H	234;232;218	ENSP00000355533:L234H;ENSP00000353174:L232H;ENSP00000443798:L218H	ENSP00000353174:L232H	L	+	2	0	RYR2	235618034	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.860000	0.75473	2.021000	0.59480	0.528000	0.53228	CTC	.	.		0.488	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
RYR2	6262	hgsc.bcm.edu	37	1	237823356	237823356	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:237823356T>A	ENST00000366574.2	+	55	8597	c.8280T>A	c.(8278-8280)taT>taA	p.Y2760*	RYR2_ENST00000542537.1_Nonsense_Mutation_p.Y2744*|RYR2_ENST00000360064.6_Nonsense_Mutation_p.Y2758*	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2760	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGAAGCCATATAAGCTATTGT	0.254																																					p.Y2760X		Atlas-SNP	.											.	RYR2	1273	.	0			c.T8280A						.						51.0	48.0	49.0					1																	237823356		1792	4057	5849	SO:0001587	stop_gained	6262	exon55			GCCATATAAGCTA	X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8280T>A	chr1.hg19:g.237823356T>A	ENSP00000355533:p.Tyr2760*	90.0	0.0		173.0	21.0	NM_001035	Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	ENST00000366574.2	hg19	CCDS55691.1	.	.	.	.	.	.	.	.	.	.	T	49	14.973841	0.99817	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	.	.	.	5.09	2.77	0.32553	.	0.000000	0.53938	U	0.000043	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.8315	0.29344	0.0:0.2278:0.0:0.7722	.	.	.	.	X	2760;2758;2744	.	ENSP00000353174:Y2758X	Y	+	3	2	RYR2	235889979	1.000000	0.71417	0.998000	0.56505	0.575000	0.36095	0.699000	0.25586	0.893000	0.36288	-0.541000	0.04245	TAT	.	.		0.254	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095402.2	NM_001035	
WDR64	128025	hgsc.bcm.edu	37	1	241904820	241904820	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:241904820T>A	ENST00000366552.2	+	11	1501	c.1294T>A	c.(1294-1296)Tct>Act	p.S432T	WDR64_ENST00000437684.2_Missense_Mutation_p.S432T	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64	432										breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TGTTCCAGGATCTAGTGTTAT	0.373																																					p.S432T		Atlas-SNP	.											.	WDR64	234	.	0			c.T1294A						.						111.0	103.0	105.0					1																	241904820		2203	4300	6503	SO:0001583	missense	128025	exon11			CCAGGATCTAGTG	AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.1294T>A	chr1.hg19:g.241904820T>A	ENSP00000355510:p.Ser432Thr	66.0	0.0		120.0	26.0	NM_144625	B1ANT0|Q7Z573|Q96LY9	Missense_Mutation	SNP	ENST00000366552.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.80	2.643106	0.47153	.	.	ENSG00000162843	ENST00000366552;ENST00000437684;ENST00000414635	T;T;T	0.51574	1.25;0.7;0.76	5.49	5.49	0.81192	.	0.398691	0.24445	N	0.038466	T	0.56848	0.2013	L	0.35644	1.08	0.35442	D	0.794979	D	0.63880	0.993	D	0.70935	0.971	T	0.64132	-0.6479	10	0.36615	T	0.2	-6.6	13.1105	0.59270	0.0:0.0:0.0:1.0	.	152	D1MPS4	.	T	432;432;203	ENSP00000355510:S432T;ENSP00000402446:S432T;ENSP00000406656:S203T	ENSP00000355510:S432T	S	+	1	0	WDR64	239971443	1.000000	0.71417	0.999000	0.59377	0.623000	0.37688	4.795000	0.62489	2.089000	0.63090	0.533000	0.62120	TCT	.	.		0.373	WDR64-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_144625	
OR2L2	26246	hgsc.bcm.edu	37	1	248202345	248202345	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:248202345T>A	ENST00000366479.2	+	1	872	c.776T>A	c.(775-777)gTa>gAa	p.V259E	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	259			V -> L (in dbSNP:rs6658141).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TATACCTATGTACGTCCAAGA	0.502																																					p.V259E		Atlas-SNP	.											.	OR2L2	115	.	0			c.T776A						.						156.0	140.0	145.0					1																	248202345		2203	4300	6503	SO:0001583	missense	26246	exon1			CCTATGTACGTCC	X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.776T>A	chr1.hg19:g.248202345T>A	ENSP00000355435:p.Val259Glu	90.0	0.0		187.0	25.0	NM_001004686	Q2M3T5	Missense_Mutation	SNP	ENST00000366479.2	hg19	CCDS31103.1	.	.	.	.	.	.	.	.	.	.	.	9.741	1.164794	0.21538	.	.	ENSG00000203663	ENST00000366479	T	0.39056	1.1	1.9	1.9	0.25705	GPCR, rhodopsin-like superfamily (1);	0.000000	0.26055	U	0.026610	T	0.57154	0.2034	H	0.94808	3.585	0.09310	N	1	B	0.24258	0.1	B	0.36092	0.217	T	0.59418	-0.7458	10	0.87932	D	0	.	9.0367	0.36291	0.0:0.0:0.0:1.0	.	259	Q8NH16	OR2L2_HUMAN	E	259	ENSP00000355435:V259E	ENSP00000355435:V259E	V	+	2	0	OR2L2	246268968	0.000000	0.05858	0.006000	0.13384	0.132000	0.20833	0.119000	0.15626	0.746000	0.32786	0.163000	0.16589	GTA	.	.		0.502	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096871.1	NM_001004686	
OR2M7	391196	hgsc.bcm.edu	37	1	248487043	248487043	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:248487043T>C	ENST00000317965.2	-	1	856	c.828A>G	c.(826-828)gtA>gtG	p.V276V		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	276						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TGGTGTAGAATACAGACACCA	0.458																																					p.V276V		Atlas-SNP	.											.	OR2M7	84	.	0			c.A828G						.						126.0	115.0	119.0					1																	248487043		2203	4300	6503	SO:0001819	synonymous_variant	391196	exon1			GTAGAATACAGAC	BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.828A>G	chr1.hg19:g.248487043T>C		147.0	0.0		267.0	35.0	NM_001004691	B2RNL0|Q6IEX6	Silent	SNP	ENST00000317965.2	hg19	CCDS31111.1																																																																																			.	.		0.458	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097357.1	NM_001004691	
OR14I1	401994	hgsc.bcm.edu	37	1	248845007	248845007	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:248845007A>T	ENST00000342623.3	-	1	622	c.599T>A	c.(598-600)cTg>cAg	p.L200Q		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						GCATGAGCTCAGGGCCAGGGT	0.483																																					p.L200Q		Atlas-SNP	.											.	OR14I1	64	.	0			c.T599A						.						79.0	86.0	84.0					1																	248845007		2203	4300	6503	SO:0001583	missense	401994	exon1			GAGCTCAGGGCCA		CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.599T>A	chr1.hg19:g.248845007A>T	ENSP00000339726:p.Leu200Gln	158.0	0.0		274.0	31.0	NM_001004734		Missense_Mutation	SNP	ENST00000342623.3	hg19	CCDS31125.1	.	.	.	.	.	.	.	.	.	.	.	17.36	3.368898	0.61624	.	.	ENSG00000189181	ENST00000342623	T	0.00198	8.57	3.3	3.3	0.37823	GPCR, rhodopsin-like superfamily (1);	0.862603	0.09406	N	0.806538	T	0.00552	0.0018	M	0.84219	2.685	0.09310	N	1	D	0.54964	0.969	D	0.66497	0.944	T	0.52064	-0.8625	10	0.54805	T	0.06	.	9.6218	0.39725	1.0:0.0:0.0:0.0	.	200	A6ND48	O14I1_HUMAN	Q	200	ENSP00000339726:L200Q	ENSP00000339726:L200Q	L	-	2	0	OR14I1	246911630	0.000000	0.05858	0.001000	0.08648	0.791000	0.44710	0.700000	0.25601	1.337000	0.45525	0.443000	0.29094	CTG	.	.		0.483	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097128.1	NM_001004734	
TSSC1	7260	hgsc.bcm.edu	37	2	3358335	3358335	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:3358335T>A	ENST00000382125.4	-	2	304	c.112A>T	c.(112-114)Aaa>Taa	p.K38*	TSSC1_ENST00000398659.4_Nonsense_Mutation_p.K38*|TSSC1_ENST00000443925.2_Nonsense_Mutation_p.K38*	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1	38										breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		TTATCATATTTAAGAGACTGC	0.373																																					p.K38X	Colon(140;1261 1762 4183 34270 49743)	Atlas-SNP	.											.	TSSC1	39	.	0			c.A112T						.						78.0	77.0	78.0					2																	3358335		2203	4300	6503	SO:0001587	stop_gained	7260	exon2			CATATTTAAGAGA	AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.112A>T	chr2.hg19:g.3358335T>A	ENSP00000371559:p.Lys38*	273.0	0.0		209.0	59.0	NM_003310	D6W4Y1|O43179|Q53S19|Q53SG2	Nonsense_Mutation	SNP	ENST00000382125.4	hg19	CCDS1651.1	.	.	.	.	.	.	.	.	.	.	t	37	6.320514	0.97471	.	.	ENSG00000032389	ENST00000382125;ENST00000398659;ENST00000443925;ENST00000444776	.	.	.	4.33	4.33	0.51752	.	0.103470	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.8001	11.8125	0.52192	0.0:0.0:0.0:1.0	.	.	.	.	X	38	.	ENSP00000371559:K38X	K	-	1	0	TSSC1	3337342	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.304000	0.72800	1.957000	0.56846	0.456000	0.33151	AAA	.	.		0.373	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206694.2	NM_003310	
MATN3	4148	hgsc.bcm.edu	37	2	20212202	20212202	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:20212202C>T	ENST00000407540.3	-	1	253	c.191G>A	c.(190-192)gGg>gAg	p.G64E	MATN3_ENST00000421259.2_Missense_Mutation_p.G64E	NM_002381.4	NP_002372.1	O15232	MATN3_HUMAN	matrilin 3	64					extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(1)	13	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTCGCTGGTCCCGGAAGCGGG	0.771																																					p.G64E		Atlas-SNP	.											.	MATN3	28	.	0			c.G191A						.						1.0	1.0	1.0					2																	20212202		305	662	967	SO:0001583	missense	4148	exon1			CTGGTCCCGGAAG	AJ001047	CCDS46226.1	2p24-p23	2008-06-03			ENSG00000132031	ENSG00000132031			6909	protein-coding gene	gene with protein product		602109				9287130, 9350998	Standard	NM_002381		Approved	EDM5, HOA	uc002rdl.3	O15232	OTTHUMG00000151788	ENST00000407540.3:c.191G>A	chr2.hg19:g.20212202C>T	ENSP00000383894:p.Gly64Glu	227.0	0.0		176.0	116.0	NM_002381	B2CPU0|Q4ZG02	Missense_Mutation	SNP	ENST00000407540.3	hg19	CCDS46226.1	.	.	.	.	.	.	.	.	.	.	C	15.62	2.888132	0.52014	.	.	ENSG00000132031	ENST00000407540;ENST00000421259	T;T	0.77750	-0.8;-1.12	4.04	3.15	0.36227	.	0.448843	0.21207	N	0.078377	T	0.69691	0.3139	L	0.57536	1.79	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.002	T	0.56884	-0.7905	10	0.30078	T	0.28	-11.5057	7.7961	0.29148	0.0:0.8827:0.0:0.1173	.	64;64	B2CPU0;O15232	.;MATN3_HUMAN	E	64	ENSP00000383894:G64E;ENSP00000398753:G64E	ENSP00000383894:G64E	G	-	2	0	MATN3	20075683	0.000000	0.05858	0.038000	0.18304	0.007000	0.05969	0.511000	0.22739	1.028000	0.39785	-0.145000	0.13849	GGG	.	.		0.771	MATN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323925.1	NM_002381	
RHOB	388	hgsc.bcm.edu	37	2	20647467	20647467	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:20647467C>T	ENST00000272233.4	+	1	633	c.241C>T	c.(241-243)Ctc>Ttc	p.L81F		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	81					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	CGACGTCATTCTCATGTGCTT	0.647																																					p.L81F		Atlas-SNP	.											.	RHOB	18	.	0			c.C241T						.						86.0	99.0	94.0					2																	20647467		2203	4300	6503	SO:0001583	missense	388	exon1			GTCATTCTCATGT		CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.241C>T	chr2.hg19:g.20647467C>T	ENSP00000272233:p.Leu81Phe	166.0	0.0		151.0	36.0	NM_004040	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Missense_Mutation	SNP	ENST00000272233.4	hg19	CCDS1699.1	.	.	.	.	.	.	.	.	.	.	C	15.40	2.822364	0.50739	.	.	ENSG00000143878	ENST00000272233	D	0.82711	-1.64	5.06	4.18	0.49190	Small GTP-binding protein domain (1);	0.000000	0.64402	U	0.000002	D	0.89375	0.6697	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.90352	0.4367	10	0.87932	D	0	-15.1028	13.778	0.63066	0.0:0.9259:0.0:0.0741	.	81	P62745	RHOB_HUMAN	F	81	ENSP00000272233:L81F	ENSP00000272233:L81F	L	+	1	0	RHOB	20510948	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	7.668000	0.83897	1.281000	0.44480	-0.251000	0.11542	CTC	.	.		0.647	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207500.1	NM_004040	
ATRAID	51374	hgsc.bcm.edu	37	2	27438566	27438566	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:27438566A>T	ENST00000606999.1	+	5	490	c.432A>T	c.(430-432)atA>atT	p.I144I	ATRAID_ENST00000405489.3_Silent_p.I86I|CAD_ENST00000264705.4_5'Flank|ATRAID_ENST00000380171.3_Silent_p.I199I|CAD_ENST00000403525.1_5'Flank	NM_001170795.1	NP_001164266.1	Q6UW56	ARAID_HUMAN	all-trans retinoic acid-induced differentiation factor	144					cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)											CCTCTTATATAGACAACCAAA	0.423																																					p.I199I		Atlas-SNP	.											.	.	.	.	0			c.A597T						.						115.0	114.0	114.0					2																	27438566		2203	4300	6503	SO:0001819	synonymous_variant	51374	exon5			TTATATAGACAAC	BC021237	CCDS1741.1, CCDS46243.1, CCDS62877.1	2p23.3	2012-08-01	2012-07-30	2012-07-30	ENSG00000138085	ENSG00000138085			24090	protein-coding gene	gene with protein product	"""apoptosis-related protein 3"""		"""chromosome 2 open reading frame 28"""	C2orf28		17524364, 21723284	Standard	NM_016085		Approved	HSPC013, p18, APR3	uc002rjf.3	Q6UW56	OTTHUMG00000128405	ENST00000606999.1:c.432A>T	chr2.hg19:g.27438566A>T		172.0	0.0		138.0	42.0	NM_080592	A8C1S2|A8K779|Q96FF6|Q96RT2|Q9Y2R7|Q9Y5L7	Silent	SNP	ENST00000606999.1	hg19																																																																																				.	.		0.423	ATRAID-007	NOVEL	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000470709.1	NM_016085	
CAPN13	92291	hgsc.bcm.edu	37	2	30966407	30966407	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:30966407C>T	ENST00000295055.8	-	13	1463	c.1287G>A	c.(1285-1287)tcG>tcA	p.S429S	CAPN13_ENST00000534090.2_Silent_p.S429S	NM_144575.2	NP_653176.2	Q6MZZ7	CAN13_HUMAN	calpain 13	429					proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(1)	30	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.155)					TGTTTCTGAACGAGGAAAAAA	0.473																																					p.S429S		Atlas-SNP	.											.	CAPN13	70	.	0			c.G1287A						.						147.0	139.0	142.0					2																	30966407		1847	4088	5935	SO:0001819	synonymous_variant	92291	exon13			TCTGAACGAGGAA		CCDS46252.1	2p22-p21	2008-02-05			ENSG00000162949	ENSG00000162949			16663	protein-coding gene	gene with protein product		610228				11675017	Standard	NM_144575		Approved	FLJ23523	uc021vfm.1	Q6MZZ7	OTTHUMG00000152053	ENST00000295055.8:c.1287G>A	chr2.hg19:g.30966407C>T		99.0	0.0		91.0	25.0	NM_144575	Q17RF0|Q580X1|Q8TE80	Silent	SNP	ENST00000295055.8	hg19	CCDS46252.1																																																																																			.	.		0.473	CAPN13-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000325101.2	NM_144575	
XDH	7498	hgsc.bcm.edu	37	2	31606664	31606664	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:31606664T>A	ENST00000379416.3	-	10	891	c.843A>T	c.(841-843)ccA>ccT	p.P281P	XDH_ENST00000491727.1_5'UTR	NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	281	FAD-binding PCMH-type. {ECO:0000255|PROSITE-ProRule:PRU00718}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GGATCCAGGCTGGGCAGACAA	0.493																																					p.P281P	Colon(66;682 1445 30109 40147)	Atlas-SNP	.											.	XDH	191	.	0			c.A843T						.						124.0	107.0	113.0					2																	31606664		2203	4300	6503	SO:0001819	synonymous_variant	7498	exon10			CCAGGCTGGGCAG	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.843A>T	chr2.hg19:g.31606664T>A		98.0	0.0		85.0	32.0	NM_000379	Q16681|Q16712|Q4PJ16	Silent	SNP	ENST00000379416.3	hg19	CCDS1775.1																																																																																			.	.		0.493	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
BIRC6	57448	hgsc.bcm.edu	37	2	32661167	32661167	+	Silent	SNP	A	A	T	rs188040071		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:32661167A>T	ENST00000421745.2	+	15	3680	c.3546A>T	c.(3544-3546)ctA>ctT	p.L1182L		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	1182					apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AAGACATTCTATGTGGGCCAG	0.333																																					p.L1182L	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.A3546T						.						46.0	43.0	44.0					2																	32661167		2187	4284	6471	SO:0001819	synonymous_variant	57448	exon15			CATTCTATGTGGG	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.3546A>T	chr2.hg19:g.32661167A>T		82.0	0.0		82.0	25.0	NM_016252	Q9ULD1	Silent	SNP	ENST00000421745.2	hg19	CCDS33175.2																																																																																			.	A|1.000;G|0.000		0.333	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	
TTC27	55622	hgsc.bcm.edu	37	2	32858993	32858993	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:32858993A>T	ENST00000317907.4	+	3	548	c.317A>T	c.(316-318)cAg>cTg	p.Q106L	MIR4765_ENST00000585007.1_RNA	NM_001193509.1|NM_017735.4	NP_001180438.1|NP_060205.3	Q6P3X3	TTC27_HUMAN	tetratricopeptide repeat domain 27	106										breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(14)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38						CTTTTTGTTCAGAGCAACTGG	0.388																																					p.Q106L		Atlas-SNP	.											.	TTC27	71	.	0			c.A317T						.						138.0	136.0	136.0					2																	32858993		2203	4300	6503	SO:0001583	missense	55622	exon3			TTGTTCAGAGCAA	BC063791, AK000279	CCDS33176.1	2p22.3	2013-01-10			ENSG00000018699	ENSG00000018699		"""Tetratricopeptide (TTC) repeat domain containing"""	25986	protein-coding gene	gene with protein product							Standard	NM_001193509		Approved	FLJ20272	uc002rom.3	Q6P3X3	OTTHUMG00000152134	ENST00000317907.4:c.317A>T	chr2.hg19:g.32858993A>T	ENSP00000313953:p.Gln106Leu	97.0	0.0		71.0	17.0	NM_017735	A6NKJ0|Q96SS5|Q9BVF1|Q9NWR4|Q9NXG4	Missense_Mutation	SNP	ENST00000317907.4	hg19	CCDS33176.1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.492283	0.84962	.	.	ENSG00000018699	ENST00000448773;ENST00000317907	T	0.74947	-0.89	5.59	5.59	0.84812	.	0.270269	0.36854	N	0.002373	D	0.86356	0.5913	M	0.81497	2.545	0.58432	D	0.999997	D	0.76494	0.999	D	0.81914	0.995	D	0.88288	0.2941	10	0.87932	D	0	-13.6704	14.7692	0.69662	1.0:0.0:0.0:0.0	.	106	Q6P3X3	TTC27_HUMAN	L	56;106	ENSP00000313953:Q106L	ENSP00000313953:Q106L	Q	+	2	0	TTC27	32712497	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.666000	0.74446	2.120000	0.65058	0.460000	0.39030	CAG	.	.		0.388	TTC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325395.1	NM_017735	
KCNG3	170850	hgsc.bcm.edu	37	2	42720359	42720359	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:42720359A>T	ENST00000306078.1	-	1	878	c.283T>A	c.(283-285)Tac>Aac	p.Y95N	KCNG3_ENST00000394973.4_Missense_Mutation_p.Y95N|MTA3_ENST00000405592.1_5'Flank	NM_133329.5|NM_172344.2	NP_579875.1|NP_758847.1	Q8TAE7	KCNG3_HUMAN	potassium voltage-gated channel, subfamily G, member 3	95					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			central_nervous_system(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(2)	6						ATCTCGTTGTAGAAGGAGAGC	0.647																																					p.Y95N		Atlas-SNP	.											.	KCNG3	19	.	0			c.T283A						.						22.0	25.0	24.0					2																	42720359		2200	4298	6498	SO:0001583	missense	170850	exon1			CGTTGTAGAAGGA	AB070604	CCDS1809.1, CCDS42674.1	2p21	2011-07-05			ENSG00000171126	ENSG00000171126		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18306	protein-coding gene	gene with protein product		606767				11852086, 16382104	Standard	NM_133329		Approved	Kv6.3	uc002rsn.3	Q8TAE7	OTTHUMG00000128604	ENST00000306078.1:c.283T>A	chr2.hg19:g.42720359A>T	ENSP00000304127:p.Tyr95Asn	82.0	0.0		45.0	13.0	NM_172344	Q53SC1	Missense_Mutation	SNP	ENST00000306078.1	hg19	CCDS1809.1	.	.	.	.	.	.	.	.	.	.	A	18.31	3.596142	0.66332	.	.	ENSG00000171126	ENST00000306078;ENST00000394973	T;T	0.43688	0.94;0.94	3.54	3.54	0.40534	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.160550	0.44285	D	0.000475	T	0.55641	0.1933	L	0.56199	1.76	0.50813	D	0.999891	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	T	0.51725	-0.8669	10	0.28530	T	0.3	.	12.2655	0.54676	1.0:0.0:0.0:0.0	.	95;95	Q8TAE7;Q8TAE7-2	KCNG3_HUMAN;.	N	95	ENSP00000304127:Y95N;ENSP00000378424:Y95N	ENSP00000304127:Y95N	Y	-	1	0	KCNG3	42573863	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.758000	0.55220	1.483000	0.48342	0.374000	0.22700	TAC	.	.		0.647	KCNG3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000250464.2	NM_172344	
SPTBN1	6711	hgsc.bcm.edu	37	2	54891657	54891657	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:54891657A>T	ENST00000356805.4	+	33	6769	c.6488A>T	c.(6487-6489)gAg>gTg	p.E2163V	AC093110.3_ENST00000456363.1_RNA	NM_003128.2	NP_003119.2	Q01082	SPTB2_HUMAN	spectrin, beta, non-erythrocytic 1	2163	Mediates interaction with CAMSAP1.				actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi to plasma membrane protein transport (GO:0043001)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|plasma membrane organization (GO:0007009)|protein targeting to plasma membrane (GO:0072661)	axolemma (GO:0030673)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phospholipid binding (GO:0005543)|poly(A) RNA binding (GO:0044822)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(8)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(27)|ovary(4)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	82			Lung(47;0.24)			AGCTCTAAAGAGTCCAGCCCC	0.582																																					p.E2163V		Atlas-SNP	.											.	SPTBN1	378	.	0			c.A6488T						.						167.0	151.0	156.0					2																	54891657		2203	4300	6503	SO:0001583	missense	6711	exon33			CTAAAGAGTCCAG		CCDS33198.1, CCDS33199.1	2p21	2013-01-10			ENSG00000115306	ENSG00000115306		"""Pleckstrin homology (PH) domain containing"""	11275	protein-coding gene	gene with protein product		182790					Standard	NM_003128		Approved		uc002rxu.3	Q01082	OTTHUMG00000133746	ENST00000356805.4:c.6488A>T	chr2.hg19:g.54891657A>T	ENSP00000349259:p.Glu2163Val	123.0	0.0		135.0	39.0	NM_003128	B2RP63|O60837|Q16057|Q53R99|Q59ER3|Q8IX99	Missense_Mutation	SNP	ENST00000356805.4	hg19	CCDS33198.1	.	.	.	.	.	.	.	.	.	.	A	15.84	2.951980	0.53293	.	.	ENSG00000115306	ENST00000356805	T	0.70282	-0.47	5.93	5.93	0.95920	.	0.194126	0.44902	D	0.000407	T	0.53222	0.1783	N	0.14661	0.345	0.80722	D	1	P;B	0.45902	0.868;0.437	B;B	0.37239	0.244;0.045	T	0.57189	-0.7854	10	0.32370	T	0.25	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	153;2163	B4DIF8;Q01082	.;SPTB2_HUMAN	V	2163	ENSP00000349259:E2163V	ENSP00000349259:E2163V	E	+	2	0	SPTBN1	54745161	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.281000	0.95811	2.281000	0.76405	0.533000	0.62120	GAG	.	.		0.582	SPTBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258115.3		
GFPT1	2673	hgsc.bcm.edu	37	2	69585596	69585596	+	Splice_Site	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:69585596C>T	ENST00000357308.4	-	6	587		c.e6-1		GFPT1_ENST00000361060.5_Splice_Site	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						CTTTGCTTTCCTGTAAGTAGA	0.323																																					.		Atlas-SNP	.											.	GFPT1	38	.	0			c.409-1G>A						.						96.0	82.0	87.0					2																	69585596		2202	4300	6502	SO:0001630	splice_region_variant	2673	exon7			GCTTTCCTGTAAG		CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.409-1G>A	chr2.hg19:g.69585596C>T		56.0	0.0		30.0	9.0	NM_002056	Q53QE6|Q9BXF8	Splice_Site	SNP	ENST00000357308.4	hg19	CCDS58713.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.281235	0.80692	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9235	0.86169	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GFPT1	69439100	1.000000	0.71417	0.996000	0.52242	0.971000	0.66376	5.556000	0.67307	2.564000	0.86499	0.561000	0.74099	.	.	.		0.323	GFPT1-201	KNOWN	basic|CCDS	protein_coding	protein_coding			Intron
ZNF638	27332	hgsc.bcm.edu	37	2	71661921	71661921	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:71661921A>T	ENST00000409544.1	+	28	6551	c.5921A>T	c.(5920-5922)gAa>gTa	p.E1974V	ZNF638_ENST00000264447.4_Missense_Mutation_p.E1974V|ZNF638_ENST00000409407.1_Missense_Mutation_p.E914V|ZNF638_ENST00000355812.3_3'UTR	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	1974					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						GAGGCTGAAGAAAGAAGCTCT	0.318																																					p.E1974V		Atlas-SNP	.											.	ZNF638	179	.	0			c.A5921T						.						72.0	85.0	81.0					2																	71661921		2203	4300	6503	SO:0001583	missense	27332	exon28			CTGAAGAAAGAAG	D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.5921A>T	chr2.hg19:g.71661921A>T	ENSP00000386433:p.Glu1974Val	473.0	0.0		373.0	91.0	NM_014497	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	ENST00000409544.1	hg19	CCDS1917.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.137337	0.77775	.	.	ENSG00000075292	ENST00000264447;ENST00000409544;ENST00000409407	T;T;T	0.45668	0.89;0.89;1.23	6.08	4.93	0.64822	.	0.000000	0.64402	D	0.000018	T	0.50939	0.1645	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.48833	-0.9000	10	0.46703	T	0.11	-21.3726	9.0298	0.36252	0.9176:0.0:0.0824:0.0	.	1953;1974	Q14966-3;Q14966	.;ZN638_HUMAN	V	1974;1974;914	ENSP00000264447:E1974V;ENSP00000386433:E1974V;ENSP00000386813:E914V	ENSP00000264447:E1974V	E	+	2	0	ZNF638	71515429	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.738000	0.47401	1.129000	0.42072	0.482000	0.46254	GAA	.	.		0.318	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000327431.1	NM_014497	
M1AP	130951	hgsc.bcm.edu	37	2	74867347	74867347	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:74867347T>A	ENST00000290536.5	-	2	172	c.56A>T	c.(55-57)cAg>cTg	p.Q19L	M1AP_ENST00000358434.2_5'UTR|M1AP_ENST00000536235.1_Missense_Mutation_p.Q19L|M1AP_ENST00000409585.1_Missense_Mutation_p.Q19L	NM_001281296.1|NM_138804.3	NP_001268225.1|NP_620159.2	Q8TC57	M1AP_HUMAN	meiosis 1 associated protein	19					cell differentiation (GO:0030154)|chromatin assembly (GO:0031497)|female gamete generation (GO:0007292)|male meiosis chromosome separation (GO:0051308)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											TGGAGGTTGCTGGTCAATCTG	0.542																																					p.Q19L		Atlas-SNP	.											.	.	.	.	0			c.A56T						.						124.0	115.0	118.0					2																	74867347		2203	4300	6503	SO:0001583	missense	130951	exon2			GGTTGCTGGTCAA		CCDS33229.1, CCDS62941.1	2p13.1	2013-02-05	2013-02-05	2013-01-16	ENSG00000159374	ENSG00000159374			25183	protein-coding gene	gene with protein product	"""meiosis 1 arresting protein"", ""spermatogenesis associated 37"""		"""chromosome 2 open reading frame 65"""	C2orf65		16881047, 23269666	Standard	NM_138804		Approved	D6Mm5e, SPATA37	uc002smy.3	Q8TC57	OTTHUMG00000152918	ENST00000290536.5:c.56A>T	chr2.hg19:g.74867347T>A	ENSP00000290536:p.Gln19Leu	167.0	0.0		110.0	23.0	NM_138804	B7Z6E7|E9PGG8|Q6ZP30|Q96L07	Missense_Mutation	SNP	ENST00000290536.5	hg19	CCDS33229.1	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907377	0.52333	.	.	ENSG00000159374	ENST00000290536;ENST00000409585;ENST00000536235;ENST00000421985	T;T;T;T	0.33216	1.42;1.42;1.42;1.42	5.65	3.34	0.38264	.	0.289402	0.34268	N	0.004116	T	0.24431	0.0592	L	0.51422	1.61	0.80722	D	1	B;B;B	0.34015	0.403;0.435;0.403	B;B;B	0.33042	0.157;0.08;0.157	T	0.05468	-1.0883	10	0.41790	T	0.15	-5.0862	6.8682	0.24104	0.0:0.1548:0.0:0.8452	.	19;19;19	E9PGG8;Q8TC57-2;Q8TC57	.;.;CB065_HUMAN	L	19	ENSP00000290536:Q19L;ENSP00000386793:Q19L;ENSP00000445662:Q19L;ENSP00000414882:Q19L	ENSP00000290536:Q19L	Q	-	2	0	C2orf65	74720855	0.999000	0.42202	0.997000	0.53966	0.877000	0.50540	0.935000	0.28924	2.155000	0.67459	0.533000	0.62120	CAG	.	.		0.542	M1AP-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000328569.1	NM_138804	
POLR1A	25885	hgsc.bcm.edu	37	2	86305011	86305011	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:86305011T>A	ENST00000263857.6	-	11	1729	c.1351A>T	c.(1351-1353)Atc>Ttc	p.I451F	POLR1A_ENST00000409681.1_Missense_Mutation_p.I451F			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	451					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TTGGTGTTGATGTACATGTCT	0.517																																					p.I451F		Atlas-SNP	.											.	POLR1A	137	.	0			c.A1351T						.						141.0	144.0	143.0					2																	86305011		2018	4162	6180	SO:0001583	missense	25885	exon11			TGTTGATGTACAT	AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.1351A>T	chr2.hg19:g.86305011T>A	ENSP00000263857:p.Ile451Phe	52.0	0.0		37.0	7.0	NM_015425	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	ENST00000263857.6	hg19	CCDS42706.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.291690	0.80914	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.70749	-0.51;-0.51	5.62	5.62	0.85841	RNA polymerase, alpha subunit (1);RNA polymerase, N-terminal (1);	0.093744	0.64402	D	0.000001	T	0.79958	0.4536	M	0.91818	3.245	0.80722	D	1	P	0.41673	0.759	B	0.42692	0.395	D	0.84382	0.0550	10	0.62326	D	0.03	-21.3433	15.7908	0.78364	0.0:0.0:0.0:1.0	.	451	O95602	RPA1_HUMAN	F	451	ENSP00000263857:I451F;ENSP00000386300:I451F	ENSP00000263857:I451F	I	-	1	0	POLR1A	86158522	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.541000	0.82084	2.270000	0.75569	0.459000	0.35465	ATC	.	.		0.517	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329830.2	NM_015425	
CNGA3	1261	hgsc.bcm.edu	37	2	99006230	99006230	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:99006230A>C	ENST00000272602.2	+	5	598	c.559A>C	c.(559-561)Att>Ctt	p.I187L	CNGA3_ENST00000393504.1_Missense_Mutation_p.I187L|CNGA3_ENST00000409937.1_Missense_Mutation_p.I191L|CNGA3_ENST00000436404.2_Missense_Mutation_p.I169L			Q16281	CNGA3_HUMAN	cyclic nucleotide gated channel alpha 3	187					cation transport (GO:0006812)|phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to magnesium ion (GO:0032026)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|transport (GO:0006810)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|perikaryon (GO:0043204)|photoreceptor outer segment membrane (GO:0042622)|transmembrane transporter complex (GO:1902495)	cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|ligand-gated ion channel activity (GO:0015276)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(10)|lung(17)|ovary(5)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	49						GTATCTGCTTATTTGCAGGTA	0.597																																					p.I187L		Atlas-SNP	.											.	CNGA3	118	.	0			c.A559C						.						89.0	78.0	82.0					2																	99006230		2203	4300	6503	SO:0001583	missense	1261	exon6			CTGCTTATTTGCA	S76069	CCDS2034.1, CCDS42719.1	2q11.2	2013-01-08			ENSG00000144191	ENSG00000144191		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2150	protein-coding gene	gene with protein product		600053		CNCG3, ACHM2		7532814, 9517456, 16382102	Standard	NM_001298		Approved	CCNC1, CCNCa, CNG3	uc002syt.3	Q16281	OTTHUMG00000130561	ENST00000272602.2:c.559A>C	chr2.hg19:g.99006230A>C	ENSP00000272602:p.Ile187Leu	78.0	0.0		51.0	14.0	NM_001298	E9PF93|Q4VAP7|Q53RD2|Q6ZNA7|Q9UP64	Missense_Mutation	SNP	ENST00000272602.2	hg19	CCDS2034.1	.	.	.	.	.	.	.	.	.	.	A	11.85	1.760814	0.31137	.	.	ENSG00000144191	ENST00000393504;ENST00000436404;ENST00000272602;ENST00000409937	D;D;D;D	0.97505	-4.41;-4.41;-4.41;-4.41	4.85	3.04	0.35103	.	0.133223	0.50627	D	0.000119	D	0.94525	0.8237	M	0.64404	1.975	0.36508	D	0.869395	B;B;B	0.16802	0.019;0.006;0.014	B;B;B	0.20384	0.014;0.014;0.029	D	0.90805	0.4697	10	0.19147	T	0.46	.	9.5874	0.39526	0.1785:0.0:0.8215:0.0	.	191;169;187	E9PF93;Q4VAP7;Q16281	.;.;CNGA3_HUMAN	L	187;169;187;191	ENSP00000377140:I187L;ENSP00000410070:I169L;ENSP00000272602:I187L;ENSP00000386761:I191L	ENSP00000272602:I187L	I	+	1	0	CNGA3	98372662	0.986000	0.35501	0.017000	0.16124	0.174000	0.22865	1.931000	0.40134	0.630000	0.30394	-0.475000	0.04921	ATT	.	.		0.597	CNGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252986.1	NM_001298	
IL18RAP	8807	hgsc.bcm.edu	37	2	103061692	103061692	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:103061692A>T	ENST00000264260.2	+	9	1553	c.964A>T	c.(964-966)Atc>Ttc	p.I322F	IL18RAP_ENST00000409369.1_Missense_Mutation_p.I180F	NM_003853.2	NP_003844.1	O95256	I18RA_HUMAN	interleukin 18 receptor accessory protein	322	Ig-like C2-type 2.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|inflammatory response (GO:0006954)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(4)	37						GCGTAATATCATCTTGGAAAA	0.388																																					p.I322F		Atlas-SNP	.											.	IL18RAP	102	.	0			c.A964T						.						103.0	95.0	98.0					2																	103061692		2203	4300	6503	SO:0001583	missense	8807	exon9			AATATCATCTTGG	AF077346	CCDS2061.1	2q12.1	2013-01-11			ENSG00000115607	ENSG00000115607		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5989	protein-coding gene	gene with protein product		604509				9792649	Standard	XM_005264034		Approved	AcPL, CD218b	uc002tbx.3	O95256	OTTHUMG00000130777	ENST00000264260.2:c.964A>T	chr2.hg19:g.103061692A>T	ENSP00000264260:p.Ile322Phe	119.0	0.0		112.0	26.0	NM_003853	B2RPJ3|Q3KPE7|Q3KPE8|Q53TT4|Q53TU5	Missense_Mutation	SNP	ENST00000264260.2	hg19	CCDS2061.1	.	.	.	.	.	.	.	.	.	.	A	6.713	0.500318	0.12762	.	.	ENSG00000115607	ENST00000264260;ENST00000409369	T;T	0.14266	2.52;2.52	5.63	-7.12	0.01537	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.831060	0.02424	N	0.082889	T	0.06462	0.0166	N	0.17082	0.46	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.33240	-0.9876	10	0.09843	T	0.71	.	6.1748	0.20437	0.4096:0.3805:0.0:0.2099	.	322	O95256	I18RA_HUMAN	F	322;180	ENSP00000264260:I322F;ENSP00000387201:I180F	ENSP00000264260:I322F	I	+	1	0	IL18RAP	102428124	0.000000	0.05858	0.000000	0.03702	0.030000	0.12068	-0.791000	0.04599	-0.838000	0.04218	0.533000	0.62120	ATC	.	.		0.388	IL18RAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253291.2	NM_003853	
SLC9A4	389015	hgsc.bcm.edu	37	2	103148873	103148873	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:103148873A>T	ENST00000295269.4	+	12	2580	c.2123A>T	c.(2122-2124)cAa>cTa	p.Q708L		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	708					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						CAAGAGGCACAAGAAATAATA	0.463																																					p.Q708L		Atlas-SNP	.											.	SLC9A4	115	.	0			c.A2123T						.						92.0	88.0	90.0					2																	103148873		2203	4300	6503	SO:0001583	missense	389015	exon12			AGGCACAAGAAAT		CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.2123A>T	chr2.hg19:g.103148873A>T	ENSP00000295269:p.Gln708Leu	118.0	0.0		86.0	20.0	NM_001011552	Q69YK0	Missense_Mutation	SNP	ENST00000295269.4	hg19	CCDS33264.1	.	.	.	.	.	.	.	.	.	.	A	11.91	1.780422	0.31502	.	.	ENSG00000180251	ENST00000295269	T	0.50813	0.73	4.76	0.618	0.17624	.	1.605070	0.03266	N	0.183960	T	0.34629	0.0904	L	0.27053	0.805	0.09310	N	1	B	0.26400	0.148	B	0.19391	0.025	T	0.20538	-1.0272	10	0.37606	T	0.19	.	6.5998	0.22695	0.5172:0.3914:0.0914:0.0	.	708	Q6AI14	SL9A4_HUMAN	L	708	ENSP00000295269:Q708L	ENSP00000295269:Q708L	Q	+	2	0	SLC9A4	102515305	0.001000	0.12720	0.001000	0.08648	0.010000	0.07245	0.316000	0.19469	0.256000	0.21614	0.533000	0.62120	CAA	.	.		0.463	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000329498.1	NM_001011552.3	
RANBP2	5903	hgsc.bcm.edu	37	2	109347864	109347864	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:109347864A>T	ENST00000283195.6	+	4	465	c.339A>T	c.(337-339)agA>agT	p.R113S		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	113					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CTGATGGAAGAGCAAAATACT	0.338																																					p.R113S		Atlas-SNP	.											.	RANBP2	488	.	0			c.A339T						.						143.0	158.0	153.0					2																	109347864		2203	4299	6502	SO:0001583	missense	5903	exon4			TGGAAGAGCAAAA	D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.339A>T	chr2.hg19:g.109347864A>T	ENSP00000283195:p.Arg113Ser	909.0	0.0		764.0	185.0	NM_006267	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	ENST00000283195.6	hg19	CCDS2079.1	.	.	.	.	.	.	.	.	.	.	A	19.77	3.888653	0.72524	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.37584	1.19	4.97	4.97	0.65823	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	T	0.48187	0.1486	M	0.70275	2.135	0.37186	D	0.903711	D	0.62365	0.991	P	0.49799	0.622	T	0.62863	-0.6764	9	0.87932	D	0	-29.3377	14.939	0.70978	1.0:0.0:0.0:0.0	.	113	P49792	RBP2_HUMAN	S	113	ENSP00000283195:R113S	ENSP00000283195:R113S	R	+	3	2	RANBP2	108714296	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.627000	0.61276	2.004000	0.58718	0.467000	0.42956	AGA	.	.		0.338	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253594.1	NM_006267	
SH3RF3	344558	hgsc.bcm.edu	37	2	109964388	109964388	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:109964388T>A	ENST00000309415.6	+	2	832	c.832T>A	c.(832-834)Tgt>Agt	p.C278S		NM_001099289.1	NP_001092759.1	Q8TEJ3	SH3R3_HUMAN	SH3 domain containing ring finger 3	278	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.						zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(6)|liver(2)|lung(5)|ovary(2)	18						AGACAAGGACTGTCTGACCTT	0.592																																					p.C278S		Atlas-SNP	.											.	SH3RF3	62	.	0			c.T832A						.						26.0	29.0	28.0					2																	109964388		1971	4153	6124	SO:0001583	missense	344558	exon2			AAGGACTGTCTGA	AK074131	CCDS74557.1	2q13	2013-01-11	2008-05-14	2008-05-14	ENSG00000172985	ENSG00000172985		"""RING-type (C3HC4) zinc fingers"""	24699	protein-coding gene	gene with protein product			"""SH3 multiple domains 4"""	SH3MD4		16374509	Standard	XM_006712493		Approved	FLJ00204, POSH2	uc010ywt.1	Q8TEJ3	OTTHUMG00000153439	ENST00000309415.6:c.832T>A	chr2.hg19:g.109964388T>A	ENSP00000309186:p.Cys278Ser	100.0	0.0		68.0	12.0	NM_001099289	A0SDZ7|A8MPR1|Q8NDU1	Missense_Mutation	SNP	ENST00000309415.6	hg19		.	.	.	.	.	.	.	.	.	.	T	23.4	4.414082	0.83449	.	.	ENSG00000172985	ENST00000418513;ENST00000309415	T;T	0.28069	1.63;1.63	5.16	5.16	0.70880	Src homology-3 domain (4);	.	.	.	.	T	0.53610	0.1807	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.52290	-0.8595	8	0.34782	T	0.22	.	15.0095	0.71539	0.0:0.0:0.0:1.0	.	278	Q8TEJ3	SH3R3_HUMAN	S	278	ENSP00000414997:C278S;ENSP00000309186:C278S	ENSP00000309186:C278S	C	+	1	0	SH3RF3	109330820	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.948000	0.87774	1.938000	0.56188	0.454000	0.30748	TGT	.	.		0.592	SH3RF3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001099289	
PAX8	7849	hgsc.bcm.edu	37	2	114004421	114004421	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:114004421A>T	ENST00000429538.3	-	3	295	c.101T>A	c.(100-102)aTc>aAc	p.I34N	AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000422956.2_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000445745.1_RNA|PAX8_ENST00000263334.5_Missense_Mutation_p.I34N|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000553869.2_RNA|PAX8_ENST00000397647.3_Missense_Mutation_p.I34N|PAX8_ENST00000263335.7_Missense_Mutation_p.I34N|AC016683.6_ENST00000333145.5_RNA|PAX8_ENST00000348715.5_Missense_Mutation_p.I34N	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8	34	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						CAGGTCTACGATGCGCTGGCG	0.617			T	PPARG	follicular thyroid		Thyroid dysgenesis																														p.I34N	Ovarian(188;7 2067 9084 29802 29892)	Atlas-SNP	.		Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	.	PAX8	42	.	0			c.T101A	GRCh37	CM065371	PAX8	M		.						44.0	51.0	48.0					2																	114004421		2135	4283	6418	SO:0001583	missense	7849	exon3			TCTACGATGCGCT	X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.101T>A	chr2.hg19:g.114004421A>T	ENSP00000395498:p.Ile34Asn	139.0	0.0		126.0	29.0	NM_013952	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	Missense_Mutation	SNP	ENST00000429538.3	hg19	CCDS46398.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.352789	0.82132	.	.	ENSG00000125618	ENST00000263335;ENST00000397647;ENST00000348715;ENST00000429538;ENST00000263334	D;D;D;D;D	0.99674	-6.36;-6.36;-6.36;-6.36;-6.36	5.1	5.1	0.69264	Paired box protein, N-terminal (4);Winged helix-turn-helix transcription repressor DNA-binding (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.99819	0.9920	H	0.97540	4.025	0.80722	D	1	D;D;D;D;D	0.89917	0.994;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.991;1.0;0.999;1.0;1.0	D	0.96869	0.9638	10	0.87932	D	0	.	12.8594	0.57906	1.0:0.0:0.0:0.0	.	34;34;34;34;34	Q06710-2;Q06710-3;Q06710;Q06710-5;Q06710-4	.;.;PAX8_HUMAN;.;.	N	34	ENSP00000263335:I34N;ENSP00000380768:I34N;ENSP00000314750:I34N;ENSP00000395498:I34N;ENSP00000263334:I34N	ENSP00000263334:I34N	I	-	2	0	PAX8	113720891	1.000000	0.71417	0.997000	0.53966	0.741000	0.42261	9.271000	0.95698	1.931000	0.55961	0.533000	0.62120	ATC	.	.		0.617	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250353.5		
IWS1	55677	hgsc.bcm.edu	37	2	128249661	128249661	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:128249661G>A	ENST00000295321.4	-	10	2192	c.1933C>T	c.(1933-1935)Cct>Tct	p.P645S	AC010976.2_ENST00000454503.2_RNA|AC010976.2_ENST00000595561.1_RNA|IWS1_ENST00000455721.2_3'UTR|AC010976.2_ENST00000599001.1_RNA|AC010976.2_ENST00000598065.1_RNA|AC010976.2_ENST00000596439.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	645	Interaction with SUPT6H and ALYREF.|TFIIS N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00649}.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTCACACTAGGCAGCTGGGGA	0.473																																					p.P645S		Atlas-SNP	.											.	IWS1	61	.	0			c.C1933T						.						81.0	70.0	74.0					2																	128249661		2203	4300	6503	SO:0001583	missense	55677	exon10			CACTAGGCAGCTG	AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1933C>T	chr2.hg19:g.128249661G>A	ENSP00000295321:p.Pro645Ser	102.0	0.0		97.0	24.0	NM_017969	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	ENST00000295321.4	hg19	CCDS2146.1	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926055	0.92319	.	.	ENSG00000163166	ENST00000295321;ENST00000433551	T	0.51325	0.71	5.2	5.2	0.72013	Transcription factor IIS, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.60612	0.2282	M	0.76170	2.325	0.80722	D	1	P	0.37781	0.608	P	0.45406	0.479	T	0.65952	-0.6043	10	0.87932	D	0	-18.0837	18.8155	0.92075	0.0:0.0:1.0:0.0	.	645	Q96ST2	IWS1_HUMAN	S	645;598	ENSP00000295321:P645S	ENSP00000295321:P645S	P	-	1	0	IWS1	127966131	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.802000	0.99131	2.431000	0.82371	0.558000	0.71614	CCT	.	.		0.473	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254384.2	NM_017969	
SAP130	79595	hgsc.bcm.edu	37	2	128747139	128747139	+	Splice_Site	SNP	T	T	A	rs372682996		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:128747139T>A	ENST00000259235.3	-	13	1986	c.1857A>T	c.(1855-1857)tcA>tcT	p.S619S	SAP130_ENST00000259234.6_Splice_Site_p.S593S|SAP130_ENST00000357702.5_Splice_Site_p.S619S	NM_024545.3	NP_078821.2	Q9H0E3	SP130_HUMAN	Sin3A-associated protein, 130kDa	619					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|STAGA complex (GO:0030914)	transcription coactivator activity (GO:0003713)			NS(4)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(2)|prostate(1)|skin(5)|urinary_tract(2)	45	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0771)		TAAAATTACCTGAAGTCTTTC	0.428																																					p.S619S		Atlas-SNP	.											.	SAP130	169	.	0			c.A1857T						.						59.0	60.0	59.0					2																	128747139		2203	4300	6503	SO:0001630	splice_region_variant	79595	exon13			ATTACCTGAAGTC	BC017453	CCDS2153.1, CCDS54397.1	2q14.3	2008-02-05	2006-02-02		ENSG00000136715	ENSG00000136715			29813	protein-coding gene	gene with protein product		609697	"""sin3A-associated protein, 130kDa"""			11230166, 12724404	Standard	NM_001145928		Approved	FLJ12761	uc010fmd.2	Q9H0E3	OTTHUMG00000131571	ENST00000259235.3:c.1858+1A>T	chr2.hg19:g.128747139T>A		134.0	0.0		101.0	33.0	NM_001145928	B7ZLM3|C9K0X9|Q4ZFV4|Q53T46|Q8WVW4|Q9H9G8	Silent	SNP	ENST00000259235.3	hg19	CCDS2153.1																																																																																			.	.		0.428	SAP130-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254436.3	NM_024545	Silent
MCM6	4175	hgsc.bcm.edu	37	2	136609093	136609093	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:136609093T>A	ENST00000264156.2	-	13	1856	c.1796A>T	c.(1795-1797)aAa>aTa	p.K599I	MCM6_ENST00000492091.1_5'UTR	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	599					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		GCGGAGATGTTTATATTGCTC	0.428																																					p.K599I	Ovarian(196;141 2104 8848 24991 25939)	Atlas-SNP	.											.	MCM6	64	.	0			c.A1796T						.						106.0	90.0	95.0					2																	136609093		2203	4300	6503	SO:0001583	missense	4175	exon13			AGATGTTTATATT		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.1796A>T	chr2.hg19:g.136609093T>A	ENSP00000264156:p.Lys599Ile	61.0	0.0		42.0	10.0	NM_005915	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	hg19	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	T	27.8	4.864644	0.91511	.	.	ENSG00000076003	ENST00000264156	T	0.06528	3.29	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.14056	0.0340	L	0.31420	0.93	0.80722	D	1	P	0.49447	0.924	P	0.61201	0.885	T	0.08106	-1.0738	10	0.34782	T	0.22	-23.1599	15.8555	0.78975	0.0:0.0:0.0:1.0	.	599	Q14566	MCM6_HUMAN	I	599	ENSP00000264156:K599I	ENSP00000264156:K599I	K	-	2	0	MCM6	136325563	1.000000	0.71417	1.000000	0.80357	0.918000	0.54935	6.226000	0.72277	2.140000	0.66376	0.374000	0.22700	AAA	.	.		0.428	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	NM_005915	
NOSTRIN	115677	hgsc.bcm.edu	37	2	169688005	169688005	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:169688005A>T	ENST00000317647.7	+	6	595	c.366A>T	c.(364-366)acA>acT	p.T122T	NOSTRIN_ENST00000397206.2_Silent_p.T44T|NOSTRIN_ENST00000397209.2_Silent_p.T94T|NOSTRIN_ENST00000444448.2_Silent_p.T122T|NOSTRIN_ENST00000458381.2_Silent_p.T122T|NOSTRIN_ENST00000445023.2_Silent_p.T44T|NOSTRIN_ENST00000421711.2_Silent_p.T94T	NM_001039724.3	NP_001034813.2	Q8IVI9	NOSTN_HUMAN	nitric oxide synthase trafficking	122					endocytosis (GO:0006897)|negative regulation of transcription, DNA-templated (GO:0045892)|nitric oxide metabolic process (GO:0046209)|regulation of nitric-oxide synthase activity (GO:0050999)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoskeleton (GO:0005856)|endocytic vesicle membrane (GO:0030666)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						TTGAAAAGACAGCAAATCTTG	0.333																																					p.T122T		Atlas-SNP	.											.	NOSTRIN	68	.	0			c.A366T						.						93.0	84.0	87.0					2																	169688005		1853	4106	5959	SO:0001819	synonymous_variant	115677	exon6			AAAGACAGCAAAT	AJ532842	CCDS42771.1, CCDS42772.1, CCDS54415.1, CCDS54416.1	2q31.1	2013-08-05	2013-08-05		ENSG00000163072	ENSG00000163072			20203	protein-coding gene	gene with protein product		607496	"""nitric oxide synthase trafficker"""			12446846	Standard	NM_001171631		Approved	MGC20702	uc002ueg.3	Q8IVI9	OTTHUMG00000153990	ENST00000317647.7:c.366A>T	chr2.hg19:g.169688005A>T		253.0	0.0		238.0	53.0	NM_001039724	A8K2I9|B3KSF5|E7EPT9|Q27HG3|Q53S62|Q96CJ9	Silent	SNP	ENST00000317647.7	hg19	CCDS42771.1																																																																																			.	.		0.333	NOSTRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333356.4	NM_052946	
BBS5	129880	hgsc.bcm.edu	37	2	170355994	170355994	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:170355994A>T	ENST00000295240.3	+	9	1057		c.e9-1		RP11-724O16.1_ENST00000513963.1_Splice_Site|BBS5_ENST00000392663.2_Splice_Site|BBS5_ENST00000554017.1_Splice_Site	NM_152384.2	NP_689597.1	Q8N3I7	BBS5_HUMAN	Bardet-Biedl syndrome 5						cilium assembly (GO:0042384)|heart looping (GO:0001947)|melanosome transport (GO:0032402)|motile cilium assembly (GO:0044458)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphate binding (GO:0032266)|RNA polymerase II repressing transcription factor binding (GO:0001103)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						TTTCTCTTGTAGAGTGGTGGA	0.299									Bardet-Biedl syndrome																												.		Atlas-SNP	.											.	BBS5	27	.	0			c.682-2A>T						.						53.0	55.0	55.0					2																	170355994		2203	4298	6501	SO:0001630	splice_region_variant	129880	exon9	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	TCTTGTAGAGTGG	AY604003	CCDS2233.1	2q31	2011-08-02			ENSG00000163093	ENSG00000163093			970	protein-coding gene	gene with protein product		603650				9888993, 10053027	Standard	NM_152384		Approved	DKFZp762I194		Q8N3I7	OTTHUMG00000132207	ENST00000295240.3:c.682-1A>T	chr2.hg19:g.170355994A>T		214.0	0.0		186.0	59.0	NM_152384	D3DPC3|Q6PKN0	Splice_Site	SNP	ENST00000295240.3	hg19	CCDS2233.1	.	.	.	.	.	.	.	.	.	.	A	16.09	3.024720	0.54683	.	.	ENSG00000163093;ENSG00000163093;ENSG00000163093;ENSG00000251569	ENST00000295240;ENST00000554017;ENST00000392663;ENST00000513963	.	.	.	5.74	5.74	0.90152	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0271	0.80551	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BBS5;RP11-724O16.1	170064240	1.000000	0.71417	0.925000	0.36789	0.558000	0.35554	9.267000	0.95665	2.188000	0.69820	0.482000	0.46254	.	.	.		0.299	BBS5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255265.2	NM_152384	Intron
DCAF17	80067	hgsc.bcm.edu	37	2	172300031	172300031	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:172300031A>T	ENST00000375255.3	+	3	557		c.e3-1		DCAF17_ENST00000539783.1_Splice_Site|DCAF17_ENST00000468592.1_Splice_Site	NM_025000.3	NP_079276.2	Q5H9S7	DCA17_HUMAN	DDB1 and CUL4 associated factor 17						protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)	17						CTTTTTTCCCAGTGTTGCATC	0.323																																					.		Atlas-SNP	.											.	DCAF17	41	.	0			c.231-2A>T						.						85.0	78.0	80.0					2																	172300031		1791	4069	5860	SO:0001630	splice_region_variant	80067	exon3			TTTCCCAGTGTTG	AK023158	CCDS2243.2, CCDS54419.1	2q31.1	2014-01-28	2009-07-17	2009-07-17	ENSG00000115827	ENSG00000115827		"""DDB1 and CUL4 associated factors"""	25784	protein-coding gene	gene with protein product	"""Woodhouse-Sakati syndrome"""	612515	"""chromosome 2 open reading frame 37"""	C2orf37			Standard	NM_001164821		Approved	FLJ13096	uc002ugx.3	Q5H9S7	OTTHUMG00000132259	ENST00000375255.3:c.231-1A>T	chr2.hg19:g.172300031A>T		41.0	0.0		41.0	12.0	NM_025000	B2RTW5|Q53TN3|Q9H908	Splice_Site	SNP	ENST00000375255.3	hg19	CCDS2243.2	.	.	.	.	.	.	.	.	.	.	A	15.23	2.770789	0.49680	.	.	ENSG00000115827	ENST00000375255;ENST00000539783	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2196	0.73299	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DCAF17	172008277	1.000000	0.71417	0.923000	0.36655	0.634000	0.38068	6.614000	0.74197	2.073000	0.62155	0.472000	0.43445	.	.	.		0.323	DCAF17-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255342.2	NM_025000	Intron
WIPF1	7456	hgsc.bcm.edu	37	2	175432711	175432711	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:175432711A>T	ENST00000392547.2	-	6	1319	c.1220T>A	c.(1219-1221)gTa>gAa	p.V407E	WIPF1_ENST00000272746.5_Missense_Mutation_p.V407E|WIPF1_ENST00000409891.1_Missense_Mutation_p.V407E|WIPF1_ENST00000467149.1_5'UTR|WIPF1_ENST00000359761.3_Missense_Mutation_p.V407E|WIPF1_ENST00000392546.2_Missense_Mutation_p.V407E|AC018890.6_ENST00000412835.1_RNA|AC018890.6_ENST00000442996.1_RNA	NM_003387.4	NP_003378.3	O43516	WIPF1_HUMAN	WAS/WASL interacting protein family, member 1	407	Pro-rich.				actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|protein complex assembly (GO:0006461)|response to other organism (GO:0051707)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	actin binding (GO:0003779)|profilin binding (GO:0005522)			NS(1)|breast(1)|endometrium(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)	32						GGGACTGTCTACTCCACTCCT	0.612																																					p.V407E		Atlas-SNP	.											.	WIPF1	88	.	0			c.T1220A						.						55.0	55.0	55.0					2																	175432711		2203	4300	6503	SO:0001583	missense	7456	exon6			CTGTCTACTCCAC	AF031588	CCDS2260.1	2q31.2	2014-09-17	2006-10-12	2006-10-12	ENSG00000115935	ENSG00000115935			12736	protein-coding gene	gene with protein product		602357	"""Wiskott-Aldrich syndrome protein interacting protein"""	WASPIP		9405671	Standard	NM_001077269		Approved	WIP	uc002uiz.3	O43516	OTTHUMG00000132334	ENST00000392547.2:c.1220T>A	chr2.hg19:g.175432711A>T	ENSP00000376330:p.Val407Glu	101.0	0.0		64.0	20.0	NM_003387	B8ZZM1|D3DPE4|Q15220|Q53TA9|Q6MZU9|Q9BU37|Q9UNP1	Missense_Mutation	SNP	ENST00000392547.2	hg19	CCDS2260.1	.	.	.	.	.	.	.	.	.	.	A	13.48	2.249736	0.39797	.	.	ENSG00000115935	ENST00000392547;ENST00000392548;ENST00000272746;ENST00000359761;ENST00000392546;ENST00000409891	T;T;T;T;T	0.46819	1.55;1.55;1.55;1.55;0.86	5.49	3.03	0.35002	.	0.815711	0.11106	N	0.599157	T	0.34716	0.0907	N	0.19112	0.55	0.22996	N	0.998457	B;B;B	0.26258	0.145;0.145;0.09	B;B;B	0.34779	0.189;0.189;0.057	T	0.37430	-0.9706	10	0.22706	T	0.39	.	8.5897	0.33679	0.8024:0.1299:0.0677:0.0	.	407;407;407	O43516-3;O43516-2;O43516	.;.;WIPF1_HUMAN	E	407;263;407;407;407;407	ENSP00000376330:V407E;ENSP00000272746:V407E;ENSP00000352802:V407E;ENSP00000376329:V407E;ENSP00000386431:V407E	ENSP00000272746:V407E	V	-	2	0	WIPF1	175140957	0.990000	0.36364	0.014000	0.15608	0.884000	0.51177	3.261000	0.51530	0.428000	0.26173	0.533000	0.62120	GTA	.	.		0.612	WIPF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255453.1	NM_003387	
ATF2	1386	hgsc.bcm.edu	37	2	175939359	175939359	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:175939359T>A	ENST00000264110.2	-	14	1794	c.1496A>T	c.(1495-1497)cAg>cTg	p.Q499L	ATF2_ENST00000409437.1_Missense_Mutation_p.Q383L|ATF2_ENST00000538946.1_3'UTR|ATF2_ENST00000409499.1_Missense_Mutation_p.Q138L|ATF2_ENST00000409635.1_Missense_Mutation_p.Q441L|ATF2_ENST00000426833.3_Missense_Mutation_p.Q481L|ATF2_ENST00000487334.2_3'UTR|ATF2_ENST00000345739.5_Missense_Mutation_p.Q441L|ATF2_ENST00000392544.1_Missense_Mutation_p.Q499L|ATF2_ENST00000392543.2_Missense_Mutation_p.Q120L	NM_001256090.1|NM_001256091.1|NM_001880.3	NP_001243019.1|NP_001243020.1|NP_001871.2	P15336	ATF2_HUMAN	activating transcription factor 2	499					adipose tissue development (GO:0060612)|cellular response to DNA damage stimulus (GO:0006974)|chromatin organization (GO:0006325)|fat cell differentiation (GO:0045444)|histone acetylation (GO:0016573)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|outflow tract morphogenesis (GO:0003151)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta2 production (GO:0032915)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	cAMP response element binding (GO:0035497)|cAMP response element binding protein binding (GO:0008140)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	17			OV - Ovarian serous cystadenocarcinoma(117;0.125)		Pseudoephedrine(DB00852)	GGGCTGTGACTGGGAGGAAGG	0.473																																					p.Q499L	Pancreas(17;87 705 4534 15538 30988)	Atlas-SNP	.											.	ATF2	52	.	0			c.A1496T						.						46.0	43.0	44.0					2																	175939359		2203	4300	6503	SO:0001583	missense	1386	exon14			TGTGACTGGGAGG	X15875	CCDS2262.1, CCDS58737.1, CCDS58738.1, CCDS58739.1	2q32	2013-01-10			ENSG00000115966	ENSG00000115966		"""basic leucine zipper proteins"""	784	protein-coding gene	gene with protein product		123811	"""cAMP responsive element binding protein 2"""	CREB2		1833307, 1838349	Standard	NM_001880		Approved	TREB7, CRE-BP1, HB16	uc002ujl.4	P15336	OTTHUMG00000132424	ENST00000264110.2:c.1496A>T	chr2.hg19:g.175939359T>A	ENSP00000264110:p.Gln499Leu	102.0	0.0		112.0	29.0	NM_001880	A1L3Z2|A4D7U4|A4D7U5|A4D7V1|D3DPE9|G8JLM5|Q13000|Q3B7B7|Q4ZFU9|Q53RY2|Q8TAR1|Q96JT8	Missense_Mutation	SNP	ENST00000264110.2	hg19	CCDS2262.1	.	.	.	.	.	.	.	.	.	.	T	12.92	2.081896	0.36758	.	.	ENSG00000115966	ENST00000264110;ENST00000345739;ENST00000542046;ENST00000409437;ENST00000409635;ENST00000392544;ENST00000409499;ENST00000426833;ENST00000392543	D;T;T;T;D;D	0.81821	-1.54;0.02;-0.7;0.02;-1.54;-1.5	5.91	5.91	0.95273	.	0.125508	0.56097	D	0.000033	D	0.83289	0.5222	N	0.24115	0.695	0.80722	D	1	B;D;B;B	0.53745	0.231;0.962;0.413;0.231	B;D;B;B	0.66716	0.05;0.946;0.066;0.05	D	0.85783	0.1362	10	0.87932	D	0	-48.7905	16.3472	0.83146	0.0:0.0:0.0:1.0	.	481;138;441;499	A4D7U4;Q96JT8;Q3B7B7;P15336	.;.;.;ATF2_HUMAN	L	499;441;476;383;441;499;138;481;120	ENSP00000264110:Q499L;ENSP00000340576:Q441L;ENSP00000386326:Q383L;ENSP00000387093:Q441L;ENSP00000376327:Q499L;ENSP00000407911:Q481L	ENSP00000264110:Q499L	Q	-	2	0	ATF2	175647605	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.785000	0.55424	2.266000	0.75297	0.454000	0.30748	CAG	.	.		0.473	ATF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000255562.1	NM_001880	
NFE2L2	4780	hgsc.bcm.edu	37	2	178098800	178098800	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:178098800T>C	ENST00000397062.3	-	2	799	c.245A>G	c.(244-246)gAa>gGa	p.E82G	NFE2L2_ENST00000446151.2_Missense_Mutation_p.E66G|NFE2L2_ENST00000464747.1_Missense_Mutation_p.E66G|NFE2L2_ENST00000397063.4_Missense_Mutation_p.E66G|NFE2L2_ENST00000423513.1_Missense_Mutation_p.E66G	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	82					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E82G(3)|p.G81_F83delGEF(1)|p.E82V(1)		central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TGGGAGAAATTCACCTGTCTC	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																											p.E82G		Atlas-SNP	.		Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	NFE2L2,NS,carcinoma,+1,7	NFE2L2	225	.	5	Substitution - Missense(4)|Deletion - In frame(1)	liver(3)|lung(1)|oesophagus(1)	c.A245G						.						137.0	137.0	137.0					2																	178098800		1900	4105	6005	SO:0001583	missense	4780	exon2			AGAAATTCACCTG		CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.245A>G	chr2.hg19:g.178098800T>C	ENSP00000380252:p.Glu82Gly	67.0	0.0		56.0	28.0	NM_006164	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Missense_Mutation	SNP	ENST00000397062.3	hg19	CCDS42782.1	.	.	.	.	.	.	.	.	.	.	T	29.9	5.048793	0.93740	.	.	ENSG00000116044	ENST00000397063;ENST00000397062;ENST00000446151;ENST00000448782;ENST00000421929;ENST00000423513	T;T;T;T;T;T	0.38077	1.57;1.57;1.57;1.16;1.16;1.57	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.66287	0.2774	M	0.87180	2.865	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.87578	0.997;0.994;0.998;0.997	T	0.72959	-0.4133	10	0.87932	D	0	.	16.098	0.81144	0.0:0.0:0.0:1.0	.	66;66;66;82	E9PGJ7;B4DNB0;C9JFL6;Q16236	.;.;.;NF2L2_HUMAN	G	66;82;66;66;66;66	ENSP00000380253:E66G;ENSP00000380252:E82G;ENSP00000411575:E66G;ENSP00000400073:E66G;ENSP00000412191:E66G;ENSP00000410015:E66G	ENSP00000380252:E82G	E	-	2	0	NFE2L2	177807046	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.503000	0.81632	2.210000	0.71456	0.460000	0.39030	GAA	.	.		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257752.4	NM_006164	
TTN	7273	hgsc.bcm.edu	37	2	179417476	179417476	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:179417476A>T	ENST00000591111.1	-	285	85452	c.85228T>A	c.(85228-85230)Tgg>Agg	p.W28410R	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.W21178R|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.W27483R|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.W21111R|TTN_ENST00000460472.2_Missense_Mutation_p.W20986R|RP11-65L3.2_ENST00000603415.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.W30051R|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	28410	Fibronectin type-III 107. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGTTTGGTCCAGCTGAGGATG	0.463																																					p.W30051R		Atlas-SNP	.											.	TTN	18412	.	0			c.T90151A						.						110.0	99.0	102.0					2																	179417476		1996	4176	6172	SO:0001583	missense	7273	exon335			TGGTCCAGCTGAG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.85228T>A	chr2.hg19:g.179417476A>T	ENSP00000465570:p.Trp28410Arg	130.0	0.0		119.0	39.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	16.27	3.076478	0.55753	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	5.76	5.76	0.90799	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.95837	0.8645	H	0.98849	4.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	D	0.97693	1.0180	9	0.87932	D	0	.	16.3634	0.83296	1.0:0.0:0.0:0.0	.	20986;21111;21178;28410	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	R	27483;20986;21178;21111;20983	ENSP00000343764:W27483R;ENSP00000434586:W20986R;ENSP00000340554:W21178R;ENSP00000352154:W21111R	ENSP00000340554:W21178R	W	-	1	0	TTN	179125722	1.000000	0.71417	0.986000	0.45419	0.998000	0.95712	9.339000	0.96797	2.324000	0.78689	0.533000	0.62120	TGG	.	.		0.463	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179439715	179439715	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:179439715A>T	ENST00000591111.1	-	276	66445	c.66221T>A	c.(66220-66222)gTt>gAt	p.V22074D	TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.V14842D|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V21147D|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V14775D|TTN_ENST00000460472.2_Missense_Mutation_p.V14650D|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.V23715D|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN-AS1_ENST00000419746.1_RNA			Q8WZ42	TITIN_HUMAN	titin	22074	Ig-like 115.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GACATCACCAACCTCTCCTAC	0.413																																					p.V23715D		Atlas-SNP	.											.	TTN	18412	.	0			c.T71144A						.						78.0	72.0	74.0					2																	179439715		1924	4135	6059	SO:0001583	missense	7273	exon326			TCACCAACCTCTC	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66221T>A	chr2.hg19:g.179439715A>T	ENSP00000465570:p.Val22074Asp	90.0	0.0		108.0	39.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	11.32	1.602884	0.28534	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.69	4.5	0.54988	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67813	0.2933	N	0.20986	0.625	0.80722	D	1	D;D;D;D	0.58620	0.983;0.971;0.983;0.971	P;P;P;P	0.62298	0.9;0.9;0.9;0.867	T	0.70753	-0.4786	9	0.87932	D	0	.	11.8911	0.52630	0.9309:0.0:0.0691:0.0	.	14650;14775;14842;22074	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	21147;14650;14842;14775;14648	ENSP00000343764:V21147D;ENSP00000434586:V14650D;ENSP00000340554:V14842D;ENSP00000352154:V14775D	ENSP00000340554:V14842D	V	-	2	0	TTN	179147961	1.000000	0.71417	0.986000	0.45419	0.911000	0.54048	9.281000	0.95811	0.948000	0.37687	0.528000	0.53228	GTT	.	.		0.413	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179575489	179575489	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:179575489A>T	ENST00000591111.1	-	96	27608	c.27384T>A	c.(27382-27384)atT>atA	p.I9128I	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Silent_p.I8201I|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.I9445I|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13259	Ig-like 74.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCAGATAACTAATCTGGTACT	0.473																																					p.I9445I		Atlas-SNP	.											.	TTN	18412	.	0			c.T28335A						.						158.0	151.0	153.0					2																	179575489		1966	4158	6124	SO:0001819	synonymous_variant	7273	exon98			ATAACTAATCTGG	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.27384T>A	chr2.hg19:g.179575489A>T		97.0	0.0		90.0	24.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	ENST00000591111.1	hg19																																																																																				.	.		0.473	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
TTN	7273	hgsc.bcm.edu	37	2	179612800	179612800	+	Intron	SNP	A	A	T	rs142132973	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:179612800A>T	ENST00000591111.1	-	45	10585				TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Nonsense_Mutation_p.L4776*			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACCAACCCCTAAAGGCTTTTC	0.423																																					p.L4776X		Atlas-SNP	.											TTN_ENST00000360870,NS,lymphoid_neoplasm,0,1	TTN	18412	.	0			c.T14327A						.																																			SO:0001627	intron_variant	7273	exon46			ACCCCTAAAGGCT	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+5050T>A	chr2.hg19:g.179612800A>T		77.0	0.0		82.0	23.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	A	54	23.311441	0.99954	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	.	.	.	6.05	-0.358	0.12575	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.3174	0.43745	0.553:0.0:0.447:0.0	.	.	.	.	X	4776;90	.	ENSP00000304714:L90X	L	-	2	0	TTN	179321045	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	0.062000	0.14389	-0.267000	0.09325	-0.263000	0.10527	TTA	.	A|0.999;G|0.001		0.423	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
FAM171B	165215	hgsc.bcm.edu	37	2	187605125	187605125	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:187605125A>G	ENST00000304698.5	+	2	612	c.409A>G	c.(409-411)Att>Gtt	p.I137V		NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	137						integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						TAGTTTAACTATTATTGCTTA	0.363																																					p.I137V		Atlas-SNP	.											.	FAM171B	146	.	0			c.A409G						.						117.0	109.0	112.0					2																	187605125		2203	4300	6503	SO:0001583	missense	165215	exon2			TTAACTATTATTG	AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.409A>G	chr2.hg19:g.187605125A>G	ENSP00000304108:p.Ile137Val	179.0	0.0		159.0	35.0	NM_177454	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	Missense_Mutation	SNP	ENST00000304698.5	hg19	CCDS33347.1	.	.	.	.	.	.	.	.	.	.	A	3.871	-0.027915	0.07589	.	.	ENSG00000144369	ENST00000304698;ENST00000272804	T	0.24538	1.85	5.98	4.82	0.62117	.	0.128720	0.53938	D	0.000055	T	0.12902	0.0313	N	0.13235	0.315	0.36456	D	0.866387	B;B	0.34329	0.449;0.449	B;B	0.34873	0.191;0.191	T	0.10800	-1.0614	10	0.05351	T	0.99	-18.9574	10.8533	0.46782	0.9289:0.0:0.0711:0.0	.	137;138	Q6P995;A8K122	F171B_HUMAN;.	V	137	ENSP00000304108:I137V	ENSP00000272804:I137V	I	+	1	0	FAM171B	187313370	1.000000	0.71417	0.959000	0.39883	0.978000	0.69477	2.806000	0.47947	1.077000	0.40990	0.528000	0.53228	ATT	.	.		0.363	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000334679.1	NM_177454	
COL3A1	1281	hgsc.bcm.edu	37	2	189870090	189870090	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:189870090A>T	ENST00000304636.3	+	41	3116	c.2946A>T	c.(2944-2946)aaA>aaT	p.K982N	COL3A1_ENST00000317840.5_Intron	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	982	Triple-helical region.				aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	AAAGTGGGAAACCAGGAGCTA	0.433																																					p.K982N		Atlas-SNP	.											.	COL3A1	292	.	0			c.A2946T						.						110.0	114.0	112.0					2																	189870090		2203	4300	6503	SO:0001583	missense	1281	exon41			TGGGAAACCAGGA	X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.2946A>T	chr2.hg19:g.189870090A>T	ENSP00000304408:p.Lys982Asn	117.0	0.0		105.0	24.0	NM_000090	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	ENST00000304636.3	hg19	CCDS2297.1	.	.	.	.	.	.	.	.	.	.	A	19.65	3.866632	0.72065	.	.	ENSG00000168542	ENST00000304636	D	0.94232	-3.38	5.5	-2.67	0.06059	.	0.000000	0.53938	D	0.000041	D	0.92090	0.7493	L	0.28556	0.865	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.87381	0.2357	10	0.25106	T	0.35	.	11.7586	0.51890	0.574:0.0:0.426:0.0	.	982	P02461	CO3A1_HUMAN	N	982	ENSP00000304408:K982N	ENSP00000304408:K982N	K	+	3	2	COL3A1	189578335	0.960000	0.32886	0.725000	0.30721	0.873000	0.50193	0.230000	0.17852	-0.746000	0.04766	0.528000	0.53228	AAA	.	.		0.433	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255899.3	NM_000090	
FZD7	8324	hgsc.bcm.edu	37	2	202900427	202900427	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:202900427T>A	ENST00000286201.1	+	1	1118	c.1057T>A	c.(1057-1059)Tgg>Agg	p.W353R	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	353					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CAGCTCCATCTGGTGGGTCAT	0.627											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.W353R		Atlas-SNP	.											.	FZD7	70	.	0			c.T1057A						.						79.0	78.0	78.0					2																	202900427		2203	4300	6503	SO:0001583	missense	8324	exon1			TCCATCTGGTGGG	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1057T>A	chr2.hg19:g.202900427T>A	ENSP00000286201:p.Trp353Arg	84.0	0.0	2133	98.0	26.0	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	hg19	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.083506	0.76642	.	.	ENSG00000155760	ENST00000286201	D	0.91351	-2.83	5.41	5.41	0.78517	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.96996	0.9019	H	0.97077	3.935	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98370	1.0553	10	0.87932	D	0	.	15.4377	0.75160	0.0:0.0:0.0:1.0	.	353	O75084	FZD7_HUMAN	R	353	ENSP00000286201:W353R	ENSP00000286201:W353R	W	+	1	0	FZD7	202608672	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.035000	0.88872	2.061000	0.61500	0.379000	0.24179	TGG	.	.		0.627	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
FZD7	8324	hgsc.bcm.edu	37	2	202900508	202900508	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:202900508T>A	ENST00000286201.1	+	1	1199	c.1138T>A	c.(1138-1140)Tac>Aac	p.Y380N	RP11-107N15.1_ENST00000608741.1_lincRNA	NM_003507.1	NP_003498.1	O75084	FZD7_HUMAN	frizzled class receptor 7	380					axonogenesis (GO:0007409)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of ectodermal cell fate specification (GO:0042666)|neuron differentiation (GO:0030182)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of catenin import into nucleus (GO:0035412)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle satellite cell maintenance involved in skeletal muscle regeneration (GO:0014834)|somatic stem cell division (GO:0048103)|stem cell maintenance (GO:0019827)|substrate adhesion-dependent cell spreading (GO:0034446)|T cell differentiation in thymus (GO:0033077)|vasculature development (GO:0001944)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	frizzled binding (GO:0005109)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|endometrium(6)|large_intestine(6)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	31						CAACTCGCAGTACTTCCACCT	0.652											OREG0015146	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Y380N		Atlas-SNP	.											.	FZD7	70	.	0			c.T1138A						.						59.0	61.0	60.0					2																	202900508		2203	4300	6503	SO:0001583	missense	8324	exon1			TCGCAGTACTTCC	AB010881	CCDS2351.1	2q33	2014-01-29	2014-01-29		ENSG00000155760	ENSG00000155760		"""GPCR / Class F : Frizzled receptors"""	4045	protein-coding gene	gene with protein product		603410	"""frizzled (Drosophila) homolog 7"", ""frizzled homolog 7 (Drosophila)"", ""frizzled 7, seven transmembrane spanning receptor"", ""frizzled family receptor 7"""			9707618, 9813155	Standard	NM_003507		Approved	FzE3	uc002uyw.1	O75084	OTTHUMG00000132841	ENST00000286201.1:c.1138T>A	chr2.hg19:g.202900508T>A	ENSP00000286201:p.Tyr380Asn	85.0	0.0	2133	70.0	12.0	NM_003507	O94816|Q53S59|Q96B74	Missense_Mutation	SNP	ENST00000286201.1	hg19	CCDS2351.1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.062275	0.76187	.	.	ENSG00000155760	ENST00000286201	D	0.86366	-2.11	5.41	5.41	0.78517	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.94938	0.8363	M	0.93016	3.37	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96069	0.9044	10	0.87932	D	0	.	15.4377	0.75160	0.0:0.0:0.0:1.0	.	380	O75084	FZD7_HUMAN	N	380	ENSP00000286201:Y380N	ENSP00000286201:Y380N	Y	+	1	0	FZD7	202608753	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.035000	0.88872	2.061000	0.61500	0.379000	0.24179	TAC	.	.		0.652	FZD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256314.1	NM_003507	
ICOS	29851	hgsc.bcm.edu	37	2	204820588	204820588	+	Silent	SNP	A	A	G	rs372256111		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:204820588A>G	ENST00000316386.6	+	2	355	c.288A>G	c.(286-288)ctA>ctG	p.L96L	ICOS_ENST00000435193.1_Silent_p.L96L	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	96	Ig-like V-type.				immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						CTTTTTTTCTATACAACTTGG	0.373																																					p.L96L		Atlas-SNP	.											.	ICOS	20	.	0			c.A288G						.	A		0,4406		0,0,2203	140.0	133.0	136.0		288	-4.8	0.0	2		136	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ICOS	NM_012092.3		0,1,6502	GG,GA,AA		0.0116,0.0,0.0077		96/200	204820588	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	29851	exon2			TTTTCTATACAAC	AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.288A>G	chr2.hg19:g.204820588A>G		171.0	0.0		168.0	48.0	NM_012092	Q8N6W8	Silent	SNP	ENST00000316386.6	hg19	CCDS2363.1																																																																																			.	.		0.373	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256369.1	NM_012092	
ADAM23	8745	hgsc.bcm.edu	37	2	207436449	207436449	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:207436449A>T	ENST00000264377.3	+	17	1894		c.e17-1		ADAM23_ENST00000374416.1_Splice_Site|ADAM23_ENST00000374415.3_Splice_Site	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		TGTTTTCTCTAGGAATGCTAT	0.453																																					.	Melanoma(194;1127 2130 19620 24042 27855)	Atlas-SNP	.											.	ADAM23	239	.	0			c.1567-2A>T						.						98.0	88.0	91.0					2																	207436449		2203	4300	6503	SO:0001630	splice_region_variant	8745	exon17			TTCTCTAGGAATG	AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.1567-1A>T	chr2.hg19:g.207436449A>T		86.0	0.0		55.0	17.0	NM_003812	A2RU59	Splice_Site	SNP	ENST00000264377.3	hg19	CCDS2369.1	.	.	.	.	.	.	.	.	.	.	A	14.73	2.622871	0.46840	.	.	ENSG00000114948	ENST00000264377;ENST00000374416;ENST00000431817;ENST00000374415	.	.	.	6.16	6.16	0.99307	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7887	0.78332	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADAM23	207144694	1.000000	0.71417	0.983000	0.44433	0.143000	0.21401	7.524000	0.81866	2.367000	0.80283	0.528000	0.53228	.	.	.		0.453	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256431.2	NM_003812	Intron
MAP2	4133	hgsc.bcm.edu	37	2	210559831	210559831	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:210559831A>T	ENST00000360351.4	+	7	3443	c.2937A>T	c.(2935-2937)aaA>aaT	p.K979N	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.K975N|MAP2_ENST00000392194.1_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	979					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	ATGCCAAGAAAACTGAAGAGG	0.393																																					p.K979N	Pancreas(27;423 979 28787 29963)	Atlas-SNP	.											.	MAP2	372	.	0			c.A2937T						.						73.0	71.0	72.0					2																	210559831		2203	4300	6503	SO:0001583	missense	4133	exon7			CAAGAAAACTGAA		CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.2937A>T	chr2.hg19:g.210559831A>T	ENSP00000353508:p.Lys979Asn	335.0	0.0		305.0	82.0	NM_002374	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	ENST00000360351.4	hg19	CCDS2384.1	.	.	.	.	.	.	.	.	.	.	A	7.139	0.581399	0.13686	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.18502	2.21;2.21	5.79	4.68	0.58851	MAP2/Tau projection (1);	0.669186	0.14360	N	0.324524	T	0.07593	0.0191	N	0.11427	0.14	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.08055	0.002;0.003	T	0.30297	-0.9983	10	0.29301	T	0.29	-0.4207	1.6616	0.02793	0.5386:0.1397:0.0938:0.2279	.	975;979	P11137-3;P11137	.;MAP2_HUMAN	N	979;975	ENSP00000353508:K979N;ENSP00000392164:K975N	ENSP00000353508:K979N	K	+	3	2	MAP2	210268076	0.001000	0.12720	0.007000	0.13788	0.790000	0.44656	0.621000	0.24418	1.087000	0.41251	0.528000	0.53228	AAA	.	.		0.393	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000256521.2	NM_001039538	
VWC2L	402117	hgsc.bcm.edu	37	2	215440464	215440464	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:215440464A>T	ENST00000312504.5	+	4	1391	c.589A>T	c.(589-591)Atc>Ttc	p.I197F	AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA|VWC2L_ENST00000427124.1_3'UTR	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	197					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						CGAATGTAACATCTGTCATTG	0.458																																					p.I197F		Atlas-SNP	.											.	VWC2L	40	.	0			c.A589T						.						233.0	226.0	229.0					2																	215440464		2018	4206	6224	SO:0001583	missense	402117	exon4			TGTAACATCTGTC	AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.589A>T	chr2.hg19:g.215440464A>T	ENSP00000308976:p.Ile197Phe	122.0	0.0		97.0	31.0	NM_001080500	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	ENST00000312504.5	hg19	CCDS46509.1	.	.	.	.	.	.	.	.	.	.	A	24.2	4.503260	0.85176	.	.	ENSG00000174453	ENST00000312504	T	0.44083	0.93	5.58	5.58	0.84498	.	.	.	.	.	T	0.54822	0.1882	L	0.42245	1.32	0.80722	D	1	D	0.71674	0.998	P	0.62649	0.905	T	0.55692	-0.8101	9	0.54805	T	0.06	-1.7923	15.759	0.78063	1.0:0.0:0.0:0.0	.	197	B2RUY7	VWC2L_HUMAN	F	197	ENSP00000308976:I197F	ENSP00000308976:I197F	I	+	1	0	VWC2L	215148709	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.962000	0.93254	2.121000	0.65114	0.533000	0.62120	ATC	.	.		0.458	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337175.1	NM_001080500	
TRIP12	9320	hgsc.bcm.edu	37	2	230638852	230638852	+	Silent	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:230638852A>G	ENST00000283943.5	-	37	5608	c.5430T>C	c.(5428-5430)gaT>gaC	p.D1810D	TRIP12_ENST00000389044.4_Silent_p.D1858D|TRIP12_ENST00000389045.3_Silent_p.D1540D	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1810					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TGACTGGTATATCCTTCCCTC	0.448																																					p.D1810D		Atlas-SNP	.											.	TRIP12	207	.	0			c.T5430C						.						187.0	168.0	174.0					2																	230638852		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon37			TGGTATATCCTTC	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.5430T>C	chr2.hg19:g.230638852A>G		86.0	0.0		87.0	26.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.448	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
ALPP	250	hgsc.bcm.edu	37	2	233244624	233244624	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr2:233244624T>A	ENST00000392027.2	+	5	904	c.635T>A	c.(634-636)cTc>cAc	p.L212H	AC068134.8_ENST00000441266.1_RNA|AC068134.8_ENST00000439072.1_RNA	NM_001632.3	NP_001623.3	P05187	PPB1_HUMAN	alkaline phosphatase, placental	212					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|endometrium(1)|kidney(4)|large_intestine(2)|liver(1)|lung(10)|ovary(2)	22		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)		GCTACGCAGCTCATCTCCAAC	0.667																																					p.L212H		Atlas-SNP	.											.	ALPP	53	.	0			c.T635A						.						69.0	70.0	70.0					2																	233244624		2203	4300	6503	SO:0001583	missense	250	exon5			CGCAGCTCATCTC	M14169	CCDS2490.1	2q37.1	2010-06-24	2010-06-24		ENSG00000163283	ENSG00000163283	3.1.3.1		439	protein-coding gene	gene with protein product	"""Regan isozyme"""	171800	"""alkaline phosphatase, placental (Regan isozyme)"""			3001717, 3461452	Standard	XM_005246439		Approved		uc002vsq.3	P05187	OTTHUMG00000133255	ENST00000392027.2:c.635T>A	chr2.hg19:g.233244624T>A	ENSP00000375881:p.Leu212His	249.0	0.0		180.0	50.0	NM_001632	P05188|P06861|Q53S78|Q96DB7	Missense_Mutation	SNP	ENST00000392027.2	hg19	CCDS2490.1	.	.	.	.	.	.	.	.	.	.	.	14.13	2.444826	0.43429	.	.	ENSG00000163283	ENST00000392027	D	0.97529	-4.42	2.31	2.31	0.28768	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.072538	0.56097	D	0.000021	D	0.98998	0.9658	H	0.99169	4.455	0.58432	D	0.999992	D	0.89917	1.0	D	0.91635	0.999	D	0.98132	1.0431	10	0.87932	D	0	.	10.365	0.44017	0.0:0.0:0.0:1.0	.	212	P05187	PPB1_HUMAN	H	212	ENSP00000375881:L212H	ENSP00000375881:L212H	L	+	2	0	ALPP	232952868	1.000000	0.71417	0.683000	0.30040	0.075000	0.17131	4.433000	0.59929	1.061000	0.40601	0.248000	0.18094	CTC	.	.		0.667	ALPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257032.3	NM_001632	
PDCD6IP	10015	hgsc.bcm.edu	37	3	33840379	33840379	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:33840379A>T	ENST00000307296.3	+	1	536	c.159A>T	c.(157-159)gcA>gcT	p.A53A	RP11-10C24.1_ENST00000605513.1_lincRNA|RP11-10C24.3_ENST00000604982.1_lincRNA|PDCD6IP_ENST00000457054.2_Silent_p.A53A			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	53	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						GCCGCGCCGCAGTCGGTCGTC	0.701																																					p.A53A		Atlas-SNP	.											.	PDCD6IP	62	.	0			c.A159T						.						7.0	9.0	8.0					3																	33840379		2061	4031	6092	SO:0001819	synonymous_variant	10015	exon1			CGCCGCAGTCGGT	BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.159A>T	chr3.hg19:g.33840379A>T		144.0	0.0		135.0	40.0	NM_013374	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	ENST00000307296.3	hg19	CCDS2660.1																																																																																			.	.		0.701	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253251.2		
CTNNB1	1499	hgsc.bcm.edu	37	3	41266103	41266103	+	Missense_Mutation	SNP	G	G	C	rs121913399|rs121913416		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:41266103G>C	ENST00000349496.5	+	3	380	c.100G>C	c.(100-102)Gga>Cga	p.G34R	CTNNB1_ENST00000453024.1_Missense_Mutation_p.G27R|CTNNB1_ENST00000396185.3_Missense_Mutation_p.G34R|CTNNB1_ENST00000396183.3_Missense_Mutation_p.G34R|CTNNB1_ENST00000405570.1_Missense_Mutation_p.G34R	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	34			G -> E (in PTR). {ECO:0000269|PubMed:10192393}.|G -> R (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|G -> V (in hepatoblastoma; dbSNP:rs28931589). {ECO:0000269|PubMed:9927029}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.G34R(87)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.S33_G34insGTS(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.GIHS34?(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.S33_G34insGI(1)|p.A5_I35del(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		CCTGGACTCTGGAATCCATTC	0.488		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.G34R	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,-1,1	CTNNB1	4904	.	220	Deletion - In frame(105)|Substitution - Missense(87)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)|Insertion - In frame(2)	liver(126)|large_intestine(21)|central_nervous_system(19)|pancreas(15)|endometrium(11)|stomach(10)|skin(4)|pituitary(4)|soft_tissue(2)|small_intestine(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|bone(1)|lung(1)|ovary(1)|kidney(1)	c.G100C						.						92.0	77.0	82.0					3																	41266103		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GACTCTGGAATCC	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.100G>C	chr3.hg19:g.41266103G>C	ENSP00000344456:p.Gly34Arg	151.0	0.0		126.0	42.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.625128	0.87560	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79258	2.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-31.2232	19.9596	0.97236	0.0:0.0:1.0:0.0	.	34	P35222	CTNB1_HUMAN	R	27;34;34;34;34;27;34;34;34	ENSP00000400508:G27R;ENSP00000385604:G34R;ENSP00000412219:G34R;ENSP00000379486:G34R;ENSP00000344456:G34R;ENSP00000411226:G27R;ENSP00000379488:G34R;ENSP00000409302:G34R;ENSP00000401599:G34R	ENSP00000344456:G34R	G	+	1	0	CTNNB1	41241107	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.726000	0.93360	0.655000	0.94253	GGA	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
HHATL	57467	hgsc.bcm.edu	37	3	42735312	42735312	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:42735312T>A	ENST00000441594.1	-	10	1308		c.e10-2		HHATL_ENST00000310417.5_Splice_Site	NM_020707.3	NP_065758.3	Q9HCP6	HHATL_HUMAN	hedgehog acyltransferase-like						negative regulation of N-terminal protein palmitoylation (GO:0060262)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(3)|prostate(3)	19				KIRC - Kidney renal clear cell carcinoma(284;0.215)		TACACATATCTGCAGGAAAGA	0.572																																					.		Atlas-SNP	.											.	HHATL	49	.	0			c.1047-2A>T						.						56.0	45.0	49.0					3																	42735312		2203	4300	6503	SO:0001630	splice_region_variant	57467	exon11			CATATCTGCAGGA	AB042554	CCDS2704.1	3p22	2009-10-06	2007-02-06	2007-02-06	ENSG00000010282	ENSG00000010282			13242	protein-coding gene	gene with protein product	"""membrane bound O-acyltransferase domain containing 3"""	608116	"""chromosome 3 open reading frame 3"", ""GUP1, glycerol uptake/transporter homolog (yeast)"""	C3orf3, GUP1		11374908	Standard	NM_020707		Approved	KIAA1173, OACT3, MSTP002, MBOAT3	uc003clx.3	Q9HCP6	OTTHUMG00000133043	ENST00000441594.1:c.1047-2A>T	chr3.hg19:g.42735312T>A		76.0	0.0		76.0	23.0	NM_020707	Q8TBG3|Q9ULP7	Splice_Site	SNP	ENST00000441594.1	hg19	CCDS2704.1	.	.	.	.	.	.	.	.	.	.	t	11.45	1.641621	0.29157	.	.	ENSG00000010282	ENST00000310417;ENST00000441594	.	.	.	4.09	4.09	0.47781	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1086	0.59261	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HHATL	42710316	1.000000	0.71417	0.845000	0.33349	0.220000	0.24768	7.936000	0.87665	1.476000	0.48215	0.370000	0.22315	.	.	.		0.572	HHATL-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343627.1	NM_020707	Intron
CCDC13	152206	hgsc.bcm.edu	37	3	42751273	42751273	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:42751273T>A	ENST00000310232.6	-	15	1974	c.1891A>T	c.(1891-1893)Aac>Tac	p.N631Y		NM_144719.3	NP_653320.3	Q8IYE1	CCD13_HUMAN	coiled-coil domain containing 13	631										endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(11)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	25						TTGTGCCTGTTGTTAGAGGTG	0.597																																					p.N631Y		Atlas-SNP	.											.	CCDC13	71	.	0			c.A1891T						.						198.0	170.0	179.0					3																	42751273		2203	4300	6503	SO:0001583	missense	152206	exon15			GCCTGTTGTTAGA	AK058196	CCDS2705.1	3p22.1	2005-01-25			ENSG00000244607	ENSG00000244607			26358	protein-coding gene	gene with protein product						12477932	Standard	NM_144719		Approved	FLJ25467	uc003cly.4	Q8IYE1	OTTHUMG00000133046	ENST00000310232.6:c.1891A>T	chr3.hg19:g.42751273T>A	ENSP00000309836:p.Asn631Tyr	94.0	0.0		88.0	23.0	NM_144719		Missense_Mutation	SNP	ENST00000310232.6	hg19	CCDS2705.1	.	.	.	.	.	.	.	.	.	.	T	11.31	1.601972	0.28534	.	.	ENSG00000244607	ENST00000310232	T	0.10860	2.83	4.82	-4.66	0.03329	.	0.789022	0.11530	N	0.554791	T	0.03348	0.0097	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.38672	-0.9650	10	0.30854	T	0.27	.	0.3845	0.00400	0.2552:0.2347:0.1315:0.3786	.	631	Q8IYE1	CCD13_HUMAN	Y	631	ENSP00000309836:N631Y	ENSP00000309836:N631Y	N	-	1	0	CCDC13	42726277	0.000000	0.05858	0.020000	0.16555	0.008000	0.06430	-1.541000	0.02198	-0.553000	0.06158	-1.219000	0.01604	AAC	.	.		0.597	CCDC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256652.1	NM_144719	
ZNF197	10168	hgsc.bcm.edu	37	3	44685446	44685446	+	Nonsense_Mutation	SNP	A	A	T	rs543730571		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:44685446A>T	ENST00000396058.1	+	5	2991	c.2824A>T	c.(2824-2826)Aag>Tag	p.K942*	ZNF197_ENST00000383745.2_Intron|ZNF197_ENST00000344387.4_Nonsense_Mutation_p.K942*|RP11-944L7.4_ENST00000457331.1_RNA|ZNF197_ENST00000383744.4_Intron			O14709	ZN197_HUMAN	zinc finger protein 197	942					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(1)	25				KIRC - Kidney renal clear cell carcinoma(197;0.0478)|Kidney(197;0.0598)		CTTTACTTCTAAGAGGAATTT	0.373																																					p.K942X		Atlas-SNP	.											.	ZNF197	81	.	0			c.A2824T						.						71.0	78.0	76.0					3																	44685446		2203	4300	6503	SO:0001587	stop_gained	10168	exon6			ACTTCTAAGAGGA	AF011573	CCDS2717.1, CCDS33743.1	3p21	2013-01-09	2003-10-07		ENSG00000186448	ENSG00000186448		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12988	protein-coding gene	gene with protein product			"""zinc finger protein 166"""	ZNF166		9380504, 8353497	Standard	XM_005264783		Approved	P18, D3S1363E, ZKSCAN9, ZSCAN41	uc003cnm.3	O14709	OTTHUMG00000133089	ENST00000396058.1:c.2824A>T	chr3.hg19:g.44685446A>T	ENSP00000379370:p.Lys942*	208.0	0.0		190.0	52.0	NM_006991	B2RAH8|Q86VG0	Nonsense_Mutation	SNP	ENST00000396058.1	hg19	CCDS2717.1	.	.	.	.	.	.	.	.	.	.	A	37	6.587061	0.97684	.	.	ENSG00000186448	ENST00000344387;ENST00000396058	.	.	.	4.07	4.07	0.47477	.	0.000000	0.34025	U	0.004335	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.3905	0.26907	0.8988:0.0:0.1012:0.0	.	.	.	.	X	942	.	ENSP00000345809:K942X	K	+	1	0	ZNF197	44660450	0.000000	0.05858	1.000000	0.80357	0.991000	0.79684	1.491000	0.35583	1.828000	0.53243	0.455000	0.32223	AAG	.	.		0.373	ZNF197-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256747.4	NM_006991	
PLXNB1	5364	hgsc.bcm.edu	37	3	48455080	48455080	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:48455080T>A	ENST00000358536.4	-	23	4803	c.4534A>T	c.(4534-4536)Agg>Tgg	p.R1512W	PLXNB1_ENST00000465117.1_5'Flank|PLXNB1_ENST00000296440.6_Splice_Site_p.R1512W|PLXNB1_ENST00000448774.2_Splice_Site_p.R123W|PLXNB1_ENST00000358459.4_Splice_Site_p.R1329W|PLXNB1_ENST00000456774.1_Splice_Site_p.R1329W	NM_002673.4	NP_002664.2	O43157	PLXB1_HUMAN	plexin B1	1512					axon guidance (GO:0007411)|cell migration (GO:0016477)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast proliferation (GO:0033689)|neuron projection morphogenesis (GO:0048812)|ossification involved in bone maturation (GO:0043931)|positive regulation of axonogenesis (GO:0050772)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	GTPase activating protein binding (GO:0032794)|receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(10)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGCACCCACCTGTACATGAGG	0.622																																					p.R1512W		Atlas-SNP	.											.	PLXNB1	150	.	0			c.A4534T						.						30.0	33.0	32.0					3																	48455080		2203	4300	6503	SO:0001630	splice_region_variant	5364	exon23			CCCACCTGTACAT	X87904	CCDS2765.1	3p21.31	2008-07-18			ENSG00000164050	ENSG00000164050		"""Plexins"""	9103	protein-coding gene	gene with protein product		601053		PLXN5		8570614, 11035813	Standard	XM_005265234		Approved	SEP, KIAA0407	uc003csw.2	O43157	OTTHUMG00000133527	ENST00000358536.4:c.4535+1A>T	chr3.hg19:g.48455080T>A		100.0	0.0		89.0	28.0	NM_001130082	A6H8Y2|Q6NY20|Q9UIV7|Q9UJ92|Q9UJ93	Missense_Mutation	SNP	ENST00000358536.4	hg19	CCDS2765.1	.	.	.	.	.	.	.	.	.	.	T	18.57	3.652585	0.67472	.	.	ENSG00000164050	ENST00000296440;ENST00000358459;ENST00000358536;ENST00000448774;ENST00000456774	T;T;T;T;T	0.14516	3.65;3.69;3.65;2.5;3.69	5.29	5.29	0.74685	.	0.102139	0.64402	D	0.000004	T	0.37237	0.0996	M	0.75264	2.295	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.975;0.997	T	0.10042	-1.0647	10	0.42905	T	0.14	.	14.4032	0.67063	0.0:0.0:0.0:1.0	.	1512;1329	O43157;O43157-2	PLXB1_HUMAN;.	W	1512;1329;1512;123;1329	ENSP00000296440:R1512W;ENSP00000351242:R1329W;ENSP00000351338:R1512W;ENSP00000389320:R123W;ENSP00000414199:R1329W	ENSP00000296440:R1512W	R	-	1	2	PLXNB1	48430084	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.927000	0.87577	1.984000	0.57885	0.460000	0.39030	AGG	.	.		0.622	PLXNB1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344454.1	NM_002673	Missense_Mutation
CELSR3	1951	hgsc.bcm.edu	37	3	48685300	48685300	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:48685300T>A	ENST00000164024.4	-	20	7383	c.7103A>T	c.(7102-7104)cAg>cTg	p.Q2368L	CELSR3_ENST00000544264.1_Missense_Mutation_p.Q2373L	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	2368					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCGTGGGGACTGGGAAGGCAG	0.632																																					p.Q2368L		Atlas-SNP	.											.	CELSR3	237	.	0			c.A7103T						.						85.0	94.0	91.0					3																	48685300		2203	4299	6502	SO:0001583	missense	1951	exon20			GGGGACTGGGAAG	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.7103A>T	chr3.hg19:g.48685300T>A	ENSP00000164024:p.Gln2368Leu	34.0	0.0		38.0	9.0	NM_001407	O75092	Missense_Mutation	SNP	ENST00000164024.4	hg19	CCDS2775.1	.	.	.	.	.	.	.	.	.	.	T	10.96	1.499384	0.26861	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.09723	2.95;2.95	4.22	2.96	0.34315	Domain of unknown function DUF3497 (1);	.	.	.	.	T	0.04770	0.0129	N	0.03608	-0.345	0.27686	N	0.946268	B;B	0.06786	0.001;0.001	B;B	0.14023	0.01;0.007	T	0.34004	-0.9846	9	0.21540	T	0.41	.	9.4711	0.38842	0.0:0.0:0.4095:0.5905	.	2368;2438	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	L	2368;2373	ENSP00000164024:Q2368L;ENSP00000445694:Q2373L	ENSP00000164024:Q2368L	Q	-	2	0	CELSR3	48660304	1.000000	0.71417	0.979000	0.43373	0.899000	0.52679	3.783000	0.55409	1.906000	0.55180	0.379000	0.24179	CAG	.	.		0.632	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
ARIH2	10425	hgsc.bcm.edu	37	3	49006053	49006053	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:49006053A>C	ENST00000356401.4	+	7	964	c.625A>C	c.(625-627)Aaa>Caa	p.K209Q	ARIH2_ENST00000449376.1_Missense_Mutation_p.K209Q|ARIH2_ENST00000490095.1_3'UTR	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	209					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		ATTGAGAGAGAAATACAGGCG	0.507																																					p.K209Q		Atlas-SNP	.											.	ARIH2	32	.	0			c.A625C						.						171.0	167.0	168.0					3																	49006053		2203	4300	6503	SO:0001583	missense	10425	exon7			AGAGAGAAATACA	AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.625A>C	chr3.hg19:g.49006053A>C	ENSP00000348769:p.Lys209Gln	67.0	0.0		51.0	12.0	NM_006321	Q9HBZ6|Q9UEM9	Missense_Mutation	SNP	ENST00000356401.4	hg19	CCDS2780.1	.	.	.	.	.	.	.	.	.	.	A	33	5.277347	0.95459	.	.	ENSG00000177479	ENST00000356401;ENST00000449376;ENST00000444790;ENST00000395481	T;T	0.67698	-0.28;-0.28	5.95	5.95	0.96441	Zinc finger, C6HC-type (2);	0.000000	0.85682	D	0.000000	D	0.85120	0.5624	M	0.89904	3.07	0.80722	D	1	D;D;D	0.89917	0.997;0.991;1.0	D;D;D	0.78314	0.939;0.991;0.991	D	0.87905	0.2693	10	0.66056	D	0.02	.	16.4237	0.83790	1.0:0.0:0.0:0.0	.	216;209;209	B3KMG5;Q53ET9;O95376	.;.;ARI2_HUMAN	Q	209;209;208;33	ENSP00000348769:K209Q;ENSP00000403222:K209Q	ENSP00000348769:K209Q	K	+	1	0	ARIH2	48981057	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.932000	0.92897	2.279000	0.76181	0.533000	0.62120	AAA	.	.		0.507	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257525.1	NM_006321	
QRICH1	54870	hgsc.bcm.edu	37	3	49070097	49070097	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:49070097G>A	ENST00000395443.2	-	8	2477	c.2005C>T	c.(2005-2007)Cgg>Tgg	p.R669W	QRICH1_ENST00000357496.2_Missense_Mutation_p.R669W|QRICH1_ENST00000424300.1_Missense_Mutation_p.R669W|QRICH1_ENST00000479449.1_5'Flank|RP13-131K19.6_ENST00000607245.1_RNA	NM_198880.1	NP_942581.1	Q2TAL8	QRIC1_HUMAN	glutamine-rich 1	669						nucleus (GO:0005634)				breast(2)|endometrium(5)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25				BRCA - Breast invasive adenocarcinoma(193;8.88e-05)|Kidney(197;0.00239)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		TTCAAGTACCGGATACTCGTG	0.517																																					p.R669W		Atlas-SNP	.											.	QRICH1	48	.	0			c.C2005T						.						128.0	115.0	119.0					3																	49070097		2203	4300	6503	SO:0001583	missense	54870	exon8			AGTACCGGATACT		CCDS2787.1	3p21.31	2011-06-03			ENSG00000198218	ENSG00000198218			24713	protein-coding gene	gene with protein product						12477932	Standard	NM_017730		Approved	FLJ20259	uc003cvv.3	Q2TAL8	OTTHUMG00000156772	ENST00000395443.2:c.2005C>T	chr3.hg19:g.49070097G>A	ENSP00000378830:p.Arg669Trp	79.0	0.0		73.0	5.0	NM_198880	Q4G0F7|Q7L621|Q8TEA5	Missense_Mutation	SNP	ENST00000395443.2	hg19	CCDS2787.1	.	.	.	.	.	.	.	.	.	.	G	32	5.153115	0.94645	.	.	ENSG00000198218	ENST00000395443;ENST00000357496;ENST00000424300	.	.	.	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.83622	0.5294	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85425	0.1145	9	0.87932	D	0	-11.435	19.4646	0.94932	0.0:0.0:1.0:0.0	.	669	Q2TAL8	QRIC1_HUMAN	W	669	.	ENSP00000350094:R669W	R	-	1	2	QRICH1	49045101	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.403000	0.66338	2.606000	0.88127	0.650000	0.86243	CGG	.	.		0.517	QRICH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345669.1	NM_017730	
DAG1	1605	hgsc.bcm.edu	37	3	49570032	49570032	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:49570032A>T	ENST00000539901.1	+	3	2646	c.2088A>T	c.(2086-2088)ctA>ctT	p.L696L	DAG1_ENST00000538711.1_Silent_p.L696L|DAG1_ENST00000308775.2_Silent_p.L696L|DAG1_ENST00000545947.1_Silent_p.L696L|DAG1_ENST00000541308.1_Silent_p.L696L|DAG1_ENST00000515359.2_Silent_p.L696L	NM_001177644.2	NP_001171115	Q14118	DAG1_HUMAN	dystroglycan 1 (dystrophin-associated glycoprotein 1)	696	Peptidase S72.				basement membrane organization (GO:0071711)|branching involved in salivary gland morphogenesis (GO:0060445)|calcium-dependent cell-matrix adhesion (GO:0016340)|commissural neuron axon guidance (GO:0071679)|cytoskeletal anchoring at plasma membrane (GO:0007016)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|microtubule anchoring (GO:0034453)|modulation by virus of host morphology or physiology (GO:0019048)|morphogenesis of an epithelial sheet (GO:0002011)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell migration (GO:0030336)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of protein kinase B signaling (GO:0051898)|nerve maturation (GO:0021682)|NLS-bearing protein import into nucleus (GO:0006607)|response to peptide hormone (GO:0043434)	basement membrane (GO:0005604)|basolateral plasma membrane (GO:0016323)|cell outer membrane (GO:0009279)|cell-cell adherens junction (GO:0005913)|contractile ring (GO:0070938)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystroglycan complex (GO:0016011)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|membrane raft (GO:0045121)|node of Ranvier (GO:0033268)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|alpha-actinin binding (GO:0051393)|calcium ion binding (GO:0005509)|laminin-1 binding (GO:0043237)|SH2 domain binding (GO:0042169)|structural constituent of muscle (GO:0008307)|tubulin binding (GO:0015631)|vinculin binding (GO:0017166)|virus receptor activity (GO:0001618)			NS(1)|autonomic_ganglia(2)|breast(2)|endometrium(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)|skin(1)	23				BRCA - Breast invasive adenocarcinoma(193;5.13e-05)|Kidney(197;0.00241)|KIRC - Kidney renal clear cell carcinoma(197;0.00258)		CCAACGCCCTAGAGCCTGACT	0.607																																					p.L696L		Atlas-SNP	.											.	DAG1	60	.	0			c.A2088T						.						67.0	64.0	65.0					3																	49570032		2203	4300	6503	SO:0001819	synonymous_variant	1605	exon4			CGCCCTAGAGCCT	L19711	CCDS2799.1	3p21	2014-09-17			ENSG00000173402	ENSG00000173402			2666	protein-coding gene	gene with protein product	"""alpha-dystroglycan"", ""dystrophin-associated glycoprotein-1"", ""beta-dystroglycan"""	128239				7774920, 1741056	Standard	NM_001177643		Approved	A3a, 156DAG, AGRNR, DAG	uc021wyd.1	Q14118	OTTHUMG00000156869	ENST00000539901.1:c.2088A>T	chr3.hg19:g.49570032A>T		86.0	0.0		94.0	23.0	NM_001177642	A8K6M7|Q969J9	Silent	SNP	ENST00000539901.1	hg19	CCDS2799.1																																																																																			.	.		0.607	DAG1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346326.1		
DOCK3	1795	hgsc.bcm.edu	37	3	51264732	51264732	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:51264732T>A	ENST00000266037.9	+	16	1419	c.1396T>A	c.(1396-1398)Tca>Aca	p.S466T		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	466	DHR-1.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		CAGCTTGGGTTCAGGAGAGCC	0.438																																					p.S466T		Atlas-SNP	.											.	DOCK3	397	.	0			c.T1396A						.						169.0	161.0	163.0					3																	51264732		1867	4101	5968	SO:0001583	missense	1795	exon16			TTGGGTTCAGGAG	AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.1396T>A	chr3.hg19:g.51264732T>A	ENSP00000266037:p.Ser466Thr	80.0	0.0		55.0	18.0	NM_004947	O15017	Missense_Mutation	SNP	ENST00000266037.9	hg19	CCDS46835.1	.	.	.	.	.	.	.	.	.	.	T	14.90	2.672392	0.47781	.	.	ENSG00000088538	ENST00000266037	T	0.14766	2.48	6.05	6.05	0.98169	.	0.331275	0.32503	N	0.006012	T	0.16981	0.0408	L	0.53671	1.685	0.43852	D	0.996449	B	0.30889	0.299	B	0.34824	0.19	T	0.02294	-1.1181	10	0.44086	T	0.13	.	11.6453	0.51257	0.1324:0.0:0.0:0.8676	.	466	Q8IZD9	DOCK3_HUMAN	T	466	ENSP00000266037:S466T	ENSP00000266037:S466T	S	+	1	0	DOCK3	51239772	0.109000	0.22037	1.000000	0.80357	0.998000	0.95712	1.625000	0.37029	2.320000	0.78422	0.528000	0.53228	TCA	.	.		0.438	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346478.5	NM_004947	
TKT	7086	hgsc.bcm.edu	37	3	53263101	53263101	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:53263101T>A	ENST00000462138.1	-	10	1405	c.1317A>T	c.(1315-1317)tcA>tcT	p.S439S	TKT_ENST00000423525.2_Silent_p.S439S|TKT_ENST00000296289.6_Silent_p.S392S|TKT_ENST00000423516.1_Silent_p.S447S|TKT_ENST00000461139.1_5'UTR			P29401	TKT_HUMAN	transketolase	439					carbohydrate metabolic process (GO:0005975)|energy reserve metabolic process (GO:0006112)|glyceraldehyde-3-phosphate biosynthetic process (GO:0046166)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, non-oxidative branch (GO:0009052)|regulation of growth (GO:0040008)|small molecule metabolic process (GO:0044281)|xylulose biosynthetic process (GO:0005999)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|peroxisome (GO:0005777)|vesicle (GO:0031982)	cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|transketolase activity (GO:0004802)			endometrium(5)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	17		Prostate(884;0.0959)		BRCA - Breast invasive adenocarcinoma(193;0.000159)|OV - Ovarian serous cystadenocarcinoma(275;0.000314)|Kidney(197;0.00178)|KIRC - Kidney renal clear cell carcinoma(197;0.00201)		ATGTGGGGACTGACCGAAACA	0.537																																					p.S447S	Colon(133;1506 2347 35238 42177)	Atlas-SNP	.											.	TKT	38	.	0			c.A1341T						.						160.0	157.0	158.0					3																	53263101		2203	4300	6503	SO:0001819	synonymous_variant	7086	exon11			GGGGACTGACCGA		CCDS2871.1, CCDS58834.1	3p14.3	2008-07-31	2008-07-31		ENSG00000163931	ENSG00000163931	2.2.1.1		11834	protein-coding gene	gene with protein product	"""Wernicke-Korsakoff syndrome"""	606781				1567394	Standard	NM_001064		Approved		uc011beq.2	P29401	OTTHUMG00000158192	ENST00000462138.1:c.1317A>T	chr3.hg19:g.53263101T>A		115.0	0.0		95.0	20.0	NM_001258028	A8K089|B4DE31|E7EPA7|Q8TBA3|Q96HH3	Silent	SNP	ENST00000462138.1	hg19	CCDS2871.1																																																																																			.	.		0.537	TKT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350356.1		
FLNB	2317	hgsc.bcm.edu	37	3	58112352	58112352	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:58112352G>T	ENST00000295956.4	+	24	4250	c.4085G>T	c.(4084-4086)gGc>gTc	p.G1362V	FLNB_ENST00000358537.3_Missense_Mutation_p.G1362V|FLNB_ENST00000493452.1_Missense_Mutation_p.G1193V|FLNB_ENST00000357272.4_Missense_Mutation_p.G1362V|FLNB_ENST00000419752.2_Missense_Mutation_p.G1193V|FLNB_ENST00000490882.1_Missense_Mutation_p.G1362V|FLNB_ENST00000348383.5_Missense_Mutation_p.G1362V|FLNB_ENST00000429972.2_Missense_Mutation_p.G1362V	NM_001457.3	NP_001448.2	O75369	FLNB_HUMAN	filamin B, beta	1362	Interaction with FBLP1.				actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|cytokine-mediated signaling pathway (GO:0019221)|cytoskeletal anchoring at plasma membrane (GO:0007016)|signal transduction (GO:0007165)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin binding (GO:0003779)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(13)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(23)|liver(2)|lung(38)|ovary(6)|prostate(3)|skin(8)|upper_aerodigestive_tract(3)|urinary_tract(5)	120				BRCA - Breast invasive adenocarcinoma(55;0.000335)|KIRC - Kidney renal clear cell carcinoma(284;0.0726)|Kidney(284;0.0898)		GGTGGGCTTGGCATAACTGTT	0.458																																					p.G1362V		Atlas-SNP	.											.	FLNB	430	.	0			c.G4085T						.						111.0	109.0	110.0					3																	58112352		2203	4300	6503	SO:0001583	missense	2317	exon24			GGCTTGGCATAAC	AF043045	CCDS2885.1, CCDS54599.1, CCDS54600.1, CCDS54601.1	3p14.3	2011-02-11	2009-07-23		ENSG00000136068	ENSG00000136068			3755	protein-coding gene	gene with protein product	"""actin binding protein 278"""	603381	"""filamin B, beta (actin binding protein 278)"", ""Larsen syndrome 1 (autosomal dominant)"""	FLN1L, LRS1		8327473, 10449914, 14991055, 16801345	Standard	NM_001457		Approved	TAP, TABP, ABP-278, FH1	uc010hne.2	O75369	OTTHUMG00000159158	ENST00000295956.4:c.4085G>T	chr3.hg19:g.58112352G>T	ENSP00000295956:p.Gly1362Val	182.0	0.0		170.0	89.0	NM_001457	B2ZZ83|B2ZZ84|B2ZZ85|C9JKE6|C9JMC4|Q13706|Q59EC2|Q60FE7|Q6MZJ1|Q8WXS9|Q8WXT0|Q8WXT1|Q8WXT2|Q8WXT3|Q9NRB5|Q9NT26|Q9UEV9	Missense_Mutation	SNP	ENST00000295956.4	hg19	CCDS2885.1	.	.	.	.	.	.	.	.	.	.	G	26.0	4.692024	0.88735	.	.	ENSG00000136068	ENST00000295956;ENST00000490882;ENST00000358537;ENST00000429972;ENST00000348383;ENST00000357272;ENST00000493452;ENST00000419752	D;D;D;D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	5.95	5.95	0.96441	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.92948	0.7756	M	0.79123	2.44	0.80722	D	1	D;D;D;D;D;D	0.89917	0.992;1.0;1.0;1.0;1.0;1.0	P;D;D;D;D;D	0.97110	0.892;0.999;1.0;1.0;1.0;1.0	D	0.92845	0.6292	10	0.87932	D	0	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	1362;1362;1193;1193;1362;1362	O75369-2;B2ZZ83;E7EN95;O75369-7;Q60FE7;O75369	.;.;.;.;.;FLNB_HUMAN	V	1362;1362;1362;1362;1362;1362;1193;1193	ENSP00000295956:G1362V;ENSP00000420213:G1362V;ENSP00000351339:G1362V;ENSP00000415599:G1362V;ENSP00000232447:G1362V;ENSP00000349819:G1362V;ENSP00000418510:G1193V;ENSP00000414532:G1193V	ENSP00000295956:G1362V	G	+	2	0	FLNB	58087392	1.000000	0.71417	1.000000	0.80357	0.686000	0.39977	9.869000	0.99810	2.824000	0.97209	0.655000	0.94253	GGC	.	.		0.458	FLNB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000353569.1	NM_001457	
ATXN7	6314	hgsc.bcm.edu	37	3	63973873	63973873	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:63973873A>T	ENST00000295900.6	+	9	1784	c.1234A>T	c.(1234-1236)Agg>Tgg	p.R412W	ATXN7_ENST00000484332.1_Missense_Mutation_p.R267W|ATXN7_ENST00000538065.1_Missense_Mutation_p.R412W|ATXN7_ENST00000398590.3_Missense_Mutation_p.R412W|ATXN7_ENST00000487717.1_Missense_Mutation_p.R412W	NM_000333.3	NP_000324.1	O15265	ATX7_HUMAN	ataxin 7	412	Pro-rich.				cell death (GO:0008219)|chromatin organization (GO:0006325)|histone deubiquitination (GO:0016578)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of phosphorylation (GO:0042326)|nucleus organization (GO:0006997)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(7)|lung(12)|prostate(2)|stomach(1)|urinary_tract(3)	35		Prostate(884;0.0181)		BRCA - Breast invasive adenocarcinoma(55;0.000614)|KIRC - Kidney renal clear cell carcinoma(15;0.00294)|Kidney(15;0.00305)		GCAGCCTCTCAGGGACCCGCA	0.507																																					p.R412W		Atlas-SNP	.											.	ATXN7	126	.	0			c.A1234T						.						115.0	131.0	126.0					3																	63973873		1956	4146	6102	SO:0001583	missense	6314	exon9			CCTCTCAGGGACC	AJ000517	CCDS43102.1, CCDS46861.1, CCDS46861.2, CCDS54603.1	3p21.1-p12	2014-09-17	2004-08-12	2004-08-12	ENSG00000163635	ENSG00000163635		"""Ataxins"""	10560	protein-coding gene	gene with protein product		607640	"""spinocerebellar ataxia 7 (olivopontocerebellar atrophy with retinal degeneration)"""	SCA7		7647798, 10598805	Standard	NM_000333		Approved	OPCA3, ADCAII	uc021wzy.1	O15265	OTTHUMG00000158763	ENST00000295900.6:c.1234A>T	chr3.hg19:g.63973873A>T	ENSP00000295900:p.Arg412Trp	177.0	0.0		145.0	39.0	NM_000333	B4E207|E9PHP9|O75328|O75329|Q9Y6P8	Missense_Mutation	SNP	ENST00000295900.6	hg19	CCDS43102.1	.	.	.	.	.	.	.	.	.	.	A	35	5.547343	0.96488	.	.	ENSG00000163635	ENST00000398590;ENST00000295900;ENST00000487717;ENST00000538065;ENST00000484332	T;T;T;T;T	0.18338	2.22;2.23;2.23;2.22;2.22	5.95	5.95	0.96441	.	0.131887	0.64402	D	0.000002	T	0.44414	0.1292	M	0.75264	2.295	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.995	T	0.40440	-0.9563	10	0.87932	D	0	-15.7601	16.4237	0.83790	1.0:0.0:0.0:0.0	.	267;412;412	E9PHP9;O15265-2;O15265	.;.;ATX7_HUMAN	W	412;412;412;412;267	ENSP00000381590:R412W;ENSP00000295900:R412W;ENSP00000420234:R412W;ENSP00000439585:R412W;ENSP00000428277:R267W	ENSP00000295900:R412W	R	+	1	2	ATXN7	63948913	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.279000	0.95777	2.279000	0.76181	0.533000	0.62120	AGG	.	.		0.507	ATXN7-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000352070.1	NM_000333	
MINA	84864	hgsc.bcm.edu	37	3	97686360	97686360	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:97686360T>A	ENST00000333396.7	-	2	660	c.78A>T	c.(76-78)gcA>gcT	p.A26A	MINA_ENST00000330299.2_Silent_p.A26A|MINA_ENST00000394198.2_Silent_p.A26A|MINA_ENST00000360258.4_Silent_p.A26A	NM_001042533.2|NM_032778.5	NP_001035998.1|NP_116167.3			MYC induced nuclear antigen											breast(2)|endometrium(1)|large_intestine(1)|lung(8)|ovary(1)	13						GCCCCCCAGCTGCTTCTAACT	0.478																																					p.A26A		Atlas-SNP	.											.	MINA	39	.	0			c.A78T						.						48.0	49.0	48.0					3																	97686360		2203	4300	6503	SO:0001819	synonymous_variant	84864	exon2			CCCAGCTGCTTCT	AB083189	CCDS2929.1, CCDS43114.1	3q22.1	2005-07-22			ENSG00000170854	ENSG00000170854			19441	protein-coding gene	gene with protein product		612049				12091391	Standard	NM_001042533		Approved	MINA53, FLJ14393, mdig	uc003dsb.1	Q8IUF8	OTTHUMG00000160107	ENST00000333396.7:c.78A>T	chr3.hg19:g.97686360T>A		58.0	0.0		67.0	13.0	NM_001261829		Silent	SNP	ENST00000333396.7	hg19	CCDS43114.1																																																																																			.	.		0.478	MINA-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359244.3	NM_032778	
OR5K2	402135	hgsc.bcm.edu	37	3	98216964	98216964	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:98216964G>A	ENST00000427338.1	+	1	517	c.440G>A	c.(439-441)gGc>gAc	p.G147D	CLDND1_ENST00000502288.1_3'UTR	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	147						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						ATGACCACAGGCGCCTTCATA	0.458																																					p.G147D		Atlas-SNP	.											.	OR5K2	56	.	0			c.G440A						.						147.0	149.0	149.0					3																	98216964		2203	4300	6503	SO:0001583	missense	402135	exon1			CCACAGGCGCCTT	AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.440G>A	chr3.hg19:g.98216964G>A	ENSP00000393889:p.Gly147Asp	124.0	0.0		126.0	37.0	NM_001004737	B2RN70|Q6IF47	Missense_Mutation	SNP	ENST00000427338.1	hg19	CCDS33804.1	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102826	0.37145	.	.	ENSG00000231861	ENST00000427338	T	0.39787	1.06	2.87	2.87	0.33458	GPCR, rhodopsin-like superfamily (1);	0.172228	0.27807	N	0.017775	T	0.67646	0.2915	M	0.93283	3.4	0.34987	D	0.754642	D	0.67145	0.996	D	0.72075	0.976	T	0.78125	-0.2326	10	0.66056	D	0.02	-7.634	8.0572	0.30612	0.0:0.2519:0.7481:0.0	.	147	Q8NHB8	OR5K2_HUMAN	D	147	ENSP00000393889:G147D	ENSP00000393889:G147D	G	+	2	0	OR5K2	99699654	0.014000	0.17966	0.553000	0.28255	0.603000	0.37013	-0.232000	0.09055	1.918000	0.55548	0.298000	0.19748	GGC	.	.		0.458	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359020.2		
ALCAM	214	hgsc.bcm.edu	37	3	105266289	105266289	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:105266289A>T	ENST00000306107.5	+	11	1796	c.1296A>T	c.(1294-1296)acA>acT	p.T432T	ALCAM_ENST00000486979.2_Silent_p.T381T|ALCAM_ENST00000389927.4_Silent_p.T154T|ALCAM_ENST00000472644.2_Silent_p.T432T	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	432	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						TATCTAAAACAATAATCTGCC	0.348																																					p.T432T		Atlas-SNP	.											.	ALCAM	71	.	0			c.A1296T						.						73.0	69.0	71.0					3																	105266289		2203	4297	6500	SO:0001819	synonymous_variant	214	exon11			TAAAACAATAATC	AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1296A>T	chr3.hg19:g.105266289A>T		339.0	0.0		302.0	80.0	NM_001627	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Silent	SNP	ENST00000306107.5	hg19	CCDS33810.1	.	.	.	.	.	.	.	.	.	.	A	7.080	0.570033	0.13560	.	.	ENSG00000170017	ENST00000465413	.	.	.	5.76	-1.82	0.07857	.	.	.	.	.	T	0.53530	0.1802	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49103	-0.8974	4	.	.	.	-16.0416	8.5618	0.33516	0.3412:0.4366:0.0:0.2222	.	.	.	.	Y	193	.	.	N	+	1	0	ALCAM	106748979	0.883000	0.30277	0.993000	0.49108	0.638000	0.38207	-0.133000	0.10451	-0.177000	0.10690	0.477000	0.44152	AAT	.	.		0.348	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353764.1	NM_001627	
ATG3	64422	hgsc.bcm.edu	37	3	112262916	112262916	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:112262916T>A	ENST00000283290.5	-	6	815	c.381A>T	c.(379-381)acA>acT	p.T127T	ATG3_ENST00000495756.1_5'UTR|ATG3_ENST00000402314.2_Silent_p.T127T	NM_022488.3	NP_071933.2	Q9NT62	ATG3_HUMAN	autophagy related 3	127					autophagic vacuole assembly (GO:0000045)|cellular protein modification process (GO:0006464)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)|protein targeting to membrane (GO:0006612)|protein ubiquitination (GO:0016567)|regulation of cilium assembly (GO:1902017)	cytoplasmic ubiquitin ligase complex (GO:0000153)|cytosol (GO:0005829)	Atg12 ligase activity (GO:0019777)|Atg8 ligase activity (GO:0019776)|enzyme binding (GO:0019899)|small conjugating protein ligase activity (GO:0019787)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(3)	9						TATTTTCCAGTGTGATCTCTT	0.279																																					p.T127T		Atlas-SNP	.											.	ATG3	23	.	0			c.A381T						.						37.0	43.0	41.0					3																	112262916		2200	4279	6479	SO:0001819	synonymous_variant	64422	exon6			TTCCAGTGTGATC		CCDS2966.1, CCDS63721.1	3q13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000144848	ENSG00000144848			20962	protein-coding gene	gene with protein product		609606	"""APG3 autophagy 3-like (S. cerevisiae)"", ""ATG3 autophagy related 3 homolog (S. cerevisiae)"""	APG3L		11825910	Standard	NM_022488		Approved	PC3-96, FLJ22125, MGC15201, DKFZp564M1178	uc003dzd.3	Q9NT62	OTTHUMG00000159260	ENST00000283290.5:c.381A>T	chr3.hg19:g.112262916T>A		449.0	1.0		400.0	114.0	NM_022488	Q6PKC5|Q9H6L9	Silent	SNP	ENST00000283290.5	hg19	CCDS2966.1																																																																																			.	.		0.279	ATG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354147.1	NM_022488	
CCDC80	151887	hgsc.bcm.edu	37	3	112357260	112357260	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:112357260T>A	ENST00000206423.3	-	2	2446	c.1493A>T	c.(1492-1494)cAg>cTg	p.Q498L	CCDC80_ENST00000475181.1_5'Flank|CCDC80_ENST00000439685.2_Missense_Mutation_p.Q498L	NM_199511.1|NM_199512.1	NP_955805.1|NP_955806.1	Q76M96	CCD80_HUMAN	coiled-coil domain containing 80	498	Lys-rich.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(21)|ovary(3)|pancreas(2)|prostate(4)	51						AATTTTGTCCTGGGCCTTCTT	0.552																																					p.Q498L		Atlas-SNP	.											.	CCDC80	100	.	0			c.A1493T						.						82.0	86.0	85.0					3																	112357260		2203	4300	6503	SO:0001583	missense	151887	exon2			TTGTCCTGGGCCT	AY333429	CCDS2968.1	3q13.2	2010-12-24			ENSG00000091986	ENSG00000091986			30649	protein-coding gene	gene with protein product	"""steroid sensitive gene 1"""	608298				15325258, 18178152	Standard	XM_005247135		Approved	URB, SSG1, DRO1	uc003dzf.3	Q76M96	OTTHUMG00000159265	ENST00000206423.3:c.1493A>T	chr3.hg19:g.112357260T>A	ENSP00000206423:p.Gln498Leu	90.0	0.0		73.0	21.0	NM_199511	D3DN67|Q5PR20|Q6GPG9|Q8IVT6|Q8NBV1|Q8NHY8	Missense_Mutation	SNP	ENST00000206423.3	hg19	CCDS2968.1	.	.	.	.	.	.	.	.	.	.	T	15.13	2.741267	0.49151	.	.	ENSG00000091986	ENST00000206423;ENST00000439685;ENST00000444594	T;T	0.44482	0.92;0.92	4.98	0.879	0.19155	.	0.190911	0.47093	D	0.000259	T	0.20333	0.0489	N	0.24115	0.695	0.09310	N	1	B;B;B	0.26809	0.16;0.099;0.043	B;B;B	0.22601	0.037;0.04;0.011	T	0.06481	-1.0824	10	0.29301	T	0.29	-11.1986	1.9084	0.03282	0.1308:0.1486:0.1356:0.5851	.	509;498;498	Q76M96-2;A3KC71;Q76M96	.;.;CCD80_HUMAN	L	498;498;126	ENSP00000206423:Q498L;ENSP00000411814:Q498L	ENSP00000206423:Q498L	Q	-	2	0	CCDC80	113839950	0.791000	0.28800	0.904000	0.35570	0.944000	0.59088	1.381000	0.34362	0.323000	0.23307	0.454000	0.30748	CAG	.	.		0.552	CCDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354219.1	NM_199511	
POLQ	10721	hgsc.bcm.edu	37	3	121186434	121186434	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:121186434T>A	ENST00000264233.5	-	24	7027	c.6899A>T	c.(6898-6900)gAg>gTg	p.E2300V		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	2300					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		AGCTCTCTCCTCCATCTGTGC	0.453								DNA polymerases (catalytic subunits)																													p.E2300V	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.A6899T						.						187.0	171.0	176.0					3																	121186434		2203	4300	6503	SO:0001583	missense	10721	exon24			CTCTCCTCCATCT	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.6899A>T	chr3.hg19:g.121186434T>A	ENSP00000264233:p.Glu2300Val	110.0	0.0		95.0	34.0	NM_199420	O95160|Q6VMB5	Missense_Mutation	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952134	0.73787	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	T	0.52526	0.66	5.58	-4.36	0.03645	.	0.397058	0.24708	N	0.036244	T	0.32406	0.0828	L	0.60455	1.87	0.09310	N	1	B;P	0.51933	0.011;0.949	B;B	0.43052	0.008;0.406	T	0.26121	-1.0112	10	0.40728	T	0.16	.	1.2713	0.02022	0.2011:0.2144:0.1128:0.4717	.	2300;1472	O75417;O75417-2	DPOLQ_HUMAN;.	V	1923;2300;2436	ENSP00000264233:E2300V	ENSP00000264233:E2300V	E	-	2	0	POLQ	122669124	0.099000	0.21834	0.000000	0.03702	0.908000	0.53690	0.306000	0.19279	-0.464000	0.06963	0.482000	0.46254	GAG	.	.		0.453	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	
POLQ	10721	hgsc.bcm.edu	37	3	121256056	121256056	+	Splice_Site	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:121256056C>G	ENST00000264233.5	-	5	760		c.e5-1			NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta						ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		ACCACCATTCCTAAAAAGATT	0.353								DNA polymerases (catalytic subunits)																													.	Pancreas(152;907 1925 26081 31236 36904)	Atlas-SNP	.											.	POLQ	273	.	0			c.632-1G>C						.						82.0	79.0	80.0					3																	121256056		2203	4300	6503	SO:0001630	splice_region_variant	10721	exon6			CCATTCCTAAAAA	AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.632-1G>C	chr3.hg19:g.121256056C>G		222.0	0.0		195.0	99.0	NM_199420	O95160|Q6VMB5	Splice_Site	SNP	ENST00000264233.5	hg19	CCDS33833.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.100266	0.76983	.	.	ENSG00000051341	ENST00000264233;ENST00000393672	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.882	0.88843	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	POLQ	122738746	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.203000	0.77864	2.202000	0.70862	0.462000	0.41574	.	.	.		0.353	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355097.1	NM_199420	Intron
CASR	846	hgsc.bcm.edu	37	3	121981126	121981126	+	Missense_Mutation	SNP	G	G	A	rs193922421		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:121981126G>A	ENST00000490131.1	+	4	1616	c.1244G>A	c.(1243-1245)cGg>cAg	p.R415Q	CASR_ENST00000498619.1_Missense_Mutation_p.R415Q|CASR_ENST00000296154.5_Missense_Mutation_p.R415Q	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	415					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	ACGCATTTACGGATATCCTAC	0.498																																					p.R415Q		Atlas-SNP	.											.	CASR	190	.	0			c.G1244A						.						131.0	121.0	124.0					3																	121981126		2203	4300	6503	SO:0001583	missense	846	exon4			ATTTACGGATATC	U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.1244G>A	chr3.hg19:g.121981126G>A	ENSP00000418685:p.Arg415Gln	72.0	0.0		74.0	13.0	NM_001178065	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	ENST00000490131.1	hg19	CCDS3010.1	.	.	.	.	.	.	.	.	.	.	G	33	5.237354	0.95240	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.83419	-1.72;-1.72;-1.72	5.93	5.93	0.95920	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.90964	0.7159	M	0.70108	2.13	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.80764	0.994;0.877	D	0.90967	0.4817	10	0.72032	D	0.01	.	19.3193	0.94231	0.0:0.0:1.0:0.0	.	415;415	E7ENE0;P41180	.;CASR_HUMAN	Q	415	ENSP00000418685:R415Q;ENSP00000420194:R415Q;ENSP00000296154:R415Q	ENSP00000296154:R415Q	R	+	2	0	CASR	123463816	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	9.869000	0.99810	2.797000	0.96272	0.655000	0.94253	CGG	.	.		0.498	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355761.1	NM_000388	
TPRA1	131601	hgsc.bcm.edu	37	3	127295719	127295719	+	Silent	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:127295719G>A	ENST00000355552.3	-	5	739	c.363C>T	c.(361-363)acC>acT	p.T121T	TPRA1_ENST00000465915.1_5'Flank|TPRA1_ENST00000489960.1_Silent_p.T121T|TPRA1_ENST00000296210.7_Silent_p.T121T|TPRA1_ENST00000450633.2_Silent_p.T121T	NM_001136053.1	NP_001129525.1	Q86W33	TPRA1_HUMAN	transmembrane protein, adipocyte asscociated 1	121					aging (GO:0007568)|G-protein coupled receptor signaling pathway (GO:0007186)|lipid metabolic process (GO:0006629)	integral component of membrane (GO:0016021)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	9						GGAAGAAGCGGGTGATCTCCC	0.657																																					p.T121T		Atlas-SNP	.											.	TPRA1	21	.	0			c.C363T						.						77.0	75.0	76.0					3																	127295719		2203	4300	6503	SO:0001819	synonymous_variant	131601	exon5			GAAGCGGGTGATC	AK056759	CCDS3042.1, CCDS46899.1	3q21.2	2012-08-22	2009-07-08	2009-07-08	ENSG00000163870	ENSG00000163870		"""GPCR / Unclassified : 7TM orphan receptors"""	30413	protein-coding gene	gene with protein product	"""transmembrane protein 227"""	608336	"""G protein-coupled receptor 175"""	GPR175		10342878	Standard	NM_001136053		Approved	TPRA40, FLJ32197, TMEM227	uc003ejn.3	Q86W33	OTTHUMG00000159639	ENST00000355552.3:c.363C>T	chr3.hg19:g.127295719G>A		245.0	0.0		191.0	41.0	NM_001142646	A8MVB8|D3DNA9|Q8WZ24|Q96AJ6|Q9P2R4	Silent	SNP	ENST00000355552.3	hg19	CCDS3042.1																																																																																			.	.		0.657	TPRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356624.1	NM_016372	
KBTBD12	166348	hgsc.bcm.edu	37	3	127703119	127703119	+	Nonstop_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:127703119T>A	ENST00000405109.1	+	6	2337	c.1870T>A	c.(1870-1872)Taa>Aaa	p.*624K	KBTBD12_ENST00000343941.4_Nonstop_Mutation_p.*199K|KBTBD12_ENST00000405256.1_Nonstop_Mutation_p.*624K|KBTBD12_ENST00000492025.1_3'UTR|KBTBD12_ENST00000407609.3_Nonstop_Mutation_p.*231K			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	0										endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						CAATGAGCACTAAGGTGACCT	0.547																																					p.X624K		Atlas-SNP	.											.	KBTBD12	41	.	0			c.T1870A						.						78.0	72.0	74.0					3																	127703119		2203	4300	6503	SO:0001578	stop_lost	166348	exon5			GAGCACTAAGGTG		CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.1870T>A	chr3.hg19:g.127703119T>A	ENSP00000385957:p.*624Lysext*35	107.0	0.0		86.0	24.0	NM_207335	B5MCC6|Q6ZRK1	Missense_Mutation	SNP	ENST00000405109.1	hg19	CCDS33848.2	.	.	.	.	.	.	.	.	.	.	T	18.13	3.555638	0.65425	.	.	ENSG00000187715	ENST00000405109;ENST00000407609;ENST00000405256;ENST00000343941	.	.	.	5.96	2.09	0.27110	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.4744	0.04572	0.1466:0.079:0.285:0.4894	.	.	.	.	K	624;231;624;199	.	.	X	+	1	0	KBTBD12	129185809	0.010000	0.17322	0.185000	0.23176	0.957000	0.61999	0.019000	0.13444	0.112000	0.17975	0.482000	0.46254	TAA	.	.		0.547	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318682.1	NM_207335	
KIAA1257	57501	hgsc.bcm.edu	37	3	128696958	128696958	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:128696958T>A	ENST00000265068.5	-	5	905	c.738A>T	c.(736-738)agA>agT	p.R246S	KIAA1257_ENST00000515659.1_Missense_Mutation_p.R134S|KIAA1257_ENST00000511438.1_Missense_Mutation_p.R246S|KIAA1257_ENST00000510149.1_5'UTR	NM_020741.2	NP_065792.1	Q9ULG3	K1257_HUMAN	KIAA1257	246										breast(1)|endometrium(2)|large_intestine(3)|lung(6)|skin(2)	14						TCGACTCTTCTCTGACAATGT	0.413																																					p.R246S		Atlas-SNP	.											.	KIAA1257	33	.	0			c.A738T						.						176.0	170.0	172.0					3																	128696958		1928	4125	6053	SO:0001583	missense	57501	exon5			CTCTTCTCTGACA	AB033083	CCDS46905.1	3q21.3	2011-11-07			ENSG00000114656	ENSG00000114656			29231	protein-coding gene	gene with protein product						10574462	Standard	NM_020741		Approved		uc003elj.4	Q9ULG3	OTTHUMG00000159946	ENST00000265068.5:c.738A>T	chr3.hg19:g.128696958T>A	ENSP00000265068:p.Arg246Ser	104.0	0.0		105.0	28.0	NM_020741	Q8IXY7|Q8N5T4	Missense_Mutation	SNP	ENST00000265068.5	hg19	CCDS46905.1	.	.	.	.	.	.	.	.	.	.	T	10.95	1.495122	0.26774	.	.	ENSG00000114656	ENST00000511438;ENST00000265068;ENST00000515659	.	.	.	3.78	-1.71	0.08133	.	2.846150	0.01307	N	0.010489	T	0.18341	0.0440	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.05582	-1.0876	9	0.08837	T	0.75	0.0411	0.4002	0.00425	0.1817:0.2241:0.1872:0.407	.	246;246	Q9ULG3;D6RH05	K1257_HUMAN;.	S	246;246;134	.	ENSP00000265068:R246S	R	-	3	2	KIAA1257	130179648	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.028000	0.12350	-0.409000	0.07553	0.383000	0.25322	AGA	.	.		0.413	KIAA1257-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000358430.1	NM_020741	
TMCC1	23023	hgsc.bcm.edu	37	3	129373861	129373861	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:129373861T>C	ENST00000393238.3	-	5	1937	c.1597A>G	c.(1597-1599)Atg>Gtg	p.M533V	TMCC1_ENST00000426664.2_Missense_Mutation_p.M419V|TMCC1_ENST00000329333.5_Missense_Mutation_p.M354V|TMCC1_ENST00000432054.2_Missense_Mutation_p.M209V	NM_001017395.3	NP_001017395.2	O94876	TMCC1_HUMAN	transmembrane and coiled-coil domain family 1	533						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)			PLXND1/TMCC1(4)	breast(1)|endometrium(3)|large_intestine(8)|lung(12)|skin(1)	25						TTTTCTTCCATGCTTGCCAGT	0.418																																					p.M533V		Atlas-SNP	.											.	TMCC1	105	.	0			c.A1597G						.						149.0	146.0	147.0					3																	129373861		2203	4300	6503	SO:0001583	missense	23023	exon5			CTTCCATGCTTGC	AB018322	CCDS33855.1	3q21.3	2010-04-19	2005-07-13		ENSG00000172765	ENSG00000172765		"""Transmembrane and coiled-coil domain containing"""	29116	protein-coding gene	gene with protein product			"""transmembrane and coiled-coil domains 1"""			9872452	Standard	NR_033361		Approved	KIAA0779	uc021xdy.1	O94876	OTTHUMG00000159579	ENST00000393238.3:c.1597A>G	chr3.hg19:g.129373861T>C	ENSP00000376930:p.Met533Val	116.0	0.0		97.0	30.0	NM_001017395	A8K5Y3|B4DE04|Q68E06|Q8IXM8	Missense_Mutation	SNP	ENST00000393238.3	hg19	CCDS33855.1	.	.	.	.	.	.	.	.	.	.	T	17.77	3.470431	0.63625	.	.	ENSG00000172765	ENST00000432054;ENST00000393238;ENST00000426664;ENST00000329333;ENST00000510323	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.61148	0.2324	M	0.71206	2.165	0.80722	D	1	P;P	0.47191	0.891;0.843	P;D	0.64506	0.826;0.926	T	0.56013	-0.8049	10	0.13470	T	0.59	-17.0852	16.4221	0.83766	0.0:0.0:0.0:1.0	.	354;533	B4DE04;O94876	.;TMCC1_HUMAN	V	209;533;419;354;1	ENSP00000404711:M209V;ENSP00000376930:M533V;ENSP00000389892:M419V;ENSP00000327349:M354V;ENSP00000426180:M1V	ENSP00000327349:M354V	M	-	1	0	TMCC1	130856551	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.035000	0.88872	2.283000	0.76528	0.477000	0.44152	ATG	.	.		0.418	TMCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356418.2	NM_015008	
ARMC8	25852	hgsc.bcm.edu	37	3	138007891	138007891	+	Splice_Site	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:138007891G>T	ENST00000469044.1	+	20	2094	c.1823G>T	c.(1822-1824)gGc>gTc	p.G608V	NME9_ENST00000383180.2_Intron|NME9_ENST00000341790.5_Intron|ARMC8_ENST00000481646.1_Splice_Site_p.G594V|ARMC8_ENST00000393058.3_Splice_Site_p.G598V|NME9_ENST00000317876.4_Intron|NME9_ENST00000536478.1_Intron|ARMC8_ENST00000461822.1_Splice_Site_p.G541V|ARMC8_ENST00000491704.1_Splice_Site_p.G566V|ARMC8_ENST00000485396.1_Splice_Site_p.G535V|NME9_ENST00000484930.1_Intron|ARMC8_ENST00000538260.1_Splice_Site_p.G577V	NM_001267041.1|NM_001267042.1	NP_001253970.1|NP_001253971.1	Q8IUR7	ARMC8_HUMAN	armadillo repeat containing 8	608										endometrium(2)|kidney(1)|large_intestine(7)|lung(5)|upper_aerodigestive_tract(1)	16						TATTAATAGGGCCATTCACAT	0.338																																					p.G594V		Atlas-SNP	.											.	ARMC8	79	.	0			c.G1781T						.						65.0	58.0	61.0					3																	138007891		1817	4076	5893	SO:0001630	splice_region_variant	25852	exon21			AATAGGGCCATTC		CCDS3098.1, CCDS54646.1, CCDS58853.1, CCDS58854.1, CCDS75020.1	3q22	2013-02-14			ENSG00000114098	ENSG00000114098		"""Armadillo repeat containing"""	24999	protein-coding gene	gene with protein product	"""GID complex subunit 5, VID28 homolog (S. cerevisiae)"""					11042152	Standard	NM_014154		Approved	HSPC056, DKFZP434A043, GID5, VID28	uc003esa.2	Q8IUR7	OTTHUMG00000159821	ENST00000469044.1:c.1822-1G>T	chr3.hg19:g.138007891G>T		255.0	0.0		265.0	145.0	NM_015396	A8K0L2|B7Z441|B7Z453|D3DNE6|F5GWK4|Q6PIL2|Q96D19|Q96HZ5|Q9NV02|Q9NV94|Q9Y4R9	Missense_Mutation	SNP	ENST00000469044.1	hg19		.	.	.	.	.	.	.	.	.	.	g	11.09	1.535444	0.27475	.	.	ENSG00000114098	ENST00000481646;ENST00000469044;ENST00000491704;ENST00000461822;ENST00000485396;ENST00000538260;ENST00000393058;ENST00000539459	T;T;T;T;T;T;T	0.64438	-0.1;-0.1;-0.1;0.75;0.75;0.75;-0.1	5.39	5.39	0.77823	Armadillo-like helical (1);Armadillo-type fold (1);	0.049311	0.85682	D	0.000000	T	0.47040	0.1424	N	0.17474	0.49	0.80722	D	1	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.04013	0.001;0.0;0.001;0.001;0.001	T	0.34976	-0.9807	10	0.22706	T	0.39	-47.7555	16.7171	0.85399	0.0:0.0:1.0:0.0	.	535;541;577;608;594	B7Z637;B7Z441;F5GWK4;Q8IUR7;Q8IUR7-2	.;.;.;ARMC8_HUMAN;.	V	594;608;566;541;535;577;598;465	ENSP00000420333:G594V;ENSP00000419413:G608V;ENSP00000417304:G566V;ENSP00000420706:G541V;ENSP00000417049:G535V;ENSP00000441592:G577V;ENSP00000376778:G598V	ENSP00000376778:G598V	G	+	2	0	ARMC8	139490581	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	9.153000	0.94687	2.526000	0.85167	0.585000	0.79938	GGC	.	.		0.338	ARMC8-003	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000357560.1	NM_015396	Missense_Mutation
ESYT3	83850	hgsc.bcm.edu	37	3	138180931	138180931	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:138180931T>A	ENST00000389567.4	+	8	984	c.798T>A	c.(796-798)gaT>gaA	p.D266E	ESYT3_ENST00000289135.4_Missense_Mutation_p.D266E	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	266	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						TGTCCAGTGATGTGTCAGACA	0.607																																					p.D266E		Atlas-SNP	.											.	ESYT3	64	.	0			c.T798A						.						181.0	137.0	152.0					3																	138180931		2203	4300	6503	SO:0001583	missense	83850	exon8			CAGTGATGTGTCA	AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.798T>A	chr3.hg19:g.138180931T>A	ENSP00000374218:p.Asp266Glu	63.0	0.0		43.0	11.0	NM_031913	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	ENST00000389567.4	hg19	CCDS3101.2	.	.	.	.	.	.	.	.	.	.	T	4.919	0.170757	0.09391	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	T;T	0.23552	1.9;1.9	4.65	-0.406	0.12389	.	0.450748	0.25971	N	0.027137	T	0.09202	0.0227	N	0.16266	0.395	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.20505	-1.0273	10	0.09590	T	0.72	-22.9442	0.9789	0.01432	0.1705:0.2746:0.2716:0.2833	.	266	A0FGR9	ESYT3_HUMAN	E	266	ENSP00000374218:D266E;ENSP00000289135:D266E	ENSP00000289135:D266E	D	+	3	2	ESYT3	139663621	0.006000	0.16342	0.174000	0.22961	0.620000	0.37586	-0.089000	0.11180	0.227000	0.20999	-0.973000	0.02599	GAT	.	.		0.607	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000303993.1	NM_031913	
SPSB4	92369	hgsc.bcm.edu	37	3	140785482	140785482	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:140785482T>A	ENST00000310546.2	+	2	1280	c.536T>A	c.(535-537)gTg>gAg	p.V179E		NM_080862.1	NP_543138.1	Q96A44	SPSB4_HUMAN	splA/ryanodine receptor domain and SOCS box containing 4	179	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				biliary_tract(1)|large_intestine(1)|lung(1)|pancreas(1)	4						TCGCTGCTCGTGGTGCTGGAC	0.662																																					p.V179E		Atlas-SNP	.											.	SPSB4	19	.	0			c.T536A						.						39.0	35.0	37.0					3																	140785482		2203	4300	6503	SO:0001583	missense	92369	exon2			TGCTCGTGGTGCT		CCDS3115.1	3q23	2008-02-05			ENSG00000175093	ENSG00000175093			30630	protein-coding gene	gene with protein product		611660				12076535	Standard	NM_080862		Approved	SSB-4	uc003ett.3	Q96A44	OTTHUMG00000160223	ENST00000310546.2:c.536T>A	chr3.hg19:g.140785482T>A	ENSP00000311609:p.Val179Glu	137.0	0.0		98.0	17.0	NM_080862		Missense_Mutation	SNP	ENST00000310546.2	hg19	CCDS3115.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.184819	0.78677	.	.	ENSG00000175093	ENST00000310546	T	0.74842	-0.88	5.03	5.03	0.67393	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.89392	0.6702	H	0.95504	3.68	0.80722	D	1	D	0.67145	0.996	D	0.72982	0.979	D	0.92079	0.5671	10	0.87932	D	0	-37.919	12.7037	0.57049	0.0:0.0:0.0:1.0	.	179	Q96A44	SPSB4_HUMAN	E	179	ENSP00000311609:V179E	ENSP00000311609:V179E	V	+	2	0	SPSB4	142268172	1.000000	0.71417	0.851000	0.33527	0.941000	0.58515	8.040000	0.89188	1.881000	0.54492	0.460000	0.39030	GTG	.	.		0.662	SPSB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359727.1	NM_080862	
ATR	545	hgsc.bcm.edu	37	3	142188239	142188239	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:142188239T>A	ENST00000350721.4	-	38	6613	c.6492A>T	c.(6490-6492)atA>atT	p.I2164I	RP11-383G6.3_ENST00000460977.1_RNA|ATR_ENST00000383101.3_Silent_p.I2100I	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	2164	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.				cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						ATACTTTGGCTATTATTTCCA	0.333								Other conserved DNA damage response genes																													p.I2164I		Atlas-SNP	.											.	ATR	285	.	0			c.A6492T						.						105.0	108.0	107.0					3																	142188239		2203	4300	6503	SO:0001819	synonymous_variant	545	exon38			TTTGGCTATTATT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.6492A>T	chr3.hg19:g.142188239T>A		225.0	0.0		194.0	50.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Silent	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	10.36	1.328115	0.24080	.	.	ENSG00000175054	ENST00000513291	.	.	.	5.15	3.93	0.45458	.	.	.	.	.	T	0.48021	0.1477	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45454	-0.9260	4	.	.	.	-17.2193	4.1392	0.10186	0.3148:0.1051:0.0:0.5801	.	.	.	.	C	11	.	.	S	-	1	0	ATR	143670929	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.603000	0.36794	1.926000	0.55796	0.482000	0.46254	AGC	.	.		0.333	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
ATR	545	hgsc.bcm.edu	37	3	142278251	142278251	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:142278251T>A	ENST00000350721.4	-	7	1695	c.1574A>T	c.(1573-1575)aAg>aTg	p.K525M	ATR_ENST00000383101.3_Missense_Mutation_p.K461M	NM_001184.3	NP_001175.2	Q13535	ATR_HUMAN	ATR serine/threonine kinase	525					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|multicellular organismal development (GO:0007275)|negative regulation of DNA replication (GO:0008156)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|protein autophosphorylation (GO:0046777)|regulation of protein binding (GO:0043393)|replicative senescence (GO:0090399)|response to drug (GO:0042493)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|XY body (GO:0001741)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MutLalpha complex binding (GO:0032405)|MutSalpha complex binding (GO:0032407)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(10)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|liver(2)|lung(45)|ovary(3)|skin(10)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(4)	122						AGGTTTCTTCTTGGATTTATG	0.323								Other conserved DNA damage response genes																													p.K525M		Atlas-SNP	.											.	ATR	285	.	0			c.A1574T						.						85.0	82.0	83.0					3																	142278251		2203	4300	6503	SO:0001583	missense	545	exon7			TTCTTCTTGGATT	U76308	CCDS3124.1	3q23	2014-06-17	2014-06-17		ENSG00000175054	ENSG00000175054			882	protein-coding gene	gene with protein product	"""MEC1, mitosis entry checkpoint 1, homolog (S. cerevisiae)"""	601215	"""ataxia telangiectasia and Rad3 related"""			8978690, 8610130	Standard	NM_001184		Approved	FRP1, SCKL, SCKL1, MEC1	uc003eux.4	Q13535	OTTHUMG00000159234	ENST00000350721.4:c.1574A>T	chr3.hg19:g.142278251T>A	ENSP00000343741:p.Lys525Met	155.0	0.0		117.0	31.0	NM_001184	Q59HB2|Q7KYL3|Q93051|Q9BXK4	Missense_Mutation	SNP	ENST00000350721.4	hg19	CCDS3124.1	.	.	.	.	.	.	.	.	.	.	T	14.96	2.690611	0.48097	.	.	ENSG00000175054	ENST00000350721;ENST00000383101;ENST00000515149	T;T	0.03889	3.9;3.77	5.6	5.6	0.85130	Armadillo-type fold (1);	0.518940	0.20332	N	0.094420	T	0.04998	0.0134	L	0.27053	0.805	0.35962	D	0.834641	B	0.16802	0.019	B	0.09377	0.004	T	0.30297	-0.9983	10	0.51188	T	0.08	-8.453	13.1662	0.59573	0.0:0.0:0.0:1.0	.	525	Q13535	ATR_HUMAN	M	525;461;142	ENSP00000343741:K525M;ENSP00000372581:K461M	ENSP00000343741:K525M	K	-	2	0	ATR	143760941	0.921000	0.31238	0.996000	0.52242	0.191000	0.23601	1.841000	0.39240	2.123000	0.65237	0.533000	0.62120	AAG	.	.		0.323	ATR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353995.2	NM_001184	
CLRN1	7401	hgsc.bcm.edu	37	3	150690482	150690482	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:150690482T>A	ENST00000327047.1	-	1	304	c.14A>T	c.(13-15)cAg>cTg	p.Q5L	CLRN1-AS1_ENST00000465576.1_RNA|CLRN1-AS1_ENST00000476886.1_RNA|CLRN1_ENST00000328863.4_Missense_Mutation_p.Q5L|RP11-166N6.2_ENST00000469268.1_RNA	NM_174878.2	NP_777367.1	P58418	CLRN1_HUMAN	clarin 1	5					actin filament organization (GO:0007015)|auditory receptor cell stereocilium organization (GO:0060088)|cell motility (GO:0048870)|equilibrioception (GO:0050957)|photoreceptor cell maintenance (GO:0045494)|positive regulation of lamellipodium assembly (GO:0010592)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|microvillus (GO:0005902)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			GATTTTCTTCTGTTGGCTTGG	0.488																																					p.Q5L		Atlas-SNP	.											.	CLRN1	44	.	0			c.A14T						.						72.0	70.0	71.0					3																	150690482		2203	4300	6503	SO:0001583	missense	7401	exon1			TTCTTCTGTTGGC	AF388366	CCDS3153.1, CCDS35492.1, CCDS56285.1	3q25.1	2014-09-17	2006-11-23	2006-11-23	ENSG00000163646	ENSG00000163646			12605	protein-coding gene	gene with protein product		606397	"""Usher syndrome 3A"""	USH3, USH3A, RP61		7711740, 8975700	Standard	NM_052995		Approved		uc021xfr.1	P58418	OTTHUMG00000140368	ENST00000327047.1:c.14A>T	chr3.hg19:g.150690482T>A	ENSP00000322280:p.Gln5Leu	82.0	0.0		81.0	21.0	NM_001256819	D3DNJ3|E1ACU9|Q8N6A9	Missense_Mutation	SNP	ENST00000327047.1	hg19	CCDS3153.1	.	.	.	.	.	.	.	.	.	.	T	13.29	2.192623	0.38707	.	.	ENSG00000163646	ENST00000327047;ENST00000328863	T;T	0.75367	-0.93;-0.93	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.80358	0.4608	M	0.70595	2.14	0.80722	D	1	D	0.63880	0.993	P	0.55923	0.787	T	0.77408	-0.2599	10	0.10636	T	0.68	2.2764	15.7075	0.77594	0.0:0.0:0.0:1.0	.	5	P58418	CLRN1_HUMAN	L	5	ENSP00000322280:Q5L;ENSP00000329158:Q5L	ENSP00000322280:Q5L	Q	-	2	0	CLRN1	152173172	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.461000	0.80834	2.117000	0.64856	0.533000	0.62120	CAG	.	.		0.488	CLRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277060.1		
OTOL1	131149	hgsc.bcm.edu	37	3	161221107	161221107	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:161221107A>T	ENST00000327928.4	+	4	811	c.811A>T	c.(811-813)Agt>Tgt	p.S271C		NM_001080440.1	NP_001073909.1	A6NHN0	OTOL1_HUMAN	otolin 1	271						collagen trimer (GO:0005581)|extracellular region (GO:0005576)				central_nervous_system(2)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(2)|skin(1)	27						CAAAGGAGACAGTGGAATGGA	0.532																																					p.S271C		Atlas-SNP	.											.	OTOL1	63	.	0			c.A811T						.						11.0	12.0	12.0					3																	161221107		1964	4146	6110	SO:0001583	missense	131149	exon4			GGAGACAGTGGAA		CCDS46948.1	3q26.1	2011-05-19	2011-05-19			ENSG00000182447			34071	protein-coding gene	gene with protein product	"""C1q and tumor necrosis factor related protein 15"""		"""otolin 1 homolog (zebrafish)"""			17544811, 15905077	Standard	NM_001080440		Approved	C1QTNF15	uc011bpb.2	A6NHN0		ENST00000327928.4:c.811A>T	chr3.hg19:g.161221107A>T	ENSP00000330808:p.Ser271Cys	331.0	0.0		299.0	81.0	NM_001080440		Missense_Mutation	SNP	ENST00000327928.4	hg19	CCDS46948.1	.	.	.	.	.	.	.	.	.	.	A	11.16	1.557296	0.27827	.	.	ENSG00000182447	ENST00000327928	D	0.93604	-3.25	4.49	-8.99	0.00751	.	2.248860	0.01739	N	0.029308	D	0.91459	0.7304	L	0.55481	1.735	0.09310	N	1	P	0.34757	0.467	B	0.42386	0.386	D	0.85851	0.1404	10	0.54805	T	0.06	.	8.8546	0.35221	0.2721:0.5098:0.2181:0.0	.	271	A6NHN0	OTOL1_HUMAN	C	271	ENSP00000330808:S271C	ENSP00000330808:S271C	S	+	1	0	OTOL1	162703801	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.394000	0.07296	-1.926000	0.01061	-1.272000	0.01410	AGT	.	.		0.532	OTOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353184.1	NM_001080440	
MECOM	2122	hgsc.bcm.edu	37	3	168834399	168834399	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:168834399T>A	ENST00000464456.1	-	7	1897	c.697A>T	c.(697-699)Aat>Tat	p.N233Y	MECOM_ENST00000433243.2_Missense_Mutation_p.N234Y|MECOM_ENST00000264674.3_Missense_Mutation_p.N298Y|MECOM_ENST00000468789.1_Missense_Mutation_p.N233Y|MECOM_ENST00000460814.1_Missense_Mutation_p.N233Y|MECOM_ENST00000392736.3_Missense_Mutation_p.N233Y|MECOM_ENST00000494292.1_Missense_Mutation_p.N421Y|MECOM_ENST00000472280.1_Missense_Mutation_p.N234Y	NM_001164000.1	NP_001157472.1	Q13465	MDS1_HUMAN	MDS1 and EVI1 complex locus	0					regulation of transcription, DNA-templated (GO:0006355)		sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	85						CTGTGTTTATTTAAGGAAGAC	0.448																																					p.N421Y		Atlas-SNP	.											.	MECOM	216	.	0			c.A1261T						.						440.0	371.0	394.0					3																	168834399		2203	4300	6503	SO:0001583	missense	2122	exon8			GTTTATTTAAGGA	S82592, AF164154	CCDS3205.1, CCDS54669.1, CCDS54670.1	3q26.2	2013-01-08	2009-08-07	2009-08-07	ENSG00000085276	ENSG00000085276		"""Zinc fingers, C2H2-type"""	3498	protein-coding gene	gene with protein product		165215	"""myelodysplasia syndrome 1"", ""ecotropic viral integration site 1"""	MDS1, EVI1		2115646, 8171026, 8643684	Standard	NM_001105077		Approved	MDS1-EVI1, PRDM3	uc011bpj.1	Q03112	OTTHUMG00000158596	ENST00000464456.1:c.697A>T	chr3.hg19:g.168834399T>A	ENSP00000419770:p.Asn233Tyr	140.0	0.0		117.0	41.0	NM_004991	Q13466|Q6FH90	Missense_Mutation	SNP	ENST00000464456.1	hg19	CCDS54669.1	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372102	0.61624	.	.	ENSG00000085276	ENST00000264674;ENST00000392736;ENST00000464456;ENST00000472280;ENST00000494292;ENST00000468789;ENST00000460814;ENST00000433243	T;T;T;T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68;0.68;0.68;0.68	5.88	5.88	0.94601	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.64402	D	0.000001	T	0.64649	0.2617	L	0.52266	1.64	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.994;0.999	T	0.66929	-0.5799	10	0.87932	D	0	-22.2034	16.3015	0.82820	0.0:0.0:0.0:1.0	.	421;234;421;298;233	Q03112-3;Q03112-6;E7EQ57;Q03112-4;Q03112	.;.;.;.;EVI1_HUMAN	Y	298;233;233;234;421;233;233;234	ENSP00000264674:N298Y;ENSP00000376493:N233Y;ENSP00000419770:N233Y;ENSP00000420048:N234Y;ENSP00000417899:N421Y;ENSP00000419995:N233Y;ENSP00000420466:N233Y;ENSP00000394302:N234Y	ENSP00000264674:N298Y	N	-	1	0	MECOM	170317093	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.239000	0.73571	0.533000	0.62120	AAT	.	.		0.448	MECOM-020	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000351519.1	NM_005241, NM_004991	
PLD1	5337	hgsc.bcm.edu	37	3	171443814	171443814	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:171443814T>A	ENST00000351298.4	-	7	785	c.659A>T	c.(658-660)aAg>aTg	p.K220M	PLD1_ENST00000340989.4_Missense_Mutation_p.K220M|PLD1_ENST00000342215.6_Missense_Mutation_p.K220M|PLD1_ENST00000356327.5_Missense_Mutation_p.K220M	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	220	PH.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TTACATGCCCTTTGGTCCCAA	0.378																																					p.K220M	NSCLC(149;2174 3517 34058)	Atlas-SNP	.											.	PLD1	134	.	0			c.A659T						.						144.0	133.0	136.0					3																	171443814		2203	4300	6503	SO:0001583	missense	5337	exon7			ATGCCCTTTGGTC	U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.659A>T	chr3.hg19:g.171443814T>A	ENSP00000342793:p.Lys220Met	82.0	0.0		84.0	21.0	NM_002662		Missense_Mutation	SNP	ENST00000351298.4	hg19	CCDS3216.1	.	.	.	.	.	.	.	.	.	.	T	23.0	4.360259	0.82353	.	.	ENSG00000075651	ENST00000356327;ENST00000351298;ENST00000342215;ENST00000340989	T;T;T;T	0.39787	2.99;2.97;1.06;2.83	5.38	5.38	0.77491	Pleckstrin homology domain (1);	0.097920	0.64402	D	0.000001	T	0.66157	0.2761	M	0.84948	2.725	0.80722	D	1	D;D	0.69078	0.997;0.988	D;P	0.64687	0.928;0.77	T	0.72161	-0.4374	10	0.62326	D	0.03	-23.0449	14.3768	0.66884	0.0:0.0:0.0:1.0	.	243;220	Q59EA4;Q13393	.;PLD1_HUMAN	M	220	ENSP00000348681:K220M;ENSP00000342793:K220M;ENSP00000339936:K220M;ENSP00000340326:K220M	ENSP00000340326:K220M	K	-	2	0	PLD1	172926508	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.324000	0.72896	2.035000	0.60131	0.528000	0.53228	AAG	.	.		0.378	PLD1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000346730.2	NM_002662	
EPHB3	2049	hgsc.bcm.edu	37	3	184290454	184290454	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:184290454T>A	ENST00000330394.2	+	3	798	c.346T>A	c.(346-348)Tgc>Agc	p.C116S	EIF2B5_ENST00000444495.1_Intron	NM_004443.3	NP_004434.2	P54753	EPHB3_HUMAN	EPH receptor B3	116	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell migration (GO:0016477)|central nervous system projection neuron axonogenesis (GO:0021952)|corpus callosum development (GO:0022038)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|digestive tract morphogenesis (GO:0048546)|ephrin receptor signaling pathway (GO:0048013)|palate development (GO:0060021)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of axonogenesis (GO:0050770)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell-cell adhesion (GO:0022407)|regulation of Rac GTPase activity (GO:0032314)|retinal ganglion cell axon guidance (GO:0031290)|substrate adhesion-dependent cell spreading (GO:0034446)|thymus development (GO:0048538)|urogenital system development (GO:0001655)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|ephrin receptor activity (GO:0005003)	p.C116R(1)		breast(5)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_cancers(143;1.89e-10)|Ovarian(172;0.0339)		Epithelial(37;1.27e-34)|OV - Ovarian serous cystadenocarcinoma(80;3.8e-22)			TGTGCGTGACTGCAACAGCAT	0.602																																					p.C116S		Atlas-SNP	.											EPHB3,NS,carcinoma,0,1	EPHB3	114	.	1	Substitution - Missense(1)	ovary(1)	c.T346A						.						72.0	66.0	68.0					3																	184290454		2202	4300	6502	SO:0001583	missense	2049	exon3			CGTGACTGCAACA	X75208	CCDS3268.1	3q27.1	2013-09-19	2004-10-28		ENSG00000182580	ENSG00000182580		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3394	protein-coding gene	gene with protein product		601839	"""EphB3"""	ETK2		8397371	Standard	NM_004443		Approved	Hek2, Tyro6	uc003foz.3	P54753	OTTHUMG00000156710	ENST00000330394.2:c.346T>A	chr3.hg19:g.184290454T>A	ENSP00000332118:p.Cys116Ser	107.0	0.0		98.0	28.0	NM_004443	Q7Z740	Missense_Mutation	SNP	ENST00000330394.2	hg19	CCDS3268.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.719374	0.89205	.	.	ENSG00000182580	ENST00000330394	T	0.64991	-0.13	5.53	5.53	0.82687	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.84615	0.5511	H	0.96048	3.76	0.80722	D	1	D	0.69078	0.997	D	0.65573	0.936	D	0.89621	0.3848	10	0.87932	D	0	.	14.8554	0.70332	0.0:0.0:0.0:1.0	.	116	P54753	EPHB3_HUMAN	S	116	ENSP00000332118:C116S	ENSP00000332118:C116S	C	+	1	0	EPHB3	185773148	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.004000	0.88535	2.095000	0.63458	0.533000	0.62120	TGC	.	.		0.602	EPHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345413.1	NM_004443	
IGF2BP2	10644	hgsc.bcm.edu	37	3	185390424	185390424	+	Missense_Mutation	SNP	T	T	A	rs368787882		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:185390424T>A	ENST00000382199.2	-	10	1200	c.1105A>T	c.(1105-1107)Agc>Tgc	p.S369C	IGF2BP2_ENST00000494906.1_Intron|IGF2BP2_ENST00000457616.2_Missense_Mutation_p.S375C|IGF2BP2_ENST00000346192.3_Intron|IGF2BP2_ENST00000421047.2_Missense_Mutation_p.S312C	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	369					anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			CCAAGTGCGCTGAGGTTCAAC	0.582																																					p.S369C		Atlas-SNP	.											.	IGF2BP2	69	.	0			c.A1105T						.						75.0	66.0	69.0					3																	185390424		2203	4300	6503	SO:0001583	missense	10644	exon10			GTGCGCTGAGGTT	BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1105A>T	chr3.hg19:g.185390424T>A	ENSP00000371634:p.Ser369Cys	520.0	0.0		429.0	111.0	NM_006548	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	ENST00000382199.2	hg19	CCDS3273.2	.	.	.	.	.	.	.	.	.	.	T	26.7	4.763467	0.89932	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616	T;T;T	0.49139	2.12;0.79;2.39	5.48	5.48	0.80851	.	0.080944	0.85682	D	0.000000	T	0.54127	0.1839	L	0.40543	1.245	0.53005	D	0.999965	P;D;D;P	0.61697	0.94;0.99;0.983;0.836	P;P;P;P	0.58013	0.753;0.753;0.831;0.571	T	0.54091	-0.8345	10	0.48119	T	0.1	-17.1355	13.3761	0.60739	0.0:0.0:0.0:1.0	.	306;312;375;369	Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1	.;.;.;IF2B2_HUMAN	C	369;312;375	ENSP00000371634:S369C;ENSP00000413787:S312C;ENSP00000410242:S375C	ENSP00000371634:S369C	S	-	1	0	IGF2BP2	186873118	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.508000	0.81686	2.210000	0.71456	0.533000	0.62120	AGC	.	.		0.582	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000157087.2	NM_006548	
ETV5	2119	hgsc.bcm.edu	37	3	185797835	185797835	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:185797835G>C	ENST00000306376.5	-	7	667	c.421C>G	c.(421-423)Ctc>Gtc	p.L141V	ETV5_ENST00000537818.1_Missense_Mutation_p.L183V|ETV5_ENST00000434744.1_Missense_Mutation_p.L141V|ETV5-AS1_ENST00000453370.1_RNA	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	141					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			GTGGGTGAGAGGGGGGTTGTA	0.547			T	"""TMPRSS2, SCL45A3"""	Prostate																																p.L141V		Atlas-SNP	.		Dom	yes		3	3q28	2119	ets variant gene 5		E	.	ETV5	106	.	0			c.C421G						.						19.0	24.0	22.0					3																	185797835		2124	4237	6361	SO:0001583	missense	2119	exon7			GTGAGAGGGGGGT	BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.421C>G	chr3.hg19:g.185797835G>C	ENSP00000306894:p.Leu141Val	68.0	0.0		91.0	31.0	NM_004454	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	ENST00000306376.5	hg19	CCDS33906.1	.	.	.	.	.	.	.	.	.	.	G	0.213	-1.034972	0.02029	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818;ENST00000440773	T;T;T;T	0.20881	2.04;2.04;2.04;2.04	5.31	-0.0789	0.13713	PEA3-type ETS-domain transcription factor, N-terminal (1);	1.102340	0.06653	N	0.763155	T	0.07098	0.0180	N	0.03948	-0.315	0.28907	N	0.892938	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.38908	-0.9639	10	0.02654	T	1	.	5.1111	0.14809	0.3394:0.208:0.4527:0.0	.	141;183	P41161;B7Z7D7	ETV5_HUMAN;.	V	141;141;183;141	ENSP00000306894:L141V;ENSP00000413755:L141V;ENSP00000441737:L183V;ENSP00000389707:L141V	ENSP00000306894:L141V	L	-	1	0	ETV5	187280529	0.421000	0.25465	0.994000	0.49952	0.879000	0.50718	0.791000	0.26915	0.218000	0.20820	0.557000	0.71058	CTC	.	.		0.547	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000344947.1	NM_004454	
KNG1	3827	hgsc.bcm.edu	37	3	186459911	186459911	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:186459911A>G	ENST00000265023.4	+	10	1938	c.1726A>G	c.(1726-1728)Ata>Gta	p.I576V	RP11-573D15.8_ENST00000609652.1_RNA|RP11-573D15.8_ENST00000609726.1_RNA|RP11-573D15.8_ENST00000596632.1_RNA|KNG1_ENST00000287611.2_Intron|RP11-573D15.8_ENST00000354642.2_RNA|RP11-573D15.8_ENST00000596329.1_RNA|RP11-573D15.8_ENST00000599314.1_RNA|KNG1_ENST00000447445.1_Intron	NM_001102416.2	NP_001095886.1	P01042	KNG1_HUMAN	kininogen 1	576					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|inflammatory response (GO:0006954)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|smooth muscle contraction (GO:0006939)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|heparin binding (GO:0008201)|receptor binding (GO:0005102)|zinc ion binding (GO:0008270)			endometrium(1)|lung(15)|prostate(1)|skin(2)|stomach(2)	21	all_cancers(143;8.96e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;4.12e-20)	GBM - Glioblastoma multiforme(93;0.0798)		GATGCCTCCTATATCACCAGC	0.458																																					p.I576V		Atlas-SNP	.											.	KNG1	129	.	0			c.A1726G						.						148.0	140.0	143.0					3																	186459911		1979	4153	6132	SO:0001583	missense	3827	exon10			CCTCCTATATCAC		CCDS3281.1, CCDS43183.1, CCDS54695.1	3q27.3	2014-05-15	2004-05-21	2004-05-26	ENSG00000113889	ENSG00000113889		"""Endogenous ligands"""	6383	protein-coding gene	gene with protein product	"""alpha-2-thiol proteinase inhibitor"", ""bradykinin"""	612358	"""kininogen"""	KNG, BDK		1733668	Standard	NM_000893		Approved	BK	uc011bsa.2	P01042	OTTHUMG00000150348	ENST00000265023.4:c.1726A>G	chr3.hg19:g.186459911A>G	ENSP00000265023:p.Ile576Val	156.0	0.0		118.0	27.0	NM_001102416	A8K474|B2RCR2|C9JEX1|P01043|Q53EQ0|Q6PAU9|Q7M4P1	Missense_Mutation	SNP	ENST00000265023.4	hg19	CCDS43183.1	.	.	.	.	.	.	.	.	.	.	A	0	-2.646795	0.00111	.	.	ENSG00000113889	ENST00000265023	T	0.12879	2.64	5.42	3.05	0.35203	.	0.983616	0.08274	N	0.970886	T	0.12263	0.0298	L	0.43152	1.355	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.32693	-0.9897	9	.	.	.	-0.004	6.5616	0.22489	0.8145:0.0:0.1855:0.0	.	576	P01042	KNG1_HUMAN	V	576	ENSP00000265023:I576V	.	I	+	1	0	KNG1	187942605	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.201000	0.17276	1.008000	0.39264	0.533000	0.62120	ATA	.	.		0.458	KNG1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000317738.1	NM_001102416	
XXYLT1	152002	hgsc.bcm.edu	37	3	194877312	194877312	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr3:194877312T>A	ENST00000310380.6	-	3	761		c.e3-2		XXYLT1_ENST00000429994.1_Splice_Site|XXYLT1_ENST00000437101.1_Splice_Site|XXYLT1_ENST00000355729.4_Splice_Site	NM_152531.4	NP_689744.3	Q8NBI6	XXLT1_HUMAN	xyloside xylosyltransferase 1							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring pentosyl groups (GO:0016763)										GCAGGATCTCTGCGGGAAAGA	0.517																																					.		Atlas-SNP	.											.	.	.	.	0			c.653-2A>T						.						77.0	79.0	78.0					3																	194877312		1945	4154	6099	SO:0001630	splice_region_variant	152002	exon4			GATCTCTGCGGGA	AK075551	CCDS43188.1	3q29	2013-02-22	2011-10-19	2011-10-19	ENSG00000173950	ENSG00000173950		"""Glycosyltransferase family 8 domain containing"""	26639	protein-coding gene	gene with protein product		614552	"""chromosome 3 open reading frame 21"""	C3orf21		22117070	Standard	NM_152531		Approved	FLJ35155	uc003fum.4	Q8NBI6	OTTHUMG00000155915	ENST00000310380.6:c.653-2A>T	chr3.hg19:g.194877312T>A		83.0	0.0		46.0	11.0	NM_152531	D3DNW5|Q8NAL3|Q8WV03|Q96ME0	Splice_Site	SNP	ENST00000310380.6	hg19	CCDS43188.1	.	.	.	.	.	.	.	.	.	.	T	18.35	3.604786	0.66445	.	.	ENSG00000173950	ENST00000310380;ENST00000437101;ENST00000355729;ENST00000429994;ENST00000458652	.	.	.	5.69	5.69	0.88448	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9022	0.63812	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	C3orf21	196358601	1.000000	0.71417	0.998000	0.56505	0.648000	0.38561	7.450000	0.80656	2.167000	0.68274	0.460000	0.39030	.	.	.		0.517	XXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342290.1	NM_152531	Intron
RGS12	6002	hgsc.bcm.edu	37	4	3424630	3424630	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:3424630A>T	ENST00000344733.5	+	12	3937		c.e12-1		RGS12_ENST00000508158.1_Splice_Site|RGS12_ENST00000336727.3_Splice_Site|RGS12_ENST00000306648.7_Splice_Site|RGS12_ENST00000382788.3_Splice_Site|RGS12_ENST00000338806.4_Splice_Site|RGS12_ENST00000538395.1_Splice_Site	NM_198229.2	NP_937872.1	O14924	RGS12_HUMAN	regulator of G-protein signaling 12						positive regulation of GTPase activity (GO:0043547)|regulation of catalytic activity (GO:0050790)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|GTPase regulator activity (GO:0030695)|receptor signaling protein activity (GO:0005057)			autonomic_ganglia(1)|breast(4)|endometrium(3)|kidney(2)|large_intestine(9)|lung(16)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TCTGTTCCTCAGCCTCTGGTG	0.572																																					.		Atlas-SNP	.											.	RGS12	128	.	0			c.3034-2A>T						.						99.0	90.0	93.0					4																	3424630		2203	4300	6503	SO:0001630	splice_region_variant	6002	exon12			TTCCTCAGCCTCT	AF035152	CCDS3366.1, CCDS3367.1, CCDS3368.1	4p16.3	2008-02-05	2007-08-14		ENSG00000159788	ENSG00000159788		"""Regulators of G-protein signaling"""	9994	protein-coding gene	gene with protein product		602512	"""regulator of G-protein signalling 12"""			9651375	Standard	NM_198229		Approved		uc003ggw.3	O14924	OTTHUMG00000090277	ENST00000344733.5:c.3034-1A>T	chr4.hg19:g.3424630A>T		51.0	0.0		24.0	11.0	NM_002926	B1AQ30|B1AQ31|B1AQ32|B7Z764|E7EMN9|O14922|O14923|O43510|O75338|Q147X0|Q8WX95	Splice_Site	SNP	ENST00000344733.5	hg19	CCDS3366.1	.	.	.	.	.	.	.	.	.	.	A	13.23	2.174218	0.38413	.	.	ENSG00000159788	ENST00000344733;ENST00000336727;ENST00000382788;ENST00000306648;ENST00000338806;ENST00000538395	.	.	.	4.6	3.41	0.39046	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.2512	0.37555	0.9131:0.0:0.0869:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RGS12	3394428	1.000000	0.71417	0.355000	0.25773	0.629000	0.37895	8.441000	0.90313	0.622000	0.30249	0.334000	0.21626	.	.	.		0.572	RGS12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000206602.1	NM_002926	Intron
STK32B	55351	hgsc.bcm.edu	37	4	5500757	5500757	+	Missense_Mutation	SNP	G	G	C	rs558465928		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:5500757G>C	ENST00000282908.5	+	12	1614	c.1192G>C	c.(1192-1194)Ggg>Cgg	p.G398R	STK32B_ENST00000510398.1_Missense_Mutation_p.G351R|STK32B_ENST00000512636.1_Missense_Mutation_p.G321R|STK32B_ENST00000508728.1_3'UTR	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.G398R(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GCTCCAGGACGGGTGCAACAA	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		18403	0.0		0.0	False		,,,				2504	0.001				p.G398R		Atlas-SNP	.											STK32B,mouth,carcinoma,0,1	STK32B	87	.	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)	c.G1192C						.						167.0	124.0	138.0					4																	5500757		2203	4300	6503	SO:0001583	missense	55351	exon12			CAGGACGGGTGCA	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.1192G>C	chr4.hg19:g.5500757G>C	ENSP00000282908:p.Gly398Arg	301.0	1.0		191.0	67.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	hg19	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	G	15.41	2.826182	0.50739	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.69685	-0.35;-0.07;-0.42	4.97	4.97	0.65823	.	0.000000	0.40818	U	0.001010	T	0.68915	0.3053	M	0.65498	2.005	0.35393	D	0.790908	P	0.50272	0.933	P	0.46718	0.525	T	0.77778	-0.2460	10	0.40728	T	0.16	.	13.7115	0.62672	0.0:0.0:1.0:0.0	.	398	Q9NY57	ST32B_HUMAN	R	398;321;351	ENSP00000282908:G398R;ENSP00000423209:G321R;ENSP00000420984:G351R	ENSP00000282908:G398R	G	+	1	0	STK32B	5551658	0.988000	0.35896	0.815000	0.32552	0.045000	0.14185	4.377000	0.59562	2.293000	0.77203	0.561000	0.74099	GGG	.	.		0.632	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
TBC1D14	57533	hgsc.bcm.edu	37	4	6925360	6925360	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:6925360A>T	ENST00000409757.4	+	2	368	c.244A>T	c.(244-246)Agc>Tgc	p.S82C	TBC1D14_ENST00000448507.1_Missense_Mutation_p.S82C	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	82					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						TGTACCCTGCAGCGCGGTCCA	0.657																																					p.S82C		Atlas-SNP	.											.	TBC1D14	110	.	0			c.A244T						.						48.0	53.0	51.0					4																	6925360		2203	4300	6503	SO:0001583	missense	57533	exon2			CCCTGCAGCGCGG	AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.244A>T	chr4.hg19:g.6925360A>T	ENSP00000386921:p.Ser82Cys	171.0	0.0		82.0	39.0	NM_001113361	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	ENST00000409757.4	hg19	CCDS3394.2	.	.	.	.	.	.	.	.	.	.	A	15.09	2.729911	0.48833	.	.	ENSG00000132405	ENST00000444368;ENST00000448507;ENST00000409757	T;T;T	0.54279	0.58;3.32;3.32	4.83	3.66	0.41972	.	0.306951	0.30244	N	0.010077	T	0.41373	0.1156	L	0.27053	0.805	0.80722	D	1	D	0.57257	0.979	P	0.46975	0.533	T	0.20638	-1.0269	10	0.42905	T	0.14	-11.5914	8.0332	0.30478	0.9092:0.0:0.0908:0.0	.	82	Q9P2M4	TBC14_HUMAN	C	82	ENSP00000414951:S82C;ENSP00000404041:S82C;ENSP00000386921:S82C	ENSP00000386921:S82C	S	+	1	0	TBC1D14	6976261	1.000000	0.71417	0.981000	0.43875	0.180000	0.23129	2.763000	0.47605	0.902000	0.36520	0.533000	0.62120	AGC	.	.		0.657	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206981.3	NM_020773	
LRRC66	339977	hgsc.bcm.edu	37	4	52860981	52860981	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:52860981T>A	ENST00000343457.3	-	4	2213	c.2207A>T	c.(2206-2208)cAg>cTg	p.Q736L		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	736						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GCTCTCGTCCTGCAGGGACTC	0.498																																					p.Q736L		Atlas-SNP	.											.	LRRC66	128	.	0			c.A2207T						.						119.0	117.0	118.0					4																	52860981		2031	4196	6227	SO:0001583	missense	339977	exon4			TCGTCCTGCAGGG	BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.2207A>T	chr4.hg19:g.52860981T>A	ENSP00000341944:p.Gln736Leu	77.0	0.0		63.0	23.0	NM_001024611		Missense_Mutation	SNP	ENST00000343457.3	hg19	CCDS43229.1	.	.	.	.	.	.	.	.	.	.	T	12.63	1.996286	0.35226	.	.	ENSG00000188993	ENST00000343457	T	0.28069	1.63	4.21	0.217	0.15264	.	0.950663	0.08711	N	0.904982	T	0.13713	0.0332	N	0.08118	0	0.09310	N	1	P	0.39480	0.675	B	0.36504	0.226	T	0.14282	-1.0478	10	0.56958	D	0.05	-0.677	3.5626	0.07888	0.0:0.2362:0.2099:0.5539	.	736	Q68CR7	LRC66_HUMAN	L	736	ENSP00000341944:Q736L	ENSP00000341944:Q736L	Q	-	2	0	LRRC66	52555738	0.000000	0.05858	0.001000	0.08648	0.329000	0.28539	0.072000	0.14617	-0.029000	0.13827	0.496000	0.49642	CAG	.	.		0.498	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361473.1	NM_001024611	
CENPC	1060	hgsc.bcm.edu	37	4	68357970	68357970	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:68357970C>G	ENST00000273853.6	-	16	2693	c.2443G>C	c.(2443-2445)Ggt>Cgt	p.G815R		NM_001812.2	NP_001803.2	Q03188	CENPC_HUMAN	centromere protein C	815					chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	centromeric DNA binding (GO:0019237)|DNA binding (GO:0003677)										AGAGGTATACCTAGATTTACC	0.348																																					p.G815R		Atlas-SNP	.											.	CENPC1	66	.	0			c.G2443C						.						74.0	63.0	67.0					4																	68357970		1820	4076	5896	SO:0001583	missense	1060	exon16			GTATACCTAGATT	M95724	CCDS47063.1	4q13.2	2013-11-05	2013-07-03	2013-07-03	ENSG00000145241	ENSG00000145241			1854	protein-coding gene	gene with protein product		117141	"""centromere protein C 1"""	CENPC1		7959789	Standard	XR_245245		Approved	CENP-C, hcp-4, MIF2	uc003hdd.1	Q03188	OTTHUMG00000160735	ENST00000273853.6:c.2443G>C	chr4.hg19:g.68357970C>G	ENSP00000273853:p.Gly815Arg	81.0	0.0		46.0	23.0	NM_001812	Q8IW27|Q9P0M5	Missense_Mutation	SNP	ENST00000273853.6	hg19	CCDS47063.1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.673093	0.29693	.	.	ENSG00000145241	ENST00000273853	.	.	.	5.34	2.05	0.26809	Cupin, RmlC-type (1);	0.552784	0.17801	N	0.161570	T	0.11879	0.0289	N	0.08118	0	0.22880	N	0.998615	P	0.34462	0.454	B	0.24006	0.05	T	0.13818	-1.0495	9	0.45353	T	0.12	-9.2474	6.0144	0.19594	0.0:0.3764:0.0:0.6236	.	815	Q03188	CENPC_HUMAN	R	815	.	ENSP00000273853:G815R	G	-	1	0	CENPC1	68040565	0.569000	0.26643	0.679000	0.29978	0.684000	0.39900	0.193000	0.17116	0.566000	0.29273	0.563000	0.77884	GGT	.	.		0.348	CENPC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362001.2		
NPFFR2	10886	hgsc.bcm.edu	37	4	72994540	72994540	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:72994540A>G	ENST00000308744.6	+	2	636	c.538A>G	c.(538-540)Aca>Gca	p.T180A	NPFFR2_ENST00000358749.3_Missense_Mutation_p.T78A|NPFFR2_ENST00000344413.5_Intron|NPFFR2_ENST00000395999.1_Missense_Mutation_p.T81A	NM_004885.2	NP_004876.2	Q9Y5X5	NPFF2_HUMAN	neuropeptide FF receptor 2	180					detection of abiotic stimulus (GO:0009582)|G-protein coupled receptor signaling pathway (GO:0007186)|regulation of adenylate cyclase activity (GO:0045761)|regulation of cAMP-dependent protein kinase activity (GO:2000479)|regulation of MAPK cascade (GO:0043408)	actin cytoskeleton (GO:0015629)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuropeptide receptor activity (GO:0008188)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(24)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43			Lung(101;0.0935)|LUSC - Lung squamous cell carcinoma(112;0.138)			ACATATGCACACAGTCACTAA	0.368																																					p.T180A		Atlas-SNP	.											.	NPFFR2	98	.	0			c.A538G						.						192.0	179.0	184.0					4																	72994540		2203	4300	6503	SO:0001583	missense	10886	exon2			ATGCACACAGTCA	AF236083	CCDS3551.1, CCDS3552.1, CCDS47072.1	4q21	2012-08-10	2006-02-15	2006-02-15	ENSG00000056291	ENSG00000056291		"""GPCR / Class A :  Neuropeptide receptors : FF/AF"", ""GPCR / Class A : RF amide peptide receptors"""	4525	protein-coding gene	gene with protein product	"""neuropeptide FF 2"""	607449	"""G protein-coupled receptor 74"""	GPR74		10079187, 10851242	Standard	NM_001144756		Approved	NPFF2, NPGPR	uc003hgg.2	Q9Y5X5	OTTHUMG00000129918	ENST00000308744.6:c.538A>G	chr4.hg19:g.72994540A>G	ENSP00000307822:p.Thr180Ala	132.0	0.0		47.0	18.0	NM_004885	Q96RV1|Q9NR49	Missense_Mutation	SNP	ENST00000308744.6	hg19	CCDS3551.1	.	.	.	.	.	.	.	.	.	.	A	25.8	4.674499	0.88445	.	.	ENSG00000056291	ENST00000308744;ENST00000395999;ENST00000358749	T;T;T	0.45668	0.89;0.89;0.89	5.9	5.9	0.94986	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000052	T	0.76579	0.4007	H	0.96576	3.845	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.77557	0.975;0.99	D	0.85000	0.0899	10	0.87932	D	0	.	15.9936	0.80225	1.0:0.0:0.0:0.0	.	81;180	Q9Y5X5-3;Q9Y5X5	.;NPFF2_HUMAN	A	180;81;78	ENSP00000307822:T180A;ENSP00000379321:T81A;ENSP00000351599:T78A	ENSP00000307822:T180A	T	+	1	0	NPFFR2	73213404	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.163000	0.94750	2.251000	0.74343	0.528000	0.53228	ACA	.	.		0.368	NPFFR2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252170.2	NM_004885	
ADAMTS3	9508	hgsc.bcm.edu	37	4	73181644	73181644	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:73181644A>T	ENST00000286657.4	-	11	1566	c.1530T>A	c.(1528-1530)ccT>ccA	p.P510P		NM_014243.2	NP_055058.2	O15072	ATS3_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 3	510	Disintegrin.				collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix organization (GO:0030198)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|protein processing (GO:0016485)|vascular endothelial growth factor production (GO:0010573)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	endopeptidase activity (GO:0004175)|heparin binding (GO:0008201)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(33)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	76			Epithelial(6;4.97e-05)|OV - Ovarian serous cystadenocarcinoma(6;5.66e-05)|all cancers(17;0.000486)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGGGATTATCAGGATGGCTAC	0.403																																					p.P510P	NSCLC(168;1941 2048 2918 13048 43078)	Atlas-SNP	.											.	ADAMTS3	164	.	0			c.T1530A						.						100.0	95.0	96.0					4																	73181644		2203	4300	6503	SO:0001819	synonymous_variant	9508	exon11			ATTATCAGGATGG	AB002364	CCDS3553.1	4q21	2008-07-29	2005-08-19		ENSG00000156140	ENSG00000156140	3.4.24.-	"""ADAM metallopeptidases with thrombospondin type 1 motif"""	219	protein-coding gene	gene with protein product		605011	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 3"""			10094461	Standard	NM_014243		Approved	KIAA0366, ADAMTS-4	uc003hgk.2	O15072	OTTHUMG00000129912	ENST00000286657.4:c.1530T>A	chr4.hg19:g.73181644A>T		153.0	0.0		88.0	30.0	NM_014243	A1L3U9|Q9BXZ8	Silent	SNP	ENST00000286657.4	hg19	CCDS3553.1																																																																																			.	.		0.403	ADAMTS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252164.2		
FRAS1	80144	hgsc.bcm.edu	37	4	79366793	79366793	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:79366793A>G	ENST00000325942.6	+	42	6223	c.5783A>G	c.(5782-5784)cAt>cGt	p.H1928R	FRAS1_ENST00000264895.6_Missense_Mutation_p.H1928R	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1928					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GAGCCAACCCATGATATTTTT	0.388																																					p.H1928R		Atlas-SNP	.											.	FRAS1	779	.	0			c.A5783G						.						219.0	217.0	218.0					4																	79366793		1881	4109	5990	SO:0001583	missense	80144	exon42			CAACCCATGATAT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5783A>G	chr4.hg19:g.79366793A>G	ENSP00000326330:p.His1928Arg	103.0	0.0		52.0	20.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	A	13.72	2.320684	0.41096	.	.	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.28255	1.62;1.62	5.96	4.59	0.56863	.	0.442701	0.26746	N	0.022703	T	0.20820	0.0501	L	0.51422	1.61	0.80722	D	1	P;B	0.36086	0.536;0.384	B;B	0.30401	0.115;0.096	T	0.08617	-1.0713	10	0.33940	T	0.23	.	3.3313	0.07085	0.6348:0.0:0.1739:0.1913	.	1928;1928	E9PHH6;A2RRR8	.;.	R	1928	ENSP00000326330:H1928R;ENSP00000264895:H1928R	ENSP00000264895:H1928R	H	+	2	0	FRAS1	79585817	0.896000	0.30565	0.999000	0.59377	0.992000	0.81027	2.664000	0.46783	2.283000	0.76528	0.477000	0.44152	CAT	.	.		0.388	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
FRAS1	80144	hgsc.bcm.edu	37	4	79455718	79455718	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:79455718A>T	ENST00000264895.6	+	71	11481	c.11041A>T	c.(11041-11043)Aca>Tca	p.T3681S		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3677					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GGATCCCAATACATCTGATAT	0.448																																					p.T3681S		Atlas-SNP	.											.	FRAS1	779	.	0			c.A11041T						.						123.0	110.0	114.0					4																	79455718		1893	4119	6012	SO:0001583	missense	80144	exon71			CCCAATACATCTG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.11041A>T	chr4.hg19:g.79455718A>T	ENSP00000264895:p.Thr3681Ser	75.0	0.0		42.0	17.0	NM_025074	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000264895.6	hg19	CCDS54771.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.998|6.998	0.554236|0.554236	0.13374|0.13374	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000264895|ENST00000512123	T|.	0.11063|.	2.81|.	5.05|5.05	3.84|3.84	0.44239|0.44239	.|.	0.217790|.	0.37955|.	N|.	0.001868|.	T|T	0.46852|0.46852	0.1414|0.1414	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999999|0.999999	P|.	0.46064|.	0.872|.	B|.	0.37731|.	0.257|.	T|T	0.27536|0.27536	-1.0071|-1.0071	10|5	0.22706|.	T|.	0.39|.	.|.	11.9167|11.9167	0.52769|0.52769	0.8541:0.1459:0.0:0.0|0.8541:0.1459:0.0:0.0	.|.	3681|.	E9PHH6|.	.|.	S|F	3681|1909	ENSP00000264895:T3681S|.	ENSP00000264895:T3681S|.	T|Y	+|+	1|2	0|0	FRAS1|FRAS1	79674742|79674742	1.000000|1.000000	0.71417|0.71417	0.879000|0.879000	0.34478|0.34478	0.648000|0.648000	0.38561|0.38561	3.893000|3.893000	0.56243|0.56243	0.741000|0.741000	0.32674|0.32674	0.482000|0.482000	0.46254|0.46254	ACA|TAC	.	.		0.448	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
PTPN13	5783	hgsc.bcm.edu	37	4	87638220	87638220	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:87638220T>A	ENST00000411767.2	+	9	1398	c.1335T>A	c.(1333-1335)ggT>ggA	p.G445G	PTPN13_ENST00000427191.2_Silent_p.G445G|PTPN13_ENST00000316707.6_Silent_p.G445G|PTPN13_ENST00000511467.1_Silent_p.G445G|PTPN13_ENST00000436978.1_Silent_p.G445G			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	445					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CCAGCAGTGGTCTCCCAGGGG	0.403																																					p.G445G		Atlas-SNP	.											.	PTPN13	203	.	0			c.T1335A						.						68.0	68.0	68.0					4																	87638220		1849	4102	5951	SO:0001819	synonymous_variant	5783	exon9			CAGTGGTCTCCCA		CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.1335T>A	chr4.hg19:g.87638220T>A		78.0	0.0		48.0	22.0	NM_006264	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	ENST00000411767.2	hg19	CCDS47094.1																																																																																			.	.		0.403	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000363191.1		
CCSER1	401145	hgsc.bcm.edu	37	4	92519745	92519745	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:92519745T>A	ENST00000509176.1	+	11	2528	c.2240T>A	c.(2239-2241)gTg>gAg	p.V747E	CCSER1_ENST00000333691.8_Missense_Mutation_p.V747E	NM_001145065.1	NP_001138537.1	Q9C0I3	CCSE1_HUMAN	coiled-coil serine-rich protein 1	747																	AATCGAATTGTGAGCCAAAAT	0.398																																					p.V747E		Atlas-SNP	.											.	.	.	.	0			c.T2240A						.						46.0	40.0	42.0					4																	92519745		692	1591	2283	SO:0001583	missense	401145	exon11			GAATTGTGAGCCA		CCDS47099.1, CCDS47100.1	4q22.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184305	ENSG00000184305			29349	protein-coding gene	gene with protein product			"""family with sequence similarity 190, member A"""	FAM190A		11214970	Standard	NM_001145065		Approved	KIAA1680	uc003hsv.4	Q9C0I3	OTTHUMG00000160950	ENST00000509176.1:c.2240T>A	chr4.hg19:g.92519745T>A	ENSP00000425040:p.Val747Glu	175.0	0.0		118.0	48.0	NM_001145065	Q4W5M0|Q86V57	Missense_Mutation	SNP	ENST00000509176.1	hg19	CCDS47099.1	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889566	0.52014	.	.	ENSG00000184305	ENST00000509176;ENST00000333691	T;T	0.35236	1.32;1.32	5.77	4.59	0.56863	.	.	.	.	.	T	0.24122	0.0584	N	0.08118	0	0.26559	N	0.973771	D	0.55385	0.971	P	0.46917	0.531	T	0.04165	-1.0972	9	0.56958	D	0.05	-2.186	8.4929	0.33110	0.0:0.1502:0.0:0.8498	.	747	Q9C0I3	F190A_HUMAN	E	747	ENSP00000425040:V747E;ENSP00000329482:V747E	ENSP00000329482:V747E	V	+	2	0	FAM190A	92738768	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.797000	0.26999	1.126000	0.42016	0.528000	0.53228	GTG	.	.		0.398	CCSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363109.3	NM_001145065	
CENPE	1062	hgsc.bcm.edu	37	4	104061192	104061192	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:104061192T>A	ENST00000265148.3	-	38	6047	c.5958A>T	c.(5956-5958)aaA>aaT	p.K1986N	CENPE_ENST00000380026.3_Intron	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	1986					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		TGACATCTTCTTTCACTCTAA	0.323																																					p.K1986N		Atlas-SNP	.											.	CENPE	253	.	0			c.A5958T						.						101.0	76.0	85.0					4																	104061192		2203	4299	6502	SO:0001583	missense	1062	exon38			ATCTTCTTTCACT	Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.5958A>T	chr4.hg19:g.104061192T>A	ENSP00000265148:p.Lys1986Asn	94.0	0.0		59.0	22.0	NM_001813	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	ENST00000265148.3	hg19	CCDS34042.1	.	.	.	.	.	.	.	.	.	.	T	10.32	1.317374	0.23908	.	.	ENSG00000138778	ENST00000265148;ENST00000394771	T	0.71461	-0.57	4.92	-0.369	0.12534	.	.	.	.	.	T	0.74596	0.3737	M	0.62723	1.935	0.09310	N	1	D	0.76494	0.999	D	0.64144	0.922	T	0.61317	-0.7087	9	0.44086	T	0.13	.	3.7279	0.08481	0.1531:0.2574:0.0:0.5895	.	1986	Q02224	CENPE_HUMAN	N	1986	ENSP00000265148:K1986N	ENSP00000265148:K1986N	K	-	3	2	CENPE	104280641	0.001000	0.12720	0.001000	0.08648	0.017000	0.09413	0.050000	0.14120	-0.294000	0.08973	0.523000	0.50628	AAA	.	.		0.323	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
TACR3	6870	hgsc.bcm.edu	37	4	104511135	104511135	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:104511135T>A	ENST00000304883.2	-	5	1242	c.1102A>T	c.(1102-1104)Aag>Tag	p.K368*	RP11-297P16.3_ENST00000502936.1_RNA|RP11-297P16.3_ENST00000512401.1_RNA	NM_001059.2	NP_001050.1	P29371	NK3R_HUMAN	tachykinin receptor 3	368					aging (GO:0007568)|hyperosmotic salinity response (GO:0042538)|positive regulation of blood pressure (GO:0045777)|positive regulation of heart rate (GO:0010460)|positive regulation of uterine smooth muscle contraction (GO:0070474)|regulation of dopamine metabolic process (GO:0042053)|regulation of feeding behavior (GO:0060259)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to morphine (GO:0043278)|tachykinin receptor signaling pathway (GO:0007217)	cytoplasm (GO:0005737)|dendrite membrane (GO:0032590)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	tachykinin receptor activity (GO:0004995)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	51		Hepatocellular(203;0.217)		UCEC - Uterine corpus endometrioid carcinoma (10;0.22)|OV - Ovarian serous cystadenocarcinoma(123;3.4e-08)		AATGCTCTCTTGAAGCCAGCT	0.428																																					p.K368X		Atlas-SNP	.											TACR3,rectum,carcinoma,+1,1	TACR3	102	.	0			c.A1102T						.						65.0	64.0	64.0					4																	104511135		2203	4300	6503	SO:0001587	stop_gained	6870	exon5			CTCTCTTGAAGCC	M89473	CCDS3664.1	4q25	2012-08-08			ENSG00000169836	ENSG00000169836		"""GPCR / Class A : Tachykinin receptors"""	11528	protein-coding gene	gene with protein product	"""neurokinin beta receptor"""	162332				1374246	Standard	NM_001059		Approved	NK3R	uc003hxe.1	P29371	OTTHUMG00000131124	ENST00000304883.2:c.1102A>T	chr4.hg19:g.104511135T>A	ENSP00000303325:p.Lys368*	109.0	0.0		72.0	29.0	NM_001059	Q0P510	Nonsense_Mutation	SNP	ENST00000304883.2	hg19	CCDS3664.1	.	.	.	.	.	.	.	.	.	.	T	39	7.694338	0.98438	.	.	ENSG00000169836	ENST00000304883	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.3584	0.74448	0.0:0.0:0.0:1.0	.	.	.	.	X	368	.	ENSP00000303325:K368X	K	-	1	0	TACR3	104730584	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.565000	0.82337	2.217000	0.71921	0.482000	0.46254	AAG	.	.		0.428	TACR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253804.1	NM_001059	
EGF	1950	hgsc.bcm.edu	37	4	110915949	110915949	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:110915949A>C	ENST00000265171.5	+	20	3363	c.2918A>C	c.(2917-2919)gAc>gCc	p.D973A	RNU6-35P_ENST00000384530.1_RNA|EGF_ENST00000509793.1_Missense_Mutation_p.D931A|EGF_ENST00000503392.1_Missense_Mutation_p.D932A	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	973	EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00076}.				activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	AGAAATAGTGACTCTGAATGT	0.443																																					p.D973A		Atlas-SNP	.											.	EGF	113	.	0			c.A2918C						.						167.0	143.0	151.0					4																	110915949		2203	4300	6503	SO:0001583	missense	1950	exon20			ATAGTGACTCTGA	X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.2918A>C	chr4.hg19:g.110915949A>C	ENSP00000265171:p.Asp973Ala	70.0	0.0		54.0	16.0	NM_001963	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Missense_Mutation	SNP	ENST00000265171.5	hg19	CCDS3689.1	.	.	.	.	.	.	.	.	.	.	A	6.701	0.497961	0.12762	.	.	ENSG00000138798	ENST00000509793;ENST00000265171;ENST00000503392	D;D;D	0.87571	-2.27;-2.18;-2.19	5.35	-3.14	0.05250	Epidermal growth factor-like, type 3 (1);	1.123320	0.06488	N	0.734176	T	0.74869	0.3773	L	0.27053	0.805	0.09310	N	1	B;B;B	0.15141	0.012;0.003;0.012	B;B;B	0.10450	0.002;0.005;0.002	T	0.57539	-0.7794	10	0.16896	T	0.51	.	6.0503	0.19783	0.3294:0.2157:0.0:0.4549	.	932;931;973	E7EVD2;P01133-2;P01133	.;.;EGF_HUMAN	A	931;973;932	ENSP00000424316:D931A;ENSP00000265171:D973A;ENSP00000421384:D932A	ENSP00000265171:D973A	D	+	2	0	EGF	111135398	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.733000	0.04898	-0.012000	0.14223	0.533000	0.62120	GAC	.	.		0.443	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255065.1		
PDE5A	8654	hgsc.bcm.edu	37	4	120463621	120463621	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:120463621G>T	ENST00000354960.3	-	10	1884	c.1565C>A	c.(1564-1566)aCa>aAa	p.T522K	PDE5A_ENST00000264805.5_Missense_Mutation_p.T480K|PDE5A_ENST00000394439.1_Missense_Mutation_p.T470K|RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000512739.1_5'UTR	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	522					blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CACCTCCAATGTGACCATTTG	0.478																																					p.T522K		Atlas-SNP	.											.	PDE5A	83	.	0			c.C1565A						.						133.0	118.0	123.0					4																	120463621		2203	4300	6503	SO:0001583	missense	8654	exon10			TCCAATGTGACCA	D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1565C>A	chr4.hg19:g.120463621G>T	ENSP00000347046:p.Thr522Lys	145.0	0.0		87.0	29.0	NM_001083	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	ENST00000354960.3	hg19	CCDS3713.1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.796566	0.90453	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.54675	0.56;0.56;0.56	5.11	5.11	0.69529	.	0.172780	0.53938	D	0.000060	T	0.71341	0.3328	M	0.78049	2.395	0.80722	D	1	D;D	0.54601	0.967;0.967	P;P	0.59115	0.852;0.799	T	0.75528	-0.3286	10	0.72032	D	0.01	.	18.8992	0.92435	0.0:0.0:1.0:0.0	.	522;480	O76074;O76074-2	PDE5A_HUMAN;.	K	522;470;480	ENSP00000347046:T522K;ENSP00000377957:T470K;ENSP00000264805:T480K	ENSP00000264805:T480K	T	-	2	0	PDE5A	120683069	1.000000	0.71417	0.942000	0.38095	0.899000	0.52679	9.789000	0.99068	2.549000	0.85964	0.650000	0.86243	ACA	.	.		0.478	PDE5A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256529.1	NM_001083	
KIAA1109	84162	hgsc.bcm.edu	37	4	123246433	123246433	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:123246433A>T	ENST00000264501.4	+	65	11326	c.10953A>T	c.(10951-10953)gcA>gcT	p.A3651A	KIAA1109_ENST00000455637.1_Silent_p.A3651A|KIAA1109_ENST00000388738.3_Silent_p.A3651A			Q2LD37	K1109_HUMAN	KIAA1109	3651					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTGTGGATGCAGCATCTCCTG	0.323																																					p.A3651A		Atlas-SNP	.											.	KIAA1109	424	.	0			c.A10953T						.						76.0	78.0	78.0					4																	123246433		1813	4073	5886	SO:0001819	synonymous_variant	84162	exon63			GGATGCAGCATCT	AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.10953A>T	chr4.hg19:g.123246433A>T		377.0	1.0		255.0	102.0	NM_015312	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Silent	SNP	ENST00000264501.4	hg19	CCDS43267.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	11.27|11.27	1.590646|1.590646	0.28357|0.28357	.|.	.|.	ENSG00000138688|ENSG00000138688	ENST00000306802|ENST00000419325	.|.	.|.	.|.	5.93|5.93	3.4|3.4	0.38934|0.38934	.|.	.|.	.|.	.|.	.|.	T|T	0.55721|0.55721	0.1938|0.1938	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.47446|0.47446	-0.9117|-0.9117	4|4	.|.	.|.	.|.	.|.	7.1251|7.1251	0.25467|0.25467	0.5173:0.1176:0.0:0.3651|0.5173:0.1176:0.0:0.3651	.|.	.|.	.|.	.|.	L|C	41|1609	.|.	.|.	Q|S	+|+	2|1	0|0	KIAA1109|KIAA1109	123465883|123465883	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	0.380000|0.380000	0.20602|0.20602	0.440000|0.440000	0.26502|0.26502	0.533000|0.533000	0.62120|0.62120	CAG|AGC	.	.		0.323	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316415.1	NM_020797	
FAT4	79633	hgsc.bcm.edu	37	4	126370737	126370737	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:126370737A>T	ENST00000394329.3	+	9	8579	c.8566A>T	c.(8566-8568)Aca>Tca	p.T2856S	FAT4_ENST00000335110.5_Missense_Mutation_p.T1154S	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2856	Cadherin 27. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GACTGTAAGTACAGATGTCAC	0.408																																					p.T2856S		Atlas-SNP	.											.	FAT4	1752	.	0			c.A8566T						.						85.0	82.0	83.0					4																	126370737		2203	4300	6503	SO:0001583	missense	79633	exon9			GTAAGTACAGATG	AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.8566A>T	chr4.hg19:g.126370737A>T	ENSP00000377862:p.Thr2856Ser	106.0	0.0		75.0	25.0	NM_024582	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	ENST00000394329.3	hg19	CCDS3732.3	.	.	.	.	.	.	.	.	.	.	A	20.6	4.009869	0.75046	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.01685	4.69;4.69	5.51	5.51	0.81932	Cadherin (4);Cadherin-like (1);	0.000000	0.35235	U	0.003348	T	0.06962	0.0177	L	0.41492	1.28	0.58432	D	0.999999	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.87578	0.987;0.998;0.994	T	0.31779	-0.9931	10	0.59425	D	0.04	.	15.924	0.79597	1.0:0.0:0.0:0.0	.	1154;2856;2856	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	S	2856;1154	ENSP00000377862:T2856S;ENSP00000335169:T1154S	ENSP00000335169:T1154S	T	+	1	0	FAT4	126590187	1.000000	0.71417	0.997000	0.53966	0.861000	0.49209	9.097000	0.94193	2.217000	0.71921	0.533000	0.62120	ACA	.	.		0.408	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256765.2	NM_024582	
DCHS2	54798	hgsc.bcm.edu	37	4	155156250	155156250	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:155156250T>A	ENST00000357232.4	-	25	8188	c.8189A>T	c.(8188-8190)cAg>cTg	p.Q2730L		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2730					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CTGAACTGTCTGGGGTAACAC	0.483																																					p.Q2730L		Atlas-SNP	.											.	DCHS2	594	.	0			c.A8189T						.						78.0	63.0	68.0					4																	155156250		2203	4300	6503	SO:0001583	missense	54798	exon25			ACTGTCTGGGGTA	BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8189A>T	chr4.hg19:g.155156250T>A	ENSP00000349768:p.Gln2730Leu	94.0	0.0		64.0	28.0	NM_017639	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	ENST00000357232.4	hg19	CCDS3785.1	.	.	.	.	.	.	.	.	.	.	T	17.86	3.492591	0.64074	.	.	ENSG00000197410	ENST00000357232	T	0.54675	0.56	5.94	-1.1	0.09872	.	0.396151	0.23844	N	0.044018	T	0.26738	0.0654	N	0.20766	0.605	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.17077	-1.0381	10	0.11182	T	0.66	.	4.9814	0.14166	0.1087:0.0601:0.3403:0.491	.	2730	Q6V1P9	PCD23_HUMAN	L	2730	ENSP00000349768:Q2730L	ENSP00000349768:Q2730L	Q	-	2	0	DCHS2	155375700	0.006000	0.16342	0.000000	0.03702	0.419000	0.31324	0.630000	0.24553	-0.363000	0.08101	-0.385000	0.06624	CAG	.	.		0.483	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365281.2	NM_001142552	
ETFDH	2110	hgsc.bcm.edu	37	4	159603531	159603531	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:159603531T>G	ENST00000511912.1	+	3	692	c.360T>G	c.(358-360)gaT>gaG	p.D120E	ETFDH_ENST00000307738.5_Missense_Mutation_p.D73E	NM_001281738.1|NM_004453.2	NP_001268667.1|NP_004444.2	Q16134	ETFD_HUMAN	electron-transferring-flavoprotein dehydrogenase	120					cellular metabolic process (GO:0044237)|electron transport chain (GO:0022900)|fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)	4 iron, 4 sulfur cluster binding (GO:0051539)|electron carrier activity (GO:0009055)|electron-transferring-flavoprotein dehydrogenase activity (GO:0004174)|flavin adenine dinucleotide binding (GO:0050660)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, oxidizing metal ions with flavin as acceptor (GO:0043783)|quinone binding (GO:0048038)|ubiquinone binding (GO:0048039)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(13)|prostate(1)|skin(3)	28	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0172)		CTTGCCTTGATCCAGGTGCTT	0.413																																					p.D120E		Atlas-SNP	.											.	ETFDH	57	.	0			c.T360G						.						101.0	108.0	106.0					4																	159603531		2203	4300	6503	SO:0001583	missense	2110	exon3			CCTTGATCCAGGT	S69232	CCDS3800.1, CCDS64090.1	4q32-q35	2008-08-26			ENSG00000171503	ENSG00000171503			3483	protein-coding gene	gene with protein product		231675					Standard	NM_004453		Approved	ETFQO	uc003iqb.3	Q16134	OTTHUMG00000161684	ENST00000511912.1:c.360T>G	chr4.hg19:g.159603531T>G	ENSP00000426638:p.Asp120Glu	80.0	0.0		56.0	16.0	NM_004453	B4E3R9|J3KND9|Q7Z347	Missense_Mutation	SNP	ENST00000511912.1	hg19	CCDS3800.1	.	.	.	.	.	.	.	.	.	.	T	9.899	1.206361	0.22205	.	.	ENSG00000171503	ENST00000511912;ENST00000307738	D;D	0.95482	-3.72;-3.72	5.78	-11.0	0.00169	.	0.093945	0.64402	N	0.000001	T	0.78947	0.4364	N	0.05330	-0.07	0.41941	D	0.990614	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.001;0.003	T	0.70066	-0.4974	10	0.02654	T	1	0.2788	5.1954	0.15233	0.2346:0.4952:0.135:0.1352	.	73;59;120	B4E3R9;B4DEQ0;Q16134	.;.;ETFD_HUMAN	E	120;73	ENSP00000426638:D120E;ENSP00000303552:D73E	ENSP00000303552:D73E	D	+	3	2	ETFDH	159822981	1.000000	0.71417	0.010000	0.14722	0.794000	0.44872	0.659000	0.24994	-1.503000	0.01812	0.460000	0.39030	GAT	.	.		0.413	ETFDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365718.2		
DDX60L	91351	hgsc.bcm.edu	37	4	169369824	169369824	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:169369824T>C	ENST00000511577.1	-	9	1350	c.1103A>G	c.(1102-1104)aAt>aGt	p.N368S	DDX60L_ENST00000260184.7_Missense_Mutation_p.N368S|DDX60L_ENST00000505890.1_Missense_Mutation_p.N368S			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	368							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		GAAGGCTATATTCTTTAACAA	0.279																																					p.N368S		Atlas-SNP	.											.	DDX60L	116	.	0			c.A1103G						.						49.0	46.0	47.0					4																	169369824		1819	4074	5893	SO:0001583	missense	91351	exon9			GCTATATTCTTTA	AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1103A>G	chr4.hg19:g.169369824T>C	ENSP00000422423:p.Asn368Ser	361.0	0.0		228.0	82.0	NM_001012967	Q96ND6	Missense_Mutation	SNP	ENST00000511577.1	hg19		.	.	.	.	.	.	.	.	.	.	T	9.678	1.148510	0.21288	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.25912	1.77;1.77;1.79;2.44	2.55	2.55	0.30701	.	0.187799	0.24856	U	0.035060	T	0.32406	0.0828	L	0.55481	1.735	0.09310	N	1	D;D;D	0.69078	0.995;0.997;0.995	P;P;P	0.55965	0.788;0.788;0.788	T	0.07009	-1.0795	10	0.26408	T	0.33	.	8.0632	0.30646	0.0:0.0:0.0:1.0	.	368;368;368	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	S	368;368;368;96	ENSP00000260184:N368S;ENSP00000422423:N368S;ENSP00000422202:N368S;ENSP00000421026:N96S	ENSP00000260184:N368S	N	-	2	0	DDX60L	169606399	1.000000	0.71417	0.085000	0.20634	0.176000	0.22953	3.581000	0.53914	1.147000	0.42369	0.383000	0.25322	AAT	.	.		0.279	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000364839.1	NM_001012967	
DNAH5	1767	hgsc.bcm.edu	37	5	13920675	13920675	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:13920675T>C	ENST00000265104.4	-	6	816	c.712A>G	c.(712-714)Acg>Gcg	p.T238A		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	238	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					AAGTAGTCCGTAGGTTCCTTT	0.348									Kartagener syndrome																												p.T238A		Atlas-SNP	.											.	DNAH5	868	.	0			c.A712G						.						163.0	158.0	160.0					5																	13920675		2203	4300	6503	SO:0001583	missense	1767	exon6	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGTCCGTAGGTTC	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.712A>G	chr5.hg19:g.13920675T>C	ENSP00000265104:p.Thr238Ala	130.0	0.0		149.0	37.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	.	0.015	-1.552610	0.00918	.	.	ENSG00000039139	ENST00000265104	T	0.21543	2.0	6.07	-3.1	0.05315	.	1.385200	0.03796	N	0.263676	T	0.09468	0.0233	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31336	-0.9947	10	0.08837	T	0.75	.	8.1826	0.31319	0.1835:0.4598:0.0:0.3567	.	238	Q8TE73	DYH5_HUMAN	A	238	ENSP00000265104:T238A	ENSP00000265104:T238A	T	-	1	0	DNAH5	13973675	0.000000	0.05858	0.000000	0.03702	0.114000	0.19823	-0.199000	0.09491	-0.269000	0.09298	-0.899000	0.02877	ACG	.	.		0.348	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	
DNAH5	1767	hgsc.bcm.edu	37	5	13928204	13928204	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:13928204T>A	ENST00000265104.4	-	3	380	c.276A>T	c.(274-276)acA>acT	p.T92T		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	92	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					TTCAGATACCTGTTTCTGCTT	0.388									Kartagener syndrome																												p.T92T		Atlas-SNP	.											.	DNAH5	868	.	0			c.A276T						.						107.0	105.0	106.0					5																	13928204		2203	4300	6503	SO:0001630	splice_region_variant	1767	exon3	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	GATACCTGTTTCT	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.277+1A>T	chr5.hg19:g.13928204T>A		71.0	0.0		104.0	25.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	ENST00000265104.4	hg19	CCDS3882.1																																																																																			.	.		0.388	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	Silent
DNAH5	1767	hgsc.bcm.edu	37	5	13931352	13931352	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:13931352T>A	ENST00000265104.4	-	2	163	c.59A>T	c.(58-60)cAa>cTa	p.Q20L		NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	20	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CTTCAGTCTTTGCTAAAAGAA	0.373									Kartagener syndrome																												p.Q20L		Atlas-SNP	.											.	DNAH5	868	.	0			c.A59T						.						73.0	75.0	74.0					5																	13931352		2203	4300	6503	SO:0001630	splice_region_variant	1767	exon2	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AGTCTTTGCTAAA	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.58-1A>T	chr5.hg19:g.13931352T>A		95.0	0.0		94.0	21.0	NM_001369	Q92860|Q96L74|Q9H5S7|Q9HCG9	Missense_Mutation	SNP	ENST00000265104.4	hg19	CCDS3882.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.496828	0.64186	.	.	ENSG00000039139	ENST00000265104	T	0.24723	1.84	5.6	5.6	0.85130	.	0.053610	0.85682	D	0.000000	T	0.32912	0.0845	M	0.76574	2.34	0.80722	D	1	P	0.34546	0.456	B	0.33521	0.165	T	0.13469	-1.0508	10	0.49607	T	0.09	.	15.7445	0.77929	0.0:0.0:0.0:1.0	.	20	Q8TE73	DYH5_HUMAN	L	20	ENSP00000265104:Q20L	ENSP00000265104:Q20L	Q	-	2	0	DNAH5	13984352	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.021000	0.76425	2.257000	0.74773	0.528000	0.53228	CAA	.	.		0.373	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207057.2	NM_001369	Missense_Mutation
FBXL7	23194	hgsc.bcm.edu	37	5	15936796	15936796	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:15936796T>A	ENST00000504595.1	+	4	1458	c.977T>A	c.(976-978)aTc>aAc	p.I326N	FBXL7_ENST00000329673.7_Missense_Mutation_p.I314N|FBXL7_ENST00000510662.1_Missense_Mutation_p.I279N|MIR887_ENST00000401258.1_RNA	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	326					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TGCGCCTCCATCAAGGAGCTG	0.672																																					p.I326N		Atlas-SNP	.											.	FBXL7	138	.	0			c.T977A						.						27.0	30.0	29.0					5																	15936796		2185	4272	6457	SO:0001583	missense	23194	exon4			CCTCCATCAAGGA	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.977T>A	chr5.hg19:g.15936796T>A	ENSP00000423630:p.Ile326Asn	49.0	0.0		59.0	10.0	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	hg19	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	T	19.62	3.862352	0.71949	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.56611	0.45;0.45;0.45	5.37	5.37	0.77165	.	0.098474	0.64402	D	0.000001	T	0.53834	0.1821	M	0.67569	2.06	0.58432	D	0.999997	P	0.49559	0.925	B	0.41666	0.363	T	0.63051	-0.6723	10	0.87932	D	0	.	15.3717	0.74570	0.0:0.0:0.0:1.0	.	326	Q9UJT9	FBXL7_HUMAN	N	326;279;314	ENSP00000423630:I326N;ENSP00000425184:I279N;ENSP00000329632:I314N	ENSP00000329632:I314N	I	+	2	0	FBXL7	15989796	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	8.040000	0.89188	2.042000	0.60477	0.533000	0.62120	ATC	.	.		0.672	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
IL7R	3575	hgsc.bcm.edu	37	5	35874564	35874564	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:35874564T>A	ENST00000303115.3	+	6	849	c.720T>A	c.(718-720)ccT>ccA	p.P240P	IL7R_ENST00000343305.4_Intron|IL7R_ENST00000506850.1_Intron	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	240					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)	p.E237_L242>ASWC(2)|p.M238_L243>PCK(2)|p.P240_T244>RFCPH(1)|p.P240_L242>QSPSC(1)|p.I241_L242>CRPH(1)|p.P240_I241insCS(1)|p.P240_S246>LKC(1)|p.P240_S246>LQSC(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			AGATGGATCCTATCTTACTAA	0.428			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																														p.P240P		Atlas-SNP	.		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	.,1	IL7R	200	.	10	Complex - deletion inframe(6)|Complex - insertion inframe(2)|Insertion - In frame(1)|Complex - compound substitution(1)	haematopoietic_and_lymphoid_tissue(10)	c.T720A						.						242.0	210.0	221.0					5																	35874564		2203	4300	6503	SO:0001819	synonymous_variant	3575	exon6			GGATCCTATCTTA	M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.720T>A	chr5.hg19:g.35874564T>A		115.0	0.0		142.0	46.0	NM_002185	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Silent	SNP	ENST00000303115.3	hg19	CCDS3911.1																																																																																			.	.		0.428	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207577.2		
FYB	2533	hgsc.bcm.edu	37	5	39130702	39130702	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:39130702A>T	ENST00000351578.6	-	10	2020	c.1830T>A	c.(1828-1830)agT>agA	p.S610R	FYB_ENST00000505428.1_Missense_Mutation_p.S610R|FYB_ENST00000540520.1_Missense_Mutation_p.S620R|FYB_ENST00000515010.1_Missense_Mutation_p.S610R|FYB_ENST00000512982.1_Missense_Mutation_p.S610R	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	610					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			CTCCACTTCCACTCTGACTGT	0.333																																					p.S620R		Atlas-SNP	.											.	FYB	354	.	0			c.T1860A						.						74.0	69.0	70.0					5																	39130702		1889	4117	6006	SO:0001583	missense	2533	exon10			ACTTCCACTCTGA	U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.1830T>A	chr5.hg19:g.39130702A>T	ENSP00000316460:p.Ser610Arg	107.0	0.0		125.0	29.0	NM_001243093	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Missense_Mutation	SNP	ENST00000351578.6	hg19	CCDS47200.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.061175	0.76187	.	.	ENSG00000082074	ENST00000351578;ENST00000515010;ENST00000512982;ENST00000505428;ENST00000540520;ENST00000542542	T;T;T;T;T	0.25579	1.79;1.79;1.85;1.85;1.85	5.94	2.23	0.28157	.	0.261548	0.35407	N	0.003232	T	0.43743	0.1261	M	0.73962	2.25	0.27661	N	0.947068	D;D	0.76494	0.999;0.997	D;D	0.80764	0.994;0.916	T	0.20538	-1.0272	10	0.36615	T	0.2	-9.2975	7.11	0.25384	0.7451:0.0:0.2549:0.0	.	620;610	B4DLN2;O15117	.;FYB_HUMAN	R	610;610;610;610;620;610	ENSP00000316460:S610R;ENSP00000426346:S610R;ENSP00000425845:S610R;ENSP00000427114:S610R;ENSP00000442840:S620R	ENSP00000316460:S610R	S	-	3	2	FYB	39166459	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.882000	0.28186	0.470000	0.27294	0.528000	0.53228	AGT	.	.		0.333	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000367098.1	NM_001465	
MROH2B	133558	hgsc.bcm.edu	37	5	41048467	41048467	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:41048467A>T	ENST00000399564.4	-	16	2093	c.1643T>A	c.(1642-1644)cTa>cAa	p.L548Q	MROH2B_ENST00000506092.2_Missense_Mutation_p.L103Q	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	548																	TGTTTTCCATAGGTCTACCAA	0.468																																					p.L548Q		Atlas-SNP	.											.	.	.	.	0			c.T1643A						.						144.0	136.0	138.0					5																	41048467		1892	4118	6010	SO:0001583	missense	133558	exon16			TTCCATAGGTCTA		CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1643T>A	chr5.hg19:g.41048467A>T	ENSP00000382476:p.Leu548Gln	128.0	0.0		131.0	28.0	NM_173489	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	ENST00000399564.4	hg19	CCDS47202.1	.	.	.	.	.	.	.	.	.	.	A	15.83	2.950400	0.53186	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.07216	3.21;3.21	4.87	4.87	0.63330	Armadillo-type fold (1);	0.174107	0.28257	N	0.016019	T	0.17365	0.0417	L	0.50333	1.59	0.25720	N	0.985388	D	0.57899	0.981	P	0.58873	0.847	T	0.04203	-1.0969	10	0.36615	T	0.2	.	11.0524	0.47898	1.0:0.0:0.0:0.0	.	548	Q7Z745	HTRB2_HUMAN	Q	103;252;548	ENSP00000441504:L103Q;ENSP00000382476:L548Q	ENSP00000296803:L252Q	L	-	2	0	HEATR7B2	41084224	0.143000	0.22626	0.622000	0.29159	0.968000	0.65278	3.953000	0.56699	2.168000	0.68352	0.533000	0.62120	CTA	.	.		0.468	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367558.2	NM_173489	
CDC20B	166979	hgsc.bcm.edu	37	5	54429246	54429246	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:54429246C>G	ENST00000381375.2	-	6	836	c.691G>C	c.(691-693)Gac>Cac	p.D231H	CDC20B_ENST00000296733.1_Missense_Mutation_p.D231H|CDC20B_ENST00000322374.6_Missense_Mutation_p.D231H|CDC20B_ENST00000334206.5_Missense_Mutation_p.D231H			Q86Y33	CD20B_HUMAN	cell division cycle 20B	231										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TTACAGTAGTCATTTCGAAGA	0.353																																					p.D231H		Atlas-SNP	.											.	CDC20B	61	.	0			c.G691C						.						99.0	100.0	100.0					5																	54429246		2203	4300	6503	SO:0001583	missense	166979	exon6			AGTAGTCATTTCG	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.691G>C	chr5.hg19:g.54429246C>G	ENSP00000370781:p.Asp231His	77.0	0.0		97.0	16.0	NM_001170402	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Missense_Mutation	SNP	ENST00000381375.2	hg19	CCDS54852.1	.	.	.	.	.	.	.	.	.	.	C	19.20	3.782502	0.70222	.	.	ENSG00000164287	ENST00000334206;ENST00000296733;ENST00000381375;ENST00000322374	T;T;T;T	0.10099	2.91;2.91;2.91;2.91	4.97	4.1	0.47936	WD40 repeat-like-containing domain (1);	0.000000	0.49305	D	0.000156	T	0.42086	0.1187	M	0.93328	3.405	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;P;D	0.80764	0.994;0.944;0.879;0.983	T	0.56792	-0.7920	10	0.87932	D	0	-6.0811	13.2244	0.59907	0.0:0.9223:0.0:0.0777	.	231;231;231;231	Q86Y33-4;Q86Y33-3;Q86Y33;Q86Y33-2	.;.;CD20B_HUMAN;.	H	231	ENSP00000335664:D231H;ENSP00000296733:D231H;ENSP00000370781:D231H;ENSP00000315720:D231H	ENSP00000296733:D231H	D	-	1	0	CDC20B	54465003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.180000	0.65048	1.303000	0.44873	0.650000	0.86243	GAC	.	.		0.353	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
CDC20B	166979	hgsc.bcm.edu	37	5	54429259	54429259	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:54429259A>T	ENST00000381375.2	-	6	823	c.678T>A	c.(676-678)acT>acA	p.T226T	CDC20B_ENST00000296733.1_Silent_p.T226T|CDC20B_ENST00000322374.6_Silent_p.T226T|CDC20B_ENST00000334206.5_Silent_p.T226T			Q86Y33	CD20B_HUMAN	cell division cycle 20B	226										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			TTCGAAGACCAGTAATATGAA	0.353																																					p.T226T		Atlas-SNP	.											.	CDC20B	61	.	0			c.T678A						.						113.0	114.0	114.0					5																	54429259		2203	4300	6503	SO:0001819	synonymous_variant	166979	exon6			AAGACCAGTAATA	AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.678T>A	chr5.hg19:g.54429259A>T		83.0	0.0		108.0	19.0	NM_001170402	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Silent	SNP	ENST00000381375.2	hg19	CCDS54852.1																																																																																			.	.		0.353	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000369715.1	NM_152623	
DEPDC1B	55789	hgsc.bcm.edu	37	5	59899387	59899387	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:59899387T>A	ENST00000265036.5	-	9	1140	c.1073A>T	c.(1072-1074)cAg>cTg	p.Q358L	DEPDC1B_ENST00000453022.2_Missense_Mutation_p.Q358L|DEPDC1B_ENST00000545085.1_Missense_Mutation_p.Q331L|DEPDC1B_ENST00000509006.1_5'Flank	NM_018369.2	NP_060839.2	Q8WUY9	DEP1B_HUMAN	DEP domain containing 1B	358	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(2)|skin(2)	17		Lung NSC(810;0.000214)|Prostate(74;0.0147)|Breast(144;0.0991)|Ovarian(174;0.17)				GGAAAATGTCTGAACCATCTA	0.408																																					p.Q358L		Atlas-SNP	.											.	DEPDC1B	56	.	0			c.A1073T						.						62.0	66.0	65.0					5																	59899387		2203	4300	6503	SO:0001583	missense	55789	exon9			AATGTCTGAACCA	AF303178	CCDS3977.1, CCDS47214.1	5q12	2008-02-05			ENSG00000035499	ENSG00000035499			24902	protein-coding gene	gene with protein product	"""breast cancer cell 3"""					12477932	Standard	NM_001145208		Approved	XTP1, BRCC3	uc003jsh.3	Q8WUY9	OTTHUMG00000097083	ENST00000265036.5:c.1073A>T	chr5.hg19:g.59899387T>A	ENSP00000265036:p.Gln358Leu	47.0	0.0		57.0	14.0	NM_001145208	A8K3R9|B4DUT4|Q86WJ3|Q8IZY6|Q9NUN3|Q9NW57	Missense_Mutation	SNP	ENST00000265036.5	hg19	CCDS3977.1	.	.	.	.	.	.	.	.	.	.	T	14.51	2.557662	0.45590	.	.	ENSG00000035499	ENST00000265036;ENST00000453022;ENST00000545085	T;T;T	0.32272	1.46;1.46;1.46	5.27	4.12	0.48240	Rho GTPase-activating protein domain (2);Rho GTPase activation protein (1);	0.159640	0.56097	D	0.000022	T	0.34424	0.0897	M	0.76838	2.35	0.58432	D	0.999999	B;B	0.33345	0.27;0.409	B;B	0.33690	0.168;0.118	T	0.11060	-1.0603	9	.	.	.	-19.1281	10.8395	0.46706	0.0:0.0734:0.0:0.9266	.	358;358	B4DUT4;Q8WUY9	.;DEP1B_HUMAN	L	358;358;331	ENSP00000265036:Q358L;ENSP00000389101:Q358L;ENSP00000438320:Q331L	.	Q	-	2	0	DEPDC1B	59935144	1.000000	0.71417	1.000000	0.80357	0.572000	0.35998	7.269000	0.78482	1.025000	0.39708	0.482000	0.46254	CAG	.	.		0.408	DEPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214207.1	NM_018369	
MARVELD2	153562	hgsc.bcm.edu	37	5	68715848	68715848	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:68715848A>T	ENST00000325631.5	+	2	710	c.636A>T	c.(634-636)acA>acT	p.T212T	MARVELD2_ENST00000413223.2_Silent_p.T212T	NM_001038603.2|NM_001244734.1	NP_001033692.2|NP_001231663.1	Q8N4S9	MALD2_HUMAN	MARVEL domain containing 2	212	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				cell-cell junction organization (GO:0045216)|establishment of endothelial barrier (GO:0061028)|sensory perception of sound (GO:0007605)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|paranodal junction (GO:0033010)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|liver(1)|lung(4)|skin(1)|urinary_tract(1)	15		Lung NSC(167;0.000937)|Prostate(74;0.0187)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;7.31e-57)|Epithelial(20;1.05e-52)|all cancers(19;2.63e-48)|Lung(70;0.0183)		CTTGTGTCACAGCTTACATTC	0.512																																					p.T212T		Atlas-SNP	.											.	MARVELD2	49	.	0			c.A636T						.						214.0	199.0	204.0					5																	68715848		2203	4300	6503	SO:0001819	synonymous_variant	153562	exon2			TGTCACAGCTTAC	AK055094	CCDS34175.1, CCDS58956.1	5q13.1	2007-05-01	2004-07-12	2004-07-14	ENSG00000152939	ENSG00000152939			26401	protein-coding gene	gene with protein product	"""tricellulin"""	610572	"""MARVEL (membrane-associating) domain containing 2"", ""deafness, autosomal recessive 49"""	MRVLDC2, DFNB49		17186462	Standard	NM_001038603		Approved	FLJ30532, TRIC	uc003jwq.3	Q8N4S9	OTTHUMG00000162512	ENST00000325631.5:c.636A>T	chr5.hg19:g.68715848A>T		171.0	0.0		170.0	36.0	NM_001244734	A1BQX0|A1BQX1|A8KA97|Q96NM9	Silent	SNP	ENST00000325631.5	hg19	CCDS34175.1																																																																																			.	.		0.512	MARVELD2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369583.1	NM_144724	
MAP1B	4131	hgsc.bcm.edu	37	5	71411599	71411599	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:71411599T>A	ENST00000296755.7	+	2	557	c.259T>A	c.(259-261)Tct>Act	p.S87T	MAP1B_ENST00000504183.1_3'UTR	NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	87					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATCTCGACACTCTGCAAGATT	0.463																																					p.S87T	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.T259A						.						136.0	124.0	128.0					5																	71411599		2203	4300	6503	SO:0001583	missense	4131	exon2			CGACACTCTGCAA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.259T>A	chr5.hg19:g.71411599T>A	ENSP00000296755:p.Ser87Thr	59.0	0.0		53.0	10.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.391208	0.82902	.	.	ENSG00000131711	ENST00000512974;ENST00000296755;ENST00000511641	T;T	0.17528	2.27;2.27	5.75	5.75	0.90469	.	0.000000	0.53938	D	0.000042	T	0.37758	0.1015	L	0.59436	1.845	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	T	0.03259	-1.1055	10	0.32370	T	0.25	-16.5086	16.0623	0.80847	0.0:0.0:0.0:1.0	.	87	P46821	MAP1B_HUMAN	T	87	ENSP00000296755:S87T;ENSP00000423444:S87T	ENSP00000296755:S87T	S	+	1	0	MAP1B	71447355	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.431000	0.80335	2.195000	0.70347	0.533000	0.62120	TCT	.	.		0.463	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
MAP1B	4131	hgsc.bcm.edu	37	5	71491824	71491824	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:71491824A>T	ENST00000296755.7	+	5	2940	c.2642A>T	c.(2641-2643)gAg>gTg	p.E881V		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	881					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ATCCAGAAGGAGAGAGAAGTC	0.532																																					p.E881V	Melanoma(17;367 822 11631 31730 47712)	Atlas-SNP	.											.	MAP1B	243	.	0			c.A2642T						.						118.0	119.0	119.0					5																	71491824		2203	4300	6503	SO:0001583	missense	4131	exon5			AGAAGGAGAGAGA	L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.2642A>T	chr5.hg19:g.71491824A>T	ENSP00000296755:p.Glu881Val	102.0	0.0		136.0	32.0	NM_005909	A2BDK5	Missense_Mutation	SNP	ENST00000296755.7	hg19	CCDS4012.1	.	.	.	.	.	.	.	.	.	.	A	18.19	3.569611	0.65765	.	.	ENSG00000131711	ENST00000296755	T	0.03524	3.9	5.17	4.02	0.46733	.	0.307900	0.28119	N	0.016530	T	0.04272	0.0118	L	0.39898	1.24	0.53005	D	0.999962	P;P	0.37955	0.612;0.612	B;B	0.37943	0.261;0.261	T	0.50676	-0.8800	10	0.42905	T	0.14	-9.8103	10.3101	0.43704	0.9226:0.0:0.0774:0.0	.	755;881	A2BDK6;P46821	.;MAP1B_HUMAN	V	881	ENSP00000296755:E881V	ENSP00000296755:E881V	E	+	2	0	MAP1B	71527580	1.000000	0.71417	0.999000	0.59377	0.808000	0.45660	7.498000	0.81546	1.950000	0.56595	0.482000	0.46254	GAG	.	.		0.532	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000218561.6	NM_005909	
FAM169A	26049	hgsc.bcm.edu	37	5	74101006	74101006	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:74101006T>A	ENST00000389156.4	-	7	864	c.774A>T	c.(772-774)ttA>ttT	p.L258F	FAM169A_ENST00000380515.3_3'UTR|FAM169A_ENST00000510496.1_Missense_Mutation_p.L198F	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	258						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						CTTCTCTTTGTAATGCTCTGG	0.413																																					p.L258F		Atlas-SNP	.											.	FAM169A	61	.	0			c.A774T						.						119.0	116.0	117.0					5																	74101006		1855	4088	5943	SO:0001583	missense	26049	exon7			TCTTTGTAATGCT		CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.774A>T	chr5.hg19:g.74101006T>A	ENSP00000373808:p.Leu258Phe	68.0	0.0		82.0	12.0	NM_015566	A8K1T9|Q6MZT0|Q9H989	Missense_Mutation	SNP	ENST00000389156.4	hg19	CCDS43330.1	.	.	.	.	.	.	.	.	.	.	T	16.47	3.132928	0.56828	.	.	ENSG00000198780	ENST00000389156;ENST00000510496	T	0.57595	0.39	5.45	-2.97	0.05530	.	0.184844	0.26496	N	0.024052	T	0.33876	0.0878	L	0.39397	1.21	0.80722	D	1	P;P	0.46277	0.875;0.644	B;B	0.37198	0.243;0.192	T	0.14448	-1.0472	10	0.44086	T	0.13	-3.0567	9.5262	0.39165	0.1156:0.5465:0.0:0.3379	.	198;258	D6RB01;Q9Y6X4	.;F169A_HUMAN	F	258;198	ENSP00000373808:L258F	ENSP00000373808:L258F	L	-	3	2	FAM169A	74136762	0.331000	0.24713	0.985000	0.45067	0.986000	0.74619	-0.799000	0.04560	-0.461000	0.06993	0.477000	0.44152	TTA	.	.		0.413	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371092.2		
MCTP1	79772	hgsc.bcm.edu	37	5	94230454	94230454	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:94230454A>T	ENST00000515393.1	-	11	1738	c.1739T>A	c.(1738-1740)cTg>cAg	p.L580Q	MCTP1_ENST00000505208.1_Missense_Mutation_p.L359Q|MCTP1_ENST00000505078.1_Missense_Mutation_p.L96Q|MCTP1_ENST00000429576.2_Missense_Mutation_p.L313Q|MCTP1_ENST00000312216.8_Missense_Mutation_p.L359Q	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	580					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		AGTGACCAGCAGCACCAGGTG	0.537																																					p.L580Q		Atlas-SNP	.											.	MCTP1	110	.	0			c.T1739A						.						91.0	74.0	80.0					5																	94230454		2203	4300	6503	SO:0001583	missense	79772	exon11			ACCAGCAGCACCA		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1739T>A	chr5.hg19:g.94230454A>T	ENSP00000424126:p.Leu580Gln	62.0	0.0		92.0	17.0	NM_024717	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	hg19	CCDS34203.1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.291736	0.80914	.	.	ENSG00000175471	ENST00000515393;ENST00000429576;ENST00000505078;ENST00000312216;ENST00000508509;ENST00000512425;ENST00000505208;ENST00000506568	T;T;T;T;T;T;T;T	0.80653	-1.36;-1.08;-0.36;-1.27;-1.06;-1.26;-1.4;-1.04	5.38	5.38	0.77491	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.64402	D	0.000002	D	0.89146	0.6632	M	0.73962	2.25	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.78314	0.949;0.991;0.989	D	0.90488	0.4465	10	0.87932	D	0	-7.3821	15.6821	0.77376	1.0:0.0:0.0:0.0	.	580;313;359	Q6DN14;Q6DN14-3;Q6DN14-2	MCTP1_HUMAN;.;.	Q	580;313;96;359;300;241;359;181	ENSP00000424126:L580Q;ENSP00000391639:L313Q;ENSP00000426417:L96Q;ENSP00000308957:L359Q;ENSP00000423410:L300Q;ENSP00000431075:L241Q;ENSP00000426438:L359Q;ENSP00000426294:L181Q	ENSP00000308957:L359Q	L	-	2	0	MCTP1	94256210	1.000000	0.71417	0.998000	0.56505	0.866000	0.49608	8.910000	0.92685	2.165000	0.68154	0.482000	0.46254	CTG	.	.		0.537	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
MCTP1	79772	hgsc.bcm.edu	37	5	94353130	94353130	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:94353130A>T	ENST00000515393.1	-	2	778	c.779T>A	c.(778-780)aTg>aAg	p.M260K	MCTP1_ENST00000505208.1_Missense_Mutation_p.M39K|MCTP1_ENST00000429576.2_Missense_Mutation_p.M39K|MCTP1_ENST00000312216.8_Missense_Mutation_p.M39K	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	260	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		CAGCTGGTACATTCCGGGATC	0.378																																					p.M260K		Atlas-SNP	.											.	MCTP1	110	.	0			c.T779A						.						137.0	129.0	131.0					5																	94353130		2203	4300	6503	SO:0001583	missense	79772	exon2			TGGTACATTCCGG		CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.779T>A	chr5.hg19:g.94353130A>T	ENSP00000424126:p.Met260Lys	60.0	0.0		81.0	16.0	NM_024717	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	ENST00000515393.1	hg19	CCDS34203.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.16|18.16	3.562006|3.562006	0.65538|0.65538	.|.	.|.	ENSG00000175471|ENSG00000175471	ENST00000515393;ENST00000429576;ENST00000312216;ENST00000508509;ENST00000505208;ENST00000415885;ENST00000507214;ENST00000514780;ENST00000510732;ENST00000505465|ENST00000503301	T;T;T;T;T;T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;-0.2;1.15;3.0|.	5.79|5.79	5.79|5.79	0.91817|0.91817	C2 calcium/lipid-binding domain, CaLB (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.51568|0.51568	0.1682|0.1682	N|N	0.25060|0.25060	0.705|0.705	0.58432|0.58432	D|D	0.999999|0.999999	D;D;P|.	0.65815|.	0.995;0.981;0.956|.	P;P;P|.	0.53593|.	0.718;0.73;0.583|.	T|T	0.49163|0.49163	-0.8968|-0.8968	10|5	0.62326|.	D|.	0.03|.	-20.8458|-20.8458	13.651|13.651	0.62310|0.62310	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	260;39;39|.	Q6DN14;Q6DN14-3;Q6DN14-2|.	MCTP1_HUMAN;.;.|.	K|K	260;39;39;39;39;1;21;20;54;39|68	ENSP00000424126:M260K;ENSP00000391639:M39K;ENSP00000308957:M39K;ENSP00000423410:M39K;ENSP00000426438:M39K;ENSP00000424936:M21K;ENSP00000421543:M20K;ENSP00000422219:M54K;ENSP00000422317:M39K|.	ENSP00000308957:M39K|.	M|N	-|-	2|3	0|2	MCTP1|MCTP1	94378886|94378886	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	5.185000|5.185000	0.65076|0.65076	2.213000|2.213000	0.71641|0.71641	0.533000|0.533000	0.62120|0.62120	ATG|AAT	.	.		0.378	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000370280.3	NM_024717	
SLC25A46	91137	hgsc.bcm.edu	37	5	110081977	110081977	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:110081977A>T	ENST00000355943.3	+	4	518	c.392A>T	c.(391-393)tAc>tTc	p.Y131F	SLC25A46_ENST00000504098.1_5'UTR|SLC25A46_ENST00000509442.2_Missense_Mutation_p.Y40F|SLC25A46_ENST00000447245.2_Missense_Mutation_p.Y131F|SLC25A46_ENST00000513807.1_5'UTR	NM_138773.1	NP_620128.1	Q96AG3	S2546_HUMAN	solute carrier family 25, member 46	131					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	10		all_cancers(142;0.00203)|all_epithelial(76;4.52e-05)|Prostate(80;0.0115)|Colorectal(57;0.0676)|Ovarian(225;0.156)		OV - Ovarian serous cystadenocarcinoma(64;2.58e-09)|Epithelial(69;7.29e-08)|all cancers(49;9.35e-06)|COAD - Colon adenocarcinoma(37;0.211)		CAGGTTAATTACCATGCTCAG	0.303																																					p.Y131F		Atlas-SNP	.											.	SLC25A46	33	.	0			c.A392T						.						81.0	88.0	85.0					5																	110081977		2201	4294	6495	SO:0001583	missense	91137	exon4			TTAATTACCATGC	BC017169	CCDS4100.1	5q22.1	2013-05-22			ENSG00000164209	ENSG00000164209		"""Solute carriers"""	25198	protein-coding gene	gene with protein product		610826				1651562, 1651563, 16949250	Standard	NM_138773		Approved		uc003koz.3	Q96AG3	OTTHUMG00000128794	ENST00000355943.3:c.392A>T	chr5.hg19:g.110081977A>T	ENSP00000348211:p.Tyr131Phe	335.0	0.0		315.0	115.0	NM_138773	A8K2F2|B3KRE6|B4DTA3|D3DSZ6|D6R9W7|Q04197	Missense_Mutation	SNP	ENST00000355943.3	hg19	CCDS4100.1	.	.	.	.	.	.	.	.	.	.	A	10.26	1.302411	0.23736	.	.	ENSG00000164209	ENST00000509442;ENST00000355943;ENST00000447245	T;T;T	0.77750	-1.12;-1.12;-1.12	5.5	5.5	0.81552	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	L	0.55103	1.725	0.58432	D	0.999994	D;D	0.63880	0.993;0.985	P;P	0.49999	0.628;0.622	T	0.74169	-0.3752	10	0.10377	T	0.69	-8.2498	15.2619	0.73631	1.0:0.0:0.0:0.0	.	40;131	B4DY98;Q96AG3	.;S2546_HUMAN	F	40;131;131	ENSP00000424136:Y40F;ENSP00000348211:Y131F;ENSP00000399717:Y131F	ENSP00000348211:Y131F	Y	+	2	0	SLC25A46	110109876	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	8.229000	0.89791	2.084000	0.62774	0.528000	0.53228	TAC	.	.		0.303	SLC25A46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250721.5	NM_138773	
ACSL6	23305	hgsc.bcm.edu	37	5	131323886	131323886	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:131323886T>A	ENST00000379240.1	-	7	764	c.611A>T	c.(610-612)cAg>cTg	p.Q204L	ACSL6_ENST00000544770.1_Missense_Mutation_p.Q113L|ACSL6_ENST00000543479.1_Missense_Mutation_p.Q204L|ACSL6_ENST00000431707.1_Missense_Mutation_p.Q184L|ACSL6_ENST00000379249.3_Missense_Mutation_p.Q204L|ACSL6_ENST00000379255.1_Missense_Mutation_p.Q169L|ACSL6_ENST00000379246.1_Missense_Mutation_p.Q215L|ACSL6_ENST00000379244.1_Missense_Mutation_p.Q204L|ACSL6_ENST00000379264.2_Missense_Mutation_p.Q229L|ACSL6_ENST00000357096.1_Missense_Mutation_p.Q169L|ACSL6_ENST00000379272.2_Missense_Mutation_p.Q219L|ACSL6_ENST00000296869.4_Missense_Mutation_p.Q229L			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	204					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CACAGCCTTCTGAGGTTTGTC	0.567																																					p.Q229L		Atlas-SNP	.											.	ACSL6	169	.	0			c.A686T						.						266.0	249.0	255.0					5																	131323886		2203	4300	6503	SO:0001583	missense	23305	exon7			GCCTTCTGAGGTT	AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.611A>T	chr5.hg19:g.131323886T>A	ENSP00000368542:p.Gln204Leu	61.0	0.0		79.0	16.0	NM_001009185	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	ENST00000379240.1	hg19		.	.	.	.	.	.	.	.	.	.	T	14.19	2.460391	0.43736	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479;ENST00000434099;ENST00000430403	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06;3.06	5.92	3.47	0.39725	AMP-dependent synthetase/ligase (1);	0.439517	0.27595	N	0.018672	T	0.05547	0.0146	N	0.13098	0.295	0.29883	N	0.825873	B;B;B;B;B;B;B	0.26041	0.115;0.031;0.019;0.14;0.031;0.031;0.031	B;B;B;B;B;B;B	0.31337	0.078;0.062;0.063;0.128;0.038;0.038;0.038	T	0.27331	-1.0077	10	0.30078	T	0.28	.	8.6304	0.33915	0.0:0.0668:0.1304:0.8029	.	204;219;194;204;169;229;229	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	L	204;229;219;169;169;229;215;204;113;204;184;204;169;204	ENSP00000368551:Q204L;ENSP00000368566:Q229L;ENSP00000368574:Q219L;ENSP00000349608:Q169L;ENSP00000368557:Q169L;ENSP00000296869:Q229L;ENSP00000368548:Q215L;ENSP00000368546:Q204L;ENSP00000445154:Q113L;ENSP00000368542:Q204L;ENSP00000413329:Q184L;ENSP00000442124:Q204L;ENSP00000397507:Q169L;ENSP00000398423:Q204L	ENSP00000296869:Q229L	Q	-	2	0	ACSL6	131351785	1.000000	0.71417	0.970000	0.41538	0.399000	0.30720	4.060000	0.57477	0.470000	0.27294	0.454000	0.30748	CAG	.	.		0.567	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	protein_coding	OTTHUMT00000132622.1	NM_015256	
CATSPER3	347732	hgsc.bcm.edu	37	5	134332053	134332053	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:134332053A>T	ENST00000282611.6	+	3	429	c.343A>T	c.(343-345)Aac>Tac	p.N115Y		NM_178019.2	NP_821138.1	Q86XQ3	CTSR3_HUMAN	cation channel, sperm associated 3	115					calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sodium ion transport (GO:0006814)|sperm capacitation (GO:0048240)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)	acrosomal vesicle (GO:0001669)|CatSper complex (GO:0036128)|endoplasmic reticulum (GO:0005783)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|stomach(1)|urinary_tract(1)	18			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			GAACGGCTACAACCTGCTGGA	0.473																																					p.N115Y		Atlas-SNP	.											.	CATSPER3	38	.	0			c.A343T						.						258.0	203.0	222.0					5																	134332053		2203	4300	6503	SO:0001583	missense	347732	exon3			GGCTACAACCTGC	AF432876	CCDS4181.1	5q31.2	2011-07-05			ENSG00000152705	ENSG00000152705		"""Voltage-gated ion channels / Cation channels, sperm associated"""	20819	protein-coding gene	gene with protein product		609120				12646162, 12932298, 17227845, 16382101	Standard	NM_178019		Approved	CACRC	uc003lag.3	Q86XQ3	OTTHUMG00000129137	ENST00000282611.6:c.343A>T	chr5.hg19:g.134332053A>T	ENSP00000282611:p.Asn115Tyr	53.0	0.0		64.0	9.0	NM_178019	Q86XS6	Missense_Mutation	SNP	ENST00000282611.6	hg19	CCDS4181.1	.	.	.	.	.	.	.	.	.	.	A	13.75	2.329246	0.41197	.	.	ENSG00000152705	ENST00000282611	D	0.99259	-5.64	4.14	4.14	0.48551	Ion transport (1);	0.105491	0.42172	D	0.000744	D	0.99281	0.9749	M	0.87827	2.91	0.36895	D	0.890081	D	0.63046	0.992	D	0.66847	0.947	D	0.99912	1.1208	10	0.87932	D	0	-32.1956	9.8501	0.41051	1.0:0.0:0.0:0.0	.	115	Q86XQ3	CTSR3_HUMAN	Y	115	ENSP00000282611:N115Y	ENSP00000282611:N115Y	N	+	1	0	CATSPER3	134359952	1.000000	0.71417	0.998000	0.56505	0.138000	0.21146	2.495000	0.45337	2.092000	0.63282	0.459000	0.35465	AAC	.	.		0.473	CATSPER3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251191.2	NM_178019	
HBEGF	1839	hgsc.bcm.edu	37	5	139725617	139725617	+	Silent	SNP	T	T	A	rs375401691		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:139725617T>A	ENST00000230990.6	-	2	401	c.99A>T	c.(97-99)ctA>ctT	p.L33L	CTC-329D1.3_ENST00000520443.1_RNA|HBEGF_ENST00000507104.1_Silent_p.L33L	NM_001945.2	NP_001936.1	Q99075	HBEGF_HUMAN	heparin-binding EGF-like growth factor	33					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|muscle organ development (GO:0007517)|negative regulation of elastin biosynthetic process (GO:0051545)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of wound healing (GO:0090303)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)	7			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCCAGCAGCTAGCCCTCTCC	0.667											OREG0016844	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L33L		Atlas-SNP	.											.	HBEGF	12	.	0			c.A99T						.	T		0,4406		0,0,2203	30.0	35.0	34.0		99	2.6	0.4	5		34	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	HBEGF	NM_001945.2		0,1,6502	AA,AT,TT		0.0116,0.0,0.0077		33/209	139725617	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	1839	exon2			AGCAGCTAGCCCT		CCDS4223.1	5q23	2012-10-02	2005-01-14	2005-01-14	ENSG00000113070	ENSG00000113070			3059	protein-coding gene	gene with protein product	"""Diphtheria toxin receptor (heparin-binding EGF-like growth factor)"", ""heparin-binding epidermal growth factor"""	126150	"""diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor)"""	HEGFL, DTS, DTR		7590736, 12163414	Standard	NM_001945		Approved		uc003lfi.3	Q99075	OTTHUMG00000129496	ENST00000230990.6:c.99A>T	chr5.hg19:g.139725617T>A		105.0	0.0	1651	103.0	20.0	NM_001945	B2R821	Silent	SNP	ENST00000230990.6	hg19	CCDS4223.1																																																																																			.	.		0.667	HBEGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251665.2	NM_001945	
PCDHB3	56132	hgsc.bcm.edu	37	5	140481325	140481325	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140481325A>T	ENST00000231130.2	+	1	1092	c.1092A>T	c.(1090-1092)gtA>gtT	p.V364V	AC005754.7_ENST00000607216.1_RNA	NM_018937.2	NP_061760.1	Q9Y5E6	PCDB3_HUMAN	protocadherin beta 3	364	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	72			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GAGAGACTGTACTGGCTGTTT	0.473																																					p.V364V		Atlas-SNP	.											.	PCDHB3	208	.	0			c.A1092T						.						85.0	82.0	83.0					5																	140481325		2203	4300	6503	SO:0001819	synonymous_variant	56132	exon1			GACTGTACTGGCT	AF152496	CCDS4245.1	5q31	2010-01-26			ENSG00000113205	ENSG00000113205		"""Cadherins / Protocadherins : Clustered"""	8688	other	protocadherin		606329				10380929	Standard	NM_018937		Approved	PCDH-BETA3	uc003lio.3	Q9Y5E6	OTTHUMG00000129622	ENST00000231130.2:c.1092A>T	chr5.hg19:g.140481325A>T		53.0	0.0		62.0	16.0	NM_018937	B2R8P2	Silent	SNP	ENST00000231130.2	hg19	CCDS4245.1																																																																																			.	.		0.473	PCDHB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251817.2	NM_018937	
PCDHB6	56130	hgsc.bcm.edu	37	5	140531957	140531957	+	Missense_Mutation	SNP	G	G	T	rs540523095		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140531957G>T	ENST00000231136.1	+	1	2119	c.2119G>T	c.(2119-2121)Gtg>Ttg	p.V707L	PCDHB6_ENST00000543635.1_Missense_Mutation_p.V571L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	707					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCTCCTGTTCGTGGCGGTGCG	0.687																																					p.V707L		Atlas-SNP	.											.	PCDHB6	161	.	0			c.G2119T						.						80.0	93.0	89.0					5																	140531957		2199	4269	6468	SO:0001583	missense	56130	exon1			CTGTTCGTGGCGG	AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2119G>T	chr5.hg19:g.140531957G>T	ENSP00000231136:p.Val707Leu	69.0	0.0		66.0	10.0	NM_018939	B2R8R9	Missense_Mutation	SNP	ENST00000231136.1	hg19	CCDS4248.1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.932948	0.34096	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.13901	2.55;2.55	4.55	-0.0228	0.13946	.	.	.	.	.	T	0.14527	0.0351	L	0.51914	1.62	0.09310	N	1	B	0.18310	0.027	B	0.25405	0.06	T	0.31806	-0.9930	9	0.72032	D	0.01	.	10.3991	0.44218	0.3439:0.0:0.6561:0.0	.	707	Q9Y5E3	PCDB6_HUMAN	L	571;707	ENSP00000438466:V571L;ENSP00000231136:V707L	ENSP00000231136:V707L	V	+	1	0	PCDHB6	140512141	0.000000	0.05858	0.284000	0.24805	0.974000	0.67602	-0.315000	0.08081	0.116000	0.18110	0.556000	0.70494	GTG	.	.		0.687	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251818.2	NM_018939	
PCDHB7	56129	hgsc.bcm.edu	37	5	140552882	140552882	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140552882A>T	ENST00000231137.3	+	1	640	c.466A>T	c.(466-468)Agt>Tgt	p.S156C		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	156	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TCTCCTAGAGAGTGCACAGGA	0.458																																					p.S156C		Atlas-SNP	.											.	PCDHB7	231	.	0			c.A466T						.						53.0	56.0	55.0					5																	140552882		2203	4300	6503	SO:0001583	missense	56129	exon1			CTAGAGAGTGCAC	AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.466A>T	chr5.hg19:g.140552882A>T	ENSP00000231137:p.Ser156Cys	105.0	0.0		132.0	24.0	NM_018940	A1L3Y8	Missense_Mutation	SNP	ENST00000231137.3	hg19	CCDS4249.1	.	.	.	.	.	.	.	.	.	.	A	10.03	1.237785	0.22711	.	.	ENSG00000113212	ENST00000231137	T	0.53640	0.61	4.61	2.09	0.27110	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.56124	0.1964	H	0.94886	3.595	0.09310	N	1	B	0.18863	0.031	B	0.27262	0.078	T	0.58346	-0.7652	9	0.54805	T	0.06	.	3.1162	0.06375	0.4211:0.3683:0.0808:0.1298	.	156	Q9Y5E2	PCDB7_HUMAN	C	156	ENSP00000231137:S156C	ENSP00000231137:S156C	S	+	1	0	PCDHB7	140533066	0.000000	0.05858	0.906000	0.35671	0.908000	0.53690	-0.160000	0.10041	0.202000	0.20498	0.533000	0.62120	AGT	.	.		0.458	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251803.2	NM_018940	
PCDHB8	56128	hgsc.bcm.edu	37	5	140559337	140559337	+	Silent	SNP	C	C	T	rs374710779		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140559337C>T	ENST00000239444.2	+	1	1967	c.1722C>T	c.(1720-1722)acC>acT	p.T574T	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	574	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CGCCCTGCACCGAGCTGGTGC	0.701																																					p.T574T		Atlas-SNP	.											PCDHB8,NS,carcinoma,0,1	PCDHB8	199	.	0			c.C1722T						.						9.0	18.0	15.0					5																	140559337		2148	4213	6361	SO:0001819	synonymous_variant	56128	exon1			CTGCACCGAGCTG	AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.1722C>T	chr5.hg19:g.140559337C>T		68.0	0.0		86.0	4.0	NM_019120	B9EGV1	Silent	SNP	ENST00000239444.2	hg19	CCDS4250.1																																																																																			.	.		0.701	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251816.2	NM_019120	
PCDHB11	56125	hgsc.bcm.edu	37	5	140581442	140581442	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140581442T>A	ENST00000354757.3	+	1	2095	c.2095T>A	c.(2095-2097)Tcg>Acg	p.S699T	PCDHB11_ENST00000536699.1_Missense_Mutation_p.S334T	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	699					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTCGGTGTCTTCGCTCTTCCT	0.687																																					p.S699T		Atlas-SNP	.											PCDHB11,right_upper_lobe,carcinoma,0,1	PCDHB11	162	.	0			c.T2095A						.						92.0	93.0	93.0					5																	140581442		2202	4295	6497	SO:0001583	missense	56125	exon1			GTGTCTTCGCTCT	AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2095T>A	chr5.hg19:g.140581442T>A	ENSP00000346802:p.Ser699Thr	91.0	0.0		99.0	25.0	NM_018931	B4DSF7|Q2M223	Missense_Mutation	SNP	ENST00000354757.3	hg19	CCDS4253.1	.	.	.	.	.	.	.	.	.	.	t	9.122	1.009275	0.19277	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.13538	2.58;2.58	2.64	2.64	0.31445	.	.	.	.	.	T	0.23094	0.0558	M	0.86343	2.81	0.09310	N	1	B	0.31077	0.307	B	0.34093	0.175	T	0.10382	-1.0632	9	0.41790	T	0.15	.	10.6444	0.45610	0.0:0.0:0.0:1.0	.	699	Q9Y5F2	PCDBB_HUMAN	T	334;699	ENSP00000440344:S334T;ENSP00000346802:S699T	ENSP00000346802:S699T	S	+	1	0	PCDHB11	140561626	0.000000	0.05858	0.536000	0.28039	0.692000	0.40212	0.004000	0.13106	1.215000	0.43411	0.369000	0.22263	TCG	.	.		0.687	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251813.1	NM_018931	
PCDHGA3	56112	hgsc.bcm.edu	37	5	140726047	140726047	+	Intron	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140726047T>C	ENST00000253812.6	+	1	2424				PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTCTTTGATTATTAAGAAC	0.323																																					p.I816T		Atlas-SNP	.											.	PCDHGA3	246	.	0			c.T2447C						.						34.0	38.0	36.0					5																	140726047		2096	4239	6335	SO:0001627	intron_variant	56112	exon1			CTTTGATTATTAA	AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.2424+23T>C	chr5.hg19:g.140726047T>C		294.0	0.0		344.0	67.0	NM_032011	Q9Y5D4	Missense_Mutation	SNP	ENST00000253812.6	hg19	CCDS47290.1																																																																																			.	.		0.323	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377017.1	NM_018916	
PCDHGC4	56098	hgsc.bcm.edu	37	5	140865877	140865877	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:140865877A>T	ENST00000306593.1	+	1	1137	c.1137A>T	c.(1135-1137)tcA>tcT	p.S379S	PCDHGB6_ENST00000520790.1_Intron|PCDHGC5_ENST00000252087.1_5'Flank|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018928.2|NM_032406.1	NP_061751.1|NP_115782.1	Q9Y5F7	PCDGL_HUMAN	protocadherin gamma subfamily C, 4	379	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(13)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	42			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCAGACTCAGGGTCAAACG	0.562																																					p.S379S		Atlas-SNP	.											.	PCDHGC4	91	.	0			c.A1137T						.						117.0	97.0	104.0					5																	140865877		2203	4300	6503	SO:0001819	synonymous_variant	56098	exon1			AGACTCAGGGTCA	AF152525	CCDS4262.1, CCDS75349.1	5q31	2010-01-26			ENSG00000242419	ENSG00000242419		"""Cadherins / Protocadherins : Clustered"""	8717	other	protocadherin		606305				10380929	Standard	NM_018928		Approved	PCDH-GAMMA-C4		Q9Y5F7	OTTHUMG00000129625	ENST00000306593.1:c.1137A>T	chr5.hg19:g.140865877A>T		115.0	0.0		146.0	32.0	NM_018928	Q495T2|Q9Y5C3	Silent	SNP	ENST00000306593.1	hg19	CCDS4262.1																																																																																			.	.		0.562	PCDHGC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251820.1	NM_018928	
ARSI	340075	hgsc.bcm.edu	37	5	149676796	149676796	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:149676796A>T	ENST00000328668.7	-	2	2270	c.1691T>A	c.(1690-1692)cTa>cAa	p.L564Q		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	564					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTGGGACATTAGCCTGGTGTT	0.527																																					p.L564Q		Atlas-SNP	.											.	ARSI	65	.	0			c.T1691A						.						105.0	99.0	101.0					5																	149676796		2203	4300	6503	SO:0001583	missense	340075	exon2			GACATTAGCCTGG	AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.1691T>A	chr5.hg19:g.149676796A>T	ENSP00000333395:p.Leu564Gln	167.0	0.0		199.0	45.0	NM_001012301	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	ENST00000328668.7	hg19	CCDS34275.1	.	.	.	.	.	.	.	.	.	.	A	8.481	0.859725	0.17178	.	.	ENSG00000183876	ENST00000328668;ENST00000515301	D;D	0.97710	-4.5;-3.61	4.56	4.56	0.56223	.	0.077544	0.50627	D	0.000110	D	0.95557	0.8556	L	0.50333	1.59	0.44030	D	0.996751	P	0.45348	0.856	B	0.38803	0.282	D	0.95850	0.8874	10	0.87932	D	0	.	14.0867	0.64962	1.0:0.0:0.0:0.0	.	564	Q5FYB1	ARSI_HUMAN	Q	564;421	ENSP00000333395:L564Q;ENSP00000426879:L421Q	ENSP00000333395:L564Q	L	-	2	0	ARSI	149656989	1.000000	0.71417	0.996000	0.52242	0.138000	0.21146	7.107000	0.77047	1.909000	0.55274	0.523000	0.50628	CTA	.	.		0.527	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000373681.1	NM_001012301	
FAT2	2196	hgsc.bcm.edu	37	5	150933925	150933925	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:150933925T>A	ENST00000261800.5	-	4	3955	c.3943A>T	c.(3943-3945)Acg>Tcg	p.T1315S		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	1315	Cadherin 11. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGCTCACCGTTAGGATGTTG	0.537																																					p.T1315S		Atlas-SNP	.											.	FAT2	465	.	0			c.A3943T						.						69.0	63.0	65.0					5																	150933925		2203	4300	6503	SO:0001583	missense	2196	exon4			TCACCGTTAGGAT	AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.3943A>T	chr5.hg19:g.150933925T>A	ENSP00000261800:p.Thr1315Ser	109.0	0.0		114.0	18.0	NM_001447	O75091|Q9NSR7	Missense_Mutation	SNP	ENST00000261800.5	hg19	CCDS4317.1	.	.	.	.	.	.	.	.	.	.	T	15.59	2.879833	0.51801	.	.	ENSG00000086570	ENST00000261800	T	0.02345	4.33	5.46	5.46	0.80206	Cadherin (4);Cadherin-like (1);	0.000000	0.64402	D	0.000005	T	0.05547	0.0146	L	0.58810	1.83	0.51767	D	0.999931	P	0.44946	0.846	P	0.48189	0.57	T	0.50759	-0.8790	10	0.11794	T	0.64	.	10.2894	0.43586	0.1471:0.0:0.0:0.8529	.	1315	Q9NYQ8	FAT2_HUMAN	S	1315	ENSP00000261800:T1315S	ENSP00000261800:T1315S	T	-	1	0	FAT2	150914118	1.000000	0.71417	0.913000	0.36048	0.665000	0.39181	4.721000	0.61951	2.191000	0.70037	0.533000	0.62120	ACG	.	.		0.537	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252434.1	NM_001447	
GRIA1	2890	hgsc.bcm.edu	37	5	153085377	153085377	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:153085377A>T	ENST00000285900.5	+	11	1916	c.1573A>T	c.(1573-1575)Aag>Tag	p.K525*	GRIA1_ENST00000448073.4_Nonsense_Mutation_p.K535*|GRIA1_ENST00000518783.1_Nonsense_Mutation_p.K535*|GRIA1_ENST00000521843.2_Nonsense_Mutation_p.K456*|GRIA1_ENST00000340592.5_Nonsense_Mutation_p.K525*|GRIA1_ENST00000518142.1_Nonsense_Mutation_p.K445*	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	525					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	ACAGAAATCCAAGCCGGGTGT	0.423																																					p.K535X		Atlas-SNP	.											.	GRIA1	321	.	0			c.A1603T						.						165.0	162.0	163.0					5																	153085377		2203	4300	6503	SO:0001587	stop_gained	2890	exon11			AAATCCAAGCCGG		CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1573A>T	chr5.hg19:g.153085377A>T	ENSP00000285900:p.Lys525*	132.0	0.0		157.0	34.0	NM_001258021	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Nonsense_Mutation	SNP	ENST00000285900.5	hg19	CCDS4322.1	.	.	.	.	.	.	.	.	.	.	A	38	6.805579	0.97853	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2848	0.66240	1.0:0.0:0.0:0.0	.	.	.	.	X	525;525;445;479;525;456;456;535;535	.	ENSP00000285900:K525X	K	+	1	0	GRIA1	153065570	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	9.072000	0.93986	2.020000	0.59435	0.533000	0.62120	AAG	.	.		0.423	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000252456.3		
ATP10B	23120	hgsc.bcm.edu	37	5	160071197	160071197	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:160071197T>A	ENST00000327245.5	-	9	1662	c.816A>T	c.(814-816)cgA>cgT	p.R272R		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	272					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGGTGCAGCCTCGAAGCAGAA	0.498																																					p.R272R		Atlas-SNP	.											.	ATP10B	201	.	0			c.A816T						.						119.0	121.0	120.0					5																	160071197		2011	4183	6194	SO:0001819	synonymous_variant	23120	exon9			GCAGCCTCGAAGC	AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.816A>T	chr5.hg19:g.160071197T>A		122.0	0.0		116.0	25.0	NM_025153	Q9H725	Silent	SNP	ENST00000327245.5	hg19	CCDS43394.1																																																																																			.	.		0.498	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374127.1	NM_025153	
DOCK2	1794	hgsc.bcm.edu	37	5	169174411	169174411	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:169174411G>A	ENST00000256935.8	+	23	2359	c.2279G>A	c.(2278-2280)gGc>gAc	p.G760D	DOCK2_ENST00000540750.1_5'UTR|DOCK2_ENST00000520908.1_Missense_Mutation_p.G252D	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	760					actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CTTTATGAAGGCAAAGAACAG	0.353																																					p.G760D		Atlas-SNP	.											.	DOCK2	389	.	0			c.G2279A						.						78.0	75.0	76.0					5																	169174411		2203	4300	6503	SO:0001583	missense	1794	exon23			ATGAAGGCAAAGA	BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.2279G>A	chr5.hg19:g.169174411G>A	ENSP00000256935:p.Gly760Asp	119.0	0.0		99.0	23.0	NM_004946	Q2M3I0|Q96AK7	Missense_Mutation	SNP	ENST00000256935.8	hg19	CCDS4371.1	.	.	.	.	.	.	.	.	.	.	G	13.03	2.116645	0.37339	.	.	ENSG00000134516	ENST00000256935;ENST00000520908	T;T	0.37235	1.21;1.21	5.57	5.57	0.84162	.	0.047995	0.85682	D	0.000000	T	0.49029	0.1533	L	0.35793	1.09	0.80722	D	1	D;D	0.76494	0.999;0.994	P;P	0.62089	0.879;0.898	T	0.36432	-0.9748	10	0.42905	T	0.14	.	18.3118	0.90203	0.0:0.0:1.0:0.0	.	252;760	E7ERW7;Q92608	.;DOCK2_HUMAN	D	760;252	ENSP00000256935:G760D;ENSP00000429283:G252D	ENSP00000256935:G760D	G	+	2	0	DOCK2	169106989	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.921000	0.87530	2.623000	0.88846	0.561000	0.74099	GGC	.	.		0.353	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252828.2	NM_004946	
STC2	8614	hgsc.bcm.edu	37	5	172744922	172744922	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:172744922A>T	ENST00000265087.4	-	4	2146	c.837T>A	c.(835-837)ctT>ctA	p.L279L	STC2_ENST00000520593.1_5'Flank	NM_003714.2	NP_003705.1	O76061	STC2_HUMAN	stanniocalcin 2	279					cellular calcium ion homeostasis (GO:0006874)|cellular response to hypoxia (GO:0071456)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|regulation of hormone biosynthetic process (GO:0046885)|regulation of store-operated calcium entry (GO:2001256)|response to oxidative stress (GO:0006979)|response to peptide hormone (GO:0043434)|response to vitamin D (GO:0033280)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|protein homodimerization activity (GO:0042803)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|prostate(1)|skin(3)	25	Renal(175;0.000159)|Lung NSC(126;0.00229)|all_lung(126;0.004)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.223)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			CCTGAGCCCCAAGGCCCCCGA	0.602																																					p.L279L		Atlas-SNP	.											.	STC2	59	.	0			c.T837A						.						76.0	81.0	79.0					5																	172744922		2203	4300	6503	SO:0001819	synonymous_variant	8614	exon4			AGCCCCAAGGCCC	AB012664	CCDS4388.1	5q35.2	2004-05-17			ENSG00000113739	ENSG00000113739			11374	protein-coding gene	gene with protein product		603665				9723890, 9753616	Standard	NM_003714		Approved	STC-2	uc003mco.1	O76061	OTTHUMG00000130542	ENST00000265087.4:c.837T>A	chr5.hg19:g.172744922A>T		82.0	0.0		92.0	24.0	NM_003714		Silent	SNP	ENST00000265087.4	hg19	CCDS4388.1																																																																																			.	.		0.602	STC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252965.1	NM_003714	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178541069	178541069	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:178541069A>T	ENST00000251582.7	-	22	3536	c.3435T>A	c.(3433-3435)aaT>aaA	p.N1145K		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1145					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGCTGGAGGCATTGAGAGGGA	0.567																																					p.N1145K		Atlas-SNP	.											.	ADAMTS2	190	.	0			c.T3435A						.						204.0	190.0	195.0					5																	178541069		2203	4300	6503	SO:0001583	missense	9509	exon22			GGAGGCATTGAGA	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3435T>A	chr5.hg19:g.178541069A>T	ENSP00000251582:p.Asn1145Lys	175.0	0.0		198.0	34.0	NM_014244		Missense_Mutation	SNP	ENST00000251582.7	hg19	CCDS4444.1	.	.	.	.	.	.	.	.	.	.	A	6.399	0.441796	0.12164	.	.	ENSG00000087116	ENST00000251582	T	0.58797	0.31	5.05	-1.47	0.08772	.	0.373259	0.22207	N	0.063151	T	0.36166	0.0957	L	0.27053	0.805	0.09310	N	1	B	0.26318	0.146	B	0.24974	0.057	T	0.28839	-1.0031	10	0.10902	T	0.67	.	11.0286	0.47759	0.5528:0.0:0.4472:0.0	.	1145	O95450	ATS2_HUMAN	K	1145	ENSP00000251582:N1145K	ENSP00000251582:N1145K	N	-	3	2	ADAMTS2	178473675	0.000000	0.05858	0.369000	0.25952	0.161000	0.22273	-0.197000	0.09518	-0.277000	0.09193	-0.441000	0.05720	AAT	.	.		0.567	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
RUFY1	80230	hgsc.bcm.edu	37	5	179016569	179016569	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:179016569T>C	ENST00000319449.4	+	9	1061	c.1049T>C	c.(1048-1050)aTt>aCt	p.I350T	RUFY1_ENST00000393438.2_Missense_Mutation_p.I242T|RUFY1_ENST00000377001.2_Silent_p.N398N|RUFY1_ENST00000437570.2_Missense_Mutation_p.I242T	NM_025158.4	NP_079434.3	Q96T51	RUFY1_HUMAN	RUN and FYVE domain containing 1	350					endocytosis (GO:0006897)|regulation of endocytosis (GO:0030100)	cytoplasm (GO:0005737)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	lipid binding (GO:0008289)|protein transporter activity (GO:0008565)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;0.00018)|all_epithelial(37;8.37e-05)|Renal(175;0.000159)|Lung NSC(126;0.00108)|all_lung(126;0.00195)	all_cancers(40;0.0322)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACAGACCGAATTTGCTCACTT	0.313										HNSCC(44;0.11)																											p.I350T		Atlas-SNP	.											.	RUFY1	101	.	0			c.T1049C						.						96.0	96.0	96.0					5																	179016569		2203	4300	6503	SO:0001583	missense	80230	exon9			ACCGAATTTGCTC	AF361055	CCDS4445.2, CCDS34312.1	5q35.3	2008-02-05			ENSG00000176783	ENSG00000176783		"""Zinc fingers, FYVE domain containing"""	19760	protein-coding gene	gene with protein product		610327				11877430	Standard	NM_001040451		Approved	FLJ22251, ZFYVE12, RABIP4	uc003mka.2	Q96T51	OTTHUMG00000130913	ENST00000319449.4:c.1049T>C	chr5.hg19:g.179016569T>C	ENSP00000325594:p.Ile350Thr	374.0	0.0		477.0	116.0	NM_025158	Q59FF3|Q71S93|Q9H6I3	Missense_Mutation	SNP	ENST00000319449.4	hg19	CCDS4445.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.5|20.5	4.005708|4.005708	0.74932|0.74932	.|.	.|.	ENSG00000176783|ENSG00000176783	ENST00000508609|ENST00000319449;ENST00000437570;ENST00000393438	.|T;T;T	.|0.80123	.|-1.34;-1.34;-1.34	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.093541	.|0.64402	.|D	.|0.000001	D|D	0.87148|0.87148	0.6105|0.6105	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D	.|0.62365	.|0.991	.|P	.|0.57468	.|0.821	D|D	0.87581|0.87581	0.2484|0.2484	5|10	.|0.44086	.|T	.|0.13	-15.9482|-15.9482	15.0943|15.0943	0.72220|0.72220	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|350	.|Q96T51	.|RUFY1_HUMAN	L|T	139|350;242;242	.|ENSP00000325594:I350T;ENSP00000390025:I242T;ENSP00000377087:I242T	.|ENSP00000325594:I350T	F|I	+|+	1|2	0|0	RUFY1|RUFY1	178949175|178949175	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	6.998000|6.998000	0.76277|0.76277	2.148000|2.148000	0.66965|0.66965	0.449000|0.449000	0.29647|0.29647	TTT|ATT	.	.		0.313	RUFY1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000253505.2	NM_001040451	
MGAT1	4245	hgsc.bcm.edu	37	5	180219134	180219134	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr5:180219134C>G	ENST00000446023.2	-	3	1588	c.838G>C	c.(838-840)Gag>Cag	p.E280Q	MGAT1_ENST00000307826.4_Missense_Mutation_p.E280Q|MGAT1_ENST00000427865.2_Missense_Mutation_p.E280Q|MGAT1_ENST00000393340.3_Missense_Mutation_p.E280Q|MGAT1_ENST00000333055.3_Missense_Mutation_p.E280Q	NM_001114617.1|NM_001114618.1	NP_001108089.1|NP_001108090.1	P26572	MGAT1_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,2-N-acetylglucosaminyltransferase	280					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine catabolic process (GO:0006049)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	acetylglucosaminyltransferase activity (GO:0008375)|alpha-1,3-mannosylglycoprotein 2-beta-N-acetylglucosaminyltransferase activity (GO:0003827)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	13	all_cancers(89;1.11e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.0027)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00356)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CACTTGGGCTCCAGCTCAGCC	0.662																																					p.E280Q		Atlas-SNP	.											.	MGAT1	48	.	0			c.G838C						.						27.0	28.0	28.0					5																	180219134		2203	4298	6501	SO:0001583	missense	4245	exon3			TGGGCTCCAGCTC	M61829	CCDS4458.1	5q35.3	2013-02-25			ENSG00000131446	ENSG00000131446	2.4.1.101	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7044	protein-coding gene	gene with protein product		160995		MGAT, GLYT1		1827260	Standard	NM_002406		Approved	GNT-1, GLCNAC-TI	uc003mmg.4	P26572	OTTHUMG00000130937	ENST00000446023.2:c.838G>C	chr5.hg19:g.180219134C>G	ENSP00000404718:p.Glu280Gln	77.0	0.0		86.0	21.0	NM_001114617	A8K404|B3KRU8|D3DWR1|Q6IBE3	Missense_Mutation	SNP	ENST00000446023.2	hg19	CCDS4458.1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.367841	0.82463	.	.	ENSG00000131446	ENST00000333055;ENST00000307826;ENST00000446023;ENST00000393340;ENST00000452920;ENST00000427865	D;D;D;D;D	0.84873	-1.91;-1.91;-1.91;-1.91;-1.91	5.41	5.41	0.78517	.	0.055037	0.64402	D	0.000001	D	0.91730	0.7385	M	0.77486	2.375	0.80722	D	1	D	0.71674	0.998	D	0.68765	0.96	D	0.90626	0.4563	10	0.37606	T	0.19	-31.8305	17.0589	0.86541	0.0:1.0:0.0:0.0	.	280	P26572	MGAT1_HUMAN	Q	280;280;280;280;137;280	ENSP00000332073:E280Q;ENSP00000311888:E280Q;ENSP00000404718:E280Q;ENSP00000377010:E280Q;ENSP00000402838:E280Q	ENSP00000311888:E280Q	E	-	1	0	MGAT1	180151740	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.111000	0.77077	2.696000	0.92011	0.655000	0.94253	GAG	.	.		0.662	MGAT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368189.1	NM_001114618	
ZBED9	114821	hgsc.bcm.edu	37	6	28540129	28540129	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:28540129A>T	ENST00000452236.2	-	4	4154	c.3537T>A	c.(3535-3537)agT>agA	p.S1179R		NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						taagatgttcactgataactt	0.289																																					p.S1179R		Atlas-SNP	.											.	SCAND3	156	.	0			c.T3537A						.						34.0	33.0	33.0					6																	28540129		2197	4290	6487	SO:0001583	missense	114821	exon4			ATGTTCACTGATA																												ENST00000452236.2:c.3537T>A	chr6.hg19:g.28540129A>T	ENSP00000395259:p.Ser1179Arg	191.0	0.0		293.0	205.0	NM_052923		Missense_Mutation	SNP	ENST00000452236.2	hg19	CCDS34355.1	.	.	.	.	.	.	.	.	.	.	A	1.434	-0.569409	0.03910	.	.	ENSG00000232040	ENST00000452236	T	0.20738	2.05	2.53	-1.59	0.08453	Ribonuclease H-like (1);	1.115970	0.07146	U	0.848318	T	0.03695	0.0105	L	0.34521	1.04	0.18873	N	0.999988	B	0.15719	0.014	B	0.14023	0.01	T	0.43621	-0.9380	10	0.16896	T	0.51	.	3.93	0.09281	0.4294:0.4327:0.1379:0.0	.	1179	Q6R2W3	SCND3_HUMAN	R	1179	ENSP00000395259:S1179R	ENSP00000395259:S1179R	S	-	3	2	SCAND3	28648108	0.335000	0.24748	0.329000	0.25429	0.941000	0.58515	-0.110000	0.10824	-0.343000	0.08351	0.533000	0.62120	AGT	.	.		0.289	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000043551.3		
HLA-G	3135	hgsc.bcm.edu	37	6	29797324	29797324	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:29797324A>T	ENST00000360323.6	+	4	773	c.749A>T	c.(748-750)cAg>cTg	p.Q250L	HLA-G_ENST00000428701.1_Missense_Mutation_p.Q250L|HLA-G_ENST00000376818.3_Missense_Mutation_p.Q158L|HLA-G_ENST00000376815.3_Intron|HLA-G_ENST00000376828.2_Missense_Mutation_p.Q255L			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	250	Alpha-3.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						GACCAGACCCAGGACGTGGAG	0.622																																					p.Q250L		Atlas-SNP	.											.	HLA-G	90	.	0			c.A749T						.						79.0	73.0	75.0					6																	29797324		2203	4300	6503	SO:0001583	missense	3135	exon5			AGACCCAGGACGT		CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.749A>T	chr6.hg19:g.29797324A>T	ENSP00000353472:p.Gln250Leu	120.0	0.0		156.0	104.0	NM_002127		Missense_Mutation	SNP	ENST00000360323.6	hg19	CCDS4668.1	.	.	.	.	.	.	.	.	.	.	.	10.54	1.379690	0.24944	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323;ENST00000376818	T;T;T;T	0.03035	4.07;4.07;4.07;4.07	1.72	1.72	0.24424	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.000000	0.38272	U	0.001742	T	0.09555	0.0235	M	0.89904	3.07	0.25782	N	0.984716	D;P;D	0.57899	0.978;0.891;0.981	D;B;D	0.75484	0.986;0.391;0.97	T	0.02743	-1.1116	10	0.87932	D	0	.	7.1442	0.25573	1.0:0.0:0.0:0.0	.	255;158;250	Q5RJ85;Q31611;P17693	.;.;HLAG_HUMAN	L	255;250;250;158	ENSP00000366024:Q255L;ENSP00000412927:Q250L;ENSP00000353472:Q250L;ENSP00000366014:Q158L	ENSP00000353472:Q250L	Q	+	2	0	HLA-G	29905303	0.993000	0.37304	0.497000	0.27552	0.016000	0.09150	4.430000	0.59907	0.791000	0.33826	0.248000	0.18094	CAG	.	.		0.622	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076286.2	NM_002127	
PSORS1C1	170679	hgsc.bcm.edu	37	6	31084505	31084505	+	Intron	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:31084505T>A	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_Missense_Mutation_p.Y296F|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						CACCACCTCGTAGCCACCATA	0.552																																					p.Y296F		Atlas-SNP	.											.	CDSN	48	.	0			c.A887T						.						34.0	33.0	34.0					6																	31084505		1920	3825	5745	SO:0001627	intron_variant	1041	exon2			ACCTCGTAGCCAC	AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+1837T>A	chr6.hg19:g.31084505T>A		37.0	0.0		67.0	50.0	NM_001264	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	Missense_Mutation	SNP	ENST00000259881.9	hg19	CCDS34390.1	.	.	.	.	.	.	.	.	.	.	T	19.69	3.875591	0.72180	.	.	ENSG00000204539	ENST00000376288	T	0.12984	2.63	4.76	4.76	0.60689	.	0.000000	0.46145	D	0.000305	T	0.14399	0.0348	L	0.36672	1.1	0.28094	N	0.931694	D	0.67145	0.996	D	0.77557	0.99	T	0.02966	-1.1088	10	0.66056	D	0.02	-14.1856	10.6432	0.45604	0.0:0.0:0.0:1.0	.	296	Q15517	CDSN_HUMAN	F	296	ENSP00000365465:Y296F	ENSP00000365465:Y296F	Y	-	2	0	CDSN	31192484	0.988000	0.35896	0.998000	0.56505	0.977000	0.68977	2.242000	0.43106	1.778000	0.52293	0.448000	0.29417	TAC	.	.		0.552	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076110.3	NM_014068	
XPO5	57510	hgsc.bcm.edu	37	6	43526298	43526298	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:43526298T>A	ENST00000265351.7	-	12	1462	c.1252A>T	c.(1252-1254)Agc>Tgc	p.S418C	XPO5_ENST00000424378.2_5'UTR	NM_020750.2	NP_065801.1	Q9HAV4	XPO5_HUMAN	exportin 5	418					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(4)|lung(10)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	34	all_cancers(18;2.08e-05)|Lung NSC(15;0.000907)|all_lung(25;0.00243)		all cancers(41;0.000321)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|OV - Ovarian serous cystadenocarcinoma(102;0.0524)			TATTCACAGCTAGGGCTGTCT	0.423																																					p.S418C		Atlas-SNP	.											.	XPO5	79	.	0			c.A1252T						.						70.0	65.0	66.0					6																	43526298		1848	4083	5931	SO:0001583	missense	57510	exon12			CACAGCTAGGGCT	AB033117	CCDS47430.1	6p21.1	2011-04-13			ENSG00000124571	ENSG00000124571		"""Exportins"""	17675	protein-coding gene	gene with protein product		607845				11777942, 12426392	Standard	NM_020750		Approved	KIAA1291	uc003ovp.3	Q9HAV4	OTTHUMG00000014742	ENST00000265351.7:c.1252A>T	chr6.hg19:g.43526298T>A	ENSP00000265351:p.Ser418Cys	111.0	0.0		160.0	118.0	NM_020750	Q5JTE6|Q96G48|Q96HN3|Q9BWM6|Q9BZV5|Q9H9M4|Q9NT89|Q9NW39|Q9ULC9	Missense_Mutation	SNP	ENST00000265351.7	hg19	CCDS47430.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582744	0.86748	.	.	ENSG00000124571	ENST00000265351;ENST00000436943;ENST00000439465	D	0.89485	-2.52	6.06	6.06	0.98353	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.91774	0.7398	L	0.60455	1.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.67231	0.95	D	0.92460	0.5977	10	0.62326	D	0.03	-18.4017	16.6093	0.84858	0.0:0.0:0.0:1.0	.	418	Q9HAV4	XPO5_HUMAN	C	418;123;46	ENSP00000265351:S418C	ENSP00000265351:S418C	S	-	1	0	XPO5	43634276	1.000000	0.71417	0.960000	0.40013	0.955000	0.61496	4.748000	0.62148	2.324000	0.78689	0.533000	0.62120	AGC	.	.		0.423	XPO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040657.2	NM_020750	
TMEM63B	55362	hgsc.bcm.edu	37	6	44116248	44116248	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:44116248A>T	ENST00000259746.9	+	14	1304		c.e14-1		TMEM63B_ENST00000323267.6_Splice_Site			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B						ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CCATCTTTCTAGCATCCTGAA	0.622																																					.		Atlas-SNP	.											.	TMEM63B	77	.	0			c.1122-2A>T						.						105.0	95.0	99.0					6																	44116248		2203	4300	6503	SO:0001630	splice_region_variant	55362	exon14			CTTTCTAGCATCC	BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1122-1A>T	chr6.hg19:g.44116248A>T		63.0	0.0		78.0	14.0	NM_018426	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Splice_Site	SNP	ENST00000259746.9	hg19	CCDS34461.1	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931602	0.52866	.	.	ENSG00000137216	ENST00000259746;ENST00000323267;ENST00000371893	.	.	.	4.38	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9603	0.58453	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TMEM63B	44224226	1.000000	0.71417	0.991000	0.47740	0.645000	0.38454	7.106000	0.77039	1.851000	0.53745	0.460000	0.39030	.	.	.		0.622	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040712.2	XM_166410	Intron
TNFRSF21	27242	hgsc.bcm.edu	37	6	47202430	47202430	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:47202430T>A	ENST00000296861.2	-	5	2107	c.1714A>T	c.(1714-1716)Agg>Tgg	p.R572W		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	572					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			GAACCGTTCCTGCTCAGCGCG	0.597																																					p.R572W		Atlas-SNP	.											.	TNFRSF21	61	.	0			c.A1714T						.						45.0	43.0	44.0					6																	47202430		2203	4300	6503	SO:0001583	missense	27242	exon5			CGTTCCTGCTCAG	AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.1714A>T	chr6.hg19:g.47202430T>A	ENSP00000296861:p.Arg572Trp	51.0	0.0		104.0	13.0	NM_014452	B2RDI9|Q0D2P5|Q96D86	Missense_Mutation	SNP	ENST00000296861.2	hg19	CCDS4921.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.144082	0.77888	.	.	ENSG00000146072	ENST00000296861;ENST00000419206	T	0.76186	-1.0	5.26	2.61	0.31194	.	0.080591	0.85682	D	0.000000	T	0.69717	0.3142	L	0.29908	0.895	0.52501	D	0.999957	D	0.71674	0.998	D	0.69307	0.963	T	0.74765	-0.3554	10	0.87932	D	0	.	12.562	0.56286	0.0:0.0:0.3803:0.6197	.	572	O75509	TNR21_HUMAN	W	572;261	ENSP00000296861:R572W	ENSP00000296861:R572W	R	-	1	2	TNFRSF21	47310389	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	2.173000	0.42472	0.917000	0.36895	0.529000	0.55759	AGG	.	.		0.597	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040814.1	NM_014452	
GPR111	222611	hgsc.bcm.edu	37	6	47650129	47650129	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:47650129T>A	ENST00000296862.1	+	6	1834	c.1834T>A	c.(1834-1836)Ttg>Atg	p.L612M	GPR111_ENST00000398742.2_Missense_Mutation_p.L544M|GPR111_ENST00000507065.1_Missense_Mutation_p.L544M			Q8IZF7	GP111_HUMAN	G protein-coupled receptor 111	612					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(15)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	29						GATCCCAGCTTTGGCCATCGT	0.532																																					p.L544M		Atlas-SNP	.											.	GPR111	123	.	0			c.T1630A						.						57.0	58.0	57.0					6																	47650129		2051	4204	6255	SO:0001583	missense	222611	exon7			CCAGCTTTGGCCA	AB065684		6p12.3	2014-08-08			ENSG00000164393	ENSG00000164393		"""-"", ""GPCR / Class B : Orphans"""	18991	protein-coding gene	gene with protein product						12435584	Standard	NM_153839		Approved	hGPCR35, PGR20	uc003oyy.3	Q8IZF7	OTTHUMG00000046168	ENST00000296862.1:c.1834T>A	chr6.hg19:g.47650129T>A	ENSP00000296862:p.Leu612Met	97.0	0.0		138.0	26.0	NM_153839	Q2PNZ1|Q86SL6|Q8NGU5|Q8TDT5	Missense_Mutation	SNP	ENST00000296862.1	hg19		.	.	.	.	.	.	.	.	.	.	T	17.60	3.429870	0.62844	.	.	ENSG00000164393	ENST00000507065;ENST00000296862;ENST00000398742	T;T;T	0.42513	0.97;0.97;0.97	5.64	3.82	0.43975	GPCR, family 2-like (1);	0.000000	0.49305	D	0.000150	T	0.54791	0.1880	M	0.85542	2.76	0.34655	D	0.722014	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.64339	-0.6431	10	0.72032	D	0.01	.	9.9031	0.41359	0.0:0.7834:0.1396:0.077	.	544;612	Q8IZF7-2;Q8IZF7	.;GP111_HUMAN	M	544;612;544	ENSP00000422934:L544M;ENSP00000296862:L612M;ENSP00000381727:L544M	ENSP00000296862:L612M	L	+	1	2	GPR111	47758088	0.590000	0.26815	0.993000	0.49108	0.852000	0.48524	1.292000	0.33342	0.699000	0.31761	-0.242000	0.12053	TTG	.	.		0.532	GPR111-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000106423.2	NM_153839	
CD109	135228	hgsc.bcm.edu	37	6	74502490	74502490	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:74502490A>C	ENST00000287097.5	+	23	2955	c.2843A>C	c.(2842-2844)aAt>aCt	p.N948T	CD109_ENST00000474094.1_3'UTR|CD109_ENST00000437994.2_Missense_Mutation_p.N948T|CD109_ENST00000422508.2_Missense_Mutation_p.N871T			Q6YHK3	CD109_HUMAN	CD109 molecule	948					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTGACAGATAATTTGAAAGAA	0.318																																					p.N948T		Atlas-SNP	.											.	CD109	170	.	0			c.A2843C						.						50.0	52.0	52.0					6																	74502490		2203	4298	6501	SO:0001583	missense	135228	exon23			CAGATAATTTGAA	AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.2843A>C	chr6.hg19:g.74502490A>C	ENSP00000287097:p.Asn948Thr	57.0	0.0		54.0	17.0	NM_133493	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	ENST00000287097.5	hg19	CCDS4982.1	.	.	.	.	.	.	.	.	.	.	A	12.61	1.988810	0.35131	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.37915	1.17;1.17;1.17	5.87	-2.46	0.06461	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);	0.507932	0.23521	N	0.047297	T	0.08447	0.0210	L	0.28649	0.875	0.09310	N	1	B;B;B	0.19331	0.035;0.027;0.014	B;B;B	0.26693	0.029;0.072;0.011	T	0.32666	-0.9898	10	0.35671	T	0.21	.	6.3715	0.21483	0.5443:0.2134:0.2424:0.0	.	871;948;948	Q6YHK3-2;Q6YHK3-4;Q6YHK3	.;.;CD109_HUMAN	T	948;871;948	ENSP00000388062:N948T;ENSP00000404475:N871T;ENSP00000287097:N948T	ENSP00000287097:N948T	N	+	2	0	CD109	74559211	0.032000	0.19561	0.001000	0.08648	0.928000	0.56348	1.471000	0.35365	-0.287000	0.09064	-0.316000	0.08728	AAT	.	.		0.318	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041230.3	NM_133493	
IBTK	25998	hgsc.bcm.edu	37	6	82921267	82921267	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:82921267T>A	ENST00000306270.7	-	14	2863	c.2314A>T	c.(2314-2316)Atg>Ttg	p.M772L	IBTK_ENST00000510291.1_Missense_Mutation_p.M772L|RNU6-130P_ENST00000411112.1_RNA|IBTK_ENST00000503631.1_Missense_Mutation_p.M571L	NM_015525.2	NP_056340.2	Q9P2D0	IBTK_HUMAN	inhibitor of Bruton agammaglobulinemia tyrosine kinase	772	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein tyrosine kinase activity (GO:0061099)|release of sequestered calcium ion into cytosol (GO:0051209)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine kinase inhibitor activity (GO:0030292)			central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(10)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	54		all_cancers(76;3.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.0037)		BRCA - Breast invasive adenocarcinoma(397;0.0901)		ACTGATTTCATGGTCACGTCA	0.343																																					p.M772L		Atlas-SNP	.											.	IBTK	128	.	0			c.A2314T						.						77.0	73.0	74.0					6																	82921267		2203	4300	6503	SO:0001583	missense	25998	exon14			ATTTCATGGTCAC	AF235049	CCDS34490.1, CCDS75486.1	6q14.3	2013-01-10	2003-10-06	2003-10-08	ENSG00000005700	ENSG00000005700		"""BTB/POZ domain containing"", ""Ankyrin repeat domain containing"""	17853	protein-coding gene	gene with protein product		606457	"""Bruton agammaglobulinemia tyrosine kinase inhibitor"""	BTKI		11577348	Standard	XM_006715453		Approved	DKFZP564B116, BTBD26	uc003pjl.1	Q9P2D0	OTTHUMG00000015102	ENST00000306270.7:c.2314A>T	chr6.hg19:g.82921267T>A	ENSP00000305721:p.Met772Leu	479.0	0.0		292.0	104.0	NM_015525	Q2QKU2|Q2QKU3|Q2QKU4|Q5TFD7|Q5TFD9|Q8IUQ9|Q8IUY7|Q8TAI4|Q9HBI8|Q9Y3T8	Missense_Mutation	SNP	ENST00000306270.7	hg19	CCDS34490.1	.	.	.	.	.	.	.	.	.	.	T	12.41	1.930562	0.34096	.	.	ENSG00000005700	ENST00000306270;ENST00000503631;ENST00000510291	T;T;T	0.59906	0.23;0.23;0.23	5.74	5.74	0.90152	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.091238	0.85682	D	0.000000	T	0.09774	0.0240	N	0.00329	-1.635	0.37649	D	0.922343	B;B;B;B	0.21071	0.051;0.005;0.004;0.005	B;B;B;B	0.20184	0.028;0.01;0.006;0.01	T	0.12041	-1.0563	10	0.30078	T	0.28	-18.8857	8.9326	0.35680	0.1238:0.0:0.1294:0.7468	.	571;772;772;772	E9PDR5;E7EPI0;Q9P2D0-2;Q9P2D0	.;.;.;IBTK_HUMAN	L	772;571;772	ENSP00000305721:M772L;ENSP00000422762:M571L;ENSP00000426405:M772L	ENSP00000305721:M772L	M	-	1	0	IBTK	82977986	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.395000	0.52558	2.190000	0.69967	0.477000	0.44152	ATG	.	.		0.343	IBTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041337.2	NM_015525	
ORC3	23595	hgsc.bcm.edu	37	6	88375515	88375515	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:88375515A>C	ENST00000392844.3	+	19	2042	c.1994A>C	c.(1993-1995)aAt>aCt	p.N665T	ORC3_ENST00000546266.1_Missense_Mutation_p.N522T|ORC3_ENST00000257789.4_Missense_Mutation_p.N666T	NM_012381.3|NM_181837.2	NP_036513.2|NP_862820.1	Q9UBD5	ORC3_HUMAN	origin recognition complex, subunit 3	665					DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|neural precursor cell proliferation (GO:0061351)	nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|origin recognition complex (GO:0000808)	DNA replication origin binding (GO:0003688)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	28						ATGGATGCAAATTCTGCAACC	0.313																																					p.N666T		Atlas-SNP	.											.	ORC3	51	.	0			c.A1997C						.						54.0	56.0	55.0					6																	88375515		2203	4299	6502	SO:0001583	missense	23595	exon19			ATGCAAATTCTGC	AF093535	CCDS5012.1, CCDS43486.1, CCDS56440.1	6q	2010-10-12	2010-10-12	2010-10-12	ENSG00000135336	ENSG00000135336			8489	protein-coding gene	gene with protein product		604972	"""origin recognition complex, subunit 3 (yeast homolog)-like"", ""origin recognition complex, subunit 3-like (yeast)"", ""origin recognition complex, subunit 3 honolog (yeast)"""	ORC3L		9829972, 10402192	Standard	NM_181837		Approved	IMAGE50150, LATHEO	uc003pmg.3	Q9UBD5	OTTHUMG00000015179	ENST00000392844.3:c.1994A>C	chr6.hg19:g.88375515A>C	ENSP00000376586:p.Asn665Thr	105.0	0.0		51.0	21.0	NM_181837	A2A2T5|B4E025|Q13565|Q53GY6|Q5T159|Q6IUY7|Q86TN5|Q9UG44|Q9UNT6	Missense_Mutation	SNP	ENST00000392844.3	hg19	CCDS43486.1	.	.	.	.	.	.	.	.	.	.	A	13.15	2.150056	0.37923	.	.	ENSG00000135336	ENST00000392844;ENST00000257789;ENST00000546266	T;T;T	0.12569	3.01;3.02;2.67	5.85	2.85	0.33270	.	0.428631	0.27522	N	0.018983	T	0.04363	0.0120	L	0.43152	1.355	0.09310	N	0.999998	B;B;B	0.29037	0.002;0.121;0.231	B;B;B	0.32980	0.003;0.034;0.156	T	0.40869	-0.9540	10	0.16896	T	0.51	-1.2314	12.0699	0.53609	0.9156:0.0:0.0844:0.0	.	603;665;666	B4E014;Q9UBD5;Q9UBD5-2	.;ORC3_HUMAN;.	T	665;666;522	ENSP00000376586:N665T;ENSP00000257789:N666T;ENSP00000444695:N522T	ENSP00000257789:N666T	N	+	2	0	ORC3	88432234	1.000000	0.71417	0.142000	0.22268	0.996000	0.88848	2.230000	0.42999	0.419000	0.25927	0.533000	0.62120	AAT	.	.		0.313	ORC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000041452.2		
TRDN	10345	hgsc.bcm.edu	37	6	123851680	123851680	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:123851680T>A	ENST00000398178.3	-	5	476	c.455A>T	c.(454-456)gAg>gTg	p.E152V	TRDN_ENST00000334268.4_Missense_Mutation_p.E152V|TRDN_ENST00000542443.1_Missense_Mutation_p.E152V|TRDN_ENST00000546248.1_Missense_Mutation_p.E152V	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	152					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		TTCAGGTTTCTCTTGTTTTTC	0.234																																					p.E152V		Atlas-SNP	.											.	TRDN	88	.	0			c.A455T						.						47.0	41.0	43.0					6																	123851680		1070	2430	3500	SO:0001583	missense	10345	exon5			GGTTTCTCTTGTT	U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.455A>T	chr6.hg19:g.123851680T>A	ENSP00000381240:p.Glu152Val	214.0	0.0		120.0	45.0	NM_001256022	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	ENST00000398178.3	hg19	CCDS55053.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	13.84|13.84	2.358081|2.358081	0.41801|0.41801	.|.	.|.	ENSG00000186439|ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268;ENST00000542014;ENST00000543022;ENST00000546248;ENST00000333613;ENST00000542443;ENST00000265491|ENST00000359698;ENST00000422596	T;T;T;T|.	0.70045|.	1.26;1.26;0.91;-0.45|.	5.33|5.33	5.33|5.33	0.75918|0.75918	Aspartyl beta-hydroxylase/Triadin domain (1);|.	0.062472|.	0.64402|.	D|.	0.000010|.	T|.	0.48003|.	0.1476|.	M|M	0.76574|0.76574	2.34|2.34	0.29689|0.29689	N|N	0.841055|0.841055	D;P;D;D;D|.	0.89917|.	0.996;0.885;1.0;1.0;1.0|.	D;P;D;D;D|.	0.77557|.	0.99;0.487;0.979;0.979;0.99|.	T|.	0.49934|.	-0.8886|.	10|.	0.87932|.	D|.	0|.	-17.1943|-17.1943	12.9569|12.9569	0.58432|0.58432	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	152;152;152;152;152|.	F5H6E3;F5H2W7;Q5SWK9;Q8IVK2;Q13061|.	.;.;.;.;TRDN_HUMAN|.	V|X	152;152;152;152;152;152;57;152;57|11	ENSP00000381240:E152V;ENSP00000333984:E152V;ENSP00000439281:E152V;ENSP00000437684:E152V|.	ENSP00000265491:E57V|.	E|R	-|-	2|1	0|2	TRDN|TRDN	123893379|123893379	0.758000|0.758000	0.28405|0.28405	0.819000|0.819000	0.32651|0.32651	0.808000|0.808000	0.45660|0.45660	2.246000|2.246000	0.43142|0.43142	2.155000|2.155000	0.67459|0.67459	0.460000|0.460000	0.39030|0.39030	GAG|AGA	.	.		0.234	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
SOGA3	387104	hgsc.bcm.edu	37	6	127837602	127837602	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:127837602G>T	ENST00000525778.1	-	2	903	c.158C>A	c.(157-159)aCa>aAa	p.T53K	SOGA3_ENST00000556132.1_Missense_Mutation_p.T53K|SOGA3_ENST00000465909.2_Missense_Mutation_p.T53K|SOGA3_ENST00000481848.2_Missense_Mutation_p.T53K|SOGA3_ENST00000368268.2_Missense_Mutation_p.T53K			Q5TF21	SOGA3_HUMAN	SOGA family member 3	53					regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											GGCCGCGATTGTCTGTCGCAG	0.642																																					p.T53K		Atlas-SNP	.											.	.	.	.	0			c.C158A						.						28.0	32.0	31.0					6																	127837602		1981	4163	6144	SO:0001583	missense	387104	exon2			GCGATTGTCTGTC	AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.158C>A	chr6.hg19:g.127837602G>T	ENSP00000434570:p.Thr53Lys	25.0	0.0		16.0	7.0	NM_001012279		Missense_Mutation	SNP	ENST00000525778.1	hg19	CCDS43505.1	.	.	.	.	.	.	.	.	.	.	G	13.55	2.271568	0.40194	.	.	ENSG00000214338	ENST00000556132;ENST00000368268;ENST00000525778;ENST00000465909	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.79	5.79	0.91817	.	0.573888	0.16839	N	0.197421	T	0.09730	0.0239	N	0.08118	0	0.35030	D	0.758737	B	0.17667	0.023	B	0.28139	0.086	T	0.16041	-1.0416	10	0.13853	T	0.58	-1.9333	18.7926	0.91980	0.0:0.0:1.0:0.0	.	53	Q5TF21	CF174_HUMAN	K	53	ENSP00000451768:T53K;ENSP00000357251:T53K;ENSP00000434570:T53K;ENSP00000435559:T53K	ENSP00000435559:T53K	T	-	2	0	C6orf174	127879295	0.444000	0.25649	0.858000	0.33744	0.061000	0.15899	2.114000	0.41911	2.735000	0.93741	0.561000	0.74099	ACA	.	.		0.642	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388246.1	NM_001012279	
AHI1	54806	hgsc.bcm.edu	37	6	135644338	135644338	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:135644338T>A	ENST00000367800.4	-	23	3506	c.3290A>T	c.(3289-3291)cAg>cTg	p.Q1097L	AHI1_ENST00000457866.2_Missense_Mutation_p.Q1097L|AHI1_ENST00000417892.2_Missense_Mutation_p.Q451L	NM_001134830.1	NP_001128302.1	Q8N157	AHI1_HUMAN	Abelson helper integration site 1	1097	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cellular protein localization (GO:0034613)|central nervous system development (GO:0007417)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|cloaca development (GO:0035844)|heart looping (GO:0001947)|hindbrain development (GO:0030902)|Kupffer's vesicle development (GO:0070121)|left/right axis specification (GO:0070986)|morphogenesis of a polarized epithelium (GO:0001738)|negative regulation of apoptotic process (GO:0043066)|otic vesicle development (GO:0071599)|photoreceptor cell outer segment organization (GO:0035845)|positive regulation of polarized epithelial cell differentiation (GO:0030862)|positive regulation of receptor internalization (GO:0002092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|pronephric duct morphogenesis (GO:0039023)|pronephric nephron tubule morphogenesis (GO:0039008)|protein localization to organelle (GO:0033365)|regulation of behavior (GO:0050795)|retina layer formation (GO:0010842)|specification of axis polarity (GO:0065001)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vesicle targeting (GO:0006903)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|nonmotile primary cilium (GO:0031513)|photoreceptor outer segment (GO:0001750)|primary cilium (GO:0072372)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(18)|ovary(1)	37	Breast(56;0.239)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00904)|OV - Ovarian serous cystadenocarcinoma(155;0.00991)		ATAACCTTCCTGTCCCTTTCC	0.403																																					p.Q1097L		Atlas-SNP	.											.	AHI1	81	.	0			c.A3290T						.						110.0	104.0	105.0					6																	135644338		1896	4098	5994	SO:0001583	missense	54806	exon24			CCTTCCTGTCCCT	AJ459824	CCDS47483.1, CCDS47484.1	6q23.2	2013-01-10	2005-11-29		ENSG00000135541	ENSG00000135541		"""WD repeat domain containing"""	21575	protein-coding gene	gene with protein product	"""Jouberin"""	608894	"""Abelson helper integration site"""			15060101, 16240161	Standard	NM_017651		Approved	FLJ20069, ORF1, JBTS3	uc003qgj.3	Q8N157	OTTHUMG00000015631	ENST00000367800.4:c.3290A>T	chr6.hg19:g.135644338T>A	ENSP00000356774:p.Gln1097Leu	108.0	0.0		69.0	25.0	NM_017651	E1P584|Q4FD35|Q504T3|Q5TCP9|Q6P098|Q6PIT6|Q8NDX0|Q9H0H2	Missense_Mutation	SNP	ENST00000367800.4	hg19	CCDS47483.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.17|18.17	3.564872|3.564872	0.65651|0.65651	.|.	.|.	ENSG00000135541|ENSG00000135541	ENST00000367800;ENST00000457866;ENST00000417892;ENST00000265602|ENST00000367799	T;T;T;T|.	0.53857|.	0.6;0.6;0.6;0.6|.	6.06|6.06	6.06|6.06	0.98353|0.98353	Src homology-3 domain (5);|.	0.119062|.	0.56097|.	D|.	0.000022|.	T|T	0.63745|0.63745	0.2537|0.2537	L|L	0.58101|0.58101	1.795|1.795	0.80722|0.80722	D|D	1|1	P;P|.	0.47034|.	0.889;0.659|.	P;B|.	0.49799|.	0.622;0.424|.	T|T	0.62840|0.62840	-0.6769|-0.6769	10|5	0.62326|.	D|.	0.03|.	-13.0256|-13.0256	16.6093|16.6093	0.84858|0.84858	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	1097;1097|.	Q8N157;Q4FD35|.	AHI1_HUMAN;.|.	L|W	1097;1097;451;1097|597	ENSP00000356774:Q1097L;ENSP00000388650:Q1097L;ENSP00000416867:Q451L;ENSP00000265602:Q1097L|.	ENSP00000265602:Q1097L|.	Q|R	-|-	2|1	0|2	AHI1|AHI1	135686031|135686031	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	3.835000|3.835000	0.55805|0.55805	2.324000|2.324000	0.78689|0.78689	0.533000|0.533000	0.62120|0.62120	CAG|AGG	.	.		0.403	AHI1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391948.1	NM_017651	
SYNE1	23345	hgsc.bcm.edu	37	6	152651184	152651184	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:152651184C>A	ENST00000367255.5	-	78	15237	c.14636G>T	c.(14635-14637)tGt>tTt	p.C4879F	SYNE1_ENST00000341594.5_Missense_Mutation_p.C4626F|SYNE1_ENST00000265368.4_Missense_Mutation_p.C4879F|SYNE1_ENST00000423061.1_Missense_Mutation_p.C4808F|SYNE1_ENST00000448038.1_Missense_Mutation_p.C4808F	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4879					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TCGGCTCTCACATTCTGTCAC	0.537										HNSCC(10;0.0054)																											p.C4879F		Atlas-SNP	.											.	SYNE1	3227	.	0			c.G14636T						.						89.0	85.0	86.0					6																	152651184		2203	4300	6503	SO:0001583	missense	23345	exon78			CTCTCACATTCTG	AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14636G>T	chr6.hg19:g.152651184C>A	ENSP00000356224:p.Cys4879Phe	69.0	0.0		65.0	18.0	NM_182961	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	ENST00000367255.5	hg19	CCDS5236.2	.	.	.	.	.	.	.	.	.	.	C	15.44	2.833807	0.50951	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594	T;T;T;T;T	0.49720	0.77;0.77;0.77;0.77;0.77	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000002	T	0.60715	0.2290	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.76494	0.999;0.998;0.998;0.999	D;D;D;D	0.76071	0.987;0.923;0.923;0.965	T	0.59584	-0.7427	10	0.56958	D	0.05	.	20.0109	0.97448	0.0:1.0:0.0:0.0	.	4879;4879;4879;4808	Q8NF91-7;Q8NF91;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.	F	4879;4808;4879;4808;4626	ENSP00000356224:C4879F;ENSP00000396024:C4808F;ENSP00000265368:C4879F;ENSP00000390975:C4808F;ENSP00000341887:C4626F	ENSP00000265368:C4879F	C	-	2	0	SYNE1	152692877	1.000000	0.71417	0.995000	0.50966	0.942000	0.58702	7.818000	0.86416	2.738000	0.93877	0.591000	0.81541	TGT	.	.		0.537	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000334755.2	NM_182961	
TIAM2	26230	hgsc.bcm.edu	37	6	155458554	155458554	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr6:155458554A>T	ENST00000461783.3	+	7	2711	c.1438A>T	c.(1438-1440)Aca>Tca	p.T480S	TIAM2_ENST00000318981.5_Missense_Mutation_p.T480S|TIAM2_ENST00000367174.2_5'UTR|TIAM2_ENST00000529824.2_Missense_Mutation_p.T480S|TIAM2_ENST00000360366.4_Missense_Mutation_p.T480S|TIAM2_ENST00000456144.1_Missense_Mutation_p.T480S			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2	480					apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		AGAAACATCTACAGAAACCGC	0.532																																					p.T480S		Atlas-SNP	.											.	TIAM2	161	.	0			c.A1438T						.						85.0	94.0	91.0					6																	155458554		2203	4300	6503	SO:0001583	missense	26230	exon4			ACATCTACAGAAA		CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.1438A>T	chr6.hg19:g.155458554A>T	ENSP00000437188:p.Thr480Ser	116.0	0.0		106.0	37.0	NM_012454	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	Missense_Mutation	SNP	ENST00000461783.3	hg19	CCDS34558.1	.	.	.	.	.	.	.	.	.	.	A	4.757	0.140758	0.09083	.	.	ENSG00000146426	ENST00000461783;ENST00000528928;ENST00000528535;ENST00000456144;ENST00000318981;ENST00000360366;ENST00000529824	T;T;T;T;T;T	0.05319	3.58;3.46;3.53;3.58;3.59;3.53	6.08	4.88	0.63580	.	0.111618	0.64402	N	0.000010	T	0.02047	0.0064	L	0.43701	1.375	0.80722	D	1	B;B	0.21147	0.052;0.031	B;B	0.21151	0.033;0.015	T	0.40979	-0.9534	10	0.25751	T	0.34	.	5.8384	0.18619	0.653:0.0:0.0701:0.2769	.	480;480	Q8IVF5-2;Q8IVF5	.;TIAM2_HUMAN	S	480;726;480;480;480;480;480	ENSP00000437188:T480S;ENSP00000434901:T480S;ENSP00000407746:T480S;ENSP00000327315:T480S;ENSP00000353528:T480S;ENSP00000433348:T480S	ENSP00000327315:T480S	T	+	1	0	TIAM2	155500246	0.973000	0.33851	0.011000	0.14972	0.009000	0.06853	3.158000	0.50723	1.066000	0.40716	0.533000	0.62120	ACA	.	.		0.532	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	protein_coding	OTTHUMT00000387980.2	NM_012454	
LFNG	3955	hgsc.bcm.edu	37	7	2552910	2552910	+	Missense_Mutation	SNP	A	A	G	rs199517402		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:2552910A>G	ENST00000402506.1	+	2	293	c.167A>G	c.(166-168)gAg>gGg	p.E56G		NM_001166355.1	NP_001159827.1	Q8NES3	LFNG_HUMAN	LFNG O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase	0					compartment pattern specification (GO:0007386)|female meiotic division (GO:0007143)|metabolic process (GO:0008152)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|ovarian follicle development (GO:0001541)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of protein binding (GO:0032092)|regulation of Notch signaling pathway (GO:0008593)|regulation of somitogenesis (GO:0014807)|somitogenesis (GO:0001756)	extracellular region (GO:0005576)|integral component of Golgi membrane (GO:0030173)|vesicle (GO:0031982)	metal ion binding (GO:0046872)|O-fucosylpeptide 3-beta-N-acetylglucosaminyltransferase activity (GO:0033829)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|ovary(1)|urinary_tract(2)	6		Ovarian(82;0.0112)		OV - Ovarian serous cystadenocarcinoma(56;2.54e-14)		tggatggatgagtggaGCCCA	0.547																																					p.E56G		Atlas-SNP	.											.	LFNG	57	.	0			c.A167G						.						101.0	98.0	99.0					7																	2552910		1568	3582	5150	SO:0001583	missense	3955	exon2			TGGATGAGTGGAG	BC014851	CCDS34586.1, CCDS34587.1, CCDS55081.1, CCDS55082.1	7p22.3	2013-02-19	2006-11-13		ENSG00000106003	ENSG00000106003	2.4.1.222	"""Beta 3-glycosyltransferases"""	6560	protein-coding gene	gene with protein product		602576	"""lunatic fringe (Drosophila) homolog"", ""lunatic fringe homolog (Drosophila)"""			9878264, 9187150	Standard	NM_001166355		Approved	SCDO3	uc003smf.3	Q8NES3	OTTHUMG00000152043	ENST00000402506.1:c.167A>G	chr7.hg19:g.2552910A>G	ENSP00000385764:p.Glu56Gly	68.0	0.0		57.0	4.0	NM_001166355	B3KTY6|B5MCR5|O00589|Q96C39|Q9UJW5	Missense_Mutation	SNP	ENST00000402506.1	hg19	CCDS55081.1	.	.	.	.	.	.	.	.	.	.	a	2.466	-0.323062	0.05350	.	.	ENSG00000106003	ENST00000402506	T	0.44083	0.93	1.61	-1.65	0.08291	.	.	.	.	.	T	0.21590	0.0520	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.24368	-1.0162	7	0.87932	D	0	.	5.1731	0.15120	0.5881:0.0:0.4119:0.0	.	.	.	.	G	56	ENSP00000385764:E56G	ENSP00000385764:E56G	E	+	2	0	LFNG	2519436	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	-0.608000	0.05641	-0.582000	0.05929	-1.528000	0.00924	GAG	.	.		0.547	LFNG-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000325023.1	NM_002304	
MMD2	221938	hgsc.bcm.edu	37	7	4959927	4959927	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:4959927G>T	ENST00000404774.3	-	3	359	c.165C>A	c.(163-165)aaC>aaA	p.N55K	MMD2_ENST00000406755.1_Missense_Mutation_p.N55K|MMD2_ENST00000401401.3_Missense_Mutation_p.N55K	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	55						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		GGAAGTAGAGGTTGGAGCTGC	0.627																																					p.N55K		Atlas-SNP	.											.	MMD2	63	.	0			c.C165A						.						47.0	54.0	52.0					7																	4959927		2118	4231	6349	SO:0001583	missense	221938	exon3			GTAGAGGTTGGAG	BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.165C>A	chr7.hg19:g.4959927G>T	ENSP00000384690:p.Asn55Lys	102.0	0.0		78.0	24.0	NM_198403	B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	ENST00000404774.3	hg19	CCDS47529.1	.	.	.	.	.	.	.	.	.	.	G	10.98	1.505364	0.26949	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.28895	1.59;1.59;1.59	4.44	3.56	0.40772	.	0.443567	0.24438	N	0.038538	T	0.19366	0.0465	N	0.14661	0.345	0.31007	N	0.719678	B;B;B	0.30634	0.288;0.013;0.003	B;B;B	0.38156	0.266;0.038;0.007	T	0.18209	-1.0344	10	0.26408	T	0.33	-27.1991	7.5037	0.27532	0.0897:0.1672:0.7431:0.0	.	55;55;55	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	K	55	ENSP00000384690:N55K;ENSP00000385963:N55K;ENSP00000384141:N55K	ENSP00000384141:N55K	N	-	3	2	MMD2	4926453	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	2.415000	0.44635	1.083000	0.41159	0.561000	0.74099	AAC	.	.		0.627	MMD2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324136.1	NM_198403	
ZNF12	7559	hgsc.bcm.edu	37	7	6737036	6737036	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:6737036T>A	ENST00000405858.1	-	4	713	c.172A>T	c.(172-174)Agc>Tgc	p.S58C	ZNF12_ENST00000342651.5_Missense_Mutation_p.S58C|ZNF12_ENST00000404360.1_Missense_Mutation_p.S22C|AC073343.13_ENST00000366167.2_RNA	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	58	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		TCCAACTTGCTGATAACATCC	0.468																																					p.S58C		Atlas-SNP	.											.	ZNF12	53	.	0			c.A172T						.						85.0	85.0	85.0					7																	6737036		2064	4232	6296	SO:0001583	missense	7559	exon4			ACTTGCTGATAAC	X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.172A>T	chr7.hg19:g.6737036T>A	ENSP00000385939:p.Ser58Cys	105.0	0.0		77.0	23.0	NM_016265	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	ENST00000405858.1	hg19	CCDS47538.1	.	.	.	.	.	.	.	.	.	.	.	13.66	2.302258	0.40694	.	.	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476;ENST00000330442	T;T;T	0.42900	5.54;0.96;0.96	4.13	0.247	0.15521	Krueppel-associated box (3);	0.583037	0.14374	N	0.323611	T	0.39545	0.1082	M	0.86502	2.82	0.19775	N	0.999951	B;B	0.31859	0.343;0.047	B;B	0.29716	0.106;0.009	T	0.37454	-0.9705	10	0.37606	T	0.19	.	1.7189	0.02908	0.1653:0.0958:0.3411:0.3978	.	58;58	P17014;P17014-5	ZNF12_HUMAN;.	C	22;58;58;116;22	ENSP00000384405:S22C;ENSP00000385939:S58C;ENSP00000344745:S58C	ENSP00000331039:S22C	S	-	1	0	ZNF12	6703561	0.921000	0.31238	0.835000	0.33067	0.958000	0.62258	0.653000	0.24902	0.043000	0.15746	0.482000	0.46254	AGC	.	.		0.468	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000324373.2	NM_016265	
PHF14	9678	hgsc.bcm.edu	37	7	11080358	11080358	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:11080358A>T	ENST00000403050.3	+	12	2588	c.2136A>T	c.(2134-2136)gaA>gaT	p.E712D	PHF14_ENST00000445996.2_Missense_Mutation_p.E427D	NM_014660.3	NP_055475.2	O94880	PHF14_HUMAN	PHD finger protein 14	712					lung alveolus development (GO:0048286)|negative regulation of mesenchymal cell proliferation involved in lung development (GO:2000791)|negative regulation of platelet-derived growth factor receptor-alpha signaling pathway (GO:2000584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(4)|kidney(5)|large_intestine(5)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	35				UCEC - Uterine corpus endometrioid carcinoma (126;0.205)		GTAAAAAAGAAGGAGGCACAC	0.303																																					p.E712D		Atlas-SNP	.											.	PHF14	90	.	0			c.A2136T						.						52.0	52.0	52.0					7																	11080358		1813	4074	5887	SO:0001583	missense	9678	exon12			AAAAGAAGGAGGC	AB018326	CCDS47542.1	7p21.3	2013-01-28			ENSG00000106443	ENSG00000106443		"""Zinc fingers, PHD-type"""	22203	protein-coding gene	gene with protein product						9872452	Standard	NM_014660		Approved	KIAA0783	uc003sry.2	O94880	OTTHUMG00000150463	ENST00000403050.3:c.2136A>T	chr7.hg19:g.11080358A>T	ENSP00000385795:p.Glu712Asp	469.0	1.0		435.0	115.0	NM_014660	A7MCZ3|B4DI82	Missense_Mutation	SNP	ENST00000403050.3	hg19	CCDS47542.1	.	.	.	.	.	.	.	.	.	.	A	18.00	3.526226	0.64860	.	.	ENSG00000106443	ENST00000403050;ENST00000445996	T;T	0.71103	-0.19;-0.54	5.36	5.36	0.76844	Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.72763	0.3501	N	0.24115	0.695	0.53005	D	0.999968	D;P;D;D	0.58970	0.974;0.956;0.984;0.963	D;P;D;P	0.68192	0.953;0.899;0.956;0.543	T	0.69292	-0.5183	10	0.21014	T	0.42	.	15.5304	0.75956	1.0:0.0:0.0:0.0	.	427;427;712;712	O94880-2;B4DG57;A8MSQ1;O94880	.;.;.;PHF14_HUMAN	D	712;427	ENSP00000385795:E712D;ENSP00000403907:E427D	ENSP00000385795:E712D	E	+	3	2	PHF14	11046883	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.275000	0.58927	2.246000	0.74042	0.533000	0.62120	GAA	.	.		0.303	PHF14-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000318212.1	NM_014660	
VWDE	221806	hgsc.bcm.edu	37	7	12409623	12409623	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:12409623G>A	ENST00000275358.3	-	12	2497	c.2309C>T	c.(2308-2310)aCg>aTg	p.T770M		NM_001135924.1	NP_001129396.1	Q8N2E2	VWDE_HUMAN	von Willebrand factor D and EGF domains	770						extracellular region (GO:0005576)				breast(4)|endometrium(2)|kidney(1)|skin(1)	8						TTCCAGATCCGTTTGGCTGAG	0.483																																					p.T770M		Atlas-SNP	.											VWDE_ENST00000275358,colon,carcinoma,0,2	VWDE	123	.	0			c.C2309T						.						145.0	117.0	126.0					7																	12409623		692	1591	2283	SO:0001583	missense	221806	exon12			AGATCCGTTTGGC		CCDS47544.1	7p21.3	2008-09-23			ENSG00000146530	ENSG00000146530			21897	protein-coding gene	gene with protein product						14702039, 16303743	Standard	NM_001135924		Approved	FLJ14712	uc003ssj.2	Q8N2E2	OTTHUMG00000152315	ENST00000275358.3:c.2309C>T	chr7.hg19:g.12409623G>A	ENSP00000275358:p.Thr770Met	138.0	0.0		134.0	39.0	NM_001135924	B7ZM77|Q96SQ3	Missense_Mutation	SNP	ENST00000275358.3	hg19	CCDS47544.1	.	.	.	.	.	.	.	.	.	.	G	8.677	0.904294	0.17760	.	.	ENSG00000146530	ENST00000275358;ENST00000536307	D	0.82433	-1.61	4.93	-4.17	0.03857	.	0.976044	0.08401	N	0.951482	T	0.65333	0.2681	L	0.34521	1.04	0.09310	N	1	P	0.47604	0.898	B	0.36504	0.226	T	0.58787	-0.7575	10	0.62326	D	0.03	.	1.4965	0.02467	0.2526:0.3485:0.2238:0.1751	.	770	Q8N2E2	VWDE_HUMAN	M	770;224	ENSP00000275358:T770M	ENSP00000275358:T770M	T	-	2	0	VWDE	12376148	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.243000	0.18106	-1.264000	0.02452	-0.136000	0.14681	ACG	.	.		0.483	VWDE-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325870.3	XM_371878	
AGR2	10551	hgsc.bcm.edu	37	7	16832566	16832566	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:16832566T>C	ENST00000419304.2	-	8	646	c.494A>G	c.(493-495)aAg>aGg	p.K165R	AGR2_ENST00000419572.2_Missense_Mutation_p.K185R	NM_006408.3	NP_006399.1	O95994	AGR2_HUMAN	anterior gradient 2	165					lung goblet cell differentiation (GO:0060480)|mucus secretion (GO:0070254)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	dystroglycan binding (GO:0002162)			endometrium(2)|lung(1)|prostate(1)|skin(2)	6	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		GAGAGCTTTCTTCATGTTGTC	0.413																																					p.K165R		Atlas-SNP	.											.	AGR2	14	.	0			c.A494G						.						103.0	95.0	98.0					7																	16832566		2203	4300	6503	SO:0001583	missense	10551	exon8			GCTTTCTTCATGT	AF038451	CCDS5364.1	7p21.3	2013-07-31	2013-07-31		ENSG00000106541	ENSG00000106541		"""Protein disulfide isomerases"""	328	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 17"""	606358	"""anterior gradient 2 homolog (Xenopus laevis)"""			9790916	Standard	NM_006408		Approved	XAG-2, HAG-2, AG2, PDIA17	uc003str.3	O95994	OTTHUMG00000023446	ENST00000419304.2:c.494A>G	chr7.hg19:g.16832566T>C	ENSP00000391490:p.Lys165Arg	64.0	0.0		50.0	10.0	NM_006408		Missense_Mutation	SNP	ENST00000419304.2	hg19	CCDS5364.1	.	.	.	.	.	.	.	.	.	.	T	15.72	2.915379	0.52546	.	.	ENSG00000106541	ENST00000419304;ENST00000419572	.	.	.	5.86	3.49	0.39957	.	0.202835	0.52532	N	0.000080	T	0.47414	0.1444	L	0.39245	1.2	0.39685	D	0.970955	B	0.10296	0.003	B	0.16289	0.015	T	0.43410	-0.9393	9	0.62326	D	0.03	.	10.435	0.44430	0.0:0.1332:0.0:0.8668	.	165	O95994	AGR2_HUMAN	R	165;185	.	ENSP00000391490:K165R	K	-	2	0	AGR2	16799091	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.068000	0.41471	0.563000	0.29222	0.528000	0.53228	AAG	.	.		0.413	AGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207594.2	NM_006408	
MACC1	346389	hgsc.bcm.edu	37	7	20198999	20198999	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:20198999A>T	ENST00000400331.5	-	5	1293	c.985T>A	c.(985-987)Tat>Aat	p.Y329N	MACC1_ENST00000589011.1_Missense_Mutation_p.Y329N|MACC1_ENST00000332878.4_Missense_Mutation_p.Y329N	NM_182762.3	NP_877439.3	Q6ZN28	MACC1_HUMAN	metastasis associated in colon cancer 1	329					positive regulation of cell division (GO:0051781)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(15)|lung(12)|ovary(2)|prostate(1)|skin(3)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(1)	39						GTGTCTTTATAAATGTAGCAG	0.423																																					p.Y329N		Atlas-SNP	.											.	MACC1	99	.	0			c.T985A						.						54.0	52.0	53.0					7																	20198999		2203	4300	6503	SO:0001583	missense	346389	exon5			CTTTATAAATGTA		CCDS5369.1	7p15.3	2008-10-14			ENSG00000183742	ENSG00000183742			30215	protein-coding gene	gene with protein product		612646					Standard	NM_182762		Approved	7A5, SH3BP4L	uc003sus.4	Q6ZN28	OTTHUMG00000128415	ENST00000400331.5:c.985T>A	chr7.hg19:g.20198999A>T	ENSP00000383185:p.Tyr329Asn	93.0	0.0		81.0	25.0	NM_182762	A8MUS5|B2RNR9|Q6ZQN8|Q7Z5A5	Missense_Mutation	SNP	ENST00000400331.5	hg19	CCDS5369.1	.	.	.	.	.	.	.	.	.	.	A	10.58	1.389053	0.25118	.	.	ENSG00000183742	ENST00000400331;ENST00000332878	T;T	0.17854	2.25;2.25	5.47	5.47	0.80525	.	0.221502	0.48767	D	0.000169	T	0.41259	0.1151	M	0.78637	2.42	0.53688	D	0.999976	D	0.63880	0.993	P	0.61397	0.888	T	0.38866	-0.9641	10	0.72032	D	0.01	-9.7349	15.5516	0.76158	1.0:0.0:0.0:0.0	.	329	Q6ZN28	MACC1_HUMAN	N	329	ENSP00000383185:Y329N;ENSP00000328410:Y329N	ENSP00000328410:Y329N	Y	-	1	0	MACC1	20165524	1.000000	0.71417	0.981000	0.43875	0.011000	0.07611	4.315000	0.59172	2.078000	0.62432	0.477000	0.44152	TAT	.	.		0.423	MACC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250202.5	NM_182762	
NME8	51314	hgsc.bcm.edu	37	7	37936559	37936559	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:37936559A>T	ENST00000199447.4	+	17	2004	c.1632A>T	c.(1630-1632)gcA>gcT	p.A544A	NME8_ENST00000440017.1_Silent_p.A544A|EPDR1_ENST00000476620.1_Intron	NM_016616.4	NP_057700.3	Q8N427	TXND3_HUMAN	NME/NM23 family member 8	544	NDK 3.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|UTP biosynthetic process (GO:0006228)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)										CAGAAGAAGCAAAATTACTTT	0.458																																					p.A544A		Atlas-SNP	.											.	.	.	.	0			c.A1632T						.						104.0	99.0	101.0					7																	37936559		2203	4300	6503	SO:0001819	synonymous_variant	51314	exon17			AGAAGCAAAATTA	AF202051	CCDS5452.1	7p15.2	2012-05-18	2012-05-18	2012-05-18	ENSG00000086288	ENSG00000086288			16473	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 2"""	607421	"""thioredoxin domain containing 3 (spermatozoa)"""	TXNDC3		11737268, 11768308, 19852809	Standard	NM_016616		Approved	CILD6, SPTRX2, NM23-H8	uc003tfn.3	Q8N427	OTTHUMG00000023716	ENST00000199447.4:c.1632A>T	chr7.hg19:g.37936559A>T		153.0	0.0		155.0	34.0	NM_016616	Q9NZH1	Silent	SNP	ENST00000199447.4	hg19	CCDS5452.1																																																																																			.	.		0.458	NME8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219946.1	NM_016616	
ADCY1	107	hgsc.bcm.edu	37	7	45614683	45614683	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:45614683A>T	ENST00000297323.7	+	1	563	c.541A>T	c.(541-543)Agc>Tgc	p.S181C	ADCY1_ENST00000432715.1_5'UTR	NM_021116.2	NP_066939.1	Q08828	ADCY1_HUMAN	adenylate cyclase 1 (brain)	181					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|axonogenesis (GO:0007409)|cellular response to glucagon stimulus (GO:0071377)|circadian rhythm (GO:0007623)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|long-term memory (GO:0007616)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of circadian rhythm (GO:0042752)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(33)|ovary(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	71					Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)	GCCCGTGCGCAGCCTGCTGGC	0.677																																					p.S181C		Atlas-SNP	.											.	ADCY1	187	.	0			c.A541T						.						21.0	18.0	19.0					7																	45614683		2190	4280	6470	SO:0001583	missense	107	exon1			GTGCGCAGCCTGC	L05500	CCDS34631.1, CCDS75593.1	7p13-p12	2013-02-04			ENSG00000164742	ENSG00000164742	4.6.1.1	"""Adenylate cyclases"""	232	protein-coding gene	gene with protein product		103072				8314585	Standard	NM_021116		Approved	AC1	uc003tne.4	Q08828	OTTHUMG00000155420	ENST00000297323.7:c.541A>T	chr7.hg19:g.45614683A>T	ENSP00000297323:p.Ser181Cys	82.0	0.0		85.0	24.0	NM_021116	A4D2L8|Q75MI1	Missense_Mutation	SNP	ENST00000297323.7	hg19	CCDS34631.1	.	.	.	.	.	.	.	.	.	.	A	17.25	3.341774	0.61073	.	.	ENSG00000164742	ENST00000297323;ENST00000545300	T	0.79454	-1.27	3.7	3.7	0.42460	.	0.060259	0.64402	D	0.000006	T	0.73210	0.3558	L	0.29908	0.895	0.39195	D	0.963038	P	0.49185	0.92	P	0.51229	0.663	T	0.76526	-0.2927	10	0.59425	D	0.04	.	10.3691	0.44042	1.0:0.0:0.0:0.0	.	181	Q08828	ADCY1_HUMAN	C	181	ENSP00000297323:S181C	ENSP00000297323:S181C	S	+	1	0	ADCY1	45581208	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	8.108000	0.89559	1.531000	0.49152	0.172000	0.16884	AGC	.	.		0.677	ADCY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340055.2	NM_021116	
ZPBP	11055	hgsc.bcm.edu	37	7	50132767	50132767	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:50132767T>A	ENST00000046087.2	-	1	93	c.24A>T	c.(22-24)ccA>ccT	p.P8P	ZPBP_ENST00000419417.1_Silent_p.P8P|C7orf72_ENST00000297001.6_5'Flank	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	8					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					cccgccgcgcTGGGCCAAGGG	0.731																																					p.P8P		Atlas-SNP	.											.	ZPBP	65	.	0			c.A24T						.						2.0	4.0	3.0					7																	50132767		1524	3135	4659	SO:0001819	synonymous_variant	11055	exon1			CCGCGCTGGGCCA	D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.24A>T	chr7.hg19:g.50132767T>A		67.0	0.0		42.0	15.0	NM_007009	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Silent	SNP	ENST00000046087.2	hg19	CCDS5509.1																																																																																			.	.		0.731	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000251374.1	NM_007009	
EGFR	1956	hgsc.bcm.edu	37	7	55273271	55273271	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:55273271A>T	ENST00000275493.2	+	28	3771	c.3594A>T	c.(3592-3594)ctA>ctT	p.L1198L	EGFR_ENST00000454757.2_Silent_p.L1145L|EGFR_ENST00000442591.1_Intron	NM_005228.3	NP_005219.2	P00533	EGFR_HUMAN	epidermal growth factor receptor	1198					activation of phospholipase A2 activity by calcium-mediated signaling (GO:0043006)|activation of phospholipase C activity (GO:0007202)|alkanesulfonate metabolic process (GO:0019694)|astrocyte activation (GO:0048143)|axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|cellular response to amino acid stimulus (GO:0071230)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to drug (GO:0035690)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cerebral cortex cell migration (GO:0021795)|circadian rhythm (GO:0007623)|digestive tract morphogenesis (GO:0048546)|diterpenoid metabolic process (GO:0016101)|embryonic placenta development (GO:0001892)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle development (GO:0001942)|hydrogen peroxide metabolic process (GO:0042743)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|liver development (GO:0001889)|lung development (GO:0030324)|magnesium ion homeostasis (GO:0010960)|MAPK cascade (GO:0000165)|morphogenesis of an epithelial fold (GO:0060571)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein catabolic process (GO:0042177)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|polysaccharide metabolic process (GO:0005976)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of DNA repair (GO:0045739)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|positive regulation of vasodilation (GO:0045909)|protein autophosphorylation (GO:0046777)|protein insertion into membrane (GO:0051205)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to calcium ion (GO:0051592)|response to cobalamin (GO:0033590)|response to hydroxyisoflavone (GO:0033594)|response to osmotic stress (GO:0006970)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|response to UV-A (GO:0070141)|salivary gland morphogenesis (GO:0007435)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|tongue development (GO:0043586)|translation (GO:0006412)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|Shc-EGFR complex (GO:0070435)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|epidermal growth factor-activated receptor activity (GO:0005006)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)|ubiquitin protein ligase binding (GO:0031625)			NS(2)|adrenal_gland(5)|biliary_tract(8)|bone(3)|breast(18)|central_nervous_system(106)|endometrium(26)|eye(3)|haematopoietic_and_lymphoid_tissue(9)|kidney(11)|large_intestine(85)|liver(2)|lung(13575)|oesophagus(21)|ovary(38)|pancreas(3)|peritoneum(11)|pleura(2)|prostate(35)|salivary_gland(11)|skin(9)|small_intestine(1)|soft_tissue(4)|stomach(41)|thymus(2)|thyroid(14)|upper_aerodigestive_tract(59)|urinary_tract(6)	14110	all_cancers(1;1.57e-46)|all_epithelial(1;5.62e-37)|Lung NSC(1;9.29e-25)|all_lung(1;4.39e-23)|Esophageal squamous(2;7.55e-08)|Breast(14;0.0318)		GBM - Glioblastoma multiforme(1;0)|all cancers(1;2.19e-314)|Lung(13;4.65e-05)|LUSC - Lung squamous cell carcinoma(13;0.000168)|STAD - Stomach adenocarcinoma(5;0.00164)|Epithelial(13;0.0607)		Afatinib(DB08916)|Cetuximab(DB00002)|Erlotinib(DB00530)|Gefitinib(DB00317)|Lapatinib(DB01259)|Lidocaine(DB00281)|Panitumumab(DB01269)|Trastuzumab(DB00072)|Vandetanib(DB05294)	CAGAATACCTAAGGGTCGCGC	0.493		8	"""A, O, Mis"""		"""glioma, NSCLC"""	NSCLC			Lung Cancer, Familial Clustering of	TCGA GBM(3;<1E-08)|TSP Lung(4;<1E-08)																											p.L1198L		Atlas-SNP	.	yes	Dom	yes	Familial lung cancer	7	7p12.3-p12.1	1956	"""epidermal growth factor receptor (erythroblastic leukemia viral (v-erb-b) oncogene homolog, avian)"""		"""E, O"""	.	EGFR	20426	.	0			c.A3594T						.						63.0	60.0	61.0					7																	55273271		2203	4300	6503	SO:0001819	synonymous_variant	1956	exon28	Familial Cancer Database	incl. Hereditary Lung cancer, Hereditary Non-Small Cell Lung cancer	ATACCTAAGGGTC		CCDS5514.1, CCDS5515.1, CCDS5516.1, CCDS47587.1	7p12	2014-09-17	2010-06-25		ENSG00000146648	ENSG00000146648			3236	protein-coding gene	gene with protein product	"""erythroblastic leukemia viral (v-erb-b) oncogene homolog (avian)"""	131550	"""epidermal growth factor receptor (avian erythroblastic leukemia viral (v-erb-b) oncogene homolog)"""	ERBB		1505215	Standard	NM_201282		Approved	ERBB1	uc003tqk.3	P00533	OTTHUMG00000023661	ENST00000275493.2:c.3594A>T	chr7.hg19:g.55273271A>T		153.0	0.0		152.0	31.0	NM_005228	O00688|O00732|P06268|Q14225|Q68GS5|Q92795|Q9BZS2|Q9GZX1|Q9H2C9|Q9H3C9|Q9UMD7|Q9UMD8|Q9UMG5	Silent	SNP	ENST00000275493.2	hg19	CCDS5514.1																																																																																			.	.		0.493	EGFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251456.2	NM_005228	
FKBP6	8468	hgsc.bcm.edu	37	7	72745693	72745693	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:72745693C>A	ENST00000252037.4	+	5	571	c.502C>A	c.(502-504)Ctg>Atg	p.L168M	FKBP6_ENST00000431982.2_Missense_Mutation_p.L163M|FKBP6_ENST00000413573.2_Missense_Mutation_p.L138M	NM_003602.3	NP_003593.3	O75344	FKBP6_HUMAN	FK506 binding protein 6, 36kDa	168					cell differentiation (GO:0030154)|chaperone-mediated protein folding (GO:0061077)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|piRNA metabolic process (GO:0034587)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|synaptonemal complex (GO:0000795)	FK506 binding (GO:0005528)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)	16		Lung NSC(55;0.0908)|all_lung(88;0.198)				TCAGAAGGTCCTGAAAGTGGC	0.453																																					p.L168M		Atlas-SNP	.											.	FKBP6	35	.	0			c.C502A						.						92.0	89.0	90.0					7																	72745693		1889	4113	6002	SO:0001583	missense	8468	exon5			AAGGTCCTGAAAG	AF038847	CCDS43595.1, CCDS47604.1, CCDS64670.1	7q11.23	2009-01-05	2002-08-29		ENSG00000077800	ENSG00000077800			3722	protein-coding gene	gene with protein product	"""FK506 binding protein 6 (36kD)"", ""peptidylprolyl cis-trans isomerase"", ""rotamase"", ""immunophilin FKBP36"""	604839	"""FK506-binding protein 6 (36kD)"""			9782077, 19001379	Standard	NM_003602		Approved	PPIase, FKBP36	uc003tya.2	O75344	OTTHUMG00000150520	ENST00000252037.4:c.502C>A	chr7.hg19:g.72745693C>A	ENSP00000252037:p.Leu168Met	88.0	0.0		82.0	39.0	NM_003602	B4DXT7|G3V0I2|Q7Z4T4|Q9UDS0	Missense_Mutation	SNP	ENST00000252037.4	hg19	CCDS43595.1	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854967	0.51376	.	.	ENSG00000077800	ENST00000431982;ENST00000413573;ENST00000252037	T;T;T	0.74421	-0.84;-0.84;-0.84	5.2	5.2	0.72013	.	0.072350	0.56097	D	0.000025	T	0.80037	0.4550	L	0.60455	1.87	0.51767	D	0.999933	D;P;D	0.89917	1.0;0.899;0.994	D;B;P	0.79784	0.993;0.421;0.591	T	0.78119	-0.2328	10	0.33940	T	0.23	-10.5982	6.3705	0.21479	0.1842:0.7199:0.0:0.0959	.	163;168;138	O75344-2;O75344;Q7Z4T4	.;FKBP6_HUMAN;.	M	163;138;168	ENSP00000416277:L163M;ENSP00000394952:L138M;ENSP00000252037:L168M	ENSP00000252037:L168M	L	+	1	2	FKBP6	72383629	1.000000	0.71417	0.998000	0.56505	0.830000	0.47004	0.952000	0.29149	2.442000	0.82660	0.591000	0.81541	CTG	.	.		0.453	FKBP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318723.1	NM_003602	
UPK3B	80761	hgsc.bcm.edu	37	7	76143358	76143358	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:76143358A>C	ENST00000257632.5	+	3	849	c.721A>C	c.(721-723)Act>Cct	p.T241P	UPK3B_ENST00000334348.3_Silent_p.L212L|UPK3B_ENST00000419923.2_Missense_Mutation_p.T241P|UPK3B_ENST00000394849.1_Missense_Mutation_p.T186P|UPK3B_ENST00000448265.3_Missense_Mutation_p.T241P|UPK3B_ENST00000443097.2_Silent_p.L212L			Q9BT76	UPK3B_HUMAN	uroplakin 3B	241					negative regulation of gene expression (GO:0010629)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(1)|lung(1)|skin(2)	8		Myeloproliferative disorder(862;0.204)				CCGGCCTCCTACTCTTGGCCT	0.622																																					p.T241P		Atlas-SNP	.											.	UPK3B	15	.	0			c.A721C						.						168.0	121.0	137.0					7																	76143358		2203	4300	6503	SO:0001583	missense	80761	exon3			CCTCCTACTCTTG	BC004304	CCDS5588.1, CCDS5589.1, CCDS64693.1	7q11.2	2003-07-29			ENSG00000243566	ENSG00000243566			21444	protein-coding gene	gene with protein product	"""uroplakin IIIb"""	611887				12446744	Standard	XM_005250612		Approved	MGC10902, p35, UPIIIb, FLJ32198	uc003ufq.3	Q9BT76	OTTHUMG00000149929	ENST00000257632.5:c.721A>C	chr7.hg19:g.76143358A>C	ENSP00000257632:p.Thr241Pro	102.0	0.0		100.0	36.0	NM_030570	A6NHH5|A8K231|A8MZA8|B3KPU5|Q75MM5|Q86W06	Missense_Mutation	SNP	ENST00000257632.5	hg19	CCDS5588.1	.	.	.	.	.	.	.	.	.	.	.	12.76	2.033122	0.35893	.	.	ENSG00000243566	ENST00000419923;ENST00000448265;ENST00000257632;ENST00000394849	T;T;T;T	0.35789	1.29;1.29;1.29;1.34	5.22	1.08	0.20341	.	1.778480	0.02936	N	0.139844	T	0.18882	0.0453	N	0.03608	-0.345	0.80722	D	1	B;B	0.16166	0.016;0.016	B;B	0.20384	0.029;0.018	T	0.28073	-1.0055	10	0.48119	T	0.1	-30.3739	4.8266	0.13419	0.2535:0.0:0.5981:0.1483	.	186;241	Q9BT76-2;Q9BT76	.;UPK3B_HUMAN	P	241;241;241;186	ENSP00000441602:T241P;ENSP00000441284:T241P;ENSP00000257632:T241P;ENSP00000378319:T186P	ENSP00000257632:T241P	T	+	1	0	UPK3B	75981294	0.998000	0.40836	1.000000	0.80357	0.567000	0.35839	0.155000	0.16362	0.617000	0.30160	-0.344000	0.07964	ACT	.	.		0.622	UPK3B-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000313978.2	NM_030570	
PCLO	27445	hgsc.bcm.edu	37	7	82544071	82544071	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:82544071T>C	ENST00000333891.9	-	7	13568	c.13231A>G	c.(13231-13233)Act>Gct	p.T4411A	PCLO_ENST00000423517.2_Missense_Mutation_p.T4411A|PCLO_ENST00000437081.1_Missense_Mutation_p.T1131A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TAGCCTCGAGTCCGTGATTCT	0.493																																					p.T4411A		Atlas-SNP	.											.	PCLO	1506	.	0			c.A13231G						.						90.0	89.0	89.0					7																	82544071		2068	4196	6264	SO:0001583	missense	27445	exon7			CTCGAGTCCGTGA	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13231A>G	chr7.hg19:g.82544071T>C	ENSP00000334319:p.Thr4411Ala	103.0	0.0		85.0	17.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	8.844	0.942904	0.18281	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000437081	T;T	0.17854	2.25;2.26	5.75	5.75	0.90469	.	.	.	.	.	T	0.21761	0.0524	L	0.54323	1.7	0.48571	D	0.99967	B;P;P	0.41450	0.058;0.75;0.75	B;B;B	0.43274	0.017;0.414;0.414	T	0.01245	-1.1407	9	0.87932	D	0	.	11.147	0.48436	0.0:0.0711:0.0:0.9289	.	4342;4411;4411	Q9Y6V0;Q9Y6V0-5;Q9Y6V0-6	PCLO_HUMAN;.;.	A	4411;4411;1131	ENSP00000334319:T4411A;ENSP00000388393:T4411A	ENSP00000334319:T4411A	T	-	1	0	PCLO	82382007	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	2.574000	0.46016	2.201000	0.70794	0.533000	0.62120	ACT	.	.		0.493	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
SEMA3A	10371	hgsc.bcm.edu	37	7	83689783	83689783	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:83689783A>G	ENST00000265362.4	-	5	859	c.545T>C	c.(544-546)aTa>aCa	p.I182T	SEMA3A_ENST00000436949.1_Missense_Mutation_p.I182T	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	182	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						CTACGCACCTATTAAAAGGGA	0.348																																					p.I182T		Atlas-SNP	.											.	SEMA3A	121	.	0			c.T545C						.						106.0	110.0	109.0					7																	83689783		2203	4300	6503	SO:0001583	missense	10371	exon5			GCACCTATTAAAA	L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.545T>C	chr7.hg19:g.83689783A>G	ENSP00000265362:p.Ile182Thr	205.0	0.0		173.0	40.0	NM_006080		Missense_Mutation	SNP	ENST00000265362.4	hg19	CCDS5599.1	.	.	.	.	.	.	.	.	.	.	A	14.55	2.569453	0.45798	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.22539	1.95;1.95	5.65	5.65	0.86999	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.121250	0.64402	D	0.000001	T	0.22666	0.0547	L	0.33710	1.025	0.58432	D	0.999995	B	0.17038	0.02	B	0.33392	0.163	T	0.04386	-1.0955	10	0.36615	T	0.2	.	16.1718	0.81822	1.0:0.0:0.0:0.0	.	182	Q14563	SEM3A_HUMAN	T	182	ENSP00000265362:I182T;ENSP00000415260:I182T	ENSP00000265362:I182T	I	-	2	0	SEMA3A	83527719	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.649000	0.83500	2.267000	0.75376	0.528000	0.53228	ATA	.	.		0.348	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253355.2	NM_006080	
SEMA3D	223117	hgsc.bcm.edu	37	7	84649627	84649627	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:84649627A>T	ENST00000284136.6	-	12	1468	c.1425T>A	c.(1423-1425)acT>acA	p.T475T	SEMA3D_ENST00000484038.1_5'UTR	NM_152754.2	NP_689967.2	O95025	SEM3D_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3D	475	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(2)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(19)|lung(29)|ovary(3)|pancreas(1)|prostate(4)|skin(2)	73						CTTTGAGGACAGTTCCAATGT	0.413																																					p.T475T	Ovarian(63;442 1191 17318 29975 31528)	Atlas-SNP	.											.	SEMA3D	177	.	0			c.T1425A						.						94.0	82.0	86.0					7																	84649627		2203	4300	6503	SO:0001819	synonymous_variant	223117	exon12			GAGGACAGTTCCA	BC029590	CCDS34676.1	7q21.11	2013-01-11			ENSG00000153993	ENSG00000153993		"""Semaphorins"", ""Immunoglobulin superfamily / V-set domain containing"""	10726	protein-coding gene	gene with protein product		609907					Standard	NM_152754		Approved	coll-2, Sema-Z2	uc003uic.3	O95025	OTTHUMG00000154569	ENST00000284136.6:c.1425T>A	chr7.hg19:g.84649627A>T		79.0	0.0		70.0	18.0	NM_152754	A6NK46|Q6UW77|Q8NCQ1	Silent	SNP	ENST00000284136.6	hg19	CCDS34676.1																																																																																			.	.		0.413	SEMA3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336084.2	NM_152754	
COL1A2	1278	hgsc.bcm.edu	37	7	94055788	94055788	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:94055788A>T	ENST00000297268.6	+	46	3522	c.3051A>T	c.(3049-3051)agA>agT	p.R1017S		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	1017					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	AGGGGCCCAGAGGTCTTCCTG	0.478										HNSCC(75;0.22)																											p.R1017S		Atlas-SNP	.											.	COL1A2	240	.	0			c.A3051T						.						69.0	54.0	59.0					7																	94055788		2203	4300	6503	SO:0001583	missense	1278	exon46			GCCCAGAGGTCTT	Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.3051A>T	chr7.hg19:g.94055788A>T	ENSP00000297268:p.Arg1017Ser	130.0	0.0		103.0	27.0	NM_000089	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	ENST00000297268.6	hg19	CCDS34682.1	.	.	.	.	.	.	.	.	.	.	A	17.67	3.446562	0.63178	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.94092	-3.35	5.85	3.43	0.39272	.	0.000000	0.85682	D	0.000000	D	0.93822	0.8024	L	0.38531	1.155	0.58432	D	0.999995	D	0.71674	0.998	D	0.79784	0.993	D	0.92957	0.6385	10	0.87932	D	0	.	10.5471	0.45066	0.8683:0.0:0.1317:0.0	.	1017	P08123	CO1A2_HUMAN	S	1017;1018	ENSP00000297268:R1017S	ENSP00000297268:R1017S	R	+	3	2	COL1A2	93893724	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.498000	0.60373	0.539000	0.28788	0.533000	0.62120	AGA	.	.		0.478	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309045.2	NM_000089	
KPNA7	402569	hgsc.bcm.edu	37	7	98786068	98786068	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:98786068T>A	ENST00000327442.6	-	6	794	c.755A>T	c.(754-756)cAc>cTc	p.H252L		NM_001145715.1	NP_001139187.1	A9QM74	IMA8_HUMAN	karyopherin alpha 7 (importin alpha 8)	252					cytokine-mediated signaling pathway (GO:0019221)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)			breast(3)|endometrium(2)|kidney(1)|prostate(1)|skin(1)	8						ACTGTCCTGGTGCTGCAGGAG	0.592																																					p.H252L		Atlas-SNP	.											.	KPNA7	31	.	0			c.A755T						.						40.0	35.0	37.0					7																	98786068		692	1591	2283	SO:0001583	missense	402569	exon6			TCCTGGTGCTGCA		CCDS47651.1	7q22.1	2013-02-14			ENSG00000185467	ENSG00000185467		"""Importins"", ""Armadillo repeat containing"""	21839	protein-coding gene	gene with protein product		614107					Standard	NM_001145715		Approved		uc010lft.2	A9QM74	OTTHUMG00000154412	ENST00000327442.6:c.755A>T	chr7.hg19:g.98786068T>A	ENSP00000330878:p.His252Leu	93.0	0.0		115.0	23.0	NM_001145715	A4D277	Missense_Mutation	SNP	ENST00000327442.6	hg19	CCDS47651.1	.	.	.	.	.	.	.	.	.	.	-	11.35	1.613592	0.28712	.	.	ENSG00000185467	ENST00000327442	T	0.70749	-0.51	5.58	4.41	0.53225	Armadillo-like helical (1);Armadillo-type fold (1);	0.044266	0.85682	D	0.000000	T	0.69878	0.3160	M	0.77486	2.375	0.53688	D	0.999975	B	0.22003	0.063	B	0.24394	0.053	T	0.69826	-0.5040	10	0.45353	T	0.12	-8.672	11.0871	0.48093	0.0:0.0742:0.0:0.9258	.	252	A9QM74	IMA8_HUMAN	L	252	ENSP00000330878:H252L	ENSP00000330878:H252L	H	-	2	0	KPNA7	98624004	1.000000	0.71417	0.959000	0.39883	0.054000	0.15201	4.005000	0.57075	2.132000	0.65825	0.449000	0.29647	CAC	.	.		0.592	KPNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335118.1	NM_001145715	
MUC17	140453	hgsc.bcm.edu	37	7	100677847	100677847	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:100677847C>T	ENST00000306151.4	+	3	3214	c.3150C>T	c.(3148-3150)agC>agT	p.S1050S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1050	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCCTGTCAGCACCACAATGG	0.502																																					p.S1050S		Atlas-SNP	.											.	MUC17	804	.	0			c.C3150T						.						512.0	393.0	433.0					7																	100677847		2203	4300	6503	SO:0001819	synonymous_variant	140453	exon3			TGTCAGCACCACA	AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3150C>T	chr7.hg19:g.100677847C>T		129.0	0.0		183.0	45.0	NM_001040105	O14761|Q685J2|Q8TDH7	Silent	SNP	ENST00000306151.4	hg19	CCDS34711.1																																																																																			.	.		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347161.1	NM_001040105	
LRRC17	10234	hgsc.bcm.edu	37	7	102574534	102574534	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:102574534A>T	ENST00000339431.4	+	2	469	c.174A>T	c.(172-174)acA>acT	p.T58T	FBXL13_ENST00000379308.3_Intron|FBXL13_ENST00000393772.2_Intron|FBXL13_ENST00000379305.3_Intron|FBXL13_ENST00000436908.1_Intron|FBXL13_ENST00000379306.3_Intron|FBXL13_ENST00000455112.2_Intron|FBXL13_ENST00000456695.1_Intron|FBXL13_ENST00000313221.4_Intron|LRRC17_ENST00000249377.4_Silent_p.T58T	NM_001031692.2	NP_001026862.1	Q8N6Y2	LRC17_HUMAN	leucine rich repeat containing 17	58					bone marrow development (GO:0048539)|negative regulation of osteoclast differentiation (GO:0045671)|ossification (GO:0001503)	extracellular space (GO:0005615)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	17						ACGTGTACACATATCTCCATG	0.522																																					p.T58T		Atlas-SNP	.											.	LRRC17	45	.	0			c.A174T						.						56.0	51.0	52.0					7																	102574534		2203	4300	6503	SO:0001819	synonymous_variant	10234	exon2			GTACACATATCTC	U32907	CCDS5727.1, CCDS34721.1	7q22.1	2009-05-26			ENSG00000128606	ENSG00000128606			16895	protein-coding gene	gene with protein product						8982252, 19336404	Standard	NM_005824		Approved	P37NB, H_RG318M05.3	uc003vau.3	Q8N6Y2	OTTHUMG00000157210	ENST00000339431.4:c.174A>T	chr7.hg19:g.102574534A>T		114.0	0.0		97.0	28.0	NM_005824	Q13288|Q6UWA7|Q75MG5	Silent	SNP	ENST00000339431.4	hg19	CCDS34721.1																																																																																			.	.		0.522	LRRC17-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347930.1	NM_005824	
FOXP2	93986	hgsc.bcm.edu	37	7	114299675	114299675	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:114299675A>T	ENST00000393494.2	+	13	1873	c.1594A>T	c.(1594-1596)Agc>Tgc	p.S532C	FOXP2_ENST00000393491.3_Missense_Mutation_p.S347C|FOXP2_ENST00000408937.3_Missense_Mutation_p.S557C|FOXP2_ENST00000350908.4_Missense_Mutation_p.S532C|FOXP2_ENST00000393500.3_3'UTR|FOXP2_ENST00000403559.4_Missense_Mutation_p.S549C|FOXP2_ENST00000393498.2_Missense_Mutation_p.S511C|FOXP2_ENST00000393489.3_Missense_Mutation_p.S440C			O15409	FOXP2_HUMAN	forkhead box P2	532					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						TGAAATTTACAGCTGGTTTAC	0.383																																					p.S557C		Atlas-SNP	.											.	FOXP2	133	.	0			c.A1669T						.						157.0	147.0	151.0					7																	114299675		2203	4300	6503	SO:0001583	missense	93986	exon14			ATTTACAGCTGGT	U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.1594A>T	chr7.hg19:g.114299675A>T	ENSP00000377132:p.Ser532Cys	157.0	0.0		133.0	30.0	NM_148898	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Missense_Mutation	SNP	ENST00000393494.2	hg19	CCDS5760.1	.	.	.	.	.	.	.	.	.	.	A	13.31	2.197852	0.38806	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	D;D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83;-3.83	6.06	6.06	0.98353	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.96839	0.8968	L	0.51914	1.62	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.999;0.995;0.999;0.998	D;D;D;D;D	0.76575	0.978;0.986;0.988;0.978;0.975	D	0.97470	1.0040	10	0.87932	D	0	.	16.6127	0.84892	1.0:0.0:0.0:0.0	.	531;549;347;532;557	B7ZLK5;B4DLD9;Q0PRL4;O15409;O15409-4	.;.;.;FOXP2_HUMAN;.	C	532;557;549;532;509;440;347	ENSP00000377132:S532C;ENSP00000386200:S557C;ENSP00000385069:S549C;ENSP00000265436:S532C;ENSP00000377129:S440C;ENSP00000377130:S347C	ENSP00000265436:S532C	S	+	1	0	FOXP2	114086911	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.322000	0.78497	0.528000	0.53228	AGC	.	.		0.383	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317366.1	NM_014491	
ASZ1	136991	hgsc.bcm.edu	37	7	117060261	117060261	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:117060261T>C	ENST00000284629.2	-	4	458	c.396A>G	c.(394-396)gtA>gtG	p.V132V		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GTAGTAGTTCTACACACTTCA	0.343																																					p.V132V		Atlas-SNP	.											.	ASZ1	56	.	0			c.A396G						.						106.0	104.0	104.0					7																	117060261		2203	4300	6503	SO:0001819	synonymous_variant	136991	exon4			TAGTTCTACACAC	AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.396A>G	chr7.hg19:g.117060261T>C		45.0	0.0		40.0	11.0	NM_130768		Silent	SNP	ENST00000284629.2	hg19	CCDS5772.1																																																																																			.	.		0.343	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000138907.7	NM_130768	
PLXNA4	91584	hgsc.bcm.edu	37	7	132192611	132192611	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:132192611A>T	ENST00000359827.3	-	2	1804	c.842T>A	c.(841-843)gTg>gAg	p.V281E	PLXNA4_ENST00000321063.4_Missense_Mutation_p.V281E|PLXNA4_ENST00000423507.2_Missense_Mutation_p.V281E|PLXNA4_ENST00000378539.5_Missense_Mutation_p.V281E			Q9HCM2	PLXA4_HUMAN	plexin A4	281	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						GCAAAGCCTCACGAGCTTGGA	0.552																																					p.V281E		Atlas-SNP	.											.	PLXNA4	873	.	0			c.T842A						.						69.0	52.0	58.0					7																	132192611		2203	4300	6503	SO:0001583	missense	91584	exon2			AGCCTCACGAGCT	AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.842T>A	chr7.hg19:g.132192611A>T	ENSP00000352882:p.Val281Glu	71.0	0.0		88.0	32.0	NM_001105543	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	ENST00000359827.3	hg19	CCDS43646.1	.	.	.	.	.	.	.	.	.	.	A	14.74	2.626336	0.46840	.	.	ENSG00000221866	ENST00000321063;ENST00000359827;ENST00000423507;ENST00000378539	T;T;T;T	0.12879	2.64;2.64;2.64;2.64	5.84	5.84	0.93424	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.56097	U	0.000031	T	0.45617	0.1351	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.53387	-0.8446	10	0.66056	D	0.02	.	16.2159	0.82217	1.0:0.0:0.0:0.0	.	281;281;281	Q9HCM2-2;A4D1N6;Q9HCM2	.;.;PLXA4_HUMAN	E	281	ENSP00000323194:V281E;ENSP00000352882:V281E;ENSP00000392772:V281E;ENSP00000367800:V281E	ENSP00000323194:V281E	V	-	2	0	PLXNA4	131843151	1.000000	0.71417	0.998000	0.56505	0.028000	0.11728	9.339000	0.96797	2.243000	0.73865	0.533000	0.62120	GTG	.	.		0.552	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338422.2	NM_181775	
MKRN1	23608	hgsc.bcm.edu	37	7	140171777	140171777	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:140171777T>A	ENST00000255977.2	-	2	444	c.220A>T	c.(220-222)Aac>Tac	p.N74Y	MKRN1_ENST00000481705.1_5'UTR|MKRN1_ENST00000443720.2_Missense_Mutation_p.N74Y|MKRN1_ENST00000474576.1_Missense_Mutation_p.N10Y|MKRN1_ENST00000437223.2_5'UTR|MKRN1_ENST00000480552.1_Missense_Mutation_p.N10Y	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	74					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					TAGCGACAGTTGTCTCCTTCC	0.408																																					p.N74Y		Atlas-SNP	.											.	MKRN1	35	.	0			c.A220T						.						82.0	77.0	78.0					7																	140171777		2203	4300	6503	SO:0001583	missense	23608	exon2			GACAGTTGTCTCC	AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.220A>T	chr7.hg19:g.140171777T>A	ENSP00000255977:p.Asn74Tyr	84.0	0.0		80.0	16.0	NM_013446	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	ENST00000255977.2	hg19	CCDS5860.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.534557	0.85812	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000474576;ENST00000480552;ENST00000443720;ENST00000471104;ENST00000467513;ENST00000494939;ENST00000473444;ENST00000481705	T;T;T;T;T;T;T	0.47528	0.93;2.18;0.93;1.81;1.79;1.8;0.84	5.88	4.75	0.60458	Zinc finger, CCCH-type (3);	0.094910	0.64402	D	0.000001	T	0.65688	0.2715	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.66512	-0.5905	10	0.45353	T	0.12	.	11.1264	0.48322	0.0:0.0722:0.0:0.9278	.	74	Q9UHC7	MKRN1_HUMAN	Y	74;10;10;10;74;10;10;10;25;74	ENSP00000255977:N74Y;ENSP00000417863:N10Y;ENSP00000416369:N74Y;ENSP00000418864:N10Y;ENSP00000418588:N10Y;ENSP00000419843:N10Y;ENSP00000418620:N25Y	ENSP00000255977:N74Y	N	-	1	0	MKRN1	139818246	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.858000	0.69532	2.246000	0.74042	0.533000	0.62120	AAC	.	.		0.408	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348752.1	NM_013446	
PRSS1	5644	hgsc.bcm.edu	37	7	142459633	142459633	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:142459633A>T	ENST00000311737.7	+	3	215	c.209A>T	c.(208-210)cAg>cTg	p.Q70L	PRSS1_ENST00000486171.1_Missense_Mutation_p.Q84L	NM_002769.4	NP_002760.1	P07477	TRY1_HUMAN	protease, serine, 1 (trypsin 1)	70	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(24)|prostate(2)	38	Melanoma(164;0.047)	all_cancers(3;2.14e-49)|Acute lymphoblastic leukemia(3;7.3e-185)|all_hematologic(3;1.1e-165)	all cancers(2;0.000126)|Colorectal(2;0.000157)|Epithelial(2;0.000191)|COAD - Colon adenocarcinoma(2;0.00189)		Aprotinin(DB06692)	AGCCGCATCCAGGTGAGACTG	0.577																																					p.Q70L		Atlas-SNP	.											.	PRSS1	68	.	0			c.A209T						.						144.0	140.0	141.0					7																	142459633		2203	4300	6503	SO:0001583	missense	5644	exon3			GCATCCAGGTGAG	M22612	CCDS5872.1	7q34	2012-10-02			ENSG00000204983	ENSG00000204983	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9475	protein-coding gene	gene with protein product		276000		TRY1			Standard	NM_002769		Approved		uc003wak.2	P07477	OTTHUMG00000158923	ENST00000311737.7:c.209A>T	chr7.hg19:g.142459633A>T	ENSP00000308720:p.Gln70Leu	148.0	0.0		137.0	20.0	NM_002769	A1A509|A6NJ71|B2R5I5|Q5NV57|Q7M4N3|Q7M4N4|Q92955|Q9HAN4|Q9HAN5|Q9HAN6|Q9HAN7	Missense_Mutation	SNP	ENST00000311737.7	hg19	CCDS5872.1	.	.	.	.	.	.	.	.	.	.	A	11.91	1.779097	0.31502	.	.	ENSG00000204983	ENST00000486171;ENST00000311737;ENST00000529243;ENST00000492062	D;D;D	0.89343	-2.5;-2.5;-2.5	3.28	3.28	0.37604	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.85682	D	0.000000	T	0.81716	0.4881	N	0.21545	0.675	0.42457	D	0.992772	B;B	0.29612	0.251;0.159	B;B	0.32624	0.149;0.149	T	0.81616	-0.0852	10	0.72032	D	0.01	.	11.1704	0.48569	1.0:0.0:0.0:0.0	.	84;70	E7EQ64;P07477	.;TRY1_HUMAN	L	84;70;70;20	ENSP00000417854:Q84L;ENSP00000308720:Q70L;ENSP00000419912:Q20L	ENSP00000308720:Q70L	Q	+	2	0	PRSS1	142139207	1.000000	0.71417	0.999000	0.59377	0.529000	0.34654	7.162000	0.77515	1.459000	0.47892	0.327000	0.21459	CAG	.	.		0.577	PRSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352538.2		
EPHB6	2051	hgsc.bcm.edu	37	7	142562074	142562074	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:142562074C>T	ENST00000392957.2	+	7	1303	c.516C>T	c.(514-516)tcC>tcT	p.S172S	EPHB6_ENST00000442129.1_Silent_p.S172S|EPHB6_ENST00000411471.2_Intron	NM_004445.3	NP_004436.3	O15197	EPHB6_HUMAN	EPH receptor B6	172	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.|Poly-Ser.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(46)|ovary(2)|pancreas(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	87	Melanoma(164;0.059)					cctcctcctcctcttcttcct	0.622																																					p.S172S		Atlas-SNP	.											.	EPHB6	168	.	0			c.C516T						.						83.0	98.0	93.0					7																	142562074		2200	4299	6499	SO:0001819	synonymous_variant	2051	exon7			CTCCTCCTCTTCT	D83492	CCDS5873.2, CCDS75672.1	7q33-q35	2013-02-11	2004-10-28		ENSG00000106123	ENSG00000106123		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3396	protein-coding gene	gene with protein product		602757	"""EphB6"""				Standard	XM_006715881		Approved	HEP	uc011kst.2	O15197	OTTHUMG00000155707	ENST00000392957.2:c.516C>T	chr7.hg19:g.142562074C>T		94.0	0.0		81.0	7.0	NM_004445	A4D2I7|A8CDT5|D3DXD3|Q2TB23|Q2TB24	Silent	SNP	ENST00000392957.2	hg19	CCDS5873.2																																																																																			.	.		0.622	EPHB6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341329.1		
TRPV5	56302	hgsc.bcm.edu	37	7	142609803	142609803	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:142609803C>A	ENST00000265310.1	-	13	1981	c.1633G>T	c.(1633-1635)Gcc>Tcc	p.A545S		NM_019841.4	NP_062815.2	Q9NQA5	TRPV5_HUMAN	transient receptor potential cation channel, subfamily V, member 5	545					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|ion transmembrane transport (GO:0034220)|protein tetramerization (GO:0051262)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(14)|lung(32)|ovary(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	67	Melanoma(164;0.059)					TCGTAGTTGGCAGGTGCATCA	0.493																																					p.A545S		Atlas-SNP	.											.	TRPV5	164	.	0			c.G1633T						.						212.0	177.0	188.0					7																	142609803		2203	4300	6503	SO:0001583	missense	56302	exon13			AGTTGGCAGGTGC	AJ271207	CCDS5875.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000127412	ENSG00000127412		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	3145	protein-coding gene	gene with protein product		606679	"""epithelial calcium channel 1"""	ECAC1		10944439, 10945469, 16382100	Standard	NM_019841		Approved	CaT2	uc003wby.1	Q9NQA5	OTTHUMG00000157157	ENST00000265310.1:c.1633G>T	chr7.hg19:g.142609803C>A	ENSP00000265310:p.Ala545Ser	208.0	0.0		177.0	105.0	NM_019841	A4D2H7|E9PBZ6|Q8N4C1|Q8NDW5|Q8NDX7|Q8NDX8|Q96PM6	Missense_Mutation	SNP	ENST00000265310.1	hg19	CCDS5875.1	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366477	0.61513	.	.	ENSG00000127412	ENST00000265310;ENST00000439304	D;D	0.85171	-1.95;-1.95	5.79	5.79	0.91817	Ion transport (1);	0.059359	0.64402	D	0.000002	D	0.89976	0.6871	M	0.73753	2.245	0.80722	D	1	D	0.76494	0.999	D	0.76575	0.988	D	0.85701	0.1313	10	0.08837	T	0.75	-18.0362	12.6801	0.56916	0.0:0.9249:0.0:0.0751	.	545	Q9NQA5	TRPV5_HUMAN	S	545;490	ENSP00000265310:A545S;ENSP00000406361:A490S	ENSP00000265310:A545S	A	-	1	0	TRPV5	142319925	1.000000	0.71417	0.973000	0.42090	0.130000	0.20726	4.951000	0.63610	2.899000	0.99337	0.655000	0.94253	GCC	.	.		0.493	TRPV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347660.1	NM_019841	
CNTNAP2	26047	hgsc.bcm.edu	37	7	146825821	146825821	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:146825821A>T	ENST00000361727.3	+	7	1492	c.976A>T	c.(976-978)Agc>Tgc	p.S326C		NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	326	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			TGGCAAGCCCAGCTCCAGCAG	0.398										HNSCC(39;0.1)																											p.S326C		Atlas-SNP	.											.	CNTNAP2	392	.	0			c.A976T						.						96.0	99.0	98.0					7																	146825821		2203	4300	6503	SO:0001583	missense	26047	exon7			AAGCCCAGCTCCA	AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.976A>T	chr7.hg19:g.146825821A>T	ENSP00000354778:p.Ser326Cys	172.0	0.0		168.0	40.0	NM_014141	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	ENST00000361727.3	hg19	CCDS5889.1	.	.	.	.	.	.	.	.	.	.	A	14.43	2.534399	0.45073	.	.	ENSG00000174469	ENST00000361727	T	0.79653	-1.29	5.84	5.84	0.93424	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.262784	0.32147	N	0.006501	D	0.85665	0.5749	L	0.56280	1.765	0.80722	D	1	P	0.52170	0.951	P	0.59288	0.855	D	0.86612	0.1873	10	0.62326	D	0.03	.	15.0509	0.71867	1.0:0.0:0.0:0.0	.	326	Q9UHC6	CNTP2_HUMAN	C	326	ENSP00000354778:S326C	ENSP00000354778:S326C	S	+	1	0	CNTNAP2	146456754	0.996000	0.38824	0.998000	0.56505	0.103000	0.19146	3.239000	0.51360	2.243000	0.73865	0.533000	0.62120	AGC	.	.		0.398	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327668.1		
KCNH2	3757	hgsc.bcm.edu	37	7	150643965	150643965	+	Splice_Site	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:150643965C>A	ENST00000262186.5	-	14	3731	c.3330G>T	c.(3328-3330)caG>caT	p.Q1110H	KCNH2_ENST00000330883.4_Splice_Site_p.Q770H|KCNH2_ENST00000392968.2_Splice_Site_p.Q1014H	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	1110					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	TGGAGCTTACCTGAGAAAGCG	0.637																																					p.Q1110H	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.G3330T						.						63.0	54.0	57.0					7																	150643965		2203	4300	6503	SO:0001630	splice_region_variant	3757	exon14			GCTTACCTGAGAA	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.3330+1G>T	chr7.hg19:g.150643965C>A		92.0	0.0		48.0	16.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	hg19	CCDS5910.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.996132|3.996132	0.74703|0.74703	.|.	.|.	ENSG00000055118|ENSG00000055118	ENST00000350328|ENST00000330883;ENST00000392968;ENST00000262186	.|D;D;D	.|0.98777	.|-4.86;-4.92;-5.13	4.89|4.89	4.89|4.89	0.63831|0.63831	.|.	.|0.317543	.|0.27956	.|N	.|0.017165	D|D	0.97707|0.97707	0.9248|0.9248	L|L	0.29908|0.29908	0.895|0.895	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.64830	.|0.989;0.989;0.994	.|P;P;P	.|0.56865	.|0.648;0.648;0.808	D|D	0.97273|0.97273	0.9912|0.9912	5|9	.|.	.|.	.|.	.|.	15.9235|15.9235	0.79592|0.79592	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1014;1110;770	.|C4PFH9;Q12809;Q12809-2	.|.;KCNH2_HUMAN;.	C|H	387|770;1014;1110	.|ENSP00000328531:Q770H;ENSP00000376695:Q1014H;ENSP00000262186:Q1110H	.|.	G|Q	-|-	1|3	0|2	KCNH2|KCNH2	150274898|150274898	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.683000|0.683000	0.39861|0.39861	4.485000|4.485000	0.60279|0.60279	2.426000|2.426000	0.82243|0.82243	0.484000|0.484000	0.47621|0.47621	GGT|CAG	.	.		0.637	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	Missense_Mutation
DNAJB6	10049	hgsc.bcm.edu	37	7	157174947	157174947	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr7:157174947T>C	ENST00000262177.4	+	6	559	c.354T>C	c.(352-354)ccT>ccC	p.P118P	DNAJB6_ENST00000429029.2_Silent_p.P118P|DNAJB6_ENST00000443280.1_Intron|DNAJB6_ENST00000452797.2_Silent_p.P69P	NM_058246.3	NP_490647.1	O75190	DNJB6_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 6	118	Gly/Phe-rich.|Interaction with HSP70.				intermediate filament organization (GO:0045109)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|protein folding (GO:0006457)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	ATPase activator activity (GO:0001671)|chaperone binding (GO:0051087)|heat shock protein binding (GO:0031072)|unfolded protein binding (GO:0051082)			central_nervous_system(1)|lung(1)|ovary(2)|stomach(1)	5	all_neural(206;0.181)	all_epithelial(9;0.000606)|all_hematologic(28;0.00287)|Acute lymphoblastic leukemia(9;0.0647)|Ovarian(593;0.196)	OV - Ovarian serous cystadenocarcinoma(82;0.00399)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		TAGAAGACCCTTTTGAGGACT	0.413																																					p.P118P	Esophageal Squamous(46;195 967 1350 20350 43814)	Atlas-SNP	.											.	DNAJB6	39	.	0			c.T354C						.						77.0	81.0	80.0					7																	157174947		2203	4300	6503	SO:0001819	synonymous_variant	10049	exon6			AGACCCTTTTGAG	AB014888	CCDS5946.1, CCDS47755.1	7q36.3	2014-02-03			ENSG00000105993	ENSG00000105993		"""Heat shock proteins / DNAJ (HSP40)"""	14888	protein-coding gene	gene with protein product		611332	"""limb girdle muscular dystrophy 1D (autosomal dominant)"""	LGMD1D		10319584, 9915854, 22366786	Standard	NM_005494		Approved	MRJ	uc003wnk.3	O75190	OTTHUMG00000157242	ENST00000262177.4:c.354T>C	chr7.hg19:g.157174947T>C		75.0	0.0		55.0	4.0	NM_058246	A4D232|A8K7D8|A8KAG0|B4DN73|E9PCZ2|O95806|Q53EN8|Q59EF2|Q6FIC8|Q75MA2|Q9UIK6	Silent	SNP	ENST00000262177.4	hg19	CCDS5946.1																																																																																			.	.		0.413	DNAJB6-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000348119.2		
XKR5	389610	hgsc.bcm.edu	37	8	6690291	6690291	+	RNA	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:6690291C>T	ENST00000518724.1	-	0	340				GS1-24F4.2_ENST00000500823.2_lincRNA			Q6UX68	XKR5_HUMAN	XK, Kell blood group complex subunit-related family, member 5							integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3			STAD - Stomach adenocarcinoma(24;0.0984)	READ - Rectum adenocarcinoma(644;0.137)|COAD - Colon adenocarcinoma(149;0.166)		GAGCAATGCCCTGGATGCCCG	0.592																																					p.G64R		Atlas-SNP	.											.	XKR5	20	.	0			c.G190A						.						92.0	102.0	99.0					8																	6690291		2079	4210	6289			389610	exon2			AATGCCCTGGATG	AY358489		8p23.1	2006-01-12	2006-01-12		ENSG00000186530	ENSG00000275591			20782	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 5"""				Standard	NM_207411		Approved		uc022aqv.1	Q6UX68	OTTHUMG00000153652		chr8.hg19:g.6690291C>T		100.0	0.0		122.0	21.0	NM_207411	Q5GH74	Missense_Mutation	SNP	ENST00000518724.1	hg19																																																																																				.	.		0.592	XKR5-001	KNOWN	basic	processed_transcript	processed_transcript	OTTHUMT00000331969.2	NM_207411	
MTMR9	66036	hgsc.bcm.edu	37	8	11177226	11177226	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:11177226G>A	ENST00000221086.3	+	9	1838	c.1365G>A	c.(1363-1365)atG>atA	p.M455I	AF131216.6_ENST00000498997.2_RNA|MTMR9_ENST00000526292.1_Missense_Mutation_p.M370I	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	455	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.					cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		AGAAGACGATGTCTTTGTGGT	0.428																																					p.M455I		Atlas-SNP	.											.	MTMR9	58	.	0			c.G1365A						.						137.0	126.0	130.0					8																	11177226		2203	4300	6503	SO:0001583	missense	66036	exon9			GACGATGTCTTTG	AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1365G>A	chr8.hg19:g.11177226G>A	ENSP00000221086:p.Met455Ile	79.0	0.0		83.0	15.0	NM_015458	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	ENST00000221086.3	hg19	CCDS5979.1	.	.	.	.	.	.	.	.	.	.	G	12.57	1.978543	0.34942	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.89552	-2.53;-2.53	4.43	4.43	0.53597	Myotubularin phosphatase domain (1);	0.205047	0.56097	D	0.000037	T	0.74711	0.3752	N	0.02539	-0.55	0.46113	D	0.998874	B	0.06786	0.001	B	0.01281	0.0	T	0.69800	-0.5047	10	0.23891	T;T	0.37;0.37	.	16.5541	0.84481	0.0:0.0:1.0:0.0	.	455	Q96QG7	MTMR9_HUMAN	I	455;370	ENSP00000221086:M455I;ENSP00000433239:M370I	ENSP00000221086:M455I;ENSP00000221086:M455I	M	+	3	0	MTMR9	11214636	1.000000	0.71417	1.000000	0.80357	0.695000	0.40330	6.197000	0.72100	2.441000	0.82636	0.563000	0.77884	ATG	.	.		0.428	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207307.2	NM_015458	
ATP6V1B2	526	hgsc.bcm.edu	37	8	20068078	20068078	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:20068078A>T	ENST00000276390.2	+	5	425		c.e5-1			NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	ACTGATTTCTAGGTCGGGTAT	0.388																																					.	Pancreas(119;1230 1726 3901 4036 31644)	Atlas-SNP	.											.	ATP6V1B2	34	.	0			c.386-2A>T						.						160.0	156.0	157.0					8																	20068078		2203	4300	6503	SO:0001630	splice_region_variant	526	exon5			ATTTCTAGGTCGG	L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.386-1A>T	chr8.hg19:g.20068078A>T		144.0	0.0		165.0	36.0	NM_001693	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Splice_Site	SNP	ENST00000276390.2	hg19	CCDS6014.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.979219	0.74360	.	.	ENSG00000147416	ENST00000276390;ENST00000542368;ENST00000519667	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4514	0.61174	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP6V1B2	20112358	1.000000	0.71417	0.966000	0.40874	0.757000	0.42996	7.342000	0.79310	2.252000	0.74401	0.519000	0.50382	.	.	.		0.388	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253732.1	NM_001693	Intron
PRKDC	5591	hgsc.bcm.edu	37	8	48746959	48746959	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:48746959T>A	ENST00000523565.1	-	59	8007		c.e59-2		PRKDC_ENST00000314191.2_Splice_Site|PRKDC_ENST00000338368.3_Splice_Site			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TTCTTCCATCTGTGACATGCA	0.592								Non-homologous end-joining																													.	Esophageal Squamous(79;1091 1253 12329 31680 40677)	Atlas-SNP	.											.	PRKDC	394	.	0			c.7951-2A>T						.						73.0	81.0	78.0					8																	48746959		2179	4277	6456	SO:0001630	splice_region_variant	5591	exon60			TCCATCTGTGACA		CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.5502-2A>T	chr8.hg19:g.48746959T>A		53.0	0.0		61.0	16.0	NM_001081640	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Splice_Site	SNP	ENST00000523565.1	hg19		.	.	.	.	.	.	.	.	.	.	T	16.50	3.140375	0.56936	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	.	.	.	4.82	4.82	0.62117	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.4107	0.67113	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRKDC	48909512	1.000000	0.71417	0.994000	0.49952	0.493000	0.33554	6.158000	0.71851	1.800000	0.52685	0.460000	0.39030	.	.	.		0.592	PRKDC-002	KNOWN	basic	processed_transcript	protein_coding	OTTHUMT00000377896.1	NM_001081640	Intron
OPRK1	4986	hgsc.bcm.edu	37	8	54142248	54142248	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:54142248A>T	ENST00000265572.3	-	4	1049	c.752T>A	c.(751-753)cTg>cAg	p.L251Q	OPRK1_ENST00000524278.1_Missense_Mutation_p.L162Q|OPRK1_ENST00000520287.1_Missense_Mutation_p.L251Q|RP11-162D9.3_ENST00000524425.1_RNA	NM_000912.3	NP_000903.2	P41145	OPRK_HUMAN	opioid receptor, kappa 1	251					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-inhibiting opioid receptor signaling pathway (GO:0031635)|behavior (GO:0007610)|defense response to virus (GO:0051607)|immune response (GO:0006955)|locomotory behavior (GO:0007626)|opioid receptor signaling pathway (GO:0038003)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|regulation of saliva secretion (GO:0046877)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dynorphin receptor activity (GO:0038048)|opioid receptor activity (GO:0004985)			NS(2)|breast(3)|endometrium(3)|kidney(12)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	43		all_epithelial(80;0.066)|Lung NSC(129;0.0804)|all_lung(136;0.136)			Alvimopan(DB06274)|Amitriptyline(DB00321)|Buprenorphine(DB00921)|Butorphanol(DB00611)|Codeine(DB00318)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Dezocine(DB01209)|Fentanyl(DB00813)|Heroin(DB01452)|Hydromorphone(DB00327)|Ketamine(DB01221)|Ketobemidone(DB06738)|Levorphanol(DB00854)|Loperamide(DB00836)|Menthol(DB00825)|Methylnaltrexone(DB06800)|Mianserin(DB06148)|Mirtazapine(DB00370)|Morphine(DB00295)|Nalbuphine(DB00844)|Naloxone(DB01183)|Naltrexone(DB00704)|Oxycodone(DB00497)|Pentazocine(DB00652)|Pethidine(DB00454)|Progesterone(DB00396)|Remifentanil(DB00899)|Sufentanil(DB00708)|Tapentadol(DB06204)|Tramadol(DB00193)	CTTGAGACGCAGGATCATCAG	0.552																																					p.L251Q		Atlas-SNP	.											.	OPRK1	90	.	0			c.T752A						.						87.0	93.0	91.0					8																	54142248		2203	4300	6503	SO:0001583	missense	4986	exon4			AGACGCAGGATCA		CCDS6152.1, CCDS64895.1	8q11.2	2014-05-21			ENSG00000082556	ENSG00000082556		"""GPCR / Class A : Opioid receptors"""	8154	protein-coding gene	gene with protein product		165196				8188308	Standard	XM_005251252		Approved	KOR, OPRK	uc003xri.1	P41145	OTTHUMG00000164276	ENST00000265572.3:c.752T>A	chr8.hg19:g.54142248A>T	ENSP00000265572:p.Leu251Gln	165.0	0.0		203.0	30.0	NM_000912	E5RHC9|Q499G4	Missense_Mutation	SNP	ENST00000265572.3	hg19	CCDS6152.1	.	.	.	.	.	.	.	.	.	.	A	18.50	3.637284	0.67130	.	.	ENSG00000082556	ENST00000265572;ENST00000524278;ENST00000520287;ENST00000396798	T;T;T	0.38560	1.13;1.13;1.13	5.64	5.64	0.86602	GPCR, rhodopsin-like superfamily (1);	0.132704	0.52532	D	0.000074	T	0.59252	0.2180	L	0.55213	1.73	0.80722	D	1	D	0.60575	0.988	D	0.69654	0.965	T	0.58375	-0.7647	10	0.45353	T	0.12	.	15.8659	0.79063	1.0:0.0:0.0:0.0	.	251	P41145	OPRK_HUMAN	Q	251;162;251;237	ENSP00000265572:L251Q;ENSP00000430923:L162Q;ENSP00000429706:L251Q	ENSP00000265572:L251Q	L	-	2	0	OPRK1	54304801	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	7.369000	0.79578	2.152000	0.67230	0.528000	0.53228	CTG	.	.		0.552	OPRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378048.1		
CYP7B1	9420	hgsc.bcm.edu	37	8	65528610	65528610	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:65528610T>A	ENST00000310193.3	-	3	661	c.488A>T	c.(487-489)cAa>cTa	p.Q163L	CYP7B1_ENST00000523954.1_5'Flank	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	163					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TTCAAAAACTTGTTTTAGATT	0.368																																					p.Q163L		Atlas-SNP	.											.	CYP7B1	94	.	0			c.A488T						.						66.0	65.0	65.0					8																	65528610		2203	4300	6503	SO:0001583	missense	9420	exon3			AAAACTTGTTTTA	AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.488A>T	chr8.hg19:g.65528610T>A	ENSP00000310721:p.Gln163Leu	75.0	0.0		90.0	20.0	NM_004820	B2RN07|Q9UNF5	Missense_Mutation	SNP	ENST00000310193.3	hg19	CCDS6180.1	.	.	.	.	.	.	.	.	.	.	T	0.009	-1.808131	0.00606	.	.	ENSG00000172817	ENST00000310193	T	0.68903	-0.36	5.17	4.01	0.46588	.	0.685395	0.15989	N	0.234924	T	0.48750	0.1517	N	0.25485	0.75	0.09310	N	1	B	0.06786	0.001	B	0.14023	0.01	T	0.21930	-1.0231	9	.	.	.	-7.7898	7.1398	0.25550	0.0:0.2249:0.0:0.7751	.	163	O75881	CP7B1_HUMAN	L	163	ENSP00000310721:Q163L	.	Q	-	2	0	CYP7B1	65691164	0.031000	0.19500	0.050000	0.19076	0.458000	0.32498	1.639000	0.37176	2.069000	0.61940	0.533000	0.62120	CAA	.	.		0.368	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378550.1		
ARFGEF1	10565	hgsc.bcm.edu	37	8	68211585	68211585	+	Silent	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:68211585A>C	ENST00000262215.3	-	4	707	c.318T>G	c.(316-318)ctT>ctG	p.L106L		NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	106	DCB; DCB:DCB domain and DCB:HUS domain interaction.				endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CATAAGCAATAAGTTTCTAAA	0.303																																					p.L106L		Atlas-SNP	.											.	ARFGEF1	196	.	0			c.T318G						.						57.0	56.0	56.0					8																	68211585		2203	4300	6503	SO:0001819	synonymous_variant	10565	exon4			AGCAATAAGTTTC	AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.318T>G	chr8.hg19:g.68211585A>C		135.0	0.0		157.0	90.0	NM_006421	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	ENST00000262215.3	hg19	CCDS6199.1																																																																																			.	.		0.303	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379441.4	NM_006421	
ZFHX4	79776	hgsc.bcm.edu	37	8	77617787	77617787	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:77617787A>C	ENST00000521891.2	+	2	1912	c.1464A>C	c.(1462-1464)ttA>ttC	p.L488F	ZFHX4_ENST00000517683.1_Intron|ZFHX4_ENST00000050961.6_Missense_Mutation_p.L488F|ZFHX4_ENST00000518282.1_Missense_Mutation_p.L488F|ZFHX4_ENST00000455469.2_Missense_Mutation_p.L488F	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	488					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AGGAAGTATTAGGTGAACTCA	0.423										HNSCC(33;0.089)																											p.L488F		Atlas-SNP	.											.	ZFHX4	878	.	0			c.A1464C						.						59.0	60.0	59.0					8																	77617787		2000	4167	6167	SO:0001583	missense	79776	exon2			AGTATTAGGTGAA		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.1464A>C	chr8.hg19:g.77617787A>C	ENSP00000430497:p.Leu488Phe	142.0	0.0		233.0	39.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	A	13.10	2.135719	0.37728	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.51071	0.72;0.78;0.74;0.74	5.41	5.41	0.78517	.	0.000000	0.34314	U	0.004073	T	0.46983	0.1421	N	0.19112	0.55	0.53688	D	0.999974	D;D;D;P	0.59767	0.976;0.986;0.986;0.868	P;P;P;B	0.54174	0.559;0.656;0.744;0.397	T	0.49224	-0.8962	10	0.51188	T	0.08	.	15.612	0.76733	1.0:0.0:0.0:0.0	.	488;488;488;488	Q86UP3;Q86UP3-4;G3V138;Q86UP3-3	ZFHX4_HUMAN;.;.;.	F	488	ENSP00000430497:L488F;ENSP00000399605:L488F;ENSP00000050961:L488F;ENSP00000430848:L488F	ENSP00000050961:L488F	L	+	3	2	ZFHX4	77780342	1.000000	0.71417	0.999000	0.59377	0.975000	0.68041	4.553000	0.60753	2.281000	0.76405	0.533000	0.62120	TTA	.	.		0.423	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
ZFHX4	79776	hgsc.bcm.edu	37	8	77766437	77766437	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:77766437C>T	ENST00000521891.2	+	10	7728	c.7280C>T	c.(7279-7281)cCa>cTa	p.P2427L	ZFHX4_ENST00000050961.6_Missense_Mutation_p.P2382L|ZFHX4_ENST00000518282.1_Missense_Mutation_p.P2401L|ZFHX4_ENST00000455469.2_Missense_Mutation_p.P2382L	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2382	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			GGCACCAAACCAGCCCTGCCA	0.552										HNSCC(33;0.089)																											p.P2427L		Atlas-SNP	.											.	ZFHX4	878	.	0			c.C7280T						.						46.0	76.0	66.0					8																	77766437		2036	4154	6190	SO:0001583	missense	79776	exon10			CCAAACCAGCCCT		CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.7280C>T	chr8.hg19:g.77766437C>T	ENSP00000430497:p.Pro2427Leu	132.0	0.0		157.0	32.0	NM_024721	G3V138|Q18PS0|Q6ZN20	Missense_Mutation	SNP	ENST00000521891.2	hg19	CCDS47878.2	.	.	.	.	.	.	.	.	.	.	C	3.378	-0.126986	0.06795	.	.	ENSG00000091656	ENST00000521891;ENST00000399468;ENST00000455469;ENST00000050961;ENST00000518282	T;T;T;T	0.50813	0.73;0.79;0.76;0.75	5.23	4.35	0.52113	.	0.353337	0.20228	U	0.096546	T	0.32224	0.0822	L	0.36672	1.1	0.32514	N	0.537226	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.001	T	0.32955	-0.9887	10	0.08179	T	0.78	.	8.9085	0.35539	0.1499:0.7763:0.0:0.0739	.	2382;2382;2427	Q86UP3;Q86UP3-4;G3V138	ZFHX4_HUMAN;.;.	L	2427;2411;2382;2382;2401	ENSP00000430497:P2427L;ENSP00000399605:P2382L;ENSP00000050961:P2382L;ENSP00000430848:P2401L	ENSP00000050961:P2382L	P	+	2	0	ZFHX4	77928992	0.995000	0.38212	0.538000	0.28064	0.046000	0.14306	3.825000	0.55730	1.427000	0.47276	-0.175000	0.13238	CCA	.	.		0.552	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000379197.2	NM_024721	
CDH17	1015	hgsc.bcm.edu	37	8	95174341	95174341	+	Silent	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:95174341A>G	ENST00000027335.3	-	11	1456	c.1332T>C	c.(1330-1332)gaT>gaC	p.D444D	CDH17_ENST00000450165.2_Silent_p.D444D|CDH17_ENST00000441892.2_Silent_p.D230D	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TGGGGATCTGATCATTGATAT	0.318																																					p.D444D		Atlas-SNP	.											.	CDH17	119	.	0			c.T1332C						.						105.0	103.0	103.0					8																	95174341		2203	4300	6503	SO:0001819	synonymous_variant	1015	exon11			GATCTGATCATTG	X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1332T>C	chr8.hg19:g.95174341A>G		213.0	0.0		353.0	257.0	NM_004063	Q15336|Q2M2E0	Silent	SNP	ENST00000027335.3	hg19	CCDS6260.1																																																																																			.	.		0.318	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378560.1	NM_004063	
KIAA1429	25962	hgsc.bcm.edu	37	8	95539091	95539091	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:95539091T>A	ENST00000297591.5	-	8	1456	c.1381A>T	c.(1381-1383)Aaa>Taa	p.K461*	KIAA1429_ENST00000437199.1_Nonsense_Mutation_p.K461*|KIAA1429_ENST00000421249.2_Nonsense_Mutation_p.K461*	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	461					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GACACTAATTTGGTCCCAGCT	0.463																																					p.K461X		Atlas-SNP	.											.	KIAA1429	176	.	0			c.A1381T						.						113.0	108.0	109.0					8																	95539091		2203	4300	6503	SO:0001587	stop_gained	25962	exon8			CTAATTTGGTCCC	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.1381A>T	chr8.hg19:g.95539091T>A	ENSP00000297591:p.Lys461*	70.0	0.0		113.0	49.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Nonsense_Mutation	SNP	ENST00000297591.5	hg19	CCDS34923.1	.	.	.	.	.	.	.	.	.	.	T	39	7.512537	0.98329	.	.	ENSG00000164944	ENST00000297591;ENST00000437199;ENST00000421249	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.7314	16.2285	0.82315	0.0:0.0:0.0:1.0	.	.	.	.	X	461	.	ENSP00000297591:K461X	K	-	1	0	KIAA1429	95608267	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.235000	0.73313	0.460000	0.39030	AAA	.	.		0.463	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
CSMD3	114788	hgsc.bcm.edu	37	8	113599330	113599330	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:113599330T>A	ENST00000297405.5	-	23	4094	c.3850A>T	c.(3850-3852)Aga>Tga	p.R1284*	CSMD3_ENST00000352409.3_Nonsense_Mutation_p.R1284*|CSMD3_ENST00000343508.3_Nonsense_Mutation_p.R1244*|CSMD3_ENST00000455883.2_Nonsense_Mutation_p.R1180*	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1284	CUB 7. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAAATGTTCTGGCTGAAATA	0.318										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.R1284X		Atlas-SNP	.											.	CSMD3	2325	.	0			c.A3850T						.						126.0	115.0	119.0					8																	113599330		2203	4299	6502	SO:0001587	stop_gained	114788	exon23			ATGTTCTGGCTGA	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.3850A>T	chr8.hg19:g.113599330T>A	ENSP00000297405:p.Arg1284*	99.0	0.0		157.0	30.0	NM_198123	Q96PZ3	Nonsense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	T	44	11.122374	0.99518	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	.	.	.	4.08	4.08	0.47627	.	0.167593	0.46145	D	0.000315	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	13.4972	0.61432	0.0:0.0:0.0:1.0	.	.	.	.	X	1244;1284;624;1180;1284	.	ENSP00000297405:R1284X	R	-	1	2	CSMD3	113668506	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.061000	0.41403	1.839000	0.53478	0.482000	0.46254	AGA	.	.		0.318	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
FER1L6	654463	hgsc.bcm.edu	37	8	125103790	125103790	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:125103790T>C	ENST00000522917.1	+	34	4724	c.4518T>C	c.(4516-4518)ttT>ttC	p.F1506F	FER1L6-AS2_ENST00000520031.1_RNA|FER1L6_ENST00000399018.1_Silent_p.F1506F	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1506						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			ACCAAGTCTTTTCTGGAAAAA	0.428																																					p.F1506F		Atlas-SNP	.											.	FER1L6	268	.	0			c.T4518C						.						111.0	103.0	106.0					8																	125103790		1859	4087	5946	SO:0001819	synonymous_variant	654463	exon34			AGTCTTTTCTGGA	AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.4518T>C	chr8.hg19:g.125103790T>C		150.0	0.0		196.0	101.0	NM_001039112		Silent	SNP	ENST00000522917.1	hg19	CCDS43767.1																																																																																			.	.		0.428	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381400.1	NM_001039112	
TG	7038	hgsc.bcm.edu	37	8	133899402	133899402	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:133899402A>T	ENST00000220616.4	+	9	1825	c.1785A>T	c.(1783-1785)ttA>ttT	p.L595F	TG_ENST00000377869.1_Missense_Mutation_p.L595F	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	595					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		CAAGAGATTTAGGTGATGTGA	0.473																																					p.L595F		Atlas-SNP	.											.	TG	416	.	0			c.A1785T						.						132.0	122.0	125.0					8																	133899402		2203	4300	6503	SO:0001583	missense	7038	exon9			AGATTTAGGTGAT	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.1785A>T	chr8.hg19:g.133899402A>T	ENSP00000220616:p.Leu595Phe	173.0	0.0		239.0	36.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	A	12.99	2.104002	0.37145	.	.	ENSG00000042832	ENST00000377869;ENST00000220616;ENST00000535932	T;T	0.67865	-0.29;-0.29	5.03	0.0604	0.14336	.	0.132698	0.32244	N	0.006375	T	0.79240	0.4412	M	0.89414	3.03	0.29969	N	0.818738	D	0.58268	0.982	P	0.62740	0.906	T	0.75619	-0.3255	10	0.87932	D	0	.	8.7505	0.34613	0.5974:0.0:0.4026:0.0	.	595	P01266	THYG_HUMAN	F	595	ENSP00000367100:L595F;ENSP00000220616:L595F	ENSP00000220616:L595F	L	+	3	2	TG	133968584	0.987000	0.35691	0.859000	0.33776	0.209000	0.24338	0.495000	0.22483	-0.122000	0.11766	0.533000	0.62120	TTA	.	.		0.473	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
TG	7038	hgsc.bcm.edu	37	8	133913655	133913655	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:133913655G>T	ENST00000220616.4	+	16	3531	c.3491G>T	c.(3490-3492)gGc>gTc	p.G1164V	TG_ENST00000377869.1_Missense_Mutation_p.G1164V	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1164	Thyroglobulin type-1 10. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GTCAGCCCAGGCTATGTCCCA	0.607																																					p.G1164V		Atlas-SNP	.											.	TG	416	.	0			c.G3491T						.						74.0	74.0	74.0					8																	133913655		2203	4300	6503	SO:0001583	missense	7038	exon16			GCCCAGGCTATGT	AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3491G>T	chr8.hg19:g.133913655G>T	ENSP00000220616:p.Gly1164Val	121.0	0.0		163.0	28.0	NM_003235	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	ENST00000220616.4	hg19	CCDS34944.1	.	.	.	.	.	.	.	.	.	.	G	11.34	1.609296	0.28623	.	.	ENSG00000042832	ENST00000377869;ENST00000220616	T;T	0.61742	0.08;0.08	5.12	5.12	0.69794	Thyroglobulin type-1 (4);	0.436747	0.21424	N	0.074773	T	0.64193	0.2576	L	0.29908	0.895	0.50171	D	0.999858	D	0.89917	1.0	D	0.81914	0.995	T	0.66452	-0.5920	10	0.72032	D	0.01	.	11.8975	0.52663	0.0:0.176:0.824:0.0	.	1164	P01266	THYG_HUMAN	V	1164	ENSP00000367100:G1164V;ENSP00000220616:G1164V	ENSP00000220616:G1164V	G	+	2	0	TG	133982837	1.000000	0.71417	0.798000	0.32154	0.015000	0.08874	4.083000	0.57643	2.377000	0.81083	0.655000	0.94253	GGC	.	.		0.607	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379606.1	NM_003235	
CYP11B1	1584	hgsc.bcm.edu	37	8	143961039	143961039	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:143961039A>T	ENST00000292427.4	-	1	223	c.191T>A	c.(190-192)cTg>cAg	p.L64Q	CYP11B1_ENST00000517471.1_Missense_Mutation_p.L64Q|CYP11B1_ENST00000377675.3_Missense_Mutation_p.L64Q	NM_000497.3	NP_000488.3	P15538	C11B1_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 1	64					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|glucocorticoid biosynthetic process (GO:0006704)|glucose homeostasis (GO:0042593)|immune response (GO:0006955)|mineralocorticoid biosynthetic process (GO:0006705)|regulation of blood pressure (GO:0008217)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|lung(36)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	67	all_cancers(97;4.74e-11)|all_epithelial(106;2.06e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Cimetidine(DB00501)|Clotrimazole(DB00257)|Etomidate(DB00292)|Fluconazole(DB00196)|Hydrocortisone(DB00741)|Ketoconazole(DB01026)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Miconazole(DB01110)|Mitotane(DB00648)|Phenytoin(DB00252)|Spironolactone(DB00421)	TTCCAGGTGCAGGTCCTCATA	0.622									Familial Hyperaldosteronism type I																												p.L64Q		Atlas-SNP	.											.	CYP11B1	128	.	0			c.T191A						.						81.0	73.0	75.0					8																	143961039		2203	4300	6503	SO:0001583	missense	1584	exon1	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	AGGTGCAGGTCCT	D16153	CCDS6392.1, CCDS34953.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000160882	ENSG00000160882	1.14.15.4	"""Cytochrome P450s"""	2591	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	610613	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 1"""	CYP11B		1303253	Standard	XM_005250807		Approved	P450C11, FHI, CPN1	uc003yxi.3	P15538	OTTHUMG00000164637	ENST00000292427.4:c.191T>A	chr8.hg19:g.143961039A>T	ENSP00000292427:p.Leu64Gln	137.0	0.0		187.0	47.0	NM_000497	Q14095|Q4VAQ8|Q4VAQ9|Q9UML2	Missense_Mutation	SNP	ENST00000292427.4	hg19	CCDS6392.1	.	.	.	.	.	.	.	.	.	.	A	13.43	2.234987	0.39498	.	.	ENSG00000160882	ENST00000292427;ENST00000517471;ENST00000377675	T;T;T	0.80123	-0.53;-0.53;-1.34	2.96	1.69	0.24217	.	1.218420	0.06447	N	0.727002	D	0.87505	0.6194	M	0.75615	2.305	0.09310	N	1	D;D;D	0.64830	0.986;0.989;0.994	D;D;D	0.71870	0.938;0.975;0.954	T	0.69057	-0.5246	10	0.41790	T	0.15	.	6.267	0.20932	0.7428:0.2572:0.0:0.0	.	64;64;64	Q4VAR0;Q4VAQ9;P15538	.;.;C11B1_HUMAN	Q	64	ENSP00000292427:L64Q;ENSP00000428043:L64Q;ENSP00000366903:L64Q	ENSP00000292427:L64Q	L	-	2	0	CYP11B1	143958041	0.174000	0.23070	0.002000	0.10522	0.695000	0.40330	5.531000	0.67148	0.273000	0.22049	0.254000	0.18369	CTG	.	.		0.622	CYP11B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379475.2		
MFSD3	113655	hgsc.bcm.edu	37	8	145738779	145738779	+	IGR	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr8:145738779C>T	ENST00000301327.4	+	0	1548				RECQL4_ENST00000428558.2_Silent_p.Q762Q|CTD-2517M22.17_ENST00000580385.1_RNA|RECQL4_ENST00000532237.1_5'UTR	NM_138431.1	NP_612440.1	Q96ES6	MFSD3_HUMAN	major facilitator superfamily domain containing 3						transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)	8	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCAACTGGCCCTGCATGAAGG	0.682																																					p.Q762Q		Atlas-SNP	.											.	RECQL4	75	.	0			c.G2286A						.						16.0	21.0	20.0					8																	145738779		2090	4203	6293	SO:0001628	intergenic_variant	9401	exon14			CTGGCCCTGCATG		CCDS6431.1	8q24.3	2005-11-17			ENSG00000167700	ENSG00000167700			25157	protein-coding gene	gene with protein product							Standard	NM_138431		Approved		uc003zdi.1	Q96ES6	OTTHUMG00000165177		chr8.hg19:g.145738779C>T		106.0	0.0		121.0	12.0	NM_004260		Silent	SNP	ENST00000301327.4	hg19	CCDS6431.1																																																																																			.	.		0.682	MFSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382478.2	NM_138431	
DOCK8	81704	hgsc.bcm.edu	37	9	336700	336700	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:336700T>A	ENST00000453981.1	+	12	1516	c.1404T>A	c.(1402-1404)gtT>gtA	p.V468V	DOCK8_ENST00000432829.2_Silent_p.V400V|DOCK8_ENST00000469391.1_Silent_p.V400V			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	468					blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CTCTGAGCGTTAGCAGCTTTT	0.488																																					p.V468V		Atlas-SNP	.											.	DOCK8	401	.	0			c.T1404A						.						96.0	92.0	93.0					9																	336700		2203	4300	6503	SO:0001819	synonymous_variant	81704	exon12			GAGCGTTAGCAGC	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.1404T>A	chr9.hg19:g.336700T>A		109.0	0.0		99.0	32.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Silent	SNP	ENST00000453981.1	hg19	CCDS6440.2																																																																																			.	.		0.488	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
GLDC	2731	hgsc.bcm.edu	37	9	6592892	6592892	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:6592892C>A	ENST00000321612.6	-	10	1510	c.1360G>T	c.(1360-1362)Gct>Tct	p.A454S		NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	454					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	TGCCGCTGAGCGGCCCTGCCC	0.443																																					p.A454S		Atlas-SNP	.											.	GLDC	118	.	0			c.G1360T						.						68.0	67.0	67.0					9																	6592892		2203	4298	6501	SO:0001583	missense	2731	exon10			GCTGAGCGGCCCT	D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.1360G>T	chr9.hg19:g.6592892C>A	ENSP00000370737:p.Ala454Ser	341.0	1.0		303.0	173.0	NM_000170	Q2M2F8	Missense_Mutation	SNP	ENST00000321612.6	hg19	CCDS34987.1	.	.	.	.	.	.	.	.	.	.	C	9.251	1.040684	0.19669	.	.	ENSG00000178445	ENST00000321612	D	0.95853	-3.83	5.74	3.86	0.44501	Glycine cleavage system P-protein, N-terminal (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.199645	0.53938	D	0.000056	D	0.92476	0.7611	L	0.58810	1.83	0.46927	D	0.999254	B	0.20550	0.046	B	0.21917	0.037	D	0.86649	0.1897	10	0.11794	T	0.64	-5.6063	11.7802	0.52010	0.0:0.8542:0.0:0.1458	.	454	P23378	GCSP_HUMAN	S	454	ENSP00000370737:A454S	ENSP00000370737:A454S	A	-	1	0	GLDC	6582892	0.016000	0.18221	0.654000	0.29608	0.941000	0.58515	0.785000	0.26830	0.738000	0.32606	0.563000	0.77884	GCT	.	.		0.443	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051674.2	NM_000170	
PTPRD	5789	hgsc.bcm.edu	37	9	8341889	8341889	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:8341889T>A	ENST00000381196.4	-	37	5294	c.4751A>T	c.(4750-4752)cAt>cTt	p.H1584L	PTPRD_ENST00000358503.5_Missense_Mutation_p.H1562L|PTPRD_ENST00000355233.5_Missense_Mutation_p.H1178L|PTPRD_ENST00000486161.1_Missense_Mutation_p.H1177L|PTPRD_ENST00000360074.4_Missense_Mutation_p.H1571L|PTPRD_ENST00000540109.1_Missense_Mutation_p.H1584L|PTPRD_ENST00000397617.3_Missense_Mutation_p.H1177L|PTPRD_ENST00000356435.5_Missense_Mutation_p.H1584L|PTPRD_ENST00000397611.3_Missense_Mutation_p.H1174L|PTPRD_ENST00000397606.3_Missense_Mutation_p.H1177L|PTPRD_ENST00000537002.1_Missense_Mutation_p.H1174L	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	1584	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		TAAAGTTACATGGCCATAAAT	0.398										TSP Lung(15;0.13)																											p.H1584L		Atlas-SNP	.											.	PTPRD	1348	.	0			c.A4751T						.						162.0	160.0	161.0					9																	8341889		2203	4300	6503	SO:0001583	missense	5789	exon40			GTTACATGGCCAT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.4751A>T	chr9.hg19:g.8341889T>A	ENSP00000370593:p.His1584Leu	109.0	0.0		68.0	14.0	NM_002839	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	hg19	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.310861	0.81358	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.26957	1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7;1.7	6.07	6.07	0.98685	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	T	0.31420	0.0796	N	0.08118	0	0.80722	D	1	D;D;D;D;P;D;D;D;P	0.89917	0.99;0.99;0.99;0.99;0.862;0.988;0.976;1.0;0.948	P;P;P;P;B;P;P;D;P	0.91635	0.743;0.743;0.743;0.743;0.386;0.626;0.679;0.999;0.737	T	0.32375	-0.9909	9	.	.	.	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	1177;1168;1177;1178;1174;1174;1571;1584;1584	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	L	1584;1584;1571;1562;1178;1177;1174;1174;1055;1584;1177;1177	ENSP00000370593:H1584L;ENSP00000348812:H1584L;ENSP00000353187:H1571L;ENSP00000351293:H1562L;ENSP00000347373:H1178L;ENSP00000380741:H1177L;ENSP00000380735:H1174L;ENSP00000440515:H1174L;ENSP00000438164:H1584L;ENSP00000417093:H1177L;ENSP00000380731:H1177L	.	H	-	2	0	PTPRD	8331889	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.997000	0.88414	2.326000	0.78906	0.533000	0.62120	CAT	.	.		0.398	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
PTPRD	5789	hgsc.bcm.edu	37	9	8636718	8636718	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:8636718A>C	ENST00000381196.4	-	10	734	c.191T>G	c.(190-192)gTc>gGc	p.V64G	PTPRD_ENST00000360074.4_Missense_Mutation_p.V64G|PTPRD_ENST00000358503.5_Missense_Mutation_p.V64G|PTPRD_ENST00000355233.5_Missense_Mutation_p.V64G|PTPRD_ENST00000486161.1_Missense_Mutation_p.V64G|PTPRD_ENST00000463477.1_Missense_Mutation_p.V64G|PTPRD_ENST00000540109.1_Missense_Mutation_p.V64G|PTPRD_ENST00000397617.3_Missense_Mutation_p.V64G|PTPRD_ENST00000356435.5_Missense_Mutation_p.V64G|PTPRD_ENST00000397611.3_Missense_Mutation_p.V64G|PTPRD_ENST00000397606.3_Missense_Mutation_p.V64G|PTPRD_ENST00000537002.1_Missense_Mutation_p.V64G	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	64	Ig-like C2-type 1.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		CTGATTGCTGACTTTCTTTCC	0.443										TSP Lung(15;0.13)																											p.V64G		Atlas-SNP	.											.	PTPRD	1348	.	0			c.T191G						.						141.0	129.0	133.0					9																	8636718		2203	4300	6503	SO:0001583	missense	5789	exon2			TTGCTGACTTTCT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.191T>G	chr9.hg19:g.8636718A>C	ENSP00000370593:p.Val64Gly	147.0	0.0		105.0	6.0	NM_001040712	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	ENST00000381196.4	hg19	CCDS43786.1	.	.	.	.	.	.	.	.	.	.	A	21.9	4.212532	0.79240	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606;ENST00000463477;ENST00000481079	T;T;T;T;T;T;T;T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41;-0.41	5.57	5.57	0.84162	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.78175	0.4242	L	0.54863	1.705	0.80722	D	1	D;D;D;D;D;P;D;D;D;D	0.89917	1.0;0.996;0.999;1.0;1.0;0.942;0.999;0.999;1.0;0.998	D;D;D;D;D;P;D;D;D;D	0.91635	0.999;0.977;0.995;0.997;0.997;0.614;0.995;0.983;0.999;0.985	T	0.77416	-0.2596	9	.	.	.	.	15.7282	0.77780	1.0:0.0:0.0:0.0	.	64;64;64;64;64;64;64;64;64;64	C9J8S8;Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;.;PTPRD_HUMAN	G	64	ENSP00000370593:V64G;ENSP00000348812:V64G;ENSP00000353187:V64G;ENSP00000351293:V64G;ENSP00000347373:V64G;ENSP00000380741:V64G;ENSP00000380735:V64G;ENSP00000440515:V64G;ENSP00000438164:V64G;ENSP00000417093:V64G;ENSP00000380731:V64G;ENSP00000417661:V64G;ENSP00000417890:V64G	.	V	-	2	0	PTPRD	8626718	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.288000	0.96055	2.113000	0.64589	0.455000	0.32223	GTC	.	.		0.443	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
BNC2	54796	hgsc.bcm.edu	37	9	16418994	16418994	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:16418994A>T	ENST00000380672.4	-	7	3350	c.3293T>A	c.(3292-3294)gTa>gAa	p.V1098E	BNC2_ENST00000380667.2_Missense_Mutation_p.V1031E|BNC2_ENST00000545497.1_Missense_Mutation_p.V1003E	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		AGACTAATCTACTGAAGTGAA	0.463																																					p.V1098E		Atlas-SNP	.											.	BNC2	166	.	0			c.T3293A						.						126.0	122.0	123.0					9																	16418994		2203	4300	6503	SO:0001583	missense	54796	exon7			TAATCTACTGAAG	AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.3293T>A	chr9.hg19:g.16418994A>T	ENSP00000370047:p.Val1098Glu	68.0	0.0		67.0	13.0	NM_017637		Missense_Mutation	SNP	ENST00000380672.4	hg19	CCDS6482.2	.	.	.	.	.	.	.	.	.	.	A	13.95	2.390904	0.42410	.	.	ENSG00000173068	ENST00000380672;ENST00000380667;ENST00000545497	T;T;T	0.36157	1.27;1.3;1.29	6.08	6.08	0.98989	.	0.170192	0.51477	D	0.000092	T	0.24431	0.0592	N	0.08118	0	0.80722	D	1	B;B;B	0.25105	0.118;0.072;0.072	B;B;B	0.25291	0.059;0.059;0.059	T	0.08932	-1.0698	10	0.72032	D	0.01	-7.2811	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1003;1098;863	F5H586;Q6ZN30;D3DRJ1	.;BNC2_HUMAN;.	E	1098;1031;1003	ENSP00000370047:V1098E;ENSP00000370042:V1031E;ENSP00000444640:V1003E	ENSP00000370042:V1031E	V	-	2	0	BNC2	16408994	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.964000	0.70379	2.333000	0.79357	0.482000	0.46254	GTA	.	.		0.463	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000216901.5	NM_017637	
IFNA7	3444	hgsc.bcm.edu	37	9	21202098	21202098	+	Missense_Mutation	SNP	C	C	T	rs112551811		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:21202098C>T	ENST00000239347.3	-	1	106	c.67G>A	c.(67-69)Ggc>Agc	p.G23S		NM_021057.2	NP_066401.2	P01567	IFNA7_HUMAN	interferon, alpha 7	23					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(6)	12				GBM - Glioblastoma multiforme(5;4.75e-197)|Lung(24;1.26e-23)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)		AGATCACAGCCCAGAGAGCAG	0.507																																					p.G23S		Atlas-SNP	.											.	IFNA7	24	.	0			c.G67A						.						87.0	86.0	86.0					9																	21202098		2203	4300	6503	SO:0001583	missense	3444	exon1			CACAGCCCAGAGA		CCDS34995.1	9p22	2010-12-10			ENSG00000214042	ENSG00000214042		"""Interferons"""	5428	protein-coding gene	gene with protein product		147567				1385305	Standard	NM_021057		Approved	IFNA-J, IFN-alphaJ	uc003zop.1	P01567	OTTHUMG00000019662	ENST00000239347.3:c.67G>A	chr9.hg19:g.21202098C>T	ENSP00000239347:p.Gly23Ser	134.0	0.0		144.0	33.0	NM_021057	Q14607|Q5VV14	Missense_Mutation	SNP	ENST00000239347.3	hg19	CCDS34995.1	.	.	.	.	.	.	.	.	.	.	C	14.42	2.531452	0.45073	.	.	ENSG00000214042	ENST00000239347	T	0.03035	4.07	3.56	1.61	0.23674	Four-helical cytokine-like, core (1);	0.590041	0.16895	N	0.195148	T	0.05318	0.0141	M	0.72118	2.19	0.09310	N	1	P	0.45474	0.859	B	0.38921	0.285	T	0.28650	-1.0037	10	0.72032	D	0.01	.	7.6473	0.28327	0.0:0.7663:0.0:0.2337	.	23	P01567	IFNA7_HUMAN	S	23	ENSP00000239347:G23S	ENSP00000239347:G23S	G	-	1	0	IFNA7	21192098	0.004000	0.15560	0.016000	0.15963	0.308000	0.27856	0.998000	0.29744	0.611000	0.30052	-0.225000	0.12378	GGC	.	C|0.500;T|0.500		0.507	IFNA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051891.1	NM_021057	
TUSC1	286319	hgsc.bcm.edu	37	9	25677993	25677993	+	Silent	SNP	G	G	A	rs377425143		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:25677993G>A	ENST00000358022.3	-	1	863	c.327C>T	c.(325-327)agC>agT	p.S109S		NM_001004125.2	NP_001004125.1	Q2TAM9	TUSC1_HUMAN	tumor suppressor candidate 1	109										kidney(1)	1	all_hematologic(1;0.197)	all_neural(3;5.42e-18)|Glioma(3;5.54e-17)		GBM - Glioblastoma multiforme(1;1.51e-108)|Lung(42;2.88e-14)|LUSC - Lung squamous cell carcinoma(38;3.16e-11)		GACGGAAGAGGCTGCGGTTCT	0.726																																					p.S109S	Pancreas(19;648 672 25630 30820 31331)	Atlas-SNP	.											.	TUSC1	7	.	0			c.C327T						.						4.0	5.0	5.0					9																	25677993		1970	3933	5903	SO:0001819	synonymous_variant	286319	exon1			GAAGAGGCTGCGG	AY168647	CCDS34999.1	9p21.2	2014-05-22			ENSG00000198680	ENSG00000198680			31010	protein-coding gene	gene with protein product		610529				15208665	Standard	NM_001004125		Approved	TSG-9	uc003zpx.3	Q2TAM9	OTTHUMG00000159591	ENST00000358022.3:c.327C>T	chr9.hg19:g.25677993G>A		70.0	0.0		67.0	13.0	NM_001004125	A0PJ78|Q67GI3|Q86SS1|Q8TAH8	Silent	SNP	ENST00000358022.3	hg19	CCDS34999.1																																																																																			.	.		0.726	TUSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356351.1	NM_001004125	
TAF1L	138474	hgsc.bcm.edu	37	9	32632698	32632699	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:32632698_32632699GG>TT	ENST00000242310.4	-	1	2968_2969	c.2879_2880CC>AA	c.(2878-2880)gCC>gAA	p.A960E	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	960					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TGCCCTTCATGGCAGCAATGAA	0.475																																					p.A960A|p.A960D		Atlas-SNP	.											.	TAF1L	382	.	0			c.C2880A|c.C2879A						.																																			SO:0001583	missense	138474	exon1			CTTCATGGCAGCA|TTCATGGCAGCAA	AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2879_2880delinsTT	chr9.hg19:g.32632698_32632699delinsTT	ENSP00000418379:p.Ala960Glu	222.0|220.0	0.0		197.0|198.0	55.0	NM_153809	Q0VG57	Silent|Missense_Mutation	SNP	ENST00000242310.4	hg19	CCDS35003.1																																																																																			.	.		0.475	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052012.2		
UNC13B	10497	hgsc.bcm.edu	37	9	35403468	35403468	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:35403468A>T	ENST00000378495.3	+	38	4584	c.4362A>T	c.(4360-4362)acA>acT	p.T1454T	UNC13B_ENST00000396787.1_Silent_p.T1485T|UNC13B_ENST00000378496.4_Silent_p.T1473T	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	1454	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			AGTGGCAGACAGCGGGTATGT	0.527																																					p.T1454T		Atlas-SNP	.											.	UNC13B	153	.	0			c.A4362T						.						61.0	60.0	61.0					9																	35403468		2203	4300	6503	SO:0001819	synonymous_variant	10497	exon38			GCAGACAGCGGGT	AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.4362A>T	chr9.hg19:g.35403468A>T		172.0	0.0		120.0	36.0	NM_006377	Q5VYM8	Silent	SNP	ENST00000378495.3	hg19	CCDS6579.1																																																																																			.	.		0.527	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000052296.1	NM_006377	
CA9	768	hgsc.bcm.edu	37	9	35675916	35675916	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:35675916A>T	ENST00000378357.4	+	3	696	c.592A>T	c.(592-594)Aat>Tat	p.N198Y		NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	198	Catalytic.				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	CCTGCGCAACAATGGCCACAG	0.726																																					p.N198Y		Atlas-SNP	.											.	CA9	48	.	0			c.A592T						.						19.0	21.0	21.0					9																	35675916		1749	3612	5361	SO:0001583	missense	768	exon3			CGCAACAATGGCC	X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.592A>T	chr9.hg19:g.35675916A>T	ENSP00000367608:p.Asn198Tyr	74.0	0.0		52.0	12.0	NM_001216	Q5T4R1	Missense_Mutation	SNP	ENST00000378357.4	hg19	CCDS6585.1	.	.	.	.	.	.	.	.	.	.	A	22.0	4.224089	0.79576	.	.	ENSG00000107159	ENST00000378357;ENST00000544074	T	0.57752	0.38	4.68	4.68	0.58851	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.64402	D	0.000001	T	0.77322	0.4113	M	0.93375	3.41	0.45541	D	0.99849	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.993	T	0.82416	-0.0468	10	0.87932	D	0	.	10.6845	0.45835	1.0:0.0:0.0:0.0	.	198;198	F5H404;Q16790	.;CAH9_HUMAN	Y	198	ENSP00000367608:N198Y	ENSP00000367608:N198Y	N	+	1	0	CA9	35665916	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.563000	0.60823	2.088000	0.63022	0.459000	0.35465	AAT	.	.		0.726	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055479.1	NM_001216	
TLN1	7094	hgsc.bcm.edu	37	9	35707454	35707454	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:35707454C>A	ENST00000314888.9	-	36	5017	c.4664G>T	c.(4663-4665)cGt>cTt	p.R1555L	TLN1_ENST00000540444.1_Missense_Mutation_p.R1555L|TLN1_ENST00000464379.1_Intron	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1555	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GCACTGGGCACGGTTCTCCTC	0.577																																					p.R1555L		Atlas-SNP	.											.	TLN1	185	.	0			c.G4664T						.						47.0	44.0	45.0					9																	35707454		2203	4300	6503	SO:0001583	missense	7094	exon36			TGGGCACGGTTCT	AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4664G>T	chr9.hg19:g.35707454C>A	ENSP00000316029:p.Arg1555Leu	78.0	0.0		51.0	25.0	NM_006289	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	ENST00000314888.9	hg19	CCDS35009.1	.	.	.	.	.	.	.	.	.	.	C	33	5.197261	0.94960	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.31769	1.48;1.48	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.55752	0.1940	M	0.84433	2.695	0.80722	D	1	D	0.63046	0.992	P	0.53861	0.736	T	0.61148	-0.7121	10	0.62326	D	0.03	-11.0069	20.1386	0.98045	0.0:1.0:0.0:0.0	.	1555	Q9Y490	TLN1_HUMAN	L	1555	ENSP00000316029:R1555L;ENSP00000442981:R1555L	ENSP00000316029:R1555L	R	-	2	0	TLN1	35697454	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.794000	0.85869	2.767000	0.95098	0.561000	0.74099	CGT	.	.		0.577	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052353.2	NM_006289	
DAPK1	1612	hgsc.bcm.edu	37	9	90296521	90296521	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:90296521C>T	ENST00000408954.3	+	20	2539	c.2204C>T	c.(2203-2205)cCc>cTc	p.P735L	DAPK1_ENST00000472284.1_Missense_Mutation_p.P735L|DAPK1_ENST00000358077.5_Missense_Mutation_p.P735L|DAPK1_ENST00000491893.1_Missense_Mutation_p.P735L|DAPK1_ENST00000469640.2_Missense_Mutation_p.P735L	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	735					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						CCACCTTCACCCCTGGCTTCT	0.577									Chronic Lymphocytic Leukemia, Familial Clustering of																												p.P735L		Atlas-SNP	.											.	DAPK1	329	.	0			c.C2204T						.						32.0	34.0	33.0					9																	90296521		1923	4110	6033	SO:0001583	missense	1612	exon20	Familial Cancer Database	Familial CLL	CTTCACCCCTGGC	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.2204C>T	chr9.hg19:g.90296521C>T	ENSP00000386135:p.Pro735Leu	55.0	0.0		54.0	16.0	NM_004938	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	ENST00000408954.3	hg19	CCDS43842.1	.	.	.	.	.	.	.	.	.	.	C	16.18	3.050506	0.55218	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.69306	-0.28;-0.28;-0.26;-0.28;-0.39	5.17	4.27	0.50696	.	0.000000	0.49916	D	0.000124	T	0.76955	0.4060	L	0.54323	1.7	0.80722	D	1	B;D;B	0.89917	0.001;1.0;0.001	B;D;B	0.91635	0.002;0.999;0.002	T	0.77619	-0.2520	10	0.49607	T	0.09	.	13.3899	0.60818	0.0:0.9239:0.0:0.0761	.	735;289;735	B7ZLE7;P53355-2;P53355	.;.;DAPK1_HUMAN	L	735	ENSP00000350785:P735L;ENSP00000417076:P735L;ENSP00000418885:P735L;ENSP00000386135:P735L;ENSP00000419026:P735L	ENSP00000350785:P735L	P	+	2	0	DAPK1	89486341	1.000000	0.71417	0.975000	0.42487	0.253000	0.25986	7.576000	0.82467	1.437000	0.47472	0.556000	0.70494	CCC	.	.		0.577	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356843.1	NM_004938	
SEMA4D	10507	hgsc.bcm.edu	37	9	91994239	91994239	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:91994239T>A	ENST00000450295.1	-	16	2745	c.1969A>T	c.(1969-1971)Acc>Tcc	p.T657S	SEMA4D_ENST00000356444.2_Missense_Mutation_p.T657S|SEMA4D_ENST00000422704.2_Missense_Mutation_p.T657S|SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000438547.2_Missense_Mutation_p.T657S|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000455551.2_Intron			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	657					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						ACTGACAAGGTGGGGGCCACT	0.567																																					p.T657S		Atlas-SNP	.											.	SEMA4D	81	.	0			c.A1969T						.						124.0	132.0	129.0					9																	91994239		2203	4300	6503	SO:0001583	missense	10507	exon18			ACAAGGTGGGGGC	U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.1969A>T	chr9.hg19:g.91994239T>A	ENSP00000416523:p.Thr657Ser	101.0	0.0		57.0	14.0	NM_006378	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	ENST00000450295.1	hg19	CCDS6685.1	.	.	.	.	.	.	.	.	.	.	T	4.704	0.130851	0.08981	.	.	ENSG00000187764	ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	3.92	1.55	0.23275	.	1.722020	0.02641	N	0.105346	T	0.15003	0.0362	L	0.29908	0.895	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.22208	-1.0223	10	0.32370	T	0.25	.	1.5817	0.02636	0.1461:0.1549:0.1506:0.5484	.	657	Q92854	SEM4D_HUMAN	S	657	ENSP00000416523:T657S;ENSP00000405102:T657S;ENSP00000348822:T657S;ENSP00000388768:T657S	ENSP00000348822:T657S	T	-	1	0	SEMA4D	91184059	0.808000	0.29022	0.005000	0.12908	0.101000	0.19017	0.043000	0.13971	0.656000	0.30886	0.459000	0.35465	ACC	.	.		0.567	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000342411.1	NM_006378	
FGD3	89846	hgsc.bcm.edu	37	9	95772649	95772649	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:95772649A>T	ENST00000375482.3	+	7	1455	c.959A>T	c.(958-960)gAc>gTc	p.D320V	FGD3_ENST00000416701.2_Missense_Mutation_p.D320V|FGD3_ENST00000337352.6_Missense_Mutation_p.D320V	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	320	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						GACGCCCCAGACCGGAAGGAT	0.662																																					p.D320V		Atlas-SNP	.											.	FGD3	116	.	0			c.A959T						.						19.0	22.0	21.0					9																	95772649		1994	4183	6177	SO:0001583	missense	89846	exon7			CCCCAGACCGGAA	AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.959A>T	chr9.hg19:g.95772649A>T	ENSP00000364631:p.Asp320Val	126.0	0.0		92.0	31.0	NM_001083536	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	ENST00000375482.3	hg19	CCDS43849.1	.	.	.	.	.	.	.	.	.	.	A	14.87	2.664810	0.47572	.	.	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352	T;T;T	0.41758	0.99;0.99;0.99	4.29	4.29	0.51040	Dbl homology (DH) domain (5);	0.000000	0.40385	N	0.001110	T	0.76807	0.4039	H	0.98525	4.255	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.997;1.0	D	0.85554	0.1223	10	0.87932	D	0	.	12.9694	0.58503	1.0:0.0:0.0:0.0	.	320;320;320	Q5JSP0-2;F8W7P2;Q5JSP0	.;.;FGD3_HUMAN	V	320	ENSP00000364631:D320V;ENSP00000413833:D320V;ENSP00000336914:D320V	ENSP00000336914:D320V	D	+	2	0	FGD3	94812470	1.000000	0.71417	0.289000	0.24876	0.029000	0.11900	8.835000	0.92100	1.891000	0.54761	0.459000	0.35465	GAC	.	.		0.662	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055493.1	NM_033086	
CCDC180	100499483	hgsc.bcm.edu	37	9	100116932	100116932	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:100116932A>T	ENST00000357054.1	+	34	4064	c.3129A>T	c.(3127-3129)atA>atT	p.I1043I	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000375202.2_Silent_p.I1072I|CCDC180_ENST00000529487.1_Silent_p.I1072I			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	1043						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTGCCCGGATAGAGTTGGTTG	0.493																																					p.I1072I		Atlas-SNP	.											.	.	.	.	0			c.A3216T						.						76.0	76.0	76.0					9																	100116932		2203	4300	6503	SO:0001819	synonymous_variant	0	exon23			CCGGATAGAGTTG	AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3129A>T	chr9.hg19:g.100116932A>T		205.0	0.0		173.0	35.0	NM_020893	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	ENST00000357054.1	hg19																																																																																				.	.		0.493	CCDC180-201	KNOWN	basic	protein_coding	protein_coding		NM_020893	
ZNF462	58499	hgsc.bcm.edu	37	9	109765689	109765689	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:109765689A>T	ENST00000277225.5	+	11	7460	c.7171A>T	c.(7171-7173)Agc>Tgc	p.S2391C	RP11-508N12.2_ENST00000439901.1_RNA|ZNF462_ENST00000441147.2_Missense_Mutation_p.S1297C|ZNF462_ENST00000542028.1_Missense_Mutation_p.S348C|ZNF462_ENST00000457913.1_Missense_Mutation_p.S2451C			Q96JM2	ZN462_HUMAN	zinc finger protein 462	2391					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AGAAATGAACAGCAAGGCTGA	0.512																																					p.S2391C		Atlas-SNP	.											.	ZNF462	322	.	0			c.A7171T						.						121.0	98.0	106.0					9																	109765689		2203	4300	6503	SO:0001583	missense	58499	exon11			ATGAACAGCAAGG	AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.7171A>T	chr9.hg19:g.109765689A>T	ENSP00000277225:p.Ser2391Cys	73.0	0.0		65.0	18.0	NM_021224	Q5T0T4|Q8N408	Missense_Mutation	SNP	ENST00000277225.5	hg19	CCDS35096.1	.	.	.	.	.	.	.	.	.	.	A	14.63	2.592024	0.46214	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147;ENST00000542028	T;T;T;T;T	0.15603	3.4;3.87;3.97;3.98;2.41	5.13	3.99	0.46301	.	0.371919	0.28176	N	0.016313	T	0.14227	0.0344	L	0.46157	1.445	0.33130	D	0.54301	P;B	0.39862	0.692;0.0	B;B	0.38712	0.28;0.001	T	0.17745	-1.0359	10	0.38643	T	0.18	.	5.9486	0.19234	0.69:0.221:0.089:0.0	.	2451;2391	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	C	2391;2451;1334;1297;348	ENSP00000277225:S2391C;ENSP00000414570:S2451C;ENSP00000363818:S1334C;ENSP00000397306:S1297C;ENSP00000439771:S348C	ENSP00000277225:S2391C	S	+	1	0	ZNF462	108805510	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.093000	0.41710	0.973000	0.38340	0.383000	0.25322	AGC	.	.		0.512	ZNF462-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000053532.2	NM_021224	
SVEP1	79987	hgsc.bcm.edu	37	9	113169638	113169638	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:113169638T>A	ENST00000401783.2	-	38	8578	c.8242A>T	c.(8242-8244)Att>Ttt	p.I2748F	SVEP1_ENST00000374469.1_Missense_Mutation_p.I2725F|SVEP1_ENST00000297826.5_Missense_Mutation_p.I674F	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2748	Sushi 22. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CCTGCTAGAATGTGTCCAGGT	0.453																																					p.I2748F		Atlas-SNP	.											.	SVEP1	326	.	0			c.A8242T						.						79.0	82.0	81.0					9																	113169638		1989	4159	6148	SO:0001583	missense	79987	exon38			CTAGAATGTGTCC	AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8242A>T	chr9.hg19:g.113169638T>A	ENSP00000384917:p.Ile2748Phe	107.0	0.0		92.0	15.0	NM_153366	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	ENST00000401783.2	hg19	CCDS48004.1	.	.	.	.	.	.	.	.	.	.	T	6.503	0.461092	0.12342	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826;ENST00000374463	T;T;T	0.63913	-0.07;-0.07;-0.07	5.87	-9.8	0.00490	Complement control module (2);Sushi/SCR/CCP (3);	1.031550	0.07601	N	0.923634	T	0.46034	0.1372	L	0.36672	1.1	0.09310	N	1	B	0.25904	0.137	B	0.24974	0.057	T	0.43065	-0.9414	10	0.49607	T	0.09	.	11.8495	0.52403	0.0:0.5033:0.1748:0.3219	.	2748	Q4LDE5	SVEP1_HUMAN	F	2748;2725;674;420	ENSP00000384917:I2748F;ENSP00000363593:I2725F;ENSP00000297826:I674F	ENSP00000297826:I674F	I	-	1	0	SVEP1	112209459	0.410000	0.25376	0.001000	0.08648	0.080000	0.17528	-0.165000	0.09968	-1.798000	0.01250	-0.334000	0.08254	ATT	.	.		0.453	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
ZNF618	114991	hgsc.bcm.edu	37	9	116798646	116798646	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:116798646A>T	ENST00000374126.5	+	13	1334	c.1235A>T	c.(1234-1236)cAg>cTg	p.Q412L	ZNF618_ENST00000288466.7_Missense_Mutation_p.Q319L|ZNF618_ENST00000470105.1_3'UTR			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	412					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						GAGCACATGCAGTCCCATGCA	0.572																																					p.Q319L		Atlas-SNP	.											.	ZNF618	184	.	0			c.A956T						.						63.0	67.0	66.0					9																	116798646		1943	4142	6085	SO:0001583	missense	114991	exon12			ACATGCAGTCCCA	BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.1235A>T	chr9.hg19:g.116798646A>T	ENSP00000363241:p.Gln412Leu	117.0	0.0		106.0	24.0	NM_133374	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	ENST00000374126.5	hg19		.	.	.	.	.	.	.	.	.	.	A	19.67	3.870248	0.72065	.	.	ENSG00000157657	ENST00000374126;ENST00000288466	T;T	0.33654	1.4;1.4	4.88	4.88	0.63580	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.60534	0.2276	.	.	.	0.80722	D	1	D;D;B	0.71674	0.969;0.998;0.216	D;D;P	0.85130	0.968;0.997;0.502	T	0.65557	-0.6139	9	0.66056	D	0.02	-21.1973	13.6156	0.62105	1.0:0.0:0.0:0.0	.	379;412;319	B9EG82;Q5T7W0;Q5T7W0-2	.;ZN618_HUMAN;.	L	412;319	ENSP00000363241:Q412L;ENSP00000288466:Q319L	ENSP00000288466:Q319L	Q	+	2	0	ZNF618	115838467	1.000000	0.71417	1.000000	0.80357	0.599000	0.36880	8.555000	0.90693	1.962000	0.57031	0.459000	0.35465	CAG	.	.		0.572	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000053749.1	XM_054983	
PTGS1	5742	hgsc.bcm.edu	37	9	125148941	125148941	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:125148941A>T	ENST00000362012.2	+	9	1231	c.1226A>T	c.(1225-1227)aAc>aTc	p.N409I	AL162424.1_ENST00000600713.1_5'Flank|PTGS1_ENST00000540753.1_Intron|PTGS1_ENST00000373698.5_Missense_Mutation_p.N300I|PTGS1_ENST00000223423.4_Intron	NM_000962.3|NM_001271164.1|NM_001271367.1|NM_080591.2	NP_000953.2|NP_001258093.1|NP_001258296.1|NP_542158.1	P23219	PGH1_HUMAN	prostaglandin-endoperoxide synthase 1 (prostaglandin G/H synthase and cyclooxygenase)	409					arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|inflammatory response (GO:0006954)|lipid metabolic process (GO:0006629)|prostaglandin biosynthetic process (GO:0001516)|regulation of blood pressure (GO:0008217)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)	dioxygenase activity (GO:0051213)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			large_intestine(3)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	8					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bortezomib(DB00188)|Bromfenac(DB00963)|Candesartan(DB00796)|Carprofen(DB00821)|Carvedilol(DB01136)|Chlorpropamide(DB00672)|Dapsone(DB00250)|Desmopressin(DB00035)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Diphenhydramine(DB01075)|Dronabinol(DB00470)|Eletriptan(DB00216)|Eszopiclone(DB00402)|Etodolac(DB00749)|Etoposide(DB00773)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Hexobarbital(DB01355)|Hydromorphone(DB00327)|Ibuprofen(DB01050)|Icosapent(DB00159)|Ifosfamide(DB01181)|Imatinib(DB00619)|Indomethacin(DB00328)|Irbesartan(DB01029)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Minoxidil(DB00350)|Montelukast(DB00471)|Nabumetone(DB00461)|Naproxen(DB00788)|Nateglinide(DB00731)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nortriptyline(DB00540)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Rosiglitazone(DB00412)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfamethoxazole(DB01015)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tenoxicam(DB00469)|Terbinafine(DB00857)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Torasemide(DB00214)|Trabectedin(DB05109)|Triflusal(DB08814)|Trisalicylate-choline(DB01401)|Valproic Acid(DB00313)|Voriconazole(DB00582)|Zafirlukast(DB00549)|Zileuton(DB00744)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTCTTGTTCAACACCTCCATG	0.577																																					p.N409I		Atlas-SNP	.											.	PTGS1	84	.	0			c.A1226T						.						140.0	117.0	125.0					9																	125148941		2203	4300	6503	SO:0001583	missense	5742	exon9			TGTTCAACACCTC	M59979	CCDS6842.1, CCDS6843.1, CCDS59520.1, CCDS59521.1, CCDS75895.1	9q32-q33.3	2008-02-05			ENSG00000095303	ENSG00000095303	1.14.99.1		9604	protein-coding gene	gene with protein product		176805				2512924, 1907252	Standard	NM_000962		Approved	COX1, PGHS-1, PTGHS	uc004bmg.2	P23219	OTTHUMG00000020605	ENST00000362012.2:c.1226A>T	chr9.hg19:g.125148941A>T	ENSP00000354612:p.Asn409Ile	111.0	0.0		78.0	18.0	NM_000962	A8K1V7|B4DHQ2|B4E2S5|Q15122|Q3HY28|Q3HY29|Q5T7T6|Q5T7T7|Q5T7T8	Missense_Mutation	SNP	ENST00000362012.2	hg19	CCDS6842.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681052	0.88542	.	.	ENSG00000095303	ENST00000362012;ENST00000373698	T;T	0.12569	2.67;2.67	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.46756	0.1409	M	0.92738	3.34	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.60042	-0.7340	10	0.87932	D	0	-29.4922	14.2194	0.65815	1.0:0.0:0.0:0.0	.	409	P23219	PGH1_HUMAN	I	409;300	ENSP00000354612:N409I;ENSP00000362802:N300I	ENSP00000354612:N409I	N	+	2	0	PTGS1	124188762	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.339000	0.96797	1.948000	0.56530	0.533000	0.62120	AAC	.	.		0.577	PTGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053933.1		
PKN3	29941	hgsc.bcm.edu	37	9	131469505	131469505	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:131469505A>T	ENST00000291906.4	+	6	1049	c.656A>T	c.(655-657)cAg>cTg	p.Q219L	RN7SL560P_ENST00000577943.1_RNA	NM_013355.3	NP_037487.2	Q6P5Z2	PKN3_HUMAN	protein kinase N3	219					epithelial cell migration (GO:0010631)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(9)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24						CTGCAGGCCCAGGCCCAGCTA	0.637																																					p.Q219L		Atlas-SNP	.											.	PKN3	62	.	0			c.A656T						.						24.0	26.0	26.0					9																	131469505		2203	4300	6503	SO:0001583	missense	29941	exon6			AGGCCCAGGCCCA	AB019692	CCDS6908.1	9q34.13	2008-02-05			ENSG00000160447	ENSG00000160447			17999	protein-coding gene	gene with protein product		610714				10441506	Standard	NM_013355		Approved	PKNbeta	uc004bvw.3	Q6P5Z2	OTTHUMG00000020757	ENST00000291906.4:c.656A>T	chr9.hg19:g.131469505A>T	ENSP00000291906:p.Gln219Leu	73.0	0.0		55.0	12.0	NM_013355	Q9UM03	Missense_Mutation	SNP	ENST00000291906.4	hg19	CCDS6908.1	.	.	.	.	.	.	.	.	.	.	A	21.4	4.144538	0.77888	.	.	ENSG00000160447	ENST00000291906	T	0.20200	2.09	5.37	5.37	0.77165	.	.	.	.	.	T	0.46288	0.1385	M	0.77406	2.37	0.80722	D	1	D;D	0.69078	0.997;0.994	D;D	0.80764	0.994;0.988	T	0.42050	-0.9474	9	0.40728	T	0.16	.	13.3212	0.60434	1.0:0.0:0.0:0.0	.	219;219	Q05BU1;Q6P5Z2	.;PKN3_HUMAN	L	219	ENSP00000291906:Q219L	ENSP00000291906:Q219L	Q	+	2	0	PKN3	130509326	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	8.274000	0.89889	2.033000	0.60031	0.459000	0.35465	CAG	.	.		0.637	PKN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054487.1	NM_013355	
C9orf171	389799	hgsc.bcm.edu	37	9	135374923	135374923	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:135374923G>A	ENST00000343036.2	+	4	616	c.568G>A	c.(568-570)Gac>Aac	p.D190N	C9orf171_ENST00000393215.3_Missense_Mutation_p.D154N|C9orf171_ENST00000393216.2_Missense_Mutation_p.D154N	NM_207417.1	NP_997300.1	Q6ZQR2	CI171_HUMAN	chromosome 9 open reading frame 171	190										large_intestine(7)|lung(9)|ovary(4)|prostate(3)	23						TGACCAGGATGACCGGCGCAT	0.602																																					p.D190N		Atlas-SNP	.											.	C9orf171	53	.	0			c.G568A						.						82.0	83.0	83.0					9																	135374923		2203	4300	6503	SO:0001583	missense	389799	exon4			CAGGATGACCGGC	AK128819	CCDS6949.1, CCDS65167.1	9q34.13	2012-04-03			ENSG00000188523	ENSG00000188523			33776	protein-coding gene	gene with protein product							Standard	NM_207417		Approved	FLJ46082	uc004cbn.3	Q6ZQR2	OTTHUMG00000131684	ENST00000343036.2:c.568G>A	chr9.hg19:g.135374923G>A	ENSP00000343290:p.Asp190Asn	180.0	0.0		149.0	38.0	NM_207417	Q147X1	Missense_Mutation	SNP	ENST00000343036.2	hg19	CCDS6949.1	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910071	0.52439	.	.	ENSG00000188523	ENST00000393215;ENST00000343036;ENST00000393216	T;T;T	0.20463	2.07;2.07;2.07	5.15	3.31	0.37934	.	0.599767	0.17593	N	0.168692	T	0.11324	0.0276	N	0.24115	0.695	0.27478	N	0.952671	B;B	0.27140	0.014;0.169	B;B	0.20955	0.004;0.032	T	0.21280	-1.0250	10	0.27785	T	0.31	.	5.0277	0.14393	0.1778:0.0:0.6558:0.1665	.	154;190	Q6ZQR2-2;Q6ZQR2	.;CI171_HUMAN	N	154;190;154	ENSP00000376908:D154N;ENSP00000343290:D190N;ENSP00000376909:D154N	ENSP00000343290:D190N	D	+	1	0	C9orf171	134364744	0.927000	0.31430	0.860000	0.33809	0.940000	0.58332	2.093000	0.41710	0.672000	0.31204	0.561000	0.74099	GAC	.	.		0.602	C9orf171-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254589.1	NM_207417	
BRD3	8019	hgsc.bcm.edu	37	9	136905393	136905393	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:136905393T>A	ENST00000303407.7	-	9	1593		c.e9-2		BRD3_ENST00000473349.1_Intron|BRD3_ENST00000357885.2_Splice_Site|BRD3_ENST00000371834.2_Splice_Site	NM_007371.3	NP_031397.1	Q15059	BRD3_HUMAN	bromodomain containing 3						chromatin modification (GO:0016568)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)		BRD3/C15orf55(3)	kidney(1)|skin(1)|stomach(4)	6				OV - Ovarian serous cystadenocarcinoma(145;1.43e-08)|Epithelial(140;8.41e-08)|all cancers(34;5.21e-07)		GGCCTTCAGCTGGAAAAGAGC	0.622			T	C15orf55	lethal midline carcinoma of young people																																.		Atlas-SNP	.		Dom	yes		9	9q34	8019	bromodomain containing 3		E	.	BRD3	82	.	0			c.1408-2A>T						.						11.0	11.0	11.0					9																	136905393		2190	4291	6481	SO:0001630	splice_region_variant	8019	exon10			TTCAGCTGGAAAA		CCDS6980.1	9q34	2010-12-23	2002-01-14		ENSG00000169925	ENSG00000169925			1104	protein-coding gene	gene with protein product	"""RING3-like"""	601541	"""bromodomain-containing 3"""			7584044, 8781126	Standard	NM_007371		Approved	RING3L, ORFX, KIAA0043	uc004cew.3	Q15059	OTTHUMG00000021004	ENST00000303407.7:c.1408-2A>T	chr9.hg19:g.136905393T>A		19.0	0.0		31.0	5.0	NM_007371	B1APD9|Q4G5Y3|Q5T1R7|Q8N5M3|Q92645	Splice_Site	SNP	ENST00000303407.7	hg19	CCDS6980.1	.	.	.	.	.	.	.	.	.	.	T	15.97	2.989215	0.53934	.	.	ENSG00000169925	ENST00000303407;ENST00000540795;ENST00000371834;ENST00000357885	.	.	.	4.8	4.8	0.61643	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8032	0.63214	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	BRD3	135895214	1.000000	0.71417	0.908000	0.35775	0.520000	0.34377	7.659000	0.83766	1.913000	0.55393	0.459000	0.35465	.	.	.		0.622	BRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055390.4	NM_007371	Intron
WDR5	11091	hgsc.bcm.edu	37	9	137023031	137023031	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:137023031A>T	ENST00000358625.3	+	14	1092	c.921A>T	c.(919-921)acA>acT	p.T307T	WDR5_ENST00000425041.1_Silent_p.T307T	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	307					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		TGATCTCAACAGCTTGTCACC	0.507																																					p.T307T		Atlas-SNP	.											.	WDR5	29	.	0			c.A921T						.						154.0	128.0	137.0					9																	137023031		2203	4300	6503	SO:0001819	synonymous_variant	11091	exon13			CTCAACAGCTTGT	AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.921A>T	chr9.hg19:g.137023031A>T		82.0	0.0		62.0	19.0	NM_052821	Q91VA5|Q9NWX7|Q9UGP9	Silent	SNP	ENST00000358625.3	hg19	CCDS6981.1																																																																																			.	.		0.507	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254621.1	NM_052821	
CYSRT1	375791	hgsc.bcm.edu	37	9	140120486	140120486	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:140120486G>T	ENST00000359069.2	+	2	463	c.413G>T	c.(412-414)tGc>tTc	p.C138F	C9orf169_ENST00000409414.1_Missense_Mutation_p.C178F|RNF224_ENST00000445101.2_5'Flank	NM_199001.2	NP_945352.2	A8MQ03	CRTP1_HUMAN		138	Cys-rich.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)	1						tgccacagctgctgctgctgT	0.687																																					p.C138F		Atlas-SNP	.											.	C9orf169	6	.	0			c.G413T						.						2.0	2.0	2.0					9																	140120486		430	1173	1603	SO:0001583	missense	375791	exon2			ACAGCTGCTGCTG																												ENST00000359069.2:c.413G>T	chr9.hg19:g.140120486G>T	ENSP00000351967:p.Cys138Phe	73.0	0.0		81.0	16.0	NM_199001	Q86UY7	Missense_Mutation	SNP	ENST00000359069.2	hg19	CCDS48064.1	.	.	.	.	.	.	.	.	.	.	G	10.38	1.334828	0.24253	.	.	ENSG00000197191	ENST00000409414;ENST00000359069	.	.	.	3.63	2.71	0.32032	.	0.000000	0.37178	U	0.002215	T	0.45875	0.1364	L	0.29908	0.895	0.28043	N	0.933653	D	0.71674	0.998	D	0.67382	0.951	T	0.28554	-1.0040	9	0.48119	T	0.1	.	8.8409	0.35142	0.0:0.2308:0.7692:0.0	.	138	A8MQ03	CI169_HUMAN	F	178;138	.	ENSP00000351967:C138F	C	+	2	0	C9orf169	139240307	0.094000	0.21725	0.999000	0.59377	0.446000	0.32137	0.653000	0.24902	0.720000	0.32209	0.313000	0.20887	TGC	.	.		0.687	C9orf169-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding			
NELFB	25920	hgsc.bcm.edu	37	9	140166672	140166672	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr9:140166672A>T	ENST00000343053.4	+	11	1822	c.1485A>T	c.(1483-1485)ccA>ccT	p.P495P		NM_015456.3	NP_056271.2	Q8WX92	NELFB_HUMAN	negative elongation factor complex member B	495					gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	cytoplasm (GO:0005737)|NELF complex (GO:0032021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CCGCCTCTCCAAGGTAGGCCT	0.637																																					p.P495P		Atlas-SNP	.											.	.	.	.	0			c.A1485T						.						78.0	72.0	74.0					9																	140166672		2203	4300	6503	SO:0001819	synonymous_variant	25920	exon11			CTCTCCAAGGTAG	AF464935	CCDS7040.1	9q34	2013-01-31	2013-01-31	2013-01-31	ENSG00000188986	ENSG00000188986			24324	protein-coding gene	gene with protein product		611180	"""cofactor of BRCA1"""	COBRA1		11230166, 10574461, 17910036, 17659869	Standard	NM_015456		Approved	KIAA1182, NELF-B	uc004cmm.4	Q8WX92	OTTHUMG00000131778	ENST00000343053.4:c.1485A>T	chr9.hg19:g.140166672A>T		55.0	0.0		60.0	21.0	NM_015456	A2BFA3|Q96EW5|Q9H9R4|Q9ULN8|Q9Y3W0	Silent	SNP	ENST00000343053.4	hg19	CCDS7040.1																																																																																			.	.		0.637	NELFB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254710.1	NM_015456	
MCM10	55388	hgsc.bcm.edu	37	10	13214750	13214750	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:13214750A>G	ENST00000484800.2	+	5	683	c.580A>G	c.(580-582)Aag>Gag	p.K194E	MCM10_ENST00000378714.3_Missense_Mutation_p.K193E|MCM10_ENST00000378694.1_Missense_Mutation_p.K193E			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	194					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TCGAACACCAAAGGCTTCACC	0.498																																					p.K194E		Atlas-SNP	.											.	MCM10	76	.	0			c.A580G						.						91.0	78.0	82.0					10																	13214750		2203	4300	6503	SO:0001583	missense	55388	exon5			ACACCAAAGGCTT	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.580A>G	chr10.hg19:g.13214750A>G	ENSP00000418268:p.Lys194Glu	112.0	0.0		92.0	23.0	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	ENST00000484800.2	hg19	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	A	15.39	2.820830	0.50633	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.16196	2.36;2.37;2.36	5.23	5.23	0.72850	.	0.165528	0.51477	D	0.000089	T	0.20333	0.0489	M	0.63428	1.95	0.45477	D	0.99844	P;P;P	0.45348	0.856;0.787;0.682	B;B;B	0.41510	0.355;0.359;0.197	T	0.02691	-1.1123	10	0.26408	T	0.33	-13.1271	13.4958	0.61426	1.0:0.0:0.0:0.0	.	193;193;194	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	E	193;194;194;193	ENSP00000367986:K193E;ENSP00000418268:K194E;ENSP00000367966:K193E	ENSP00000354945:K194E	K	+	1	0	MCM10	13254756	0.996000	0.38824	0.052000	0.19188	0.023000	0.10783	3.639000	0.54339	2.197000	0.70478	0.533000	0.62120	AAG	.	.		0.498	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
KIAA1217	56243	hgsc.bcm.edu	37	10	24722117	24722117	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:24722117T>C	ENST00000376454.3	+	4	777	c.747T>C	c.(745-747)gaT>gaC	p.D249D	KIAA1217_ENST00000430453.2_Silent_p.D170D|KIAA1217_ENST00000376462.1_Silent_p.D169D|KIAA1217_ENST00000458595.1_Silent_p.D249D|KIAA1217_ENST00000376452.3_Silent_p.D249D	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	249					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						AATTAAATGATGTAAGGTAAG	0.358																																					p.D249D		Atlas-SNP	.											.	KIAA1217	235	.	0			c.T747C						.						74.0	70.0	71.0					10																	24722117		2203	4300	6503	SO:0001819	synonymous_variant	56243	exon4			AAATGATGTAAGG	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.747T>C	chr10.hg19:g.24722117T>C		34.0	0.0		38.0	11.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Silent	SNP	ENST00000376454.3	hg19	CCDS31165.1																																																																																			.	.		0.358	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
MYO3A	53904	hgsc.bcm.edu	37	10	26385344	26385344	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:26385344T>A	ENST00000265944.5	+	16	1763	c.1597T>A	c.(1597-1599)Tat>Aat	p.Y533N	MYO3A_ENST00000543632.1_Missense_Mutation_p.Y533N	NM_017433.4	NP_059129.3	Q8NEV4	MYO3A_HUMAN	myosin IIIA	533	Myosin motor.				ATP catabolic process (GO:0006200)|inner ear development (GO:0048839)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|filopodium (GO:0030175)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|stereocilium bundle tip (GO:0032426)	actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|plus-end directed microfilament motor activity (GO:0060002)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(9)|central_nervous_system(3)|endometrium(9)|kidney(10)|large_intestine(28)|liver(1)|lung(46)|ovary(11)|pancreas(1)|prostate(6)|skin(11)|stomach(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	146						TTACTACATTTATGCTGGTTT	0.323																																					p.Y533N		Atlas-SNP	.											.	MYO3A	371	.	0			c.T1597A						.						47.0	51.0	49.0					10																	26385344		2200	4297	6497	SO:0001583	missense	53904	exon16			TACATTTATGCTG	AF229172	CCDS7148.1	10p11.1	2011-09-27	2004-05-19		ENSG00000095777	ENSG00000095777		"""Myosins / Myosin superfamily : Class III"""	7601	protein-coding gene	gene with protein product		606808	"""deafness, autosomal recessive 30"""	DFNB30		10936054	Standard	NM_017433		Approved		uc001isn.2	Q8NEV4	OTTHUMG00000017837	ENST00000265944.5:c.1597T>A	chr10.hg19:g.26385344T>A	ENSP00000265944:p.Tyr533Asn	339.0	0.0		373.0	91.0	NM_017433	Q4G0X2|Q5VZ28|Q8WX17|Q9NYS8	Missense_Mutation	SNP	ENST00000265944.5	hg19	CCDS7148.1	.	.	.	.	.	.	.	.	.	.	T	22.8	4.335813	0.81801	.	.	ENSG00000095777	ENST00000265944;ENST00000543632	D;D	0.87571	-2.27;-2.27	5.13	5.13	0.70059	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.94062	0.8097	M	0.86953	2.85	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.998	D	0.95073	0.8206	10	0.87932	D	0	.	15.2533	0.73564	0.0:0.0:0.0:1.0	.	533;533;533	F5H0U9;Q0VD65;Q8NEV4	.;.;MYO3A_HUMAN	N	533	ENSP00000265944:Y533N;ENSP00000445909:Y533N	ENSP00000265944:Y533N	Y	+	1	0	MYO3A	26425350	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.655000	0.83696	2.069000	0.61940	0.533000	0.62120	TAT	.	.		0.323	MYO3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047259.1	NM_017433	
GAD2	2572	hgsc.bcm.edu	37	10	26518688	26518688	+	Silent	SNP	T	T	C	rs375159804		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:26518688T>C	ENST00000376261.3	+	7	1325	c.822T>C	c.(820-822)atT>atC	p.I274I	GAD2_ENST00000259271.3_Silent_p.I274I	NM_001134366.1	NP_001127838.1	Q05329	DCE2_HUMAN	glutamate decarboxylase 2 (pancreatic islets and brain, 65kDa)	274					glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|cell junction (GO:0030054)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(26)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						CCAGGCTCATTGCCTTCACGT	0.438																																					p.I274I		Atlas-SNP	.											.	GAD2	116	.	0			c.T822C						.						227.0	181.0	197.0					10																	26518688		2203	4300	6503	SO:0001819	synonymous_variant	2572	exon7			GCTCATTGCCTTC	AJ251501	CCDS7149.1	10p13-p11.2	2003-11-11	2002-08-29		ENSG00000136750	ENSG00000136750	4.1.1.15		4093	protein-coding gene	gene with protein product		138275	"""glutamate decarboxylase 2 (pancreatic islets and brain, 65kD)"""			2039509	Standard	NM_000818		Approved	GAD65	uc001isp.2	Q05329	OTTHUMG00000017836	ENST00000376261.3:c.822T>C	chr10.hg19:g.26518688T>C		76.0	0.0		52.0	8.0	NM_000818	Q9UD87	Silent	SNP	ENST00000376261.3	hg19	CCDS7149.1																																																																																			.	.		0.438	GAD2-001	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047255.1	NM_000818	
GDF10	2662	hgsc.bcm.edu	37	10	48429198	48429198	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:48429198T>A	ENST00000224605.2	-	2	953	c.688A>T	c.(688-690)Agg>Tgg	p.R230W		NM_004962.3	NP_004953.1	P55107	BMP3B_HUMAN	growth differentiation factor 10	230					fat cell differentiation (GO:0045444)|growth (GO:0040007)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(20)|skin(1)	31						CCCGGGTCCCTCTCCTCAGAA	0.682																																					p.R230W		Atlas-SNP	.											.	GDF10	79	.	0			c.A688T						.						10.0	15.0	13.0					10																	48429198		2171	4282	6453	SO:0001583	missense	2662	exon2			GGTCCCTCTCCTC	L42113	CCDS73117.1	10q11.22	2014-04-10			ENSG00000107623	ENSG00000266524		"""Endogenous ligands"""	4215	protein-coding gene	gene with protein product		601361				8679252	Standard	NM_004962		Approved	BMP-3b	uc001jfb.3	P55107	OTTHUMG00000188319	ENST00000224605.2:c.688A>T	chr10.hg19:g.48429198T>A	ENSP00000224605:p.Arg230Trp	92.0	0.0		87.0	22.0	NM_004962	Q5VSQ8|Q9UCX6	Missense_Mutation	SNP	ENST00000224605.2	hg19	CCDS7220.1	.	.	.	.	.	.	.	.	.	.	T	13.94	2.386047	0.42308	.	.	ENSG00000107623	ENST00000374247;ENST00000224605	T	0.76060	-0.99	5.44	0.276	0.15663	.	0.382872	0.30011	N	0.010634	T	0.68393	0.2996	N	0.19112	0.55	0.23120	N	0.998261	P;D	0.58620	0.89;0.983	P;P	0.61722	0.476;0.893	T	0.60005	-0.7347	10	0.52906	T	0.07	.	6.0154	0.19601	0.0:0.2071:0.1262:0.6667	.	40;230	Q8N6T2;P55107	.;BMP3B_HUMAN	W	40;230	ENSP00000224605:R230W	ENSP00000224605:R230W	R	-	1	2	GDF10	48049204	0.021000	0.18746	0.050000	0.19076	0.061000	0.15899	0.223000	0.17719	-0.188000	0.10499	-0.501000	0.04562	AGG	.	.		0.682	GDF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047884.1	NM_004962	
C10orf71	118461	hgsc.bcm.edu	37	10	50531471	50531471	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:50531471C>A	ENST00000374144.3	+	3	1169	c.881C>A	c.(880-882)gCt>gAt	p.A294D	C10orf71_ENST00000323868.4_Missense_Mutation_p.A294D			Q711Q0	CJ071_HUMAN	chromosome 10 open reading frame 71	294										endometrium(1)	1						AAGGACACAGCTGGAACCGTC	0.542																																					p.A294D		Atlas-SNP	.											.	C10orf71	179	.	0			c.C881A						.						69.0	81.0	77.0					10																	50531471		2031	4190	6221	SO:0001583	missense	118461	exon3			ACACAGCTGGAAC	AL833265	CCDS44387.1	10q11.23	2012-05-31			ENSG00000177354	ENSG00000177354			26973	protein-coding gene	gene with protein product							Standard	NM_001135196		Approved	FLJ45913	uc021pqa.2	Q711Q0	OTTHUMG00000018190	ENST00000374144.3:c.881C>A	chr10.hg19:g.50531471C>A	ENSP00000363259:p.Ala294Asp	135.0	0.0		103.0	31.0	NM_001135196	A0AVL8	Missense_Mutation	SNP	ENST00000374144.3	hg19	CCDS44387.1	.	.	.	.	.	.	.	.	.	.	C	7.397	0.632030	0.14322	.	.	ENSG00000177354	ENST00000323868;ENST00000374144	T;T	0.15017	2.46;3.6	5.4	3.31	0.37934	.	0.783434	0.11097	N	0.600073	T	0.12518	0.0304	L	0.33485	1.01	0.09310	N	1	B	0.17667	0.023	B	0.17433	0.018	T	0.24657	-1.0154	10	0.30854	T	0.27	.	6.1116	0.20104	0.1483:0.6378:0.1283:0.0856	.	294	Q711Q0-3	.	D	294	ENSP00000318713:A294D;ENSP00000363259:A294D	ENSP00000318713:A294D	A	+	2	0	C10orf71	50201477	0.026000	0.19158	0.002000	0.10522	0.005000	0.04900	2.679000	0.46909	1.259000	0.44117	0.561000	0.74099	GCT	.	.		0.542	C10orf71-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047984.2	NM_199459	
TMEM26	219623	hgsc.bcm.edu	37	10	63212811	63212811	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:63212811A>G	ENST00000399298.3	-	1	397	c.29T>C	c.(28-30)cTg>cCg	p.L10P	TMEM26_ENST00000399293.1_Missense_Mutation_p.L10P|RP11-809M12.1_ENST00000389640.4_RNA	NM_178505.6	NP_848600.2	Q6ZUK4	TMM26_HUMAN	transmembrane protein 26	10						integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(11)|prostate(1)|skin(2)|urinary_tract(1)	18	Prostate(12;0.0112)					CCGAGTGGCCAGGGCGTTAAG	0.677																																					p.L10P		Atlas-SNP	.											.	TMEM26	47	.	0			c.T29C						.						59.0	70.0	66.0					10																	63212811		2105	4229	6334	SO:0001583	missense	219623	exon1			GTGGCCAGGGCGT	BC042872	CCDS41530.1	10q21.3	2008-10-20			ENSG00000196932	ENSG00000196932			28550	protein-coding gene	gene with protein product						12477932	Standard	NM_178505		Approved	MGC35010, Em:AC068892.1	uc001jlo.2	Q6ZUK4	OTTHUMG00000018293	ENST00000399298.3:c.29T>C	chr10.hg19:g.63212811A>G	ENSP00000382237:p.Leu10Pro	97.0	0.0		88.0	26.0	NM_178505	Q6ZVM0|Q8IVN9	Missense_Mutation	SNP	ENST00000399298.3	hg19	CCDS41530.1	.	.	.	.	.	.	.	.	.	.	A	15.35	2.808152	0.50421	.	.	ENSG00000196932	ENST00000399298;ENST00000399293	.	.	.	5.23	4.07	0.47477	.	0.256767	0.32802	N	0.005625	T	0.76271	0.3964	M	0.71036	2.16	0.58432	D	0.999999	D	0.89917	1.0	D	0.76071	0.987	T	0.78219	-0.2289	9	0.87932	D	0	-29.0541	12.1911	0.54273	0.8571:0.1429:0.0:0.0	.	10	Q6ZUK4	TMM26_HUMAN	P	10	.	ENSP00000382232:L10P	L	-	2	0	TMEM26	62882817	1.000000	0.71417	1.000000	0.80357	0.149000	0.21700	5.779000	0.68948	0.973000	0.38340	0.533000	0.62120	CTG	.	.		0.677	TMEM26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359121.1	NM_178505	
GRID1	2894	hgsc.bcm.edu	37	10	87379775	87379775	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:87379775A>C	ENST00000327946.7	-	14	2294	c.2209T>G	c.(2209-2211)Tac>Gac	p.Y737D	GRID1_ENST00000536331.1_Missense_Mutation_p.Y308D	NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	737					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AGGAAGGCGTAGTTCCCCTTC	0.532										Multiple Myeloma(13;0.14)																											p.Y737D		Atlas-SNP	.											.	GRID1	204	.	0			c.T2209G						.						109.0	79.0	89.0					10																	87379775		2203	4300	6503	SO:0001583	missense	2894	exon14			AGGCGTAGTTCCC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.2209T>G	chr10.hg19:g.87379775A>C	ENSP00000330148:p.Tyr737Asp	153.0	0.0		71.0	26.0	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	hg19	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.395647	0.83011	.	.	ENSG00000182771	ENST00000327946;ENST00000536331	T;T	0.27557	1.66;1.66	5.28	5.28	0.74379	Extracellular solute-binding protein, family 3 (1);Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.56992	0.2023	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62746	-0.6789	10	0.87932	D	0	.	14.3972	0.67020	1.0:0.0:0.0:0.0	.	737	Q9ULK0	GRID1_HUMAN	D	737;308	ENSP00000330148:Y737D;ENSP00000444455:Y308D	ENSP00000330148:Y737D	Y	-	1	0	GRID1	87369755	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.297000	0.96120	1.987000	0.57996	0.459000	0.35465	TAC	.	.		0.532	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
ANKRD1	27063	hgsc.bcm.edu	37	10	92678913	92678913	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:92678913A>G	ENST00000371697.3	-	3	568	c.320T>C	c.(319-321)gTa>gCa	p.V107A		NM_014391.2	NP_055206.2	Q15327	ANKR1_HUMAN	ankyrin repeat domain 1 (cardiac muscle)	107					cardiac muscle tissue morphogenesis (GO:0055008)|cellular lipid metabolic process (GO:0044255)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|skeletal muscle cell differentiation (GO:0035914)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I band (GO:0031674)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|p53 binding (GO:0002039)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|titin binding (GO:0031432)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|prostate(3)|skin(1)	27		Colorectal(252;0.0475)				TGGTTCCTTTACAACTGGAAC	0.353																																					p.V107A		Atlas-SNP	.											.	ANKRD1	50	.	0			c.T320C						.						103.0	101.0	102.0					10																	92678913		2203	4300	6503	SO:0001583	missense	27063	exon3			TCCTTTACAACTG	X83703	CCDS7412.1	10q23.33	2014-09-17			ENSG00000148677	ENSG00000148677		"""Ankyrin repeat domain containing"""	15819	protein-coding gene	gene with protein product		609599				7730328	Standard	NM_014391		Approved	C-193, ALRP, CARP, CVARP, MCARP	uc001khe.1	Q15327	OTTHUMG00000018734	ENST00000371697.3:c.320T>C	chr10.hg19:g.92678913A>G	ENSP00000360762:p.Val107Ala	64.0	0.0		60.0	20.0	NM_014391	Q96LE7	Missense_Mutation	SNP	ENST00000371697.3	hg19	CCDS7412.1	.	.	.	.	.	.	.	.	.	.	A	0.061	-1.224621	0.01530	.	.	ENSG00000148677	ENST00000371697	T	0.66280	-0.2	5.49	0.366	0.16136	.	0.541157	0.18123	N	0.150986	T	0.32615	0.0835	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25363	-1.0134	10	0.02654	T	1	.	5.1086	0.14796	0.6616:0.0:0.2165:0.1219	.	107	Q15327	ANKR1_HUMAN	A	107	ENSP00000360762:V107A	ENSP00000360762:V107A	V	-	2	0	ANKRD1	92668893	0.219000	0.23619	0.004000	0.12327	0.086000	0.17979	2.191000	0.42640	-0.114000	0.11936	-0.274000	0.10170	GTA	.	.		0.353	ANKRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049357.1	NM_014391	
MYOF	26509	hgsc.bcm.edu	37	10	95072901	95072901	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:95072901T>A	ENST00000359263.4	-	51	5764	c.5765A>T	c.(5764-5766)gAc>gTc	p.D1922V	MYOF_ENST00000358334.5_Missense_Mutation_p.D1909V|MYOF_ENST00000371502.4_Missense_Mutation_p.D1912V|MYOF_ENST00000371501.4_Missense_Mutation_p.D1922V	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1922					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						CGGAATCATGTCCAATCTGCA	0.483																																					p.D1922V		Atlas-SNP	.											.	MYOF	177	.	0			c.A5765T						.						229.0	222.0	224.0					10																	95072901		1985	4171	6156	SO:0001583	missense	26509	exon51			ATCATGTCCAATC	AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5765A>T	chr10.hg19:g.95072901T>A	ENSP00000352208:p.Asp1922Val	100.0	0.0		75.0	20.0	NM_013451	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	ENST00000359263.4	hg19	CCDS41551.1	.	.	.	.	.	.	.	.	.	.	T	18.53	3.644831	0.67358	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.7	5.42	5.42	0.78866	C2 calcium/lipid-binding domain, CaLB (1);	0.485741	0.26638	N	0.023273	D	0.84710	0.5532	M	0.73962	2.25	0.58432	D	0.999999	B;B	0.19331	0.035;0.023	B;B	0.30716	0.119;0.031	T	0.83050	-0.0153	10	0.62326	D	0.03	-18.6733	15.621	0.76805	0.0:0.0:0.0:1.0	.	1909;1922	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	V	1909;1922;1922;1912	ENSP00000351094:D1909V;ENSP00000352208:D1922V;ENSP00000360556:D1922V;ENSP00000360557:D1912V	ENSP00000351094:D1909V	D	-	2	0	MYOF	95062891	1.000000	0.71417	1.000000	0.80357	0.727000	0.41649	4.957000	0.63652	2.270000	0.75569	0.523000	0.50628	GAC	.	.		0.483	MYOF-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049423.2	NM_013451	
PIK3AP1	118788	hgsc.bcm.edu	37	10	98369550	98369550	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:98369550C>A	ENST00000339364.5	-	14	2208	c.2089G>T	c.(2089-2091)Ggc>Tgc	p.G697C	PIK3AP1_ENST00000371109.3_Missense_Mutation_p.G296C|PIK3AP1_ENST00000371110.2_Missense_Mutation_p.G519C	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1	697					negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TTCCTGGGGCCACTCTCATAG	0.552																																					p.G697C		Atlas-SNP	.											.	PIK3AP1	111	.	0			c.G2089T						.						225.0	232.0	230.0					10																	98369550		2203	4300	6503	SO:0001583	missense	118788	exon14			TGGGGCCACTCTC	AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.2089G>T	chr10.hg19:g.98369550C>A	ENSP00000339826:p.Gly697Cys	137.0	0.0		103.0	54.0	NM_152309	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Missense_Mutation	SNP	ENST00000339364.5	hg19	CCDS31259.1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.350716	0.82132	.	.	ENSG00000155629	ENST00000339364;ENST00000371110;ENST00000371109	T;T;T	0.47528	0.84;0.84;0.84	5.69	5.69	0.88448	.	0.317119	0.34507	N	0.003916	T	0.59824	0.2222	L	0.47716	1.5	0.44825	D	0.997837	D;D	0.71674	0.988;0.998	P;P	0.61592	0.73;0.891	T	0.55661	-0.8106	10	0.44086	T	0.13	-25.2151	16.8983	0.86106	0.0:1.0:0.0:0.0	.	697;296	Q6ZUJ8;Q6ZUJ8-3	BCAP_HUMAN;.	C	697;519;296	ENSP00000339826:G697C;ENSP00000360151:G519C;ENSP00000360150:G296C	ENSP00000339826:G697C	G	-	1	0	PIK3AP1	98359540	0.870000	0.30015	0.994000	0.49952	0.960000	0.62799	1.361000	0.34136	2.840000	0.97914	0.655000	0.94253	GGC	.	.		0.552	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049619.2	NM_152309	
ARHGAP19	84986	hgsc.bcm.edu	37	10	99025682	99025682	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:99025682T>A	ENST00000358531.4	-	2	285	c.257A>T	c.(256-258)aAg>aTg	p.K86M	ARHGAP19_ENST00000355366.5_Missense_Mutation_p.K77M|ARHGAP19-SLIT1_ENST00000316676.8_Missense_Mutation_p.K86M|ARHGAP19-SLIT1_ENST00000358308.3_Missense_Mutation_p.K86M|ARHGAP19-SLIT1_ENST00000453547.2_Missense_Mutation_p.K86M|ARHGAP19_ENST00000371027.1_Missense_Mutation_p.K77M	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19	86					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GCCAGGCAACTTAAGGTCCAC	0.527																																					p.K86M		Atlas-SNP	.											.	ARHGAP19	72	.	0			c.A257T						.						86.0	81.0	83.0					10																	99025682		2203	4300	6503	SO:0001583	missense	84986	exon2			GGCAACTTAAGGT	AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.257A>T	chr10.hg19:g.99025682T>A	ENSP00000351333:p.Lys86Met	132.0	0.0		112.0	38.0	NM_001204300	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	Missense_Mutation	SNP	ENST00000358531.4	hg19	CCDS7454.2	.	.	.	.	.	.	.	.	.	.	T	21.7	4.195050	0.78902	.	.	ENSG00000213390	ENST00000453547;ENST00000316676;ENST00000355366;ENST00000358531;ENST00000371027;ENST00000358308	T;T;T;T;T;T	0.12465	2.68;2.71;2.72;2.71;2.72;2.68	5.94	4.78	0.61160	.	0.000000	0.85682	U	0.000000	T	0.24353	0.0590	L	0.29908	0.895	0.41772	D	0.989775	D;D;D	0.76494	0.999;0.999;0.999	D;P;D	0.68039	0.955;0.906;0.946	T	0.01617	-1.1311	10	0.87932	D	0	-15.8445	13.1382	0.59421	0.0:0.0:0.1336:0.8664	.	86;86;77	Q14CB8-6;Q14CB8;Q14CB8-3	.;RHG19_HUMAN;.	M	86;86;77;86;77;86	ENSP00000414774:K86M;ENSP00000324468:K86M;ENSP00000347526:K77M;ENSP00000351333:K86M;ENSP00000360066:K77M;ENSP00000351058:K86M	ENSP00000324468:K86M	K	-	2	0	ARHGAP19	99015672	1.000000	0.71417	0.997000	0.53966	0.910000	0.53928	3.469000	0.53093	1.021000	0.39600	0.455000	0.32223	AAG	.	.		0.527	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049647.2	NM_032900	
LDB1	8861	hgsc.bcm.edu	37	10	103870894	103870894	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:103870894T>A	ENST00000425280.1	-	4	523	c.181A>T	c.(181-183)Aca>Tca	p.T61S	LDB1_ENST00000361198.5_Missense_Mutation_p.T25S|LDB1_ENST00000490751.1_5'UTR	NM_001113407.1	NP_001106878.1	Q86U70	LDB1_HUMAN	LIM domain binding 1	61					anterior/posterior axis specification (GO:0009948)|cellular component assembly (GO:0022607)|cerebellar Purkinje cell differentiation (GO:0021702)|epithelial structure maintenance (GO:0010669)|gastrulation with mouth forming second (GO:0001702)|hair follicle development (GO:0001942)|head development (GO:0060322)|histone H3-K4 acetylation (GO:0043973)|multicellular organismal development (GO:0007275)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron differentiation (GO:0030182)|positive regulation of cell adhesion (GO:0045785)|positive regulation of hemoglobin biosynthetic process (GO:0046985)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|transcription-dependent tethering of RNA polymerase II gene DNA at nuclear periphery (GO:0000972)|Wnt signaling pathway (GO:0016055)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|enzyme binding (GO:0019899)|LIM domain binding (GO:0030274)|protein homodimerization activity (GO:0042803)|RNA polymerase II activating transcription factor binding (GO:0001102)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)	21		Colorectal(252;0.122)		Epithelial(162;1.11e-07)|all cancers(201;1.82e-06)		CCATATGGTGTGTGCCTCCTG	0.557																																					p.T61S		Atlas-SNP	.											.	LDB1	61	.	0			c.A181T						.						144.0	144.0	144.0					10																	103870894		2203	4300	6503	SO:0001583	missense	8861	exon4			ATGGTGTGTGCCT	AF068652	CCDS7528.1, CCDS44472.1	10q24-q25	2008-08-01			ENSG00000198728	ENSG00000198728			6532	protein-coding gene	gene with protein product	"""carboxy terminal LIM domain protein 2"""	603451				9503020, 9799849	Standard	NM_003893		Approved	NLI, CLIM2	uc009xwz.3	Q86U70	OTTHUMG00000018950	ENST00000425280.1:c.181A>T	chr10.hg19:g.103870894T>A	ENSP00000392466:p.Thr61Ser	53.0	0.0		49.0	14.0	NM_001113407	B4DUC4|O75479|O96010|Q1EQX1|Q9UGM4	Missense_Mutation	SNP	ENST00000425280.1	hg19	CCDS44472.1	.	.	.	.	.	.	.	.	.	.	T	18.22	3.576407	0.65878	.	.	ENSG00000198728	ENST00000361198;ENST00000425280	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.67429	0.2892	L	0.54323	1.7	0.58432	D	0.999999	P;B	0.52842	0.956;0.03	P;B	0.62184	0.899;0.03	T	0.62167	-0.6911	9	0.13108	T	0.6	-13.3938	15.6898	0.77442	0.0:0.0:0.0:1.0	.	61;25	Q86U70;Q86U70-3	LDB1_HUMAN;.	S	25;61	.	ENSP00000354616:T25S	T	-	1	0	LDB1	103860884	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.771000	0.68881	2.199000	0.70637	0.459000	0.35465	ACA	.	.		0.557	LDB1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113407	
CALHM1	255022	hgsc.bcm.edu	37	10	105215321	105215321	+	Missense_Mutation	SNP	T	T	A	rs536458604	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:105215321T>A	ENST00000329905.5	-	2	875	c.739A>T	c.(739-741)Atc>Ttc	p.I247F	RP11-225H22.4_ENST00000411906.1_RNA|CALHM2_ENST00000393235.1_5'Flank	NM_001001412.3	NP_001001412.3	Q8IU99	CAHM1_HUMAN	calcium homeostasis modulator 1	247					ATP transport (GO:0015867)|cation transport (GO:0006812)|protein homooligomerization (GO:0051260)|regulation of ion transmembrane transport (GO:0034765)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|identical protein binding (GO:0042802)|voltage-gated ion channel activity (GO:0005244)			large_intestine(2)|liver(1)|lung(5)|ovary(1)	9						AACTGCTGGATGCAGACCTTG	0.612																																					p.I247F		Atlas-SNP	.											.	CALHM1	33	.	0			c.A739T						.						88.0	68.0	75.0					10																	105215321		2203	4300	6503	SO:0001583	missense	255022	exon2			GCTGGATGCAGAC	BC036208	CCDS7550.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000185933	ENSG00000185933			23494	protein-coding gene	gene with protein product		612234	"""family with sequence similarity 26, member C"""	FAM26C		18585350	Standard	NM_001001412		Approved		uc001kxe.2	Q8IU99	OTTHUMG00000018991	ENST00000329905.5:c.739A>T	chr10.hg19:g.105215321T>A	ENSP00000329926:p.Ile247Phe	96.0	0.0		83.0	17.0	NM_001001412	Q5W091	Missense_Mutation	SNP	ENST00000329905.5	hg19	CCDS7550.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.039512	0.93630	.	.	ENSG00000185933	ENST00000329905	T	0.24723	1.84	5.26	5.26	0.73747	.	0.104705	0.64402	D	0.000004	T	0.50888	0.1642	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.54768	-0.8244	10	0.72032	D	0.01	-41.1511	15.161	0.72785	0.0:0.0:0.0:1.0	.	247	Q8IU99	CAHM1_HUMAN	F	247	ENSP00000329926:I247F	ENSP00000329926:I247F	I	-	1	0	CALHM1	105205311	1.000000	0.71417	0.998000	0.56505	0.974000	0.67602	5.830000	0.69324	1.989000	0.58080	0.379000	0.24179	ATC	.	.		0.612	CALHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050165.1	NM_001001412	
ADD3	120	hgsc.bcm.edu	37	10	111879082	111879082	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:111879082A>T	ENST00000356080.4	+	7	1198	c.831A>T	c.(829-831)caA>caT	p.Q277H	ADD3_ENST00000277900.8_Missense_Mutation_p.Q277H|ADD3_ENST00000360162.3_Missense_Mutation_p.Q277H	NM_016824.3	NP_058432.1	Q9UEY8	ADDG_HUMAN	adducin 3 (gamma)	277						cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|prostate(1)|skin(3)	29		Breast(234;0.052)|Lung NSC(174;0.223)		Epithelial(162;4.15e-05)|all cancers(201;0.000587)|BRCA - Breast invasive adenocarcinoma(275;0.0742)		AGAGAATTCAACTGCAGAAGG	0.423																																					p.Q277H		Atlas-SNP	.											.	ADD3	89	.	0			c.A831T						.						94.0	95.0	94.0					10																	111879082		2203	4300	6503	SO:0001583	missense	120	exon7			AATTCAACTGCAG	U37122	CCDS7561.1, CCDS7562.1	10q25.2	2005-11-08			ENSG00000148700	ENSG00000148700			245	protein-coding gene	gene with protein product		601568		ADDL		8893809	Standard	XM_005269529		Approved		uc001kyv.3	Q9UEY8	OTTHUMG00000019032	ENST00000356080.4:c.831A>T	chr10.hg19:g.111879082A>T	ENSP00000348381:p.Gln277His	171.0	0.0		154.0	42.0	NM_001121	D3DRA8|O43243|Q5VU09|Q92773|Q9UEY7	Missense_Mutation	SNP	ENST00000356080.4	hg19	CCDS7561.1	.	.	.	.	.	.	.	.	.	.	A	14.78	2.638071	0.47153	.	.	ENSG00000148700	ENST00000360162;ENST00000356080;ENST00000277900	T;T;T	0.22336	1.96;1.96;1.96	6.17	-0.229	0.13094	Class II aldolase/adducin, N-terminal (3);	0.095691	0.64402	D	0.000001	T	0.19248	0.0462	N	0.16656	0.425	0.37856	D	0.929568	B;P	0.35982	0.431;0.531	P;B	0.46419	0.516;0.382	T	0.11717	-1.0576	10	0.59425	D	0.04	-8.7629	13.5282	0.61607	0.6468:0.0:0.3532:0.0	.	277;277	Q9UEY8;Q9UEY8-2	ADDG_HUMAN;.	H	277	ENSP00000353286:Q277H;ENSP00000348381:Q277H;ENSP00000277900:Q277H	ENSP00000277900:Q277H	Q	+	3	2	ADD3	111869072	1.000000	0.71417	0.993000	0.49108	0.962000	0.63368	1.199000	0.32235	-0.253000	0.09514	-1.139000	0.01908	CAA	.	.		0.423	ADD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000050289.1	NM_019903	
ATRNL1	26033	hgsc.bcm.edu	37	10	117059542	117059542	+	Splice_Site	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:117059542A>G	ENST00000355044.3	+	16	2541		c.e16-1		ATRNL1_ENST00000423111.2_5'Flank|ATRNL1_ENST00000303745.7_5'Flank	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1						G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		TGTTGTTTACAGAAAGTATCA	0.353																																					.		Atlas-SNP	.											.	ATRNL1	219	.	0			c.2416-2A>G						.						86.0	83.0	84.0					10																	117059542		2203	4300	6503	SO:0001630	splice_region_variant	26033	exon16			GTTTACAGAAAGT	AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2416-1A>G	chr10.hg19:g.117059542A>G		83.0	0.0		68.0	15.0	NM_207303	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Splice_Site	SNP	ENST00000355044.3	hg19	CCDS7592.1	.	.	.	.	.	.	.	.	.	.	A	18.44	3.625411	0.66901	.	.	ENSG00000107518	ENST00000355044	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3786	0.83431	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATRNL1	117049532	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.256000	0.78350	2.323000	0.78572	0.528000	0.53228	.	.	.		0.353	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050507.3	XM_049349	Intron
TACC2	10579	hgsc.bcm.edu	37	10	123970404	123970404	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:123970404A>T	ENST00000369005.1	+	9	6804	c.6464A>T	c.(6463-6465)cAg>cTg	p.Q2155L	TACC2_ENST00000369001.1_De_novo_Start_OutOfFrame|TACC2_ENST00000358010.1_Missense_Mutation_p.Q301L|TACC2_ENST00000360561.3_Missense_Mutation_p.Q233L|TACC2_ENST00000515273.1_Missense_Mutation_p.Q2159L|TACC2_ENST00000453444.2_Missense_Mutation_p.Q2159L|TACC2_ENST00000369000.1_De_novo_Start_OutOfFrame|TACC2_ENST00000260733.3_Missense_Mutation_p.Q233L|TACC2_ENST00000369004.3_Missense_Mutation_p.Q233L|TACC2_ENST00000515603.1_Missense_Mutation_p.Q2110L|TACC2_ENST00000334433.3_Missense_Mutation_p.Q2155L|TACC2_ENST00000368999.1_Missense_Mutation_p.Q233L|TACC2_ENST00000513429.1_Missense_Mutation_p.Q301L	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	2155					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				GAGACGCAACAGGAGCCAGAT	0.517																																					p.Q2155L		Atlas-SNP	.											.	TACC2	271	.	0			c.A6464T						.						102.0	115.0	111.0					10																	123970404		2203	4300	6503	SO:0001583	missense	10579	exon9			CGCAACAGGAGCC	AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.6464A>T	chr10.hg19:g.123970404A>T	ENSP00000358001:p.Gln2155Leu	65.0	0.0		42.0	8.0	NM_206862	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	ENST00000369005.1	hg19	CCDS7626.1	.	.	.	.	.	.	.	.	.	.	A	0.105	-1.146426	0.01714	.	.	ENSG00000138162	ENST00000369005;ENST00000513429;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000358010;ENST00000453444;ENST00000340076;ENST00000360561;ENST00000368999;ENST00000369004;ENST00000260733;ENST00000514539	T;T;T;T;T;T;T;T;T;T;T;T	0.08896	3.98;3.56;4.01;4.0;3.98;3.56;4.01;3.44;3.4;3.4;3.45;3.04	5.54	-0.0152	0.13977	.	0.247890	0.21274	N	0.077276	T	0.11452	0.0279	M	0.63428	1.95	0.09310	N	1	P;B;B;B;B;P;B;P;B	0.40834	0.73;0.258;0.258;0.258;0.258;0.515;0.374;0.604;0.258	B;B;B;B;B;B;B;B;B	0.39531	0.302;0.103;0.103;0.196;0.103;0.135;0.208;0.208;0.196	T	0.15752	-1.0426	10	0.31617	T	0.26	-0.4321	17.5354	0.87829	0.2934:0.7065:0.0:0.0	.	250;2159;233;2110;2159;233;233;301;2155	E9PGB3;E9PBC6;D6RAA5;E7EMZ9;B7ZMJ9;O95359-6;O95359-1;O95359-5;O95359	.;.;.;.;.;.;.;.;TACC2_HUMAN	L	2155;301;2159;2110;2155;301;2159;2145;233;233;233;233;250	ENSP00000358001:Q2155L;ENSP00000425062:Q301L;ENSP00000424467:Q2159L;ENSP00000427618:Q2110L;ENSP00000334280:Q2155L;ENSP00000350701:Q301L;ENSP00000395048:Q2159L;ENSP00000353763:Q233L;ENSP00000357995:Q233L;ENSP00000422815:Q233L;ENSP00000260733:Q233L;ENSP00000420967:Q250L	ENSP00000260733:Q233L	Q	+	2	0	TACC2	123960394	0.142000	0.22610	0.008000	0.14137	0.137000	0.21094	0.450000	0.21762	0.039000	0.15632	0.533000	0.62120	CAG	.	.		0.517	TACC2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090004.1		
FAM24A	118670	hgsc.bcm.edu	37	10	124672386	124672386	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:124672386T>A	ENST00000368894.1	+	3	355	c.234T>A	c.(232-234)tcT>tcA	p.S78S		NM_001029888.1	NP_001025059.1	A6NFZ4	FA24A_HUMAN	family with sequence similarity 24, member A	78						extracellular region (GO:0005576)				large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	9		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.124)|COAD - Colon adenocarcinoma(40;0.141)		CTTGTCCATCTCTCCAGTGCT	0.527																																					p.S78S		Atlas-SNP	.											.	FAM24A	16	.	0			c.T234A						.						173.0	124.0	141.0					10																	124672386		2203	4300	6503	SO:0001819	synonymous_variant	118670	exon3			TCCATCTCTCCAG		CCDS31304.1	10q26.13	2008-08-27			ENSG00000203795	ENSG00000203795			23470	protein-coding gene	gene with protein product							Standard	NM_001029888		Approved	AC073585.4	uc001lgv.3	A6NFZ4	OTTHUMG00000019193	ENST00000368894.1:c.234T>A	chr10.hg19:g.124672386T>A		127.0	0.0		116.0	40.0	NM_001029888		Silent	SNP	ENST00000368894.1	hg19	CCDS31304.1																																																																																			.	.		0.527	FAM24A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050824.1	XM_058332	
VENTX	27287	hgsc.bcm.edu	37	10	135053795	135053795	+	Silent	SNP	G	G	A	rs376398632|rs528996055		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr10:135053795G>A	ENST00000325980.9	+	3	1273	c.762G>A	c.(760-762)acG>acA	p.T254T		NM_014468.3	NP_055283.1	O95231	VENTX_HUMAN	VENT homeobox	254					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			NS(1)|endometrium(1)|large_intestine(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(1)	14		all_cancers(35;4.15e-10)|all_epithelial(44;2.07e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;7.8e-06)|Epithelial(32;9.31e-06)|all cancers(32;1.19e-05)		TGCCACAGACGGGGGATGCAT	0.657																																					p.T254T		Atlas-SNP	.											VENTX,right_upper_lobe,carcinoma,0,1	VENTX	24	.	0			c.G762A						.						16.0	18.0	17.0					10																	135053795		2026	4029	6055	SO:0001819	synonymous_variant	27287	exon3			ACAGACGGGGGAT	AF068006	CCDS7675.1	10q26.3	2011-06-20	2011-06-01	2005-09-27	ENSG00000151650	ENSG00000151650		"""Homeoboxes / ANTP class : NKL subclass"""	13639	protein-coding gene	gene with protein product		607158	"""VENT-like homeobox 2"", ""VENT homeobox homolog (Xenopus laevis)"""	VENTX2		10790436	Standard	NM_014468		Approved	HPX42B	uc010quy.1	O95231	OTTHUMG00000019307	ENST00000325980.9:c.762G>A	chr10.hg19:g.135053795G>A		50.0	0.0		52.0	17.0	NM_014468	Q32MZ3	Silent	SNP	ENST00000325980.9	hg19	CCDS7675.1																																																																																			.	.		0.657	VENTX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051116.4	NM_014468	
PKP3	11187	hgsc.bcm.edu	37	11	399156	399156	+	Silent	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:399156A>G	ENST00000331563.2	+	5	1309	c.1233A>G	c.(1231-1233)acA>acG	p.T411T		NM_007183.2	NP_009114.1	Q9Y446	PKP3_HUMAN	plakophilin 3	411					desmosome assembly (GO:0002159)|establishment of protein localization to plasma membrane (GO:0090002)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|desmosome (GO:0030057)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)			breast(1)|central_nervous_system(1)|endometrium(3)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGCTGCGGACACTGCGGGAGC	0.612																																					p.T411T		Atlas-SNP	.											.	PKP3	36	.	0			c.A1233G						.						123.0	104.0	110.0					11																	399156		2187	4290	6477	SO:0001819	synonymous_variant	11187	exon5			GCGGACACTGCGG	Z98265	CCDS7695.1	11p15	2013-02-14			ENSG00000184363	ENSG00000184363		"""Armadillo repeat containing"""	9025	protein-coding gene	gene with protein product		605561				10374265	Standard	XM_005252760		Approved		uc001lpc.3	Q9Y446	OTTHUMG00000119068	ENST00000331563.2:c.1233A>G	chr11.hg19:g.399156A>G		106.0	0.0		74.0	18.0	NM_007183	F8J390|Q53EX8	Silent	SNP	ENST00000331563.2	hg19	CCDS7695.1																																																																																			.	.		0.612	PKP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239281.1	NM_007183	
KRTAP5-6	440023	hgsc.bcm.edu	37	11	1718756	1718756	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:1718756G>A	ENST00000382160.1	+	1	332	c.281G>A	c.(280-282)tGc>tAc	p.C94Y		NM_001012416.1	NP_001012416.1	Q6L8G9	KRA56_HUMAN	keratin associated protein 5-6	94	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				endometrium(1)|large_intestine(2)|lung(6)|skin(1)	10		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00136)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		TGCAAGCCCTGCTACTGTTCC	0.637																																					p.C94Y		Atlas-SNP	.											.	KRTAP5-6	18	.	0			c.G281A						.						93.0	111.0	105.0					11																	1718756		2202	4299	6501	SO:0001583	missense	440023	exon1			AGCCCTGCTACTG	AB126075	CCDS31332.1	11p15.5	2008-02-05			ENSG00000205864	ENSG00000205864		"""Keratin associated proteins"""	23600	protein-coding gene	gene with protein product						15144888	Standard	NM_001012416		Approved	KRTAP5.6	uc001lua.3	Q6L8G9	OTTHUMG00000043932	ENST00000382160.1:c.281G>A	chr11.hg19:g.1718756G>A	ENSP00000371595:p.Cys94Tyr	119.0	0.0		90.0	29.0	NM_001012416	A1L452	Missense_Mutation	SNP	ENST00000382160.1	hg19	CCDS31332.1	.	.	.	.	.	.	.	.	.	.	g	0.177	-1.065766	0.01934	.	.	ENSG00000205864	ENST00000382160	T	0.08984	3.03	3.75	1.59	0.23543	.	.	.	.	.	T	0.11196	0.0273	M	0.74467	2.265	0.21579	N	0.999635	P	0.36249	0.545	B	0.35607	0.206	T	0.17077	-1.0381	9	0.72032	D	0.01	.	6.1755	0.20441	0.0:0.207:0.5802:0.2128	.	94	Q6L8G9	KRA56_HUMAN	Y	94	ENSP00000371595:C94Y	ENSP00000371595:C94Y	C	+	2	0	KRTAP5-6	1675332	0.992000	0.36948	0.010000	0.14722	0.040000	0.13550	5.348000	0.66004	0.507000	0.28148	0.399000	0.26434	TGC	.	.		0.637	KRTAP5-6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000102339.2		
OR51L1	119682	hgsc.bcm.edu	37	11	5020231	5020231	+	Missense_Mutation	SNP	A	A	G	rs61910724		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:5020231A>G	ENST00000321543.1	+	1	19	c.19A>G	c.(19-21)Agt>Ggt	p.S7G		NM_001004755.1	NP_001004755.1	Q8NGJ5	O51L1_HUMAN	olfactory receptor, family 51, subfamily L, member 1	7						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(19)|skin(2)|stomach(1)	31		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.75e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGGAATAACAGTGATGCTGT	0.433																																					p.S7G		Atlas-SNP	.											.	OR51L1	60	.	0			c.A19G						.						168.0	164.0	165.0					11																	5020231		2201	4298	6499	SO:0001583	missense	119682	exon1			AATAACAGTGATG	AB065799	CCDS31369.1	11p15.4	2012-08-09			ENSG00000176798	ENSG00000176798		"""GPCR / Class A : Olfactory receptors"""	14759	protein-coding gene	gene with protein product							Standard	NM_001004755		Approved		uc010qyu.2	Q8NGJ5	OTTHUMG00000066605	ENST00000321543.1:c.19A>G	chr11.hg19:g.5020231A>G	ENSP00000322156:p.Ser7Gly	118.0	0.0		106.0	65.0	NM_001004755	Q6IFE5	Missense_Mutation	SNP	ENST00000321543.1	hg19	CCDS31369.1	.	.	.	.	.	.	.	.	.	.	A	14.38	2.519298	0.44866	.	.	ENSG00000176798	ENST00000321543	T	0.54071	0.59	5.58	5.58	0.84498	.	0.281465	0.25660	N	0.029150	T	0.56659	0.2000	M	0.89658	3.05	0.23198	N	0.998133	P	0.41393	0.748	B	0.31390	0.129	T	0.65894	-0.6057	10	0.72032	D	0.01	.	13.241	0.59997	1.0:0.0:0.0:0.0	.	7	Q8NGJ5	O51L1_HUMAN	G	7	ENSP00000322156:S7G	ENSP00000322156:S7G	S	+	1	0	OR51L1	4976807	0.874000	0.30092	0.903000	0.35520	0.969000	0.65631	5.312000	0.65792	2.343000	0.79666	0.533000	0.62120	AGT	.	A|0.987;C|0.013		0.433	OR51L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142812.1	NM_001004755	
OR52E2	119678	hgsc.bcm.edu	37	11	5080160	5080160	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:5080160T>A	ENST00000321522.2	-	1	697	c.698A>T	c.(697-699)gAa>gTa	p.E233V		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		GAGTCGGGCTTCATGAGTAGG	0.433																																					p.E233V		Atlas-SNP	.											.	OR52E2	63	.	0			c.A698T						.						82.0	76.0	78.0					11																	5080160		2201	4298	6499	SO:0001583	missense	119678	exon1			CGGGCTTCATGAG	AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.698A>T	chr11.hg19:g.5080160T>A	ENSP00000322088:p.Glu233Val	184.0	0.0		155.0	35.0	NM_001005164		Missense_Mutation	SNP	ENST00000321522.2	hg19	CCDS31371.1	.	.	.	.	.	.	.	.	.	.	T	11.74	1.727419	0.30593	.	.	ENSG00000176787	ENST00000321522	T	0.00220	8.52	3.76	3.76	0.43208	GPCR, rhodopsin-like superfamily (1);	0.942816	0.08847	N	0.885004	T	0.00524	0.0017	M	0.92026	3.265	0.09310	N	1	P	0.45986	0.87	P	0.49012	0.598	T	0.47058	-0.9146	10	0.87932	D	0	.	12.3384	0.55081	0.0:0.0:0.0:1.0	.	233	Q8NGJ4	O52E2_HUMAN	V	233	ENSP00000322088:E233V	ENSP00000322088:E233V	E	-	2	0	OR52E2	5036736	0.000000	0.05858	0.745000	0.31077	0.378000	0.30076	0.024000	0.13555	1.963000	0.57068	0.524000	0.50904	GAA	.	.		0.433	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142815.1	NM_001005164	
OR51B6	390058	hgsc.bcm.edu	37	11	5373112	5373112	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:5373112C>T	ENST00000380219.1	+	1	375	c.375C>T	c.(373-375)cgC>cgT	p.R125R	AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	125			R -> H (in dbSNP:rs7479477).	TIRS -> AIHN (in Ref. 1; AAG41682). {ECO:0000305}.	detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTACCATCCGCAGCCCCTTAA	0.468																																					p.R125R		Atlas-SNP	.											.	OR51B6	53	.	0			c.C375T						.						126.0	116.0	119.0					11																	5373112		2201	4297	6498	SO:0001819	synonymous_variant	390058	exon1			CATCCGCAGCCCC		CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.375C>T	chr11.hg19:g.5373112C>T		107.0	0.0		105.0	55.0	NM_001004750		Silent	SNP	ENST00000380219.1	hg19	CCDS31379.1																																																																																			.	.		0.468	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000142960.1	NM_001004750	
OR52B6	340980	hgsc.bcm.edu	37	11	5602597	5602597	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:5602597T>C	ENST00000345043.2	+	1	491	c.491T>C	c.(490-492)gTc>gCc	p.V164A	HBG2_ENST00000380259.2_Intron|AC015691.13_ENST00000394793.2_RNA	NM_001005162.2	NP_001005162.2	Q8NGF0	O52B6_HUMAN	olfactory receptor, family 52, subfamily B, member 6	164						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)	12		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;3.56e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGGAAGATCGTCACTGCCGCC	0.507																																					p.V164A		Atlas-SNP	.											.	OR52B6	37	.	0			c.T491C						.						190.0	198.0	195.0					11																	5602597		2201	4297	6498	SO:0001583	missense	340980	exon1			AGATCGTCACTGC	AB065858	CCDS41611.1	11p15.4	2012-08-09			ENSG00000187747	ENSG00000187747		"""GPCR / Class A : Olfactory receptors"""	15211	protein-coding gene	gene with protein product							Standard	NM_001005162		Approved		uc010qzi.2	Q8NGF0	OTTHUMG00000066906	ENST00000345043.2:c.491T>C	chr11.hg19:g.5602597T>C	ENSP00000341581:p.Val164Ala	48.0	0.0		45.0	11.0	NM_001005162	Q6IFI7	Missense_Mutation	SNP	ENST00000345043.2	hg19	CCDS41611.1	.	.	.	.	.	.	.	.	.	.	T	1.402	-0.577869	0.03854	.	.	ENSG00000187747	ENST00000345043	T	0.39056	1.1	5.15	-4.92	0.03075	GPCR, rhodopsin-like superfamily (1);	1.912130	0.03822	N	0.267676	T	0.19327	0.0464	N	0.03209	-0.39	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.19160	-1.0314	10	0.23302	T	0.38	.	9.9	0.41342	0.0:0.4874:0.0977:0.4149	.	164	Q8NGF0	O52B6_HUMAN	A	164	ENSP00000341581:V164A	ENSP00000341581:V164A	V	+	2	0	OR52B6	5559173	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-4.627000	0.00206	-0.690000	0.05142	-0.137000	0.14449	GTC	.	.		0.507	OR52B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000143397.1	NM_001005162	
OR56A4	120793	hgsc.bcm.edu	37	11	6024147	6024147	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:6024147A>T	ENST00000330728.4	-	1	277	c.232T>A	c.(232-234)Tgg>Agg	p.W78R		NM_001005179.2	NP_001005179.2	Q8NGH8	O56A4_HUMAN	olfactory receptor, family 56, subfamily A, member 4	26						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	32		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;7.01e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		CAGTGCTGCCAGCTCTGGAAG	0.557																																					p.W78R		Atlas-SNP	.											.	OR56A4	66	.	0			c.T232A						.						86.0	81.0	83.0					11																	6024147		2201	4296	6497	SO:0001583	missense	120793	exon1			GCTGCCAGCTCTG	BK004255	CCDS31404.1	11p15.4	2012-08-09			ENSG00000183389	ENSG00000183389		"""GPCR / Class A : Olfactory receptors"""	14791	protein-coding gene	gene with protein product							Standard	NM_001005179		Approved		uc010qzv.2	Q8NGH8	OTTHUMG00000165376	ENST00000330728.4:c.232T>A	chr11.hg19:g.6024147A>T	ENSP00000328215:p.Trp78Arg	169.0	0.0		148.0	34.0	NM_001005179	B9EH17	Missense_Mutation	SNP	ENST00000330728.4	hg19	CCDS31404.1	.	.	.	.	.	.	.	.	.	.	A	15.06	2.720776	0.48728	.	.	ENSG00000183389	ENST00000330728	T	0.00231	8.49	3.62	3.62	0.41486	.	0.910037	0.08857	U	0.883572	T	0.00271	0.0008	L	0.60845	1.875	0.26470	N	0.975298	P	0.48640	0.913	P	0.47891	0.56	T	0.54497	-0.8285	10	0.41790	T	0.15	.	8.6004	0.33740	0.8064:0.1936:0.0:0.0	.	26	Q8NGH8	O56A4_HUMAN	R	78	ENSP00000328215:W78R	ENSP00000328215:W78R	W	-	1	0	OR56A4	5980723	0.000000	0.05858	0.937000	0.37676	0.918000	0.54935	0.238000	0.18004	1.629000	0.50426	0.454000	0.30748	TGG	.	.		0.557	OR56A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383756.2	NM_001005179	
SBF2	81846	hgsc.bcm.edu	37	11	9868576	9868576	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:9868576T>A	ENST00000256190.8	-	23	2998	c.2861A>T	c.(2860-2862)aAg>aTg	p.K954M	RP11-1H15.2_ENST00000533659.1_RNA	NM_030962.3	NP_112224.1	Q86WG5	MTMRD_HUMAN	SET binding factor 2	954	GRAM.				cell death (GO:0008219)|myelination (GO:0042552)|positive regulation of Rab GTPase activity (GO:0032851)|protein tetramerization (GO:0051262)	membrane (GO:0016020)|vacuolar membrane (GO:0005774)	phosphatase activity (GO:0016791)|phosphatase regulator activity (GO:0019208)|phosphatidylinositol binding (GO:0035091)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(4)|endometrium(8)|kidney(2)|large_intestine(8)|lung(16)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	48				all cancers(16;2.88e-11)|Epithelial(150;3.61e-10)|BRCA - Breast invasive adenocarcinoma(625;0.00887)		TGTAATCTTCTTCTCCTTGGT	0.438																																					p.K954M		Atlas-SNP	.											.	SBF2	146	.	0			c.A2861T						.						215.0	183.0	194.0					11																	9868576		2201	4294	6495	SO:0001583	missense	81846	exon23			ATCTTCTTCTCCT	AB051553	CCDS31427.1	11p15.3	2014-09-17	2004-11-12	2004-11-12	ENSG00000133812	ENSG00000133812		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	2135	protein-coding gene	gene with protein product	"""myotubularin related 13"""	607697	"""Charcot-Marie-Tooth neuropathy 4B2 (autosomal recessive, with myelin outfolding)"", ""DENN/MADD domain containing 7B"""	CMT4B2		10644431	Standard	NM_030962		Approved	KIAA1766, MTMR13, DENND7B	uc001mib.2	Q86WG5	OTTHUMG00000165890	ENST00000256190.8:c.2861A>T	chr11.hg19:g.9868576T>A	ENSP00000256190:p.Lys954Met	129.0	0.0		97.0	20.0	NM_030962	Q3MJF0|Q68DQ3|Q6P459|Q6PJD1|Q7Z325|Q7Z621|Q86VE2|Q96FE2|Q9C097	Missense_Mutation	SNP	ENST00000256190.8	hg19	CCDS31427.1	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038572	0.93630	.	.	ENSG00000133812	ENST00000256190	D	0.88509	-2.39	6.03	6.03	0.97812	GRAM (2);	0.000000	0.85682	D	0.000000	D	0.95220	0.8450	M	0.86573	2.825	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95780	0.8816	10	0.87932	D	0	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	954	Q86WG5	MTMRD_HUMAN	M	954	ENSP00000256190:K954M	ENSP00000256190:K954M	K	-	2	0	SBF2	9825152	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.308000	0.77769	0.533000	0.62120	AAG	.	.		0.438	SBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386911.2	NM_030962	
DKK3	27122	hgsc.bcm.edu	37	11	11987363	11987363	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:11987363G>A	ENST00000396505.2	-	7	1061	c.823C>T	c.(823-825)Ccc>Tcc	p.P275S	DKK3_ENST00000326932.4_Missense_Mutation_p.P275S|DKK3_ENST00000525493.1_Missense_Mutation_p.P275S|DKK3_ENST00000527132.1_Intron|DKK3_ENST00000450094.2_Missense_Mutation_p.P247S	NM_015881.5	NP_056965.3	Q9UBP4	DKK3_HUMAN	dickkopf WNT signaling pathway inhibitor 3	275	DKK-type Cys-2.				adrenal gland development (GO:0030325)|anatomical structure morphogenesis (GO:0009653)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of transcription, DNA-templated (GO:0045892)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|pancreas(1)	8				Epithelial(150;0.000502)		CACCTGTGGGGCTGGCAGAGG	0.657																																					p.P275S		Atlas-SNP	.											.	DKK3	35	.	0			c.C823T						.						51.0	50.0	50.0					11																	11987363		2201	4294	6495	SO:0001583	missense	27122	exon6			TGTGGGGCTGGCA	AF177396	CCDS7808.1	11p15.3	2013-05-15	2013-05-15		ENSG00000050165	ENSG00000050165			2893	protein-coding gene	gene with protein product	"""regulated in glioma"""	605416	"""dickkopf (Xenopus laevis) homolog 3"", ""dickkopf 3 homolog (Xenopus laevis)"""			10570958	Standard	XM_006718177		Approved	REIC, RIG	uc001mjv.3	Q9UBP4	OTTHUMG00000165709	ENST00000396505.2:c.823C>T	chr11.hg19:g.11987363G>A	ENSP00000379762:p.Pro275Ser	35.0	0.0		39.0	9.0	NM_001018057	A8K1I2|D3DQW1|Q9ULB7	Missense_Mutation	SNP	ENST00000396505.2	hg19	CCDS7808.1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.710210	0.89018	.	.	ENSG00000050165	ENST00000396505;ENST00000326932;ENST00000366345;ENST00000525493;ENST00000450094;ENST00000326914	T;T;T;T	0.30448	2.26;2.26;2.18;1.53	5.65	5.65	0.86999	.	0.157444	0.64402	D	0.000019	T	0.51295	0.1666	L	0.61218	1.895	0.47183	D	0.999344	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.71870	0.975;0.915;0.915	T	0.40117	-0.9580	10	0.37606	T	0.19	-13.224	15.0107	0.71547	0.0:0.0:0.857:0.143	.	275;247;275	F6SYF8;E7EUD0;Q9UBP4	.;.;DKK3_HUMAN	S	275;275;218;275;247;119	ENSP00000379762:P275S;ENSP00000314910:P275S;ENSP00000433112:P275S;ENSP00000398365:P247S	ENSP00000314730:P119S	P	-	1	0	DKK3	11943939	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.576000	0.53878	2.655000	0.90218	0.655000	0.94253	CCC	.	.		0.657	DKK3-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385863.1	NM_013253	
CYP2R1	120227	hgsc.bcm.edu	37	11	14902118	14902118	+	Silent	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:14902118T>G	ENST00000334636.5	-	3	610	c.564A>C	c.(562-564)tcA>tcC	p.S188S	CYP2R1_ENST00000526489.1_5'UTR|CYP2R1_ENST00000532378.1_Intron	NM_024514.4	NP_078790.2	Q6VVX0	CP2R1_HUMAN	cytochrome P450, family 2, subfamily R, polypeptide 1	188					small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|vitamin D3 25-hydroxylase activity (GO:0030343)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14					Cholecalciferol(DB00169)|Ergocalciferol(DB00153)	TGGTTATGTTTGAAACAGCAT	0.318																																					p.S188S	NSCLC(173;1584 2058 26117 29365 41534)	Atlas-SNP	.											.	CYP2R1	41	.	0			c.A564C						.						99.0	92.0	94.0					11																	14902118		2200	4293	6493	SO:0001819	synonymous_variant	120227	exon3			TATGTTTGAAACA	AY323817	CCDS7818.1	11p15.2	2008-02-05			ENSG00000186104	ENSG00000186104		"""Cytochrome P450s"""	20580	protein-coding gene	gene with protein product		608713				12464240, 12867411	Standard	XM_005252788		Approved		uc001mlr.3	Q6VVX0	OTTHUMG00000165900	ENST00000334636.5:c.564A>C	chr11.hg19:g.14902118T>G		92.0	0.0		90.0	22.0	NM_024514	Q2M3H3|Q5RT65	Silent	SNP	ENST00000334636.5	hg19	CCDS7818.1																																																																																			.	.		0.318	CYP2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386985.1	NM_024514	
ELP4	26610	hgsc.bcm.edu	37	11	31669364	31669364	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:31669364A>T	ENST00000350638.5	+	8	1038	c.1003A>T	c.(1003-1005)Aga>Tga	p.R335*	ELP4_ENST00000395934.2_Nonsense_Mutation_p.R335*|Z83001.1_ENST00000429821.1_RNA|ELP4_ENST00000379163.5_Nonsense_Mutation_p.R336*	NM_019040.3	NP_061913.3	Q96EB1	ELP4_HUMAN	elongator acetyltransferase complex subunit 4	335					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(3)	20	Lung SC(675;0.225)					TGGTTCTGAGAGAGAAACTAA	0.403																																					p.R335X		Atlas-SNP	.											.	ELP4	78	.	0			c.A1003T						.						180.0	165.0	170.0					11																	31669364		1857	4101	5958	SO:0001587	stop_gained	26610	exon8			TCTGAGAGAGAAA	AJ276005	CCDS7875.2, CCDS73271.1, CCDS73272.1	11p13	2012-08-14	2012-08-08	2002-05-24	ENSG00000109911	ENSG00000109911		"""Elongator acetyltransferase complex subunits"""	1171	protein-coding gene	gene with protein product		606985	"""chromosome 11 open reading frame 19"", ""elongation protein 4 homolog (S. cerevisiae)"""	C11orf19		11889558, 11435442	Standard	XM_005252865		Approved	PAXNEB	uc001mtb.3	Q96EB1	OTTHUMG00000142919	ENST00000350638.5:c.1003A>T	chr11.hg19:g.31669364A>T	ENSP00000298937:p.Arg335*	116.0	0.0		144.0	47.0	NM_019040	B4E3W0|E7EPZ6|Q9H4E8|Q9NX11	Nonsense_Mutation	SNP	ENST00000350638.5	hg19	CCDS7875.2	.	.	.	.	.	.	.	.	.	.	A	29.2	4.989003	0.93106	.	.	ENSG00000109911	ENST00000350638;ENST00000379163;ENST00000395934	.	.	.	5.92	5.92	0.95590	.	0.195426	0.53938	D	0.000053	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12103	T	0.63	-11.9345	16.3604	0.83263	1.0:0.0:0.0:0.0	.	.	.	.	X	335;336;335	.	ENSP00000298937:R335X	R	+	1	2	ELP4	31625940	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	7.781000	0.85668	2.260000	0.74910	0.528000	0.53228	AGA	.	.		0.403	ELP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286640.1	NM_019040	
KIAA1549L	25758	hgsc.bcm.edu	37	11	33566763	33566763	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:33566763T>A	ENST00000321505.4	+	2	2513	c.2333T>A	c.(2332-2334)cTg>cAg	p.L778Q	KIAA1549L_ENST00000265654.5_Missense_Mutation_p.L784Q|KIAA1549L_ENST00000389726.3_Missense_Mutation_p.L784Q			Q6ZVL6	K154L_HUMAN	KIAA1549-like	778						integral component of membrane (GO:0016021)											ACGGCCGCGCTGACATCCATT	0.612																																					p.L778Q		Atlas-SNP	.											.	.	.	.	0			c.T2333A						.						81.0	98.0	92.0					11																	33566763		2184	4283	6467	SO:0001583	missense	25758	exon2			CCGCGCTGACATC	U10991	CCDS44565.1, CCDS44565.2	11p13	2012-08-09	2012-08-09	2012-08-09	ENSG00000110427	ENSG00000110427			24836	protein-coding gene	gene with protein product		612297	"""chromosome 11 open reading frame 69"", ""chromosome 11 open reading frame 41"""	C11orf69, C11orf41			Standard	NM_012194		Approved	G2, MGC34830	uc021qfs.1	Q6ZVL6	OTTHUMG00000150410	ENST00000321505.4:c.2333T>A	chr11.hg19:g.33566763T>A	ENSP00000315295:p.Leu778Gln	127.0	0.0		108.0	34.0	NM_012194	B0QYU0	Missense_Mutation	SNP	ENST00000321505.4	hg19	CCDS44565.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	14.29|14.29	2.492117|2.492117	0.44352|0.44352	.|.	.|.	ENSG00000110427|ENSG00000110427	ENST00000321505;ENST00000389726;ENST00000265654;ENST00000536568|ENST00000526400	.|.	.|.	.|.	5.81|5.81	5.81|5.81	0.92471|0.92471	.|.	0.000000|.	0.56097|.	D|.	0.000023|.	T|.	0.62986|.	0.2473|.	M|M	0.64997|0.64997	1.995|1.995	0.33158|0.33158	D|D	0.546609|0.546609	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.986;0.999|.	T|.	0.72327|.	-0.4327|.	9|.	0.20519|.	T|.	0.43|.	-13.5133|-13.5133	14.7306|14.7306	0.69379|0.69379	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	784;784|.	E9PAT2;Q6ZVL6-2|.	.;.|.	Q|R	778;784;784;617|176	.|.	ENSP00000265654:L784Q|.	L|X	+|+	2|1	0|0	C11orf41|C11orf41	33523339|33523339	0.998000|0.998000	0.40836|0.40836	0.087000|0.087000	0.20705|0.20705	0.107000|0.107000	0.19398|0.19398	3.548000|3.548000	0.53670|0.53670	2.220000|2.220000	0.72140|0.72140	0.459000|0.459000	0.35465|0.35465	CTG|TGA	.	.		0.612	KIAA1549L-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317998.1	NM_012194	
CD44	960	hgsc.bcm.edu	37	11	35226078	35226078	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:35226078T>A	ENST00000428726.2	+	10	1296	c.1173T>A	c.(1171-1173)agT>agA	p.S391R	CD44_ENST00000263398.6_Intron|CD44_ENST00000433892.2_Intron|CD44_ENST00000415148.2_Missense_Mutation_p.S348R|CD44_ENST00000526669.2_Intron|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Intron|CD44_ENST00000352818.4_Intron|CD44_ENST00000437706.2_Missense_Mutation_p.S391R|CD44_ENST00000360158.4_Intron|CD44_ENST00000434472.2_Intron|CD44_ENST00000433354.2_Missense_Mutation_p.S392R	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	391	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	CTCCTAGTAGTACAACGGAAG	0.438																																					p.S391R		Atlas-SNP	.											.	CD44	48	.	0			c.T1173A						.						149.0	126.0	134.0					11																	35226078		2202	4298	6500	SO:0001583	missense	960	exon10			TAGTAGTACAACG	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.1173T>A	chr11.hg19:g.35226078T>A	ENSP00000398632:p.Ser391Arg	86.0	0.0		83.0	23.0	NM_000610	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Missense_Mutation	SNP	ENST00000428726.2	hg19	CCDS7897.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.334|7.334	0.619466|0.619466	0.14129|0.14129	.|.	.|.	ENSG00000026508|ENSG00000026508	ENST00000415148;ENST00000433354;ENST00000437706;ENST00000428726;ENST00000531110;ENST00000528672|ENST00000526553	T;T;T;T;T;T|.	0.25912|.	1.77;1.77;1.77;1.77;1.77;1.77|.	4.39|4.39	-6.13|-6.13	0.02118|0.02118	.|.	0.466636|.	0.20449|.	N|.	0.092132|.	T|T	0.21761|0.21761	0.0524|0.0524	L|L	0.37561|0.37561	1.115|1.115	0.09310|0.09310	N|N	1|1	B;B|.	0.12013|.	0.002;0.005|.	B;B|.	0.09377|.	0.004;0.004|.	T|T	0.28522|0.28522	-1.0041|-1.0041	10|5	0.36615|.	T|.	0.2|.	-22.2004|-22.2004	2.1465|2.1465	0.03789|0.03789	0.1314:0.3617:0.2687:0.2381|0.1314:0.3617:0.2687:0.2381	.|.	348;391|.	P16070-4;P16070|.	.;CD44_HUMAN|.	R|N	348;392;391;391;103;43|45	ENSP00000389830:S348R;ENSP00000414567:S392R;ENSP00000403990:S391R;ENSP00000398632:S391R;ENSP00000436549:S103R;ENSP00000431860:S43R|.	ENSP00000389830:S348R|.	S|Y	+|+	3|1	2|0	CD44|CD44	35182654|35182654	0.012000|0.012000	0.17670|0.17670	0.000000|0.000000	0.03702|0.03702	0.001000|0.001000	0.01503|0.01503	-0.424000|-0.424000	0.07025|0.07025	-1.249000|-1.249000	0.02500|0.02500	-1.155000|-1.155000	0.01812|0.01812	AGT|TAC	.	.		0.438	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	
LDLRAD3	143458	hgsc.bcm.edu	37	11	36250861	36250861	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:36250861A>T	ENST00000315571.5	+	6	973	c.952A>T	c.(952-954)Agc>Tgc	p.S318C	LDLRAD3_ENST00000528989.1_Missense_Mutation_p.S269C|LDLRAD3_ENST00000524419.1_Missense_Mutation_p.S308C	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	318					receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				GGAAGACACCAGCCACAGCCC	0.662																																					p.S318C		Atlas-SNP	.											.	LDLRAD3	52	.	0			c.A952T						.						56.0	67.0	63.0					11																	36250861		2201	4292	6493	SO:0001583	missense	143458	exon6			GACACCAGCCACA	AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.952A>T	chr11.hg19:g.36250861A>T	ENSP00000318607:p.Ser318Cys	195.0	0.0		190.0	46.0	NM_174902	B7Z1U3|B9EG81|Q8NBJ0	Missense_Mutation	SNP	ENST00000315571.5	hg19	CCDS31462.1	.	.	.	.	.	.	.	.	.	.	A	3.800	-0.041806	0.07452	.	.	ENSG00000179241	ENST00000528989;ENST00000524419;ENST00000315571	D;D;D	0.94576	-3.46;-3.31;-3.21	5.12	-10.2	0.00374	.	1.204760	0.05640	N	0.583225	D	0.84669	0.5523	N	0.08118	0	0.09310	N	1	B;B;B	0.28512	0.001;0.214;0.07	B;B;B	0.27170	0.002;0.077;0.077	T	0.78537	-0.2166	10	0.59425	D	0.04	.	10.2419	0.43316	0.6743:0.1099:0.1507:0.0651	.	308;269;318	E9PR86;B7Z1U3;Q86YD5	.;.;LRAD3_HUMAN	C	269;308;318	ENSP00000433954:S269C;ENSP00000434313:S308C;ENSP00000318607:S318C	ENSP00000318607:S318C	S	+	1	0	LDLRAD3	36207437	0.000000	0.05858	0.000000	0.03702	0.079000	0.17450	-1.570000	0.02140	-2.955000	0.00292	-2.346000	0.00244	AGC	.	.		0.662	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389085.1	NM_174902	
RAG2	5897	hgsc.bcm.edu	37	11	36614484	36614484	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:36614484T>A	ENST00000311485.3	-	2	1396	c.1235A>T	c.(1234-1236)gAg>gTg	p.E412V	C11orf74_ENST00000534635.1_5'Flank|C11orf74_ENST00000334307.5_5'Flank|RAG2_ENST00000528428.1_5'Flank|C11orf74_ENST00000347206.4_5'Flank|C11orf74_ENST00000446510.2_5'Flank	NM_000536.3|NM_001243785.1|NM_001243786.1	NP_000527.2|NP_001230714.1|NP_001230715.1	P55895	RAG2_HUMAN	recombination activating gene 2	412					B cell differentiation (GO:0030183)|chromatin modification (GO:0016568)|pre-B cell allelic exclusion (GO:0002331)|T cell differentiation in thymus (GO:0033077)|V(D)J recombination (GO:0033151)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|pancreas(2)|prostate(1)|skin(4)	32	all_lung(20;0.226)	all_hematologic(20;0.00756)				GTAGCCTGTCTCAGACTCATC	0.403									Familial Hemophagocytic Lymphohistiocytosis																												p.E412V		Atlas-SNP	.											.	RAG2	92	.	0			c.A1235T						.						147.0	139.0	141.0					11																	36614484		2202	4298	6500	SO:0001583	missense	5897	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	CCTGTCTCAGACT	AF080577	CCDS7903.1	11p13	2014-09-17				ENSG00000175097			9832	protein-coding gene	gene with protein product		179616				1283330	Standard	NM_000536		Approved		uc001mwv.4	P55895		ENST00000311485.3:c.1235A>T	chr11.hg19:g.36614484T>A	ENSP00000308620:p.Glu412Val	72.0	0.0		55.0	13.0	NM_001243785	A8K9E9|Q8TBL4	Missense_Mutation	SNP	ENST00000311485.3	hg19	CCDS7903.1	.	.	.	.	.	.	.	.	.	.	T	0.620	-0.821701	0.02755	.	.	ENSG00000175097	ENST00000311485	D	0.96300	-3.97	5.45	3.07	0.35406	.	0.174480	0.49916	N	0.000131	D	0.92509	0.7621	L	0.42487	1.325	0.40961	D	0.984626	B	0.02656	0.0	B	0.01281	0.0	D	0.86340	0.1704	10	0.24483	T	0.36	-1.7618	10.3425	0.43887	0.3088:0.0:0.0:0.6912	.	412	P55895	RAG2_HUMAN	V	412	ENSP00000308620:E412V	ENSP00000308620:E412V	E	-	2	0	RAG2	36571060	1.000000	0.71417	0.997000	0.53966	0.998000	0.95712	3.310000	0.51911	0.415000	0.25817	0.528000	0.53228	GAG	.	.		0.403	RAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389536.1	NM_000536	
EXT2	2132	hgsc.bcm.edu	37	11	44253901	44253901	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:44253901A>T	ENST00000343631.3	+	11	1791		c.e11-1		EXT2_ENST00000358681.4_Splice_Site|EXT2_ENST00000395673.3_Splice_Site|EXT2_ENST00000533608.1_Splice_Site			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2						carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						GTCTGTCCTTAGGTCTGGCGG	0.478			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																												.		Atlas-SNP	.	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	.	EXT2	129	.	0			c.1663-2A>T						.						128.0	113.0	118.0					11																	44253901		2203	4299	6502	SO:0001630	splice_region_variant	2132	exon11	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses	GTCCTTAGGTCTG		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1663-1A>T	chr11.hg19:g.44253901A>T		122.0	0.0		80.0	22.0	NM_207122	B2R5Z6|C9JU51|J3KPT2|O15288	Splice_Site	SNP	ENST00000343631.3	hg19	CCDS7908.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.055462	0.75960	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.8211	0.70074	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	EXT2	44210477	1.000000	0.71417	0.971000	0.41717	0.950000	0.60333	7.465000	0.80898	1.913000	0.55393	0.482000	0.46254	.	.	.		0.478	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390074.1	NM_000401	Intron
CREB3L1	90993	hgsc.bcm.edu	37	11	46329400	46329400	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:46329400A>T	ENST00000529193.1	+	3	816	c.365A>T	c.(364-366)aAa>aTa	p.K122I	CREB3L1_ENST00000288400.3_Missense_Mutation_p.K122I			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	122					regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)		FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		CTGGGACACAAACTGTGCTCC	0.682			T	FUS	myxofibrosarcoma																																p.K122I	Pancreas(3;159 194 19597 26278 47995)	Atlas-SNP	.		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	.	CREB3L1	30	.	0			c.A365T						.						10.0	13.0	12.0					11																	46329400		2040	4177	6217	SO:0001583	missense	90993	exon3			GACACAAACTGTG		CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.365A>T	chr11.hg19:g.46329400A>T	ENSP00000434939:p.Lys122Ile	200.0	0.0		153.0	46.0	NM_052854	Q8N2D5|Q96CP0	Missense_Mutation	SNP	ENST00000529193.1	hg19	CCDS53620.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.277516	0.80580	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000534787	T;T;T	0.38240	2.43;2.43;1.15	4.68	2.23	0.28157	.	0.288076	0.33813	N	0.004522	T	0.43366	0.1244	L	0.44542	1.39	0.29740	N	0.837183	D	0.64830	0.994	P	0.59288	0.855	T	0.39722	-0.9600	10	0.49607	T	0.09	-17.056	10.4158	0.44320	0.684:0.316:0.0:0.0	.	122	Q96BA8	CR3L1_HUMAN	I	122;122;76	ENSP00000434939:K122I;ENSP00000288400:K122I;ENSP00000431677:K76I	ENSP00000288400:K122I	K	+	2	0	CREB3L1	46285976	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	2.449000	0.44935	0.216000	0.20781	0.454000	0.30748	AAA	.	.		0.682	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389702.1	NM_052854	
OR5D18	219438	hgsc.bcm.edu	37	11	55587486	55587486	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:55587486T>A	ENST00000333976.4	+	1	401	c.381T>A	c.(379-381)atT>atA	p.I127I		NM_001001952.1	NP_001001952.1	Q8NGL1	OR5DI_HUMAN	olfactory receptor, family 5, subfamily D, member 18	127						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(3)|large_intestine(6)|lung(33)|ovary(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		all_epithelial(135;0.208)				TCGTGGCCATTTGCAACCCTC	0.463																																					p.I127I		Atlas-SNP	.											.	OR5D18	121	.	0			c.T381A						.						180.0	168.0	172.0					11																	55587486		2200	4296	6496	SO:0001819	synonymous_variant	219438	exon1			GGCCATTTGCAAC	AB065781	CCDS31510.1	11q11	2012-08-09			ENSG00000186119	ENSG00000186119		"""GPCR / Class A : Olfactory receptors"""	15285	protein-coding gene	gene with protein product							Standard	NM_001001952		Approved		uc010rin.2	Q8NGL1	OTTHUMG00000166811	ENST00000333976.4:c.381T>A	chr11.hg19:g.55587486T>A		138.0	0.0		109.0	23.0	NM_001001952	Q6IF67|Q6IFD3|Q96RB3	Silent	SNP	ENST00000333976.4	hg19	CCDS31510.1																																																																																			.	.		0.463	OR5D18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391515.1	NM_001001952	
OR5F1	338674	hgsc.bcm.edu	37	11	55761572	55761572	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:55761572A>T	ENST00000278409.1	-	1	529	c.530T>A	c.(529-531)tTc>tAc	p.F177Y		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	177					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					GTCACAGAAGAAGTGATGGAT	0.468																																					p.F177Y		Atlas-SNP	.											.	OR5F1	116	.	0			c.T530A						.						93.0	88.0	90.0					11																	55761572		2201	4296	6497	SO:0001583	missense	338674	exon1			CAGAAGAAGTGAT	AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.530T>A	chr11.hg19:g.55761572A>T	ENSP00000278409:p.Phe177Tyr	169.0	0.0		127.0	33.0	NM_003697	Q495D1|Q6IFB9	Missense_Mutation	SNP	ENST00000278409.1	hg19	CCDS31515.1	.	.	.	.	.	.	.	.	.	.	A	14.23	2.472907	0.43942	.	.	ENSG00000149133	ENST00000278409	T	0.00318	8.12	3.03	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00496	0.0016	M	0.66560	2.04	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.52881	-0.8516	9	0.51188	T	0.08	.	6.4031	0.21650	0.7809:0.0:0.0:0.2191	.	177	O95221	OR5F1_HUMAN	Y	177	ENSP00000278409:F177Y	ENSP00000278409:F177Y	F	-	2	0	OR5F1	55518148	0.111000	0.22076	0.902000	0.35471	0.694000	0.40290	2.486000	0.45259	1.167000	0.42706	0.247000	0.18012	TTC	.	.		0.468	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391532.1	NM_003697	
MPEG1	219972	hgsc.bcm.edu	37	11	58978713	58978713	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:58978713A>C	ENST00000361050.3	-	1	1711	c.1626T>G	c.(1624-1626)gaT>gaG	p.D542E		NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	542						integral component of membrane (GO:0016021)				NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				ATATAGCAGGATCTACCAGGG	0.552																																					p.D542E		Atlas-SNP	.											.	MPEG1	72	.	0			c.T1626G						.						39.0	42.0	41.0					11																	58978713		1836	4082	5918	SO:0001583	missense	219972	exon1			AGCAGGATCTACC	AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.1626T>G	chr11.hg19:g.58978713A>C	ENSP00000354335:p.Asp542Glu	93.0	0.0		63.0	12.0	NM_001039396	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	ENST00000361050.3	hg19	CCDS41650.1	.	.	.	.	.	.	.	.	.	.	A	4.735	0.136761	0.09032	.	.	ENSG00000197629	ENST00000361050	T	0.21543	2.0	5.93	-2.81	0.05805	.	0.776296	0.11828	N	0.525479	T	0.15696	0.0378	L	0.44542	1.39	0.09310	N	1	B	0.20887	0.049	B	0.19666	0.026	T	0.25641	-1.0126	10	0.42905	T	0.14	-3.8218	8.6342	0.33936	0.2424:0.1586:0.599:0.0	.	542	Q2M385	MPEG1_HUMAN	E	542	ENSP00000354335:D542E	ENSP00000354335:D542E	D	-	3	2	MPEG1	58735289	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.068000	0.14531	-0.406000	0.07588	-0.250000	0.11733	GAT	.	.		0.552	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370027.1	NM_001039396	
DAGLA	747	hgsc.bcm.edu	37	11	61511593	61511593	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:61511593T>A	ENST00000257215.5	+	20	2877	c.2761T>A	c.(2761-2763)Ttc>Atc	p.F921I	RP11-467L20.10_ENST00000536405.1_lincRNA	NM_006133.2	NP_006124.1	Q9Y4D2	DGLA_HUMAN	diacylglycerol lipase, alpha	921					arachidonic acid metabolic process (GO:0019369)|blood coagulation (GO:0007596)|cell death (GO:0008219)|diacylglycerol catabolic process (GO:0046340)|endocannabinoid signaling pathway (GO:0071926)|neuroblast proliferation (GO:0007405)|neurotransmitter biosynthetic process (GO:0042136)|platelet activation (GO:0030168)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|liver(2)|lung(17)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	43				READ - Rectum adenocarcinoma(4;0.219)		CGACAGCCTCTTCAACCTGGA	0.662																																					p.F921I		Atlas-SNP	.											.	DAGLA	109	.	0			c.T2761A						.						68.0	59.0	62.0					11																	61511593		2202	4298	6500	SO:0001583	missense	747	exon20			AGCCTCTTCAACC	AB014559	CCDS31578.1	11q12.3	2008-03-18	2007-02-28	2007-02-28		ENSG00000134780	3.1.1.-		1165	protein-coding gene	gene with protein product	"""neural stem cell-derived dendrite regulator"""	614015	"""chromosome 11 open reading frame 11"""	C11orf11		9734811	Standard	NM_006133		Approved	KIAA0659, NSDDR, DAGLALPHA	uc001nsa.3	Q9Y4D2		ENST00000257215.5:c.2761T>A	chr11.hg19:g.61511593T>A	ENSP00000257215:p.Phe921Ile	113.0	0.0		97.0	34.0	NM_006133	A7E233|Q6WQJ0	Missense_Mutation	SNP	ENST00000257215.5	hg19	CCDS31578.1	.	.	.	.	.	.	.	.	.	.	T	24.9	4.584025	0.86748	.	.	ENSG00000134780	ENST00000257215	T	0.38887	1.11	3.97	3.97	0.46021	.	0.000000	0.85682	D	0.000000	T	0.48995	0.1531	L	0.27053	0.805	0.58432	D	0.999999	D	0.57899	0.981	D	0.67231	0.95	T	0.53578	-0.8419	10	0.72032	D	0.01	-33.3698	13.1654	0.59569	0.0:0.0:0.0:1.0	.	921	Q9Y4D2	DGLA_HUMAN	I	921	ENSP00000257215:F921I	ENSP00000257215:F921I	F	+	1	0	DAGLA	61268169	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.518000	0.81795	1.581000	0.49865	0.379000	0.24179	TTC	.	.		0.662	DAGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398516.1	NM_006133	
SLC22A12	116085	hgsc.bcm.edu	37	11	64359422	64359422	+	Missense_Mutation	SNP	G	G	C	rs547191924		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:64359422G>C	ENST00000377574.1	+	1	1141	c.394G>C	c.(394-396)Gtg>Ctg	p.V132L	SLC22A12_ENST00000336464.7_Missense_Mutation_p.V132L|SLC22A12_ENST00000377567.2_Missense_Mutation_p.V132L|SLC22A12_ENST00000473690.1_5'UTR|SLC22A12_ENST00000377572.1_Missense_Mutation_p.V132L	NM_144585.2	NP_653186.2	Q96S37	S22AC_HUMAN	solute carrier family 22 (organic anion/urate transporter), member 12	132					cellular homeostasis (GO:0019725)|response to drug (GO:0042493)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)|urate transport (GO:0015747)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)|urate transmembrane transporter activity (GO:0015143)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(9)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27					Losartan(DB00678)|Probenecid(DB01032)	CTCCACAATCGTGGCCAAGGT	0.627																																					p.V132L		Atlas-SNP	.											.	SLC22A12	68	.	0			c.G394C						.						26.0	28.0	27.0					11																	64359422		2201	4297	6498	SO:0001583	missense	116085	exon1			ACAATCGTGGCCA	AB071863	CCDS8075.1, CCDS60835.1, CCDS60836.1	11q13.1	2013-05-22	2008-01-11		ENSG00000197891	ENSG00000197891		"""Solute carriers"""	17989	protein-coding gene	gene with protein product		607096	"""solute carrier family 22 (organic anion/cation transporter), member 12"""			12024214	Standard	NM_144585		Approved	OAT4L, RST, URAT1	uc009yps.2	Q96S37	OTTHUMG00000045213	ENST00000377574.1:c.394G>C	chr11.hg19:g.64359422G>C	ENSP00000366797:p.Val132Leu	32.0	0.0		26.0	9.0	NM_144585	B7WPG1|G3XAN7|Q19PF7|Q19PF8|Q19PF9|Q19PG0|Q6UXW3|Q96DT2	Missense_Mutation	SNP	ENST00000377574.1	hg19	CCDS8075.1	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928963	0.73327	.	.	ENSG00000197891	ENST00000377567;ENST00000377574;ENST00000377572;ENST00000336464	D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52	4.4	4.4	0.53042	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.067890	0.56097	D	0.000022	D	0.88070	0.6338	M	0.88241	2.94	0.24856	N	0.992377	P;P;D;P	0.59767	0.685;0.903;0.986;0.903	P;P;P;P	0.54210	0.447;0.525;0.745;0.525	T	0.83269	-0.0044	10	0.72032	D	0.01	.	14.481	0.67582	0.0:0.0:1.0:0.0	.	132;132;132;132	B5ME56;B3KV05;Q96S37-2;Q96S37	.;.;.;S22AC_HUMAN	L	132	ENSP00000366790:V132L;ENSP00000366797:V132L;ENSP00000366795:V132L;ENSP00000336836:V132L	ENSP00000336836:V132L	V	+	1	0	SLC22A12	64115998	0.996000	0.38824	0.079000	0.20413	0.958000	0.62258	2.543000	0.45752	1.988000	0.58038	0.484000	0.47621	GTG	.	.		0.627	SLC22A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000104966.2	NM_144585	
CATSPER1	117144	hgsc.bcm.edu	37	11	65787819	65787819	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:65787819A>T	ENST00000312106.5	-	8	2170	c.2033T>A	c.(2032-2034)cTg>cAg	p.L678Q		NM_053054.3	NP_444282.3	Q8NEC5	CTSR1_HUMAN	cation channel, sperm associated 1	678					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|fusion of sperm to egg plasma membrane (GO:0007342)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|regulation of calcium ion transport (GO:0051924)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|endometrium(9)|kidney(3)|large_intestine(6)|liver(3)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	44						GCCTTTGAACAGCGCCGTCTG	0.642																																					p.L678Q		Atlas-SNP	.											.	CATSPER1	101	.	0			c.T2033A						.						122.0	117.0	119.0					11																	65787819		2201	4296	6497	SO:0001583	missense	117144	exon8			TTGAACAGCGCCG	AF407333	CCDS8127.1	11q12.1	2011-07-05			ENSG00000175294	ENSG00000175294		"""Voltage-gated ion channels / Cation channels, sperm associated"""	17116	protein-coding gene	gene with protein product		606389				11675491, 11595941, 16382101	Standard	NM_053054		Approved	CATSPER	uc001ogt.3	Q8NEC5	OTTHUMG00000166668	ENST00000312106.5:c.2033T>A	chr11.hg19:g.65787819A>T	ENSP00000309052:p.Leu678Gln	95.0	0.0		88.0	28.0	NM_053054	Q96P76	Missense_Mutation	SNP	ENST00000312106.5	hg19	CCDS8127.1	.	.	.	.	.	.	.	.	.	.	A	12.55	1.973085	0.34848	.	.	ENSG00000175294	ENST00000312106	D	0.97114	-4.25	5.14	3.97	0.46021	.	0.000000	0.26571	U	0.023637	D	0.96030	0.8707	L	0.34521	1.04	0.27518	N	0.951494	D	0.69078	0.997	D	0.64410	0.925	D	0.90432	0.4425	10	0.23302	T	0.38	-9.4742	8.7857	0.34818	0.8088:0.1911:0.0:0.0	.	678	Q8NEC5	CTSR1_HUMAN	Q	678	ENSP00000309052:L678Q	ENSP00000309052:L678Q	L	-	2	0	CATSPER1	65544395	0.995000	0.38212	0.812000	0.32479	0.069000	0.16628	3.908000	0.56355	0.758000	0.33059	0.402000	0.26972	CTG	.	.		0.642	CATSPER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391055.1	NM_053054	
CCDC87	55231	hgsc.bcm.edu	37	11	66360350	66360350	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:66360350T>A	ENST00000333861.3	-	1	204	c.137A>T	c.(136-138)cAg>cTg	p.Q46L	CCS_ENST00000310190.4_5'Flank|CCS_ENST00000533244.1_5'UTR	NM_018219.2	NP_060689.2	Q9NVE4	CCD87_HUMAN	coiled-coil domain containing 87	46					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28						AGGGAAGGACTGCAGAATCCG	0.687											OREG0021111	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.Q46L		Atlas-SNP	.											.	CCDC87	83	.	0			c.A137T						.						21.0	24.0	23.0					11																	66360350		2154	4218	6372	SO:0001583	missense	55231	exon1			AAGGACTGCAGAA	BC034469	CCDS8145.1	11q13.2	2006-03-15			ENSG00000182791	ENSG00000182791			25579	protein-coding gene	gene with protein product						12477932	Standard	NM_018219		Approved	FLJ10786	uc001oiq.4	Q9NVE4	OTTHUMG00000167237	ENST00000333861.3:c.137A>T	chr11.hg19:g.66360350T>A	ENSP00000328487:p.Gln46Leu	78.0	0.0	1091	68.0	23.0	NM_018219	Q8NE76	Missense_Mutation	SNP	ENST00000333861.3	hg19	CCDS8145.1	.	.	.	.	.	.	.	.	.	.	T	8.470	0.857287	0.17106	.	.	ENSG00000182791	ENST00000333861	T	0.30981	1.51	5.39	-0.16	0.13375	.	0.918974	0.08933	N	0.872707	T	0.13372	0.0324	N	0.04355	-0.22	0.09310	N	0.999994	B	0.09022	0.002	B	0.06405	0.002	T	0.27806	-1.0063	10	0.36615	T	0.2	-4.0533	6.655	0.22982	0.1651:0.0:0.4743:0.3606	.	46	Q9NVE4	CCD87_HUMAN	L	46	ENSP00000328487:Q46L	ENSP00000328487:Q46L	Q	-	2	0	CCDC87	66116926	0.000000	0.05858	0.003000	0.11579	0.073000	0.16967	0.670000	0.25157	0.095000	0.17434	0.533000	0.62120	CAG	.	.		0.687	CCDC87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393825.1	NM_018219	
MTL5	9633	hgsc.bcm.edu	37	11	68517742	68517742	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:68517742T>A	ENST00000255087.5	-	2	570	c.387A>T	c.(385-387)ctA>ctT	p.L129L	MTL5_ENST00000443940.2_Silent_p.L129L|MTL5_ENST00000544963.1_Silent_p.L129L|MTL5_ENST00000540869.1_5'Flank	NM_004923.3	NP_004914.2	Q9Y4I5	MTL5_HUMAN	metallothionein-like 5, testis-specific (tesmin)	129					cell differentiation (GO:0030154)|cellular metal ion homeostasis (GO:0006875)|multicellular organismal development (GO:0007275)|response to metal ion (GO:0010038)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	15	Esophageal squamous(3;4.37e-12)		LUAD - Lung adenocarcinoma(13;0.0676)|STAD - Stomach adenocarcinoma(18;0.185)			GGTGCGCGGGTAGCAGCGAGG	0.721																																					p.L129L		Atlas-SNP	.											.	MTL5	37	.	0			c.A387T						.						8.0	10.0	9.0					11																	68517742		2164	4233	6397	SO:0001819	synonymous_variant	9633	exon2			CGCGGGTAGCAGC	U86074	CCDS8184.1, CCDS44661.1	11q13.2-q13.3	2007-01-03			ENSG00000132749	ENSG00000132749			7446	protein-coding gene	gene with protein product	"""CXC domain containing 2"""	604374				1091092	Standard	XR_428932		Approved	CXCDC2	uc001ooc.3	Q9Y4I5	OTTHUMG00000167891	ENST00000255087.5:c.387A>T	chr11.hg19:g.68517742T>A		91.0	0.0		92.0	29.0	NM_001039656	A8K8J3|Q4G182|Q6P2E2|Q8NCC8	Silent	SNP	ENST00000255087.5	hg19	CCDS8184.1																																																																																			.	.		0.721	MTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396844.1	NM_004923	
RSF1	51773	hgsc.bcm.edu	37	11	77413496	77413496	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:77413496T>C	ENST00000308488.6	-	6	1080	c.778A>G	c.(778-780)Atg>Gtg	p.M260V	RSF1_ENST00000480887.1_Missense_Mutation_p.M8V|RSF1_ENST00000360355.2_Missense_Mutation_p.M229V			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	260	Glu-rich.				CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			TCTAAATCCATAGGCTGCTCC	0.333																																					p.M260V		Atlas-SNP	.											.	RSF1	105	.	0			c.A778G						.						51.0	57.0	55.0					11																	77413496		2161	4119	6280	SO:0001583	missense	51773	exon6			AATCCATAGGCTG	AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.778A>G	chr11.hg19:g.77413496T>C	ENSP00000311513:p.Met260Val	69.0	0.0		49.0	14.0	NM_016578	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	ENST00000308488.6	hg19	CCDS8253.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-2.965152	0.00049	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355;ENST00000526324;ENST00000528095	D;D;D;D;T	0.84298	-1.79;-1.83;-1.78;-1.83;1.67	5.28	-8.16	0.01061	.	1.479250	0.04013	N	0.298577	T	0.68613	0.3020	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.65849	-0.6068	10	0.02654	T	1	1.121	19.1506	0.93487	0.0:0.2187:0.0:0.7813	.	260	Q96T23	RSF1_HUMAN	V	260;8;229;61;259	ENSP00000311513:M260V;ENSP00000434509:M8V;ENSP00000353511:M229V;ENSP00000432022:M61V;ENSP00000436408:M259V	ENSP00000311513:M260V	M	-	1	0	RSF1	77091144	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.669000	0.05262	-1.669000	0.01470	-0.408000	0.06270	ATG	.	.		0.333	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318075.2	NM_016578	
TRPC6	7225	hgsc.bcm.edu	37	11	101323689	101323689	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:101323689T>A	ENST00000344327.3	-	13	3217	c.2793A>T	c.(2791-2793)agA>agT	p.R931S	TRPC6_ENST00000360497.4_Missense_Mutation_p.R876S|TRPC6_ENST00000348423.4_Missense_Mutation_p.R815S|TRPC6_ENST00000532133.1_Missense_Mutation_p.R853S	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	931					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		CTTCGCATTATCTATTGGTTT	0.338																																					p.R931S	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											.	TRPC6	132	.	0			c.A2793T						.						175.0	177.0	176.0					11																	101323689		2202	4300	6502	SO:0001583	missense	7225	exon13			GCATTATCTATTG	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2793A>T	chr11.hg19:g.101323689T>A	ENSP00000340913:p.Arg931Ser	107.0	0.0		83.0	17.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	hg19	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	T	12.32	1.901635	0.33535	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.80123	-1.19;-1.27;-1.07;-1.34	5.55	5.55	0.83447	.	0.237633	0.43747	D	0.000526	T	0.79263	0.4416	N	0.08118	0	0.32409	N	0.550908	B;D	0.54601	0.009;0.967	B;D	0.63597	0.009;0.916	D	0.85010	0.0905	10	0.87932	D	0	.	15.7429	0.77914	0.0:0.0:0.0:1.0	.	815;931	Q9Y210-2;Q9Y210	.;TRPC6_HUMAN	S	931;853;815;876	ENSP00000340913:R931S;ENSP00000435574:R853S;ENSP00000343672:R815S;ENSP00000353687:R876S	ENSP00000340913:R931S	R	-	3	2	TRPC6	100828899	1.000000	0.71417	0.992000	0.48379	0.174000	0.22865	2.510000	0.45468	2.119000	0.64992	0.529000	0.55759	AGA	.	.		0.338	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
TRPC6	7225	hgsc.bcm.edu	37	11	101375297	101375297	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:101375297T>A	ENST00000344327.3	-	2	827	c.403A>T	c.(403-405)Aat>Tat	p.N135Y	TRPC6_ENST00000360497.4_Missense_Mutation_p.N135Y|TRPC6_ENST00000526713.1_5'Flank|TRPC6_ENST00000348423.4_Missense_Mutation_p.N135Y|TRPC6_ENST00000532133.1_Missense_Mutation_p.N135Y	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	135					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TGTAGGGCATTCTGGCCCATG	0.458																																					p.N135Y	Colon(166;1315 1927 11094 12848 34731)	Atlas-SNP	.											.	TRPC6	132	.	0			c.A403T						.						119.0	102.0	108.0					11																	101375297		2203	4299	6502	SO:0001583	missense	7225	exon2			GGGCATTCTGGCC	AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.403A>T	chr11.hg19:g.101375297T>A	ENSP00000340913:p.Asn135Tyr	88.0	0.0		93.0	27.0	NM_004621	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	ENST00000344327.3	hg19	CCDS8311.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.325259	0.81580	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55	5.96	5.96	0.96718	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.80088	0.4559	L	0.43646	1.37	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.81588	-0.0864	10	0.72032	D	0.01	-13.0051	16.4484	0.83959	0.0:0.0:0.0:1.0	.	135;135;135	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	Y	135	ENSP00000340913:N135Y;ENSP00000435574:N135Y;ENSP00000343672:N135Y;ENSP00000353687:N135Y	ENSP00000340913:N135Y	N	-	1	0	TRPC6	100880507	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.040000	0.89188	2.285000	0.76669	0.533000	0.62120	AAT	.	.		0.458	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394770.1	NM_004621	
DSCAML1	57453	hgsc.bcm.edu	37	11	117314605	117314605	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:117314605T>A	ENST00000321322.6	-	21	4040	c.4039A>T	c.(4039-4041)Aag>Tag	p.K1347*	DSCAML1_ENST00000527706.1_Nonsense_Mutation_p.K1077*	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	1287	Ig-like C2-type 10.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		TTCTCACCCTTGCCAGCAGGC	0.622																																					p.K1347X		Atlas-SNP	.											.	DSCAML1	286	.	0			c.A4039T						.						50.0	50.0	50.0					11																	117314605		2201	4296	6497	SO:0001587	stop_gained	57453	exon21			CACCCTTGCCAGC		CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.4039A>T	chr11.hg19:g.117314605T>A	ENSP00000315465:p.Lys1347*	33.0	0.0		33.0	11.0	NM_020693	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Nonsense_Mutation	SNP	ENST00000321322.6	hg19	CCDS8384.1	.	.	.	.	.	.	.	.	.	.	T	42	9.301018	0.99130	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	.	.	.	4.59	4.59	0.56863	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.1423	0.65327	0.0:0.0:0.0:1.0	.	.	.	.	X	1077;1347;1054	.	ENSP00000315465:K1347X	K	-	1	0	DSCAML1	116819815	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.747000	0.85070	1.916000	0.55485	0.260000	0.18958	AAG	.	.		0.622	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392907.2	NM_020693	
TMPRSS13	84000	hgsc.bcm.edu	37	11	117789473	117789473	+	Silent	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:117789473T>G	ENST00000430170.2	-	2	189	c.102A>C	c.(100-102)gcA>gcC	p.A34A	TMPRSS13_ENST00000524993.1_Silent_p.A34A|TMPRSS13_ENST00000528626.1_Silent_p.A34A|TMPRSS13_ENST00000526090.1_Silent_p.A34A|TMPRSS13_ENST00000445164.2_Silent_p.A34A	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	34	13 X 5 AA repeats of A-S-P-A-[GLQR].|4 X 5 AA repeats of T-P-P-G-R.|Ala-rich.					blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		GGGCTGGAGATGCCCGGCCTG	0.627																																					p.A34A		Atlas-SNP	.											.	TMPRSS13	75	.	0			c.A102C						.						46.0	53.0	51.0					11																	117789473		1924	4133	6057	SO:0001819	synonymous_variant	84000	exon2			TGGAGATGCCCGG	AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.102A>C	chr11.hg19:g.117789473T>G		68.0	0.0		72.0	19.0	NM_001206790	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	ENST00000430170.2	hg19	CCDS58185.1																																																																																			.	.		0.627	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000392318.1	NM_032046	
PHLDB1	23187	hgsc.bcm.edu	37	11	118502989	118502989	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:118502989A>T	ENST00000361417.2	+	10	2766	c.2355A>T	c.(2353-2355)acA>acT	p.T785T	PHLDB1_ENST00000534672.1_3'UTR|PHLDB1_ENST00000356063.5_Silent_p.T785T	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	785										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCTTGGAGACAGGCATCCAGA	0.612																																					p.T785T		Atlas-SNP	.											.	PHLDB1	103	.	0			c.A2355T						.						89.0	76.0	80.0					11																	118502989		2200	4295	6495	SO:0001819	synonymous_variant	23187	exon9			GGAGACAGGCATC		CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2355A>T	chr11.hg19:g.118502989A>T		173.0	0.0		144.0	43.0	NM_001144758	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Silent	SNP	ENST00000361417.2	hg19	CCDS8401.1																																																																																			.	.		0.612	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389279.1	NM_015157	
CLMP	79827	hgsc.bcm.edu	37	11	122945480	122945480	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:122945480A>T	ENST00000448775.2	-	6	1091	c.751T>A	c.(751-753)Ttg>Atg	p.L251M	CLMP_ENST00000530371.1_5'UTR	NM_024769.2	NP_079045.1	Q9H6B4	CLMP_HUMAN	CXADR-like membrane protein	251					digestive tract development (GO:0048565)	cell surface (GO:0009986)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	14						AGCCACACCAAGAGGAAAATC	0.458																																					p.L251M		Atlas-SNP	.											.	CLMP	39	.	0			c.T751A						.						118.0	112.0	114.0					11																	122945480		2202	4299	6501	SO:0001583	missense	79827	exon6			ACACCAAGAGGAA	BC009371	CCDS8441.1	11q24	2013-01-29			ENSG00000166250	ENSG00000166250		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	24039	protein-coding gene	gene with protein product	"""adipocyte-specific adhesion molecule"", ""coxsackie- and adenovirus receptor-like membrane protein"", ""adipocyte adhesion molecule"""	611693				12851705, 14573622	Standard	NM_024769		Approved	ASAM, FLJ22415, ACAM	uc001pyt.3	Q9H6B4		ENST00000448775.2:c.751T>A	chr11.hg19:g.122945480A>T	ENSP00000405577:p.Leu251Met	83.0	0.0		62.0	13.0	NM_024769		Missense_Mutation	SNP	ENST00000448775.2	hg19	CCDS8441.1	.	.	.	.	.	.	.	.	.	.	A	19.10	3.761582	0.69763	.	.	ENSG00000166250	ENST00000448775	T	0.77750	-1.12	5.33	-3.36	0.04913	.	0.233552	0.42172	D	0.000750	T	0.75642	0.3877	M	0.81341	2.54	0.30662	N	0.754314	P	0.50617	0.937	P	0.49276	0.605	T	0.71912	-0.4449	10	0.44086	T	0.13	.	4.9316	0.13919	0.2889:0.1401:0.4711:0.0999	.	251	Q9H6B4	CLMP_HUMAN	M	251	ENSP00000405577:L251M	ENSP00000405577:L251M	L	-	1	2	CLMP	122450690	0.126000	0.22350	0.986000	0.45419	0.990000	0.78478	-0.430000	0.06973	-0.419000	0.07439	-0.256000	0.11100	TTG	.	.		0.458	CLMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387542.1	NM_024769	
MSANTD2	79684	hgsc.bcm.edu	37	11	124637132	124637132	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:124637132T>A	ENST00000374979.3	-	4	1628	c.1620A>T	c.(1618-1620)gcA>gcT	p.A540A	MSANTD2_ENST00000526629.1_Silent_p.A310A|MSANTD2_ENST00000239614.4_Silent_p.A488A|RP11-677M14.3_ENST00000532579.1_RNA|RP11-677M14.3_ENST00000504932.2_RNA			Q6P1R3	MSD2_HUMAN	Myb/SANT-like DNA-binding domain containing 2	540																	CTAAAGAGCCTGCGGAAAGAA	0.413																																					p.A488A		Atlas-SNP	.											.	MSANTD2	7	.	0			c.A1464T						.						70.0	80.0	77.0					11																	124637132		2201	4299	6500	SO:0001819	synonymous_variant	79684	exon4			AGAGCCTGCGGAA	AK026995	CCDS8454.1, CCDS73408.1	11q24.2	2012-03-02	2012-03-02	2012-03-02	ENSG00000120458	ENSG00000120458			26266	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 61"""	C11orf61			Standard	NM_024631		Approved	FLJ23342	uc001qaz.1	Q6P1R3	OTTHUMG00000165931	ENST00000374979.3:c.1620A>T	chr11.hg19:g.124637132T>A		153.0	0.0		119.0	32.0	NM_024631	B3KRY6|Q9H042|Q9H5K8	Silent	SNP	ENST00000374979.3	hg19																																																																																				.	.		0.413	MSANTD2-002	KNOWN	basic|appris_principal|exp_conf	protein_coding	protein_coding	OTTHUMT00000387084.1	NM_024631	
SLC6A13	6540	hgsc.bcm.edu	37	12	333252	333252	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:333252T>A	ENST00000343164.4	-	11	1269	c.1217A>T	c.(1216-1218)tAc>tTc	p.Y406F	SLC6A13_ENST00000539668.1_5'UTR|SLC6A13_ENST00000445055.2_Missense_Mutation_p.Y314F	NM_016615.4	NP_057699.2	Q9NSD5	S6A13_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 13	406					neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(1)	28	all_cancers(10;0.0416)|all_epithelial(11;0.0537)|all_lung(10;0.0989)|Lung NSC(10;0.139)|Ovarian(42;0.142)		OV - Ovarian serous cystadenocarcinoma(31;0.00153)|BRCA - Breast invasive adenocarcinoma(9;0.239)			CACGTGAGGGTACATGTCCAC	0.557																																					p.Y406F		Atlas-SNP	.											.	SLC6A13	62	.	0			c.A1217T						.						119.0	99.0	106.0					12																	333252		2203	4300	6503	SO:0001583	missense	6540	exon11			TGAGGGTACATGT	U76343	CCDS8502.1, CCDS53729.1, CCDS58198.1	12p13.33	2013-07-19	2013-07-19		ENSG00000010379	ENSG00000010379		"""Solute carriers"""	11046	protein-coding gene	gene with protein product	"""GABA transporter 2"""	615097	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 13"""				Standard	NM_001243392		Approved	GAT2	uc001qic.2	Q9NSD5	OTTHUMG00000168053	ENST00000343164.4:c.1217A>T	chr12.hg19:g.333252T>A	ENSP00000339260:p.Tyr406Phe	114.0	0.0		75.0	17.0	NM_016615	B4DJL1|Q8TCC2|Q8WW56	Missense_Mutation	SNP	ENST00000343164.4	hg19	CCDS8502.1	.	.	.	.	.	.	.	.	.	.	T	5.679	0.309845	0.10733	.	.	ENSG00000010379	ENST00000445055;ENST00000313154;ENST00000343164	T;T	0.72394	-0.65;-0.65	5.5	5.5	0.81552	.	0.112740	0.64402	D	0.000007	T	0.48333	0.1494	N	0.05280	-0.08	0.47009	D	0.999282	B;B;B	0.11235	0.004;0.001;0.0	B;B;B	0.23574	0.047;0.046;0.017	T	0.49322	-0.8952	10	0.02654	T	1	.	15.5878	0.76499	0.0:0.0:0.0:1.0	.	314;385;406	B4DJL1;B4DJS3;Q9NSD5	.;.;S6A13_HUMAN	F	314;385;406	ENSP00000407104:Y314F;ENSP00000339260:Y406F	ENSP00000318097:Y385F	Y	-	2	0	SLC6A13	203513	1.000000	0.71417	1.000000	0.80357	0.747000	0.42532	3.813000	0.55636	2.098000	0.63641	0.402000	0.26972	TAC	.	.		0.557	SLC6A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397801.1	NM_016615	
C12orf4	57102	hgsc.bcm.edu	37	12	4645227	4645227	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:4645227C>A	ENST00000261250.3	-	2	221	c.134G>T	c.(133-135)gGa>gTa	p.G45V	RAD51AP1_ENST00000228843.9_5'Flank|RAD51AP1_ENST00000544927.1_5'Flank|RAD51AP1_ENST00000321524.7_5'Flank|RAD51AP1_ENST00000352618.4_5'Flank|RAD51AP1_ENST00000543041.1_5'Flank|C12orf4_ENST00000545746.1_Missense_Mutation_p.G45V	NM_020374.2	NP_065107.1	Q9NQ89	CL004_HUMAN	chromosome 12 open reading frame 4	45										NS(1)|endometrium(1)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	13			Colorectal(7;0.00165)|COAD - Colon adenocarcinoma(12;0.0229)	BRCA - Breast invasive adenocarcinoma(232;0.0281)		CATCAGACGTCCATGCAAATG	0.368																																					p.G45V		Atlas-SNP	.											.	C12orf4	58	.	0			c.G134T						.						120.0	114.0	116.0					12																	4645227		2203	4300	6503	SO:0001583	missense	57102	exon2			AGACGTCCATGCA	AJ272205	CCDS8528.1	12p13.3	2012-08-10			ENSG00000047621	ENSG00000047621			1184	protein-coding gene	gene with protein product							Standard	NM_020374		Approved		uc001qms.3	Q9NQ89	OTTHUMG00000168258	ENST00000261250.3:c.134G>T	chr12.hg19:g.4645227C>A	ENSP00000261250:p.Gly45Val	228.0	0.0		201.0	52.0	NM_020374	D3DUQ8|Q6MZH5	Missense_Mutation	SNP	ENST00000261250.3	hg19	CCDS8528.1	.	.	.	.	.	.	.	.	.	.	C	17.65	3.440987	0.63067	.	.	ENSG00000047621	ENST00000261250;ENST00000545746	.	.	.	6.17	5.24	0.73138	.	0.053164	0.85682	D	0.000000	T	0.70850	0.3271	L	0.57536	1.79	0.80722	D	1	D	0.54601	0.967	P	0.58013	0.831	T	0.63404	-0.6645	9	0.18710	T	0.47	.	17.0967	0.86637	0.0:0.8736:0.1264:0.0	.	45	Q9NQ89	CL004_HUMAN	V	45	.	ENSP00000261250:G45V	G	-	2	0	C12orf4	4515488	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.644000	0.67902	2.941000	0.99782	0.655000	0.94253	GGA	.	.		0.368	C12orf4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398992.1	NM_020374	
KLRK1	22914	hgsc.bcm.edu	37	12	10532337	10532337	+	Missense_Mutation	SNP	A	A	T	rs377167821		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:10532337A>T	ENST00000240618.6	-	4	343	c.203T>A	c.(202-204)aTt>aAt	p.I68N	RP11-277P12.20_ENST00000500682.1_RNA|KLRC4-KLRK1_ENST00000539300.1_3'UTR|KLRK1_ENST00000540818.1_Missense_Mutation_p.I68N	NM_001199805.1|NM_007360.3	NP_001186734.1|NP_031386.2	P26718	NKG2D_HUMAN	killer cell lectin-like receptor subfamily K, member 1	68					cell differentiation (GO:0030154)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)	9						TACCATAATAATGAAACGGAT	0.348																																					p.I68N		Atlas-SNP	.											.	.	.	.	0			c.T203A						.	A	ASN/ILE,ASN/ILE	0,4406		0,0,2203	71.0	65.0	67.0		203,203	4.5	0.1	12		67	2,8598	2.2+/-6.3	0,2,4298	no	missense,missense	KLRK1,KLRC4-KLRK1	NM_001199805.1,NM_007360.3	149,149	0,2,6501	TT,TA,AA		0.0233,0.0,0.0154	possibly-damaging,possibly-damaging	68/217,68/217	10532337	2,13004	2203	4300	6503	SO:0001583	missense	0	exon9			ATAATAATGAAAC	AJ001687	CCDS8623.1	12p13.2-p12.3	2010-02-17	2003-02-19		ENSG00000213809	ENSG00000213809		"""Killer cell lectin-like receptors"", ""CD molecules"""	18788	protein-coding gene	gene with protein product		611817	"""DNA segment on chromosome 12 (unique) 2489 expressed sequence"""	D12S2489E		9683661, 2007850	Standard	NM_007360		Approved	NKG2D, KLR, NKG2-D, CD314	uc009zhj.3	P26718	OTTHUMG00000168574	ENST00000240618.6:c.203T>A	chr12.hg19:g.10532337A>T	ENSP00000240618:p.Ile68Asn	182.0	0.0		135.0	37.0	NM_001199805	A8K7K5|A8K7P4|Q9NR41	Missense_Mutation	SNP	ENST00000240618.6	hg19	CCDS8623.1	.	.	.	.	.	.	.	.	.	.	A	11.87	1.768931	0.31320	0.0	2.33E-4	ENSG00000213809	ENST00000240618;ENST00000540818	T;T	0.01560	4.77;4.77	5.64	4.51	0.55191	.	0.619766	0.15348	N	0.267083	T	0.05823	0.0152	L	0.52573	1.65	0.09310	N	1	D;D;P	0.64830	0.962;0.994;0.949	P;D;P	0.64321	0.717;0.924;0.621	T	0.30208	-0.9986	10	0.87932	D	0	.	7.622	0.28191	0.9024:0.0:0.0976:0.0	.	68;49;68	Q8WZ67;Q1HEA1;P26718	.;.;NKG2D_HUMAN	N	68	ENSP00000240618:I68N;ENSP00000446003:I68N	ENSP00000240618:I68N	I	-	2	0	KLRK1	10423604	0.032000	0.19561	0.096000	0.21009	0.060000	0.15804	2.415000	0.44635	0.990000	0.38787	0.528000	0.53228	ATT	.	.		0.348	KLRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400269.1	NM_007360	
BICD1	636	hgsc.bcm.edu	37	12	32369351	32369351	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:32369351A>T	ENST00000281474.5	+	2	487	c.384A>T	c.(382-384)gcA>gcT	p.A128A	BICD1_ENST00000548411.1_Silent_p.A128A	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	128					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ATGTACAGGCAGAAAACGAGA	0.478																																					p.A128A		Atlas-SNP	.											.	BICD1	89	.	0			c.A384T						.						92.0	84.0	87.0					12																	32369351		2203	4300	6503	SO:0001819	synonymous_variant	636	exon2			ACAGGCAGAAAAC	U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.384A>T	chr12.hg19:g.32369351A>T		121.0	0.0		115.0	25.0	NM_001714	A8K2C3|F8W113|O43892|O43893	Silent	SNP	ENST00000281474.5	hg19	CCDS8726.1																																																																																			.	.		0.478	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403380.1	NM_001714	
LRRK2	120892	hgsc.bcm.edu	37	12	40761452	40761452	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:40761452A>T	ENST00000298910.7	+	51	7527	c.7469A>T	c.(7468-7470)cAa>cTa	p.Q2490L		NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	2490					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				CTAGAGATACAATCTTGCTTG	0.299																																					p.Q2490L		Atlas-SNP	.											.	LRRK2	763	.	0			c.A7469T						.						46.0	49.0	48.0					12																	40761452		2202	4297	6499	SO:0001583	missense	120892	exon51			AGATACAATCTTG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.7469A>T	chr12.hg19:g.40761452A>T	ENSP00000298910:p.Gln2490Leu	255.0	0.0		225.0	66.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	A	16.02	3.003590	0.54254	.	.	ENSG00000188906	ENST00000298910	T	0.35605	1.3	5.3	5.3	0.74995	WD40 repeat-like-containing domain (1);	0.172705	0.51477	D	0.000086	T	0.37433	0.1003	L	0.54323	1.7	0.40611	D	0.981679	B;B	0.28552	0.215;0.215	B;B	0.29524	0.103;0.103	T	0.30504	-0.9976	10	0.56958	D	0.05	.	15.2534	0.73564	1.0:0.0:0.0:0.0	.	2490;2490	Q17RV3;Q5S007	.;LRRK2_HUMAN	L	2490	ENSP00000298910:Q2490L	ENSP00000298910:Q2490L	Q	+	2	0	LRRK2	39047719	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.657000	0.74402	2.007000	0.58848	0.459000	0.35465	CAA	.	.		0.299	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
ARID2	196528	hgsc.bcm.edu	37	12	46205216	46205216	+	Nonsense_Mutation	SNP	C	C	G	rs567746850	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:46205216C>G	ENST00000334344.6	+	4	472	c.300C>G	c.(298-300)taC>taG	p.Y100*	ARID2_ENST00000422737.1_5'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	100	ARID. {ECO:0000255|PROSITE- ProRule:PRU00355}.				chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAGAAAAGTACGAGAAAGTTC	0.358			"""N, S, F"""		hepatocellular carcinoma																																p.Y100X		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.C300G						.						108.0	98.0	102.0					12																	46205216		2203	4300	6503	SO:0001587	stop_gained	196528	exon4			AAAGTACGAGAAA		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.300C>G	chr12.hg19:g.46205216C>G	ENSP00000335044:p.Tyr100*	99.0	0.0		79.0	43.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Nonsense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	35	5.476042	0.96291	.	.	ENSG00000189079	ENST00000334344	.	.	.	5.87	2.98	0.34508	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.8581	7.6302	0.28234	0.0:0.5194:0.0:0.4806	.	.	.	.	X	100	.	ENSP00000335044:Y100X	Y	+	3	2	ARID2	44491483	0.993000	0.37304	1.000000	0.80357	0.973000	0.67179	0.268000	0.18571	0.353000	0.24079	-0.162000	0.13425	TAC	.	.		0.358	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
RACGAP1	29127	hgsc.bcm.edu	37	12	50388025	50388025	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:50388025T>A	ENST00000427314.2	-	14	1451	c.1228A>T	c.(1228-1230)Agc>Tgc	p.S410C	RACGAP1_ENST00000454520.2_Missense_Mutation_p.S410C|RACGAP1_ENST00000547905.1_Missense_Mutation_p.S410C|RACGAP1_ENST00000312377.5_Missense_Mutation_p.S410C|RACGAP1_ENST00000548961.1_5'Flank|RACGAP1_ENST00000551016.1_Missense_Mutation_p.S410C|RACGAP1_ENST00000434422.1_Missense_Mutation_p.S410C|RACGAP1_ENST00000547061.1_5'Flank	NM_013277.3	NP_037409.2			Rac GTPase activating protein 1											cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(6)	14						TCCACTTTGCTGAGGAGGGGT	0.428																																					p.S410C		Atlas-SNP	.											.	RACGAP1	36	.	0			c.A1228T						.						130.0	131.0	131.0					12																	50388025		2203	4300	6503	SO:0001583	missense	29127	exon14			CTTTGCTGAGGAG		CCDS8795.1	12q13	2004-05-17				ENSG00000161800			9804	protein-coding gene	gene with protein product		604980				9497316	Standard	NM_013277		Approved	MgcRacGAP	uc001rvs.2	Q9H0H5		ENST00000427314.2:c.1228A>T	chr12.hg19:g.50388025T>A	ENSP00000404190:p.Ser410Cys	100.0	0.0		83.0	24.0	NM_013277		Missense_Mutation	SNP	ENST00000427314.2	hg19	CCDS8795.1	.	.	.	.	.	.	.	.	.	.	T	21.8	4.203846	0.79127	.	.	ENSG00000161800	ENST00000427314;ENST00000312377;ENST00000434422;ENST00000454520;ENST00000551016;ENST00000547905;ENST00000549342	T;T;T;T;T;T;T	0.25579	1.79;1.79;1.79;1.79;1.79;1.79;1.79	5.35	5.35	0.76521	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.071913	0.85682	D	0.000000	T	0.54095	0.1837	M	0.88570	2.965	0.80722	D	1	D	0.67145	0.996	P	0.59948	0.866	T	0.64676	-0.6351	10	0.72032	D	0.01	-14.0885	15.3371	0.74266	0.0:0.0:0.0:1.0	.	410	Q9H0H5	RGAP1_HUMAN	C	410;410;410;410;410;410;146	ENSP00000404190:S410C;ENSP00000309871:S410C;ENSP00000413241:S410C;ENSP00000404808:S410C;ENSP00000449374:S410C;ENSP00000449370:S410C;ENSP00000449565:S146C	ENSP00000309871:S410C	S	-	1	0	RACGAP1	48674292	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.077000	0.64419	2.014000	0.59158	0.454000	0.30748	AGC	.	.		0.428	RACGAP1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000405997.1	NM_013277	
ESPL1	9700	hgsc.bcm.edu	37	12	53684151	53684151	+	Silent	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:53684151G>T	ENST00000257934.4	+	24	5353	c.5262G>T	c.(5260-5262)ctG>ctT	p.L1754L	ESPL1_ENST00000552462.1_Silent_p.L1754L	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1754					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GTTCAGTCCTGAATGAGTTTG	0.542																																					p.L1754L	Colon(53;1069 1201 2587 5382)	Atlas-SNP	.											.	ESPL1	158	.	0			c.G5262T						.						120.0	104.0	109.0					12																	53684151		2203	4300	6503	SO:0001819	synonymous_variant	9700	exon24			AGTCCTGAATGAG	D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.5262G>T	chr12.hg19:g.53684151G>T		55.0	0.0		37.0	16.0	NM_012291		Silent	SNP	ENST00000257934.4	hg19	CCDS8852.1																																																																																			.	.		0.542	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406899.2	NM_012291	
TESPA1	9840	hgsc.bcm.edu	37	12	55356690	55356690	+	Missense_Mutation	SNP	T	T	A	rs61733026	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:55356690T>A	ENST00000449076.1	-	9	1124	c.992A>T	c.(991-993)cAg>cTg	p.Q331L	TESPA1_ENST00000524959.1_5'Flank|TESPA1_ENST00000532804.1_Missense_Mutation_p.Q193L|TESPA1_ENST00000316577.8_Missense_Mutation_p.Q331L|TESPA1_ENST00000524622.1_Missense_Mutation_p.Q193L|TESPA1_ENST00000531122.1_Missense_Mutation_p.Q193L	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	331					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											AGAGTCTTGCTGGAGGAACTG	0.517																																					p.Q331L		Atlas-SNP	.											.	.	.	.	0			c.A992T						.						70.0	73.0	72.0					12																	55356690		1956	4151	6107	SO:0001583	missense	9840	exon9			TCTTGCTGGAGGA	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.992A>T	chr12.hg19:g.55356690T>A	ENSP00000400892:p.Gln331Leu	93.0	0.0		71.0	16.0	NM_001098815	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	ENST00000449076.1	hg19	CCDS44913.1	.	.	.	.	.	.	.	.	.	.	T	18.40	3.615536	0.66672	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01;-0.01	4.96	4.96	0.65561	.	0.378758	0.22809	N	0.055364	T	0.49474	0.1559	L	0.34521	1.04	0.29542	N	0.851962	P	0.36535	0.557	B	0.33890	0.172	T	0.57802	-0.7748	10	0.72032	D	0.01	-0.5228	11.2201	0.48848	0.0:0.0:0.0:1.0	.	331	A2RU30	K0748_HUMAN	L	193;193;331;331;193	ENSP00000435622:Q193L;ENSP00000432030:Q193L;ENSP00000400892:Q331L;ENSP00000312679:Q331L;ENSP00000433098:Q193L	ENSP00000312679:Q331L	Q	-	2	0	KIAA0748	53642957	.	.	0.327000	0.25402	0.631000	0.37964	.	.	2.213000	0.71641	0.533000	0.62120	CAG	.	T|0.992;C|0.008		0.517	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815	
TESPA1	9840	hgsc.bcm.edu	37	12	55357002	55357002	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:55357002A>G	ENST00000449076.1	-	9	812	c.680T>C	c.(679-681)cTg>cCg	p.L227P	TESPA1_ENST00000524959.1_5'UTR|TESPA1_ENST00000532804.1_Missense_Mutation_p.L89P|TESPA1_ENST00000316577.8_Missense_Mutation_p.L227P|TESPA1_ENST00000524622.1_Missense_Mutation_p.L89P|TESPA1_ENST00000531122.1_Missense_Mutation_p.L89P	NM_001136030.2	NP_001129502.1	A2RU30	TESP1_HUMAN	thymocyte expressed, positive selection associated 1	227					COP9 signalosome assembly (GO:0010387)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)											AGTGACAGCCAGTGTTTGCAC	0.463																																					p.L227P		Atlas-SNP	.											.	.	.	.	0			c.T680C						.						67.0	71.0	69.0					12																	55357002		1986	4174	6160	SO:0001583	missense	9840	exon9			ACAGCCAGTGTTT	AB018291	CCDS44913.1, CCDS58240.1	12q13.2	2012-03-21	2012-03-21	2012-03-21	ENSG00000135426	ENSG00000135426			29109	protein-coding gene	gene with protein product		615664	"""KIAA0748"""	KIAA0748		9872452	Standard	NM_001136030		Approved		uc001sgn.4	A2RU30	OTTHUMG00000165407	ENST00000449076.1:c.680T>C	chr12.hg19:g.55357002A>G	ENSP00000400892:p.Leu227Pro	55.0	0.0		51.0	8.0	NM_001098815	B4DPM3|B4E048|B7Z9K7|O94849|Q4G0P2|Q9P0C4	Missense_Mutation	SNP	ENST00000449076.1	hg19	CCDS44913.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.164183	0.78339	.	.	ENSG00000135426	ENST00000524622;ENST00000532804;ENST00000449076;ENST00000316577;ENST00000531122	T;T;T;T;T	0.76060	-0.73;-0.73;-0.99;-0.99;-0.73	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000002	D	0.82462	0.5042	L	0.56199	1.76	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84048	0.0368	10	0.87932	D	0	-23.7939	12.2763	0.54737	1.0:0.0:0.0:0.0	.	227	A2RU30	K0748_HUMAN	P	89;89;227;227;89	ENSP00000435622:L89P;ENSP00000432030:L89P;ENSP00000400892:L227P;ENSP00000312679:L227P;ENSP00000433098:L89P	ENSP00000312679:L227P	L	-	2	0	KIAA0748	53643269	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.754000	0.85163	2.213000	0.71641	0.533000	0.62120	CTG	.	.		0.463	TESPA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000383822.1	NM_001098815	
OR6C68	403284	hgsc.bcm.edu	37	12	55886887	55886887	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:55886887T>C	ENST00000548615.1	+	1	726	c.726T>C	c.(724-726)caT>caC	p.H242H	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|RP11-110A12.2_ENST00000555138.1_RNA|OR6C68_ENST00000379662.1_Silent_p.H247H	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	242						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						GTTCTTCACATATTACTGTGG	0.348																																					p.H242H		Atlas-SNP	.											.	OR6C68	36	.	0			c.T726C						.						86.0	85.0	86.0					12																	55886887		2203	4300	6503	SO:0001819	synonymous_variant	403284	exon1			TTCACATATTACT		CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.726T>C	chr12.hg19:g.55886887T>C		90.0	0.0		62.0	30.0	NM_001005519		Silent	SNP	ENST00000548615.1	hg19	CCDS31826.2																																																																																			.	.		0.348	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406677.1		
WIF1	11197	hgsc.bcm.edu	37	12	65514841	65514841	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:65514841T>A	ENST00000286574.4	-	1	505	c.131A>T	c.(130-132)cAg>cTg	p.Q44L		NM_007191.4	NP_009122.2	Q9Y5W5	WIF1_HUMAN	WNT inhibitory factor 1	44	WIF. {ECO:0000255|PROSITE- ProRule:PRU00222}.				multicellular organismal development (GO:0007275)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)				cervix(1)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	21			LUAD - Lung adenocarcinoma(6;0.0234)|LUSC - Lung squamous cell carcinoma(43;0.0975)	GBM - Glioblastoma multiforme(28;0.0231)		TACTCTTGCCTGGTGAGCATC	0.622			T	HMGA2	pleomorphic salivary gland adenoma																																p.Q44L	Esophageal Squamous(148;1595 1816 48559 49439 49664)	Atlas-SNP	.		Dom	yes		12	12q14.3	11197	WNT inhibitory factor 1		E	.	WIF1	96	.	0			c.A131T						.						26.0	24.0	25.0					12																	65514841		2071	4035	6106	SO:0001583	missense	11197	exon1			CTTGCCTGGTGAG	AF122922	CCDS8971.1	12q14.2	2008-04-11			ENSG00000156076	ENSG00000156076			18081	protein-coding gene	gene with protein product		605186				10201374	Standard	NM_007191		Approved		uc001ssk.3	Q9Y5W5	OTTHUMG00000168832	ENST00000286574.4:c.131A>T	chr12.hg19:g.65514841T>A	ENSP00000286574:p.Gln44Leu	147.0	0.0		129.0	29.0	NM_007191	Q6UXI1|Q8WVG4	Missense_Mutation	SNP	ENST00000286574.4	hg19	CCDS8971.1	.	.	.	.	.	.	.	.	.	.	T	11.47	1.647258	0.29246	.	.	ENSG00000156076	ENST00000286574	T	0.50548	0.74	3.7	3.7	0.42460	WIF domain (3);	0.133760	0.50627	D	0.000109	T	0.60104	0.2243	L	0.55990	1.75	0.58432	D	0.999996	D	0.59357	0.985	D	0.69654	0.965	T	0.59511	-0.7441	9	.	.	.	.	12.5732	0.56349	0.0:0.0:0.0:1.0	.	44	Q9Y5W5	WIF1_HUMAN	L	44	ENSP00000286574:Q44L	.	Q	-	2	0	WIF1	63801108	1.000000	0.71417	1.000000	0.80357	0.156000	0.22039	5.328000	0.65887	1.932000	0.55993	0.402000	0.26972	CAG	.	.		0.622	WIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401258.2		
PTPRB	5787	hgsc.bcm.edu	37	12	70983958	70983958	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:70983958A>T	ENST00000261266.5	-	6	1211	c.1182T>A	c.(1180-1182)ctT>ctA	p.L394L	PTPRB_ENST00000538174.2_5'UTR|PTPRB_ENST00000538708.1_Silent_p.L394L|PTPRB_ENST00000334414.6_Silent_p.L612L|PTPRB_ENST00000551525.1_Silent_p.L611L|PTPRB_ENST00000451516.2_Intron|PTPRB_ENST00000550857.1_Intron|PTPRB_ENST00000550358.1_Silent_p.L612L	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	394	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			AGCTCACTACAAGAGACCTCA	0.468											OREG0021990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.L612L		Atlas-SNP	.											.	PTPRB	676	.	0			c.T1836A						.						106.0	108.0	108.0					12																	70983958		1952	4162	6114	SO:0001819	synonymous_variant	5787	exon8			CACTACAAGAGAC	X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.1182T>A	chr12.hg19:g.70983958A>T		114.0	0.0	1126	110.0	32.0	NM_001109754	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Silent	SNP	ENST00000261266.5	hg19	CCDS44944.1																																																																																			.	.		0.468	PTPRB-007	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000404439.1		
OTOGL	283310	hgsc.bcm.edu	37	12	80655748	80655748	+	Splice_Site	SNP	G	G	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:80655748G>C	ENST00000547103.1	+	18	1868		c.e18-1		OTOGL_ENST00000458043.2_Splice_Site			Q3ZCN5	OTOGL_HUMAN	otogelin-like						L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TTGCTTTCTAGTTCTCCATCA	0.378																																					.		Atlas-SNP	.											.	OTOGL	235	.	0			c.1863-1G>C						.						119.0	118.0	118.0					12																	80655748		1931	4124	6055	SO:0001630	splice_region_variant	283310	exon18			TTTCTAGTTCTCC	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1863-1G>C	chr12.hg19:g.80655748G>C		65.0	0.0		72.0	16.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Splice_Site	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	G	22.4	4.287785	0.80803	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8686	0.92303	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OTOGL	79179879	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.069000	0.93967	2.770000	0.95276	0.655000	0.94253	.	.	.		0.378	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	Intron
SLC5A8	160728	hgsc.bcm.edu	37	12	101560282	101560282	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:101560282T>A	ENST00000536262.2	-	12	2074	c.1516A>T	c.(1516-1518)Aat>Tat	p.N506Y		NM_145913.3	NP_666018.3			solute carrier family 5 (sodium/monocarboxylate cotransporter), member 8											breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(29)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						CTTTGAACATTGTATATTTGA	0.323																																					p.N506Y	GBM(60;420 1056 13605 22380 47675)	Atlas-SNP	.											.	SLC5A8	102	.	0			c.A1516T						.						82.0	81.0	81.0					12																	101560282		2203	4300	6503	SO:0001583	missense	160728	exon12			GAACATTGTATAT	AY081220	CCDS9080.1	12q23.1	2013-07-19	2013-07-19		ENSG00000256870	ENSG00000256870		"""Solute carriers"""	19119	protein-coding gene	gene with protein product		608044	"""solute carrier family 5 (iodide transporter), member 8"""			12107270, 12829793	Standard	NM_145913		Approved	AIT	uc001thz.4	Q8N695	OTTHUMG00000170499	ENST00000536262.2:c.1516A>T	chr12.hg19:g.101560282T>A	ENSP00000445340:p.Asn506Tyr	99.0	0.0		47.0	17.0	NM_145913		Missense_Mutation	SNP	ENST00000536262.2	hg19	CCDS9080.1	.	.	.	.	.	.	.	.	.	.	T	9.221	1.033262	0.19590	.	.	ENSG00000256870	ENST00000536262	T	0.63744	-0.06	5.39	2.98	0.34508	.	0.727114	0.13642	N	0.372866	T	0.52108	0.1714	L	0.47190	1.495	0.09310	N	1	B	0.13145	0.007	B	0.08055	0.003	T	0.46303	-0.9201	10	0.54805	T	0.06	.	7.0512	0.25073	0.0:0.2636:0.0:0.7364	.	506	Q8N695	SC5A8_HUMAN	Y	506	ENSP00000445340:N506Y	ENSP00000445340:N506Y	N	-	1	0	SLC5A8	100084413	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	0.041000	0.13927	0.341000	0.23771	0.533000	0.62120	AAT	.	.		0.323	SLC5A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409401.1	NM_145913	
STAB2	55576	hgsc.bcm.edu	37	12	104071229	104071229	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:104071229A>T	ENST00000388887.2	+	25	2850		c.e25-1			NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TTCCTCCTGCAGGCAGAATGC	0.493																																					.		Atlas-SNP	.											.	STAB2	370	.	0			c.2647-2A>T						.						87.0	90.0	89.0					12																	104071229		2203	4300	6503	SO:0001630	splice_region_variant	55576	exon25			TCCTGCAGGCAGA	AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.2647-1A>T	chr12.hg19:g.104071229A>T		61.0	0.0		39.0	13.0	NM_017564		Splice_Site	SNP	ENST00000388887.2	hg19	CCDS31888.1	.	.	.	.	.	.	.	.	.	.	A	13.00	2.106841	0.37145	.	.	ENSG00000136011	ENST00000388887	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.903	0.70696	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102595359	1.000000	0.71417	0.990000	0.47175	0.072000	0.16883	8.312000	0.89976	2.174000	0.68829	0.533000	0.62120	.	.	.		0.493	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407089.1		Intron
CHST11	50515	hgsc.bcm.edu	37	12	105151144	105151144	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:105151144T>A	ENST00000303694.5	+	3	1061	c.622T>A	c.(622-624)Ttc>Atc	p.F208I	CHST11_ENST00000549260.1_Missense_Mutation_p.F203I	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	208					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						CAACATCTCCTTCCACAAGCG	0.547																																					p.F208I		Atlas-SNP	.											.	CHST11	54	.	0			c.T622A						.						111.0	97.0	102.0					12																	105151144		2203	4300	6503	SO:0001583	missense	50515	exon3			ATCTCCTTCCACA	AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.622T>A	chr12.hg19:g.105151144T>A	ENSP00000305725:p.Phe208Ile	159.0	0.0		90.0	31.0	NM_018413	A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	ENST00000303694.5	hg19	CCDS9099.1	.	.	.	.	.	.	.	.	.	.	T	31	5.070691	0.93950	.	.	ENSG00000171310	ENST00000549260;ENST00000303694	T;T	0.74632	-0.86;-0.86	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.89476	0.6726	M	0.93720	3.45	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.91761	0.5420	10	0.56958	D	0.05	-24.1475	15.4615	0.75359	0.0:0.0:0.0:1.0	.	203;208	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	I	203;208	ENSP00000450004:F203I;ENSP00000305725:F208I	ENSP00000305725:F208I	F	+	1	0	CHST11	103675274	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.065000	0.61736	0.533000	0.62120	TTC	.	.		0.547	CHST11-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000405960.2	NM_018413	
MYO1H	283446	hgsc.bcm.edu	37	12	109876380	109876380	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:109876380G>A	ENST00000431443.2	+	22	2231	c.2231G>A	c.(2230-2232)cGg>cAg	p.R744Q	MYO1H_ENST00000310903.5_Missense_Mutation_p.R734Q	NM_001101421.3	NP_001094891.3	Q8N1T3	MYO1H_HUMAN	myosin IH	744	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.					myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(17)|prostate(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	47						GCCCTGGCTCGGAAGGCAATC	0.512																																					p.R734Q		Atlas-SNP	.											.	MYO1H	98	.	0			c.G2201A						.						36.0	36.0	36.0					12																	109876380		1912	4118	6030	SO:0001583	missense	283446	exon22			TGGCTCGGAAGGC		CCDS53826.1	12q24.11	2011-09-27			ENSG00000174527	ENSG00000174527		"""Myosins / Myosin superfamily : Class I"""	13879	protein-coding gene	gene with protein product		614636					Standard	NM_001101421		Approved	FLJ37587	uc010sxn.1	Q8N1T3	OTTHUMG00000169252	ENST00000431443.2:c.2231G>A	chr12.hg19:g.109876380G>A	ENSP00000444076:p.Arg744Gln	70.0	0.0		45.0	14.0	NM_001101421	F5H3C6	Missense_Mutation	SNP	ENST00000431443.2	hg19		.	.	.	.	.	.	.	.	.	.	G	14.50	2.553794	0.45487	.	.	ENSG00000174527	ENST00000310903;ENST00000431443	T;T	0.76968	-1.06;-1.06	5.13	4.24	0.50183	.	.	.	.	.	T	0.58892	0.2154	N	0.08118	0	0.38082	D	0.93669	B	0.31209	0.313	B	0.32090	0.14	T	0.58934	-0.7548	9	0.29301	T	0.29	.	11.6434	0.51246	0.0878:0.0:0.9122:0.0	.	734	F5H3C6	.	Q	734;744	ENSP00000439182:R734Q;ENSP00000444076:R744Q	ENSP00000439182:R734Q	R	+	2	0	MYO1H	108360763	1.000000	0.71417	0.962000	0.40283	0.563000	0.35712	5.343000	0.65976	1.147000	0.42369	0.655000	0.94253	CGG	.	.		0.512	MYO1H-201	KNOWN	basic	protein_coding	protein_coding		NM_173597	
UBE3B	89910	hgsc.bcm.edu	37	12	109921745	109921745	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:109921745A>T	ENST00000342494.3	+	4	836	c.241A>T	c.(241-243)Agg>Tgg	p.R81W	UBE3B_ENST00000340074.5_Missense_Mutation_p.R81W|UBE3B_ENST00000540230.1_Missense_Mutation_p.R81W|UBE3B_ENST00000280774.5_Missense_Mutation_p.R81W|UBE3B_ENST00000537063.1_Missense_Mutation_p.R81W|UBE3B_ENST00000434735.2_Missense_Mutation_p.R81W|UBE3B_ENST00000536398.1_Missense_Mutation_p.R81W	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	81					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						CAAGATTGCCAGGAAACTGCT	0.328																																					p.R81W		Atlas-SNP	.											.	UBE3B	116	.	0			c.A241T						.						110.0	112.0	111.0					12																	109921745		2203	4300	6503	SO:0001583	missense	89910	exon4			ATTGCCAGGAAAC	BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.241A>T	chr12.hg19:g.109921745A>T	ENSP00000340596:p.Arg81Trp	118.0	0.0		74.0	29.0	NM_001270451	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	ENST00000342494.3	hg19	CCDS9129.1	.	.	.	.	.	.	.	.	.	.	A	17.98	3.519914	0.64634	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000536398;ENST00000539599;ENST00000342494;ENST00000340074;ENST00000540230;ENST00000537063	T;T;T;T;T;T;T;T	0.68624	1.9;1.9;-0.34;1.9;1.9;-0.34;-0.34;1.9	5.35	2.92	0.33932	.	0.000000	0.85682	D	0.000000	T	0.77336	0.4115	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;D;D	0.78314	0.864;0.991;0.991	T	0.79310	-0.1856	10	0.87932	D	0	-0.0163	12.1142	0.53856	0.5304:0.4696:0.0:0.0	.	81;81;81	Q7Z3V4;Q7Z3V4-3;F5H6D6	UBE3B_HUMAN;.;.	W	81	ENSP00000391529:R81W;ENSP00000280774:R81W;ENSP00000440585:R81W;ENSP00000443131:R81W;ENSP00000340596:R81W;ENSP00000342614:R81W;ENSP00000443565:R81W;ENSP00000437694:R81W	ENSP00000280774:R81W	R	+	1	2	UBE3B	108406128	0.979000	0.34478	1.000000	0.80357	0.678000	0.39670	0.556000	0.23438	1.075000	0.40932	0.528000	0.53228	AGG	.	.		0.328	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403119.1	NM_183415	
DNAH10	196385	hgsc.bcm.edu	37	12	124298165	124298165	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:124298165A>T	ENST00000409039.3	+	19	3270	c.3245A>T	c.(3244-3246)tAt>tTt	p.Y1082F		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	1082	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAGGAGCTCTATAATCTCCAT	0.433																																					p.Y1082F		Atlas-SNP	.											.	DNAH10	888	.	0			c.A3245T						.						58.0	53.0	54.0					12																	124298165		2203	4300	6503	SO:0001583	missense	196385	exon19			AGCTCTATAATCT	AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.3245A>T	chr12.hg19:g.124298165A>T	ENSP00000386770:p.Tyr1082Phe	117.0	0.0		74.0	30.0	NM_207437	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	ENST00000409039.3	hg19	CCDS9255.2	.	.	.	.	.	.	.	.	.	.	A	15.53	2.859731	0.51376	.	.	ENSG00000197653	ENST00000409039	T	0.20881	2.04	5.77	0.0859	0.14443	.	2.497630	0.01623	N	0.023112	T	0.11110	0.0271	N	0.03177	-0.4	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.0	T	0.27806	-1.0063	10	0.46703	T	0.11	.	7.4994	0.27509	0.5406:0.0:0.0706:0.3887	.	1082;957;1082	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	F	1082	ENSP00000386770:Y1082F	ENSP00000386770:Y1082F	Y	+	2	0	DNAH10	122864118	0.000000	0.05858	0.000000	0.03702	0.780000	0.44128	0.552000	0.23376	0.084000	0.17077	0.460000	0.39030	TAT	.	.		0.433	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335420.3		
EP400	57634	hgsc.bcm.edu	37	12	132464277	132464277	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:132464277A>T	ENST00000333577.4	+	4	1591	c.1482A>T	c.(1480-1482)ggA>ggT	p.G494G	EP400_ENST00000330386.6_Silent_p.G458G|EP400_ENST00000389561.2_Silent_p.G458G|EP400_ENST00000332482.4_Silent_p.G457G|EP400_ENST00000389562.2_Silent_p.G457G			Q96L91	EP400_HUMAN	E1A binding protein p400	494					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(6)|central_nervous_system(10)|cervix(1)|endometrium(21)|kidney(13)|large_intestine(25)|lung(56)|ovary(5)|prostate(8)|skin(6)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	161	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.198)		OV - Ovarian serous cystadenocarcinoma(86;3.01e-08)|Epithelial(86;3.43e-07)|all cancers(50;2.01e-06)		CAGGGGCCGGAAGCACAGTAG	0.552																																					p.G458G		Atlas-SNP	.											.	EP400	370	.	0			c.A1374T						.						55.0	54.0	54.0					12																	132464277		2203	4300	6503	SO:0001819	synonymous_variant	57634	exon3			GGCCGGAAGCACA	U80743	CCDS31929.1, CCDS31929.2	12q24.33	2008-02-01	2002-02-05	2002-02-08		ENSG00000183495			11958	protein-coding gene	gene with protein product		606265	"""trinucleotide repeat containing 12"""	TNRC12		9225980, 11509179	Standard	NM_015409		Approved	CAGH32, KIAA1498, P400, KIAA1818, DKFZP434I225	uc001ujn.3	Q96L91		ENST00000333577.4:c.1482A>T	chr12.hg19:g.132464277A>T		295.0	0.0		177.0	66.0	NM_015409	O15411|Q6P2F5|Q8N8Q7|Q8NE05|Q96JK7|Q9P230	Silent	SNP	ENST00000333577.4	hg19																																																																																				.	.		0.552	EP400-203	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015409	
POLE	5426	hgsc.bcm.edu	37	12	133219131	133219131	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:133219131T>A	ENST00000320574.5	-	37	4956	c.4913A>T	c.(4912-4914)aAc>aTc	p.N1638I	POLE_ENST00000535270.1_Missense_Mutation_p.N1611I|POLE_ENST00000434528.3_5'Flank	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1638					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	GGTGTCCAGGTTGAGGTAGTG	0.612								DNA polymerases (catalytic subunits)																													p.N1638I		Atlas-SNP	.											.	POLE	416	.	0			c.A4913T						.						53.0	50.0	51.0					12																	133219131		2203	4300	6503	SO:0001583	missense	5426	exon37			TCCAGGTTGAGGT		CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4913A>T	chr12.hg19:g.133219131T>A	ENSP00000322570:p.Asn1638Ile	71.0	0.0		41.0	13.0	NM_006231	Q13533|Q86VH9	Missense_Mutation	SNP	ENST00000320574.5	hg19	CCDS9278.1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661957	0.88251	.	.	ENSG00000177084	ENST00000320574;ENST00000455752;ENST00000535270	T;T;T	0.23754	1.89;1.89;1.89	5.51	5.51	0.81932	DNA polymerase epsilon, catalytic subunit A, C-terminal (1);	0.167222	0.64402	D	0.000004	T	0.45895	0.1365	M	0.72894	2.215	0.80722	D	1	B	0.32526	0.374	P	0.48921	0.595	T	0.42207	-0.9465	10	0.51188	T	0.08	.	15.6353	0.76946	0.0:0.0:0.0:1.0	.	1638	Q07864	DPOE1_HUMAN	I	1638;1649;1611	ENSP00000322570:N1638I;ENSP00000406383:N1649I;ENSP00000445753:N1611I	ENSP00000322570:N1638I	N	-	2	0	POLE	131729204	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.929000	0.56514	2.101000	0.63845	0.533000	0.62120	AAC	.	.		0.612	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000397689.2	NM_006231	
TUBA3C	7278	hgsc.bcm.edu	37	13	19752513	19752513	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:19752513T>G	ENST00000400113.3	-	3	352	c.248A>C	c.(247-249)tAt>tCt	p.Y83S		NM_006001.2	NP_005992.1	Q13748	TBA3C_HUMAN	tubulin, alpha 3c	83					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(4)|prostate(7)|skin(7)|urinary_tract(1)	72		all_cancers(29;1.31e-20)|all_epithelial(30;1.59e-20)|all_lung(29;6.91e-20)|Lung NSC(5;9.25e-17)|Hepatocellular(1;0.0207)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;6.78e-06)|Epithelial(112;3.79e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00172)|Lung(94;0.0186)|LUSC - Lung squamous cell carcinoma(192;0.108)		GAGCTGCCTATAGGTTCCTGT	0.498																																					p.Y83S		Atlas-SNP	.											.	TUBA3C	166	.	0			c.A248C						.						119.0	104.0	109.0					13																	19752513		2203	4300	6503	SO:0001583	missense	7278	exon3			TGCCTATAGGTTC	AF005392	CCDS9284.1	13q12.11	2007-06-20	2007-02-12	2007-02-12	ENSG00000198033	ENSG00000198033		"""Tubulins"""	12408	protein-coding gene	gene with protein product		602528	"""tubulin, alpha 2"""	TUBA2		9465305	Standard	NM_006001		Approved	bA408E5.3	uc009zzj.3	Q13748	OTTHUMG00000016481	ENST00000400113.3:c.248A>C	chr13.hg19:g.19752513T>G	ENSP00000382982:p.Tyr83Ser	131.0	0.0		69.0	26.0	NM_006001	A6NJQ0|Q5W099|Q6PEY3|Q96F18	Missense_Mutation	SNP	ENST00000400113.3	hg19	CCDS9284.1	.	.	.	.	.	.	.	.	.	.	t	13.09	2.133510	0.37630	.	.	ENSG00000198033	ENST00000400113;ENST00000360801	T	0.68903	-0.36	1.53	1.53	0.23141	.	0.000000	0.44483	U	0.000443	T	0.69672	0.3137	.	.	.	0.42739	D	0.993739	.	.	.	.	.	.	T	0.70839	-0.4763	7	0.87932	D	0	.	7.129	0.25488	0.0:0.0:0.0:1.0	.	.	.	.	S	83	ENSP00000382982:Y83S	ENSP00000354037:Y83S	Y	-	2	0	TUBA3C	18650513	1.000000	0.71417	0.997000	0.53966	0.943000	0.58893	6.510000	0.73729	0.958000	0.37956	0.347000	0.21830	TAT	.	.		0.498	TUBA3C-002	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044007.2	NM_006001	
SKA3	221150	hgsc.bcm.edu	37	13	21734117	21734117	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:21734117T>A	ENST00000314759.5	-	6	963	c.839A>T	c.(838-840)tAt>tTt	p.Y280F	SKA3_ENST00000400018.3_Missense_Mutation_p.Y280F	NM_145061.5	NP_659498.4	Q8IX90	SKA3_HUMAN	spindle and kinetochore associated complex subunit 3	280					chromosome segregation (GO:0007059)|mitotic nuclear division (GO:0007067)|regulation of microtubule polymerization or depolymerization (GO:0031110)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|spindle microtubule (GO:0005876)				breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	19						AGAGTTGGTATATTCGGCATC	0.318																																					p.Y280F		Atlas-SNP	.											.	SKA3	76	.	0			c.A839T						.						127.0	136.0	133.0					13																	21734117		2203	4300	6503	SO:0001583	missense	221150	exon6			TTGGTATATTCGG	AF361358	CCDS31946.1, CCDS53856.1	13q11	2013-01-17	2009-08-19	2009-08-19	ENSG00000165480	ENSG00000165480			20262	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 3"""	C13orf3		19387489, 19289083, 19646878, 19360002	Standard	NM_145061		Approved	MGC4832, RAMA1	uc001unt.3	Q8IX90	OTTHUMG00000016539	ENST00000314759.5:c.839A>T	chr13.hg19:g.21734117T>A	ENSP00000319417:p.Tyr280Phe	101.0	0.0		43.0	20.0	NM_145061	A2A330|A2A331|B2RBY2|Q5VZV5|Q86WR2|Q8NBG1|Q96D22	Missense_Mutation	SNP	ENST00000314759.5	hg19	CCDS31946.1	.	.	.	.	.	.	.	.	.	.	T	3.711	-0.059582	0.07317	.	.	ENSG00000165480	ENST00000314759;ENST00000400018	T;T	0.22743	1.94;1.94	5.52	-1.24	0.09435	.	0.860123	0.10544	N	0.662370	T	0.12263	0.0298	L	0.44542	1.39	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.14023	0.01;0.01	T	0.39210	-0.9625	10	0.12766	T	0.61	-1.5826	1.1999	0.01883	0.1452:0.2935:0.1506:0.4106	.	280;280	Q8IX90-3;Q8IX90	.;SKA3_HUMAN	F	280	ENSP00000319417:Y280F;ENSP00000382896:Y280F	ENSP00000319417:Y280F	Y	-	2	0	SKA3	20632117	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.998000	0.03701	-0.107000	0.12088	-0.301000	0.09380	TAT	.	.		0.318	SKA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000272912.1	NM_145061	
ATP12A	479	hgsc.bcm.edu	37	13	25283840	25283840	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:25283840A>T	ENST00000381946.3	+	19	2804	c.2637A>T	c.(2635-2637)ggA>ggT	p.G879G	ATP12A_ENST00000218548.6_Silent_p.G885G			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	879					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		AAGCCCTGGGAGCTTTCCTTG	0.517																																					p.G885G	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.A2655T						.						160.0	162.0	161.0					13																	25283840		2203	4300	6503	SO:0001819	synonymous_variant	479	exon19			CCTGGGAGCTTTC	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2637A>T	chr13.hg19:g.25283840A>T		104.0	0.0		52.0	19.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	ENST00000381946.3	hg19	CCDS31948.1																																																																																			.	.		0.517	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
GPR12	2835	hgsc.bcm.edu	37	13	27333221	27333221	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:27333221T>A	ENST00000381436.2	-	1	1206	c.744A>T	c.(742-744)aaA>aaT	p.K248N	GPR12_ENST00000405846.3_Missense_Mutation_p.K248N			P47775	GPR12_HUMAN	G protein-coupled receptor 12	248					cellular calcium ion homeostasis (GO:0006874)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|phosphatidylcholine binding (GO:0031210)			endometrium(7)|kidney(2)|large_intestine(6)|lung(14)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(5;5.77e-05)	Breast(139;0.198)		Epithelial(112;9.37e-07)|OV - Ovarian serous cystadenocarcinoma(117;1.16e-06)|all cancers(112;8.31e-06)|GBM - Glioblastoma multiforme(144;0.00121)|Lung(94;0.111)|LUSC - Lung squamous cell carcinoma(192;0.184)		TGGAGACCCCTTTCCGGGTGG	0.547																																					p.K248N		Atlas-SNP	.											.	GPR12	67	.	0			c.A744T						.						66.0	65.0	65.0					13																	27333221		2203	4300	6503	SO:0001583	missense	2835	exon2			GACCCCTTTCCGG	U18548	CCDS9319.1	13q12	2014-06-12			ENSG00000132975	ENSG00000132975		"""GPCR / Class A : Orphans"""	4466	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 84"""	600752				8262253, 8530049	Standard	NM_005288		Approved	GPCR21, PPP1R84	uc010aal.3	P47775	OTTHUMG00000016620	ENST00000381436.2:c.744A>T	chr13.hg19:g.27333221T>A	ENSP00000370844:p.Lys248Asn	89.0	0.0		72.0	30.0	NM_005288	Q5T8P3	Missense_Mutation	SNP	ENST00000381436.2	hg19	CCDS9319.1	.	.	.	.	.	.	.	.	.	.	T	17.51	3.406464	0.62399	.	.	ENSG00000132975	ENST00000405846;ENST00000381436	T;T	0.42900	0.96;0.96	5.42	-2.85	0.05734	GPCR, rhodopsin-like superfamily (1);	0.045487	0.85682	D	0.000000	T	0.63954	0.2555	M	0.89904	3.07	0.48830	D	0.99971	D	0.89917	1.0	D	0.79108	0.992	T	0.68010	-0.5522	10	0.66056	D	0.02	.	11.2008	0.48741	0.0:0.3554:0.0:0.6446	.	248	P47775	GPR12_HUMAN	N	248	ENSP00000384932:K248N;ENSP00000370844:K248N	ENSP00000370844:K248N	K	-	3	2	GPR12	26231221	1.000000	0.71417	0.957000	0.39632	0.814000	0.46013	0.830000	0.27462	-0.465000	0.06953	-0.441000	0.05720	AAA	.	.		0.547	GPR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044257.2		
CDX2	1045	hgsc.bcm.edu	37	13	28542904	28542904	+	Silent	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:28542904G>A	ENST00000381020.7	-	1	2372	c.240C>T	c.(238-240)taC>taT	p.Y80Y	CDX2_ENST00000548877.1_5'Flank	NM_001265.4	NP_001256.3	Q99626	CDX2_HUMAN	caudal type homeobox 2	80					anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|endosome to lysosome transport (GO:0008333)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|labyrinthine layer development (GO:0060711)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)|trophectodermal cell differentiation (GO:0001829)	condensed nuclear chromosome (GO:0000794)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|large_intestine(1)|lung(6)	9	all_cancers(110;0.191)|all_hematologic(3;0.0447)|Acute lymphoblastic leukemia(6;0.155)	Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	GBM - Glioblastoma multiforme(144;0.0407)|all cancers(112;0.0491)|OV - Ovarian serous cystadenocarcinoma(117;0.199)		ctccgggcgcgTAGCCATTCC	0.746			T	ETV6	AML																																p.Y80Y		Atlas-SNP	.		Dom	yes		13	13q12.3	1045	caudal type homeo box transcription factor 2		L	.	CDX2	30	.	0			c.C240T						.						7.0	12.0	11.0					13																	28542904		1851	3617	5468	SO:0001819	synonymous_variant	1045	exon1			GGGCGCGTAGCCA	Y13709	CCDS9328.1	13q12.2	2012-03-09	2007-07-09		ENSG00000165556	ENSG00000165556		"""Homeoboxes / ANTP class : HOXL subclass"""	1806	protein-coding gene	gene with protein product		600297	"""caudal type homeo box transcription factor 2"""	CDX3		7698771	Standard	NM_001265		Approved		uc001urv.4	Q99626	OTTHUMG00000016640	ENST00000381020.7:c.240C>T	chr13.hg19:g.28542904G>A		54.0	0.0		43.0	22.0	NM_001265	O00503|Q5VTU7|Q969L8|Q9UD92	Silent	SNP	ENST00000381020.7	hg19	CCDS9328.1																																																																																			.	.		0.746	CDX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044312.5		
PDS5B	23047	hgsc.bcm.edu	37	13	33320210	33320210	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:33320210A>T	ENST00000315596.10	+	24	2894	c.2708A>T	c.(2707-2709)cAa>cTa	p.Q903L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	903					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ACATTAGAACAATATCAGCTA	0.403																																					p.Q903L		Atlas-SNP	.											.	PDS5B	141	.	0			c.A2708T						.						133.0	127.0	129.0					13																	33320210		1948	4154	6102	SO:0001583	missense	23047	exon24			TAGAACAATATCA	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.2708A>T	chr13.hg19:g.33320210A>T	ENSP00000313851:p.Gln903Leu	76.0	0.0		47.0	15.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	28.4	4.918925	0.92249	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.92	5.92	0.95590	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.77558	0.4148	M	0.74881	2.28	0.80722	D	1	D	0.65815	0.995	D	0.71414	0.973	T	0.74765	-0.3554	9	0.23891	T	0.37	-12.8905	16.3604	0.83263	1.0:0.0:0.0:0.0	.	903	Q9NTI5	PDS5B_HUMAN	L	903	.	ENSP00000313851:Q903L	Q	+	2	0	PDS5B	32218210	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	9.233000	0.95337	2.260000	0.74910	0.528000	0.53228	CAA	.	.		0.403	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
FAM216B	144809	hgsc.bcm.edu	37	13	43360937	43360937	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:43360937T>A	ENST00000537894.1	+	3	261	c.138T>A	c.(136-138)atT>atA	p.I46I	FAM216B_ENST00000313851.1_Silent_p.I46I	NM_182508.2	NP_872314.1	Q8N7L0	F216B_HUMAN	family with sequence similarity 216, member B	46																	TTTACAGCATTATGAGGATTT	0.493																																					p.I46I		Atlas-SNP	.											.	.	.	.	0			c.T138A						.						139.0	136.0	137.0					13																	43360937		2203	4300	6503	SO:0001819	synonymous_variant	144809	exon3			CAGCATTATGAGG	AK098238	CCDS9386.1	13q14.11	2012-02-07	2012-02-07	2012-02-07	ENSG00000179813	ENSG00000179813			26883	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 30"""	C13orf30			Standard	NM_182508		Approved	FLJ40919	uc010tfk.2	Q8N7L0	OTTHUMG00000016809	ENST00000537894.1:c.138T>A	chr13.hg19:g.43360937T>A		103.0	0.0		49.0	15.0	NM_182508	B1ALI3	Silent	SNP	ENST00000537894.1	hg19	CCDS9386.1																																																																																			.	.		0.493	FAM216B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044705.2	NM_182508	
TSC22D1	8848	hgsc.bcm.edu	37	13	45148297	45148297	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:45148297T>A	ENST00000458659.2	-	1	2404	c.1914A>T	c.(1912-1914)acA>acT	p.T638T	TSC22D1_ENST00000501704.2_Intron|TSC22D1_ENST00000460842.1_5'Flank	NM_183422.3	NP_904358.2	Q15714	T22D1_HUMAN	TSC22 domain family, member 1	638	Gln-rich.				negative regulation of apoptotic process (GO:0043066)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(4;8.74e-08)|Acute lymphoblastic leukemia(4;1.78e-07)|Lung NSC(96;2.21e-05)|Breast(139;0.000625)|Prostate(109;0.000947)|Hepatocellular(98;0.0202)|Lung SC(185;0.0262)		GBM - Glioblastoma multiforme(144;0.000522)|BRCA - Breast invasive adenocarcinoma(63;0.118)		GGGCCATCTGTGTAGAAACCA	0.507																																					p.T638T		Atlas-SNP	.											.	TSC22D1	88	.	0			c.A1914T						.						118.0	114.0	115.0					13																	45148297		2203	4300	6503	SO:0001819	synonymous_variant	8848	exon1			CATCTGTGTAGAA	AJ222700	CCDS9392.1, CCDS31966.1, CCDS58291.1, CCDS73565.1	13q14	2008-02-05	2005-03-01	2005-03-03	ENSG00000102804	ENSG00000102804			16826	protein-coding gene	gene with protein product		607715	"""transforming growth factor beta 1 induced transcript 4"""	TGFB1I4		8651929, 9022669	Standard	NM_183422		Approved	TSC22, MGC17597	uc001uzn.4	Q15714	OTTHUMG00000016838	ENST00000458659.2:c.1914A>T	chr13.hg19:g.45148297T>A		52.0	0.0		44.0	10.0	NM_183422	B3KRL7|B9EGI0|O00666|Q6AHX5|Q6IBU1|Q8NCN1|Q96JS5	Silent	SNP	ENST00000458659.2	hg19	CCDS31966.1																																																																																			.	.		0.507	TSC22D1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000044743.2	NM_006022	
DACH1	1602	hgsc.bcm.edu	37	13	72440907	72440907	+	Start_Codon_SNP	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:72440907T>A	ENST00000359684.2	-	1	0	c.1A>T	c.(1-3)Atg>Ttg	p.M1L	DACH1_ENST00000305425.4_Start_Codon_SNP_p.M1L|DACH1_ENST00000354591.4_Start_Codon_SNP_p.M1L|DACH1_ENST00000313174.7_Start_Codon_SNP_p.M1L			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	1					cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GGCACTGCCATGGTCACATAT	0.617																																					p.M1L		Atlas-SNP	.											.	DACH1	123	.	0			c.A1T						.						15.0	19.0	18.0					13																	72440907		1972	4166	6138	SO:0001582	initiator_codon_variant	1602	exon1			CTGCCATGGTCAC	AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.1A>T	chr13.hg19:g.72440907T>A	ENSP00000352712:p.Met1Leu	173.0	0.0		129.0	23.0	NM_080759	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	ENST00000359684.2	hg19		.	.	.	.	.	.	.	.	.	.	T	14.54	2.566196	0.45694	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.35048	1.38;1.33;1.36;1.44	3.13	3.13	0.36017	.	0.000000	0.64402	U	0.000006	T	0.40423	0.1116	.	.	.	0.80722	D	1	P;P;B	0.42357	0.777;0.777;0.147	P;B;B	0.45712	0.491;0.327;0.08	T	0.43245	-0.9403	9	0.87932	D	0	-5.3914	11.4835	0.50339	0.0:0.0:0.0:1.0	.	1;1;1	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	L	1	ENSP00000304994:M1L;ENSP00000318506:M1L;ENSP00000346604:M1L;ENSP00000352712:M1L	ENSP00000304994:M1L	M	-	1	0	DACH1	71338908	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.211000	0.65219	1.284000	0.44531	0.379000	0.24179	ATG	.	.		0.617	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000045240.1	NM_004392	Missense_Mutation
MYCBP2	23077	hgsc.bcm.edu	37	13	77755971	77755971	+	Silent	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:77755971C>A	ENST00000544440.2	-	33	4709	c.4692G>T	c.(4690-4692)ctG>ctT	p.L1564L	MYCBP2_ENST00000407578.2_Silent_p.L1602L|MYCBP2_ENST00000360084.5_5'UTR|MYCBP2_ENST00000357337.6_Silent_p.L1564L					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AGATGGAAGTCAGCTTAACAG	0.398																																					p.L1602L		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.G4806T						.						132.0	115.0	121.0					13																	77755971		2203	4300	6503	SO:0001819	synonymous_variant	23077	exon33			GGAAGTCAGCTTA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.4692G>T	chr13.hg19:g.77755971C>A		88.0	0.0		78.0	55.0	NM_015057		Silent	SNP	ENST00000544440.2	hg19																																																																																				.	.		0.398	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
MYO16	23026	hgsc.bcm.edu	37	13	109535531	109535531	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr13:109535531T>A	ENST00000357550.2	+	12	1525	c.1484T>A	c.(1483-1485)cTc>cAc	p.L495H	MYO16_ENST00000251041.5_Missense_Mutation_p.L495H|MYO16_ENST00000356711.2_Missense_Mutation_p.L495H|MYO16_ENST00000457511.2_5'Flank	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			TGTTTCATCCTCAGGTGAGTC	0.522																																					p.L517H		Atlas-SNP	.											.	MYO16	285	.	0			c.T1550A						.						125.0	117.0	120.0					13																	109535531		2203	4300	6503	SO:0001583	missense	23026	exon13			TCATCCTCAGGTG		CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.1484T>A	chr13.hg19:g.109535531T>A	ENSP00000350160:p.Leu495His	55.0	0.0		39.0	13.0	NM_001198950		Missense_Mutation	SNP	ENST00000357550.2	hg19	CCDS32008.1	.	.	.	.	.	.	.	.	.	.	T	19.61	3.859725	0.71834	.	.	ENSG00000041515	ENST00000356711;ENST00000397258;ENST00000357550;ENST00000251041;ENST00000375857	D;D;D	0.96365	-3.99;-3.99;-3.99	5.43	5.43	0.79202	Myosin head, motor domain (3);	0.000000	0.34025	U	0.004324	D	0.97766	0.9267	M	0.80982	2.52	0.80722	D	1	P;D	0.89917	0.892;1.0	P;D	0.77004	0.577;0.989	D	0.97922	1.0315	9	.	.	.	.	12.2147	0.54400	0.0:0.0:0.0:1.0	.	495;495	Q9Y6X6-2;Q9Y6X6	.;MYO16_HUMAN	H	495;495;495;495;283	ENSP00000349145:L495H;ENSP00000350160:L495H;ENSP00000251041:L495H	.	L	+	2	0	MYO16	108333532	1.000000	0.71417	0.997000	0.53966	0.744000	0.42396	6.358000	0.73055	2.195000	0.70347	0.529000	0.55759	CTC	.	.		0.522	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045746.1	NM_015011	
OR5AU1	390445	hgsc.bcm.edu	37	14	21624103	21624103	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:21624103T>A	ENST00000304418.3	-	1	119	c.82A>T	c.(82-84)Agt>Tgt	p.S28C		NM_001004731.1	NP_001004731.1	Q8NGC0	O5AU1_HUMAN	olfactory receptor, family 5, subfamily AU, member 1	28						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(12)|pancreas(1)	21	all_cancers(95;0.00238)		Epithelial(56;6.88e-07)|all cancers(55;6.02e-06)	GBM - Glioblastoma multiforme(265;0.0192)		GGGCTCTGACTGGGTTTAATT	0.478																																					p.S28C		Atlas-SNP	.											.	OR5AU1	46	.	0			c.A82T						.						143.0	138.0	140.0					14																	21624103		2203	4300	6503	SO:0001583	missense	390445	exon1			TCTGACTGGGTTT	AL157687	CCDS32042.1	14q11.2	2013-09-23			ENSG00000169327	ENSG00000169327		"""GPCR / Class A : Olfactory receptors"""	15362	protein-coding gene	gene with protein product							Standard	NM_001004731		Approved		uc010tlp.2	Q8NGC0	OTTHUMG00000170753	ENST00000304418.3:c.82A>T	chr14.hg19:g.21624103T>A	ENSP00000302057:p.Ser28Cys	113.0	0.0		112.0	27.0	NM_001004731	B2RP78|Q6IEU2|Q96R10	Missense_Mutation	SNP	ENST00000304418.3	hg19	CCDS32042.1	.	.	.	.	.	.	.	.	.	.	T	9.787	1.176908	0.21787	.	.	ENSG00000169327	ENST00000304418	T	0.00958	5.5	3.81	1.27	0.21489	.	.	.	.	.	T	0.00552	0.0018	N	0.08118	0	0.09310	N	1	P	0.47034	0.889	B	0.37550	0.253	T	0.53365	-0.8449	9	0.37606	T	0.19	.	4.6629	0.12652	0.0:0.1062:0.3958:0.498	.	28	Q8NGC0	O5AU1_HUMAN	C	28	ENSP00000302057:S28C	ENSP00000302057:S28C	S	-	1	0	OR5AU1	20693943	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.738000	0.04871	0.137000	0.18759	-0.619000	0.04042	AGT	.	.		0.478	OR5AU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410213.1		
MMP14	4323	hgsc.bcm.edu	37	14	23315040	23315040	+	Missense_Mutation	SNP	C	C	T	rs202185020		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:23315040C>T	ENST00000311852.6	+	10	1802	c.1541C>T	c.(1540-1542)cCg>cTg	p.P514L	MMP14_ENST00000548162.1_Intron	NM_004995.2	NP_004986.1	P50281	MMP14_HUMAN	matrix metallopeptidase 14 (membrane-inserted)	514					angiogenesis (GO:0001525)|astrocyte cell migration (GO:0043615)|branching morphogenesis of an epithelial tube (GO:0048754)|chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|endodermal cell differentiation (GO:0035987)|endothelial cell proliferation (GO:0001935)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|male gonad development (GO:0008584)|negative regulation of focal adhesion assembly (GO:0051895)|ovarian follicle development (GO:0001541)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|proteolysis (GO:0006508)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to mechanical stimulus (GO:0009612)|response to oxidative stress (GO:0006979)|tissue remodeling (GO:0048771)|zymogen activation (GO:0031638)	extracellular matrix (GO:0031012)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|peptidase activator activity (GO:0016504)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(95;9.47e-05)			GBM - Glioblastoma multiforme(265;0.00551)	Marimastat(DB00786)	GGAGGCCGGCCGGATGAGGGG	0.632																																					p.P514L		Atlas-SNP	.											.	MMP14	40	.	0			c.C1541T						.						59.0	69.0	65.0					14																	23315040		2203	4300	6503	SO:0001583	missense	4323	exon10			GCCGGCCGGATGA		CCDS9577.1	14q11-q12	2011-06-29	2005-08-08		ENSG00000157227	ENSG00000157227			7160	protein-coding gene	gene with protein product	"""membrane type 1 metalloprotease"""	600754	"""matrix metalloproteinase 14 (membrane-inserted)"""			8015608	Standard	NM_004995		Approved	MT1-MMP	uc001whc.3	P50281	OTTHUMG00000028704	ENST00000311852.6:c.1541C>T	chr14.hg19:g.23315040C>T	ENSP00000308208:p.Pro514Leu	144.0	0.0		97.0	51.0	NM_004995	A8K5L0|Q6GSF3|Q92678	Missense_Mutation	SNP	ENST00000311852.6	hg19	CCDS9577.1	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427408	0.62733	.	.	ENSG00000157227	ENST00000311852	T	0.30714	1.52	4.52	4.52	0.55395	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.724607	0.13465	N	0.385817	T	0.36276	0.0961	L	0.59436	1.845	0.51482	D	0.999928	P	0.49559	0.925	P	0.44623	0.455	T	0.16837	-1.0389	10	0.35671	T	0.21	.	15.0866	0.72158	0.0:1.0:0.0:0.0	.	514	P50281	MMP14_HUMAN	L	514	ENSP00000308208:P514L	ENSP00000308208:P514L	P	+	2	0	MMP14	22384880	.	.	0.892000	0.35008	0.878000	0.50629	.	.	2.226000	0.72624	0.305000	0.20034	CCG	.	.		0.632	MMP14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071660.3	NM_004995	
SLC22A17	51310	hgsc.bcm.edu	37	14	23821009	23821009	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:23821009A>T	ENST00000206544.8	-	2	659	c.323T>A	c.(322-324)aTc>aAc	p.I108N	SLC22A17_ENST00000474057.1_Intron|SLC22A17_ENST00000397267.1_Missense_Mutation_p.I108N|SLC22A17_ENST00000397260.3_Intron|SLC22A17_ENST00000354772.3_Missense_Mutation_p.I108N	NM_020372.2	NP_065105.2	Q8WUG5	S22AH_HUMAN	solute carrier family 22, member 17	108					ion transport (GO:0006811)|iron ion homeostasis (GO:0055072)|siderophore transport (GO:0015891)	integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|vacuole (GO:0005773)	transmembrane signaling receptor activity (GO:0004888)|transmembrane transporter activity (GO:0022857)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	15	all_cancers(95;7.12e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AAAGCCCAAGATGAAGAGGAT	0.642																																					p.I108N		Atlas-SNP	.											.	SLC22A17	32	.	0			c.T323A						.						76.0	63.0	68.0					14																	23821009		2203	4300	6503	SO:0001583	missense	51310	exon3			CCCAAGATGAAGA	AJ243653	CCDS9593.1, CCDS9594.2	14q11.2	2013-05-22	2008-01-11		ENSG00000092096	ENSG00000092096		"""Solute carriers"""	23095	protein-coding gene	gene with protein product	"""neutrophil gelatinase-associated lipocalin receptor"""	611461				16377569	Standard	NM_016609		Approved	BOCT, BOIT, NGALR	uc001wjl.3	Q8WUG5	OTTHUMG00000028740	ENST00000206544.8:c.323T>A	chr14.hg19:g.23821009A>T	ENSP00000206544:p.Ile108Asn	298.0	0.0		259.0	81.0	NM_016609	A4UA13|A8MUT0|Q2TAB0|Q5BKY8|Q86U04|Q9H1D3|Q9NQD5	Missense_Mutation	SNP	ENST00000206544.8	hg19	CCDS9593.1	.	.	.	.	.	.	.	.	.	.	A	19.78	3.891716	0.72524	.	.	ENSG00000092096	ENST00000354772;ENST00000206544;ENST00000397267	T;T;T	0.55588	0.51;0.51;0.51	3.67	3.67	0.42095	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.084250	0.45126	U	0.000385	T	0.42743	0.1216	N	0.04203	-0.255	0.47037	D	0.999295	D;D;P	0.64830	0.994;0.969;0.92	P;P;B	0.59889	0.865;0.558;0.304	T	0.34950	-0.9808	10	0.24483	T	0.36	-11.8441	11.428	0.50022	1.0:0.0:0.0:0.0	.	108;108;108	Q8WUG5-3;Q8WUG5-2;Q8WUG5	.;.;S22AH_HUMAN	N	108	ENSP00000346824:I108N;ENSP00000206544:I108N;ENSP00000380437:I108N	ENSP00000206544:I108N	I	-	2	0	SLC22A17	22890849	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.417000	0.80156	1.522000	0.49001	0.379000	0.24179	ATC	.	.		0.642	SLC22A17-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157223.3	NM_020372	
RNF31	55072	hgsc.bcm.edu	37	14	24620416	24620416	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:24620416A>T	ENST00000324103.6	+	9	1885	c.1565A>T	c.(1564-1566)cAg>cTg	p.Q522L	RNF31_ENST00000559275.1_Missense_Mutation_p.Q371L|RNF31_ENST00000382687.3_Missense_Mutation_p.Q371L|RP11-468E2.4_ENST00000558468.1_5'Flank	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	522					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		GTGCCTCTGCAGTGGTTGCGC	0.637																																					p.Q522L		Atlas-SNP	.											.	RNF31	95	.	0			c.A1565T						.						61.0	66.0	64.0					14																	24620416		2105	4228	6333	SO:0001583	missense	55072	exon9			CTCTGCAGTGGTT	AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.1565A>T	chr14.hg19:g.24620416A>T	ENSP00000315112:p.Gln522Leu	28.0	0.0		28.0	13.0	NM_017999	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	ENST00000324103.6	hg19	CCDS41931.1	.	.	.	.	.	.	.	.	.	.	A	10.60	1.394396	0.25205	.	.	ENSG00000092098	ENST00000324103;ENST00000382687	T;T	0.47177	0.86;0.85	5.16	4.02	0.46733	.	0.479529	0.22057	N	0.065222	T	0.34366	0.0895	L	0.44542	1.39	0.30922	N	0.727933	B;B	0.32467	0.255;0.372	B;B	0.30316	0.037;0.114	T	0.41963	-0.9479	10	0.52906	T	0.07	-6.0182	4.2939	0.10892	0.6536:0.1724:0.1739:0.0	.	522;371	Q96EP0;Q96EP0-3	RNF31_HUMAN;.	L	522;371	ENSP00000315112:Q522L;ENSP00000372134:Q371L	ENSP00000315112:Q522L	Q	+	2	0	RNF31	23690256	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.884000	0.48562	0.986000	0.38683	0.533000	0.62120	CAG	.	.		0.637	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071921.3	NM_017999	
NYNRIN	57523	hgsc.bcm.edu	37	14	24884806	24884806	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:24884806T>A	ENST00000382554.3	+	9	4169	c.3851T>A	c.(3850-3852)cTg>cAg	p.L1284Q		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1284					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						GAGAACCGCCTGCTCACCCCC	0.612																																					p.L1284Q		Atlas-SNP	.											.	NYNRIN	120	.	0			c.T3851A						.						65.0	71.0	69.0					14																	24884806		2025	4160	6185	SO:0001583	missense	57523	exon9			ACCGCCTGCTCAC	AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3851T>A	chr14.hg19:g.24884806T>A	ENSP00000371994:p.Leu1284Gln	71.0	0.0		50.0	11.0	NM_025081	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	ENST00000382554.3	hg19	CCDS45090.1	.	.	.	.	.	.	.	.	.	.	T	13.88	2.369276	0.42003	.	.	ENSG00000205978	ENST00000382554	T	0.12147	2.71	4.93	4.93	0.64822	.	.	.	.	.	T	0.19248	0.0462	N	0.24115	0.695	0.30264	N	0.792919	D	0.58620	0.983	P	0.56474	0.799	T	0.03043	-1.1079	9	0.87932	D	0	.	12.5824	0.56397	0.0:0.0:0.0:1.0	.	1284	Q9P2P1	NYNRI_HUMAN	Q	1284	ENSP00000371994:L1284Q	ENSP00000371994:L1284Q	L	+	2	0	NYNRIN	23954646	0.607000	0.26958	0.915000	0.36163	0.289000	0.27227	2.726000	0.47302	2.063000	0.61619	0.533000	0.62120	CTG	.	.		0.612	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412939.1		
SIX4	51804	hgsc.bcm.edu	37	14	61186827	61186827	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:61186827A>T	ENST00000216513.4	-	2	1259	c.1200T>A	c.(1198-1200)atT>atA	p.I400I		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	400					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		CATTGCTCACAATGTTTGATG	0.433																																					p.I400I		Atlas-SNP	.											.	SIX4	69	.	0			c.T1200A						.						128.0	102.0	111.0					14																	61186827		2203	4300	6503	SO:0001819	synonymous_variant	51804	exon2			GCTCACAATGTTT	AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.1200T>A	chr14.hg19:g.61186827A>T		128.0	0.0		110.0	36.0	NM_017420	Q4QQH5|Q4V764	Silent	SNP	ENST00000216513.4	hg19	CCDS9749.2																																																																																			.	.		0.433	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072397.2		
HIF1A	3091	hgsc.bcm.edu	37	14	62200973	62200973	+	Missense_Mutation	SNP	A	A	T	rs367767967		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:62200973A>T	ENST00000337138.4	+	8	1263	c.998A>T	c.(997-999)cAg>cTg	p.Q333L	HIF1A_ENST00000394997.1_Missense_Mutation_p.Q334L|HIF1A_ENST00000323441.6_Missense_Mutation_p.Q333L|HIF1A_ENST00000539097.1_Missense_Mutation_p.Q357L|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000557538.1_Missense_Mutation_p.Q274L|HIF1A-AS2_ENST00000554254.1_lincRNA	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	333	Interaction with TSGA10. {ECO:0000250}.|PAC.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	TCTCAACCACAGTGCATTGTA	0.373																																					p.Q357L		Atlas-SNP	.											.	HIF1A	120	.	0			c.A1070T						.						117.0	103.0	108.0					14																	62200973		2203	4300	6503	SO:0001583	missense	3091	exon8			AACCACAGTGCAT	U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.998A>T	chr14.hg19:g.62200973A>T	ENSP00000338018:p.Gln333Leu	129.0	0.0		107.0	32.0	NM_001243084	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	ENST00000337138.4	hg19	CCDS9753.1	.	.	.	.	.	.	.	.	.	.	A	27.9	4.873165	0.91664	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.19394	2.15;2.15;2.15;2.15;2.15	5.44	5.44	0.79542	PAS fold-3 (1);	0.000000	0.85682	D	0.000000	T	0.46092	0.1375	M	0.68952	2.095	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.45323	-0.9269	10	0.87932	D	0	.	15.7835	0.78281	1.0:0.0:0.0:0.0	.	334;333;333	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	L	84;274;333;334;333;274;357	ENSP00000338018:Q333L;ENSP00000378446:Q334L;ENSP00000323326:Q333L;ENSP00000451696:Q274L;ENSP00000437955:Q357L	ENSP00000323326:Q333L	Q	+	2	0	HIF1A	61270726	1.000000	0.71417	0.928000	0.36995	0.989000	0.77384	9.287000	0.95975	2.185000	0.69588	0.455000	0.32223	CAG	.	.		0.373	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000276977.2	NM_001530	
SYNE2	23224	hgsc.bcm.edu	37	14	64408641	64408641	+	Silent	SNP	C	C	T	rs575263745	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:64408641C>T	ENST00000344113.4	+	5	488	c.276C>T	c.(274-276)atC>atT	p.I92I	SYNE2_ENST00000358025.3_Silent_p.I92I|SYNE2_ENST00000356081.3_Silent_p.I92I|SYNE2_ENST00000341472.5_Silent_p.I92I|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Silent_p.I92I	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	92	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		AGTGTAGAATCAATATAGAAC	0.318													C|||	2	0.000399361	0.0	0.0	5008	,	,		18319	0.0		0.0	False		,,,				2504	0.002				p.I92I		Atlas-SNP	.											.	SYNE2	577	.	0			c.C276T						.						86.0	82.0	83.0					14																	64408641		1804	4072	5876	SO:0001819	synonymous_variant	23224	exon5			TAGAATCAATATA	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.276C>T	chr14.hg19:g.64408641C>T		77.0	0.0		45.0	16.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.318	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	
SYNE2	23224	hgsc.bcm.edu	37	14	64408680	64408680	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:64408680A>T	ENST00000344113.4	+	5	527	c.315A>T	c.(313-315)tcA>tcT	p.S105S	SYNE2_ENST00000358025.3_Splice_Site_p.S105S|SYNE2_ENST00000356081.3_Splice_Site_p.S105S|SYNE2_ENST00000341472.5_Splice_Site_p.S105S|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000554584.1_Splice_Site_p.S105S	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	105	Actin-binding.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAAACCGATCAGTAAGTATAA	0.333																																					p.S105S		Atlas-SNP	.											.	SYNE2	577	.	0			c.A315T						.						70.0	66.0	67.0					14																	64408680		1791	4061	5852	SO:0001630	splice_region_variant	23224	exon5			CCGATCAGTAAGT	AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.315+1A>T	chr14.hg19:g.64408680A>T		65.0	0.0		46.0	19.0	NM_182914	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Silent	SNP	ENST00000344113.4	hg19	CCDS41963.1																																																																																			.	.		0.333	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276994.2	NM_182914	Silent
ZFYVE26	23503	hgsc.bcm.edu	37	14	68233158	68233158	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:68233158T>A	ENST00000347230.4	-	32	5935	c.5797A>T	c.(5797-5799)Agc>Tgc	p.S1933C	ZFYVE26_ENST00000555452.1_Missense_Mutation_p.S1933C	NM_015346.3	NP_056161.2	Q68DK2	ZFY26_HUMAN	zinc finger, FYVE domain containing 26	1933					cell death (GO:0008219)|cytokinesis (GO:0000910)|double-strand break repair via homologous recombination (GO:0000724)	centrosome (GO:0005813)|lysosomal membrane (GO:0005765)|midbody (GO:0030496)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(8)|lung(39)|ovary(12)|pancreas(1)|prostate(7)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	94				all cancers(60;0.000763)|OV - Ovarian serous cystadenocarcinoma(108;0.0011)|BRCA - Breast invasive adenocarcinoma(234;0.0115)		AAGGAGGCGCTGGGGGCCTGG	0.602																																					p.S1933C		Atlas-SNP	.											.	ZFYVE26	223	.	0			c.A5797T						.						42.0	46.0	45.0					14																	68233158		2203	4300	6503	SO:0001583	missense	23503	exon32			AGGCGCTGGGGGC	AB002319	CCDS9788.1	14q23.3	2012-11-23				ENSG00000072121		"""Zinc fingers, FYVE domain containing"""	20761	protein-coding gene	gene with protein product	"""spastizin"", ""FYVE-CENT"""	612012	"""spastic paraplegia 15 (complicated, autosomal recessive)"""	SPG15		9205841, 18394578	Standard	NM_015346		Approved	KIAA0321	uc001xka.2	Q68DK2		ENST00000347230.4:c.5797A>T	chr14.hg19:g.68233158T>A	ENSP00000251119:p.Ser1933Cys	191.0	0.0		121.0	39.0	NM_015346	B1B5Y3|B4E2U3|O15035|Q68DT9|Q6AW90|Q6ZR50|Q7Z3A4|Q7Z3I1|Q8N4W7	Missense_Mutation	SNP	ENST00000347230.4	hg19	CCDS9788.1	.	.	.	.	.	.	.	.	.	.	T	27.2	4.805897	0.90623	.	.	ENSG00000072121	ENST00000347230;ENST00000411699;ENST00000555452	T;T	0.45276	1.08;0.9	5.71	5.71	0.89125	.	0.039141	0.85682	D	0.000000	T	0.65015	0.2651	M	0.76838	2.35	0.80722	D	1	D;D	0.76494	0.999;0.995	D;P	0.66497	0.944;0.816	T	0.69859	-0.5031	10	0.87932	D	0	-5.125	15.9832	0.80127	0.0:0.0:0.0:1.0	.	1933;1933	G3V2D8;Q68DK2	.;ZFY26_HUMAN	C	1933;1912;1933	ENSP00000251119:S1933C;ENSP00000450603:S1933C	ENSP00000251119:S1933C	S	-	1	0	ZFYVE26	67302911	1.000000	0.71417	0.980000	0.43619	0.945000	0.59286	7.992000	0.88273	2.184000	0.69523	0.454000	0.30748	AGC	.	.		0.602	ZFYVE26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412736.2	NM_015346	
PLEKHD1	400224	hgsc.bcm.edu	37	14	69967330	69967330	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:69967330A>T	ENST00000322564.7	+	3	492	c.280A>T	c.(280-282)Aag>Tag	p.K94*		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	94	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.									breast(1)|endometrium(1)|kidney(2)	4						GGTGGAGCCCAAGGAAGAGCC	0.622																																					p.K94X		Atlas-SNP	.											.	PLEKHD1	24	.	0			c.A280T						.						48.0	58.0	55.0					14																	69967330		692	1591	2283	SO:0001587	stop_gained	400224	exon3			GAGCCCAAGGAAG	AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.280A>T	chr14.hg19:g.69967330A>T	ENSP00000317175:p.Lys94*	69.0	0.0		27.0	10.0	NM_001161498	B9EJC2	Nonsense_Mutation	SNP	ENST00000322564.7	hg19	CCDS53903.1	.	.	.	.	.	.	.	.	.	.	A	37	6.489528	0.97607	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8502	0.63492	1.0:0.0:0.0:0.0	.	.	.	.	X	94	.	.	K	+	1	0	PLEKHD1	69037083	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	6.357000	0.73051	1.925000	0.55765	0.459000	0.35465	AAG	.	.		0.622	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412451.2	NM_001161498	
POMT2	29954	hgsc.bcm.edu	37	14	77767555	77767555	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:77767555T>A	ENST00000261534.4	-	6	896	c.694A>T	c.(694-696)Act>Tct	p.T232S	POMT2_ENST00000556880.1_5'Flank	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	232						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		CTAACGCCAGTCAGGCTGAGC	0.522											OREG0022837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.T232S		Atlas-SNP	.											.	POMT2	47	.	0			c.A694T						.						90.0	83.0	86.0					14																	77767555		2203	4300	6503	SO:0001583	missense	29954	exon6			CGCCAGTCAGGCT	AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.694A>T	chr14.hg19:g.77767555T>A	ENSP00000261534:p.Thr232Ser	154.0	0.0	1178	91.0	29.0	NM_013382	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	ENST00000261534.4	hg19	CCDS9857.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.494906	0.85069	.	.	ENSG00000009830	ENST00000261534	D	0.87491	-2.26	5.75	5.75	0.90469	Glycosyl transferase, family 39 (1);	0.000000	0.85682	D	0.000000	D	0.91442	0.7299	M	0.68317	2.08	0.80722	D	1	P	0.52061	0.95	P	0.58266	0.836	D	0.91659	0.5341	10	0.52906	T	0.07	-14.1461	16.0509	0.80763	0.0:0.0:0.0:1.0	.	232	Q9UKY4	POMT2_HUMAN	S	232	ENSP00000261534:T232S	ENSP00000261534:T232S	T	-	1	0	POMT2	76837308	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.989000	0.70587	2.187000	0.69744	0.533000	0.62120	ACT	.	.		0.522	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414155.1	NM_013382	
SMEK1	55671	hgsc.bcm.edu	37	14	91942204	91942204	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:91942204T>A	ENST00000554943.1	-	7	1332	c.1217A>T	c.(1216-1218)cAg>cTg	p.Q406L	SMEK1_ENST00000555462.1_Missense_Mutation_p.Q167L|SMEK1_ENST00000554684.1_Missense_Mutation_p.Q406L|SMEK1_ENST00000428424.2_Missense_Mutation_p.Q167L|SMEK1_ENST00000337238.4_Missense_Mutation_p.Q406L			Q6IN85	P4R3A_HUMAN	SMEK homolog 1, suppressor of mek1 (Dictyostelium)	406					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				NS(1)|endometrium(1)|kidney(1)|liver(1)|lung(1)|stomach(1)	6		all_cancers(154;0.0691)|all_epithelial(191;0.219)		COAD - Colon adenocarcinoma(157;0.221)		ATCATCATTCTGTTGTGCCTC	0.348																																					p.Q406L		Atlas-SNP	.											.	SMEK1	94	.	0			c.A1217T						.						117.0	104.0	109.0					14																	91942204		2203	4300	6503	SO:0001583	missense	55671	exon8			TCATTCTGTTGTG	AK000714	CCDS9895.1, CCDS61532.1	14q32.12	2008-09-15	2006-10-12	2006-10-12		ENSG00000100796			20219	protein-coding gene	gene with protein product		610351	"""KIAA2010"""	KIAA2010		16085932, 18487071	Standard	XM_005267842		Approved	FLJ20707, MSTP033, FLFL1, smk-1, smk1	uc001xzm.3	Q6IN85		ENST00000554943.1:c.1217A>T	chr14.hg19:g.91942204T>A	ENSP00000450883:p.Gln406Leu	123.0	0.0		95.0	30.0	NM_032560	Q69YK6|Q86U23|Q86YI7|Q8IVG1|Q9H3F1|Q9H7U8|Q9NV01|Q9NWP1	Missense_Mutation	SNP	ENST00000554943.1	hg19		.	.	.	.	.	.	.	.	.	.	T	18.51	3.639496	0.67244	.	.	ENSG00000100796	ENST00000554684;ENST00000337238;ENST00000428424;ENST00000554943;ENST00000555462;ENST00000554390;ENST00000555029;ENST00000417249	T;T;T;T;T;T;T	0.42131	1.01;1.01;0.98;0.98;0.98;1.01;0.98	5.31	5.31	0.75309	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.54902	0.1887	L	0.50333	1.59	0.80722	D	1	P;B;B;B	0.48294	0.908;0.114;0.315;0.442	P;B;B;B	0.61397	0.888;0.032;0.067;0.142	T	0.47873	-0.9083	10	0.23891	T	0.37	-1.8984	15.2588	0.73606	0.0:0.0:0.0:1.0	.	167;406;406;406	Q6IN85-4;G3V5Z3;Q6IN85;Q6IN85-2	.;.;P4R3A_HUMAN;.	L	406;406;167;406;167;406;167;196	ENSP00000450864:Q406L;ENSP00000337125:Q406L;ENSP00000392704:Q167L;ENSP00000450883:Q406L;ENSP00000450891:Q167L;ENSP00000452596:Q406L;ENSP00000452257:Q167L	ENSP00000337125:Q406L	Q	-	2	0	SMEK1	91011957	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.993000	0.88291	2.018000	0.59344	0.482000	0.46254	CAG	.	.		0.348	SMEK1-007	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000411665.1	NM_032560	
CATSPERB	79820	hgsc.bcm.edu	37	14	92091187	92091187	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:92091187T>A	ENST00000256343.3	-	18	2063	c.1907A>T	c.(1906-1908)tAt>tTt	p.Y636F		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	636					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				AGTGAGTTTATAGACATTTCC	0.323																																					p.Y636F		Atlas-SNP	.											.	CATSPERB	114	.	0			c.A1907T						.						68.0	71.0	70.0					14																	92091187		2202	4298	6500	SO:0001583	missense	79820	exon18			AGTTTATAGACAT	AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.1907A>T	chr14.hg19:g.92091187T>A	ENSP00000256343:p.Tyr636Phe	137.0	0.0		82.0	37.0	NM_024764	A0AV51	Missense_Mutation	SNP	ENST00000256343.3	hg19	CCDS32142.1	.	.	.	.	.	.	.	.	.	.	T	12.83	2.054841	0.36277	.	.	ENSG00000133962	ENST00000256343	T	0.45668	0.89	4.98	2.35	0.29111	.	0.292557	0.24681	N	0.036470	T	0.26593	0.0650	L	0.38531	1.155	0.09310	N	1	B	0.27910	0.193	B	0.24701	0.055	T	0.14476	-1.0471	10	0.15066	T	0.55	-8.7241	7.3613	0.26748	0.3501:0.0:0.0:0.6499	.	636	Q9H7T0	CTSRB_HUMAN	F	636	ENSP00000256343:Y636F	ENSP00000256343:Y636F	Y	-	2	0	CATSPERB	91160940	0.531000	0.26338	0.790000	0.31976	0.675000	0.39556	1.136000	0.31467	0.808000	0.34231	0.254000	0.18369	TAT	.	.		0.323	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411769.1	NM_024764	
RIN3	79890	hgsc.bcm.edu	37	14	93118727	93118727	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:93118727A>T	ENST00000216487.7	+	6	1492	c.1333A>T	c.(1333-1335)Agc>Tgc	p.S445C	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	445	Pro-rich.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				CGATCCTCACAGCATGCCAGA	0.647																																					p.S445C		Atlas-SNP	.											.	RIN3	81	.	0			c.A1333T						.						98.0	115.0	109.0					14																	93118727		2203	4300	6503	SO:0001583	missense	79890	exon6			CCTCACAGCATGC	BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.1333A>T	chr14.hg19:g.93118727A>T	ENSP00000216487:p.Ser445Cys	279.0	0.0		152.0	57.0	NM_024832	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Missense_Mutation	SNP	ENST00000216487.7	hg19	CCDS32144.1	.	.	.	.	.	.	.	.	.	.	A	11.74	1.729629	0.30684	.	.	ENSG00000100599	ENST00000216487;ENST00000428147	T	0.07688	3.17	4.22	1.61	0.23674	.	1.806560	0.02482	N	0.088605	T	0.20129	0.0484	L	0.60455	1.87	0.09310	N	0.999998	D;B;B;D	0.76494	0.999;0.005;0.005;0.999	D;B;B;P	0.64595	0.927;0.005;0.005;0.846	T	0.10177	-1.0641	10	0.54805	T	0.06	-3.4238	0.1083	0.00054	0.2781:0.2539:0.2099:0.2581	.	445;491;370;445	Q8TB24-4;Q86U22;Q6ZRC2;Q8TB24	.;.;.;RIN3_HUMAN	C	445;369	ENSP00000216487:S445C	ENSP00000216487:S445C	S	+	1	0	RIN3	92188480	0.000000	0.05858	0.010000	0.14722	0.056000	0.15407	0.358000	0.20216	0.502000	0.28037	0.260000	0.18958	AGC	.	.		0.647	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412269.1		
BCL11B	64919	hgsc.bcm.edu	37	14	99642349	99642349	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:99642349G>A	ENST00000357195.3	-	4	833	c.824C>T	c.(823-825)gCg>gTg	p.A275V	BCL11B_ENST00000345514.2_Missense_Mutation_p.A204V|BCL11B_ENST00000443726.2_Missense_Mutation_p.A81V	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	275					alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CGGGGACTGCGCCACGGCCTC	0.721			T	TLX3	T-ALL																																p.A275V		Atlas-SNP	.		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	.	BCL11B	108	.	0			c.C824T						.						7.0	9.0	8.0					14																	99642349		2141	4151	6292	SO:0001583	missense	64919	exon4			GACTGCGCCACGG	AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.824C>T	chr14.hg19:g.99642349G>A	ENSP00000349723:p.Ala275Val	167.0	0.0		129.0	39.0	NM_138576	Q9H162	Missense_Mutation	SNP	ENST00000357195.3	hg19	CCDS9950.1	.	.	.	.	.	.	.	.	.	.	G	14.73	2.621279	0.46736	.	.	ENSG00000127152	ENST00000357195;ENST00000345514;ENST00000443726	T;T;T	0.46063	0.88;0.88;0.88	4.68	3.78	0.43462	.	0.191220	0.33553	N	0.004794	T	0.45677	0.1354	L	0.40543	1.245	0.44555	D	0.997517	D;D	0.64830	0.994;0.989	P;P	0.52710	0.682;0.707	T	0.39313	-0.9620	10	0.42905	T	0.14	-16.1376	14.3543	0.66727	0.0:0.0:0.8504:0.1496	.	204;275	Q9C0K0-2;Q9C0K0	.;BC11B_HUMAN	V	275;204;81	ENSP00000349723:A275V;ENSP00000280435:A204V;ENSP00000387419:A81V	ENSP00000280435:A204V	A	-	2	0	BCL11B	98712102	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.664000	0.98607	1.084000	0.41184	-0.181000	0.13052	GCG	.	.		0.721	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000072332.2	NM_138576	
CDC42BPB	9578	hgsc.bcm.edu	37	14	103442078	103442078	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:103442078C>T	ENST00000361246.2	-	11	1738	c.1450G>A	c.(1450-1452)Gat>Aat	p.D484N		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		ATTTCTTTATCTCGGTTTGAA	0.468																																					p.D484N		Atlas-SNP	.											.	CDC42BPB	123	.	0			c.G1450A						.						154.0	157.0	156.0					14																	103442078		2203	4300	6503	SO:0001583	missense	9578	exon11			CTTTATCTCGGTT	AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1450G>A	chr14.hg19:g.103442078C>T	ENSP00000355237:p.Asp484Asn	91.0	0.0		59.0	41.0	NM_006035		Missense_Mutation	SNP	ENST00000361246.2	hg19	CCDS9978.1	.	.	.	.	.	.	.	.	.	.	C	19.28	3.797686	0.70567	.	.	ENSG00000198752	ENST00000361246	T	0.65178	-0.14	5.34	5.34	0.76211	.	0.088809	0.85682	D	0.000000	T	0.66066	0.2752	M	0.76002	2.32	0.80722	D	1	B	0.06786	0.001	B	0.12156	0.007	T	0.64149	-0.6475	10	0.51188	T	0.08	.	19.0682	0.93122	0.0:1.0:0.0:0.0	.	484	Q9Y5S2	MRCKB_HUMAN	N	484	ENSP00000355237:D484N	ENSP00000355237:D484N	D	-	1	0	CDC42BPB	102511831	1.000000	0.71417	0.332000	0.25469	0.967000	0.64934	7.212000	0.77941	2.489000	0.83994	0.650000	0.86243	GAT	.	.		0.468	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415711.1	NM_006035	
TDRD9	122402	hgsc.bcm.edu	37	14	104433111	104433111	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:104433111T>A	ENST00000409874.4	+	5	756	c.708T>A	c.(706-708)ctT>ctA	p.L236L	TDRD9_ENST00000339063.5_Silent_p.L236L|TDRD9_ENST00000554571.1_3'UTR	NM_153046.2	NP_694591.2	Q8NDG6	TDRD9_HUMAN	tudor domain containing 9	236	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|piP-body (GO:0071547)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0768)				GAGTCCTGCTTCAGAAAATAG	0.363																																					p.L236L		Atlas-SNP	.											.	TDRD9	175	.	0			c.T708A						.						216.0	186.0	195.0					14																	104433111		692	1591	2283	SO:0001819	synonymous_variant	122402	exon5			CCTGCTTCAGAAA	AK093483	CCDS9987.2	14q32.33	2013-01-23	2004-04-01	2004-04-02	ENSG00000156414	ENSG00000156414		"""Tudor domain containing"""	20122	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 75"""	C14orf75			Standard	NM_153046		Approved	DKFZp434N0820, FLJ36164, NET54	uc001yom.4	Q8NDG6	OTTHUMG00000152876	ENST00000409874.4:c.708T>A	chr14.hg19:g.104433111T>A		68.0	0.0		84.0	30.0	NM_153046	A1A4S7|Q6ZU54|Q8N7T3|Q8N827|Q8N9V5|Q96AS9	Silent	SNP	ENST00000409874.4	hg19	CCDS9987.2																																																																																			.	.		0.363	TDRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328325.3	NM_153046	
AHNAK2	113146	hgsc.bcm.edu	37	14	105419689	105419689	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr14:105419689A>T	ENST00000333244.5	-	7	2218	c.2099T>A	c.(2098-2100)gTg>gAg	p.V700E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	700						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			CGGCGCAGACACATCCACCGA	0.607																																					p.V700E		Atlas-SNP	.											.	AHNAK2	719	.	0			c.T2099A						.						150.0	160.0	157.0					14																	105419689		1962	4152	6114	SO:0001583	missense	113146	exon7			GCAGACACATCCA	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.2099T>A	chr14.hg19:g.105419689A>T	ENSP00000353114:p.Val700Glu	182.0	0.0		127.0	39.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	a	12.06	1.824061	0.32237	.	.	ENSG00000185567	ENST00000333244	T	0.01804	4.63	2.91	-0.0568	0.13803	.	.	.	.	.	T	0.09069	0.0224	M	0.89414	3.03	0.09310	N	1	D	0.76494	0.999	D	0.80764	0.994	T	0.13019	-1.0525	9	0.72032	D	0.01	-2.3935	4.2928	0.10886	0.4683:0.3184:0.2134:0.0	.	700	Q8IVF2	AHNK2_HUMAN	E	700	ENSP00000353114:V700E	ENSP00000353114:V700E	V	-	2	0	AHNAK2	104490734	0.000000	0.05858	0.005000	0.12908	0.006000	0.05464	1.139000	0.31504	0.982000	0.38575	0.454000	0.30748	GTG	.	.		0.607	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
GABRG3	2567	hgsc.bcm.edu	37	15	27222169	27222169	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:27222169A>G	ENST00000333743.6	+	2	328	c.74A>G	c.(73-75)gAt>gGt	p.D25G	GABRG3_ENST00000555083.1_Missense_Mutation_p.D25G	NM_033223.4	NP_150092.2	Q99928	GBRG3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, gamma 3	25					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(23)|skin(1)|upper_aerodigestive_tract(4)	42		all_lung(180;4.58e-12)|Breast(32;0.000625)|Colorectal(260;0.235)		all cancers(64;3.15e-07)|Epithelial(43;1.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0261)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTGGAAGAGGATGAATATGAA	0.423																																					p.D25G	NSCLC(114;800 1656 7410 37729 45293)	Atlas-SNP	.											.	GABRG3	115	.	0			c.A74G						.						85.0	83.0	84.0					15																	27222169		1870	4100	5970	SO:0001583	missense	2567	exon2			AAGAGGATGAATA		CCDS45195.1, CCDS59251.1	15q12	2012-06-22			ENSG00000182256	ENSG00000182256		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4088	protein-coding gene	gene with protein product	"""GABA(G) receptor, gamma 3"""	600233				7601451	Standard	NM_033223		Approved		uc001zbg.2	Q99928	OTTHUMG00000044462	ENST00000333743.6:c.74A>G	chr15.hg19:g.27222169A>G	ENSP00000331912:p.Asp25Gly	101.0	0.0		75.0	26.0	NM_001270873	G3V594|Q9HD46|Q9NYT2	Missense_Mutation	SNP	ENST00000333743.6	hg19	CCDS45195.1	.	.	.	.	.	.	.	.	.	.	A	17.78	3.474161	0.63737	.	.	ENSG00000182256	ENST00000333743;ENST00000555083	T;T	0.81330	-1.48;0.6	5.28	5.28	0.74379	.	.	.	.	.	T	0.76471	0.3992	L	0.59436	1.845	0.49051	D	0.999742	B;P	0.44521	0.354;0.837	B;B	0.38755	0.101;0.281	T	0.76879	-0.2796	9	0.33940	T	0.23	.	14.6626	0.68882	1.0:0.0:0.0:0.0	.	25;25	Q99928;G3V594	GBRG3_HUMAN;.	G	25	ENSP00000331912:D25G;ENSP00000452244:D25G	ENSP00000331912:D25G	D	+	2	0	GABRG3	24804915	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	6.461000	0.73522	2.115000	0.64714	0.455000	0.32223	GAT	.	.		0.423	GABRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000103584.2		
THBS1	7057	hgsc.bcm.edu	37	15	39885868	39885868	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:39885868A>T	ENST00000260356.5	+	19	3431	c.3266A>T	c.(3265-3267)cAg>cTg	p.Q1089L	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	1089	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		ACCCCTGGCCAGGTAAGAAGC	0.567																																					p.Q1089L		Atlas-SNP	.											.	THBS1	106	.	0			c.A3266T						.						76.0	82.0	80.0					15																	39885868		2200	4297	6497	SO:0001630	splice_region_variant	7057	exon19			CTGGCCAGGTAAG		CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.3267+1A>T	chr15.hg19:g.39885868A>T		110.0	0.0		58.0	24.0	NM_003246	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Missense_Mutation	SNP	ENST00000260356.5	hg19	CCDS32194.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.947593	0.92593	.	.	ENSG00000137801	ENST00000260356	D	0.96073	-3.9	5.78	5.78	0.91487	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Thrombospondin, C-terminal (2);	0.000000	0.34268	N	0.004111	D	0.97907	0.9312	M	0.86651	2.83	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.80764	0.989;0.994	D	0.98805	1.0741	10	0.87932	D	0	-16.612	16.0881	0.81073	1.0:0.0:0.0:0.0	.	1004;1089	B4E3J7;P07996	.;TSP1_HUMAN	L	1089	ENSP00000260356:Q1089L	ENSP00000260356:Q1089L	Q	+	2	0	THBS1	37673160	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAG	.	.		0.567	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257831.2	NM_003246	Missense_Mutation
MYEF2	50804	hgsc.bcm.edu	37	15	48443350	48443350	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:48443350C>T	ENST00000324324.7	-	14	1604	c.1325G>A	c.(1324-1326)gGg>gAg	p.G442E	MYEF2_ENST00000267836.6_Intron	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	442	Gly-rich.				myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		TCCTGCAAACCCTCCAATCAT	0.318																																					p.G442E		Atlas-SNP	.											.	MYEF2	67	.	0			c.G1325A						.						84.0	85.0	85.0					15																	48443350		2198	4295	6493	SO:0001583	missense	50804	exon14			GCAAACCCTCCAA	AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.1325G>A	chr15.hg19:g.48443350C>T	ENSP00000316950:p.Gly442Glu	337.0	1.0		239.0	84.0	NM_016132	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Missense_Mutation	SNP	ENST00000324324.7	hg19	CCDS32230.1	.	.	.	.	.	.	.	.	.	.	C	3.004	-0.205423	0.06180	.	.	ENSG00000104177	ENST00000324324	T	0.35973	1.28	5.3	5.3	0.74995	.	0.163439	0.53938	D	0.000048	T	0.32376	0.0827	L	0.48642	1.525	0.80722	D	1	P	0.48162	0.906	P	0.46585	0.521	T	0.04607	-1.0939	10	0.07813	T	0.8	-0.56	10.5818	0.45259	0.1471:0.7108:0.1421:0.0	.	442	Q9P2K5	MYEF2_HUMAN	E	442	ENSP00000316950:G442E	ENSP00000316950:G442E	G	-	2	0	MYEF2	46230642	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.022000	0.57203	2.753000	0.94483	0.655000	0.94253	GGG	.	.		0.318	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000416909.2	NM_016132	
PRTG	283659	hgsc.bcm.edu	37	15	55967845	55967845	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:55967845T>C	ENST00000389286.4	-	9	1465	c.1418A>G	c.(1417-1419)aAt>aGt	p.N473S		NM_173814.4	NP_776175.2			protogenin											breast(1)|endometrium(6)|kidney(4)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41				all cancers(107;0.00891)|GBM - Glioblastoma multiforme(80;0.135)		AGTTGTGTCATTTCCGATGAC	0.318																																					p.N473S		Atlas-SNP	.											.	PRTG	110	.	0			c.A1418G						.						64.0	61.0	62.0					15																	55967845		1835	4081	5916	SO:0001583	missense	283659	exon9			GTGTCATTTCCGA	AK098622	CCDS42040.1	15q21.3	2013-02-11	2010-06-24		ENSG00000166450	ENSG00000166450		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26373	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 5"""	613261	"""protogenin homolog (Gallus gallus)"""				Standard	NM_173814		Approved	FLJ25756, IGDCC5	uc002adg.3	Q2VWP7		ENST00000389286.4:c.1418A>G	chr15.hg19:g.55967845T>C	ENSP00000373937:p.Asn473Ser	78.0	0.0		53.0	18.0	NM_173814		Missense_Mutation	SNP	ENST00000389286.4	hg19	CCDS42040.1	.	.	.	.	.	.	.	.	.	.	T	22.0	4.229447	0.79688	.	.	ENSG00000166450	ENST00000389286	T	0.56776	0.44	4.99	4.99	0.66335	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.217493	0.47852	D	0.000217	T	0.67915	0.2944	M	0.64260	1.97	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.65788	-0.6083	10	0.30078	T	0.28	-25.0674	14.176	0.65542	0.0:0.0:0.0:1.0	.	473	Q2VWP7	PRTG_HUMAN	S	473	ENSP00000373937:N473S	ENSP00000373937:N473S	N	-	2	0	PRTG	53755137	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.802000	0.85969	2.001000	0.58596	0.460000	0.39030	AAT	.	.		0.318	PRTG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419357.1	NM_173814	
TMEM202	338949	hgsc.bcm.edu	37	15	72700152	72700152	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:72700152C>A	ENST00000341689.3	+	5	794	c.740C>A	c.(739-741)gCt>gAt	p.A247D	TMEM202_ENST00000567679.1_3'UTR	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	247						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						GTATCACCTGCTAAAGATGAA	0.453																																					p.A247D		Atlas-SNP	.											.	TMEM202	40	.	0			c.C740A						.						87.0	81.0	83.0					15																	72700152		2199	4297	6496	SO:0001583	missense	338949	exon5			CACCTGCTAAAGA		CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.740C>A	chr15.hg19:g.72700152C>A	ENSP00000340212:p.Ala247Asp	65.0	0.0		45.0	17.0	NM_001080462		Missense_Mutation	SNP	ENST00000341689.3	hg19	CCDS32287.1	.	.	.	.	.	.	.	.	.	.	C	13.93	2.382854	0.42207	.	.	ENSG00000187806	ENST00000341689	T	0.56103	0.48	4.29	0.0693	0.14373	.	0.895616	0.09376	N	0.810686	T	0.36524	0.0970	L	0.37630	1.12	0.09310	N	1	B	0.16802	0.019	B	0.15870	0.014	T	0.24225	-1.0166	10	0.33141	T	0.24	-4.7749	3.2966	0.06968	0.3598:0.438:0.0:0.2021	.	247	A6NGA9	TM202_HUMAN	D	247	ENSP00000340212:A247D	ENSP00000340212:A247D	A	+	2	0	TMEM202	70487206	0.000000	0.05858	0.000000	0.03702	0.193000	0.23685	-0.506000	0.06359	-0.061000	0.13110	0.561000	0.74099	GCT	.	.		0.453	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435756.1	NM_001080462	
RASGRF1	5923	hgsc.bcm.edu	37	15	79291113	79291113	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:79291113G>T	ENST00000419573.3	-	19	3123	c.2849C>A	c.(2848-2850)gCc>gAc	p.A950D	RASGRF1_ENST00000560334.1_5'UTR|RASGRF1_ENST00000558480.2_Missense_Mutation_p.A934D|RASGRF1_ENST00000394745.3_Missense_Mutation_p.A166D	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	950					activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						ACGATTGGTGGCTGCTCTGCG	0.617																																					p.A950D		Atlas-SNP	.											.	RASGRF1	168	.	0			c.C2849A						.						119.0	109.0	112.0					15																	79291113		2196	4293	6489	SO:0001583	missense	5923	exon19			TTGGTGGCTGCTC	M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.2849C>A	chr15.hg19:g.79291113G>T	ENSP00000405963:p.Ala950Asp	58.0	0.0		43.0	13.0	NM_002891	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	ENST00000419573.3	hg19	CCDS10309.1	.	.	.	.	.	.	.	.	.	.	G	15.92	2.976398	0.53720	.	.	ENSG00000058335	ENST00000419573;ENST00000394741;ENST00000394745	T;T	0.31247	1.5;1.5	4.74	3.81	0.43845	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (1);	0.062116	0.64402	D	0.000005	T	0.40570	0.1122	M	0.80422	2.495	0.80722	D	1	P;B;B;B	0.46621	0.881;0.076;0.185;0.074	P;B;B;B	0.44518	0.452;0.071;0.144;0.104	T	0.49457	-0.8938	10	0.87932	D	0	.	12.1452	0.54020	0.0:0.0:0.828:0.1719	.	346;934;952;934	B7Z6Z6;Q8IUU5;Q13972;F8VPA5	.;.;RGRF1_HUMAN;.	D	950;934;166	ENSP00000405963:A950D;ENSP00000378228:A166D	ENSP00000378224:A934D	A	-	2	0	RASGRF1	77078168	1.000000	0.71417	0.993000	0.49108	0.968000	0.65278	6.129000	0.71657	1.166000	0.42689	0.591000	0.81541	GCC	.	.		0.617	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000291371.3	NM_002891	
HDGFRP3	50810	hgsc.bcm.edu	37	15	83826759	83826759	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:83826759T>C	ENST00000299633.4	-	3	799	c.196A>G	c.(196-198)Aag>Gag	p.K66E		NM_016073.3	NP_057157.1	Q9Y3E1	HDGR3_HUMAN		66	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.				cell proliferation (GO:0008283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|lung(4)|prostate(1)	7						TTGTACTCCTTATATGGAAAA	0.348																																					p.K66E		Atlas-SNP	.											.	HDGFRP3	17	.	0			c.A196G						.						106.0	95.0	99.0					15																	83826759		2203	4300	6503	SO:0001583	missense	0	exon3			ACTCCTTATATGG																												ENST00000299633.4:c.196A>G	chr15.hg19:g.83826759T>C	ENSP00000299633:p.Lys66Glu	83.0	0.0		49.0	21.0	NM_016073		Missense_Mutation	SNP	ENST00000299633.4	hg19	CCDS32314.1	.	.	.	.	.	.	.	.	.	.	T	3.674	-0.066865	0.07273	.	.	ENSG00000166503	ENST00000299633	T	0.69175	-0.38	5.28	5.28	0.74379	PWWP (3);	0.101757	0.64402	D	0.000005	T	0.32496	0.0831	N	0.00621	-1.32	0.32425	N	0.548797	B	0.18013	0.025	B	0.20577	0.03	T	0.35624	-0.9781	10	0.02654	T	1	.	15.5016	0.75703	0.0:0.0:0.0:1.0	.	66	Q9Y3E1	HDGR3_HUMAN	E	66	ENSP00000299633:K66E	ENSP00000299633:K66E	K	-	1	0	AC024270.1	81617763	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.606000	0.46291	2.124000	0.65301	0.460000	0.39030	AAG	.	.		0.348	HDGFRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000419898.1		
ADAMTSL3	57188	hgsc.bcm.edu	37	15	84694127	84694127	+	Missense_Mutation	SNP	G	G	T	rs143304781		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:84694127G>T	ENST00000286744.5	+	27	4819	c.4595G>T	c.(4594-4596)cGg>cTg	p.R1532L	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.R1532L	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1532	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CCTAAAGACCGGCCTCTGGGA	0.522																																					p.R1532L		Atlas-SNP	.											.	ADAMTSL3	290	.	0			c.G4595T						.						120.0	108.0	112.0					15																	84694127		2203	4299	6502	SO:0001583	missense	57188	exon27			AAGACCGGCCTCT	AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.4595G>T	chr15.hg19:g.84694127G>T	ENSP00000286744:p.Arg1532Leu	230.0	0.0		156.0	59.0	NM_207517	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	ENST00000286744.5	hg19	CCDS10326.1	.	.	.	.	.	.	.	.	.	.	G	15.69	2.907580	0.52333	.	.	ENSG00000156218	ENST00000286744	T	0.61040	0.14	5.15	4.23	0.50019	.	1.071190	0.07455	N	0.899666	T	0.77565	0.4149	M	0.83774	2.66	0.26696	N	0.97126	D;B	0.61080	0.989;0.285	D;B	0.67382	0.951;0.06	T	0.61023	-0.7146	10	0.72032	D	0.01	.	11.0758	0.48030	0.0849:0.0:0.9151:0.0	.	1532;1532	P82987-2;P82987	.;ATL3_HUMAN	L	1532	ENSP00000286744:R1532L	ENSP00000286744:R1532L	R	+	2	0	ADAMTSL3	82485131	0.014000	0.17966	0.723000	0.30687	0.592000	0.36648	0.703000	0.25646	1.381000	0.46364	0.655000	0.94253	CGG	.	G|1.000;A|0.000		0.522	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000304007.2	NM_207517	
IQGAP1	8826	hgsc.bcm.edu	37	15	91038004	91038004	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:91038004A>G	ENST00000268182.5	+	36	4812	c.4688A>G	c.(4687-4689)tAt>tGt	p.Y1563C	IQGAP1_ENST00000560738.1_Missense_Mutation_p.Y991C	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	1563	C2.				cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			TCTCTGAAATATACAGCAGCA	0.338																																					p.Y1563C		Atlas-SNP	.											.	IQGAP1	140	.	0			c.A4688G						.						142.0	147.0	145.0					15																	91038004		2198	4298	6496	SO:0001583	missense	8826	exon36			TGAAATATACAGC	D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.4688A>G	chr15.hg19:g.91038004A>G	ENSP00000268182:p.Tyr1563Cys	267.0	1.0		182.0	69.0	NM_003870	A7MBM3	Missense_Mutation	SNP	ENST00000268182.5	hg19	CCDS10362.1	.	.	.	.	.	.	.	.	.	.	A	24.9	4.577768	0.86645	.	.	ENSG00000140575	ENST00000268182	T	0.53206	0.63	5.77	5.77	0.91146	RasGAP protein, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.71409	0.3336	M	0.83774	2.66	0.80722	D	1	D;D	0.89917	0.992;1.0	D;D	0.97110	0.984;1.0	T	0.75167	-0.3413	10	0.59425	D	0.04	-17.4566	15.5623	0.76258	1.0:0.0:0.0:0.0	.	184;1563	B4DNP4;P46940	.;IQGA1_HUMAN	C	1563	ENSP00000268182:Y1563C	ENSP00000268182:Y1563C	Y	+	2	0	IQGAP1	88839008	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.210000	0.95106	2.330000	0.79161	0.528000	0.53228	TAT	.	.		0.338	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313493.1	NM_003870	
CHD2	1106	hgsc.bcm.edu	37	15	93552536	93552536	+	Silent	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:93552536C>T	ENST00000394196.4	+	35	5643	c.4575C>T	c.(4573-4575)caC>caT	p.H1525H	CHD2_ENST00000557381.1_Silent_p.H1525H	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1525					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			ATCAGGAGCACATCAAACTCT	0.498																																					p.H1525H		Atlas-SNP	.											.	CHD2	280	.	0			c.C4575T						.						75.0	65.0	68.0					15																	93552536		2197	4298	6495	SO:0001819	synonymous_variant	1106	exon35			GGAGCACATCAAA	AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.4575C>T	chr15.hg19:g.93552536C>T		92.0	0.0		63.0	30.0	NM_001271	C6G482|Q96IP5	Silent	SNP	ENST00000394196.4	hg19	CCDS10374.2																																																																																			.	.		0.498	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000313528.3	NM_001271	
IGF1R	3480	hgsc.bcm.edu	37	15	99251163	99251163	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr15:99251163A>T	ENST00000268035.6	+	2	1078	c.467A>T	c.(466-468)gAc>gTc	p.D156V	IGF1R_ENST00000558762.1_Missense_Mutation_p.D156V	NM_000875.3	NP_000866.1	P08069	IGF1R_HUMAN	insulin-like growth factor 1 receptor	156					axonogenesis (GO:0007409)|brain development (GO:0007420)|epidermis development (GO:0008544)|establishment of cell polarity (GO:0030010)|exocrine pancreas development (GO:0031017)|immune response (GO:0006955)|inactivation of MAPKK activity (GO:0051389)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|male sex determination (GO:0030238)|mammary gland development (GO:0030879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|peptidyl-tyrosine autophosphorylation (GO:0038083)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of DNA replication (GO:0045740)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|prostate gland epithelium morphogenesis (GO:0060740)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein tetramerization (GO:0051262)|regulation of JNK cascade (GO:0046328)|response to vitamin E (GO:0033197)|signal transduction (GO:0007165)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor binding (GO:0005520)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor-activated receptor activity (GO:0005010)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)			NS(2)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(13)|lung(20)|ovary(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_cancers(4;4.17e-14)|all_epithelial(3;4.34e-15)|Lung NSC(78;0.00175)|all_lung(78;0.00351)|Melanoma(26;0.00505)|Medulloblastoma(229;0.163)		Epithelial(2;1.94e-12)|all cancers(5;6.83e-11)|BRCA - Breast invasive adenocarcinoma(2;2.88e-09)|OV - Ovarian serous cystadenocarcinoma(32;0.00261)		"""""""Insulin(DB00071)|Insulin Glargine(DB00047)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCCACTGTGGACTGGTCCCTG	0.512																																					p.D156V		Atlas-SNP	.											.	IGF1R	147	.	0			c.A467T						.						98.0	88.0	92.0					15																	99251163		2197	4297	6494	SO:0001583	missense	3480	exon2			CTGTGGACTGGTC	M69229	CCDS10378.1, CCDS73785.1	15q26.3	2013-02-11			ENSG00000140443	ENSG00000140443		"""CD molecules"", ""Fibronectin type III domain containing"""	5465	protein-coding gene	gene with protein product		147370				1316909	Standard	XM_006720486		Approved	JTK13, CD221, IGFIR, MGC18216, IGFR	uc002bul.3	P08069	OTTHUMG00000149851	ENST00000268035.6:c.467A>T	chr15.hg19:g.99251163A>T	ENSP00000268035:p.Asp156Val	164.0	0.0		91.0	42.0	NM_000875	B1B5Y2|Q14CV2|Q9UCC0	Missense_Mutation	SNP	ENST00000268035.6	hg19	CCDS10378.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.351834	0.82132	.	.	ENSG00000140443	ENST00000268035	D	0.84146	-1.81	5.36	5.36	0.76844	EGF receptor, L domain (1);	0.000000	0.56097	D	0.000024	D	0.93716	0.7992	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94986	0.8130	10	0.87932	D	0	.	14.824	0.70097	1.0:0.0:0.0:0.0	.	156;156	C9J5X1;P08069	.;IGF1R_HUMAN	V	156	ENSP00000268035:D156V	ENSP00000268035:D156V	D	+	2	0	IGF1R	97068686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.150000	0.94667	2.148000	0.66965	0.460000	0.39030	GAC	.	.		0.512	IGF1R-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313537.2	NM_000875	
ABAT	18	hgsc.bcm.edu	37	16	8860122	8860122	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:8860122A>T	ENST00000396600.2	+	9	1536	c.598A>T	c.(598-600)Aac>Tac	p.N200Y	ABAT_ENST00000567812.1_Missense_Mutation_p.N215Y|ABAT_ENST00000569156.1_Missense_Mutation_p.N200Y|ABAT_ENST00000425191.2_Missense_Mutation_p.N200Y|ABAT_ENST00000268251.8_Missense_Mutation_p.N200Y	NM_000663.4	NP_000654.2	P80404	GABT_HUMAN	4-aminobutyrate aminotransferase	200					behavioral response to cocaine (GO:0048148)|copulation (GO:0007620)|gamma-aminobutyric acid catabolic process (GO:0009450)|locomotory behavior (GO:0007626)|negative regulation of blood pressure (GO:0045776)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to iron ion (GO:0010039)|response to nicotine (GO:0035094)|synaptic transmission (GO:0007268)	4-aminobutyrate transaminase complex (GO:0032144)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	(S)-3-amino-2-methylpropionate transaminase activity (GO:0047298)|4-aminobutyrate transaminase activity (GO:0003867)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|succinate-semialdehyde dehydrogenase binding (GO:0032145)			breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	26					L-Alanine(DB00160)|Phenelzine(DB00780)|Pyruvic acid(DB00119)|Valproic Acid(DB00313)|Vigabatrin(DB01080)	GTGCATGATTAACCAGGTGAG	0.557																																					p.N200Y		Atlas-SNP	.											.	ABAT	46	.	0			c.A598T						.						63.0	60.0	61.0					16																	8860122		2197	4300	6497	SO:0001583	missense	18	exon9			ATGATTAACCAGG	L32961	CCDS10534.1	16p13.2	2011-01-10			ENSG00000183044	ENSG00000183044	2.6.1.19		23	protein-coding gene	gene with protein product	"""4-aminobutyrate transaminase"""	137150				7721088	Standard	NM_020686		Approved	GABAT	uc002czc.4	P80404	OTTHUMG00000048201	ENST00000396600.2:c.598A>T	chr16.hg19:g.8860122A>T	ENSP00000379845:p.Asn200Tyr	85.0	0.0		73.0	42.0	NM_001127448	A8K386|Q16260|Q8N5W2|Q96BG2|Q99800	Missense_Mutation	SNP	ENST00000396600.2	hg19	CCDS10534.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.520426	0.85495	.	.	ENSG00000183044	ENST00000268251;ENST00000396600;ENST00000425191	T;T;T	0.77750	-1.12;-1.12;-1.12	5.0	5.0	0.66597	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.91734	0.7386	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94220	0.7466	10	0.87932	D	0	-16.2983	13.9442	0.64075	1.0:0.0:0.0:0.0	.	200	P80404	GABT_HUMAN	Y	200	ENSP00000268251:N200Y;ENSP00000379845:N200Y;ENSP00000411916:N200Y	ENSP00000268251:N200Y	N	+	1	0	ABAT	8767623	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.432000	0.90288	1.892000	0.54788	0.454000	0.30748	AAC	.	.		0.557	ABAT-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000433620.2	NM_020686	
TMC5	79838	hgsc.bcm.edu	37	16	19468227	19468227	+	Intron	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:19468227A>C	ENST00000396229.2	+	6	1797				TMC5_ENST00000561503.1_Intron|TMC5_ENST00000541464.1_Intron|TMC5_ENST00000542583.2_Intron|TMC5_ENST00000219821.5_Missense_Mutation_p.N67H|TMC5_ENST00000564959.1_Intron|TMC5_ENST00000381414.4_Intron	NM_001105248.1	NP_001098718.1	Q6UXY8	TMC5_HUMAN	transmembrane channel-like 5						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|liver(2)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						CCAAAAGGGTAACCAGGTGCT	0.438																																					p.N67H		Atlas-SNP	.											.	TMC5	169	.	0			c.A199C						.						124.0	109.0	114.0					16																	19468227		2197	4300	6497	SO:0001627	intron_variant	79838	exon1			AAGGGTAACCAGG	AY263164	CCDS10577.1, CCDS42126.1, CCDS45431.1	16p13.11	2008-02-05			ENSG00000103534	ENSG00000103534			22999	protein-coding gene	gene with protein product						12812529, 12906855	Standard	NM_024780		Approved	FLJ13593	uc010var.2	Q6UXY8	OTTHUMG00000131458	ENST00000396229.2:c.1049-3330A>C	chr16.hg19:g.19468227A>C		92.0	0.0		71.0	24.0	NM_024780	Q68DK8|Q8IY20|Q8NHV6|Q9H8I7	Missense_Mutation	SNP	ENST00000396229.2	hg19	CCDS45431.1	.	.	.	.	.	.	.	.	.	.	A	8.665	0.901466	0.17760	.	.	ENSG00000103534	ENST00000219821	T	0.69561	-0.41	4.07	-1.33	0.09172	.	.	.	.	.	T	0.47488	0.1448	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.28073	-1.0055	9	0.14252	T	0.57	.	11.7366	0.51769	0.3399:0.6601:0.0:0.0	.	67;67	Q6UXY8-3;B3KUQ8	.;.	H	67	ENSP00000219821:N67H	ENSP00000219821:N67H	N	+	1	0	TMC5	19375728	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.419000	0.21247	-0.254000	0.09500	0.533000	0.62120	AAC	.	.		0.438	TMC5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435888.1	NM_024780	
PDILT	204474	hgsc.bcm.edu	37	16	20396093	20396093	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:20396093C>T	ENST00000302451.4	-	3	531	c.283G>A	c.(283-285)Ggg>Agg	p.G95R	RP11-429K17.1_ENST00000577173.1_RNA	NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	95					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						AAGCCGATCCCATTCTTGCCT	0.493																																					p.G95R		Atlas-SNP	.											.	PDILT	120	.	0			c.G283A						.						332.0	322.0	326.0					16																	20396093		2203	4300	6503	SO:0001583	missense	204474	exon3			CGATCCCATTCTT		CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.283G>A	chr16.hg19:g.20396093C>T	ENSP00000305465:p.Gly95Arg	95.0	0.0		75.0	44.0	NM_174924	Q8IVQ5	Missense_Mutation	SNP	ENST00000302451.4	hg19	CCDS10584.1	.	.	.	.	.	.	.	.	.	.	C	17.48	3.401177	0.62288	.	.	ENSG00000169340	ENST00000302451	T	0.03152	4.03	5.43	5.43	0.79202	Thioredoxin domain (1);Thioredoxin-like fold (2);	0.170044	0.40728	N	0.001033	T	0.04272	0.0118	L	0.34521	1.04	0.32825	D	0.503202	P	0.39535	0.677	B	0.39419	0.299	T	0.41197	-0.9522	10	0.20519	T	0.43	.	14.599	0.68427	0.0:1.0:0.0:0.0	.	95	Q8N807	PDILT_HUMAN	R	95	ENSP00000305465:G95R	ENSP00000305465:G95R	G	-	1	0	PDILT	20303594	0.477000	0.25909	0.677000	0.29947	0.735000	0.41995	3.347000	0.52200	2.825000	0.97269	0.655000	0.94253	GGG	.	.		0.493	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254332.1	NM_174924	
SCNN1G	6340	hgsc.bcm.edu	37	16	23208731	23208731	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:23208731T>A	ENST00000300061.2	+	6	1203	c.1060T>A	c.(1060-1062)Tct>Act	p.S354T	CTC-391G2.1_ENST00000563471.1_RNA	NM_001039.3	NP_001030.2	P51170	SCNNG_HUMAN	sodium channel, non-voltage-gated 1, gamma subunit	354					excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|multicellular organismal water homeostasis (GO:0050891)|response to stimulus (GO:0050896)|sensory perception of taste (GO:0050909)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)	ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)|WW domain binding (GO:0050699)			NS(2)|autonomic_ganglia(1)|breast(1)|cervix(2)|kidney(1)|large_intestine(9)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	34				GBM - Glioblastoma multiforme(48;0.0366)	Amiloride(DB00594)|Triamterene(DB00384)	AATGGTCACCTCTATAGGAAT	0.463																																					p.S354T		Atlas-SNP	.											.	SCNN1G	82	.	0			c.T1060A						.						113.0	107.0	109.0					16																	23208731		2197	4300	6497	SO:0001583	missense	6340	exon6			GTCACCTCTATAG	U48937	CCDS10608.1	16p12	2012-02-28	2012-02-28		ENSG00000166828	ENSG00000166828		"""Ion channels / Sodium channel, nonvoltage-gated"", ""Sodium channels"""	10602	protein-coding gene	gene with protein product		600761	"""sodium channel, nonvoltage-gated 1, gamma"", ""sodium channel, non-voltage-gated 1, gamma"""			7490094	Standard	NM_001039		Approved	ENaCgamma, SCNEG	uc002dlm.1	P51170	OTTHUMG00000131609	ENST00000300061.2:c.1060T>A	chr16.hg19:g.23208731T>A	ENSP00000300061:p.Ser354Thr	114.0	0.0		80.0	14.0	NM_001039	P78437|Q6PCC2|Q93023|Q93024|Q93025|Q93026|Q93027|Q96TD2	Missense_Mutation	SNP	ENST00000300061.2	hg19	CCDS10608.1	.	.	.	.	.	.	.	.	.	.	T	20.2	3.952158	0.73787	.	.	ENSG00000166828	ENST00000300061	T	0.64618	-0.11	5.62	4.48	0.54585	.	0.000000	0.64402	D	0.000001	T	0.72676	0.3490	L	0.53729	1.69	0.37235	D	0.905846	D	0.76494	0.999	D	0.83275	0.996	T	0.75462	-0.3309	10	0.40728	T	0.16	-36.3791	12.1782	0.54198	0.0:0.0:0.1421:0.8579	.	354	P51170	SCNNG_HUMAN	T	354	ENSP00000300061:S354T	ENSP00000300061:S354T	S	+	1	0	SCNN1G	23116232	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.920000	0.56446	2.151000	0.67156	0.533000	0.62120	TCT	.	.		0.463	SCNN1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254496.1	NM_001039	
MVP	9961	hgsc.bcm.edu	37	16	29847023	29847023	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:29847023A>T	ENST00000357402.5	+	6	715		c.e6-1		MVP_ENST00000395353.1_Splice_Site|MVP_ENST00000452209.2_Intron	NM_005115.4|NM_017458.3	NP_005106.2|NP_059447.2	Q14764	MVP_HUMAN	major vault protein						cell proliferation (GO:0008283)|ERBB signaling pathway (GO:0038127)|mRNA transport (GO:0051028)|negative regulation of protein autophosphorylation (GO:0031953)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of signaling (GO:0023057)|protein activation cascade (GO:0072376)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(7)|ovary(2)|skin(3)|soft_tissue(1)|stomach(1)	27						CTCTTGGCCCAGGGGAAGAAT	0.592																																					.		Atlas-SNP	.											.	MVP	80	.	0			c.578-2A>T						.						69.0	61.0	63.0					16																	29847023		2197	4300	6497	SO:0001630	splice_region_variant	9961	exon6			TGGCCCAGGGGAA	X79882	CCDS10656.1	16p11.2	2012-04-25			ENSG00000013364	ENSG00000013364			7531	protein-coding gene	gene with protein product	"""lung resistance-related protein"""	605088				7585126	Standard	NM_005115		Approved	LRP, VAULT1	uc002dui.3	Q14764	OTTHUMG00000048227	ENST00000357402.5:c.578-1A>T	chr16.hg19:g.29847023A>T		135.0	0.0		102.0	25.0	NM_017458	Q96BG4|Q9BPW6|Q9BQT1|Q9UBD1	Splice_Site	SNP	ENST00000357402.5	hg19	CCDS10656.1	.	.	.	.	.	.	.	.	.	.	a	16.83	3.230276	0.58777	.	.	ENSG00000013364	ENST00000357402;ENST00000395353	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1238	0.59342	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MVP	29754524	1.000000	0.71417	0.921000	0.36526	0.619000	0.37552	6.832000	0.75329	2.067000	0.61834	0.375000	0.23000	.	.	.		0.592	MVP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109711.3	NM_005115	Intron
CD2BP2	10421	hgsc.bcm.edu	37	16	30364546	30364546	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:30364546C>A	ENST00000305596.3	-	6	1046	c.871G>T	c.(871-873)Ggg>Tgg	p.G291W	CD2BP2_ENST00000569466.1_Missense_Mutation_p.G291W|RP11-347C12.10_ENST00000563252.1_lincRNA	NM_006110.2	NP_006101.1	O95400	CD2B2_HUMAN	CD2 (cytoplasmic tail) binding protein 2	291	GYF. {ECO:0000255|PROSITE- ProRule:PRU00101}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of phosphatase activity (GO:0010923)|RNA splicing (GO:0008380)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	ribonucleoprotein complex binding (GO:0043021)			breast(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)	15						TCGGCATCCCCCGTGTTCTCC	0.567																																					p.G291W		Atlas-SNP	.											.	CD2BP2	30	.	0			c.G871T						.						138.0	119.0	126.0					16																	30364546		2197	4300	6497	SO:0001583	missense	10421	exon6			CATCCCCCGTGTT	AF104222	CCDS10675.1	16p11.2	2012-04-17	2006-03-28		ENSG00000169217	ENSG00000169217		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1656	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 59"""	604470	"""CD2 antigen (cytoplasmic tail)-binding protein 2"""			9843987	Standard	NM_006110		Approved	LIN1, Snu40, PPP1R59	uc002dxs.3	O95400	OTTHUMG00000132397	ENST00000305596.3:c.871G>T	chr16.hg19:g.30364546C>A	ENSP00000304903:p.Gly291Trp	126.0	0.0		113.0	26.0	NM_006110	B2RDX2|Q9ULP2	Missense_Mutation	SNP	ENST00000305596.3	hg19	CCDS10675.1	.	.	.	.	.	.	.	.	.	.	c	15.69	2.907567	0.52333	.	.	ENSG00000169217	ENST00000305596	T	0.32272	1.46	4.81	1.2	0.21068	GYF (4);	0.365474	0.31020	N	0.008410	T	0.21307	0.0513	L	0.27053	0.805	0.40983	D	0.984794	P	0.51537	0.946	P	0.46543	0.52	T	0.04128	-1.0975	10	0.66056	D	0.02	0.0014	4.8133	0.13354	0.0:0.551:0.1752:0.2739	.	291	O95400	CD2B2_HUMAN	W	291	ENSP00000304903:G291W	ENSP00000304903:G291W	G	-	1	0	CD2BP2	30272047	0.581000	0.26741	0.991000	0.47740	0.923000	0.55619	1.912000	0.39946	0.541000	0.28827	-0.140000	0.14226	GGG	.	.		0.567	CD2BP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255528.1	NM_006110	
TGFB1I1	7041	hgsc.bcm.edu	37	16	31484780	31484780	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:31484780T>C	ENST00000394863.3	+	2	162	c.32T>C	c.(31-33)cTg>cCg	p.L11P	TGFB1I1_ENST00000567607.1_5'UTR|TGFB1I1_ENST00000361773.3_5'UTR|TGFB1I1_ENST00000394858.2_5'UTR	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	11	Interaction with PTK2B/PYK2.|Transcription activation. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CTCTCTGACCTGGAGACTACC	0.602																																					p.L11P		Atlas-SNP	.											.	TGFB1I1	60	.	0			c.T32C						.						48.0	52.0	50.0					16																	31484780		2197	4300	6497	SO:0001583	missense	7041	exon2			CTGACCTGGAGAC	AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.32T>C	chr16.hg19:g.31484780T>C	ENSP00000378332:p.Leu11Pro	42.0	0.0		30.0	8.0	NM_001042454	B2R8D5|Q9BPW3|Q9Y2V5	Missense_Mutation	SNP	ENST00000394863.3	hg19	CCDS42156.1	.	.	.	.	.	.	.	.	.	.	T	15.62	2.887572	0.52014	.	.	ENSG00000140682	ENST00000394863	T	0.65549	-0.16	4.8	4.8	0.61643	.	2.348640	0.03424	U	0.206806	T	0.72938	0.3523	L	0.28115	0.83	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58429	-0.7638	10	0.87932	D	0	.	12.3524	0.55155	0.0:0.0:0.0:1.0	.	11	O43294	TGFI1_HUMAN	P	11	ENSP00000378332:L11P	ENSP00000378332:L11P	L	+	2	0	TGFB1I1	31392281	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.005000	0.76323	2.007000	0.58848	0.454000	0.30748	CTG	.	.		0.602	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255630.3		
ABCC12	94160	hgsc.bcm.edu	37	16	48158122	48158122	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:48158122A>T	ENST00000311303.3	-	10	1933		c.e10+1		ABCC12_ENST00000416054.1_Splice_Site|ABCC12_ENST00000448542.1_Splice_Site	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				CACACAGCTTACCTGTCCTAG	0.527																																					.		Atlas-SNP	.											.	ABCC12	190	.	0			c.1587+2T>A						.						242.0	226.0	231.0					16																	48158122		2201	4300	6501	SO:0001630	splice_region_variant	94160	exon11			CAGCTTACCTGTC	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1587+1T>A	chr16.hg19:g.48158122A>T		89.0	0.0		53.0	39.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Splice_Site	SNP	ENST00000311303.3	hg19	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	A	26.6	4.748898	0.89753	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1108	0.72355	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ABCC12	46715623	1.000000	0.71417	0.994000	0.49952	0.967000	0.64934	8.468000	0.90393	2.206000	0.71126	0.528000	0.53228	.	.	.		0.527	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	Intron
MT1M	4499	hgsc.bcm.edu	37	16	56667700	56667700	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:56667700T>A	ENST00000379818.3	+	3	631	c.132T>A	c.(130-132)tgT>tgA	p.C44*	MT1JP_ENST00000564564.1_RNA|AC026461.1_ENST00000600389.1_5'Flank	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	44	Alpha.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						GTGCCAAGTGTGCCCACGGCT	0.592																																					p.C44X		Atlas-SNP	.											.	MT1M	13	.	0			c.T132A						.						126.0	129.0	128.0					16																	56667700		2198	4300	6498	SO:0001587	stop_gained	4499	exon3			CAAGTGTGCCCAC	AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.132T>A	chr16.hg19:g.56667700T>A	ENSP00000369146:p.Cys44*	41.0	0.0		26.0	8.0	NM_176870	Q8TDN3	Nonsense_Mutation	SNP	ENST00000379818.3	hg19	CCDS42166.1	.	.	.	.	.	.	.	.	.	.	T	37	6.513523	0.97629	.	.	ENSG00000205364	ENST00000379818	.	.	.	2.41	2.41	0.29592	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.9971	0.30275	0.0:0.0:0.0:1.0	.	.	.	.	X	44	.	ENSP00000369146:C44X	C	+	3	2	MT1M	55225201	1.000000	0.71417	0.996000	0.52242	0.831000	0.47069	0.857000	0.27831	1.100000	0.41517	0.378000	0.23410	TGT	.	.		0.592	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434359.1	NM_176870	
CDH11	1009	hgsc.bcm.edu	37	16	64981610	64981610	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:64981610T>A	ENST00000268603.4	-	13	2902	c.2287A>T	c.(2287-2289)Aca>Tca	p.T763S	CDH11_ENST00000566827.1_Missense_Mutation_p.T637S|CDH11_ENST00000394156.3_3'UTR	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	763					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		TCTGAATCTGTGGTGGCCGAC	0.488			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																											p.T763S		Atlas-SNP	.		Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	.	CDH11	260	.	0			c.A2287T						.						77.0	81.0	80.0					16																	64981610		2203	4300	6503	SO:0001583	missense	1009	exon13			AATCTGTGGTGGC	D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.2287A>T	chr16.hg19:g.64981610T>A	ENSP00000268603:p.Thr763Ser	172.0	0.0		141.0	36.0	NM_001797	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	ENST00000268603.4	hg19	CCDS10803.1	.	.	.	.	.	.	.	.	.	.	T	1.292	-0.607250	0.03717	.	.	ENSG00000140937	ENST00000268603;ENST00000538390	T	0.76060	-0.99	6.17	5.07	0.68467	Cadherin, cytoplasmic domain (1);	0.000000	0.85682	D	0.000000	T	0.53158	0.1779	N	0.11000	0.08	0.58432	D	0.999993	B	0.16166	0.016	B	0.20184	0.028	T	0.47471	-0.9115	10	0.07030	T	0.85	.	12.9702	0.58508	0.0:0.0:0.1352:0.8648	.	763	P55287	CAD11_HUMAN	S	763;746	ENSP00000268603:T763S	ENSP00000268603:T763S	T	-	1	0	CDH11	63539111	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.002000	0.70693	1.134000	0.42165	-0.313000	0.08912	ACA	.	.		0.488	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268755.1	NM_033664	
CMTM4	146223	hgsc.bcm.edu	37	16	66656097	66656097	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:66656097T>A	ENST00000330687.4	-	4	672	c.491A>T	c.(490-492)tAt>tTt	p.Y164F	CMTM4_ENST00000394106.2_Missense_Mutation_p.Y164F|CMTM4_ENST00000563952.1_Missense_Mutation_p.Y135F	NM_178818.2|NM_181521.2	NP_848933.1|NP_852662.1	Q8IZR5	CKLF4_HUMAN	CKLF-like MARVEL transmembrane domain containing 4	164	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(1)|ovary(1)|pancreas(1)|stomach(1)	9		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0811)|Epithelial(162;0.214)		GTTCACTGCATATGCCGCAGT	0.567																																					p.Y164F		Atlas-SNP	.											.	CMTM4	19	.	0			c.A491T						.						53.0	47.0	49.0					16																	66656097		2201	4300	6501	SO:0001583	missense	146223	exon4			ACTGCATATGCCG	AF479814	CCDS10817.1, CCDS42170.1	16q22.1-q22.3	2008-02-05	2005-11-08	2005-11-08	ENSG00000183723	ENSG00000183723			19175	protein-coding gene	gene with protein product		607887	"""chemokine-like factor super family 4"", ""chemokine-like factor superfamily 4"""	CKLFSF4		12782130	Standard	NM_178818		Approved		uc002epz.3	Q8IZR5	OTTHUMG00000137500	ENST00000330687.4:c.491A>T	chr16.hg19:g.66656097T>A	ENSP00000333833:p.Tyr164Phe	70.0	0.0		45.0	29.0	NM_178818	Q52M40|Q8IZR4|Q8IZV1	Missense_Mutation	SNP	ENST00000330687.4	hg19	CCDS10817.1	.	.	.	.	.	.	.	.	.	.	T	8.561	0.877747	0.17395	.	.	ENSG00000183723	ENST00000330687;ENST00000394106	T;T	0.20738	2.05;2.05	6.11	6.11	0.99139	Marvel (1);MARVEL-like domain (1);	0.000000	0.85682	D	0.000000	T	0.27098	0.0664	L	0.28054	0.825	0.80722	D	1	D	0.54397	0.966	P	0.56163	0.793	T	0.02713	-1.1120	10	0.17832	T	0.49	-18.3614	16.3636	0.83296	0.0:0.0:0.0:1.0	.	164	Q8IZR5	CKLF4_HUMAN	F	164	ENSP00000333833:Y164F;ENSP00000377666:Y164F	ENSP00000333833:Y164F	Y	-	2	0	CMTM4	65213598	1.000000	0.71417	0.255000	0.24374	0.059000	0.15707	6.592000	0.74095	2.343000	0.79666	0.533000	0.62120	TAT	.	.		0.567	CMTM4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000268807.1		
FHOD1	29109	hgsc.bcm.edu	37	16	67264347	67264347	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:67264347A>G	ENST00000258201.4	-	19	3168	c.2921T>C	c.(2920-2922)aTg>aCg	p.M974T		NM_013241.2	NP_037373.2	Q9Y613	FHOD1_HUMAN	formin homology 2 domain containing 1	974	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			breast(4)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	34		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.000691)|Epithelial(162;0.00462)|all cancers(182;0.0434)		GCAGAACTGCATGATGCGCAC	0.607																																					p.M974T		Atlas-SNP	.											.	FHOD1	86	.	0			c.T2921C						.						95.0	91.0	92.0					16																	67264347		2198	4300	6498	SO:0001583	missense	29109	exon19			AACTGCATGATGC	AF113615	CCDS10834.1	16q22	2008-02-22			ENSG00000135723	ENSG00000135723			17905	protein-coding gene	gene with protein product		606881				10352228, 16112087	Standard	NM_013241		Approved	FHOS	uc002esl.3	Q9Y613	OTTHUMG00000137521	ENST00000258201.4:c.2921T>C	chr16.hg19:g.67264347A>G	ENSP00000258201:p.Met974Thr	86.0	0.0		109.0	29.0	NM_013241	Q59F76|Q6Y1F2|Q76MS8|Q8N521	Missense_Mutation	SNP	ENST00000258201.4	hg19	CCDS10834.1	.	.	.	.	.	.	.	.	.	.	G	0.047	-1.262606	0.01445	.	.	ENSG00000135723	ENST00000258201	T	0.16073	2.37	5.76	1.16	0.20824	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.136267	0.64402	N	0.000003	T	0.07324	0.0185	N	0.03608	-0.345	0.27623	N	0.948275	B	0.15141	0.012	B	0.24701	0.055	T	0.34675	-0.9819	10	0.25751	T	0.34	.	10.054	0.42233	0.6208:0.0:0.3791:0.0	.	974	Q9Y613	FHOD1_HUMAN	T	974	ENSP00000258201:M974T	ENSP00000258201:M974T	M	-	2	0	FHOD1	65821848	0.713000	0.27926	0.997000	0.53966	0.073000	0.16967	1.109000	0.31135	-0.073000	0.12842	-1.163000	0.01768	ATG	.	.		0.607	FHOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268844.2		
PLEKHG4	25894	hgsc.bcm.edu	37	16	67319047	67319047	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:67319047A>T	ENST00000360461.5	+	12	4659	c.2124A>T	c.(2122-2124)ggA>ggT	p.G708G	PLEKHG4_ENST00000450733.1_Silent_p.G627G|PLEKHG4_ENST00000379344.3_Silent_p.G708G|PLEKHG4_ENST00000427155.2_Silent_p.G708G	NM_001129727.1|NM_015432.3	NP_001123199.1|NP_056247.1	Q58EX7	PKHG4_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 4	708							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37				OV - Ovarian serous cystadenocarcinoma(108;0.00376)|Epithelial(162;0.0173)|all cancers(182;0.116)|Kidney(780;0.119)		CAGAGGCTGGAGGAGGTGCCC	0.652																																					p.G708G		Atlas-SNP	.											PLEKHG4,NS,carcinoma,0,1	PLEKHG4	94	.	0			c.A2124T						.						21.0	23.0	22.0					16																	67319047		2191	4279	6470	SO:0001819	synonymous_variant	25894	exon13			GGCTGGAGGAGGT	AK024475	CCDS32466.1, CCDS45512.1	16q22.1	2013-01-11						"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	24501	protein-coding gene	gene with protein product	"""puratrophin-1"""	609526	"""spinocerebellar ataxia 4"""	SCA4		16491300, 16001362	Standard	NM_015432		Approved	DKFZP434I216, ARHGEF44	uc010cef.3	Q58EX7		ENST00000360461.5:c.2124A>T	chr16.hg19:g.67319047A>T		86.0	0.0		55.0	31.0	NM_001129728	Q4G0J8|Q4H485|Q56A69|Q9H7K4|Q9UFW0	Silent	SNP	ENST00000360461.5	hg19	CCDS32466.1																																																																																			.	.		0.652	PLEKHG4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000421395.2	NM_015432	
SLC7A6OS	84138	hgsc.bcm.edu	37	16	68344261	68344261	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr16:68344261C>T	ENST00000263997.6	-	2	466	c.448G>A	c.(448-450)Gcc>Acc	p.A150T	snoU13_ENST00000458872.1_RNA|PRMT7_ENST00000441236.1_5'Flank|PRMT7_ENST00000339507.5_5'Flank|PRMT7_ENST00000449359.3_5'Flank|PRMT7_ENST00000348497.4_5'Flank	NM_032178.2	NP_115554.2	Q96CW6	S7A6O_HUMAN	solute carrier family 7, member 6 opposite strand	150					hematopoietic progenitor cell differentiation (GO:0002244)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(1)	10		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.034)|Epithelial(162;0.106)		GCAGAGGCGGCTTCAGGTTCT	0.612																																					p.A150T		Atlas-SNP	.											.	SLC7A6OS	22	.	0			c.G448A						.						24.0	25.0	25.0					16																	68344261		2198	4300	6498	SO:0001583	missense	84138	exon2			AGGCGGCTTCAGG		CCDS10865.1	16q22.1	2010-03-11			ENSG00000103061	ENSG00000103061			25807	protein-coding gene	gene with protein product							Standard	NM_032178		Approved	FLJ13291	uc002evw.2	Q96CW6	OTTHUMG00000137558	ENST00000263997.6:c.448G>A	chr16.hg19:g.68344261C>T	ENSP00000263997:p.Ala150Thr	145.0	0.0		134.0	33.0	NM_032178	Q8TCZ3|Q9H8R8	Missense_Mutation	SNP	ENST00000263997.6	hg19	CCDS10865.1	.	.	.	.	.	.	.	.	.	.	C	13.94	2.386061	0.42308	.	.	ENSG00000103061	ENST00000263997	T	0.17054	2.3	4.25	2.31	0.28768	.	0.944258	0.09045	N	0.856764	T	0.24314	0.0589	L	0.51422	1.61	0.09310	N	1	D	0.54964	0.969	P	0.55824	0.785	T	0.16100	-1.0414	10	0.13853	T	0.58	-20.3953	6.8433	0.23975	0.0:0.7924:0.0:0.2076	.	150	Q96CW6	S7A6O_HUMAN	T	150	ENSP00000263997:A150T	ENSP00000263997:A150T	A	-	1	0	SLC7A6OS	66901762	0.010000	0.17322	0.017000	0.16124	0.159000	0.22180	0.505000	0.22642	0.755000	0.32990	-0.261000	0.10672	GCC	.	.		0.612	SLC7A6OS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268894.3	NM_032178	
OR1A2	26189	hgsc.bcm.edu	37	17	3101071	3101071	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:3101071T>A	ENST00000381951.1	+	1	259	c.259T>A	c.(259-261)Ttg>Atg	p.L87M		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	87					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						CAACCATCTCTTGGGGAGCAA	0.493																																					p.L87M		Atlas-SNP	.											.	OR1A2	52	.	0			c.T259A						.						171.0	146.0	154.0					17																	3101071		2203	4300	6503	SO:0001583	missense	26189	exon1			CATCTCTTGGGGA	AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.259T>A	chr17.hg19:g.3101071T>A	ENSP00000371377:p.Leu87Met	149.0	0.0		85.0	30.0	NM_012352	Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	ENST00000381951.1	hg19	CCDS11021.1	.	.	.	.	.	.	.	.	.	.	T	4.222	0.040113	0.08148	.	.	ENSG00000172150	ENST00000381951	D	0.82081	-1.57	3.86	-1.45	0.08828	GPCR, rhodopsin-like superfamily (1);	0.391535	0.18836	N	0.129817	T	0.68677	0.3027	L	0.31845	0.965	0.09310	N	1	B	0.26602	0.154	B	0.29077	0.098	T	0.58239	-0.7671	10	0.54805	T	0.06	.	3.279	0.06908	0.29:0.192:0.0:0.518	.	87	Q9Y585	OR1A2_HUMAN	M	87	ENSP00000371377:L87M	ENSP00000371377:L87M	L	+	1	2	OR1A2	3047821	0.000000	0.05858	0.022000	0.16811	0.120000	0.20174	-4.041000	0.00307	-0.073000	0.12842	0.491000	0.48974	TTG	.	.		0.493	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207293.1	NM_012352	
ZNF594	84622	hgsc.bcm.edu	37	17	5086891	5086891	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:5086891T>A	ENST00000399604.4	-	1	801	c.661A>T	c.(661-663)Aag>Tag	p.K221*	ZNF594_ENST00000575779.1_Nonsense_Mutation_p.K221*			Q96JF6	ZN594_HUMAN	zinc finger protein 594	221					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						GAGCTTCCCTTAAAAGCCTTC	0.448																																					p.K221X		Atlas-SNP	.											.	ZNF594	89	.	0			c.A661T						.						109.0	111.0	110.0					17																	5086891		2038	4204	6242	SO:0001587	stop_gained	84622	exon2			TTCCCTTAAAAGC	AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.661A>T	chr17.hg19:g.5086891T>A	ENSP00000382513:p.Lys221*	97.0	0.0		77.0	20.0	NM_032530	Q6RFS0	Nonsense_Mutation	SNP	ENST00000399604.4	hg19	CCDS42241.1	.	.	.	.	.	.	.	.	.	.	T	13.05	2.121990	0.37436	.	.	ENSG00000180626	ENST00000399604	.	.	.	2.63	2.63	0.31362	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	5.0116	0.14315	0.2674:0.0:0.0:0.7326	.	.	.	.	X	221	.	ENSP00000382513:K221X	K	-	1	0	ZNF594	5027615	0.000000	0.05858	0.957000	0.39632	0.075000	0.17131	-0.169000	0.09911	1.217000	0.43442	0.460000	0.39030	AAG	.	.		0.448	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438996.1	XM_290737	
PITPNM3	83394	hgsc.bcm.edu	37	17	6373607	6373607	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:6373607T>A	ENST00000262483.8	-	13	1833	c.1746A>T	c.(1744-1746)acA>acT	p.T582T	PITPNM3_ENST00000421306.3_Silent_p.T546T|PITPNM3_ENST00000576664.1_5'UTR	NM_031220.3	NP_112497.2	Q9BZ71	PITM3_HUMAN	PITPNM family member 3	582	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				phosphatidylinositol metabolic process (GO:0046488)|phospholipid transport (GO:0015914)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)|phosphatidylinositol transporter activity (GO:0008526)|receptor tyrosine kinase binding (GO:0030971)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(9)|lung(10)|ovary(3)|prostate(3)|skin(2)	36				Colorectal(2;0.000372)|READ - Rectum adenocarcinoma(2;0.0276)|LUAD - Lung adenocarcinoma(2;0.0836)|COAD - Colon adenocarcinoma(228;0.185)		CCACCACGTCTGTGGACTCCC	0.652																																					p.T582T		Atlas-SNP	.											.	PITPNM3	91	.	0			c.A1746T						.						92.0	65.0	74.0					17																	6373607		2203	4300	6503	SO:0001819	synonymous_variant	83394	exon13			CACGTCTGTGGAC	AF334586	CCDS11076.1, CCDS54080.1	17p13	2013-07-18	2013-07-18	2013-07-18	ENSG00000091622	ENSG00000091622		"""GPCR / Class A : Chemokine receptors : Atypical"""	21043	protein-coding gene	gene with protein product	"""atypical chemokine receptor 6"""	608921	"""cone rod dystrophy 5"""	CORD5		10022914	Standard	NM_031220		Approved	NIR1, RDGBA3, ACKR6	uc002gdd.4	Q9BZ71	OTTHUMG00000102039	ENST00000262483.8:c.1746A>T	chr17.hg19:g.6373607T>A		54.0	0.0		43.0	13.0	NM_031220	A1A5D0|F8WEW5|Q59GH9|Q9NPQ4	Silent	SNP	ENST00000262483.8	hg19	CCDS11076.1																																																																																			.	.		0.652	PITPNM3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000219824.2	NM_031220	
TXNDC17	84817	hgsc.bcm.edu	37	17	6546320	6546320	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:6546320T>G	ENST00000250101.5	+	4	678	c.353T>G	c.(352-354)aTg>aGg	p.M118R	TXNDC17_ENST00000570330.1_Missense_Mutation_p.M93R|TXNDC17_ENST00000577146.1_3'UTR|TXNDC17_ENST00000574838.1_3'UTR|KIAA0753_ENST00000572370.1_5'Flank|KIAA0753_ENST00000361413.3_5'Flank	NM_032731.3	NP_116120.1	Q9BRA2	TXD17_HUMAN	thioredoxin domain containing 17	118	Thioredoxin.				oxidation-reduction process (GO:0055114)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	electron carrier activity (GO:0009055)|peroxidase activity (GO:0004601)|protein-disulfide reductase activity (GO:0047134)			endometrium(1)|kidney(1)|ovary(1)	3						CTGGTGGAAATGTTGTTCTCT	0.348																																					p.M118R		Atlas-SNP	.											.	TXNDC17	10	.	0			c.T353G						.						152.0	134.0	140.0					17																	6546320		2203	4300	6503	SO:0001583	missense	84817	exon4			TGGAAATGTTGTT	BC006405	CCDS11077.1	17p13.2	2007-08-16	2007-08-16	2007-08-16	ENSG00000129235	ENSG00000129235			28218	protein-coding gene	gene with protein product	"""thioredoxin (Trx)-related protein, 14 kDa"""		"""thioredoxin-like 5"""	TXNL5		14607844, 14607843	Standard	NM_032731		Approved	MGC14353, TRP14	uc002gdf.4	Q9BRA2	OTTHUMG00000102053	ENST00000250101.5:c.353T>G	chr17.hg19:g.6546320T>G	ENSP00000250101:p.Met118Arg	95.0	0.0		81.0	9.0	NM_032731	A8K7E8	Missense_Mutation	SNP	ENST00000250101.5	hg19	CCDS11077.1	.	.	.	.	.	.	.	.	.	.	T	17.88	3.498223	0.64186	.	.	ENSG00000129235	ENST00000250101	.	.	.	5.85	5.85	0.93711	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	T	0.72078	0.3416	M	0.80982	2.52	0.80722	D	1	P	0.52316	0.952	P	0.54590	0.756	T	0.70132	-0.4956	9	0.13853	T	0.58	-27.5886	12.9295	0.58278	0.0:0.0:0.0:1.0	.	118	Q9BRA2	TXD17_HUMAN	R	118	.	ENSP00000250101:M118R	M	+	2	0	TXNDC17	6487044	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.756000	0.74919	2.371000	0.80710	0.533000	0.62120	ATG	.	.		0.348	TXNDC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219854.2	NM_032731	
TEKT1	83659	hgsc.bcm.edu	37	17	6718508	6718508	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:6718508A>T	ENST00000338694.2	-	5	732	c.603T>A	c.(601-603)tcT>tcA	p.S201S	TEKT1_ENST00000535086.1_Silent_p.S55S	NM_053285.1	NP_444515.1	Q969V4	TEKT1_HUMAN	tektin 1	201						cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)				NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20		Myeloproliferative disorder(207;0.0255)				CGGCGTTCTCAGAATATCTGA	0.502																																					p.S201S		Atlas-SNP	.											.	TEKT1	49	.	0			c.T603A						.						206.0	185.0	193.0					17																	6718508		2203	4300	6503	SO:0001819	synonymous_variant	83659	exon5			GTTCTCAGAATAT		CCDS11083.1	17p13.2	2011-05-23			ENSG00000167858	ENSG00000167858			15534	protein-coding gene	gene with protein product		609002				11606253	Standard	NM_053285		Approved		uc002gdt.3	Q969V4	OTTHUMG00000102063	ENST00000338694.2:c.603T>A	chr17.hg19:g.6718508A>T		127.0	0.0		97.0	29.0	NM_053285	D3DTM7	Silent	SNP	ENST00000338694.2	hg19	CCDS11083.1																																																																																			.	.		0.502	TEKT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219867.2	NM_053285	
NEURL4	84461	hgsc.bcm.edu	37	17	7227004	7227004	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:7227004T>A	ENST00000399464.2	-	13	2315	c.2300A>T	c.(2299-2301)cAg>cTg	p.Q767L	NEURL4_ENST00000315614.7_Missense_Mutation_p.Q767L|NEURL4_ENST00000570460.1_Missense_Mutation_p.Q745L	NM_032442.2	NP_115818.2	Q96JN8	NEUL4_HUMAN	neuralized E3 ubiquitin protein ligase 4	767	NHR 4. {ECO:0000255|PROSITE- ProRule:PRU00400}.					cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						CACCATCTTCTGAATGACAAT	0.592																																					p.Q767L		Atlas-SNP	.											.	NEURL4	192	.	0			c.A2300T						.						53.0	60.0	58.0					17																	7227004		2070	4192	6262	SO:0001583	missense	84461	exon13			ATCTTCTGAATGA		CCDS42251.1, CCDS42252.1	17p13	2013-10-24	2013-10-24		ENSG00000215041	ENSG00000215041			34410	protein-coding gene	gene with protein product		615865	"""neuralized homolog 4 (Drosophila)"""			22261722, 22441691	Standard	NM_001005408		Approved	KIAA1787	uc002gga.1	Q96JN8	OTTHUMG00000132319	ENST00000399464.2:c.2300A>T	chr17.hg19:g.7227004T>A	ENSP00000382390:p.Gln767Leu	96.0	0.0		84.0	20.0	NM_001005408	Q6GPI8|Q96IU9|Q9H0B0	Missense_Mutation	SNP	ENST00000399464.2	hg19	CCDS42251.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.107027	0.77096	.	.	ENSG00000215041	ENST00000315614;ENST00000399464	T;T	0.72615	1.49;-0.67	5.8	5.8	0.92144	NEUZ (3);	0.000000	0.85682	D	0.000000	T	0.61223	0.2330	N	0.01705	-0.755	0.50467	D	0.999872	D;D	0.69078	0.997;0.993	P;P	0.59221	0.854;0.824	T	0.72750	-0.4199	10	0.46703	T	0.11	-17.5541	15.1328	0.72539	0.0:0.0:0.0:1.0	.	767;767	Q96JN8-2;Q96JN8	.;NEUL4_HUMAN	L	767	ENSP00000319826:Q767L;ENSP00000382390:Q767L	ENSP00000319826:Q767L	Q	-	2	0	NEURL4	7167728	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.614000	0.67695	2.224000	0.72417	0.533000	0.62120	CAG	.	.		0.592	NEURL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255434.2	NM_032442	
GUCY2D	3000	hgsc.bcm.edu	37	17	7912843	7912843	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:7912843A>T	ENST00000254854.4	+	8	1838	c.1688A>T	c.(1687-1689)aAg>aTg	p.K563M		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	563	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				GTTTGGCTGAAGAAATTCCCA	0.572																																					p.K563M		Atlas-SNP	.											.	GUCY2D	82	.	0			c.A1688T						.						130.0	126.0	127.0					17																	7912843		2203	4300	6503	SO:0001583	missense	3000	exon8			GGCTGAAGAAATT	L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1688A>T	chr17.hg19:g.7912843A>T	ENSP00000254854:p.Lys563Met	125.0	0.0		86.0	26.0	NM_000180	Q6LEA7	Missense_Mutation	SNP	ENST00000254854.4	hg19	CCDS11127.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.172466	0.78452	.	.	ENSG00000132518	ENST00000254854	D	0.86432	-2.12	4.67	4.67	0.58626	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.53938	D	0.000057	D	0.95162	0.8432	H	0.96518	3.835	0.44825	D	0.997833	D	0.89917	1.0	D	0.97110	1.0	D	0.95977	0.8974	10	0.72032	D	0.01	.	12.0094	0.53278	1.0:0.0:0.0:0.0	.	563	Q02846	GUC2D_HUMAN	M	563	ENSP00000254854:K563M	ENSP00000254854:K563M	K	+	2	0	GUCY2D	7853568	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.402000	0.90205	2.094000	0.63399	0.459000	0.35465	AAG	.	.		0.572	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226973.2		
MYH4	4622	hgsc.bcm.edu	37	17	10357033	10357033	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:10357033A>T	ENST00000255381.2	-	23	2971	c.2861T>A	c.(2860-2862)cTc>cAc	p.L954H	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	954					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GTCTTTCTTGAGCTCTGAACA	0.433																																					p.L954H		Atlas-SNP	.											.	MYH4	349	.	0			c.T2861A						.						351.0	323.0	333.0					17																	10357033		2203	4300	6503	SO:0001583	missense	4622	exon23			TTCTTGAGCTCTG		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2861T>A	chr17.hg19:g.10357033A>T	ENSP00000255381:p.Leu954His	146.0	0.0		141.0	30.0	NM_017533		Missense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	A	21.1	4.101679	0.76983	.	.	ENSG00000141048	ENST00000255381	D	0.95412	-3.7	5.57	5.57	0.84162	.	0.000000	0.32314	U	0.006268	D	0.98735	0.9575	H	0.98525	4.255	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.99701	1.1004	10	0.87932	D	0	.	16.0284	0.80558	1.0:0.0:0.0:0.0	.	954	Q9Y623	MYH4_HUMAN	H	954	ENSP00000255381:L954H	ENSP00000255381:L954H	L	-	2	0	MYH4	10297758	1.000000	0.71417	0.921000	0.36526	0.989000	0.77384	9.182000	0.94881	2.253000	0.74438	0.533000	0.62120	CTC	.	.		0.433	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MYH4	4622	hgsc.bcm.edu	37	17	10357189	10357189	+	Nonsense_Mutation	SNP	A	A	T	rs138202203		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:10357189A>T	ENST00000255381.2	-	23	2815	c.2705T>A	c.(2704-2706)tTg>tAg	p.L902*	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	902					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						TGCATCAGCCAAGGCATCTGC	0.373																																					p.L902X		Atlas-SNP	.											.	MYH4	349	.	0			c.T2705A						.						206.0	197.0	200.0					17																	10357189		2203	4300	6503	SO:0001587	stop_gained	4622	exon23			TCAGCCAAGGCAT		CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.2705T>A	chr17.hg19:g.10357189A>T	ENSP00000255381:p.Leu902*	126.0	0.0		92.0	22.0	NM_017533		Nonsense_Mutation	SNP	ENST00000255381.2	hg19	CCDS11154.1	.	.	.	.	.	.	.	.	.	.	A	38	6.655714	0.97739	.	.	ENSG00000141048	ENST00000255381	.	.	.	5.43	5.43	0.79202	.	0.000000	0.30620	U	0.009232	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7669	0.78135	1.0:0.0:0.0:0.0	.	.	.	.	X	902	.	ENSP00000255381:L902X	L	-	2	0	MYH4	10297914	1.000000	0.71417	0.998000	0.56505	0.378000	0.30076	9.150000	0.94667	2.180000	0.69256	0.533000	0.62120	TTG	.	A|1.000;G|0.000		0.373	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252731.1	NM_017533	
MYH1	4619	hgsc.bcm.edu	37	17	10409339	10409339	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:10409339A>T	ENST00000226207.5	-	18	2140	c.2046T>A	c.(2044-2046)acT>acA	p.T682T	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	682	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CAGGAGTTTTAGTTTCATTGG	0.448																																					p.T682T		Atlas-SNP	.											.	MYH1	403	.	0			c.T2046A						.						134.0	135.0	135.0					17																	10409339		2203	4297	6500	SO:0001819	synonymous_variant	4619	exon18			AGTTTTAGTTTCA		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2046T>A	chr17.hg19:g.10409339A>T		204.0	0.0		208.0	49.0	NM_005963	Q14CA4|Q9Y622	Silent	SNP	ENST00000226207.5	hg19	CCDS11155.1																																																																																			.	.		0.448	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
BLMH	642	hgsc.bcm.edu	37	17	28616480	28616480	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:28616480A>T	ENST00000261714.6	-	3	406	c.232T>A	c.(232-234)Tgt>Agt	p.C78S	RNU6-1267P_ENST00000410747.1_RNA|BLMH_ENST00000394819.3_Intron	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase	78					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	ACATTCAGACAAGAAAAGATC	0.388																																					p.C78S	Pancreas(127;628 1772 12912 33293 36203)	Atlas-SNP	.											.	BLMH	42	.	0			c.T232A						.						58.0	56.0	56.0					17																	28616480		2203	4300	6503	SO:0001583	missense	642	exon3			TCAGACAAGAAAA	X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.232T>A	chr17.hg19:g.28616480A>T	ENSP00000261714:p.Cys78Ser	193.0	0.0		181.0	60.0	NM_000386	B2R796|Q53F86|Q9UER9	Missense_Mutation	SNP	ENST00000261714.6	hg19	CCDS32604.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163106	0.78226	.	.	ENSG00000108578	ENST00000261714	T	0.40476	1.03	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.44159	0.1280	N	0.12637	0.245	0.80722	D	1	D	0.54397	0.966	D	0.70016	0.967	T	0.36939	-0.9727	10	0.18710	T	0.47	-11.3298	14.897	0.70651	1.0:0.0:0.0:0.0	.	78	Q13867	BLMH_HUMAN	S	78	ENSP00000261714:C78S	ENSP00000261714:C78S	C	-	1	0	BLMH	25640606	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.432000	0.90288	2.100000	0.63781	0.528000	0.53228	TGT	.	.		0.388	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447940.1	NM_000386	
SLFN12	55106	hgsc.bcm.edu	37	17	33738498	33738498	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:33738498T>A	ENST00000394562.1	-	6	2119	c.1596A>T	c.(1594-1596)aaA>aaT	p.K532N	RP11-686D22.8_ENST00000587012.1_RNA|SLFN12_ENST00000460530.1_5'UTR|SLFN12_ENST00000452764.3_Missense_Mutation_p.K532N|SLFN12_ENST00000304905.5_Missense_Mutation_p.K532N			Q8IYM2	SLN12_HUMAN	schlafen family member 12	532							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		TAAAAAGGGCTTTCAGCAAGT	0.388																																					p.K532N		Atlas-SNP	.											.	SLFN12	56	.	0			c.A1596T						.						58.0	59.0	59.0					17																	33738498		2203	4299	6502	SO:0001583	missense	55106	exon4			AAGGGCTTTCAGC	AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.1596A>T	chr17.hg19:g.33738498T>A	ENSP00000378063:p.Lys532Asn	134.0	0.0		162.0	30.0	NM_018042	A8K711|Q9NP47	Missense_Mutation	SNP	ENST00000394562.1	hg19	CCDS11295.1	.	.	.	.	.	.	.	.	.	.	T	10.77	1.442890	0.25987	.	.	ENSG00000172123	ENST00000394562;ENST00000304905;ENST00000452764	T;T;T	0.03982	3.74;3.74;3.74	2.74	-2.12	0.07165	.	.	.	.	.	T	0.06371	0.0164	L	0.36672	1.1	0.09310	N	1	P	0.52061	0.95	P	0.50314	0.637	T	0.32079	-0.9920	9	0.72032	D	0.01	.	6.3654	0.21451	0.0:0.3992:0.0:0.6008	.	532	Q8IYM2	SLN12_HUMAN	N	532	ENSP00000378063:K532N;ENSP00000302077:K532N;ENSP00000394903:K532N	ENSP00000302077:K532N	K	-	3	2	SLFN12	30762611	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.536000	0.00940	-0.276000	0.09206	-0.437000	0.05841	AAA	.	.		0.388	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256491.1	NM_018042	
MYO19	80179	hgsc.bcm.edu	37	17	34859822	34859822	+	Silent	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:34859822G>T	ENST00000431794.3	-	20	2466	c.1944C>A	c.(1942-1944)acC>acA	p.T648T	MYO19_ENST00000268852.9_Silent_p.T448T	NM_001163735.1	NP_001157207.1	Q96H55	MYO19_HUMAN	myosin XIX	648	Myosin motor.					cytoplasm (GO:0005737)|mitochondrial outer membrane (GO:0005741)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|urinary_tract(1)	20		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TGATATGGATGGTCTCCACGA	0.637																																					p.T648T		Atlas-SNP	.											.	MYO19	130	.	0			c.C1944A						.						20.0	23.0	22.0					17																	34859822		2065	4202	6267	SO:0001819	synonymous_variant	80179	exon21			ATGGATGGTCTCC	BC008900	CCDS45654.1, CCDS54112.1, CCDS59283.1	17q12	2014-08-12	2007-09-26	2007-09-26	ENSG00000278259	ENSG00000278259		"""Myosins / Myosin superfamily : Class XIX"""	26234	protein-coding gene	gene with protein product			"""myosin head domain containing 1"""	MYOHD1		17877792, 19932026	Standard	NM_001033580		Approved	FLJ22865	uc010wcy.2	Q96H55	OTTHUMG00000188437	ENST00000431794.3:c.1944C>A	chr17.hg19:g.34859822G>T		32.0	0.0		29.0	10.0	NM_001163735	Q59GS4|Q9H5X2	Silent	SNP	ENST00000431794.3	hg19	CCDS54112.1																																																																																			.	.		0.637	MYO19-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451074.1	NM_025109	
ARL5C	390790	hgsc.bcm.edu	37	17	37313165	37313165	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:37313165A>T	ENST00000269586.7	-	6	521	c.522T>A	c.(520-522)tcT>tcA	p.S174S	ARL5C_ENST00000444555.1_Silent_p.S174S	NM_001143968.1	NP_001137440.1	A6NH57	ARL5C_HUMAN	ADP-ribosylation factor-like 5C	174					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)										CAGCGGCCTGAGATTCCATCC	0.507																																					p.S174S		Atlas-SNP	.											.	ARL5C	3	.	0			c.T522A						.						61.0	58.0	59.0					17																	37313165		692	1591	2283	SO:0001819	synonymous_variant	390790	exon6			GGCCTGAGATTCC		CCDS45664.1	17q12	2014-05-09	2005-11-08	2005-11-08	ENSG00000141748	ENSG00000141748		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31111	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 12"""	ARL12			Standard	NM_001143968		Approved		uc010wea.2	A6NH57		ENST00000269586.7:c.522T>A	chr17.hg19:g.37313165A>T		91.0	0.0		122.0	24.0	NM_001143968		Silent	SNP	ENST00000269586.7	hg19	CCDS45664.1																																																																																			.	.		0.507	ARL5C-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000444566.1	NM_001143968	
KRTAP9-3	83900	hgsc.bcm.edu	37	17	39388765	39388765	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:39388765T>A	ENST00000411528.2	+	1	51	c.12T>A	c.(10-12)tgT>tgA	p.C4*		NM_031962.2	NP_114168.1	Q9BYQ3	KRA93_HUMAN	keratin associated protein 9-3	4						keratin filament (GO:0045095)				breast(1)|endometrium(3)|lung(2)|ovary(1)|prostate(1)	8		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			TGACCCACTGTTGCTCCCCTT	0.572																																					p.C4X		Atlas-SNP	.											.	KRTAP9-3	11	.	0			c.T12A						.						124.0	141.0	135.0					17																	39388765		2105	4300	6405	SO:0001587	stop_gained	83900	exon1			CCACTGTTGCTCC	AJ406947	CCDS11385.1	17q21.2	2013-06-25			ENSG00000204873	ENSG00000204873		"""Keratin associated proteins"""	16927	protein-coding gene	gene with protein product						11279113	Standard	NM_031962		Approved	KAP9.3	uc021txg.1	Q9BYQ3	OTTHUMG00000133427	ENST00000411528.2:c.12T>A	chr17.hg19:g.39388765T>A	ENSP00000392189:p.Cys4*	191.0	0.0		248.0	35.0	NM_031962		Nonsense_Mutation	SNP	ENST00000411528.2	hg19	CCDS11385.1	.	.	.	.	.	.	.	.	.	.	.	19.22	3.786166	0.70337	.	.	ENSG00000204873	ENST00000411528	.	.	.	2.93	0.784	0.18578	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.9316	0.24444	0.0:0.736:0.0:0.264	.	.	.	.	X	4	.	ENSP00000392189:C4X	C	+	3	2	KRTAP9-3	36642291	0.902000	0.30710	0.962000	0.40283	0.292000	0.27327	0.505000	0.22642	0.089000	0.17243	-0.548000	0.04221	TGT	.	.		0.572	KRTAP9-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257290.1		
KRT35	3886	hgsc.bcm.edu	37	17	39635249	39635249	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:39635249T>A	ENST00000393989.1	-	4	754		c.e4-2		KRT35_ENST00000246639.2_Splice_Site	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35						anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				GTTCACTTCCTATAGCACAGA	0.562																																					.		Atlas-SNP	.											.	KRT35	58	.	0			c.712-2A>T						.						48.0	52.0	50.0					17																	39635249		2200	4300	6500	SO:0001630	splice_region_variant	3886	exon5			ACTTCCTATAGCA	X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.712-2A>T	chr17.hg19:g.39635249T>A		73.0	0.0		81.0	7.0	NM_002280	O76012|Q92651	Splice_Site	SNP	ENST00000393989.1	hg19	CCDS11394.2	.	.	.	.	.	.	.	.	.	.	T	17.92	3.507391	0.64410	.	.	ENSG00000197079	ENST00000246639;ENST00000393989	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.7876	0.63119	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	KRT35	36888775	1.000000	0.71417	0.918000	0.36340	0.708000	0.40852	7.360000	0.79487	2.095000	0.63458	0.533000	0.62120	.	.	.		0.562	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_002280	Intron
CRHR1	1394	hgsc.bcm.edu	37	17	43893924	43893924	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:43893924T>A	ENST00000398285.3	+	3	217	c.217T>A	c.(217-219)Tat>Aat	p.Y73N	RP11-105N13.4_ENST00000587305.1_RNA|CRHR1_ENST00000293493.7_De_novo_Start_OutOfFrame|CRHR1_ENST00000577353.1_Missense_Mutation_p.Y73N|CRHR1_ENST00000352855.5_Intron|CRHR1_ENST00000339069.5_De_novo_Start_InFrame|CRHR1_ENST00000314537.5_Missense_Mutation_p.Y73N	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	73					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TGCCTTTTTCTATGGTGTCCG	0.617																																					p.Y73N	Ovarian(110;57 1568 10207 38216 49865)	Atlas-SNP	.											.	CRHR1	48	.	0			c.T217A						.						48.0	50.0	49.0					17																	43893924		1952	4132	6084	SO:0001583	missense	1394	exon3			TTTTTCTATGGTG	L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.217T>A	chr17.hg19:g.43893924T>A	ENSP00000381333:p.Tyr73Asn	54.0	0.0		77.0	19.0	NM_001145148	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	ENST00000398285.3	hg19	CCDS45712.1	.	.	.	.	.	.	.	.	.	.	T	11.31	1.601725	0.28534	.	.	ENSG00000120088	ENST00000398285;ENST00000314537;ENST00000347197	T;T;T	0.52754	0.65;0.65;0.65	5.04	5.04	0.67666	GPCR, family 2, extracellular hormone receptor domain (3);	0.282495	0.35646	N	0.003074	T	0.21062	0.0507	N	0.01576	-0.805	0.80722	D	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.09377	0.001;0.004;0.001	T	0.08166	-1.0735	10	0.35671	T	0.21	.	11.109	0.48221	0.0:0.0:0.0:1.0	.	73;73;73	P34998-4;P34998;P34998-2	.;CRFR1_HUMAN;.	N	73	ENSP00000381333:Y73N;ENSP00000326060:Y73N;ENSP00000239167:Y73N	ENSP00000326060:Y73N	Y	+	1	0	CRHR1	41249705	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	2.026000	0.41069	2.126000	0.65437	0.533000	0.62120	TAT	.	.		0.617	CRHR1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000441241.3		
OSBPL7	114881	hgsc.bcm.edu	37	17	45888020	45888020	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:45888020T>A	ENST00000007414.3	-	18	2011	c.1820A>T	c.(1819-1821)aAg>aTg	p.K607M	OSBPL7_ENST00000392507.3_Missense_Mutation_p.K607M	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	607					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)			autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						GCCCCAGAACTTGTTCTTCCA	0.562																																					p.K607M		Atlas-SNP	.											.	OSBPL7	65	.	0			c.A1820T						.						64.0	59.0	61.0					17																	45888020		2203	4300	6503	SO:0001583	missense	114881	exon18			CAGAACTTGTTCT	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.1820A>T	chr17.hg19:g.45888020T>A	ENSP00000007414:p.Lys607Met	110.0	0.0		125.0	28.0	NM_145798	D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	hg19	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	T	22.6	4.317630	0.81469	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.38887	1.11;1.11	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.74458	0.3719	H	0.96748	3.875	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	T	0.82892	-0.0232	10	0.87932	D	0	-29.8689	12.4486	0.55666	0.0:0.0:0.0:1.0	.	607	Q9BZF2	OSBL7_HUMAN	M	607	ENSP00000007414:K607M;ENSP00000376295:K607M	ENSP00000007414:K607M	K	-	2	0	OSBPL7	43243019	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.944000	0.87722	1.588000	0.49971	0.402000	0.26972	AAG	.	.		0.562	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
HOXB8	3218	hgsc.bcm.edu	37	17	46691811	46691811	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:46691811A>T	ENST00000239144.4	-	1	490	c.256T>A	c.(256-258)Tac>Aac	p.Y86N	HOXB7_ENST00000567101.2_Intron|HOXB8_ENST00000576562.1_Missense_Mutation_p.Y86N	NM_024016.3	NP_076921.1	P17481	HXB8_HUMAN	homeobox B8	86					adult locomotory behavior (GO:0008344)|anterior/posterior pattern specification (GO:0009952)|dorsal spinal cord development (GO:0021516)|embryonic skeletal system morphogenesis (GO:0048704)|grooming behavior (GO:0007625)|negative regulation of myeloid cell differentiation (GO:0045638)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(8)|urinary_tract(2)	11						TCGTAGCCGTAGAAATTGCCG	0.667																																					p.Y86N		Atlas-SNP	.											.	HOXB8	26	.	0			c.T256A						.						49.0	49.0	49.0					17																	46691811		2203	4298	6501	SO:0001583	missense	3218	exon1			AGCCGTAGAAATT		CCDS11533.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120068	ENSG00000120068		"""Homeoboxes / ANTP class : HOXL subclass"""	5119	protein-coding gene	gene with protein product		142963	"""homeo box B8"""	HOX2, HOX2D		1973146, 1358459	Standard	XM_005257286		Approved		uc002inw.3	P17481	OTTHUMG00000159904	ENST00000239144.4:c.256T>A	chr17.hg19:g.46691811A>T	ENSP00000239144:p.Tyr86Asn	106.0	0.0		113.0	24.0	NM_024016	Q9H1I2	Missense_Mutation	SNP	ENST00000239144.4	hg19	CCDS11533.1	.	.	.	.	.	.	.	.	.	.	a	16.03	3.007494	0.54361	.	.	ENSG00000120068	ENST00000239144	T	0.44482	0.92	2.97	1.87	0.25490	.	0.000000	0.53938	U	0.000052	T	0.62816	0.2459	M	0.86740	2.835	0.53005	D	0.999963	D	0.71674	0.998	D	0.75484	0.986	T	0.61422	-0.7066	10	0.49607	T	0.09	.	7.8125	0.29239	0.895:0.0:0.105:0.0	.	86	P17481	HXB8_HUMAN	N	86	ENSP00000239144:Y86N	ENSP00000239144:Y86N	Y	-	1	0	HOXB8	44046810	1.000000	0.71417	0.997000	0.53966	0.979000	0.70002	6.872000	0.75536	0.377000	0.24735	0.241000	0.17934	TAC	.	.		0.667	HOXB8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358092.3		
WFIKKN2	124857	hgsc.bcm.edu	37	17	48917022	48917022	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:48917022A>T	ENST00000311378.4	+	2	901	c.373A>T	c.(373-375)Atc>Ttc	p.I125F	WFIKKN2_ENST00000426127.1_Missense_Mutation_p.I32F|RP11-506D12.5_ENST00000572491.2_RNA	NM_175575.5	NP_783165.1	Q8TEU8	WFKN2_HUMAN	WAP, follistatin/kazal, immunoglobulin, kunitz and netrin domain containing 2	125					muscle fiber development (GO:0048747)|negative regulation of DNA binding (GO:0043392)|negative regulation of protein binding (GO:0032091)|palate development (GO:0060021)|skeletal system development (GO:0001501)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular region (GO:0005576)	metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(13)|ovary(4)|skin(1)	29			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			TGAGTGTGACATCTGGGATGG	0.587																																					p.I125F		Atlas-SNP	.											.	WFIKKN2	69	.	0			c.A373T						.						85.0	78.0	80.0					17																	48917022		2203	4300	6503	SO:0001583	missense	124857	exon2			TGTGACATCTGGG	AY358142	CCDS11575.1	17q21.33	2013-01-21			ENSG00000173714	ENSG00000173714		"""Immunoglobulin superfamily / I-set domain containing"", ""WAP four-disulfide core domain containing"""	30916	protein-coding gene	gene with protein product	"""WAP four-disulfide core domain 20B"""	610895				11928817, 12709070	Standard	NM_175575		Approved	WFIKKNRP, WFDC20B	uc002isv.4	Q8TEU8	OTTHUMG00000162274	ENST00000311378.4:c.373A>T	chr17.hg19:g.48917022A>T	ENSP00000311184:p.Ile125Phe	179.0	0.0		144.0	44.0	NM_175575	Q6UXZ9	Missense_Mutation	SNP	ENST00000311378.4	hg19	CCDS11575.1	.	.	.	.	.	.	.	.	.	.	A	17.81	3.481595	0.63849	.	.	ENSG00000173714	ENST00000426127;ENST00000311378;ENST00000393226	D;D	0.82433	-1.55;-1.61	5.24	4.15	0.48705	.	0.058387	0.64402	D	0.000001	D	0.88051	0.6333	M	0.66939	2.045	0.58432	D	0.999998	D	0.69078	0.997	D	0.63488	0.915	D	0.87880	0.2677	10	0.87932	D	0	.	10.8307	0.46659	0.9253:0.0:0.0747:0.0	.	125	Q8TEU8	WFKN2_HUMAN	F	32;125;32	ENSP00000405889:I32F;ENSP00000311184:I125F	ENSP00000311184:I125F	I	+	1	0	WFIKKN2	46272021	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.313000	0.65798	0.825000	0.34637	0.524000	0.50904	ATC	.	.		0.587	WFIKKN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368358.1	NM_175575	
TRIM25	7706	hgsc.bcm.edu	37	17	54981763	54981763	+	Silent	SNP	T	T	A	rs200224902		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:54981763T>A	ENST00000316881.4	-	3	829	c.780A>T	c.(778-780)acA>acT	p.T260T	TRIM25_ENST00000537230.1_Silent_p.T260T	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	260	Interaction with influenza A virus NS1.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					TTATCTTCCTTGTCGAGGTGG	0.478																																					p.T260T		Atlas-SNP	.											.	TRIM25	52	.	0			c.A780T						.						215.0	195.0	202.0					17																	54981763		2203	4300	6503	SO:0001819	synonymous_variant	7706	exon3			CTTCCTTGTCGAG	D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.780A>T	chr17.hg19:g.54981763T>A		101.0	0.0		125.0	32.0	NM_005082		Silent	SNP	ENST00000316881.4	hg19	CCDS11591.1																																																																																			.	T|1.000;C|0.000		0.478	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440609.1	NM_005082	
CEP112	201134	hgsc.bcm.edu	37	17	64059102	64059102	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:64059102T>A	ENST00000392769.2	-	11	1271	c.1053A>T	c.(1051-1053)ctA>ctT	p.L351L	CEP112_ENST00000541355.1_5'UTR|CEP112_ENST00000537949.1_Silent_p.L309L|CEP112_ENST00000535342.2_Silent_p.L351L	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	351					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						AGTCATTATTTAGAGATTCCG	0.313																																					p.L351L		Atlas-SNP	.											.	CEP112	192	.	0			c.A1053T						.						124.0	115.0	118.0					17																	64059102		2201	4297	6498	SO:0001819	synonymous_variant	201134	exon11			ATTATTTAGAGAT	AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.1053A>T	chr17.hg19:g.64059102T>A		67.0	0.0		68.0	6.0	NM_001199165	Q6PIB5|Q8NCR4|Q8NFR4	Silent	SNP	ENST00000392769.2	hg19	CCDS32710.1																																																																																			.	.		0.313	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000446582.1	NM_145036	
TNRC6C	57690	hgsc.bcm.edu	37	17	76047470	76047470	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:76047470A>T	ENST00000588061.1	+	5	3054	c.2327A>T	c.(2326-2328)gAg>gTg	p.E776V	TNRC6C_ENST00000335749.4_Missense_Mutation_p.E776V|TNRC6C_ENST00000544502.1_Missense_Mutation_p.E776V|TNRC6C_ENST00000588847.1_Missense_Mutation_p.E776V|TNRC6C_ENST00000301624.4_Missense_Mutation_p.E776V|TNRC6C_ENST00000541771.1_Missense_Mutation_p.E776V			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	776	Sufficient for interaction with argonaute family proteins.|Thr-rich.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			CACAGGGTCGAGACGCCGCCC	0.517																																					p.E776V		Atlas-SNP	.											.	TNRC6C	173	.	0			c.A2327T						.						15.0	14.0	14.0					17																	76047470		1660	3290	4950	SO:0001583	missense	57690	exon4			GGGTCGAGACGCC	AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.2327A>T	chr17.hg19:g.76047470A>T	ENSP00000468647:p.Glu776Val	88.0	0.0		101.0	21.0	NM_018996	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	ENST00000588061.1	hg19	CCDS45798.1	.	.	.	.	.	.	.	.	.	.	A	12.29	1.894739	0.33442	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.15372	2.43;2.46;2.46;2.43	6.08	3.88	0.44766	.	1.325240	0.04396	N	0.363338	T	0.15998	0.0385	L	0.27053	0.805	0.09310	N	0.999998	B;B;B	0.22983	0.078;0.034;0.0	B;B;B	0.21708	0.036;0.036;0.001	T	0.36407	-0.9749	10	0.37606	T	0.19	-7.0007	10.3965	0.44203	0.8695:0.0:0.1305:0.0	.	776;776;776	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	V	776	ENSP00000336783:E776V;ENSP00000301624:E776V;ENSP00000440310:E776V;ENSP00000442421:E776V	ENSP00000301624:E776V	E	+	2	0	TNRC6C	73559065	1.000000	0.71417	0.101000	0.21167	0.026000	0.11368	2.512000	0.45485	0.547000	0.28938	0.533000	0.62120	GAG	.	.		0.517	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000395947.1	NM_018996	
CYTH1	9267	hgsc.bcm.edu	37	17	76677126	76677126	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:76677126T>A	ENST00000446868.3	-	12	962		c.e12-2		CYTH1_ENST00000361101.4_Splice_Site|CYTH1_ENST00000585509.1_Splice_Site|CYTH1_ENST00000591455.1_Splice_Site|CYTH1_ENST00000589297.1_Splice_Site|CYTH1_ENST00000589296.1_Intron|CYTH1_ENST00000586175.1_Splice_Site			Q15438	CYH1_HUMAN	cytohesin 1						establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						CTCCTTATCCTACAGAACAGT	0.453																																					.		Atlas-SNP	.											.	CYTH1	36	.	0			c.892-2A>T						.						83.0	86.0	85.0					17																	76677126		2203	4300	6503	SO:0001630	splice_region_variant	9267	exon12			TTATCCTACAGAA	M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.892-2A>T	chr17.hg19:g.76677126T>A		86.0	0.0		133.0	27.0	NM_004762	A6NFW7|B7Z1T4|Q9P123|Q9P124	Splice_Site	SNP	ENST00000446868.3	hg19		.	.	.	.	.	.	.	.	.	.	T	24.7	4.563340	0.86335	.	.	ENSG00000108669	ENST00000446868;ENST00000361101;ENST00000539525;ENST00000537048;ENST00000262763;ENST00000392453	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2049	0.65728	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	CYTH1	74188721	1.000000	0.71417	0.895000	0.35142	0.956000	0.61745	7.865000	0.87049	1.836000	0.53414	0.383000	0.25322	.	.	.		0.453	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000317099.1	NM_004762	Intron
SLC38A10	124565	hgsc.bcm.edu	37	17	79256084	79256084	+	Missense_Mutation	SNP	T	T	A	rs146598954	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:79256084T>A	ENST00000374759.3	-	5	789	c.406A>T	c.(406-408)Atc>Ttc	p.I136F	SLC38A10_ENST00000288439.5_Missense_Mutation_p.I136F|SLC38A10_ENST00000546352.1_5'Flank	NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	136					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGGAGCACGATGCACAGCGAC	0.652																																					p.I136F		Atlas-SNP	.											.	SLC38A10	133	.	0			c.A406T						.						93.0	70.0	78.0					17																	79256084		2202	4300	6502	SO:0001583	missense	124565	exon5			GCACGATGCACAG	BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.406A>T	chr17.hg19:g.79256084T>A	ENSP00000363891:p.Ile136Phe	196.0	0.0		243.0	46.0	NM_001037984	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	ENST00000374759.3	hg19	CCDS42397.1	.	.	.	.	.	.	.	.	.	.	T	17.36	3.369220	0.61624	.	.	ENSG00000157637	ENST00000374759;ENST00000288439;ENST00000539748	T;T;T	0.03152	4.03;4.03;4.03	5.19	4.07	0.47477	.	0.228496	0.43579	D	0.000542	T	0.10680	0.0261	M	0.66939	2.045	0.58432	D	0.999998	P;P	0.43607	0.812;0.58	P;P	0.53360	0.481;0.724	T	0.01283	-1.1396	10	0.46703	T	0.11	-9.8895	10.1012	0.42507	0.0:0.0849:0.0:0.9151	.	136;136	Q9HBR0-2;Q9HBR0	.;S38AA_HUMAN	F	136;136;88	ENSP00000363891:I136F;ENSP00000288439:I136F;ENSP00000439115:I88F	ENSP00000288439:I136F	I	-	1	0	SLC38A10	76870679	1.000000	0.71417	0.994000	0.49952	0.093000	0.18481	3.136000	0.50554	0.766000	0.33244	-0.408000	0.06270	ATC	.	T|0.995;C|0.005		0.652	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397747.1	NM_138570	
ARHGDIA	396	hgsc.bcm.edu	37	17	79826836	79826836	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr17:79826836G>C	ENST00000269321.7	-	6	666	c.531C>G	c.(529-531)atC>atG	p.I177M	ARHGDIA_ENST00000582520.1_5'Flank|RP11-498C9.3_ENST00000576554.1_RNA|ARHGDIA_ENST00000580685.1_Missense_Mutation_p.I177M|ARHGDIA_ENST00000541078.2_Missense_Mutation_p.I177M|RP11-498C9.3_ENST00000576021.1_RNA|ARHGDIA_ENST00000400721.4_Intron|ARHGDIA_ENST00000581876.1_Missense_Mutation_p.I102M|ARHGDIA_ENST00000584461.1_Intron	NM_001185078.1|NM_004309.4	NP_001172007.1|NP_004300.1	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha	177					cellular component movement (GO:0006928)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of axonogenesis (GO:0050772)|regulation of axonogenesis (GO:0050770)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			endometrium(1)|lung(1)|prostate(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			AGCGGGACTTGATGCTGTAGC	0.627																																					p.I177M		Atlas-SNP	.											.	ARHGDIA	14	.	0			c.C531G						.						101.0	87.0	92.0					17																	79826836		2203	4300	6503	SO:0001583	missense	396	exon6			GGACTTGATGCTG	BC028333	CCDS11788.1, CCDS58609.1	17q25.3	2005-12-20				ENSG00000141522			678	protein-coding gene	gene with protein product		601925		GDIA1		9186513	Standard	NM_001185077		Approved	RHOGDI	uc002kbq.3	P52565		ENST00000269321.7:c.531C>G	chr17.hg19:g.79826836G>C	ENSP00000269321:p.Ile177Met	80.0	0.0		87.0	9.0	NM_004309	A8MXW0|B2R5X1|B4DDD3|B4DUV9|Q6IBM5	Missense_Mutation	SNP	ENST00000269321.7	hg19	CCDS11788.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592605	0.46214	.	.	ENSG00000141522	ENST00000269321;ENST00000541078;ENST00000400721	.	.	.	4.44	3.47	0.39725	Immunoglobulin E-set (1);	0.115737	0.56097	D	0.000025	T	0.74520	0.3727	M	0.78637	2.42	0.51767	D	0.999931	P	0.41929	0.765	P	0.61003	0.882	T	0.74532	-0.3634	9	0.62326	D	0.03	-27.2918	7.3657	0.26772	0.0855:0.0:0.7478:0.1666	.	177	P52565	GDIR1_HUMAN	M	177;177;151	.	ENSP00000269321:I177M	I	-	3	3	ARHGDIA	77420125	1.000000	0.71417	1.000000	0.80357	0.122000	0.20287	4.899000	0.63245	1.070000	0.40811	0.563000	0.77884	ATC	.	.		0.627	ARHGDIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441679.2	NM_004309	
MYOM1	8736	hgsc.bcm.edu	37	18	3067424	3067424	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:3067424T>A	ENST00000356443.4	-	38	5227	c.4894A>T	c.(4894-4896)Acc>Tcc	p.T1632S	MYOM1_ENST00000400569.3_Missense_Mutation_p.T1632S|MYOM1_ENST00000261606.7_Missense_Mutation_p.T1536S	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1632	Ig-like C2-type 5.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CCGTTGATGGTGAAGTACGCG	0.592																																					p.T1632S		Atlas-SNP	.											.	MYOM1	192	.	0			c.A4894T						.						75.0	78.0	77.0					18																	3067424		2203	4300	6503	SO:0001583	missense	8736	exon38			TGATGGTGAAGTA	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4894A>T	chr18.hg19:g.3067424T>A	ENSP00000348821:p.Thr1632Ser	144.0	0.0		65.0	27.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	16.96	3.265427	0.59431	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.69435	-0.4;-0.4;-0.4	5.79	4.62	0.57501	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.199476	0.52532	D	0.000080	T	0.65770	0.2723	M	0.73319	2.225	0.42002	D	0.990894	B;P	0.38110	0.04;0.618	B;B	0.42163	0.044;0.378	T	0.61008	-0.7149	10	0.13470	T	0.59	.	11.3034	0.49320	0.2418:0.0:0.0:0.7581	.	1536;1632	P52179-2;P52179	.;MYOM1_HUMAN	S	1632;1632;1536	ENSP00000348821:T1632S;ENSP00000383413:T1632S;ENSP00000261606:T1536S	ENSP00000261606:T1536S	T	-	1	0	MYOM1	3057424	1.000000	0.71417	0.999000	0.59377	0.261000	0.26267	5.142000	0.64820	0.999000	0.39023	0.533000	0.62120	ACC	.	.		0.592	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
MYOM1	8736	hgsc.bcm.edu	37	18	3086130	3086130	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:3086130T>A	ENST00000356443.4	-	30	4490	c.4157A>T	c.(4156-4158)gAg>gTg	p.E1386V	MYOM1_ENST00000400569.3_Missense_Mutation_p.E1386V|MYOM1_ENST00000261606.7_Missense_Mutation_p.E1290V	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1386	Ig-like C2-type 4.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						AATATGAGTCTCCTTCTTAAT	0.358																																					p.E1386V		Atlas-SNP	.											.	MYOM1	192	.	0			c.A4157T						.						139.0	121.0	127.0					18																	3086130		1839	4089	5928	SO:0001583	missense	8736	exon30			TGAGTCTCCTTCT	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.4157A>T	chr18.hg19:g.3086130T>A	ENSP00000348821:p.Glu1386Val	63.0	0.0		52.0	16.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396982	0.62177	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.70986	-0.53;-0.53;-0.53	5.77	5.77	0.91146	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.160187	0.56097	D	0.000029	T	0.82038	0.4950	M	0.75085	2.285	0.80722	D	1	P;D	0.56521	0.942;0.976	P;P	0.60949	0.697;0.881	T	0.82864	-0.0246	10	0.48119	T	0.1	.	16.0953	0.81117	0.0:0.0:0.0:1.0	.	1290;1386	P52179-2;P52179	.;MYOM1_HUMAN	V	1386;1386;1290	ENSP00000348821:E1386V;ENSP00000383413:E1386V;ENSP00000261606:E1290V	ENSP00000261606:E1290V	E	-	2	0	MYOM1	3076130	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	7.993000	0.88291	2.204000	0.70986	0.383000	0.25322	GAG	.	.		0.358	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
DLGAP1	9229	hgsc.bcm.edu	37	18	3880047	3880047	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:3880047G>A	ENST00000315677.3	-	4	617	c.22C>T	c.(22-24)Cgc>Tgc	p.R8C	DLGAP1_ENST00000515196.2_Missense_Mutation_p.R8C|DLGAP1_ENST00000584874.1_Missense_Mutation_p.R8C|DLGAP1_ENST00000581527.1_Missense_Mutation_p.R8C|DLGAP1-AS3_ENST00000577649.1_RNA	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	8					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				TGATGGCTGCGGCTGCCTGAT	0.672																																					p.R8C		Atlas-SNP	.											.	DLGAP1	201	.	0			c.C22T						.																																			SO:0001583	missense	9229	exon4			GGCTGCGGCTGCC	AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.22C>T	chr18.hg19:g.3880047G>A	ENSP00000316377:p.Arg8Cys	23.0	0.0		11.0	5.0	NM_001242761	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Missense_Mutation	SNP	ENST00000315677.3	hg19	CCDS11836.1	.	.	.	.	.	.	.	.	.	.	G	23.0	4.361662	0.82353	.	.	ENSG00000170579	ENST00000315677;ENST00000515196	T;T	0.18338	2.23;2.22	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.50205	0.1602	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.925;0.998;1.0	T	0.53989	-0.8360	10	0.87932	D	0	-24.0757	20.0706	0.97721	0.0:0.0:1.0:0.0	.	8;8;8	B7Z9Y4;Q6IS01;O14490	.;.;DLGP1_HUMAN	C	8	ENSP00000316377:R8C;ENSP00000445973:R8C	ENSP00000316377:R8C	R	-	1	0	DLGAP1	3870047	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.020000	0.88740	2.744000	0.94065	0.655000	0.94253	CGC	.	.		0.672	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254394.4		
EPB41L3	23136	hgsc.bcm.edu	37	18	5423442	5423442	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:5423442C>T	ENST00000341928.2	-	11	1614	c.1274G>A	c.(1273-1275)cGc>cAc	p.R425H	EPB41L3_ENST00000540638.2_Missense_Mutation_p.R425H|EPB41L3_ENST00000544123.1_Missense_Mutation_p.R425H|EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000400111.3_Missense_Mutation_p.R425H|EPB41L3_ENST00000342933.3_Missense_Mutation_p.R425H	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	425	Hydrophilic.				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						AGGTGCTGGGCGATCTATCAA	0.493																																					p.R425H		Atlas-SNP	.											EPB41L3,colon,carcinoma,0,2	EPB41L3	222	.	0			c.G1274A						.						202.0	153.0	169.0					18																	5423442		2203	4300	6503	SO:0001583	missense	23136	exon11			GCTGGGCGATCTA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.1274G>A	chr18.hg19:g.5423442C>T	ENSP00000343158:p.Arg425His	166.0	0.0		118.0	33.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	hg19	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	C	36	5.705110	0.96812	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000342933;ENST00000400111	D;D;D;D	0.91521	-2.86;-2.86;-2.86;-2.86	6.08	6.08	0.98989	FERM adjacent (FA) (1);	0.000000	0.85682	D	0.000000	D	0.96430	0.8835	M	0.88181	2.935	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.978	D;D;D;D	0.91635	0.997;0.999;0.998;0.948	D	0.96191	0.9138	10	0.87932	D	0	.	20.6721	0.99693	0.0:1.0:0.0:0.0	.	425;316;425;425	F5GX05;A8K968;Q9Y2J2-2;Q9Y2J2	.;.;.;E41L3_HUMAN	H	425;316;425;316;425;425	ENSP00000343158:R425H;ENSP00000441174:R425H;ENSP00000341138:R425H;ENSP00000382981:R425H	ENSP00000343158:R425H	R	-	2	0	EPB41L3	5413442	1.000000	0.71417	0.991000	0.47740	0.930000	0.56654	7.788000	0.85771	2.894000	0.99253	0.591000	0.81541	CGC	.	.		0.493	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
ANKRD12	23253	hgsc.bcm.edu	37	18	9258388	9258388	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:9258388A>T	ENST00000262126.4	+	9	5363	c.5123A>T	c.(5122-5124)cAt>cTt	p.H1708L	ANKRD12_ENST00000383440.2_Missense_Mutation_p.H1685L|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Missense_Mutation_p.H1685L	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1708						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CCAGAAATGCATAAATATGGT	0.338																																					p.H1708L		Atlas-SNP	.											.	ANKRD12	167	.	0			c.A5123T						.						51.0	50.0	50.0					18																	9258388		2203	4300	6503	SO:0001583	missense	23253	exon9			AAATGCATAAATA	AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5123A>T	chr18.hg19:g.9258388A>T	ENSP00000262126:p.His1708Leu	111.0	0.0		57.0	22.0	NM_015208	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	ENST00000262126.4	hg19	CCDS11843.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.730754	0.48939	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.50277	0.75;0.75	5.33	5.33	0.75918	.	0.138696	0.49916	D	0.000135	T	0.40196	0.1107	L	0.29908	0.895	0.40159	D	0.977044	B;B	0.30361	0.277;0.181	B;B	0.35607	0.206;0.1	T	0.26744	-1.0094	10	0.22706	T	0.39	-10.5776	15.5958	0.76578	1.0:0.0:0.0:0.0	.	1685;1708	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	L	1685;1708	ENSP00000372932:H1685L;ENSP00000262126:H1708L	ENSP00000262126:H1708L	H	+	2	0	ANKRD12	9248388	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	3.039000	0.49791	2.141000	0.66446	0.533000	0.62120	CAT	.	.		0.338	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254478.2	NM_015208	
IMPACT	55364	hgsc.bcm.edu	37	18	22017984	22017984	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:22017984A>G	ENST00000284202.4	+	5	488	c.347A>G	c.(346-348)aAa>aGa	p.K116R	RP11-178F10.1_ENST00000579049.1_RNA	NM_018439.3	NP_060909	Q9P2X3	IMPCT_HUMAN	impact RWD domain protein	116	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.				negative regulation of protein phosphorylation (GO:0001933)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(3)|lung(9)|skin(1)|upper_aerodigestive_tract(2)	16	all_cancers(21;0.00018)|all_epithelial(16;1.5e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)					CTTATACAAAAATCTCAGATG	0.279																																					p.K116R		Atlas-SNP	.											.	IMPACT	37	.	0			c.A347G						.						44.0	50.0	48.0					18																	22017984		2199	4279	6478	SO:0001583	missense	55364	exon5			TACAAAAATCTCA	AB026264	CCDS11886.1	18q11.2-q12.1	2012-12-07	2012-12-07		ENSG00000154059	ENSG00000154059			20387	protein-coding gene	gene with protein product	"""RWD domain containing 5"""	615319	"""Impact homolog (mouse)"""			11116084	Standard	NM_018439		Approved	RWDD5	uc002kvh.4	Q9P2X3	OTTHUMG00000131943	ENST00000284202.4:c.347A>G	chr18.hg19:g.22017984A>G	ENSP00000284202:p.Lys116Arg	522.0	0.0		298.0	108.0	NM_018439	A8MXG0|Q49AM0|Q9H2X4	Missense_Mutation	SNP	ENST00000284202.4	hg19	CCDS11886.1	.	.	.	.	.	.	.	.	.	.	A	12.60	1.986429	0.35036	.	.	ENSG00000154059	ENST00000284202	T	0.32023	1.47	5.48	5.48	0.80851	RWD domain (2);	0.092424	0.64402	D	0.000001	T	0.31513	0.0799	M	0.63428	1.95	0.43342	D	0.99539	B	0.06786	0.001	B	0.09377	0.004	T	0.09729	-1.0661	10	0.18710	T	0.47	.	14.5246	0.67878	1.0:0.0:0.0:0.0	.	116	Q9P2X3	IMPCT_HUMAN	R	116	ENSP00000284202:K116R	ENSP00000284202:K116R	K	+	2	0	IMPACT	20271982	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	3.456000	0.53000	2.060000	0.61445	0.533000	0.62120	AAA	.	.		0.279	IMPACT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254901.1	NM_018439	
CCDC178	374864	hgsc.bcm.edu	37	18	30913332	30913332	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:30913332T>A	ENST00000383096.3	-	10	867	c.685A>T	c.(685-687)Ata>Tta	p.I229L	CCDC178_ENST00000583930.1_Missense_Mutation_p.I229L|CCDC178_ENST00000406524.2_Missense_Mutation_p.I229L|CCDC178_ENST00000402325.1_Missense_Mutation_p.I229L|CCDC178_ENST00000403303.1_Missense_Mutation_p.I229L|CCDC178_ENST00000579947.1_Missense_Mutation_p.I229L|CCDC178_ENST00000300227.8_Missense_Mutation_p.I229L|CCDC178_ENST00000579916.1_Intron			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	229																	TGTAATTCTATAACATCACTC	0.289																																					p.I229L		Atlas-SNP	.											.	.	.	.	0			c.A685T						.						127.0	114.0	118.0					18																	30913332		2202	4300	6502	SO:0001583	missense	374864	exon9			ATTCTATAACATC	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.685A>T	chr18.hg19:g.30913332T>A	ENSP00000372576:p.Ile229Leu	53.0	0.0		26.0	8.0	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	ENST00000383096.3	hg19	CCDS42424.1	.	.	.	.	.	.	.	.	.	.	T	10.53	1.374859	0.24857	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.39997	2.66;2.66;2.65;2.64;2.65;1.05	5.17	-0.6	0.11642	.	.	.	.	.	T	0.26593	0.0650	L	0.38838	1.175	0.09310	N	0.999999	B;B;B;B	0.20550	0.046;0.015;0.015;0.015	B;B;B;B	0.15484	0.013;0.01;0.01;0.01	T	0.19844	-1.0293	9	0.27082	T	0.32	-3.6271	4.5065	0.11891	0.0:0.3432:0.1697:0.4871	.	229;229;229;229	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	L	229	ENSP00000385591:I229L;ENSP00000372576:I229L;ENSP00000300227:I229L;ENSP00000385867:I229L;ENSP00000385234:I229L;ENSP00000382130:I229L	ENSP00000300227:I229L	I	-	1	0	C18orf34	29167330	0.005000	0.15991	0.120000	0.21714	0.010000	0.07245	-0.440000	0.06888	-0.260000	0.09418	0.455000	0.32223	ATA	.	.		0.289	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
CCDC178	374864	hgsc.bcm.edu	37	18	30926215	30926215	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:30926215T>A	ENST00000383096.3	-	9	800	c.618A>T	c.(616-618)tcA>tcT	p.S206S	CCDC178_ENST00000583930.1_Silent_p.S206S|CCDC178_ENST00000406524.2_Silent_p.S206S|CCDC178_ENST00000402325.1_Silent_p.S206S|CCDC178_ENST00000403303.1_Silent_p.S206S|CCDC178_ENST00000579947.1_Silent_p.S206S|CCDC178_ENST00000300227.8_Silent_p.S206S|CCDC178_ENST00000579916.1_Intron			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	206																	GTTTCCAGACTGACCAAGAGT	0.358																																					p.S206S		Atlas-SNP	.											.	.	.	.	0			c.A618T						.						116.0	116.0	116.0					18																	30926215		2203	4300	6503	SO:0001819	synonymous_variant	374864	exon8			CCAGACTGACCAA	AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.618A>T	chr18.hg19:g.30926215T>A		132.0	0.0		66.0	25.0	NM_001105528	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Silent	SNP	ENST00000383096.3	hg19	CCDS42424.1																																																																																			.	.		0.358	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000255373.2	NM_198995	
NOL4	8715	hgsc.bcm.edu	37	18	31523123	31523123	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:31523123T>A	ENST00000261592.5	-	9	1745	c.1448A>T	c.(1447-1449)cAc>cTc	p.H483L	NOL4_ENST00000589544.1_Intron|NOL4_ENST00000535384.1_Missense_Mutation_p.H198L|NOL4_ENST00000269185.4_Intron|NOL4_ENST00000538587.1_Missense_Mutation_p.H409L|NOL4_ENST00000535475.1_Missense_Mutation_p.H264L	NM_001198546.1|NM_003787.4	NP_001185475.1|NP_003778.2	O94818	NOL4_HUMAN	nucleolar protein 4	483						nucleolus (GO:0005730)	RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	51						TGAAGTAAGGTGGGAAGGAAT	0.418																																					p.H483L		Atlas-SNP	.											.	NOL4	139	.	0			c.A1448T						.						81.0	75.0	77.0					18																	31523123		2203	4300	6503	SO:0001583	missense	8715	exon9			GTAAGGTGGGAAG	AB017800	CCDS11907.2, CCDS56058.1, CCDS56059.1, CCDS59308.1	18q12	2010-05-04			ENSG00000101746	ENSG00000101746			7870	protein-coding gene	gene with protein product	"""cancer/testis antigen 125"""	603577				9813152	Standard	NM_003787		Approved	NOLP, HRIHFB2255, CT125	uc010dmi.3	O94818	OTTHUMG00000132291	ENST00000261592.5:c.1448A>T	chr18.hg19:g.31523123T>A	ENSP00000261592:p.His483Leu	72.0	0.0		34.0	11.0	NM_003787	B4DSQ0|B7Z3Z7|F5H1E3|Q6IBS2|Q9BWF1	Missense_Mutation	SNP	ENST00000261592.5	hg19	CCDS11907.2	.	.	.	.	.	.	.	.	.	.	T	23.0	4.364716	0.82463	.	.	ENSG00000101746	ENST00000261592;ENST00000399171;ENST00000535384;ENST00000535475;ENST00000538587	.	.	.	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.68842	0.3045	M	0.70595	2.14	0.24898	N	0.992128	D;D;D;D;D;D	0.89917	0.999;1.0;0.994;0.993;1.0;1.0	D;D;D;D;D;D	0.91635	0.994;0.998;0.924;0.986;0.998;0.999	T	0.65389	-0.6180	9	0.87932	D	0	-19.293	16.3863	0.83505	0.0:0.0:0.0:1.0	.	168;198;409;483;198;264	F8W825;B7Z3Z7;B4DSQ0;O94818;F5H1E3;B3KRF4	.;.;.;NOL4_HUMAN;.;.	L	483;168;198;264;409	.	ENSP00000261592:H483L	H	-	2	0	NOL4	29777121	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.022000	0.76431	2.264000	0.75181	0.528000	0.53228	CAC	.	.		0.418	NOL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255386.1	NM_003787	
LOXHD1	125336	hgsc.bcm.edu	37	18	44068976	44068976	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr18:44068976G>T	ENST00000398722.4	-	31	5173	c.5174C>A	c.(5173-5175)gCc>gAc	p.A1725D	LOXHD1_ENST00000300591.6_Missense_Mutation_p.A892D|LOXHD1_ENST00000441551.2_Missense_Mutation_p.A1797D|LOXHD1_ENST00000579038.1_Missense_Mutation_p.A796D|LOXHD1_ENST00000582408.1_Missense_Mutation_p.A830D|LOXHD1_ENST00000398686.4_Missense_Mutation_p.A242D|LOXHD1_ENST00000398705.2_Missense_Mutation_p.A242D|LOXHD1_ENST00000441893.2_Missense_Mutation_p.A874D|LOXHD1_ENST00000536736.1_Missense_Mutation_p.A1941D			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	1725	PLAT 12. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						GTTGGCACAGGCAAAGTCGCG	0.562																																					p.A1941D		Atlas-SNP	.											.	LOXHD1	367	.	0			c.C5822A						.						112.0	97.0	102.0					18																	44068976		692	1591	2283	SO:0001583	missense	125336	exon37			GCACAGGCAAAGT	AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.5174C>A	chr18.hg19:g.44068976G>T	ENSP00000381707:p.Ala1725Asp	70.0	0.0		47.0	19.0	NM_144612	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	ENST00000398722.4	hg19		.	.	.	.	.	.	.	.	.	.	G	13.16	2.154153	0.38021	.	.	ENSG00000167210	ENST00000300591;ENST00000398722;ENST00000398705;ENST00000536736;ENST00000441893;ENST00000398686	T;T;T;T;T;T	0.24908	1.83;3.28;3.37;3.28;3.3;3.32	5.58	4.66	0.58398	Lipoxygenase, LH2 (2);	.	.	.	.	T	0.36110	0.0955	M	0.69823	2.125	0.39826	D	0.972901	B;B;P	0.41748	0.441;0.235;0.761	B;B;B	0.43052	0.326;0.246;0.406	T	0.39251	-0.9623	9	0.56958	D	0.05	.	17.1023	0.86653	0.0:0.1377:0.8623:0.0	.	1941;874;1725	F5GZB4;F8WA52;Q8IVV2	.;.;LOXH1_HUMAN	D	892;1725;242;1941;874;242	ENSP00000300591:A892D;ENSP00000381707:A1725D;ENSP00000381692:A242D;ENSP00000444586:A1941D;ENSP00000409062:A874D;ENSP00000381676:A242D	ENSP00000300591:A892D	A	-	2	0	LOXHD1	42322974	1.000000	0.71417	0.993000	0.49108	0.930000	0.56654	6.132000	0.71676	2.611000	0.88343	0.655000	0.94253	GCC	.	.		0.562	LOXHD1-201	KNOWN	basic	protein_coding	protein_coding		NM_144612	
BSG	682	hgsc.bcm.edu	37	19	579507	579507	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:579507A>T	ENST00000333511.3	+	3	493	c.423A>T	c.(421-423)acA>acT	p.T141T	BSG_ENST00000545507.2_5'UTR|BSG_ENST00000346916.4_Intron|BSG_ENST00000353555.4_Silent_p.T25T|BSG_ENST00000574970.1_3'UTR	NM_001728.3	NP_001719.2	P35613	BASI_HUMAN	basigin (Ok blood group)	141	Ig-like C2-type.				blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cellular metabolic process (GO:0044237)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis of dentin-containing tooth (GO:0042475)|protein targeting to plasma membrane (GO:0072661)|pyruvate metabolic process (GO:0006090)|response to cAMP (GO:0051591)|response to mercury ion (GO:0046689)|response to peptide hormone (GO:0043434)|small molecule metabolic process (GO:0044281)	acrosomal membrane (GO:0002080)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|lung(1)	5		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGCCGGCACAGTCTTCACTA	0.662																																					p.T141T		Atlas-SNP	.											.	BSG	48	.	0			c.A423T						.						39.0	36.0	37.0					19																	579507		2200	4295	6495	SO:0001819	synonymous_variant	682	exon3			CGGCACAGTCTTC	L10240	CCDS12032.1, CCDS12033.1, CCDS12034.1, CCDS58635.1	19p13.3	2014-07-19	2014-01-02		ENSG00000172270	ENSG00000172270		"""CD molecules"", ""Blood group antigens"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1116	protein-coding gene	gene with protein product	"""Ok blood group"""	109480	"""basigin"""	OK		8404035, 7812975	Standard	NM_198591		Approved	EMMPRIN, CD147	uc002loz.4	P35613		ENST00000333511.3:c.423A>T	chr19.hg19:g.579507A>T		82.0	0.0		69.0	18.0	NM_001728	A6NJW1|D3YLG5|Q7Z796|Q8IZL7	Silent	SNP	ENST00000333511.3	hg19	CCDS12033.1																																																																																			.	.		0.662	BSG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438630.2	NM_001728	
PRSS57	400668	hgsc.bcm.edu	37	19	691985	691985	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:691985A>T	ENST00000329267.7	-	3	283	c.254T>A	c.(253-255)cTg>cAg	p.L85Q		NM_214710.3	NP_999875	Q6UWY2	PRS57_HUMAN	protease, serine, 57	85	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|lung(5)	6						CAGCACCACCAGGCCAGTGCG	0.662																																					p.L85Q		Atlas-SNP	.											.	PRSS57	18	.	0			c.T254A						.						46.0	29.0	35.0					19																	691985		2201	4300	6501	SO:0001583	missense	400668	exon3			ACCACCAGGCCAG	AY358594	CCDS12041.1	19p13.3	2012-03-26	2011-03-07	2011-03-07		ENSG00000185198		"""Serine peptidases / Serine peptidases"""	31397	protein-coding gene	gene with protein product			"""protease, serine-like 1"""	PRSSL1		12975309	Standard	NM_214710		Approved	UNQ782	uc002lpl.1	Q6UWY2		ENST00000329267.7:c.254T>A	chr19.hg19:g.691985A>T	ENSP00000327386:p.Leu85Gln	95.0	0.0		74.0	24.0	NM_214710	B2RNW8	Missense_Mutation	SNP	ENST00000329267.7	hg19	CCDS12041.1	.	.	.	.	.	.	.	.	.	.	A	3.087	-0.187659	0.06299	.	.	ENSG00000185198	ENST00000329267	D	0.92965	-3.14	4.28	0.422	0.16457	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.264352	0.20046	N	0.100411	T	0.72614	0.3482	N	0.01668	-0.77	0.32055	N	0.596455	B;B	0.18310	0.027;0.027	B;B	0.17098	0.017;0.017	T	0.65138	-0.6241	10	0.12766	T	0.61	.	5.8809	0.18854	0.3859:0.4561:0.0:0.1579	.	84;85	B7ZMF6;Q6UWY2	.;PRS57_HUMAN	Q	85	ENSP00000327386:L85Q	ENSP00000327386:L85Q	L	-	2	0	PRSS57	642985	0.100000	0.21855	0.738000	0.30950	0.087000	0.18053	0.121000	0.15667	0.115000	0.18071	0.260000	0.18958	CTG	.	.		0.662	PRSS57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452480.2	NM_214710	
ZFR2	23217	hgsc.bcm.edu	37	19	3823272	3823272	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:3823272T>A	ENST00000262961.4	-	8	1353	c.1343A>T	c.(1342-1344)cAg>cTg	p.Q448L		NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2	448							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		GCCCACCGGCTGCGCATCAGA	0.617																																					p.Q448L		Atlas-SNP	.											.	ZFR2	63	.	0			c.A1343T						.						89.0	95.0	93.0					19																	3823272		1893	4108	6001	SO:0001583	missense	23217	exon8			ACCGGCTGCGCAT	AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.1343A>T	chr19.hg19:g.3823272T>A	ENSP00000262961:p.Gln448Leu	66.0	0.0		41.0	11.0	NM_015174		Missense_Mutation	SNP	ENST00000262961.4	hg19	CCDS45921.1	.	.	.	.	.	.	.	.	.	.	T	16.04	3.009415	0.54361	.	.	ENSG00000105278	ENST00000262961	T	0.39056	1.1	3.4	2.35	0.29111	.	0.000000	0.64402	U	0.000006	T	0.41673	0.1169	M	0.81802	2.56	0.80722	D	1	P	0.42010	0.768	B	0.39379	0.298	T	0.31558	-0.9939	10	0.56958	D	0.05	-9.9101	6.643	0.22919	0.0:0.0:0.243:0.757	.	448	Q9UPR6	ZFR2_HUMAN	L	448	ENSP00000262961:Q448L	ENSP00000262961:Q448L	Q	-	2	0	ZFR2	3774272	1.000000	0.71417	0.017000	0.16124	0.008000	0.06430	1.731000	0.38135	0.378000	0.24764	0.459000	0.35465	CAG	.	.		0.617	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453648.2	NM_015174	
FUT5	2527	hgsc.bcm.edu	37	19	5867550	5867550	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:5867550G>A	ENST00000588525.1	-	2	274	c.187C>T	c.(187-189)Cgc>Tgc	p.R63C	FUT5_ENST00000252675.5_Missense_Mutation_p.R63C	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	63					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						TCCTGGCAGCGGGACCCATTG	0.632																																					p.R63C		Atlas-SNP	.											FUT5,NS,adenocarcinoma,0,1	FUT5	29	.	0			c.C187T						.						37.0	37.0	37.0					19																	5867550		2203	4300	6503	SO:0001583	missense	2527	exon2			GGCAGCGGGACCC		CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.187C>T	chr19.hg19:g.5867550G>A	ENSP00000466880:p.Arg63Cys	99.0	1.0		116.0	33.0	NM_002034	A8K4X2	Missense_Mutation	SNP	ENST00000588525.1	hg19	CCDS12154.1	.	.	.	.	.	.	.	.	.	.	G	6.407	0.443183	0.12164	.	.	ENSG00000130383	ENST00000252675	T	0.32272	1.46	1.55	1.55	0.23275	.	.	.	.	.	T	0.27349	0.0671	L	0.52573	1.65	0.09310	N	1	P	0.50272	0.933	B	0.43916	0.436	T	0.10730	-1.0617	9	0.38643	T	0.18	.	6.5424	0.22387	0.0:0.0:1.0:0.0	.	63	Q11128	FUT5_HUMAN	C	63	ENSP00000252675:R63C	ENSP00000252675:R63C	R	-	1	0	FUT5	5818550	0.000000	0.05858	0.002000	0.10522	0.025000	0.11179	-1.990000	0.01479	1.175000	0.42826	0.407000	0.27541	CGC	.	.		0.632	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452213.1	NM_002034	
CLPP	8192	hgsc.bcm.edu	37	19	6366366	6366366	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:6366366A>T	ENST00000245816.4	+	5	776	c.653A>T	c.(652-654)cAg>cTg	p.Q218L	CLPP_ENST00000596149.1_Missense_Mutation_p.Q131L|CLPP_ENST00000596605.1_3'UTR	NM_006012.2	NP_006003.1	Q16740	CLPP_HUMAN	caseinolytic mitochondrial matrix peptidase proteolytic subunit	218					protein homooligomerization (GO:0051260)|proteolysis involved in cellular protein catabolic process (GO:0051603)	endopeptidase Clp complex (GO:0009368)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(2)|ovary(2)	6						CAGAGCCTGCAGGTGATCGGT	0.562																																					p.Q218L		Atlas-SNP	.											.	CLPP	15	.	0			c.A653T						.						165.0	126.0	139.0					19																	6366366		2202	4300	6502	SO:0001583	missense	8192	exon5			GCCTGCAGGTGAT	Z50853	CCDS12162.1	19p13.3	2013-09-12	2013-09-12		ENSG00000125656	ENSG00000125656		"""ATPases / AAA-type"""	2084	protein-coding gene	gene with protein product	"""ATP-dependent protease ClpAP (E. coli), proteolytic subunit, human"""	601119	"""ClpP (caseinolytic protease, ATP-dependent, proteolytic subunit, E. coli) homolog"", ""ClpP caseinolytic protease, ATP-dependent, proteolytic subunit homolog (E. coli)"", ""ClpP caseinolytic peptidase, ATP-dependent, proteolytic subunit homolog (E. coli)"""			8543061, 23360988	Standard	NM_006012		Approved		uc002mem.1	Q16740	OTTHUMG00000180779	ENST00000245816.4:c.653A>T	chr19.hg19:g.6366366A>T	ENSP00000245816:p.Gln218Leu	88.0	0.0		46.0	12.0	NM_006012	B2R4W5	Missense_Mutation	SNP	ENST00000245816.4	hg19	CCDS12162.1	.	.	.	.	.	.	.	.	.	.	A	15.12	2.739334	0.49045	.	.	ENSG00000125656	ENST00000245816	.	.	.	5.5	4.48	0.54585	.	0.644172	0.15430	N	0.262752	T	0.43055	0.1230	L	0.27053	0.805	0.39660	D	0.97059	B	0.19445	0.036	B	0.20184	0.028	T	0.40175	-0.9577	9	0.87932	D	0	-20.004	6.7289	0.23373	0.7675:0.1535:0.079:0.0	.	218	Q16740	CLPP_HUMAN	L	218	.	ENSP00000245816:Q218L	Q	+	2	0	CLPP	6317366	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.881000	0.48538	1.050000	0.40346	0.529000	0.55759	CAG	.	.		0.562	CLPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452984.1	NM_006012	
PNPLA6	10908	hgsc.bcm.edu	37	19	7625969	7625969	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:7625969A>T	ENST00000221249.6	+	33	4203	c.3772A>T	c.(3772-3774)Agc>Tgc	p.S1258C	PNPLA6_ENST00000450331.3_Missense_Mutation_p.S1258C|PNPLA6_ENST00000600737.1_Missense_Mutation_p.S1296C|PNPLA6_ENST00000414982.3_Missense_Mutation_p.S1306C|PNPLA6_ENST00000545201.2_Missense_Mutation_p.S1231C	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1297					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GCCCCCCACGAGCTATGTCTC	0.632																																					p.S1306C		Atlas-SNP	.											.	PNPLA6	163	.	0			c.A3916T						.						32.0	31.0	31.0					19																	7625969		2203	4300	6503	SO:0001583	missense	10908	exon32			CCCACGAGCTATG	AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3772A>T	chr19.hg19:g.7625969A>T	ENSP00000221249:p.Ser1258Cys	56.0	0.0		50.0	26.0	NM_001166111	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	ENST00000221249.6	hg19	CCDS32891.1	.	.	.	.	.	.	.	.	.	.	a	16.27	3.076128	0.55646	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.04360	3.65;3.66;3.64;3.65	4.33	4.33	0.51752	.	.	.	.	.	T	0.11623	0.0283	L	0.53249	1.67	0.35271	D	0.780502	D;D;D;D	0.65815	0.991;0.99;0.995;0.967	P;P;P;P	0.57324	0.662;0.818;0.818;0.818	T	0.15178	-1.0446	9	0.39692	T	0.17	-22.9894	9.8073	0.40801	1.0:0.0:0.0:0.0	.	1297;1231;1296;1258	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	C	1258;1231;1306;1258	ENSP00000221249:S1258C;ENSP00000443323:S1231C;ENSP00000407509:S1306C;ENSP00000394348:S1258C	ENSP00000221249:S1258C	S	+	1	0	PNPLA6	7531969	0.992000	0.36948	0.869000	0.34112	0.414000	0.31173	3.136000	0.50554	1.814000	0.52955	0.379000	0.24179	AGC	.	.		0.632	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000459275.1	NM_006702	
PRAM1	84106	hgsc.bcm.edu	37	19	8563756	8563756	+	Silent	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:8563756G>A	ENST00000423345.4	-	2	1456	c.936C>T	c.(934-936)gcC>gcT	p.A312A	PRAM1_ENST00000255612.3_Silent_p.A312A			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	360	Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						CTTTGAATTCGGCCGGCCGCG	0.657																																					p.A312A		Atlas-SNP	.											.	PRAM1	53	.	0			c.C936T						.																																			SO:0001819	synonymous_variant	84106	exon2			GAATTCGGCCGGC	BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.936C>T	chr19.hg19:g.8563756G>A		79.0	0.0		105.0	35.0	NM_032152	Q8N6W7	Silent	SNP	ENST00000423345.4	hg19	CCDS45954.2																																																																																			.	.		0.657	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000397040.3	NM_032152	
MUC16	94025	hgsc.bcm.edu	37	19	9061256	9061256	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:9061256A>T	ENST00000397910.4	-	3	26393	c.26190T>A	c.(26188-26190)tcT>tcA	p.S8730S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8732	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGGCATTCCAGAAAGAGAAG	0.502																																					p.S8730S		Atlas-SNP	.											.	MUC16	4315	.	0			c.T26190A						.						109.0	99.0	102.0					19																	9061256		1942	4145	6087	SO:0001819	synonymous_variant	94025	exon3			CATTCCAGAAAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.26190T>A	chr19.hg19:g.9061256A>T		121.0	0.0		99.0	35.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.502	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
TNPO2	30000	hgsc.bcm.edu	37	19	12821577	12821577	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:12821577T>A	ENST00000592287.1	-	12	1236	c.1128A>T	c.(1126-1128)tcA>tcT	p.S376S	TNPO2_ENST00000441499.1_Silent_p.S376S|TNPO2_ENST00000588216.1_Silent_p.S376S|TNPO2_ENST00000450764.2_Silent_p.S376S|TNPO2_ENST00000425528.1_Silent_p.S376S|TNPO2_ENST00000589956.1_5'UTR|TNPO2_ENST00000356861.5_Silent_p.S376S	NM_001136196.1	NP_001129668.1	O14787	TNPO2_HUMAN	transportin 2	376					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nuclear localization sequence binding (GO:0008139)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(2)|large_intestine(2)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GTGCAGCCGCTGAGCACTTCC	0.642																																					p.S376S		Atlas-SNP	.											.	TNPO2	108	.	0			c.A1128T						.						24.0	28.0	27.0					19																	12821577		1997	4150	6147	SO:0001819	synonymous_variant	30000	exon12			AGCCGCTGAGCAC	AF019039	CCDS45991.1, CCDS45992.1	19p13.13	2009-01-12	2009-01-12			ENSG00000105576		"""Importins"""	19998	protein-coding gene	gene with protein product	"""importin 3"", ""karyopherin beta 2b"""	603002				9298975, 12384575	Standard	NM_013433		Approved	IPO3, KPNB2B, FLJ12155, TRN2	uc002muo.3	O14787		ENST00000592287.1:c.1128A>T	chr19.hg19:g.12821577T>A		66.0	0.0		82.0	21.0	NM_013433	O14655|Q6IN77	Silent	SNP	ENST00000592287.1	hg19	CCDS45991.1																																																																																			.	.		0.642	TNPO2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000450785.1	NM_013433	
NDUFB7	4713	hgsc.bcm.edu	37	19	14677729	14677729	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:14677729C>A	ENST00000215565.2	-	2	190	c.129G>T	c.(127-129)caG>caT	p.Q43H		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	43					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TCATCTCCTGCTGTGTGGCCA	0.662																																					p.Q43H		Atlas-SNP	.											.	NDUFB7	14	.	0			c.G129T						.						38.0	31.0	33.0					19																	14677729		2196	4295	6491	SO:0001583	missense	4713	exon2			CTCCTGCTGTGTG		CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.129G>T	chr19.hg19:g.14677729C>A	ENSP00000215565:p.Gln43His	31.0	0.0		27.0	10.0	NM_004146	Q6ICN9|Q9UI16	Missense_Mutation	SNP	ENST00000215565.2	hg19	CCDS12314.1	.	.	.	.	.	.	.	.	.	.	C	18.60	3.659702	0.67586	.	.	ENSG00000099795	ENST00000215565	T	0.50548	0.74	4.76	2.58	0.30949	.	0.058089	0.64402	D	0.000001	T	0.63402	0.2508	M	0.73962	2.25	0.58432	D	0.999999	D	0.76494	0.999	D	0.70227	0.968	T	0.63431	-0.6639	10	0.59425	D	0.04	-5.3708	9.4077	0.38471	0.0:0.821:0.0:0.179	.	43	P17568	NDUB7_HUMAN	H	43	ENSP00000215565:Q43H	ENSP00000215565:Q43H	Q	-	3	2	NDUFB7	14538729	1.000000	0.71417	0.999000	0.59377	0.906000	0.53458	3.287000	0.51732	0.600000	0.29862	0.585000	0.79938	CAG	.	.		0.662	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466025.1	NM_004146	
OR7A17	26333	hgsc.bcm.edu	37	19	14991448	14991448	+	Silent	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:14991448G>T	ENST00000327462.2	-	1	816	c.720C>A	c.(718-720)acC>acA	p.T240T		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					GTGATGCACAGGTGGAAAATG	0.483																																					p.T240T		Atlas-SNP	.											.	OR7A17	37	.	0			c.C720A						.						110.0	96.0	101.0					19																	14991448		2203	4300	6503	SO:0001819	synonymous_variant	26333	exon1			TGCACAGGTGGAA	X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.720C>A	chr19.hg19:g.14991448G>T		111.0	0.0		84.0	22.0	NM_030901	Q6IFQ6|Q96R98	Silent	SNP	ENST00000327462.2	hg19	CCDS12319.1																																																																																			.	.		0.483	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466523.1	NM_030901	
MYO9B	4650	hgsc.bcm.edu	37	19	17256246	17256246	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:17256246A>T	ENST00000594824.1	+	3	1027	c.880A>T	c.(880-882)Agc>Tgc	p.S294C	MYO9B_ENST00000595618.1_Missense_Mutation_p.S294C|MYO9B_ENST00000397274.2_Missense_Mutation_p.S294C			Q13459	MYO9B_HUMAN	myosin IXB	294	Myosin motor.				actin filament-based movement (GO:0030048)|establishment of cell polarity (GO:0030010)|lamellipodium morphogenesis (GO:0072673)|macrophage chemotaxis (GO:0048246)|monocyte chemotaxis (GO:0002548)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filamentous actin (GO:0031941)|filopodium tip (GO:0032433)|lamellipodium (GO:0030027)|membrane (GO:0016020)|myosin complex (GO:0016459)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	actin binding (GO:0003779)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			breast(3)|endometrium(9)|kidney(2)|large_intestine(1)|lung(19)|soft_tissue(1)|urinary_tract(4)	39						CAACAACTCCAGCCGGTTTGG	0.512																																					p.S294C		Atlas-SNP	.											.	MYO9B	264	.	0			c.A880T						.						103.0	103.0	103.0					19																	17256246		1962	4144	6106	SO:0001583	missense	4650	exon3			AACTCCAGCCGGT		CCDS46010.1	19p13.1	2011-09-27				ENSG00000099331		"""Myosins / Myosin superfamily : Class IX"""	7609	protein-coding gene	gene with protein product		602129		CELIAC4		9226381	Standard	NM_004145		Approved		uc010eak.3	Q13459		ENST00000594824.1:c.880A>T	chr19.hg19:g.17256246A>T	ENSP00000471367:p.Ser294Cys	120.0	0.0		104.0	32.0	NM_001130065	O75314|Q9NUJ2|Q9UHN0	Missense_Mutation	SNP	ENST00000594824.1	hg19		.	.	.	.	.	.	.	.	.	.	A	23.8	4.460150	0.84317	.	.	ENSG00000099331	ENST00000397274	D	0.83837	-1.77	4.77	4.77	0.60923	Myosin head, motor domain (3);	0.000000	0.64402	D	0.000014	D	0.94594	0.8258	H	0.98883	4.36	0.47778	D	0.999513	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.96219	0.9159	10	0.87932	D	0	.	13.1108	0.59273	1.0:0.0:0.0:0.0	.	294;294;300	Q13459;B0I1T6;Q4LE74	MYO9B_HUMAN;.;.	C	294	ENSP00000380444:S294C	ENSP00000380444:S294C	S	+	1	0	MYO9B	17117246	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	6.979000	0.76154	1.796000	0.52611	0.459000	0.35465	AGC	.	.		0.512	MYO9B-002	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000463236.1		
RPL18A	6142	hgsc.bcm.edu	37	19	17973829	17973829	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:17973829A>T	ENST00000222247.5	+	4	512	c.431A>T	c.(430-432)cAg>cTg	p.Q144L	RPL18A_ENST00000600147.1_Intron|SNORA68_ENST00000384437.1_RNA|RPL18A_ENST00000599870.1_Missense_Mutation_p.Q115L|RPL18A_ENST00000599898.1_Missense_Mutation_p.Q105L	NM_000980.3	NP_000971.1	Q02543	RL18A_HUMAN	ribosomal protein L18a	144					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						GCTGTCAAGCAGTTCCACGTG	0.677																																					p.Q144L		Atlas-SNP	.											.	RPL18A	15	.	0			c.A431T						.						21.0	24.0	23.0					19																	17973829		2202	4299	6501	SO:0001583	missense	6142	exon4			TCAAGCAGTTCCA	AB007175	CCDS12367.1	19p13.11	2011-04-06			ENSG00000105640	ENSG00000105640		"""L ribosomal proteins"""	10311	protein-coding gene	gene with protein product	"""60S ribosomal protein L18a"", ""ribosomal protein L18a-like protein"""	604178				9582194	Standard	NM_000980		Approved	L18A	uc002nhp.3	Q02543		ENST00000222247.5:c.431A>T	chr19.hg19:g.17973829A>T	ENSP00000222247:p.Gln144Leu	90.0	0.0		95.0	35.0	NM_000980		Missense_Mutation	SNP	ENST00000222247.5	hg19	CCDS12367.1	.	.	.	.	.	.	.	.	.	.	A	18.12	3.552562	0.65425	.	.	ENSG00000105640	ENST00000222247	.	.	.	4.71	4.71	0.59529	.	0.060094	0.64402	D	0.000002	T	0.78502	0.4293	M	0.94063	3.49	0.80722	D	1	D	0.65815	0.995	P	0.53266	0.722	D	0.84616	0.0681	8	.	.	.	.	12.4351	0.55595	1.0:0.0:0.0:0.0	.	144	Q02543	RL18A_HUMAN	L	144	.	.	Q	+	2	0	RPL18A	17834829	1.000000	0.71417	1.000000	0.80357	0.248000	0.25809	9.179000	0.94861	1.894000	0.54839	0.377000	0.23210	CAG	.	.		0.677	RPL18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466679.1	NM_000980	
SLC5A5	6528	hgsc.bcm.edu	37	19	17988625	17988625	+	Silent	SNP	G	G	T	rs148887708		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:17988625G>T	ENST00000222248.3	+	6	1139	c.792G>T	c.(790-792)gcG>gcT	p.A264A		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	264					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						TGAACCAGGCGCAGGTGCAGC	0.607																																					p.A264A	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											SLC5A5,colon,carcinoma,0,2	SLC5A5	67	.	0			c.G792T						.	G		1,4405	2.1+/-5.4	0,1,2202	151.0	125.0	134.0		792	-10.6	0.4	19	dbSNP_134	134	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	SLC5A5	NM_000453.2		0,4,6499	TT,TG,GG		0.0349,0.0227,0.0308		264/644	17988625	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	6528	exon6			CCAGGCGCAGGTG		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.792G>T	chr19.hg19:g.17988625G>T		76.0	1.0		88.0	30.0	NM_000453	O43702|Q2M335|Q9NYB6	Silent	SNP	ENST00000222248.3	hg19	CCDS12368.1																																																																																			.	G|1.000;T|0.000		0.607	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
COMP	1311	hgsc.bcm.edu	37	19	18899478	18899478	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:18899478A>T	ENST00000222271.2	-	7	729	c.685T>A	c.(685-687)Tgc>Agc	p.C229S	COMP_ENST00000542601.2_Missense_Mutation_p.C196S|COMP_ENST00000425807.1_Missense_Mutation_p.C176S	NM_000095.2	NP_000086.2	P49747	COMP_HUMAN	cartilage oligomeric matrix protein	229	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|limb development (GO:0060173)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|skeletal system development (GO:0001501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)|protease binding (GO:0002020)			breast(6)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32						CCGTCGGGGCAGAAGCGCTGT	0.746																																					p.C229S		Atlas-SNP	.											.	COMP	62	.	0			c.T685A						.						5.0	6.0	5.0					19																	18899478		1813	3424	5237	SO:0001583	missense	1311	exon7			CGGGGCAGAAGCG	L32137	CCDS12385.1	19p13.1	2008-02-05				ENSG00000105664			2227	protein-coding gene	gene with protein product	"""thrombospondin-5"""	600310	"""cartilage oligomeric matrix protein (pseudoachondroplasia, epiphyseal dysplasia 1, multiple)"""	PSACH, EDM1, EPD1		7713493, 8307576	Standard	NM_000095		Approved	MED, THBS5	uc002nke.3	P49747	OTTHUMG00000169318	ENST00000222271.2:c.685T>A	chr19.hg19:g.18899478A>T	ENSP00000222271:p.Cys229Ser	52.0	0.0		39.0	13.0	NM_000095	B4DKJ3|O14592|Q16388|Q16389|Q2NL86|Q8N4T2	Missense_Mutation	SNP	ENST00000222271.2	hg19	CCDS12385.1	.	.	.	.	.	.	.	.	.	.	A	19.42	3.823619	0.71143	.	.	ENSG00000105664	ENST00000542601;ENST00000222271;ENST00000425807;ENST00000454701	D;D;D	0.92805	-3.11;-3.11;-2.99	4.2	3.18	0.36537	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	U	0.000000	D	0.96688	0.8919	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.95706	0.8753	10	0.87932	D	0	-26.4467	6.6301	0.22851	0.8857:0.0:0.1143:0.0	.	176;229	B4DKJ3;P49747	.;COMP_HUMAN	S	196;229;176;216	ENSP00000439156:C196S;ENSP00000222271:C229S;ENSP00000403792:C176S	ENSP00000222271:C229S	C	-	1	0	COMP	18760478	1.000000	0.71417	1.000000	0.80357	0.483000	0.33249	4.665000	0.61547	1.553000	0.49476	0.397000	0.26171	TGC	.	.		0.746	COMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403457.1	NM_000095	
ZNF208	7757	hgsc.bcm.edu	37	19	22156559	22156559	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:22156559T>A	ENST00000397126.4	-	4	1425	c.1277A>T	c.(1276-1278)aAa>aTa	p.K426I	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	426					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				TTCTTCACATTTGTAGGGTTT	0.398																																					p.K426I		Atlas-SNP	.											.	ZNF208	817	.	0			c.A1277T						.						50.0	59.0	56.0					19																	22156559		2039	4225	6264	SO:0001583	missense	7757	exon4			TCACATTTGTAGG	BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.1277A>T	chr19.hg19:g.22156559T>A	ENSP00000380315:p.Lys426Ile	93.0	0.0		77.0	21.0	NM_007153		Missense_Mutation	SNP	ENST00000397126.4	hg19	CCDS54240.1	.	.	.	.	.	.	.	.	.	.	T	12.42	1.931844	0.34096	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.20881	2.04	2.65	-2.17	0.07059	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.32645	0.0836	.	.	.	0.09310	N	1	D	0.69078	0.997	D	0.91635	0.999	T	0.24728	-1.0152	8	0.59425	D	0.04	.	0.6615	0.00843	0.31:0.118:0.1588:0.4132	.	426	O43345	ZN208_HUMAN	I	426	ENSP00000380315:K426I	ENSP00000380315:K426I	K	-	2	0	ZNF208	21948399	0.000000	0.05858	0.008000	0.14137	0.046000	0.14306	-2.240000	0.01197	-0.030000	0.13804	0.254000	0.18369	AAA	.	.		0.398	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464302.1	NM_007153	
ZNF728	388523	hgsc.bcm.edu	37	19	23171133	23171133	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:23171133A>T	ENST00000594710.1	-	2	269	c.124T>A	c.(124-126)Ttc>Atc	p.F42I		NM_001267716.1	NP_001254645.1	P0DKX0	ZN728_HUMAN	zinc finger protein 728	42	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TCACCCAGGAAGACCAGGTTT	0.423																																					p.F42I		Atlas-SNP	.											.	.	.	.	0			c.T124A						.																																			SO:0001583	missense	388523	exon2			CCAGGAAGACCAG	BC128130	CCDS59370.1	19p12	2014-02-14			ENSG00000269067	ENSG00000269067		"""Zinc fingers, C2H2-type"", ""-"""	32463	protein-coding gene	gene with protein product							Standard	NM_001267716		Approved		uc002nqz.2	P0DKX0	OTTHUMG00000183124	ENST00000594710.1:c.124T>A	chr19.hg19:g.23171133A>T	ENSP00000471593:p.Phe42Ile	98.0	0.0		72.0	14.0	NM_001267716		Missense_Mutation	SNP	ENST00000594710.1	hg19	CCDS59370.1																																																																																			.	.		0.423	ZNF728-001	NOVEL	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465176.1	NM_001267716	
RYR1	6261	hgsc.bcm.edu	37	19	38964354	38964354	+	Missense_Mutation	SNP	A	A	T	rs185821937		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:38964354A>T	ENST00000359596.3	+	28	4103	c.4103A>T	c.(4102-4104)cAg>cTg	p.Q1368L	RYR1_ENST00000355481.4_Missense_Mutation_p.Q1368L|RYR1_ENST00000360985.3_Missense_Mutation_p.Q1368L			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	1368	6 X approximate repeats.|B30.2/SPRY 3. {ECO:0000255|PROSITE- ProRule:PRU00548}.			GEAQ -> RGA (in Ref. 1; AA sequence). {ECO:0000305}.	calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GGAGAGGCGCAGCCCGCCAGG	0.697																																					p.Q1368L		Atlas-SNP	.											.	RYR1	708	.	0			c.A4103T						.						3.0	3.0	3.0					19																	38964354		1583	3156	4739	SO:0001583	missense	6261	exon28			AGGCGCAGCCCGC	J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.4103A>T	chr19.hg19:g.38964354A>T	ENSP00000352608:p.Gln1368Leu	284.0	0.0		250.0	73.0	NM_001042723	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	ENST00000359596.3	hg19	CCDS33011.1	.	.	.	.	.	.	.	.	.	.	A	3.557	-0.090394	0.07053	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96651	-4.08;-4.08;-4.08	4.32	1.97	0.26223	B30.2/SPRY domain (1);	.	.	.	.	D	0.88358	0.6415	N	0.08118	0	0.31181	N	0.702024	P;B	0.44816	0.844;0.08	B;B	0.39738	0.308;0.075	D	0.85948	0.1462	9	0.34782	T	0.22	.	5.5868	0.17279	0.6541:0.1759:0.0:0.17	.	1368;1368	P21817-2;P21817	.;RYR1_HUMAN	L	1368	ENSP00000352608:Q1368L;ENSP00000347667:Q1368L;ENSP00000354254:Q1368L	ENSP00000347667:Q1368L	Q	+	2	0	RYR1	43656194	1.000000	0.71417	0.995000	0.50966	0.005000	0.04900	1.866000	0.39489	0.747000	0.32809	-0.686000	0.03744	CAG	.	A|1.000;C|0.000		0.697	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000462137.1		
CEACAM5	1048	hgsc.bcm.edu	37	19	42223902	42223902	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:42223902A>T	ENST00000221992.6	+	7	1660	c.1546A>T	c.(1546-1548)Aag>Tag	p.K516*	CEACAM5_ENST00000405816.1_Nonsense_Mutation_p.K516*|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Nonsense_Mutation_p.K515*	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	516	Ig-like 6.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CGTGGAGGACAAGGATGCTGT	0.552																																					p.K516X		Atlas-SNP	.											.	CEACAM5	84	.	0			c.A1546T						.						135.0	120.0	125.0					19																	42223902		2203	4300	6503	SO:0001587	stop_gained	1048	exon7			GAGGACAAGGATG	M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.1546A>T	chr19.hg19:g.42223902A>T	ENSP00000221992:p.Lys516*	109.0	0.0		72.0	18.0	NM_004363	H9KVA7	Nonsense_Mutation	SNP	ENST00000221992.6	hg19	CCDS12584.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.35|14.35	2.509474|2.509474	0.44660|0.44660	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000221992;ENST00000405816;ENST00000378181|ENST00000398599	.|.	.|.	.|.	2.43|2.43	-4.86|-4.86	0.03132|0.03132	.|.	.|.	.|.	.|.	.|.	.|T	.|0.15998	.|0.0385	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.09662	.|-1.0664	.|3	0.02654|.	T|.	1|.	.|.	0.2625|0.2625	0.00220|0.00220	0.1982:0.2409:0.226:0.3348|0.1982:0.2409:0.226:0.3348	.|.	.|.	.|.	.|.	X|L	516;516;234|511	.|.	ENSP00000221992:K516X|.	K|Q	+|+	1|2	0|0	CEACAM5|CEACAM5	46915742|46915742	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.023000|0.023000	0.10783|0.10783	-2.711000|-2.711000	0.00817|0.00817	-3.198000|-3.198000	0.00218|0.00218	0.332000|0.332000	0.21555|0.21555	AAG|CAA	.	.		0.552	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321132.2	NM_004363	
CEACAM3	1084	hgsc.bcm.edu	37	19	42312947	42312947	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:42312947T>A	ENST00000357396.3	+	3	762	c.521T>A	c.(520-522)cTg>cAg	p.L174Q	CEACAM3_ENST00000221999.4_Missense_Mutation_p.L174Q|CEACAM3_ENST00000344550.4_Missense_Mutation_p.L174Q|CEACAM3_ENST00000595255.1_3'UTR	NM_001815.2	NP_001806.2	P40198	CEAM3_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 3	174						integral component of membrane (GO:0016021)				endometrium(2)|kidney(4)|large_intestine(1)|lung(4)|prostate(3)|skin(4)|stomach(1)	19						GTGTGTTTCCTGCTCCTTGCC	0.602																																					p.L174Q		Atlas-SNP	.											.	CEACAM3	37	.	0			c.T521A						.						159.0	150.0	153.0					19																	42312947		2203	4300	6503	SO:0001583	missense	1084	exon3			GTTTCCTGCTCCT	E03349	CCDS12586.2, CCDS62685.1	19q13.2	2013-01-11			ENSG00000170956	ENSG00000170956		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1815	protein-coding gene	gene with protein product		609142		CGM1			Standard	NM_001815		Approved	CD66d	uc002orn.2	P40198	OTTHUMG00000150142	ENST00000357396.3:c.521T>A	chr19.hg19:g.42312947T>A	ENSP00000349971:p.Leu174Gln	109.0	0.0		83.0	14.0	NM_001815	G5E978|Q3KPH9	Missense_Mutation	SNP	ENST00000357396.3	hg19	CCDS12586.2	.	.	.	.	.	.	.	.	.	.	T	13.87	2.365804	0.41902	.	.	ENSG00000170956	ENST00000357396;ENST00000221999;ENST00000344550	T;T;T	0.02763	4.52;4.17;4.17	2.87	2.87	0.33458	.	.	.	.	.	T	0.09247	0.0228	L	0.50847	1.595	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.76575	0.988;0.974	T	0.15009	-1.0452	9	0.56958	D	0.05	.	7.8178	0.29269	0.0:0.0:0.0:1.0	.	174;174	G5E978;P40198	.;CEAM3_HUMAN	Q	174	ENSP00000349971:L174Q;ENSP00000221999:L174Q;ENSP00000341725:L174Q	ENSP00000221999:L174Q	L	+	2	0	CEACAM3	47004787	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	0.340000	0.19892	1.264000	0.44198	0.421000	0.28195	CTG	.	.		0.602	CEACAM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316509.2	NM_001815	
CEACAM1	634	hgsc.bcm.edu	37	19	43026217	43026217	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:43026217T>A	ENST00000161559.6	-	3	696	c.562A>T	c.(562-564)Agt>Tgt	p.S188C	CEACAM1_ENST00000403461.1_Missense_Mutation_p.S188C|CEACAM1_ENST00000599389.1_Missense_Mutation_p.S188C|CEACAM1_ENST00000358394.3_Missense_Mutation_p.S188C|CEACAM1_ENST00000403444.3_Missense_Mutation_p.S188C|CEACAM1_ENST00000308072.4_Missense_Mutation_p.S148C|LIPE-AS1_ENST00000594688.1_RNA|CEACAM1_ENST00000352591.5_Missense_Mutation_p.S188C|LIPE-AS1_ENST00000594624.2_RNA|CEACAM1_ENST00000351134.3_Intron|LIPE-AS1_ENST00000457234.2_RNA	NM_001712.4	NP_001703.2	P13688	CEAM1_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 1 (biliary glycoprotein)	188	Ig-like C2-type 1.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|homophilic cell adhesion (GO:0007156)|integrin-mediated signaling pathway (GO:0007229)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	17		Prostate(69;0.00682)		GBM - Glioblastoma multiforme(486;0.00148)	Arcitumomab(DB00113)	AGCCTGGGACTGACCGGGAGG	0.532																																					p.S188C		Atlas-SNP	.											.	CEACAM1	43	.	0			c.A562T						.						212.0	191.0	198.0					19																	43026217		2203	4300	6503	SO:0001583	missense	634	exon3			TGGGACTGACCGG	M72238	CCDS12609.1, CCDS46089.1, CCDS54272.1, CCDS54273.1, CCDS54274.1	19q13.2	2014-05-16			ENSG00000079385	ENSG00000079385		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1814	protein-coding gene	gene with protein product		109770		BGP		2457922, 2025273	Standard	NM_001712		Approved	BGP1, CD66a	uc002otv.3	P13688	OTTHUMG00000151078	ENST00000161559.6:c.562A>T	chr19.hg19:g.43026217T>A	ENSP00000161559:p.Ser188Cys	112.0	0.0		86.0	25.0	NM_001184816	A6NE38|A8MY49|O60430|Q069I7|Q13854|Q13857|Q13858|Q13859|Q13860|Q15600|Q15601|Q16170|Q5UB49|Q7KYP5|Q96CA7|Q9UQV9	Missense_Mutation	SNP	ENST00000161559.6	hg19	CCDS12609.1	.	.	.	.	.	.	.	.	.	.	t	15.30	2.792910	0.50102	.	.	ENSG00000079385	ENST00000161559;ENST00000358394;ENST00000446434;ENST00000378065;ENST00000352591;ENST00000403444;ENST00000403461;ENST00000308072;ENST00000377806;ENST00000344391;ENST00000403136	T;T;T;T;T;T	0.03330	3.97;3.97;3.97;3.97;3.97;3.97	4.56	1.1	0.20463	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.19805	0.0476	M	0.94142	3.5	0.09310	N	1	P;D;P;P;P;P;P;P;P	0.89917	0.89;1.0;0.821;0.951;0.821;0.865;0.876;0.922;0.859	D;D;P;P;P;P;P;D;P	0.97110	0.927;1.0;0.823;0.876;0.823;0.74;0.678;0.932;0.884	T	0.08249	-1.0731	9	0.72032	D	0.01	.	2.8958	0.05690	0.0:0.3336:0.2541:0.4123	.	188;188;188;188;188;188;188;188;188	P13688-10;P13688-3;P13688-4;P13688-2;P13688-11;P13688-6;P13688-5;P13688-8;P13688	.;.;.;.;.;.;.;.;CEAM1_HUMAN	C	188;188;215;148;188;188;188;148;188;188;188	ENSP00000161559:S188C;ENSP00000351165:S188C;ENSP00000244291:S188C;ENSP00000384709:S188C;ENSP00000384083:S188C;ENSP00000312184:S148C	ENSP00000161559:S188C	S	-	1	0	CEACAM1	47718057	0.000000	0.05858	0.001000	0.08648	0.009000	0.06853	0.769000	0.26604	0.851000	0.35264	0.379000	0.24179	AGT	.	.		0.532	CEACAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321190.2	NM_001712	
PSG6	5675	hgsc.bcm.edu	37	19	43414973	43414973	+	Missense_Mutation	SNP	T	T	A	rs1058674		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:43414973T>A	ENST00000292125.2	-	3	509	c.465A>T	c.(463-465)ttA>ttT	p.L155F	PSG6_ENST00000187910.2_Missense_Mutation_p.L155F|PSG6_ENST00000402603.4_Missense_Mutation_p.L155F	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	155	Ig-like C2-type 1.		L -> F (in dbSNP:rs1058674).		female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				CCCTGGGGTTTAAGTTGCTGC	0.522																																					p.L155F		Atlas-SNP	.											.	PSG6	89	.	0			c.A465T						.						165.0	166.0	165.0					19																	43414973		2201	4299	6500	SO:0001583	missense	5675	exon3			GGGGTTTAAGTTG		CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.465A>T	chr19.hg19:g.43414973T>A	ENSP00000292125:p.Leu155Phe	100.0	0.0		59.0	16.0	NM_001031850	O75244|Q15224|Q15235|Q549K1	Missense_Mutation	SNP	ENST00000292125.2	hg19	CCDS12613.1	.	.	.	.	.	.	.	.	.	.	N	1.537	-0.542825	0.04053	.	.	ENSG00000170848	ENST00000187910;ENST00000402603;ENST00000292125;ENST00000402456	T;T;T	0.00717	5.79;5.79;5.79	1.64	-3.28	0.05033	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.00906	0.0030	L	0.41492	1.28	0.09310	N	1	P;B;P	0.37207	0.587;0.052;0.529	B;B;B	0.44163	0.268;0.073;0.443	T	0.30416	-0.9979	9	0.25751	T	0.34	.	3.8961	0.09139	0.1639:0.0:0.4765:0.3597	.	155;155;155	Q00889;Q00889-2;B5MCE1	PSG6_HUMAN;.;.	F	155	ENSP00000187910:L155F;ENSP00000385736:L155F;ENSP00000292125:L155F	ENSP00000187910:L155F	L	-	3	2	PSG6	48106813	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	0.180000	0.16860	-2.167000	0.00779	-1.241000	0.01538	TTA	.	T|1.000;|0.000		0.522	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000321436.1	NM_002782	
PSG2	5670	hgsc.bcm.edu	37	19	43576010	43576010	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:43576010G>A	ENST00000406487.1	-	4	904	c.806C>T	c.(805-807)gCa>gTa	p.A269V		NM_031246.3	NP_112536.2	P11465	PSG2_HUMAN	pregnancy specific beta-1-glycoprotein 2	269	Ig-like C2-type 2.				cell migration (GO:0016477)|female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(24)|ovary(1)|pancreas(2)|prostate(6)|stomach(2)|urinary_tract(2)	49		Prostate(69;0.00682)				AGAATACTGTGCCGGTGGGTT	0.453																																					p.A269V		Atlas-SNP	.											.	PSG2	84	.	0			c.C806T						.						181.0	191.0	187.0					19																	43576010		2202	4299	6501	SO:0001583	missense	5670	exon4			TACTGTGCCGGTG		CCDS12616.1	19q13.1-q13.2	2013-01-29			ENSG00000242221	ENSG00000242221		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9519	protein-coding gene	gene with protein product	"""pregnancy-specific beta-1 glycoprotein"", ""pregnancy-specific beta-1-glycoprotein 7"", ""carcinoembryonic antigen SG8"""	176391		PSBG2		2377620	Standard	NM_031246		Approved	PSGGB, PSG1, CEA	uc002ovr.3	P11465	OTTHUMG00000151547	ENST00000406487.1:c.806C>T	chr19.hg19:g.43576010G>A	ENSP00000385706:p.Ala269Val	136.0	0.0		135.0	40.0	NM_031246	Q8TCD9|Q9UEA4|Q9UQ78	Missense_Mutation	SNP	ENST00000406487.1	hg19	CCDS12616.1	.	.	.	.	.	.	.	.	.	.	g	9.591	1.126263	0.20959	.	.	ENSG00000242221	ENST00000406487;ENST00000329509;ENST00000401942;ENST00000406917	T	0.72505	-0.66	1.26	1.26	0.21427	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76047	0.3933	M	0.78916	2.43	0.09310	N	1	P;B	0.36162	0.54;0.174	P;P	0.51487	0.671;0.45	T	0.63247	-0.6680	9	0.21014	T	0.42	.	5.8601	0.18743	0.0:0.0:1.0:0.0	.	269;269	B5MCM8;P11465	.;PSG2_HUMAN	V	269	ENSP00000385706:A269V	ENSP00000332984:A269V	A	-	2	0	PSG2	48267850	0.418000	0.25440	0.044000	0.18714	0.033000	0.12548	2.483000	0.45233	0.659000	0.30945	0.398000	0.26397	GCA	.	.		0.453	PSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000323083.1	NM_031246	
MARK4	57787	hgsc.bcm.edu	37	19	45790824	45790824	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:45790824A>T	ENST00000262891.4	+	13	1727	c.1396A>T	c.(1396-1398)Agt>Tgt	p.S466C	MARK4_ENST00000300843.4_Missense_Mutation_p.S466C	NM_001199867.1	NP_001186796.1	Q96L34	MARK4_HUMAN	MAP/microtubule affinity-regulating kinase 4	466					microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nervous system development (GO:0007399)|positive regulation of programmed cell death (GO:0043068)|protein phosphorylation (GO:0006468)	centrosome (GO:0005813)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)|ubiquitin binding (GO:0043130)			NS(1)|biliary_tract(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	31		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0102)		GGGGAGTGGGAGTCGAGGGCT	0.711																																					p.S466C		Atlas-SNP	.											.	MARK4	132	.	0			c.A1396T						.						27.0	32.0	30.0					19																	45790824		2185	4295	6480	SO:0001583	missense	57787	exon13			AGTGGGAGTCGAG	AB049127	CCDS12658.1, CCDS56097.1	19q13.32	2014-04-07	2002-06-12	2002-06-14	ENSG00000007047	ENSG00000007047	2.7.11.1		13538	protein-coding gene	gene with protein product		606495	"""MAP/microtubule affinity-regulating kinase like 1"""	MARKL1		23400999, 11326310, 9108484	Standard	NM_001199867		Approved	Nbla00650, FLJ90097, KIAA1860, PAR-1D	uc002paz.2	Q96L34	OTTHUMG00000181769	ENST00000262891.4:c.1396A>T	chr19.hg19:g.45790824A>T	ENSP00000262891:p.Ser466Cys	359.0	0.0		300.0	93.0	NM_001199867	Q8NG37|Q96JG7|Q96SQ2|Q9BYD8	Missense_Mutation	SNP	ENST00000262891.4	hg19	CCDS56097.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.20|17.20	3.328829|3.328829	0.60743|0.60743	.|.	.|.	ENSG00000007047|ENSG00000007047	ENST00000262893|ENST00000262891;ENST00000300843	.|T;T	.|0.37584	.|1.19;1.19	5.06|5.06	4.05|4.05	0.47172|0.47172	.|.	.|0.000000	.|0.48767	.|D	.|0.000170	T|T	0.48150|0.48150	0.1484|0.1484	L|L	0.43923|0.43923	1.385|1.385	0.51767|0.51767	D|D	0.999939|0.999939	.|D;D;D	.|0.76494	.|0.999;0.999;0.979	.|P;D;P	.|0.80764	.|0.894;0.994;0.723	T|T	0.45308|0.45308	-0.9270|-0.9270	6|10	0.28530|0.72032	T|D	0.3|0.01	.|.	8.8674|8.8674	0.35294|0.35294	0.9116:0.0:0.0884:0.0|0.9116:0.0:0.0884:0.0	.|.	.|332;466;466	.|Q8N2N5;Q96L34;Q96L34-2	.|.;MARK4_HUMAN;.	V|C	430|466	.|ENSP00000262891:S466C;ENSP00000300843:S466C	ENSP00000262893:E430V|ENSP00000262891:S466C	E|S	+|+	2|1	0|0	MARK4|MARK4	50482664|50482664	1.000000|1.000000	0.71417|0.71417	0.264000|0.264000	0.24511|0.24511	0.499000|0.499000	0.33736|0.33736	7.733000|7.733000	0.84916|0.84916	0.970000|0.970000	0.38263|0.38263	0.482000|0.482000	0.46254|0.46254	GAG|AGT	.	.		0.711	MARK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457537.1	NM_031417	
GLTSCR1	29998	hgsc.bcm.edu	37	19	48182982	48182983	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:48182982_48182983GG>TT	ENST00000396720.3	+	6	749_750	c.555_556GG>TT	c.(553-558)caGGac>caTTac	p.185_186QD>HY	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	185										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		TGCCGCCCCAGGACGTGGTCAA	0.703																																					p.Q185H|p.D186Y		Atlas-SNP	.											.	GLTSCR1	79	.	0			c.G555T|c.G556T						.																																			SO:0001583	missense	29998	exon6			GCCCCAGGACGTG|CCCCAGGACGTGG	AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		Exception_encountered	chr19.hg19:g.48182982_48182983delinsTT	ENSP00000379946:p.Q185_D186delinsHY	62.0	0.0		49.0|48.0	9.0|8.0	NM_015711	A8MW01	Missense_Mutation	SNP	ENST00000396720.3	hg19	CCDS46134.1																																																																																			.	.		0.703	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465846.1	NM_015711	
SCAF1	58506	hgsc.bcm.edu	37	19	50156008	50156008	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:50156008A>T	ENST00000360565.3	+	7	2486	c.2362A>T	c.(2362-2364)Agg>Tgg	p.R788W		NM_021228.2	NP_067051.2	Q9H7N4	SFR19_HUMAN	SR-related CTD-associated factor 1	788	Ser-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	20		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00113)|GBM - Glioblastoma multiforme(134;0.0204)		agatagggacagggacagGTC	0.687																																					p.R788W		Atlas-SNP	.											.	SCAF1	78	.	0			c.A2362T						.						31.0	39.0	36.0					19																	50156008		2198	4297	6495	SO:0001583	missense	58506	exon7			AGGGACAGGGACA	AK024444	CCDS33074.1	19q13.3-q13.4	2011-01-10			ENSG00000126461	ENSG00000126461			30403	protein-coding gene	gene with protein product						11461075	Standard	NM_021228		Approved	SR-A1, FLJ00034	uc002poq.3	Q9H7N4		ENST00000360565.3:c.2362A>T	chr19.hg19:g.50156008A>T	ENSP00000353769:p.Arg788Trp	116.0	0.0		114.0	28.0	NM_021228	Q7Z5V7|Q8WVA1|Q9NR59	Missense_Mutation	SNP	ENST00000360565.3	hg19	CCDS33074.1	.	.	.	.	.	.	.	.	.	.	A	14.07	2.425491	0.43020	.	.	ENSG00000126461	ENST00000360565	T	0.36520	1.25	3.73	1.36	0.22044	.	0.000000	0.37955	U	0.001865	T	0.40145	0.1105	L	0.27053	0.805	0.37725	D	0.925059	D	0.76494	0.999	D	0.71870	0.975	T	0.23797	-1.0178	9	.	.	.	-25.5875	10.2437	0.43328	0.5465:0.4535:0.0:0.0	.	788	Q9H7N4	SFR19_HUMAN	W	788	ENSP00000353769:R788W	.	R	+	1	2	SCAF1	54847820	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.005000	0.40864	0.472000	0.27344	0.459000	0.35465	AGG	.	.		0.687	SCAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465764.1	NM_021228	
SIGLEC11	114132	hgsc.bcm.edu	37	19	50453402	50453402	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:50453402T>A	ENST00000447370.2	-	11	2012	c.1922A>T	c.(1921-1923)gAg>gTg	p.E641V	SIGLEC11_ENST00000426971.2_Missense_Mutation_p.E545V|CTC-326K19.6_ENST00000451973.1_Intron|U3_ENST00000408198.1_RNA	NM_052884.2	NP_443116.2	Q96RL6	SIG11_HUMAN	sialic acid binding Ig-like lectin 11	641					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(6)|pancreas(1)|prostate(1)|skin(1)	32		all_lung(116;0.00318)|all_neural(266;0.107)|Ovarian(192;0.17)		GBM - Glioblastoma multiforme(134;0.00107)|OV - Ovarian serous cystadenocarcinoma(262;0.00517)		ATAGTGGAGCTCCTGCTCTTC	0.652																																					p.E641V		Atlas-SNP	.											.	SIGLEC11	70	.	0			c.A1922T						.						32.0	32.0	32.0					19																	50453402		2202	4300	6502	SO:0001583	missense	114132	exon11			TGGAGCTCCTGCT	AF337818	CCDS12790.2, CCDS46150.1	19q13.3	2013-01-29			ENSG00000161640	ENSG00000161640		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15622	protein-coding gene	gene with protein product		607157				11986327	Standard	NM_052884		Approved		uc010ybi.2	Q96RL6	OTTHUMG00000157077	ENST00000447370.2:c.1922A>T	chr19.hg19:g.50453402T>A	ENSP00000412361:p.Glu641Val	68.0	0.0		64.0	21.0	NM_052884		Missense_Mutation	SNP	ENST00000447370.2	hg19	CCDS12790.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	10.95|10.95	1.496744|1.496744	0.26861|0.26861	.|.	.|.	ENSG00000161640|ENSG00000161640	ENST00000447370;ENST00000458019|ENST00000426971	T|.	0.10192|.	2.9|.	3.97|3.97	1.66|1.66	0.24008|0.24008	.|.	0.160723|.	0.29501|.	N|.	0.011975|.	T|T	0.55130|0.55130	0.1901|0.1901	M|M	0.83312|0.83312	2.635|2.635	0.09310|0.09310	N|N	1|1	D;B|.	0.56521|.	0.976;0.005|.	P;B|.	0.54140|.	0.743;0.006|.	T|T	0.50092|0.50092	-0.8868|-0.8868	10|5	0.87932|.	D|.	0|.	.|.	4.6719|4.6719	0.12692|0.12692	0.1901:0.0:0.1971:0.6128|0.1901:0.0:0.1971:0.6128	.|.	545;641|.	Q96RL6-2;Q96RL6|.	.;SIG11_HUMAN|.	V|C	641;545|535	ENSP00000412361:E641V|.	ENSP00000412361:E641V|.	E|S	-|-	2|1	0|0	SIGLEC11|SIGLEC11	55145214|55145214	0.016000|0.016000	0.18221|0.18221	0.001000|0.001000	0.08648|0.08648	0.124000|0.124000	0.20399|0.20399	0.256000|0.256000	0.18351|0.18351	0.123000|0.123000	0.18342|0.18342	0.533000|0.533000	0.62120|0.62120	GAG|AGC	.	.		0.652	SIGLEC11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000347382.1	NM_052884	
IZUMO2	126123	hgsc.bcm.edu	37	19	50662761	50662761	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:50662761A>T	ENST00000293405.3	-	3	384	c.384T>A	c.(382-384)taT>taA	p.Y128*		NM_152358.2	NP_689571.2	Q6UXV1	IZUM2_HUMAN	IZUMO family member 2	128						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)	7						CTTTTAATTCATATGAAATTA	0.448																																					p.Y128X		Atlas-SNP	.											.	IZUMO2	26	.	0			c.T384A						.						72.0	74.0	73.0					19																	50662761		1871	4106	5977	SO:0001587	stop_gained	126123	exon3			TAATTCATATGAA	AY358196	CCDS12792.2	19q13.33	2014-02-17	2010-07-29	2010-07-29	ENSG00000161652	ENSG00000161652		"""-"""	28518	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 41"""	C19orf41		19658160, 22957301	Standard	XM_006723007		Approved	MGC33947, SCRL	uc002prp.1	Q6UXV1	OTTHUMG00000074063	ENST00000293405.3:c.384T>A	chr19.hg19:g.50662761A>T	ENSP00000293405:p.Tyr128*	217.0	0.0		193.0	63.0	NM_152358	Q5GRG3|Q5GRG4|Q6ZNM5|Q8NHR8	Nonsense_Mutation	SNP	ENST00000293405.3	hg19	CCDS12792.2	.	.	.	.	.	.	.	.	.	.	A	14.06	2.423179	0.43020	.	.	ENSG00000161652	ENST00000293405;ENST00000377000	.	.	.	4.22	-2.77	0.05877	.	0.179764	0.27327	N	0.019870	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.8665	0.46858	0.4051:0.0:0.5949:0.0	.	.	.	.	X	128	.	ENSP00000293405:Y128X	Y	-	3	2	IZUMO2	55354573	0.971000	0.33674	0.002000	0.10522	0.038000	0.13279	0.144000	0.16135	-0.735000	0.04837	0.459000	0.35465	TAT	.	.		0.448	IZUMO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000157232.1	NM_152358	
KLK10	5655	hgsc.bcm.edu	37	19	51520376	51520376	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:51520376A>T	ENST00000309958.3	-	3	477	c.259T>A	c.(259-261)Tgc>Agc	p.C87S	KLK10_ENST00000391805.1_Missense_Mutation_p.C87S|KLK10_ENST00000358789.3_Missense_Mutation_p.C87S|CTC-518B2.12_ENST00000596286.1_RNA	NM_002776.4	NP_002767.2	O43240	KLK10_HUMAN	kallikrein-related peptidase 10	87	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cell cycle (GO:0007049)	extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	13		all_neural(266;0.026)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00885)		TTGTTTCCGCAGTGCGCGGCC	0.697											OREG0025646	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.C87S		Atlas-SNP	.											.	KLK10	32	.	0			c.T259A						.						20.0	21.0	21.0					19																	51520376		2202	4294	6496	SO:0001583	missense	5655	exon3			TTCCGCAGTGCGC	AF024605	CCDS12817.1	19q13	2011-03-07	2006-10-27			ENSG00000129451		"""Kallikreins"""	6358	protein-coding gene	gene with protein product		602673	"""kallikrein 10"""	PRSSL1		8764136, 9533035, 16800724, 16800723, 10675891	Standard	NM_145888		Approved	NES1	uc002pva.3	O43240		ENST00000309958.3:c.259T>A	chr19.hg19:g.51520376A>T	ENSP00000311746:p.Cys87Ser	126.0	0.0	978	138.0	36.0	NM_145888	A6NC12|Q53YL3|Q99920|Q9GZW9	Missense_Mutation	SNP	ENST00000309958.3	hg19	CCDS12817.1	.	.	.	.	.	.	.	.	.	.	a	23.8	4.457661	0.84317	.	.	ENSG00000129451	ENST00000391805;ENST00000309958;ENST00000358789	D;D;D	0.98044	-4.68;-4.68;-4.68	4.43	4.43	0.53597	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.37761	N	0.001958	D	0.99102	0.9691	H	0.98238	4.18	0.42367	D	0.992435	D	0.89917	1.0	D	0.81914	0.995	D	0.99107	1.0845	10	0.87932	D	0	.	10.3503	0.43931	1.0:0.0:0.0:0.0	.	87	O43240	KLK10_HUMAN	S	87	ENSP00000375681:C87S;ENSP00000311746:C87S;ENSP00000351640:C87S	ENSP00000311746:C87S	C	-	1	0	KLK10	56212188	1.000000	0.71417	0.996000	0.52242	0.964000	0.63967	4.552000	0.60747	1.758000	0.51981	0.402000	0.26972	TGC	.	.		0.697	KLK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464337.2	NM_002776	
ZNF615	284370	hgsc.bcm.edu	37	19	52497458	52497458	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:52497458T>A	ENST00000602063.1	-	6	1220	c.871A>T	c.(871-873)Agc>Tgc	p.S291C	ZNF615_ENST00000598071.1_Missense_Mutation_p.S302C|ZNF615_ENST00000376716.5_Missense_Mutation_p.S291C|ZNF615_ENST00000594083.1_Missense_Mutation_p.S302C|ZNF615_ENST00000391795.3_Missense_Mutation_p.S296C			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CCACATTGGCTACATGTGTAA	0.423																																					p.S302C		Atlas-SNP	.											.	ZNF615	111	.	0			c.A904T						.						178.0	162.0	168.0					19																	52497458		2203	4300	6503	SO:0001583	missense	284370	exon7			ATTGGCTACATGT	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.871A>T	chr19.hg19:g.52497458T>A	ENSP00000473089:p.Ser291Cys	67.0	0.0		52.0	16.0	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Missense_Mutation	SNP	ENST00000602063.1	hg19	CCDS12846.1	.	.	.	.	.	.	.	.	.	.	T	12.23	1.875090	0.33162	.	.	ENSG00000197619	ENST00000376716;ENST00000354939;ENST00000391795;ENST00000391793	T;T	0.08008	3.14;3.14	3.09	3.09	0.35607	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15565	0.0375	M	0.75777	2.31	0.09310	N	1	P;P;P;P	0.51449	0.945;0.932;0.932;0.945	P;P;P;P	0.51415	0.669;0.54;0.54;0.669	T	0.22243	-1.0222	9	0.72032	D	0.01	.	2.6581	0.05018	0.2287:0.1276:0.0:0.6437	.	296;298;302;291	B4DH87;Q8N8J6-3;Q8N8J6-2;Q8N8J6	.;.;.;ZN615_HUMAN	C	291;301;296;301	ENSP00000365906:S291C;ENSP00000375672:S296C	ENSP00000347019:S301C	S	-	1	0	ZNF615	57189270	0.000000	0.05858	0.118000	0.21660	0.739000	0.42172	-0.873000	0.04214	1.402000	0.46780	0.454000	0.30748	AGC	.	.		0.423	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
ZNF415	55786	hgsc.bcm.edu	37	19	53611940	53611940	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:53611940G>T	ENST00000500065.4	-	4	1691	c.1358C>A	c.(1357-1359)tCg>tAg	p.S453*	ZNF415_ENST00000440291.1_Nonsense_Mutation_p.S440*|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000448501.1_Nonsense_Mutation_p.S501*|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000601493.1_Nonsense_Mutation_p.S223*|ZNF415_ENST00000243643.4_Nonsense_Mutation_p.S453*|ZNF415_ENST00000421033.1_Nonsense_Mutation_p.S465*|ZNF415_ENST00000455735.2_Nonsense_Mutation_p.S501*	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	501					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		AGTTAAGTTCGAATGCACACT	0.428																																					p.S453X		Atlas-SNP	.											.	ZNF415	68	.	0			c.C1358A						.						198.0	176.0	183.0					19																	53611940		2203	4300	6503	SO:0001587	stop_gained	55786	exon4			AAGTTCGAATGCA	AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.1358C>A	chr19.hg19:g.53611940G>T	ENSP00000439435:p.Ser453*	91.0	0.0		100.0	21.0	NM_018355	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Nonsense_Mutation	SNP	ENST00000500065.4	hg19	CCDS54313.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492457	0.84962	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	.	.	.	2.51	1.44	0.22558	.	.	.	.	.	.	.	.	.	.	.	0.49687	D	0.999816	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.1407	0.31082	0.1313:0.0:0.8687:0.0	.	.	.	.	X	453;453;501;465;501;440	.	ENSP00000243643:S453X	S	-	2	0	ZNF415	58303752	0.000000	0.05858	0.000000	0.03702	0.109000	0.19521	-0.228000	0.09114	0.395000	0.25257	0.313000	0.20887	TCG	.	.		0.428	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000464043.1	NM_018355	
ZNF665	79788	hgsc.bcm.edu	37	19	53668306	53668306	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:53668306A>T	ENST00000600412.1	-	2	1357	c.1242T>A	c.(1240-1242)atT>atA	p.I414I	ZNF665_ENST00000396424.3_Silent_p.I479I|CTD-2245F17.2_ENST00000600257.1_RNA			Q9H7R5	ZN665_HUMAN	zinc finger protein 665	414					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(10)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	35				GBM - Glioblastoma multiforme(134;0.0196)		CTCCAGAATGAATTCCCCGAT	0.418																																					p.I479I		Atlas-SNP	.											.	ZNF665	136	.	0			c.T1437A						.						87.0	90.0	89.0					19																	53668306		2203	4300	6503	SO:0001819	synonymous_variant	79788	exon4			AGAATGAATTCCC		CCDS46169.1	19q13.42	2013-01-08				ENSG00000197497		"""Zinc fingers, C2H2-type"", ""-"""	25885	protein-coding gene	gene with protein product							Standard	NM_024733		Approved	FLJ14345	uc010eqm.1	Q9H7R5		ENST00000600412.1:c.1242T>A	chr19.hg19:g.53668306A>T		79.0	0.0		63.0	21.0	NM_024733	A8K5T8	Silent	SNP	ENST00000600412.1	hg19																																																																																				.	.		0.418	ZNF665-002	PUTATIVE	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000464179.1	NM_024733	
PRKCG	5582	hgsc.bcm.edu	37	19	54401692	54401692	+	Splice_Site	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:54401692A>T	ENST00000263431.3	+	11	1374		c.e11-1		PRKCG_ENST00000536044.1_Splice_Site|PRKCG_ENST00000540413.1_Splice_Site|PRKCG_ENST00000542049.1_Splice_Site	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma						activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CTGTGCGCATAGGTGATGCTG	0.592																																					.		Atlas-SNP	.											.	PRKCG	246	.	0			c.1093-2A>T						.						55.0	50.0	52.0					19																	54401692		2203	4300	6503	SO:0001630	splice_region_variant	5582	exon11			GCGCATAGGTGAT	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1093-1A>T	chr19.hg19:g.54401692A>T		163.0	0.0		151.0	46.0	NM_002739	B7Z8Q0	Splice_Site	SNP	ENST00000263431.3	hg19	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	A	23.0	4.357590	0.82243	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.0909	0.59166	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PRKCG	59093504	1.000000	0.71417	0.988000	0.46212	0.844000	0.47949	9.169000	0.94788	2.044000	0.60594	0.459000	0.35465	.	.	.		0.592	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	Intron
NLRP2	55655	hgsc.bcm.edu	37	19	55512159	55512159	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr19:55512159A>T	ENST00000543010.1	+	13	3225	c.3082A>T	c.(3082-3084)Aat>Tat	p.N1028Y	NLRP2_ENST00000448584.2_Missense_Mutation_p.N1028Y|NLRP2_ENST00000263437.6_Missense_Mutation_p.N1025Y|NLRP2_ENST00000427260.2_Missense_Mutation_p.N1005Y|NLRP2_ENST00000339757.7_Missense_Mutation_p.N1006Y|NLRP2_ENST00000391721.4_Missense_Mutation_p.N1004Y|NLRP2_ENST00000538819.1_Missense_Mutation_p.N1004Y|NLRP2_ENST00000537859.1_Missense_Mutation_p.N1006Y	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	1028					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		TGATGAACTCAATAAGCTGCT	0.388																																					p.N1028Y		Atlas-SNP	.											.	NLRP2	161	.	0			c.A3082T						.						89.0	86.0	87.0					19																	55512159		2203	4300	6503	SO:0001583	missense	55655	exon13			GAACTCAATAAGC	AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.3082A>T	chr19.hg19:g.55512159A>T	ENSP00000445135:p.Asn1028Tyr	92.0	0.0		88.0	19.0	NM_017852	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	ENST00000543010.1	hg19	CCDS12913.1	.	.	.	.	.	.	.	.	.	.	A	8.280	0.815264	0.16607	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.51817	0.69;0.69;0.69;0.69;0.69;0.69;0.69;0.69	3.24	-2.68	0.06041	.	.	.	.	.	T	0.26593	0.0650	L	0.36672	1.1	0.09310	N	1	B;B;B;B;B	0.29909	0.17;0.261;0.17;0.261;0.17	B;B;B;B;B	0.27076	0.035;0.047;0.035;0.076;0.035	T	0.31696	-0.9934	9	0.02654	T	1	.	6.4428	0.21859	0.5213:0.3113:0.1675:0.0	.	1005;1006;1025;1004;1028	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	Y	1028;1004;1006;1028;1006;1005;1004;1025	ENSP00000445135:N1028Y;ENSP00000375601:N1004Y;ENSP00000344074:N1006Y;ENSP00000409370:N1028Y;ENSP00000440601:N1006Y;ENSP00000402474:N1005Y;ENSP00000441133:N1004Y;ENSP00000263437:N1025Y	ENSP00000263437:N1025Y	N	+	1	0	NLRP2	60203971	0.009000	0.17119	0.000000	0.03702	0.000000	0.00434	-0.284000	0.08422	-0.263000	0.09378	-1.621000	0.00791	AAT	.	.		0.388	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396152.1	NM_017852	
NRSN2	80023	hgsc.bcm.edu	37	20	333979	333979	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:333979A>T	ENST00000382291.3	+	4	555	c.315A>T	c.(313-315)gcA>gcT	p.A105A	NRSN2_ENST00000608736.1_Intron|NRSN2_ENST00000382285.2_Silent_p.A105A|NRSN2_ENST00000492242.1_3'UTR	NM_024958.2	NP_079234.1	Q9GZP1	NRSN2_HUMAN	neurensin 2	105						integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|transport vesicle (GO:0030133)				endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	8		all_cancers(10;0.0834)				ATCAGCGGGCAGCCGACTACA	0.642																																					p.A105A		Atlas-SNP	.											.	NRSN2	20	.	0			c.A315T						.						71.0	66.0	67.0					20																	333979		2203	4300	6503	SO:0001819	synonymous_variant	80023	exon4			GCGGGCAGCCGAC	AL136915	CCDS12996.1	20p13	2008-02-04	2006-07-04	2006-07-04	ENSG00000125841	ENSG00000125841			16229	protein-coding gene	gene with protein product		610666	"""chromosome 20 open reading frame 98"""	C20orf98		16527258	Standard	NM_024958		Approved	dJ1103G7.6	uc002wdi.4	Q9GZP1	OTTHUMG00000031628	ENST00000382291.3:c.315A>T	chr20.hg19:g.333979A>T		79.0	0.0		97.0	18.0	NM_024958	A8K3B2|Q6FII5|Q9NUD3	Silent	SNP	ENST00000382291.3	hg19	CCDS12996.1																																																																																			.	.		0.642	NRSN2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077446.1	NM_024958	
ANKEF1	63926	hgsc.bcm.edu	37	20	10033917	10033917	+	Silent	SNP	A	A	G	rs199615882		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:10033917A>G	ENST00000378380.3	+	8	2357	c.2028A>G	c.(2026-2028)aaA>aaG	p.K676K	SNAP25-AS1_ENST00000421143.2_RNA|ANKEF1_ENST00000378392.1_Silent_p.K676K|ANKEF1_ENST00000488991.1_3'UTR|SNAP25-AS1_ENST00000603542.1_RNA	NM_198798.1	NP_942093.1	Q9NU02	ANKE1_HUMAN	ankyrin repeat and EF-hand domain containing 1	676							calcium ion binding (GO:0005509)										AAATTAAGAAAGAAGAGGTAA	0.358																																					p.K676K		Atlas-SNP	.											.	.	.	.	0			c.A2028G						.						91.0	92.0	92.0					20																	10033917		2203	4299	6502	SO:0001819	synonymous_variant	63926	exon8			TAAGAAAGAAGAG	AK025322	CCDS13108.1	20p12.2	2013-01-11	2013-01-11	2013-01-11	ENSG00000132623	ENSG00000132623		"""EF-hand domain containing"", ""Ankyrin repeat domain containing"""	15803	protein-coding gene	gene with protein product			"""ankyrin repeat domain 5"""	ANKRD5		17142250	Standard	NM_022096		Approved	FLJ21669, dJ839B4.6	uc002wnp.3	Q9NU02	OTTHUMG00000031860	ENST00000378380.3:c.2028A>G	chr20.hg19:g.10033917A>G		126.0	0.0		165.0	68.0	NM_198798	B3KUQ0|Q9H6Y9	Silent	SNP	ENST00000378380.3	hg19	CCDS13108.1																																																																																			.	A|0.999;G|0.001		0.358	ANKEF1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077968.2	NM_022096	
SUN5	140732	hgsc.bcm.edu	37	20	31572988	31572988	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:31572988T>A	ENST00000356173.3	-	12	993	c.901A>T	c.(901-903)Atg>Ttg	p.M301L	SUN5_ENST00000375523.3_Missense_Mutation_p.M276L	NM_080675.3	NP_542406.2	Q8TC36	SUN5_HUMAN	Sad1 and UNC84 domain containing 5	301	SUN. {ECO:0000255|PROSITE- ProRule:PRU00802}.				spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	25						GAGCCCTCCATGCCCTGTGGA	0.577																																					p.M301L		Atlas-SNP	.											.	SUN5	63	.	0			c.A901T						.						76.0	75.0	75.0					20																	31572988		2203	4300	6503	SO:0001583	missense	140732	exon12			CCTCCATGCCCTG	AL121756	CCDS13209.1	20q11.21	2010-01-27	2010-01-27	2010-01-27	ENSG00000167098	ENSG00000167098			16252	protein-coding gene	gene with protein product	"""testis and spermatogenesis related gene 4"""	613942	"""sperm associated antigen 4-like"""	SPAG4L		9691178, 10373309	Standard	NM_080675		Approved	dJ726C3.1, TSARG4	uc002wyi.3	Q8TC36	OTTHUMG00000032239	ENST00000356173.3:c.901A>T	chr20.hg19:g.31572988T>A	ENSP00000348496:p.Met301Leu	109.0	0.0		106.0	18.0	NM_080675	A6NJ82|Q5T9R0	Missense_Mutation	SNP	ENST00000356173.3	hg19	CCDS13209.1	.	.	.	.	.	.	.	.	.	.	T	2.808	-0.247585	0.05867	.	.	ENSG00000167098	ENST00000356173;ENST00000375523	T;T	0.79845	-1.31;-1.31	5.67	0.672	0.17935	Sad1/UNC-like, C-terminal (2);	0.490007	0.23189	N	0.050921	T	0.34424	0.0897	N	0.00193	-1.875	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.45026	-0.9289	10	0.02654	T	1	-18.4525	2.9582	0.05883	0.3095:0.1708:0.0:0.5197	.	301	Q8TC36	SUN5_HUMAN	L	301;276	ENSP00000348496:M301L;ENSP00000364673:M276L	ENSP00000348496:M301L	M	-	1	0	SUN5	31036649	0.998000	0.40836	0.999000	0.59377	0.812000	0.45895	0.104000	0.15313	0.050000	0.15949	0.459000	0.35465	ATG	.	.		0.577	SUN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078659.1	NM_080675	
BPIFA1	51297	hgsc.bcm.edu	37	20	31829908	31829908	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:31829908T>A	ENST00000354297.4	+	7	784	c.713T>A	c.(712-714)cTg>cAg	p.L238Q	BPIFA1_ENST00000375422.2_Missense_Mutation_p.L238Q|BPIFA1_ENST00000375413.4_Missense_Mutation_p.L238Q	NM_130852.2	NP_570913.1	Q9NP55	BPIA1_HUMAN	BPI fold containing family A, member 1	238					antibacterial humoral response (GO:0019731)|innate immune response (GO:0045087)|multicellular organismal water homeostasis (GO:0050891)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|regulation of liquid surface tension (GO:0050828)|regulation of sodium ion transmembrane transport (GO:1902305)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	lipid binding (GO:0008289)										GACATCACCCTGGTGCATGAC	0.557																																					p.L238Q		Atlas-SNP	.											.	.	.	.	0			c.T713A						.						132.0	95.0	107.0					20																	31829908		2203	4300	6503	SO:0001583	missense	51297	exon7			TCACCCTGGTGCA	AB024937	CCDS13217.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000198183	ENSG00000198183		"""BPI fold containing"""	15749	protein-coding gene	gene with protein product		607412	"""palate, lung and nasal epithelium carcinoma associated"", ""palate, lung and nasal epithelium associated"""	PLUNC		11018263, 11251963, 21787333	Standard	NM_130852		Approved	LUNX, bA49G10.5, SPLUNC1	uc002wyv.3	Q9NP55	OTTHUMG00000032243	ENST00000354297.4:c.713T>A	chr20.hg19:g.31829908T>A	ENSP00000346251:p.Leu238Gln	85.0	0.0		69.0	9.0	NM_016583	A8K9R3|E1P5M9|Q9NZT0	Missense_Mutation	SNP	ENST00000354297.4	hg19	CCDS13217.1	.	.	.	.	.	.	.	.	.	.	t	14.82	2.649171	0.47362	.	.	ENSG00000198183	ENST00000375422;ENST00000354297;ENST00000375413;ENST00000544328	T;T;T	0.05717	3.4;3.4;3.4	5.31	5.31	0.75309	.	0.277700	0.25625	N	0.029383	T	0.21761	0.0524	M	0.67953	2.075	0.30949	N	0.725008	D	0.89917	1.0	D	0.83275	0.996	T	0.03761	-1.1006	10	0.72032	D	0.01	-4.6099	11.6146	0.51080	0.0:0.0:0.0:1.0	.	238	Q9NP55	BPIA1_HUMAN	Q	238;238;238;224	ENSP00000364571:L238Q;ENSP00000346251:L238Q;ENSP00000364562:L238Q	ENSP00000346251:L238Q	L	+	2	0	BPIFA1	31293569	0.978000	0.34361	0.672000	0.29872	0.299000	0.27559	3.429000	0.52800	2.237000	0.73441	0.473000	0.43528	CTG	.	.		0.557	BPIFA1-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078667.2	NM_130852	
EMILIN3	90187	hgsc.bcm.edu	37	20	39993757	39993757	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:39993757T>G	ENST00000332312.3	-	2	400	c.208A>C	c.(208-210)Atc>Ctc	p.I70L		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	70	EMI. {ECO:0000255|PROSITE- ProRule:PRU00384}.					cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				TCCTGTAGGATGCAGGTCACA	0.592																																					p.I70L		Atlas-SNP	.											.	EMILIN3	63	.	0			c.A208C						.						192.0	146.0	162.0					20																	39993757		2203	4300	6503	SO:0001583	missense	90187	exon2			GTAGGATGCAGGT	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.208A>C	chr20.hg19:g.39993757T>G	ENSP00000332806:p.Ile70Leu	75.0	0.0		68.0	12.0	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	ENST00000332312.3	hg19	CCDS13316.1	.	.	.	.	.	.	.	.	.	.	T	16.13	3.036510	0.54896	.	.	ENSG00000183798	ENST00000332312	T	0.40476	1.03	4.48	-4.09	0.03951	EMI domain (2);	0.751776	0.13062	N	0.416849	T	0.26629	0.0651	L	0.29908	0.895	0.24495	N	0.994282	B	0.20052	0.041	B	0.18263	0.021	T	0.22417	-1.0217	9	.	.	.	-7.1765	13.1667	0.59575	0.0:0.278:0.0:0.722	.	70	Q9NT22	EMIL3_HUMAN	L	70	ENSP00000332806:I70L	.	I	-	1	0	EMILIN3	39427171	0.000000	0.05858	0.710000	0.30468	0.976000	0.68499	-1.565000	0.02150	-0.607000	0.05738	-0.177000	0.13119	ATC	.	.		0.592	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
CHD6	84181	hgsc.bcm.edu	37	20	40127977	40127977	+	Silent	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:40127977T>A	ENST00000373233.3	-	6	1050	c.873A>T	c.(871-873)gcA>gcT	p.A291A	CHD6_ENST00000373222.3_Silent_p.A326A|CHD6_ENST00000309279.7_Silent_p.A291A	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	291	Required for DNA-dependent ATPase activity.				ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				CAATGATGTTTGCATCATCTT	0.378																																					p.A291A		Atlas-SNP	.											.	CHD6	312	.	0			c.A873T						.						67.0	56.0	59.0					20																	40127977		2203	4300	6503	SO:0001819	synonymous_variant	84181	exon6			GATGTTTGCATCA	AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.873A>T	chr20.hg19:g.40127977T>A		41.0	0.0		62.0	8.0	NM_032221	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	ENST00000373233.3	hg19	CCDS13317.1																																																																																			.	.		0.378	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079270.1		
BCAS1	8537	hgsc.bcm.edu	37	20	52601945	52601945	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:52601945T>A	ENST00000395961.3	-	7	1187	c.1021A>T	c.(1021-1023)Aaa>Taa	p.K341*	BCAS1_ENST00000371435.2_Nonsense_Mutation_p.K341*|BCAS1_ENST00000371440.3_Nonsense_Mutation_p.K386*|BCAS1_ENST00000434986.2_Nonsense_Mutation_p.K99*	NM_003657.2	NP_003648.2	O75363	BCAS1_HUMAN	breast carcinoma amplified sequence 1	341						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(23)|ovary(2)|skin(2)|stomach(1)|urinary_tract(1)	37	Breast(2;9.53e-15)|Lung NSC(4;5.57e-06)|all_lung(4;1.44e-05)		STAD - Stomach adenocarcinoma(23;0.116)|Colorectal(105;0.198)			TTGCATCCTTTGGAATTCTTG	0.542																																					p.K341X		Atlas-SNP	.											.	BCAS1	77	.	0			c.A1021T						.						233.0	211.0	219.0					20																	52601945		2203	4300	6503	SO:0001587	stop_gained	8537	exon7			ATCCTTTGGAATT	AF041260	CCDS13444.1	20q13.2	2006-11-10			ENSG00000064787	ENSG00000064787			974	protein-coding gene	gene with protein product		602968				9671742	Standard	NM_003657		Approved	NABC1, AIBC1	uc002xws.2	O75363	OTTHUMG00000032772	ENST00000395961.3:c.1021A>T	chr20.hg19:g.52601945T>A	ENSP00000379290:p.Lys341*	159.0	0.0		218.0	56.0	NM_003657	A0AVG5|Q68CZ3	Nonsense_Mutation	SNP	ENST00000395961.3	hg19	CCDS13444.1	.	.	.	.	.	.	.	.	.	.	T	33	5.238486	0.95240	.	.	ENSG00000064787	ENST00000448484;ENST00000371440;ENST00000448710;ENST00000395961;ENST00000371435;ENST00000434986	.	.	.	6.03	4.9	0.64082	.	0.066950	0.56097	D	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.7819	10.1586	0.42838	0.0:0.0:0.1675:0.8325	.	.	.	.	X	248;386;219;341;341;99	.	ENSP00000360490:K341X	K	-	1	0	BCAS1	52035352	0.981000	0.34729	0.082000	0.20525	0.008000	0.06430	0.860000	0.27871	1.052000	0.40392	0.533000	0.62120	AAA	.	.		0.542	BCAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079766.2	NM_003657	
ZBP1	81030	hgsc.bcm.edu	37	20	56188317	56188317	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:56188317T>A	ENST00000371173.3	-	5	749	c.572A>T	c.(571-573)cAg>cTg	p.Q191L	ZBP1_ENST00000538947.1_5'Flank|ZBP1_ENST00000340462.4_Missense_Mutation_p.Q168L|ZBP1_ENST00000541799.1_Missense_Mutation_p.Q191L|ZBP1_ENST00000343535.4_Missense_Mutation_p.Q191L|ZBP1_ENST00000395822.3_Missense_Mutation_p.Q116L	NM_001160417.1|NM_030776.2	NP_001153889.1|NP_110403.2	Q9H171	ZBP1_HUMAN	Z-DNA binding protein 1	191					innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|left-handed Z-DNA binding (GO:0003692)|RNA binding (GO:0003723)			large_intestine(11)|lung(8)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	27	Lung NSC(12;0.000545)|all_lung(29;0.00195)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(13;7.87e-13)|Epithelial(14;3.26e-09)|all cancers(14;3.62e-08)			GGGTCCATTCTGGCAGATCAT	0.443																																					p.Q191L		Atlas-SNP	.											.	ZBP1	65	.	0			c.A572T						.						217.0	188.0	198.0					20																	56188317		2203	4300	6503	SO:0001583	missense	81030	exon5			CCATTCTGGCAGA	AJ300575	CCDS13461.1, CCDS54477.1, CCDS54478.1	20q13.31	2009-08-21	2002-07-25	2002-07-26	ENSG00000124256	ENSG00000124256			16176	protein-coding gene	gene with protein product	"""DNA-dependent activator of IRFs"""	606750	"""chromosome 20 open reading frame 183"""	C20orf183		11842111	Standard	NM_030776		Approved	dJ718J7.3, DLM1, DLM-1, DAI	uc002xyo.3	Q9H171	OTTHUMG00000032824	ENST00000371173.3:c.572A>T	chr20.hg19:g.56188317T>A	ENSP00000360215:p.Gln191Leu	71.0	0.0		82.0	17.0	NM_001160419	A2A2F7|B3KVA1|F5GYT1|Q5JY39|Q9BYW4	Missense_Mutation	SNP	ENST00000371173.3	hg19	CCDS13461.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872716	0.51695	.	.	ENSG00000124256	ENST00000371173;ENST00000395822;ENST00000340462;ENST00000357677;ENST00000343535;ENST00000541799	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	3.36	3.36	0.38483	.	0.000000	0.41097	D	0.000953	T	0.54679	0.1873	L	0.54323	1.7	0.09310	N	0.999999	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.996;0.998;0.998;0.998	T	0.38134	-0.9675	10	0.87932	D	0	-24.968	8.4548	0.32893	0.0:0.0:0.0:1.0	.	191;191;116;191	F5GYT1;A2RRL9;A2A2F7;Q9H171	.;.;.;ZBP1_HUMAN	L	191;116;168;191;191;191	ENSP00000360215:Q191L;ENSP00000379167:Q116L;ENSP00000344954:Q168L;ENSP00000340584:Q191L;ENSP00000440552:Q191L	ENSP00000344954:Q168L	Q	-	2	0	ZBP1	55621723	0.845000	0.29573	0.142000	0.22268	0.011000	0.07611	1.637000	0.37155	1.781000	0.52344	0.379000	0.24179	CAG	.	.		0.443	ZBP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079849.1	NM_030776	
LAMA5	3911	hgsc.bcm.edu	37	20	60909582	60909582	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:60909582T>A	ENST00000252999.3	-	21	2644	c.2578A>T	c.(2578-2580)Agc>Tgc	p.S860C	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	860	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACCCACTCGCTGCAGGTGGGG	0.706																																					p.S860C		Atlas-SNP	.											.	LAMA5	268	.	0			c.A2578T						.						4.0	4.0	4.0					20																	60909582		1807	3504	5311	SO:0001583	missense	3911	exon21			ACTCGCTGCAGGT	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.2578A>T	chr20.hg19:g.60909582T>A	ENSP00000252999:p.Ser860Cys	117.0	0.0		115.0	25.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	t	17.60	3.429944	0.62844	.	.	ENSG00000130702	ENST00000252999	T	0.62232	0.04	4.79	2.45	0.29901	EGF-like, laminin (3);	0.172078	0.53938	D	0.000044	T	0.75715	0.3887	M	0.82132	2.575	0.80722	D	1	D	0.76494	0.999	D	0.68192	0.956	T	0.74671	-0.3587	10	0.72032	D	0.01	.	9.2157	0.37346	0.0:0.153:0.0:0.847	.	860	O15230	LAMA5_HUMAN	C	860	ENSP00000252999:S860C	ENSP00000252999:S860C	S	-	1	0	LAMA5	60342977	1.000000	0.71417	0.990000	0.47175	0.616000	0.37450	1.974000	0.40559	0.180000	0.19960	0.454000	0.30748	AGC	.	.		0.706	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
DIDO1	11083	hgsc.bcm.edu	37	20	61537425	61537425	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:61537425T>A	ENST00000266070.4	-	6	1727	c.1402A>T	c.(1402-1404)Aag>Tag	p.K468*	DIDO1_ENST00000370368.1_Nonsense_Mutation_p.K468*|DIDO1_ENST00000395343.1_Nonsense_Mutation_p.K468*|DIDO1_ENST00000395340.1_Nonsense_Mutation_p.K468*|DIDO1_ENST00000354665.4_Nonsense_Mutation_p.K468*|DIDO1_ENST00000370366.1_Nonsense_Mutation_p.K468*|DIDO1_ENST00000266071.5_Nonsense_Mutation_p.K468*|DIDO1_ENST00000395335.2_Nonsense_Mutation_p.K468*|DIDO1_ENST00000370371.4_Nonsense_Mutation_p.K468*	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	468					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GCTGGTCTCTTGTGCACAGAA	0.448																																					p.K468X	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											.	DIDO1	321	.	0			c.A1402T						.						85.0	94.0	91.0					20																	61537425		2203	4300	6503	SO:0001587	stop_gained	11083	exon6			GTCTCTTGTGCAC	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1402A>T	chr20.hg19:g.61537425T>A	ENSP00000266070:p.Lys468*	41.0	0.0		29.0	6.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Nonsense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	T	40	8.089264	0.98648	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335;ENST00000370371;ENST00000370368;ENST00000354665;ENST00000370366;ENST00000266071	.	.	.	5.82	5.82	0.92795	.	0.000000	0.41712	U	0.000823	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-58.5818	16.1778	0.81874	0.0:0.0:0.0:1.0	.	.	.	.	X	468	.	ENSP00000266070:K468X	K	-	1	0	DIDO1	61007870	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.015000	0.64035	2.225000	0.72522	0.459000	0.35465	AAG	.	.		0.448	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
SAMSN1	64092	hgsc.bcm.edu	37	21	15954542	15954542	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr21:15954542A>T	ENST00000285670.2	-	2	350	c.176T>A	c.(175-177)gTt>gAt	p.V59D	SAMSN1-AS1_ENST00000449214.1_RNA	NM_001256370.1	NP_001243299.1	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	0					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		CCAGGGTCCAACTTGTGCTAT	0.458																																					p.V59D		Atlas-SNP	.											.	SAMSN1	112	.	0			c.T176A						.																																			SO:0001583	missense	64092	exon2			GGTCCAACTTGTG	AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000285670.2:c.176T>A	chr21.hg19:g.15954542A>T	ENSP00000285670:p.Val59Asp	127.0	0.0		61.0	24.0	NM_001256370	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	ENST00000285670.2	hg19	CCDS58786.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.477|9.477	1.097205|1.097205	0.20552|0.20552	.|.	.|.	ENSG00000243440|ENSG00000155307	ENST00000442499;ENST00000389438|ENST00000285670	.|T	.|0.45668	.|0.89	5.65|5.65	-4.74|-4.74	0.03249|0.03249	.|.	.|1.039370	.|0.07706	.|N	.|0.941208	T|T	0.23886|0.23886	0.0578|0.0578	.|.	.|.	.|.	0.09310|0.09310	N|N	0.999995|0.999995	.|P	.|0.37636	.|0.603	.|B	.|0.40009	.|0.316	T|T	0.24440|0.24440	-1.0160|-1.0160	4|9	.|0.12430	.|T	.|0.62	-13.9629|-13.9629	7.7986|7.7986	0.29162|0.29162	0.5109:0.2659:0.2233:0.0|0.5109:0.2659:0.2233:0.0	.|.	.|59	.|F8WAA1	.|.	R|D	266;145|59	.|ENSP00000285670:V59D	.|ENSP00000285670:V59D	S|V	-|-	3|2	2|0	AF165138.7|SAMSN1	14876413|14876413	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.006000|0.006000	0.05464|0.05464	-1.248000|-1.248000	0.02890|0.02890	-0.665000|-0.665000	0.05317|0.05317	-0.960000|-0.960000	0.02634|0.02634	AGT|GTT	.	.		0.458	SAMSN1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000157913.1		
JAM2	58494	hgsc.bcm.edu	37	21	27062287	27062287	+	Splice_Site	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr21:27062287T>C	ENST00000480456.1	+	3	791		c.e3+2		JAM2_ENST00000425221.2_Intron|JAM2_ENST00000400532.1_Splice_Site|JAM2_ENST00000312957.5_Splice_Site	NM_001270407.1|NM_021219.3	NP_001257336.1|NP_067042.1	P57087	JAM2_HUMAN	junctional adhesion molecule 2						blood coagulation (GO:0007596)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|single organismal cell-cell adhesion (GO:0016337)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|urinary_tract(1)	19						CTCTTCAAGGTAAGCAGCTGT	0.443																																					.		Atlas-SNP	.											.	JAM2	33	.	0			c.241+2T>C						.						98.0	100.0	99.0					21																	27062287		1889	4108	5997	SO:0001630	splice_region_variant	58494	exon3			TCAAGGTAAGCAG	AF255910	CCDS42911.1, CCDS58787.1, CCDS58788.1	21q21.2	2013-01-11			ENSG00000154721	ENSG00000154721		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	14686	protein-coding gene	gene with protein product		606870		C21orf43		10779521, 10945976	Standard	NM_021219		Approved	VE-JAM, JAM-B, JAMB, CD322	uc031rvc.1	P57087	OTTHUMG00000078441	ENST00000480456.1:c.241+2T>C	chr21.hg19:g.27062287T>C		70.0	0.0		32.0	9.0	NM_021219	B2R6T9|B4DGT9|Q6UXG6|Q6YNC1	Splice_Site	SNP	ENST00000480456.1	hg19	CCDS42911.1	.	.	.	.	.	.	.	.	.	.	T	15.64	2.892368	0.52121	.	.	ENSG00000154721	ENST00000480456;ENST00000400533;ENST00000400532;ENST00000400537;ENST00000312957	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.4919	0.50385	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	JAM2	25984158	1.000000	0.71417	1.000000	0.80357	0.766000	0.43426	3.827000	0.55745	2.279000	0.76181	0.528000	0.53228	.	.	.		0.443	JAM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171347.1		Intron
APP	351	hgsc.bcm.edu	37	21	27269958	27269958	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr21:27269958T>A	ENST00000346798.3	-	16	2024	c.1991A>T	c.(1990-1992)gAg>gTg	p.E664V	APP_ENST00000359726.3_Missense_Mutation_p.E608V|APP_ENST00000357903.3_Missense_Mutation_p.E645V|APP_ENST00000440126.3_Missense_Mutation_p.E640V|APP_ENST00000439274.2_Missense_Mutation_p.E608V|APP_ENST00000348990.5_Missense_Mutation_p.E589V|APP_ENST00000358918.3_Missense_Mutation_p.E646V|APP_ENST00000448388.2_Missense_Mutation_p.E554V|APP_ENST00000354192.3_Missense_Mutation_p.E533V	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	664					adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				AGAGATCTCCTCCGTCTTGAT	0.343																																					p.E664V		Atlas-SNP	.											.	APP	90	.	0			c.A1991T						.						174.0	166.0	169.0					21																	27269958		2203	4300	6503	SO:0001583	missense	351	exon16			ATCTCCTCCGTCT	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.1991A>T	chr21.hg19:g.27269958T>A	ENSP00000284981:p.Glu664Val	104.0	0.0		45.0	12.0	NM_000484	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	ENST00000346798.3	hg19	CCDS13576.1	.	.	.	.	.	.	.	.	.	.	T	15.67	2.901836	0.52227	.	.	ENSG00000142192	ENST00000346798;ENST00000354192;ENST00000348990;ENST00000357903;ENST00000358918;ENST00000359726;ENST00000448388;ENST00000440126;ENST00000439274;ENST00000456209	D;D;D;D;D;D;D;D;D;D	0.96774	-2.16;-4.12;-4.11;-2.17;-1.91;-4.11;-4.11;-2.17;-2.16;-3.23	5.5	5.5	0.81552	.	0.057723	0.64402	D	0.000001	D	0.96390	0.8822	L	0.46157	1.445	0.80722	D	1	D;D;P;D;P;P;D	0.57899	0.968;0.973;0.816;0.981;0.884;0.884;0.973	P;P;B;P;B;B;P	0.57101	0.655;0.786;0.186;0.813;0.344;0.344;0.786	D	0.96232	0.9169	10	0.48119	T	0.1	-23.0203	15.4312	0.75102	0.0:0.0:0.0:1.0	.	554;608;640;533;589;645;664	E9PEV0;E9PG40;B4DII8;P05067-10;P05067-4;P05067-8;P05067	.;.;.;.;.;.;A4_HUMAN	V	664;533;589;645;646;608;554;640;608;233	ENSP00000284981:E664V;ENSP00000346129:E533V;ENSP00000345463:E589V;ENSP00000350578:E645V;ENSP00000351796:E646V;ENSP00000352760:E608V;ENSP00000388538:E554V;ENSP00000387483:E640V;ENSP00000398879:E608V;ENSP00000397795:E233V	ENSP00000284981:E664V	E	-	2	0	APP	26191829	1.000000	0.71417	0.972000	0.41901	0.908000	0.53690	5.046000	0.64226	2.310000	0.77875	0.450000	0.29827	GAG	.	.		0.343	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
PDE9A	5152	hgsc.bcm.edu	37	21	44192597	44192597	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr21:44192597A>T	ENST00000291539.6	+	19	1795	c.1735A>T	c.(1735-1737)Aga>Tga	p.R579*	PDE9A_ENST00000398227.3_Nonsense_Mutation_p.R419*|PDE9A_ENST00000380328.2_Nonsense_Mutation_p.R526*|PDE9A_ENST00000328862.6_Nonsense_Mutation_p.R553*|PDE9A_ENST00000398225.3_Nonsense_Mutation_p.R538*|PDE9A_ENST00000398224.3_Nonsense_Mutation_p.R452*|PDE9A_ENST00000398232.3_Nonsense_Mutation_p.R512*|PDE9A_ENST00000349112.3_Nonsense_Mutation_p.R451*|PDE9A_ENST00000398236.3_Nonsense_Mutation_p.R493*|PDE9A_ENST00000539837.1_Nonsense_Mutation_p.R451*|PDE9A_ENST00000398234.3_Nonsense_Mutation_p.R478*|PDE9A_ENST00000398229.3_Nonsense_Mutation_p.R445*|PDE9A_ENST00000470987.1_3'UTR|PDE9A_ENST00000335512.4_Nonsense_Mutation_p.R519*|PDE9A_ENST00000335440.6_Nonsense_Mutation_p.R477*	NM_002606.2	NP_002597.1	O76083	PDE9A_HUMAN	phosphodiesterase 9A	579					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|metabolic process (GO:0008152)|signal transduction (GO:0007165)	cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(6)|lung(8)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	27					Caffeine(DB00201)	CGAGAAGTCCAGAGAGAGAAG	0.498																																					p.R579X		Atlas-SNP	.											.	PDE9A	69	.	0			c.A1735T						.						76.0	61.0	66.0					21																	44192597		2202	4300	6502	SO:0001587	stop_gained	5152	exon19			AAGTCCAGAGAGA	AF048837	CCDS13690.1, CCDS33567.1, CCDS33568.1, CCDS33569.1, CCDS33570.1, CCDS33571.1, CCDS42941.1, CCDS42942.1, CCDS42943.1, CCDS42944.1, CCDS42945.1, CCDS42946.1, CCDS42947.1	21q22.3	2005-11-29			ENSG00000160191	ENSG00000160191	3.1.4.17	"""Phosphodiesterases"""	8795	protein-coding gene	gene with protein product		602973				9624146	Standard	NM_001001584		Approved		uc002zbm.3	O76083	OTTHUMG00000086825	ENST00000291539.6:c.1735A>T	chr21.hg19:g.44192597A>T	ENSP00000291539:p.Arg579*	94.0	0.0		56.0	25.0	NM_002606	B2RBI5|B4DFI5|D3DSJ8|D3DSJ9|O75490|O75491|O95225|Q53Y40|Q5QD39|Q86SF7|Q86SI6|Q86SJ3|Q86WN3|Q86WN4|Q86WN5|Q86WN6|Q86WN7|Q86WN8|Q86WN9|Q86WP0	Nonsense_Mutation	SNP	ENST00000291539.6	hg19	CCDS13690.1	.	.	.	.	.	.	.	.	.	.	A	23.6	4.431880	0.83776	.	.	ENSG00000160191	ENST00000335512;ENST00000539837;ENST00000291539;ENST00000380328;ENST00000398232;ENST00000398234;ENST00000398236;ENST00000328862;ENST00000335440;ENST00000398225;ENST00000398229;ENST00000398227;ENST00000349112;ENST00000398224	.	.	.	3.4	0.951	0.19579	.	148.372000	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	3.2296	0.06744	0.5568:0.2142:0.229:0.0	.	.	.	.	X	519;451;579;526;512;478;493;553;477;538;445;419;451;452	.	ENSP00000291539:R579X	R	+	1	2	PDE9A	43065666	0.024000	0.19004	0.022000	0.16811	0.111000	0.19643	0.487000	0.22356	0.189000	0.20188	0.454000	0.30748	AGA	.	.		0.498	PDE9A-016	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000195466.1		
CDC45	8318	hgsc.bcm.edu	37	22	19495303	19495303	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:19495303A>T	ENST00000407835.1	+	13	1227	c.971A>T	c.(970-972)cAg>cTg	p.Q324L	CDC45_ENST00000404724.3_Missense_Mutation_p.Q278L|CDC45_ENST00000263201.1_Missense_Mutation_p.Q324L|CDC45_ENST00000437685.2_Missense_Mutation_p.Q356L			O75419	CDC45_HUMAN	cell division cycle 45	324					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)	19						CCCCTGAAGCAGGTGAAGCAG	0.483																																					p.Q356L		Atlas-SNP	.											.	CDC45	48	.	0			c.A1067T						.						100.0	96.0	98.0					22																	19495303		2203	4300	6503	SO:0001583	missense	8318	exon13			TGAAGCAGGTGAA	AF053074	CCDS13762.1, CCDS54499.1, CCDS54500.1	22q11.21	2013-01-17	2013-01-17	2010-03-24	ENSG00000093009	ENSG00000093009			1739	protein-coding gene	gene with protein product	"""human CDC45"""	603465	"""CDC45 (cell division cycle 45, S.cerevisiae, homolog)-like"", ""CDC45 cell division cycle 45-like (S. cerevisiae)"", ""cell division cycle 45 homolog (S. cerevisiae)"""	CDC45L2, CDC45L		9660782, 9724329, 17608804	Standard	NM_001178010		Approved		uc011aha.2	O75419	OTTHUMG00000150386	ENST00000407835.1:c.971A>T	chr22.hg19:g.19495303A>T	ENSP00000385240:p.Gln324Leu	100.0	0.0		63.0	26.0	NM_001178010	B4DDB4|B4DDU3|E9PDH7|O60856|Q20WK8|Q6UW54|Q9UP68	Missense_Mutation	SNP	ENST00000407835.1	hg19	CCDS13762.1	.	.	.	.	.	.	.	.	.	.	A	28.8	4.951828	0.92660	.	.	ENSG00000093009	ENST00000407835;ENST00000437685;ENST00000263201;ENST00000404724	T;T;T;T	0.25579	1.79;1.79;1.79;1.79	5.26	5.26	0.73747	.	0.050750	0.85682	D	0.000000	T	0.54663	0.1872	M	0.86420	2.815	0.80722	D	1	P;D;D;P;P	0.60575	0.931;0.963;0.988;0.931;0.931	P;D;P;P;P	0.64321	0.816;0.924;0.903;0.816;0.751	T	0.63773	-0.6561	10	0.87932	D	0	-25.5348	15.3365	0.74260	1.0:0.0:0.0:0.0	.	356;319;278;356;324	E9PDH7;B4E092;B4DDB4;B4DDU3;O75419	.;.;.;.;CDC45_HUMAN	L	324;356;324;278	ENSP00000385240:Q324L;ENSP00000405726:Q356L;ENSP00000263201:Q324L;ENSP00000384978:Q278L	ENSP00000263201:Q324L	Q	+	2	0	CDC45	17875303	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	8.761000	0.91691	2.208000	0.71279	0.459000	0.35465	CAG	.	.		0.483	CDC45-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000317903.1	NM_003504	
GGT5	2687	hgsc.bcm.edu	37	22	24629895	24629895	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:24629895T>A	ENST00000327365.4	-	2	667	c.251A>T	c.(250-252)cAg>cTg	p.Q84L	GGT5_ENST00000263112.7_Missense_Mutation_p.Q84L|GGT5_ENST00000418439.2_Intron|GGT5_ENST00000398292.3_Missense_Mutation_p.Q84L	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	84					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						GCCCATGCTCTGAGGGTTGAC	0.612																																					p.Q84L		Atlas-SNP	.											.	GGT5	61	.	0			c.A251T						.						111.0	90.0	97.0					22																	24629895		2203	4300	6503	SO:0001583	missense	2687	exon2			ATGCTCTGAGGGT	M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.251A>T	chr22.hg19:g.24629895T>A	ENSP00000330080:p.Gln84Leu	120.0	0.0		67.0	28.0	NM_001099782	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	ENST00000327365.4	hg19	CCDS13825.1	.	.	.	.	.	.	.	.	.	.	T	23.3	4.398051	0.83120	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000398292	T;T;T	0.07021	3.23;3.23;3.23	4.87	4.87	0.63330	.	0.062767	0.64402	D	0.000004	T	0.35711	0.0941	M	0.91920	3.255	0.80722	D	1	P;D;P;D	0.89917	0.908;1.0;0.943;1.0	P;D;P;D	0.87578	0.847;0.998;0.857;0.998	T	0.41324	-0.9515	10	0.72032	D	0.01	-49.8574	12.755	0.57331	0.0:0.0:0.0:1.0	.	84;84;84;84	P36269-2;Q53XM9;Q6GMP0;P36269	.;.;.;GGT5_HUMAN	L	84	ENSP00000330080:Q84L;ENSP00000263112:Q84L;ENSP00000381340:Q84L	ENSP00000263112:Q84L	Q	-	2	0	GGT5	22959895	1.000000	0.71417	1.000000	0.80357	0.735000	0.41995	7.515000	0.81761	1.983000	0.57843	0.254000	0.18369	CAG	.	.		0.612	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000320119.1	NM_004121	
PLA2G3	50487	hgsc.bcm.edu	37	22	31536135	31536135	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:31536135T>A	ENST00000215885.3	-	1	458	c.206A>T	c.(205-207)cAg>cTg	p.Q69L		NM_015715.3	NP_056530.2	Q9NZ20	PA2G3_HUMAN	phospholipase A2, group III	69					acrosome assembly (GO:0001675)|cilium morphogenesis (GO:0060271)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|lipoxygenase pathway (GO:0019372)|mast cell degranulation (GO:0043303)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|sperm axoneme assembly (GO:0007288)	centriole (GO:0005814)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			large_intestine(1)|lung(10)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	18						GCTACATGACTGCAGCCTCCT	0.647																																					p.Q69L		Atlas-SNP	.											.,2	PLA2G3	85	.	0			c.A206T						.						67.0	70.0	69.0					22																	31536135		2203	4300	6503	SO:0001583	missense	50487	exon1			CATGACTGCAGCC	AF220490	CCDS13889.1	22q12.2	2008-09-19			ENSG00000100078	ENSG00000100078	3.1.1.4		17934	protein-coding gene	gene with protein product		611651				10713052	Standard	NM_015715		Approved	GIII-SPLA2	uc003aka.3	Q9NZ20	OTTHUMG00000151255	ENST00000215885.3:c.206A>T	chr22.hg19:g.31536135T>A	ENSP00000215885:p.Gln69Leu	43.0	0.0		34.0	14.0	NM_015715	O95768	Missense_Mutation	SNP	ENST00000215885.3	hg19	CCDS13889.1	.	.	.	.	.	.	.	.	.	.	T	2.916	-0.224345	0.06061	.	.	ENSG00000100078	ENST00000215885	T	0.09723	2.95	5.69	2.31	0.28768	.	0.500789	0.20316	N	0.094725	T	0.05731	0.0150	L	0.36672	1.1	0.30895	N	0.729934	B	0.18610	0.029	B	0.15052	0.012	T	0.38693	-0.9649	10	0.02654	T	1	-3.1582	2.9736	0.05930	0.2278:0.2007:0.0:0.5715	.	69	Q9NZ20	PA2G3_HUMAN	L	69	ENSP00000215885:Q69L	ENSP00000215885:Q69L	Q	-	2	0	PLA2G3	29866135	0.676000	0.27567	0.334000	0.25495	0.645000	0.38454	0.489000	0.22387	0.455000	0.26910	0.533000	0.62120	CAG	.	.		0.647	PLA2G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321938.1	NM_015715	
DEPDC5	9681	hgsc.bcm.edu	37	22	32293526	32293526	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:32293526A>T	ENST00000382112.3	+	39	4305	c.4235A>T	c.(4234-4236)gAg>gTg	p.E1412V	DEPDC5_ENST00000400249.2_Missense_Mutation_p.E1390V|DEPDC5_ENST00000535622.1_Missense_Mutation_p.E1321V|DEPDC5_ENST00000382111.2_Missense_Mutation_p.E1421V|DEPDC5_ENST00000400246.1_Missense_Mutation_p.E1421V|DEPDC5_ENST00000539165.1_Missense_Mutation_p.E238V|DEPDC5_ENST00000400248.2_Missense_Mutation_p.E1390V|DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000266091.3_Missense_Mutation_p.E1399V	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1421					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CCAGTTTTGGAGGGGCCTTTT	0.537																																					p.E1421V		Atlas-SNP	.											.	DEPDC5	266	.	0			c.A4262T						.						118.0	116.0	117.0					22																	32293526		1929	4123	6052	SO:0001583	missense	9681	exon40			TTTTGGAGGGGCC	AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4235A>T	chr22.hg19:g.32293526A>T	ENSP00000371546:p.Glu1412Val	110.0	0.0		65.0	22.0	NM_001242896	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	ENST00000382112.3	hg19	CCDS46692.1	.	.	.	.	.	.	.	.	.	.	a	22.6	4.314148	0.81358	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000400246;ENST00000382112;ENST00000382111;ENST00000400248;ENST00000539165	T;T;T;T;T;T;T	0.35605	1.3;1.72;1.73;1.72;1.73;1.72;1.73	5.61	5.61	0.85477	.	0.052668	0.64402	D	0.000001	T	0.45816	0.1361	L	0.31664	0.95	0.80722	D	1	D;D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;0.999;0.999	D;D;D;D;D;D	0.91635	0.994;0.996;0.999;0.996;0.991;0.991	T	0.25293	-1.0136	10	0.15066	T	0.55	.	14.9748	0.71264	1.0:0.0:0.0:0.0	.	1421;1321;807;1399;1412;1390	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	V	1321;1399;1390;1321;1421;1412;1421;1390;238	ENSP00000440210:E1321V;ENSP00000266091:E1399V;ENSP00000383108:E1390V;ENSP00000383105:E1421V;ENSP00000371546:E1412V;ENSP00000371545:E1421V;ENSP00000383107:E1390V	ENSP00000266091:E1399V	E	+	2	0	DEPDC5	30623526	1.000000	0.71417	0.714000	0.30535	0.883000	0.51084	8.948000	0.93006	2.139000	0.66308	0.454000	0.30748	GAG	.	.		0.537	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000129087.1	NM_014662	
CSF2RB	1439	hgsc.bcm.edu	37	22	37318309	37318309	+	Silent	SNP	C	C	T	rs200588212	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:37318309C>T	ENST00000403662.3	+	2	282	c.60C>T	c.(58-60)agC>agT	p.S20S	CSF2RB_ENST00000262825.5_Silent_p.S20S|CSF2RB_ENST00000406230.1_Silent_p.S20S|CSF2RB_ENST00000536485.1_5'Flank			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	20					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GGGAGCGCAGCCTGGCAGGGG	0.682																																					p.S20S		Atlas-SNP	.											.	CSF2RB	104	.	0			c.C60T						.						21.0	19.0	20.0					22																	37318309		2200	4291	6491	SO:0001819	synonymous_variant	1439	exon2			GCGCAGCCTGGCA	M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.60C>T	chr22.hg19:g.37318309C>T		108.0	0.0		77.0	28.0	NM_000395	Q5JZI1|Q6ICE0	Silent	SNP	ENST00000403662.3	hg19	CCDS13936.1																																																																																			.	C|0.999;A|0.001		0.682	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318854.1	NM_000395	
PICK1	9463	hgsc.bcm.edu	37	22	38461007	38461007	+	Splice_Site	SNP	A	A	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:38461007A>C	ENST00000404072.3	+	4	500		c.e4-1		PICK1_ENST00000356976.3_Splice_Site|RP5-1039K5.13_ENST00000445483.1_RNA|PICK1_ENST00000468288.1_Splice_Site	NM_001039583.1|NM_001039584.1	NP_001034672.1|NP_001034673.1	Q9NRD5	PICK1_HUMAN	protein interacting with PRKCA 1						ATP catabolic process (GO:0006200)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|dendritic spine maintenance (GO:0097062)|dendritic spine organization (GO:0097061)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|glial cell development (GO:0021782)|long term synaptic depression (GO:0060292)|monoamine transport (GO:0015844)|negative regulation of Arp2/3 complex-mediated actin nucleation (GO:0034316)|neuronal ion channel clustering (GO:0045161)|positive regulation of receptor internalization (GO:0002092)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)|protein targeting (GO:0006605)|receptor clustering (GO:0043113)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endocytic vesicle membrane (GO:0030666)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	actin filament binding (GO:0051015)|Arp2/3 complex binding (GO:0071933)|ATPase activity (GO:0016887)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein kinase C binding (GO:0005080)|receptor binding (GO:0005102)			cervix(1)|endometrium(3)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	Melanoma(58;0.045)					ATGCACCCACAGGTATTTGAC	0.552																																					.		Atlas-SNP	.											.	PICK1	30	.	0			c.154-2A>C						.						137.0	114.0	122.0					22																	38461007		2203	4300	6503	SO:0001630	splice_region_variant	9463	exon4			ACCCACAGGTATT	AL049654	CCDS13965.1	22q13.1	2006-02-14	2006-02-14	2006-02-14	ENSG00000100151	ENSG00000100151			9394	protein-coding gene	gene with protein product		605926	"""protein kinase C, alpha binding protein"", ""protein interacting with PRKCA"""	PRKCABP		10340301, 10591208	Standard	XM_006724377		Approved	dJ1039K5, MGC15204	uc003aus.3	Q9NRD5	OTTHUMG00000151159	ENST00000404072.3:c.154-1A>C	chr22.hg19:g.38461007A>C		135.0	0.0		66.0	23.0	NM_012407	B3KS52|O95906	Splice_Site	SNP	ENST00000404072.3	hg19	CCDS13965.1	.	.	.	.	.	.	.	.	.	.	A	19.90	3.913455	0.72983	.	.	ENSG00000100151	ENST00000404072;ENST00000424694;ENST00000437453;ENST00000356976;ENST00000435166	.	.	.	5.12	5.12	0.69794	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.2435	0.73488	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PICK1	36790953	1.000000	0.71417	0.992000	0.48379	0.903000	0.53119	9.030000	0.93725	2.071000	0.62044	0.460000	0.39030	.	.	.		0.552	PICK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321569.2	NM_012407	Intron
PARVB	29780	hgsc.bcm.edu	37	22	44547368	44547368	+	Silent	SNP	C	C	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:44547368C>A	ENST00000338758.7	+	10	843	c.780C>A	c.(778-780)ctC>ctA	p.L260L	PARVB_ENST00000406477.3_Silent_p.L293L|PARVB_ENST00000404989.1_Silent_p.L223L	NM_013327.4	NP_037459.2	Q9HBI1	PARVB_HUMAN	parvin, beta	260	CH 2. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton reorganization (GO:0031532)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell projection assembly (GO:0030031)|establishment or maintenance of cell polarity regulating cell shape (GO:0071963)|lamellipodium assembly (GO:0030032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(3)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Ovarian(80;0.0246)|all_neural(38;0.0423)				GGCAGTCTCTCATCACTTTTG	0.522																																					p.L293L		Atlas-SNP	.											.	PARVB	44	.	0			c.C879A						.						124.0	104.0	111.0					22																	44547368		2203	4300	6503	SO:0001819	synonymous_variant	29780	exon11			GTCTCTCATCACT	AF151814	CCDS14056.1, CCDS46724.1, CCDS58808.1, CCDS74874.1	22q13.2-q13.33	2013-01-24			ENSG00000188677	ENSG00000188677		"""Parvins"""	14653	protein-coding gene	gene with protein product	"""affixin"""	608121				10810093, 11171322	Standard	NM_001003828		Approved	CGI-56	uc003ben.3	Q9HBI1	OTTHUMG00000150665	ENST00000338758.7:c.780C>A	chr22.hg19:g.44547368C>A		92.0	0.0		38.0	15.0	NM_001003828	B0QYM8|B0QYN1|B2R9X6|Q5TGJ5|Q86X93|Q96PN1|Q9NSP7|Q9UGT3|Q9Y368|Q9Y3L6|Q9Y3L7	Silent	SNP	ENST00000338758.7	hg19	CCDS14056.1																																																																																			.	.		0.522	PARVB-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319518.2	NM_001003828	
IL17REL	400935	hgsc.bcm.edu	37	22	50439576	50439576	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr22:50439576A>T	ENST00000389983.2	-	4	308	c.44T>A	c.(43-45)aTg>aAg	p.M15K	IL17REL_ENST00000341280.5_Missense_Mutation_p.M15K	NM_001001694.2	NP_001001694.2	Q6ZVW7	I17EL_HUMAN	interleukin 17 receptor E-like	15										endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GACACACTGCATGGCAGTGGA	0.632																																					p.M15K		Atlas-SNP	.											.	IL17REL	21	.	0			c.T44A						.						43.0	35.0	38.0					22																	50439576		2196	4294	6490	SO:0001583	missense	400935	exon4			CACTGCATGGCAG	AK123987	CCDS33679.1	22q13.33	2009-01-13			ENSG00000188263	ENSG00000188263			33808	protein-coding gene	gene with protein product		613414					Standard	NM_001001694		Approved	FLJ41993	uc003bje.1	Q6ZVW7	OTTHUMG00000150242	ENST00000389983.2:c.44T>A	chr22.hg19:g.50439576A>T	ENSP00000374633:p.Met15Lys	153.0	0.0		103.0	41.0	NM_001001694	A6NCN4|A6PVC1	Missense_Mutation	SNP	ENST00000389983.2	hg19	CCDS33679.1	.	.	.	.	.	.	.	.	.	.	a	14.89	2.671916	0.47781	.	.	ENSG00000188263	ENST00000389983;ENST00000341280	T;T	0.27402	1.67;1.67	3.16	2.06	0.26882	.	0.282230	0.31897	U	0.006891	T	0.37705	0.1013	L	0.47716	1.5	0.09310	N	1	D	0.69078	0.997	P	0.62184	0.899	T	0.05435	-1.0885	10	0.66056	D	0.02	.	5.1524	0.15017	0.8518:0.0:0.1482:0.0	.	15	Q6ZVW7	I17EL_HUMAN	K	15	ENSP00000374633:M15K;ENSP00000342520:M15K	ENSP00000342520:M15K	M	-	2	0	IL17REL	48781703	0.724000	0.28038	0.031000	0.17742	0.003000	0.03518	1.722000	0.38042	1.303000	0.44873	0.529000	0.55759	ATG	.	.		0.632	IL17REL-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317011.1	NM_001001694	
ASMTL	8623	hgsc.bcm.edu	37	X	1531641	1531641	+	Silent	SNP	G	G	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:1531641G>A	ENST00000381317.3	-	12	1661	c.1629C>T	c.(1627-1629)gcC>gcT	p.A543A	ASMTL-AS1_ENST00000602357.1_RNA|ASMTL_ENST00000534940.1_Silent_p.A485A|ASMTL-AS1_ENST00000420411.2_RNA|ASMTL_ENST00000416733.2_Silent_p.A467A|ASMTL_ENST00000381333.4_Silent_p.A527A|ASMTL-AS1_ENST00000425740.2_RNA|ASMTL-AS1_ENST00000419737.2_RNA	NM_004192.3	NP_004183.2	O95671	ASML_HUMAN	acetylserotonin O-methyltransferase-like	543	ASMT-like.					cytoplasm (GO:0005737)	O-methyltransferase activity (GO:0008171)			NS(1)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(9)|pancreas(1)|soft_tissue(1)	23		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				TGCAGCTCTCGGCGACCCTGC	0.562																																					p.A543A		Atlas-SNP	.											.	ASMTL	56	.	0			c.C1629T						.						189.0	204.0	199.0					X																	1531641		2052	4199	6251	SO:0001819	synonymous_variant	8623	exon12			GCTCTCGGCGACC	Y15521	CCDS43917.1, CCDS55362.1, CCDS55363.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000169093	ENSG00000169093		"""Pseudoautosomal regions / PAR1"""	751	protein-coding gene	gene with protein product		300162, 400011				9736779	Standard	NM_004192		Approved		uc004cpx.2	O95671	OTTHUMG00000021057	ENST00000381317.3:c.1629C>T	chrX.hg19:g.1531641G>A		715.0	1.0		501.0	96.0	NM_004192	B4DX75|F5GXH4|J3JS33|Q5JQ53|Q8NBH5|Q96G02|Q9BUL6	Silent	SNP	ENST00000381317.3	hg19	CCDS43917.1																																																																																			.	.		0.562	ASMTL-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055595.1	NM_004192	
ARHGAP6	395	hgsc.bcm.edu	37	X	11204488	11204488	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:11204488A>T	ENST00000337414.4	-	5	2013	c.1141T>A	c.(1141-1143)Tta>Ata	p.L381I	ARHGAP6_ENST00000303025.6_Missense_Mutation_p.L178I|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.L206I|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.L190I|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.L178I|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.L381I|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.L413I	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	381					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						GAAAGTTGTAAAGCTTCTAGT	0.443																																					p.L381I		Atlas-SNP	.											.	ARHGAP6	130	.	0			c.T1141A						.						155.0	140.0	145.0					X																	11204488		2203	4300	6503	SO:0001583	missense	395	exon5			GTTGTAAAGCTTC	AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1141T>A	chrX.hg19:g.11204488A>T	ENSP00000338967:p.Leu381Ile	67.0	0.0		62.0	31.0	NM_006125	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	ENST00000337414.4	hg19	CCDS14140.1	.	.	.	.	.	.	.	.	.	.	A	23.7	4.446378	0.84101	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.31769	1.51;1.56;1.56;1.49;1.52;1.48;1.6;1.7	5.51	1.92	0.25849	.	0.000000	0.38217	N	0.001764	T	0.45498	0.1345	M	0.62723	1.935	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.994;1.0;0.998;0.997;0.997	T	0.32025	-0.9922	10	0.51188	T	0.08	.	6.3189	0.21206	0.5005:0.0:0.4995:0.0	.	190;178;381;381;381	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	I	206;178;178;381;217;381;190;413	ENSP00000438135:L206I;ENSP00000370112:L178I;ENSP00000302312:L178I;ENSP00000338967:L381I;ENSP00000370093:L217I;ENSP00000370094:L381I;ENSP00000389394:L190I;ENSP00000370108:L413I	ENSP00000302312:L178I	L	-	1	2	ARHGAP6	11114409	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	3.246000	0.51414	0.736000	0.32559	0.486000	0.48141	TTA	.	.		0.443	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055760.2	NM_013427	
TLR7	51284	hgsc.bcm.edu	37	X	12906214	12906214	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:12906214T>A	ENST00000380659.3	+	3	2726	c.2587T>A	c.(2587-2589)Tat>Aat	p.Y863N		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	863					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	AAGTCACCTCTATTTCTGGGA	0.398																																					p.Y863N		Atlas-SNP	.											.	TLR7	125	.	0			c.T2587A						.						213.0	186.0	195.0					X																	12906214		2203	4300	6503	SO:0001583	missense	51284	exon3			CACCTCTATTTCT	AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.2587T>A	chrX.hg19:g.12906214T>A	ENSP00000370034:p.Tyr863Asn	62.0	0.0		94.0	52.0	NM_016562	D1CS69|Q9NR98	Missense_Mutation	SNP	ENST00000380659.3	hg19	CCDS14151.1	.	.	.	.	.	.	.	.	.	.	T	16.82	3.229808	0.58777	.	.	ENSG00000196664	ENST00000380659	T	0.36157	1.27	5.62	5.62	0.85841	.	0.135968	0.50627	D	0.000105	T	0.47967	0.1474	M	0.61703	1.905	0.44129	D	0.996912	P	0.46621	0.881	P	0.49597	0.616	T	0.51553	-0.8691	10	0.87932	D	0	.	14.8622	0.70389	0.0:0.0:0.0:1.0	.	863	Q9NYK1	TLR7_HUMAN	N	863	ENSP00000370034:Y863N	ENSP00000370034:Y863N	Y	+	1	0	TLR7	12816135	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.994000	0.88315	1.891000	0.54761	0.430000	0.28490	TAT	.	.		0.398	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055769.1	NM_016562	
BEND2	139105	hgsc.bcm.edu	37	X	18183181	18183181	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:18183181A>T	ENST00000380033.4	-	14	2480	c.2348T>A	c.(2347-2349)cTg>cAg	p.L783Q		NM_153346.4	NP_699177.2	Q8NDZ0	BEND2_HUMAN	BEN domain containing 2	783										NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(11)|liver(1)|lung(21)|ovary(3)|prostate(1)	49						CTCCTGCTCCAGCTCTGGAGG	0.512																																					p.L783Q		Atlas-SNP	.											.	BEND2	108	.	0			c.T2348A						.						131.0	124.0	127.0					X																	18183181		2203	4300	6503	SO:0001583	missense	139105	exon14			TGCTCCAGCTCTG	AK128155	CCDS14184.1, CCDS55375.1	Xp22.22	2012-11-22	2008-10-03	2008-10-03	ENSG00000177324	ENSG00000177324		"""BEN domain containing"""	28509	protein-coding gene	gene with protein product			"""chromosome X open reading frame 20"""	CXorf20		12477932	Standard	NM_153346		Approved	MGC33653	uc004cyj.4	Q8NDZ0	OTTHUMG00000021211	ENST00000380033.4:c.2348T>A	chrX.hg19:g.18183181A>T	ENSP00000369372:p.Leu783Gln	39.0	0.0		46.0	20.0	NM_153346	E9PFY2|Q4V9S2|Q5JXE5	Missense_Mutation	SNP	ENST00000380033.4	hg19	CCDS14184.1	.	.	.	.	.	.	.	.	.	.	a	0.017	-1.506811	0.00992	.	.	ENSG00000177324	ENST00000380033	T	0.34667	1.35	0.217	-0.433	0.12287	.	18.757500	0.00166	N	0.000000	T	0.18425	0.0442	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11203	-1.0597	9	0.39692	T	0.17	.	.	.	.	.	783	Q8NDZ0	BEND2_HUMAN	Q	783	ENSP00000369372:L783Q	ENSP00000369372:L783Q	L	-	2	0	BEND2	18093102	0.007000	0.16637	0.001000	0.08648	0.001000	0.01503	-0.075000	0.11431	-2.468000	0.00531	-2.476000	0.00200	CTG	.	.		0.512	BEND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055940.1	NM_153346	
MAP3K15	389840	hgsc.bcm.edu	37	X	19418698	19418698	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:19418698A>T	ENST00000338883.4	-	14	1927	c.1928T>A	c.(1927-1929)tTg>tAg	p.L643*	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000469203.2_Nonsense_Mutation_p.L475*|MAP3K15_ENST00000359173.3_Nonsense_Mutation_p.L78*	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	643							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					ACTCACCTCCAAGGTGTCTCC	0.428																																					p.L643X		Atlas-SNP	.											.	MAP3K15	108	.	0			c.T1928A						.						372.0	320.0	338.0					X																	19418698		2203	4300	6503	SO:0001587	stop_gained	389840	exon14			ACCTCCAAGGTGT	AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.1928T>A	chrX.hg19:g.19418698A>T	ENSP00000345629:p.Leu643*	19.0	0.0		25.0	6.0	NM_001001671	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Nonsense_Mutation	SNP	ENST00000338883.4	hg19		.	.	.	.	.	.	.	.	.	.	A	39	7.349449	0.98228	.	.	ENSG00000180815	ENST00000338883;ENST00000359173;ENST00000469203	.	.	.	5.28	5.28	0.74379	.	0.072738	0.56097	D	0.000024	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3447	0.66651	1.0:0.0:0.0:0.0	.	.	.	.	X	643;78;475	.	ENSP00000345629:L643X	L	-	2	0	MAP3K15	19328619	1.000000	0.71417	0.969000	0.41365	0.961000	0.63080	8.465000	0.90383	1.766000	0.52107	0.483000	0.47432	TTG	.	.		0.428	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001001671	
POLA1	5422	hgsc.bcm.edu	37	X	24757522	24757522	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:24757522A>T	ENST00000379059.3	+	20	2068	c.2053A>T	c.(2053-2055)Acc>Tcc	p.T685S	POLA1_ENST00000379068.3_Missense_Mutation_p.T691S	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	685	DNA-binding region. {ECO:0000255}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	AAGAAATGCTACCTGTGGTCG	0.393																																					p.T685S		Atlas-SNP	.											.	POLA1	117	.	0			c.A2053T						.						140.0	125.0	130.0					X																	24757522		2203	4300	6503	SO:0001583	missense	5422	exon20			AATGCTACCTGTG		CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2053A>T	chrX.hg19:g.24757522A>T	ENSP00000368349:p.Thr685Ser	126.0	0.0		134.0	54.0	NM_016937	Q86UQ7	Missense_Mutation	SNP	ENST00000379059.3	hg19	CCDS14214.1	.	.	.	.	.	.	.	.	.	.	A	12.68	2.010841	0.35511	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.43294	0.95;0.95	5.19	2.82	0.32997	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.156412	0.64402	D	0.000017	T	0.41994	0.1183	M	0.74881	2.28	0.48288	D	0.999625	B	0.33448	0.412	B	0.37731	0.257	T	0.31052	-0.9957	10	0.46703	T	0.11	-7.6036	5.8972	0.18945	0.6205:0.0:0.3795:0.0	.	685	P09884	DPOLA_HUMAN	S	691;685	ENSP00000368358:T691S;ENSP00000368349:T685S	ENSP00000368349:T685S	T	+	1	0	POLA1	24667443	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.681000	0.46926	0.803000	0.34113	0.345000	0.21793	ACC	.	.		0.393	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000056111.1	NM_016937	
SHROOM4	57477	hgsc.bcm.edu	37	X	50377203	50377203	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:50377203G>T	ENST00000289292.7	-	4	2153	c.1870C>A	c.(1870-1872)Cag>Aag	p.Q624K	SHROOM4_ENST00000376020.2_Missense_Mutation_p.Q624K|SHROOM4_ENST00000460112.3_Missense_Mutation_p.Q508K			Q9ULL8	SHRM4_HUMAN	shroom family member 4	624					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGGGGCTCCTGGGTCTCTTCC	0.502																																					p.Q624K		Atlas-SNP	.											.	SHROOM4	171	.	0			c.C1870A						.						54.0	56.0	55.0					X																	50377203		2203	4300	6503	SO:0001583	missense	57477	exon4			GCTCCTGGGTCTC	AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.1870C>A	chrX.hg19:g.50377203G>T	ENSP00000289292:p.Gln624Lys	79.0	0.0		75.0	68.0	NM_020717	A7E2X9|D6RFW0|Q96LA0	Missense_Mutation	SNP	ENST00000289292.7	hg19	CCDS35277.1	.	.	.	.	.	.	.	.	.	.	G	7.983	0.751686	0.15778	.	.	ENSG00000158352	ENST00000289292;ENST00000376020;ENST00000460112	D;D;D	0.87650	-2.28;-2.28;-2.28	6.06	5.2	0.72013	.	0.294296	0.32608	N	0.005871	T	0.78767	0.4335	N	0.22421	0.69	0.35502	D	0.799852	B	0.17038	0.02	B	0.16722	0.016	T	0.76310	-0.3006	10	0.23891	T	0.37	.	13.0471	0.58933	0.0:0.7525:0.2475:0.0	.	624	Q9ULL8	SHRM4_HUMAN	K	624;624;508	ENSP00000289292:Q624K;ENSP00000365188:Q624K;ENSP00000421450:Q508K	ENSP00000289292:Q624K	Q	-	1	0	SHROOM4	50393943	0.972000	0.33761	0.904000	0.35570	0.546000	0.35178	2.742000	0.47434	1.316000	0.45131	0.600000	0.82982	CAG	.	.		0.502	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056564.4	NM_020717	
HUWE1	10075	hgsc.bcm.edu	37	X	53674399	53674399	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:53674399T>C	ENST00000342160.3	-	5	720	c.263A>G	c.(262-264)cAa>cGa	p.Q88R	HUWE1_ENST00000262854.6_Missense_Mutation_p.Q88R|HUWE1_ENST00000218328.8_Missense_Mutation_p.Q88R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	88					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATTTTCAGTTGCTCTCTTTC	0.488																																					p.Q88R		Atlas-SNP	.											.	HUWE1	724	.	0			c.A263G						.						169.0	137.0	148.0					X																	53674399		2203	4300	6503	SO:0001583	missense	10075	exon6			TTCAGTTGCTCTC	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.263A>G	chrX.hg19:g.53674399T>C	ENSP00000340648:p.Gln88Arg	132.0	0.0		126.0	106.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	17.03	3.284937	0.59867	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328;ENST00000432528;ENST00000446750	T;T;T	0.43688	1.25;1.25;0.94	5.6	5.6	0.85130	.	0.071005	0.56097	D	0.000028	T	0.36138	0.0956	L	0.47716	1.5	0.54753	D	0.999989	B	0.16166	0.016	B	0.12837	0.008	T	0.14559	-1.0468	10	0.18710	T	0.47	.	13.7065	0.62644	0.0:0.0:0.0:1.0	.	88	Q7Z6Z7	HUWE1_HUMAN	R	88	ENSP00000340648:Q88R;ENSP00000262854:Q88R;ENSP00000218328:Q88R	ENSP00000218328:Q88R	Q	-	2	0	HUWE1	53691124	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.841000	0.62824	1.881000	0.54492	0.486000	0.48141	CAA	.	.		0.488	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
HUWE1	10075	hgsc.bcm.edu	37	X	53674402	53674402	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:53674402T>C	ENST00000342160.3	-	5	717	c.260A>G	c.(259-261)gAg>gGg	p.E87G	HUWE1_ENST00000262854.6_Missense_Mutation_p.E87G|HUWE1_ENST00000218328.8_Missense_Mutation_p.E87G			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	87					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TTTCAGTTGCTCTCTTTCTGG	0.493																																					p.E87G		Atlas-SNP	.											.	HUWE1	724	.	0			c.A260G						.						175.0	142.0	153.0					X																	53674402		2203	4300	6503	SO:0001583	missense	10075	exon6			AGTTGCTCTCTTT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.260A>G	chrX.hg19:g.53674402T>C	ENSP00000340648:p.Glu87Gly	132.0	0.0		124.0	103.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.	.	.	.	.	.	.	.	.	.	T	13.91	2.376915	0.42105	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328;ENST00000432528;ENST00000446750	T;T;T	0.49432	1.08;1.08;0.78	5.6	5.6	0.85130	.	0.064924	0.64402	D	0.000010	T	0.24928	0.0605	N	0.02539	-0.55	0.38004	D	0.934338	B	0.12630	0.006	B	0.09377	0.004	T	0.13629	-1.0502	10	0.42905	T	0.14	.	13.7065	0.62644	0.0:0.0:0.0:1.0	.	87	Q7Z6Z7	HUWE1_HUMAN	G	87	ENSP00000340648:E87G;ENSP00000262854:E87G;ENSP00000218328:E87G	ENSP00000218328:E87G	E	-	2	0	HUWE1	53691127	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.369000	0.59511	1.881000	0.54492	0.486000	0.48141	GAG	.	.		0.493	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
HUWE1	10075	hgsc.bcm.edu	37	X	53674404	53674404	+	Silent	SNP	T	T	C			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:53674404T>C	ENST00000342160.3	-	5	715	c.258A>G	c.(256-258)agA>agG	p.R86R	HUWE1_ENST00000262854.6_Silent_p.R86R|HUWE1_ENST00000218328.8_Silent_p.R86R			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	86					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						TCAGTTGCTCTCTTTCTGGCC	0.493																																					p.R86R		Atlas-SNP	.											.	HUWE1	724	.	0			c.A258G						.						177.0	144.0	155.0					X																	53674404		2203	4300	6503	SO:0001819	synonymous_variant	10075	exon6			TTGCTCTCTTTCT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.258A>G	chrX.hg19:g.53674404T>C		133.0	0.0		125.0	104.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Silent	SNP	ENST00000342160.3	hg19	CCDS35301.1																																																																																			.	.		0.493	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
TEX11	56159	hgsc.bcm.edu	37	X	70072999	70072999	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:70072999A>T	ENST00000395889.2	-	8	610	c.455T>A	c.(454-456)cTg>cAg	p.L152Q	TEX11_ENST00000374333.2_Missense_Mutation_p.L137Q|TEX11_ENST00000344304.3_Missense_Mutation_p.L152Q	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	152					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TAATTGCTCCAGACTCTGGAA	0.398																																					p.L152Q		Atlas-SNP	.											.	TEX11	132	.	0			c.T455A						.						72.0	60.0	64.0					X																	70072999		2203	4300	6503	SO:0001583	missense	56159	exon8			TGCTCCAGACTCT	AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.455T>A	chrX.hg19:g.70072999A>T	ENSP00000379226:p.Leu152Gln	60.0	0.0		82.0	25.0	NM_001003811	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	ENST00000395889.2	hg19	CCDS35323.1	.	.	.	.	.	.	.	.	.	.	A	12.75	2.031672	0.35797	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000344304	T;T;T	0.38077	1.16;1.18;1.18	4.56	4.56	0.56223	Tetratricopeptide-like helical (1);	0.197085	0.33980	N	0.004373	T	0.50599	0.1625	L	0.49778	1.585	0.33362	D	0.572498	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.982	T	0.61705	-0.7008	9	.	.	.	-3.7026	11.0541	0.47907	1.0:0.0:0.0:0.0	.	137;152	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	Q	137;152;152	ENSP00000363453:L137Q;ENSP00000379226:L152Q;ENSP00000340995:L152Q	.	L	-	2	0	TEX11	69989724	1.000000	0.71417	0.937000	0.37676	0.044000	0.14063	4.476000	0.60216	1.810000	0.52873	0.432000	0.28606	CTG	.	.		0.398	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000359072.1		
ATRX	546	hgsc.bcm.edu	37	X	76872153	76872153	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:76872153C>G	ENST00000373344.5	-	22	5708	c.5494G>C	c.(5494-5496)Gaa>Caa	p.E1832Q	ATRX_ENST00000395603.3_Missense_Mutation_p.E1794Q|ATRX_ENST00000480283.1_5'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked	1832					ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.?(1)		bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AACACATATTCGTGTTTTGGA	0.313			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																														p.E1832Q		Atlas-SNP	.		Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	.	ATRX	833	.	1	Unknown(1)	bone(1)	c.G5494C						.						134.0	119.0	124.0					X																	76872153		2202	4291	6493	SO:0001583	missense	546	exon22			CATATTCGTGTTT	U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.5494G>C	chrX.hg19:g.76872153C>G	ENSP00000362441:p.Glu1832Gln	101.0	0.0		139.0	121.0	NM_000489	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	Missense_Mutation	SNP	ENST00000373344.5	hg19	CCDS14434.1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.761852	0.89932	.	.	ENSG00000085224	ENST00000373344;ENST00000395603	D;D	0.93906	-3.31;-3.31	5.77	5.77	0.91146	SNF2-related (1);	0.000000	0.85682	U	0.000000	D	0.97648	0.9229	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98411	1.0572	10	0.87932	D	0	-12.4853	18.9785	0.92747	0.0:1.0:0.0:0.0	.	1794;1832	P46100-4;P46100	.;ATRX_HUMAN	Q	1832;1794	ENSP00000362441:E1832Q;ENSP00000378967:E1794Q	ENSP00000362441:E1832Q	E	-	1	0	ATRX	76758809	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	7.463000	0.80869	2.430000	0.82344	0.544000	0.68410	GAA	.	.		0.313	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000058860.2	NM_000489	
CENPI	2491	hgsc.bcm.edu	37	X	100402946	100402947	+	Missense_Mutation	DNP	CA	CA	TC			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:100402946_100402947CA>TC	ENST00000372927.1	+	19	2167_2168	c.1890_1891CA>TC	c.(1888-1893)ttCAat>ttTCat	p.N631H	CENPI_ENST00000218507.5_Missense_Mutation_p.N631H|CENPI_ENST00000423383.1_Missense_Mutation_p.N631H	NM_006733.2	NP_006724.2	Q92674	CENPI_HUMAN	centromere protein I	631					CENP-A containing nucleosome assembly (GO:0034080)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)|sex differentiation (GO:0007548)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)				breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(19)|prostate(1)|skin(2)	30						AATCAGAGTTCAATTTCAGCAG	0.351																																					p.F630F|p.N631H		Atlas-SNP	.											.	CENPI	70	.	0			c.C1890T|c.A1891C						.																																			SO:0001583	missense	2491	exon19			AGAGTTCAATTTC|GAGTTCAATTTCA	X97249	CCDS14479.1	Xq22.1	2013-11-05	2006-06-15	2006-06-15	ENSG00000102384	ENSG00000102384			3968	protein-coding gene	gene with protein product		300065	"""FSH primary response (LRPR1, rat) homolog 1"", ""FSH primary response (LRPR1 homolog, rat) 1"""	FSHPRH1		16622420	Standard	NM_006733		Approved	LRPR1, CENP-I, Mis6	uc004egx.3	Q92674	OTTHUMG00000022018	Exception_encountered	chrX.hg19:g.100402946_100402947delinsTC	ENSP00000362018:p.Asn631His	144.0|146.0	0.0		149.0	67.0|66.0	NM_006733	Q5JWZ9|Q96ED0	Silent|Missense_Mutation	SNP	ENST00000372927.1	hg19	CCDS14479.1																																																																																			.	.		0.351	CENPI-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057519.1	NM_006733	
NXF3	56000	hgsc.bcm.edu	37	X	102338424	102338424	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:102338424A>T	ENST00000395065.3	-	5	543	c.442T>A	c.(442-444)Tat>Aat	p.Y148N	NXF3_ENST00000425644.1_5'UTR|NXF3_ENST00000425463.2_Missense_Mutation_p.Y59N	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3	148	RRM.				mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						ATGTTTTCATAGTGAAACTAT	0.468																																					p.Y148N		Atlas-SNP	.											.	NXF3	81	.	0			c.T442A						.						98.0	86.0	90.0					X																	102338424		2203	4300	6503	SO:0001583	missense	56000	exon5			TTTCATAGTGAAA	AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.442T>A	chrX.hg19:g.102338424A>T	ENSP00000378504:p.Tyr148Asn	69.0	0.0		78.0	37.0	NM_022052	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	ENST00000395065.3	hg19	CCDS14503.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.30|12.30	1.896354|1.896354	0.33442|0.33442	.|.	.|.	ENSG00000147206|ENSG00000147206	ENST00000427570|ENST00000395065;ENST00000425463	.|T;T	.|0.48522	.|0.81;0.81	3.64|3.64	3.64|3.64	0.41730|0.41730	.|Nuclear RNA export factor Tap, RNA-binding domain (2);Nucleotide-binding, alpha-beta plait (1);	.|0.353536	.|0.27932	.|N	.|0.017276	T|T	0.64757|0.64757	0.2627|0.2627	M|M	0.81802|0.81802	2.56|2.56	0.29047|0.29047	N|N	0.884745|0.884745	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.83275	.|0.996;0.996	T|T	0.59053|0.59053	-0.7526|-0.7526	5|10	.|0.37606	.|T	.|0.19	-2.3404|-2.3404	7.9073|7.9073	0.29769|0.29769	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|148;148	.|B4DYI1;Q9H4D5	.|.;NXF3_HUMAN	Q|N	24|148;59	.|ENSP00000378504:Y148N;ENSP00000404347:Y59N	.|ENSP00000378504:Y148N	L|Y	-|-	2|1	0|0	NXF3|NXF3	102225080|102225080	0.999000|0.999000	0.42202|0.42202	0.947000|0.947000	0.38551|0.38551	0.381000|0.381000	0.30169|0.30169	2.024000|2.024000	0.41049|0.41049	1.681000|1.681000	0.50988|0.50988	0.430000|0.430000	0.28490|0.28490	CTA|TAT	.	.		0.468	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057684.1	NM_022052	
ESX1	80712	hgsc.bcm.edu	37	X	103499021	103499021	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:103499021T>A	ENST00000372588.4	-	2	403	c.320A>T	c.(319-321)aAg>aTg	p.K107M		NM_153448.3	NP_703149.1	Q8N693	ESX1_HUMAN	ESX homeobox 1	107					labyrinthine layer blood vessel development (GO:0060716)|labyrinthine layer morphogenesis (GO:0060713)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)			endometrium(2)|large_intestine(10)|lung(12)|ovary(1)|skin(2)	27						CTGCTCTTGCTTCAGCTCGAG	0.711																																					p.K107M	Pancreas(200;1705 2227 25194 28471 45274)	Atlas-SNP	.											.	ESX1	57	.	0			c.A320T						.						32.0	38.0	36.0					X																	103499021		2195	4280	6475	SO:0001583	missense	80712	exon2			TCTTGCTTCAGCT	AL049631	CCDS14516.1	Xq22.2	2011-06-20	2007-07-11	2006-02-08	ENSG00000123576	ENSG00000123576		"""Homeoboxes / PRD class"""	14865	protein-coding gene	gene with protein product		300154	"""extraembryonic, spermatogenesis, homeobox 1 homolog (mouse)"""	ESX1L		11374906, 17242862	Standard	NM_153448		Approved	ESXR1	uc004ely.3	Q8N693	OTTHUMG00000022125	ENST00000372588.4:c.320A>T	chrX.hg19:g.103499021T>A	ENSP00000361669:p.Lys107Met	70.0	0.0		69.0	28.0	NM_153448	B0QYU3|Q7Z6K7	Missense_Mutation	SNP	ENST00000372588.4	hg19	CCDS14516.1	.	.	.	.	.	.	.	.	.	.	t	15.95	2.985050	0.53934	.	.	ENSG00000123576	ENST00000372588	D	0.91521	-2.86	4.11	-8.23	0.01033	.	.	.	.	.	D	0.82967	0.5152	N	0.08118	0	0.09310	N	1	D	0.67145	0.996	D	0.64506	0.926	T	0.74278	-0.3717	9	0.51188	T	0.08	.	0.6407	0.00810	0.1896:0.2354:0.2632:0.3118	.	107	Q8N693	ESX1_HUMAN	M	107	ENSP00000361669:K107M	ENSP00000361669:K107M	K	-	2	0	ESX1	103385677	0.000000	0.05858	0.000000	0.03702	0.268000	0.26511	-1.475000	0.02335	-2.262000	0.00690	0.144000	0.16011	AAG	.	.		0.711	ESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057763.2	NM_153448	
IL1RAPL2	26280	hgsc.bcm.edu	37	X	105011036	105011036	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:105011036A>T	ENST00000372582.1	+	11	2199	c.1443A>T	c.(1441-1443)agA>agT	p.R481S	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.R481S	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	481	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						ATATTCTCAGACGGGGATGGA	0.383																																					p.R481S		Atlas-SNP	.											.	IL1RAPL2	105	.	0			c.A1443T						.						91.0	84.0	86.0					X																	105011036		2203	4300	6503	SO:0001583	missense	26280	exon11			TCTCAGACGGGGA	AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.1443A>T	chrX.hg19:g.105011036A>T	ENSP00000361663:p.Arg481Ser	198.0	0.0		234.0	104.0	NM_017416	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	ENST00000372582.1	hg19	CCDS14517.1	.	.	.	.	.	.	.	.	.	.	A	15.90	2.968206	0.53614	.	.	ENSG00000189108	ENST00000372582;ENST00000344799;ENST00000538500	T;T;T	0.04156	3.69;3.69;3.69	5.39	4.26	0.50523	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.082759	0.52532	D	0.000076	T	0.05593	0.0147	L	0.35854	1.095	0.58432	D	0.999993	D	0.59357	0.985	P	0.52646	0.705	T	0.51164	-0.8740	10	0.11182	T	0.66	.	3.1573	0.06509	0.6055:0.0:0.3945:0.0	.	481	Q9NP60	IRPL2_HUMAN	S	481;481;86	ENSP00000361663:R481S;ENSP00000344976:R481S;ENSP00000445576:R86S	ENSP00000344976:R481S	R	+	3	2	IL1RAPL2	104897692	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.195000	0.58400	1.790000	0.52503	0.486000	0.48141	AGA	.	.		0.383	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057785.1	NM_017416	
COL4A5	1287	hgsc.bcm.edu	37	X	107823970	107823970	+	Splice_Site	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:107823970T>A	ENST00000361603.2	+	15	1135		c.e15+2		COL4A5_ENST00000328300.6_Splice_Site	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5						axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GGCAAAAGAGTAAGTGATGTA	0.378									Alport syndrome with Diffuse Leiomyomatosis																												.		Atlas-SNP	.											.	COL4A5	262	.	0			c.891+2T>A						.						152.0	151.0	151.0					X																	107823970		2203	4300	6503	SO:0001630	splice_region_variant	1287	exon15	Familial Cancer Database		AAAGAGTAAGTGA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.891+2T>A	chrX.hg19:g.107823970T>A		273.0	0.0		300.0	130.0	NM_033380	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Splice_Site	SNP	ENST00000361603.2	hg19	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.372040	0.82573	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6067	0.68483	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	COL4A5	107710626	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	6.732000	0.74790	1.829000	0.53265	0.486000	0.48141	.	.	.		0.378	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		Intron
GUCY2F	2986	hgsc.bcm.edu	37	X	108631785	108631785	+	Silent	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:108631785A>T	ENST00000218006.2	-	15	3180	c.2889T>A	c.(2887-2889)tcT>tcA	p.S963S		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	963	Guanylate cyclase. {ECO:0000255|PROSITE- ProRule:PRU00099}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						AAGTGCCCACAGAGCTCAGGA	0.488																																					p.S963S		Atlas-SNP	.											.	GUCY2F	178	.	0			c.T2889A						.						174.0	154.0	161.0					X																	108631785		2203	4300	6503	SO:0001819	synonymous_variant	2986	exon15			GCCCACAGAGCTC	L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2889T>A	chrX.hg19:g.108631785A>T		96.0	0.0		127.0	50.0	NM_001522	Q9UJF1	Silent	SNP	ENST00000218006.2	hg19	CCDS14545.1																																																																																			.	.		0.488	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057884.1	NM_001522	
KIAA1210	57481	hgsc.bcm.edu	37	X	118230582	118230582	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:118230582T>A	ENST00000402510.2	-	8	1140	c.1141A>T	c.(1141-1143)Agt>Tgt	p.S381C		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	381										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						TGGGTGCTACTGGTAGAGGCA	0.522																																					p.S381C		Atlas-SNP	.											.	KIAA1210	171	.	0			c.A1141T						.						83.0	84.0	84.0					X																	118230582		2066	4188	6254	SO:0001583	missense	57481	exon8			TGCTACTGGTAGA	AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.1141A>T	chrX.hg19:g.118230582T>A	ENSP00000384670:p.Ser381Cys	100.0	0.0		121.0	61.0	NM_020721	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	ENST00000402510.2	hg19	CCDS48156.1	.	.	.	.	.	.	.	.	.	.	T	14.03	2.412454	0.42817	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.16743	2.32	4.28	-2.12	0.07165	.	.	.	.	.	T	0.19685	0.0473	N	0.14661	0.345	0.09310	N	1	D	0.76494	0.999	D	0.68483	0.958	T	0.26258	-1.0108	9	0.59425	D	0.04	.	9.0514	0.36378	0.0:0.5937:0.0:0.4062	.	381	Q9ULL0	K1210_HUMAN	C	381;217	ENSP00000384670:S381C	ENSP00000396164:S217C	S	-	1	0	RP13-347D8.5;RP13-347D8.6	118114610	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.068000	0.14531	-0.427000	0.07350	-0.368000	0.07277	AGT	.	.		0.522	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000371251.2	NM_020721	
GPR112	139378	hgsc.bcm.edu	37	X	135431162	135431162	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:135431162A>T	ENST00000394143.1	+	6	5588	c.5297A>T	c.(5296-5298)cAg>cTg	p.Q1766L	GPR112_ENST00000287534.4_Missense_Mutation_p.Q1703L|GPR112_ENST00000394141.1_Missense_Mutation_p.Q1561L|GPR112_ENST00000370652.1_Missense_Mutation_p.Q1766L|GPR112_ENST00000412101.1_Missense_Mutation_p.Q1561L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1766					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TTCAATATTCAGGTTTCCCCA	0.388																																					p.Q1766L		Atlas-SNP	.											.	GPR112	459	.	0			c.A5297T						.						167.0	154.0	158.0					X																	135431162		2203	4300	6503	SO:0001583	missense	139378	exon6			ATATTCAGGTTTC	AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.5297A>T	chrX.hg19:g.135431162A>T	ENSP00000377699:p.Gln1766Leu	94.0	0.0		118.0	53.0	NM_153834	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	ENST00000394143.1	hg19	CCDS35409.1	.	.	.	.	.	.	.	.	.	.	a	11.98	1.800414	0.31869	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.38401	1.18;1.18;1.14;1.25;1.14	3.57	2.25	0.28309	.	.	.	.	.	T	0.23451	0.0567	L	0.32530	0.975	0.09310	N	1	B;P;P	0.44816	0.408;0.844;0.759	B;B;B	0.38616	0.086;0.277;0.143	T	0.10268	-1.0637	9	0.48119	T	0.1	.	5.0965	0.14737	0.734:0.0:0.0:0.266	.	1703;1561;1766	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	1766;1766;1561;1703;1561	ENSP00000377699:Q1766L;ENSP00000359686:Q1766L;ENSP00000416526:Q1561L;ENSP00000287534:Q1703L;ENSP00000377697:Q1561L	ENSP00000287534:Q1703L	Q	+	2	0	GPR112	135258828	0.170000	0.23016	0.007000	0.13788	0.176000	0.22953	4.467000	0.60155	1.252000	0.44001	0.372000	0.22366	CAG	.	.		0.388	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000286639.1		
GPR101	83550	hgsc.bcm.edu	37	X	136113821	136113821	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:136113821A>T	ENST00000298110.1	-	1	12	c.13T>A	c.(13-15)Tgc>Agc	p.C5S		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	5						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTGTTGGTGCAGGTGGACGTC	0.637																																					p.C5S		Atlas-SNP	.											.	GPR101	96	.	0			c.T13A						.						86.0	47.0	60.0					X																	136113821		2203	4300	6503	SO:0001583	missense	83550	exon1			TGGTGCAGGTGGA	AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.13T>A	chrX.hg19:g.136113821A>T	ENSP00000298110:p.Cys5Ser	23.0	0.0		20.0	9.0	NM_054021	Q5JSM8|Q8NG93	Missense_Mutation	SNP	ENST00000298110.1	hg19	CCDS14662.1	.	.	.	.	.	.	.	.	.	.	A	13.12	2.140917	0.37825	.	.	ENSG00000165370	ENST00000298110	T	0.64438	-0.1	4.64	2.14	0.27477	.	.	.	.	.	T	0.37100	0.0991	N	0.24115	0.695	0.22531	N	0.999019	B	0.34015	0.435	B	0.32393	0.145	T	0.15896	-1.0421	9	0.14656	T	0.56	-16.5905	0.7547	0.00996	0.475:0.2054:0.1185:0.2011	.	5	Q96P66	GP101_HUMAN	S	5	ENSP00000298110:C5S	ENSP00000298110:C5S	C	-	1	0	GPR101	135941487	0.007000	0.16637	0.539000	0.28077	0.583000	0.36354	0.233000	0.17911	1.627000	0.50400	0.441000	0.28932	TGC	.	.		0.637	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058519.1		
ATP2B3	492	hgsc.bcm.edu	37	X	152845550	152845550	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:152845550A>T	ENST00000349466.2	+	21	3783	c.3457A>T	c.(3457-3459)Acc>Tcc	p.T1153S	ATP2B3_ENST00000359149.3_3'UTR|ATP2B3_ENST00000263519.4_Missense_Mutation_p.T1153S|ATP2B3_ENST00000370181.2_3'UTR|ATP2B3_ENST00000370186.1_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1153					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAATGACTACACCCACAACAT	0.587																																					p.T1153S		Atlas-SNP	.											.	ATP2B3	552	.	0			c.A3457T						.						171.0	152.0	158.0					X																	152845550		2203	4300	6503	SO:0001583	missense	492	exon20			GACTACACCCACA	U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3457A>T	chrX.hg19:g.152845550A>T	ENSP00000343886:p.Thr1153Ser	119.0	0.0		140.0	59.0	NM_001001344	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	ENST00000349466.2	hg19	CCDS35440.1	.	.	.	.	.	.	.	.	.	.	a	11.83	1.756566	0.31137	.	.	ENSG00000067842	ENST00000349466;ENST00000263519	T;T	0.75938	-0.98;-0.98	5.02	5.02	0.67125	.	0.129231	0.50627	D	0.000107	T	0.62792	0.2457	L	0.36672	1.1	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.005;0.005	T	0.56914	-0.7900	10	0.12766	T	0.61	-44.2003	12.7904	0.57530	1.0:0.0:0.0:0.0	.	1139;1153	Q16720-4;Q16720	.;AT2B3_HUMAN	S	1153	ENSP00000343886:T1153S;ENSP00000263519:T1153S	ENSP00000263519:T1153S	T	+	1	0	ATP2B3	152498744	1.000000	0.71417	1.000000	0.80357	0.911000	0.54048	1.959000	0.40412	1.658000	0.50742	0.427000	0.28365	ACC	.	.		0.587	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060957.1	NM_021949	
DNASE1L1	1774	hgsc.bcm.edu	37	X	153631374	153631374	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chrX:153631374C>T	ENST00000393638.1	-	7	969	c.683G>A	c.(682-684)cGc>cAc	p.R228H	DNASE1L1_ENST00000369809.1_Missense_Mutation_p.R228H|SNORA70_ENST00000384436.1_RNA	NM_001009934.1	NP_001009934.1	P49184	DNSL1_HUMAN	deoxyribonuclease I-like 1	228					DNA metabolic process (GO:0006259)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			lung(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGCACGACGCGGTCATAGGT	0.652																																					p.R228H		Atlas-SNP	.											.	DNASE1L1	20	.	0			c.G683A						.						53.0	50.0	51.0					X																	153631374		2203	4299	6502	SO:0001583	missense	1774	exon7			ACGACGCGGTCAT	L40817	CCDS14747.1	Xq28	2008-02-05			ENSG00000013563	ENSG00000013563			2957	protein-coding gene	gene with protein product	"""DNase X"""	300081		DNL1L		8541839, 8654957	Standard	XM_005277829		Approved	DNAS1L1, XIB, DNASEX	uc004fkw.1	P49184	OTTHUMG00000033188	ENST00000393638.1:c.683G>A	chrX.hg19:g.153631374C>T	ENSP00000377255:p.Arg228His	47.0	0.0		53.0	47.0	NM_006730	D3DWW7|Q5HY41	Missense_Mutation	SNP	ENST00000393638.1	hg19	CCDS14747.1	.	.	.	.	.	.	.	.	.	.	C	16.73	3.203667	0.58234	.	.	ENSG00000013563	ENST00000369809;ENST00000393638;ENST00000014935;ENST00000369808;ENST00000369807;ENST00000309585	T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.38;-1.38	4.71	3.84	0.44239	Endonuclease/exonuclease/phosphatase (2);	0.054374	0.64402	N	0.000001	D	0.89487	0.6729	M	0.86805	2.84	0.39922	D	0.974161	D	0.89917	1.0	D	0.91635	0.999	D	0.90171	0.4235	10	0.87932	D	0	-0.0766	9.9673	0.41732	0.0:0.896:0.0:0.104	.	228	P49184	DNSL1_HUMAN	H	228	ENSP00000358824:R228H;ENSP00000377255:R228H;ENSP00000014935:R228H;ENSP00000358823:R228H;ENSP00000358822:R228H;ENSP00000309168:R228H	ENSP00000014935:R228H	R	-	2	0	DNASE1L1	153284568	1.000000	0.71417	0.428000	0.26697	0.088000	0.18126	4.515000	0.60489	0.898000	0.36418	0.597000	0.82753	CGC	.	.		0.652	DNASE1L1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080928.2		
PDRG1	81572	hgsc.bcm.edu	37	20	30539689	30539689	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr20:30539689delC	ENST00000202017.4	-	1	206	c.76delG	c.(76-78)gacfs	p.D26fs		NM_030815.2	NP_110442.1	Q9NUG6	PDRG1_HUMAN	p53 and DNA-damage regulated 1	26					protein folding (GO:0006457)	cytoplasm (GO:0005737)|prefoldin complex (GO:0016272)				endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	8			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGCCGCTTGTCCGCCAGCACC	0.701											OREG0025859	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.D26fs		Atlas-Indel,Pindel	.											.	PDRG1	17	.	0			c.77delA						.						20.0	18.0	19.0					20																	30539689		2199	4289	6488	SO:0001589	frameshift_variant	81572	exon1			.	AL031658	CCDS13194.1	20q11.21	2009-06-12	2009-06-12	2004-10-07	ENSG00000088356	ENSG00000088356			16119	protein-coding gene	gene with protein product		610789	"""chromosome 20 open reading frame 126"""	C20orf126		14562055	Standard	NM_030815		Approved	dJ310O13.3	uc002wxd.3	Q9NUG6	OTTHUMG00000032196	ENST00000202017.4:c.76delG	chr20.hg19:g.30539689delC	ENSP00000202017:p.Asp26fs	150.0	0.0	102	159.0	36.0	NM_030815	B2R511|Q96GP3|Q9BUW8	Frame_Shift_Del	DEL	ENST00000202017.4	hg19	CCDS13194.1																																																																																			.	.		0.701	PDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078593.2	NM_030815	
API5	8539	hgsc.bcm.edu	37	11	43350345	43350346	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:43350345_43350346insTA	ENST00000531273.1	+	9	1168_1169	c.1029_1030insTA	c.(1030-1032)gaafs	p.E344fs	API5_ENST00000420461.2_Frame_Shift_Ins_p.E290fs|API5_ENST00000378852.3_Frame_Shift_Ins_p.E344fs|API5_ENST00000534600.1_Frame_Shift_Ins_p.E344fs|RP11-484D2.2_ENST00000526220.1_RNA|API5_ENST00000534695.1_Intron|API5_ENST00000455725.2_Frame_Shift_Ins_p.E333fs|Y_RNA_ENST00000516843.1_RNA			Q9BZZ5	API5_HUMAN	apoptosis inhibitor 5	344	ARM-like and Heat-like helical repeats.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of fibroblast apoptotic process (GO:2000270)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	fibroblast growth factor binding (GO:0017134)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20						TCAGTTATGTGGAATGTTTGTT	0.406																																					p.V343fs	Pancreas(1;98 122 5625 20895 49453)	Atlas-Indel,Pindel	.											.	API5	91	.	0			c.1029_1030insTA						.																																			SO:0001589	frameshift_variant	8539	exon9			.	U83857	CCDS31465.1, CCDS44572.1, CCDS44573.1	11p12	2010-09-30			ENSG00000166181	ENSG00000166181			594	protein-coding gene	gene with protein product	"""API5-like 1"", ""fibroblast growth factor 2-interacting factor 2"", ""migration-inducing protein MIG8"""	609774				9307294	Standard	NR_024625		Approved	AAC-11, API5L1, AAC11	uc010rfh.1	Q9BZZ5	OTTHUMG00000166395	Exception_encountered	chr11.hg19:g.43350345_43350346insTA	ENSP00000431391:p.Glu344fs	278.0	0.0		217.0	53.0	NM_006595	B4DGR0|B4DRJ2|D3DR21|O15441|Q9Y4J7	Frame_Shift_Ins	INS	ENST00000531273.1	hg19	CCDS44572.1																																																																																			.	.		0.406	API5-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389545.1	NM_006595	
ANXA9	8416	hgsc.bcm.edu	37	1	150956826	150956826	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150956826delC	ENST00000368947.4	+	6	813	c.337delC	c.(337-339)cccfs	p.P113fs	ANXA9_ENST00000474997.1_3'UTR	NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	113					single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TCTGCTGCAGCCCACAGCCCA	0.567																																					p.Q112fs		Atlas-INDEL	.											.	ANXA9	28	.	0			c.336delG						.						107.0	102.0	104.0					1																	150956826		2203	4300	6503	SO:0001589	frameshift_variant	8416	exon6			.	AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.337delC	chr1.hg19:g.150956826delC	ENSP00000357943:p.Pro113fs	109.0	0.0		177.0	23.0	NM_003568	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Frame_Shift_Del	DEL	ENST00000368947.4	hg19	CCDS975.2																																																																																			.	.		0.567	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084895.2	NM_003568	
TRIM60	166655	hgsc.bcm.edu	37	4	165962511	165962511	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr4:165962511delT	ENST00000512596.1	+	3	1503	c.1287delT	c.(1285-1287)tatfs	p.Y429fs	TRIM60_ENST00000341062.5_Frame_Shift_Del_p.Y429fs|TRIM60_ENST00000508504.1_Frame_Shift_Del_p.Y429fs	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	429	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		TTTCCTTTTATAATATGAATG	0.368																																					p.Y429fs		Atlas-Indel,Pindel	.											.	TRIM60	73	.	0			c.1286delA						.						74.0	81.0	78.0					4																	165962511		2203	4300	6503	SO:0001589	frameshift_variant	166655	exon3			.	AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1287delT	chr4.hg19:g.165962511delT	ENSP00000421142:p.Tyr429fs	97.0	0.0		71.0	30.0	NM_152620	Q8NA35	Frame_Shift_Del	DEL	ENST00000512596.1	hg19	CCDS3808.1																																																																																			.	.		0.368	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364325.1	NM_152620	
MDM1	56890	hgsc.bcm.edu	37	12	68715351	68715352	+	Frame_Shift_Ins	INS	-	-	T	rs148344415		TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr12:68715351_68715352insT	ENST00000303145.7	-	6	944_945	c.858_859insA	c.(856-861)ttacacfs	p.H287fs	MDM1_ENST00000540418.1_Frame_Shift_Ins_p.H7fs|MDM1_ENST00000411698.2_Frame_Shift_Ins_p.H242fs	NM_017440.4	NP_059136.2	Q8TC05	MDM1_HUMAN	Mdm1 nuclear protein homolog (mouse)	287					retina development in camera-type eye (GO:0060041)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(3)|pancreas(1)|prostate(2)|skin(7)	33			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000174)		TTAGGCTGGTGTAAGTCTTTTA	0.307																																					p.H287fs		Atlas-Indel,Pindel	.											.	MDM1	74	.	0			c.859_860insA						.																																			SO:0001589	frameshift_variant	56890	exon6			.	AF007130	CCDS8983.1, CCDS44938.1, CCDS55841.1, CCDS55842.1	12q15	2008-04-14	2008-04-14			ENSG00000111554			29917	protein-coding gene	gene with protein product		613813	"""Mdm4, transformed 3T3 cell double minute 1, p53 binding protein (mouse)"""			8619474, 9110174	Standard	NM_017440		Approved		uc001stz.2	Q8TC05		ENST00000303145.7:c.859dupA	chr12.hg19:g.68715352_68715352dupT	ENSP00000302537:p.His287fs	108.0	0.0		93.0	23.0	NM_017440	B4DM65|E7EPQ3|O43406|Q8WTV9|Q9NR04	Frame_Shift_Ins	INS	ENST00000303145.7	hg19	CCDS8983.1																																																																																			.	.		0.307	MDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402402.1	NM_020128	
NASP	4678	hgsc.bcm.edu	37	1	46078848	46078855	+	Frame_Shift_Del	DEL	AGGCTCAG	AGGCTCAG	-	rs2230658|rs534850061	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	AGGCTCAG	AGGCTCAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:46078848_46078855delAGGCTCAG	ENST00000350030.3	+	7	1521_1528	c.1434_1441delAGGCTCAG	c.(1432-1443)gaaggctcagaafs	p.EGSE478fs	NASP_ENST00000537798.1_Frame_Shift_Del_p.EGSE414fs|NASP_ENST00000402363.3_Frame_Shift_Del_p.EGSE480fs|NASP_ENST00000372052.4_Frame_Shift_Del_p.EGSE112fs|NASP_ENST00000530073.1_3'UTR|NASP_ENST00000351223.3_Frame_Shift_Del_p.EGSE139fs	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	478	Glu-rich (acidic).|Histone-binding.				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					TAGAAACTGAAGGCTCAGAAGAGGATGA	0.365																																					p.478_480del		Atlas-Indel,Pindel	.											.	NASP	77	.	0			c.1433_1440del						.																																			SO:0001589	frameshift_variant	4678	exon7			.	M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.1434_1441delAGGCTCAG	chr1.hg19:g.46078848_46078855delAGGCTCAG	ENSP00000255120:p.Glu478fs	75.0	0.0		23.0	17.0	NM_002482	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Frame_Shift_Del	DEL	ENST00000350030.3	hg19	CCDS524.1																																																																																			.	.		0.365	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000021533.2	NM_002482	
SIPA1	6494	hgsc.bcm.edu	37	11	65417088	65417111	+	In_Frame_Del	DEL	CCACCACAGCCAAGCCATCAGTAC	CCACCACAGCCAAGCCATCAGTAC	-			TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	CCACCACAGCCAAGCCATCAGTAC	CCACCACAGCCAAGCCATCAGTAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr11:65417088_65417111delCCACCACAGCCAAGCCATCAGTAC	ENST00000394224.3	+	11	2878_2901	c.2582_2605delCCACCACAGCCAAGCCATCAGTAC	c.(2581-2607)gccaccacagccaagccatcagtaccc>gcc	p.TTAKPSVP862del	MIR4489_ENST00000578869.1_RNA|SIPA1_ENST00000394227.3_In_Frame_Del_p.TTAKPSVP760del|SIPA1_ENST00000534313.1_In_Frame_Del_p.TTAKPSVP862del|SIPA1_ENST00000527525.1_In_Frame_Del_p.TTAKPSVP760del	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	862					cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						CTCCTCCTGGCCACCACAGCCAAGCCATCAGTACCCAGTGCTGA	0.612																																					p.861_868del		Atlas-Indel,Pindel	.											.	SIPA1	45	.	0			c.2581_2604del						.																																			SO:0001651	inframe_deletion	6494	exon11			.	AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.2582_2605delCCACCACAGCCAAGCCATCAGTAC	chr11.hg19:g.65417088_65417111delCCACCACAGCCAAGCCATCAGTAC	ENSP00000377771:p.Thr862_Pro869del	65.0	0.0		36.0	10.0	NM_006747	O14518|O60484|O60618|Q2YD83	In_Frame_Del	DEL	ENST00000394224.3	hg19	CCDS8108.1																																																																																			.	.		0.612	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390356.1	NM_006747	
ANXA9	8416	hgsc.bcm.edu	37	1	150956828	150956829	+	Frame_Shift_Del	DEL	CA	CA	-	rs7536645	byFrequency	TCGA-DD-AAC8-01A-11D-A40R-10	TCGA-DD-AAC8-10A-01D-A40U-10	CA	CA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	7b3c3428-4aba-4f50-ab9e-852dbd0e4141	b7eb2f91-437b-4009-bda9-315bd19c65e2	g.chr1:150956828_150956829delCA	ENST00000368947.4	+	6	815_816	c.339_340delCA	c.(337-342)cccacafs	p.T114fs	ANXA9_ENST00000474997.1_3'UTR	NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	114			T -> A (in dbSNP:rs7536645).		single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TGCTGCAGCCCACAGCCCAGTT	0.569																																					p.113_113del		Pindel	.											.	ANXA9	28	.	0			c.338_339del						.																																			SO:0001589	frameshift_variant	8416	exon6			.	AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.339_340delCA	chr1.hg19:g.150956830_150956831delCA	ENSP00000357943:p.Thr114fs	108.0	0.0		175.0	19.0	NM_003568	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Frame_Shift_Del	DEL	ENST00000368947.4	hg19	CCDS975.2																																																																																			.	.		0.569	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000084895.2	NM_003568	
