#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
C1orf168	199920	hgsc.bcm.edu	37	1	57206372	57206372	+	Silent	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:57206372T>C	ENST00000343433.6	-	13	1781	c.1701A>G	c.(1699-1701)ttA>ttG	p.L567L	C1orf168_ENST00000484327.1_5'UTR	NM_001004303.4	NP_001004303.3	Q5VWT5	CA168_HUMAN	chromosome 1 open reading frame 168	567										NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(13)|ovary(3)|skin(6)|stomach(1)|urinary_tract(2)	46						CTTTTTACCTTAAGTTTTCTT	0.363																																					p.L567L		Atlas-SNP	.											.	C1orf168	102	.	0			c.A1701G						.						101.0	92.0	95.0					1																	57206372		2201	4297	6498	SO:0001819	synonymous_variant	199920	exon13			TTACCTTAAGTTT	BX648439	CCDS30729.1	1p32.2	2011-02-22			ENSG00000187889	ENSG00000187889			27295	protein-coding gene	gene with protein product						14702039	Standard	NM_001004303		Approved	RP4-758N20.2, FLJ43208	uc001cym.4	Q5VWT5	OTTHUMG00000008281	ENST00000343433.6:c.1701A>G	1.37:g.57206372T>C		107.0	0.0		56.0	22.0	NM_001004303	Q63HM3|Q6ZUY6	Silent	SNP	ENST00000343433.6	37	CCDS30729.1																																																																																			.	.		0.363	C1orf168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000022751.2	NM_001004303	
COL11A1	1301	hgsc.bcm.edu	37	1	103405915	103405915	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:103405915G>T	ENST00000370096.3	-	43	3664	c.3352C>A	c.(3352-3354)Cct>Act	p.P1118T	COL11A1_ENST00000512756.1_Missense_Mutation_p.P1002T|COL11A1_ENST00000358392.2_Missense_Mutation_p.P1130T|COL11A1_ENST00000353414.4_Missense_Mutation_p.P1079T	NM_001854.3	NP_001845.3	P12107	COBA1_HUMAN	collagen, type XI, alpha 1	1118	Triple-helical region.		Missing (in STL2). {ECO:0000269|PubMed:20513134}.		cartilage condensation (GO:0001502)|chondrocyte development (GO:0002063)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|embryonic skeletal system morphogenesis (GO:0048704)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|inner ear morphogenesis (GO:0042472)|proteoglycan metabolic process (GO:0006029)|sensory perception of sound (GO:0007605)|tendon development (GO:0035989)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visual perception (GO:0007601)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix binding (GO:0050840)|extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			NS(3)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(17)|kidney(8)|large_intestine(28)|lung(157)|ovary(6)|pancreas(2)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(1)	258		all_epithelial(167;2.52e-07)|all_lung(203;3.11e-05)|Lung NSC(277;6.61e-05)|Breast(1374;0.181)		Lung(183;0.186)|all cancers(265;0.242)|Epithelial(280;0.248)		GAGCCGGCAGGACCAGCTGGC	0.473																																					p.P1130T		Atlas-SNP	.											COL11A1_ENST00000370096,NS,carcinoma,0,2	COL11A1	972	2	0			c.C3388A						.						56.0	62.0	60.0					1																	103405915		2203	4300	6503	SO:0001583	missense	1301	exon43			CGGCAGGACCAGC	J04177	CCDS778.1, CCDS780.1, CCDS780.2, CCDS53348.1	1p21	2013-01-16			ENSG00000060718	ENSG00000060718		"""Collagens"""	2186	protein-coding gene	gene with protein product	"""collagen XI, alpha-1 polypeptide"""	120280		COLL6		3182841	Standard	NM_080630		Approved	STL2, CO11A1	uc001dul.3	P12107	OTTHUMG00000010872	ENST00000370096.3:c.3352C>A	1.37:g.103405915G>T	ENSP00000359114:p.Pro1118Thr	240.0	1.0		102.0	31.0	NM_080629	B1ASK7|D3DT73|E9PCU0|Q14034|Q149N0|Q9UIT4|Q9UIT5|Q9UIT6	Missense_Mutation	SNP	ENST00000370096.3	37	CCDS778.1	.	.	.	.	.	.	.	.	.	.	G	13.56	2.272323	0.40194	.	.	ENSG00000060718	ENST00000370096;ENST00000358392;ENST00000353414;ENST00000370090;ENST00000512756	D;D;D;D	0.96651	-4.08;-4.08;-4.08;-4.08	5.46	5.46	0.80206	.	0.061344	0.64402	D	0.000002	D	0.97980	0.9335	M	0.79123	2.44	0.58432	D	0.999999	P;D;P;P;P	0.67145	0.734;0.996;0.925;0.877;0.59	B;D;P;B;B	0.75484	0.254;0.986;0.621;0.417;0.346	D	0.98681	1.0692	10	0.87932	D	0	.	19.3174	0.94220	0.0:0.0:1.0:0.0	.	1002;1079;1130;1118;338	E9PCU0;P12107-3;P12107-2;P12107;F5H5Z5	.;.;.;COBA1_HUMAN;.	T	1118;1130;1079;338;1002	ENSP00000359114:P1118T;ENSP00000351163:P1130T;ENSP00000302551:P1079T;ENSP00000426533:P1002T	ENSP00000302551:P1079T	P	-	1	0	COL11A1	103178503	1.000000	0.71417	0.978000	0.43139	0.173000	0.22820	7.922000	0.87538	2.569000	0.86673	0.650000	0.86243	CCT	.	.		0.473	COL11A1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000029997.1	NM_080630	
KCNA3	3738	hgsc.bcm.edu	37	1	111216298	111216298	+	Silent	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:111216298C>T	ENST00000369769.2	-	1	1357	c.1134G>A	c.(1132-1134)tcG>tcA	p.S378S		NM_002232.3	NP_002223.3	P22001	KCNA3_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 3	378					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	membrane raft (GO:0045121)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|voltage-gated ion channel activity (GO:0005244)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(7)|ovary(4)|pancreas(1)|prostate(3)|skin(1)	38		all_cancers(81;3.92e-06)|all_epithelial(167;1.28e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000398)		Lung(183;0.0235)|Colorectal(144;0.0306)|all cancers(265;0.0752)|Epithelial(280;0.0821)|COAD - Colon adenocarcinoma(174;0.132)|LUSC - Lung squamous cell carcinoma(189;0.133)	Dalfampridine(DB06637)	TGGAGTGGCGCGACAGCTTGA	0.592																																					p.S378S		Atlas-SNP	.											KCNA3,NS,carcinoma,-1,1	KCNA3	91	1	0			c.G1134A						.						105.0	104.0	105.0					1																	111216298		2203	4300	6503	SO:0001819	synonymous_variant	3738	exon1			GTGGCGCGACAGC	L23499	CCDS828.2	1p13.3	2012-07-05			ENSG00000177272	ENSG00000177272		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6221	protein-coding gene	gene with protein product		176263				2251283, 16382104	Standard	NM_002232		Approved	Kv1.3, MK3, HLK3, HPCN3	uc001dzv.1	P22001	OTTHUMG00000034493	ENST00000369769.2:c.1134G>A	1.37:g.111216298C>T		67.0	0.0		79.0	40.0	NM_002232	Q5VWN2	Silent	SNP	ENST00000369769.2	37	CCDS828.2																																																																																			.	.		0.592	KCNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083391.1	NM_002232	
KCND3	3752	hgsc.bcm.edu	37	1	112525100	112525100	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:112525100G>T	ENST00000315987.2	-	2	728	c.249C>A	c.(247-249)ttC>ttA	p.F83L	KCND3_ENST00000302127.4_Missense_Mutation_p.F83L|KCND3_ENST00000369697.1_Missense_Mutation_p.F83L	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	83					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CCCGGTCGAAGAAGTACTCCT	0.622																																					p.F83L		Atlas-SNP	.											KCND3_ENST00000315987,NS,carcinoma,0,2	KCND3	150	2	0			c.C249A						.						126.0	114.0	119.0					1																	112525100		2203	4300	6503	SO:0001583	missense	3752	exon2			GTCGAAGAAGTAC	AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.249C>A	1.37:g.112525100G>T	ENSP00000319591:p.Phe83Leu	96.0	0.0		97.0	37.0	NM_004980	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	ENST00000315987.2	37	CCDS843.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.986080	0.74589	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.83591	-1.74;-1.74;-1.74	5.74	4.83	0.62350	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.88058	0.6335	M	0.84219	2.685	0.80722	D	1	D;D	0.65815	0.995;0.995	D;D	0.65443	0.935;0.935	D	0.89939	0.4071	10	0.87932	D	0	.	11.5885	0.50933	0.1448:0.0:0.8552:0.0	.	83;83	Q14D71;Q9UK17	.;KCND3_HUMAN	L	83	ENSP00000358711:F83L;ENSP00000319591:F83L;ENSP00000306923:F83L	ENSP00000306923:F83L	F	-	3	2	KCND3	112326623	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.523000	0.67099	1.443000	0.47586	0.655000	0.94253	TTC	.	.		0.622	KCND3-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000033144.1	NM_172198	
ADAM30	11085	hgsc.bcm.edu	37	1	120438632	120438632	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:120438632A>C	ENST00000369400.1	-	1	486	c.328T>G	c.(328-330)Tgc>Ggc	p.C110G		NM_021794.3	NP_068566.2	Q9UKF2	ADA30_HUMAN	ADAM metallopeptidase domain 30	110					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(16)|ovary(2)|skin(2)	38	all_cancers(5;7.07e-10)|all_epithelial(5;1.62e-10)|all_neural(166;0.153)|Breast(55;0.234)	all_lung(203;1.55e-06)|Lung NSC(69;1.04e-05)|all_epithelial(167;0.00138)		Lung(183;0.0204)|LUSC - Lung squamous cell carcinoma(189;0.117)		ATGTAGTTGCAGTCCTTTGGT	0.488																																					p.C110G		Atlas-SNP	.											.	ADAM30	88	.	0			c.T328G						.						66.0	65.0	66.0					1																	120438632		2203	4300	6503	SO:0001583	missense	11085	exon1			AGTTGCAGTCCTT	AF171932	CCDS907.1	1p12	2012-05-16	2005-08-18		ENSG00000134249	ENSG00000134249		"""ADAM metallopeptidase domain containing"""	208	protein-coding gene	gene with protein product		604779	"""a disintegrin and metalloproteinase domain 30"""				Standard	NM_021794		Approved	svph4	uc001eij.3	Q9UKF2	OTTHUMG00000012176	ENST00000369400.1:c.328T>G	1.37:g.120438632A>C	ENSP00000358407:p.Cys110Gly	128.0	0.0		71.0	42.0	NM_021794	A8K8W8|Q5T3X6|Q9UKF1	Missense_Mutation	SNP	ENST00000369400.1	37	CCDS907.1	.	.	.	.	.	.	.	.	.	.	A	18.93	3.728480	0.69074	.	.	ENSG00000134249	ENST00000369400;ENST00000543066	T	0.12361	2.69	4.34	4.34	0.51931	Peptidase M12B, propeptide (1);	0.000000	0.41001	U	0.000963	T	0.41073	0.1143	H	0.97874	4.095	0.32740	N	0.507848	D	0.89917	1.0	D	0.91635	0.999	T	0.61217	-0.7107	10	0.72032	D	0.01	.	9.8364	0.40971	1.0:0.0:0.0:0.0	.	110	Q9UKF2	ADA30_HUMAN	G	110	ENSP00000358407:C110G	ENSP00000358407:C110G	C	-	1	0	ADAM30	120240155	1.000000	0.71417	0.942000	0.38095	0.270000	0.26580	4.900000	0.63252	1.819000	0.53055	0.379000	0.24179	TGC	.	.		0.488	ADAM30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033678.1	NM_021794	
FLG	2312	hgsc.bcm.edu	37	1	152282404	152282404	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:152282404G>A	ENST00000368799.1	-	3	4993	c.4958C>T	c.(4957-4959)tCa>tTa	p.S1653L	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	1653	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACGAGTGCCTGATTGTCTGGA	0.567									Ichthyosis																												p.S1653L		Atlas-SNP	.											.	FLG	900	.	0			c.C4958T						.						269.0	271.0	270.0					1																	152282404		2203	4300	6503	SO:0001583	missense	2312	exon3	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	GTGCCTGATTGTC	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.4958C>T	1.37:g.152282404G>A	ENSP00000357789:p.Ser1653Leu	137.0	0.0		93.0	33.0	NM_002016	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	ENST00000368799.1	37	CCDS30860.1	.	.	.	.	.	.	.	.	.	.	G	9.866	1.197604	0.22037	.	.	ENSG00000143631	ENST00000368799	T	0.00848	5.62	3.56	3.56	0.40772	.	.	.	.	.	T	0.01627	0.0052	M	0.75447	2.3	0.09310	N	1	D	0.69078	0.997	P	0.58577	0.841	T	0.45279	-0.9272	9	0.56958	D	0.05	.	11.02	0.47711	0.0:0.0:1.0:0.0	.	1653	P20930	FILA_HUMAN	L	1653	ENSP00000357789:S1653L	ENSP00000357789:S1653L	S	-	2	0	FLG	150549028	0.001000	0.12720	0.003000	0.11579	0.007000	0.05969	0.786000	0.26844	1.721000	0.51461	0.306000	0.20318	TCA	.	.		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033742.1	NM_002016	
SLAMF1	6504	hgsc.bcm.edu	37	1	160604639	160604639	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:160604639T>G	ENST00000302035.6	-	3	813	c.464A>C	c.(463-465)aAc>aCc	p.N155T	SLAMF1_ENST00000538290.1_Missense_Mutation_p.N155T|SLAMF1_ENST00000355199.3_Missense_Mutation_p.N155T|SLAMF1_ENST00000235739.5_Missense_Mutation_p.N155T	NM_003037.2	NP_003028.1	Q13291	SLAF1_HUMAN	signaling lymphocytic activation molecule family member 1	155	Ig-like C2-type.				lymphocyte activation (GO:0046649)|positive regulation of cell proliferation (GO:0008284)|regulation of catalytic activity (GO:0050790)|regulation of vesicle fusion (GO:0031338)|signal transduction (GO:0007165)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|phagocytic vesicle (GO:0045335)	antigen binding (GO:0003823)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(52;4.94e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			GCAGGTCCCGTTCTCCTGGGT	0.552																																					p.N155T		Atlas-SNP	.											SLAMF1,NS,carcinoma,+1,1	SLAMF1	74	1	0			c.A464C						.						91.0	91.0	91.0					1																	160604639		2203	4300	6503	SO:0001583	missense	6504	exon3			GTCCCGTTCTCCT	U33017	CCDS1207.1	1q23.3	2013-01-11	2003-10-29	2003-10-31	ENSG00000117090	ENSG00000117090		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10903	protein-coding gene	gene with protein product		603492	"""signaling lymphocytic activation molecule"""	SLAM		7617038	Standard	XM_005245456		Approved	CD150	uc001fwl.4	Q13291	OTTHUMG00000024006	ENST00000302035.6:c.464A>C	1.37:g.160604639T>G	ENSP00000306190:p.Asn155Thr	119.0	0.0		93.0	37.0	NM_003037	Q5W172|Q9HBE8	Missense_Mutation	SNP	ENST00000302035.6	37	CCDS1207.1	.	.	.	.	.	.	.	.	.	.	T	7.028	0.560124	0.13498	.	.	ENSG00000117090	ENST00000302035;ENST00000235739;ENST00000538290;ENST00000355199	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	4.09	0.543	0.17179	Immunoglobulin-like (1);	0.753844	0.13658	N	0.371768	T	0.16171	0.0389	M	0.69358	2.11	0.09310	N	1	B	0.16396	0.017	B	0.13407	0.009	T	0.24225	-1.0166	10	0.40728	T	0.16	0.0403	3.2926	0.06954	0.0:0.2211:0.2114:0.5675	.	155	Q13291	SLAF1_HUMAN	T	155	ENSP00000306190:N155T;ENSP00000235739:N155T;ENSP00000438406:N155T;ENSP00000347333:N155T	ENSP00000235739:N155T	N	-	2	0	SLAMF1	158871263	0.002000	0.14202	0.007000	0.13788	0.958000	0.62258	0.299000	0.19138	0.075000	0.16796	0.533000	0.62120	AAC	.	.		0.552	SLAMF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060454.1		
ZBTB41	360023	hgsc.bcm.edu	37	1	197157558	197157558	+	Silent	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:197157558T>C	ENST00000367405.4	-	4	1478	c.1410A>G	c.(1408-1410)aaA>aaG	p.K470K	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	470					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						GAGTAAAAGATTTCTTACAAA	0.279																																					p.K470K		Atlas-SNP	.											ZBTB41,NS,carcinoma,-2,1	ZBTB41	116	1	0			c.A1410G						.						43.0	42.0	43.0					1																	197157558		2201	4299	6500	SO:0001819	synonymous_variant	360023	exon4			AAAAGATTTCTTA		CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1410A>G	1.37:g.197157558T>C		49.0	0.0		34.0	11.0	NM_194314	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Silent	SNP	ENST00000367405.4	37	CCDS30960.1																																																																																			.	.		0.279	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088249.2	NM_194314	
NUP133	55746	hgsc.bcm.edu	37	1	229625781	229625781	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:229625781A>T	ENST00000261396.3	-	9	1206	c.1115T>A	c.(1114-1116)cTg>cAg	p.L372Q	NUP133_ENST00000537506.1_Missense_Mutation_p.L356Q	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	372					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				TATTGTTATCAGAGAGTAATA	0.373																																					p.L372Q		Atlas-SNP	.											.	NUP133	111	.	0			c.T1115A						.						62.0	61.0	61.0					1																	229625781		2203	4300	6503	SO:0001583	missense	55746	exon9			GTTATCAGAGAGT		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1115T>A	1.37:g.229625781A>T	ENSP00000261396:p.Leu372Gln	161.0	0.0		84.0	39.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	37	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107287	0.77096	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.36520	1.25;1.25;1.25	5.54	5.54	0.83059	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.066940	0.64402	D	0.000010	T	0.59528	0.2200	M	0.72118	2.19	0.58432	D	0.999997	D	0.76494	0.999	D	0.70016	0.967	T	0.63010	-0.6732	10	0.66056	D	0.02	-18.8712	15.9649	0.79961	1.0:0.0:0.0:0.0	.	372	Q8WUM0	NU133_HUMAN	Q	372;372;372;356	ENSP00000261396:L372Q;ENSP00000355640:L372Q;ENSP00000443496:L356Q	ENSP00000261396:L372Q	L	-	2	0	NUP133	227692404	1.000000	0.71417	0.535000	0.28026	0.835000	0.47333	7.911000	0.87458	2.232000	0.73038	0.533000	0.62120	CTG	.	.		0.373	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
ZNF512	84450	hgsc.bcm.edu	37	2	27822456	27822456	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:27822456G>T	ENST00000355467.4	+	4	367	c.284G>T	c.(283-285)gGt>gTt	p.G95V	ZNF512_ENST00000413371.2_Missense_Mutation_p.G18V|ZNF512_ENST00000494548.1_3'UTR|ZNF512_ENST00000379717.1_Missense_Mutation_p.G94V|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000416005.2_Missense_Mutation_p.G94V|ZNF512_ENST00000556601.1_Missense_Mutation_p.V6L	NM_001271287.1|NM_001271288.1|NM_001271289.1|NM_001271318.1|NM_032434.3	NP_001258216.1|NP_001258217.1|NP_001258218.1|NP_001258247.1|NP_115810.2	Q96ME7	ZN512_HUMAN	zinc finger protein 512	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)					TCAGGGTCAGGTGGAGTATCA	0.408																																					p.G95V		Atlas-SNP	.											.	ZNF512	54	.	0			c.G284T						.						100.0	103.0	102.0					2																	27822456		2203	4300	6503	SO:0001583	missense	84450	exon4			GGTCAGGTGGAGT	AL833748	CCDS1758.1, CCDS59428.1, CCDS59429.1	2p23	2008-02-05			ENSG00000243943	ENSG00000243943		"""Zinc fingers, C2H2-type"""	29380	protein-coding gene	gene with protein product						11347906	Standard	NM_032434		Approved	KIAA1805	uc002rla.4	Q96ME7	OTTHUMG00000097786	ENST00000355467.4:c.284G>T	2.37:g.27822456G>T	ENSP00000347648:p.Gly95Val	198.0	0.0		99.0	38.0	NM_032434	B4DSM5|Q53RZ7|Q86XK6|Q96JM0	Missense_Mutation	SNP	ENST00000355467.4	37	CCDS1758.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.28|16.28	3.079673|3.079673	0.55753|0.55753	.|.	.|.	ENSG00000243943|ENSG00000243943	ENST00000379717;ENST00000355467;ENST00000416005;ENST00000413371|ENST00000556601	.|.	.|.	.|.	5.86|5.86	4.97|4.97	0.65823|0.65823	.|.	0.435767|.	0.22087|.	N|.	0.064813|.	T|T	0.29288|0.29288	0.0729|0.0729	N|N	0.12182|0.12182	0.205|0.205	0.20821|0.20821	N|N	0.999844|0.999844	P;P;P|.	0.50443|.	0.931;0.935;0.935|.	B;B;B|.	0.35413|.	0.202;0.202;0.202|.	T|T	0.19712|0.19712	-1.0297|-1.0297	9|5	0.72032|.	D|.	0.01|.	-7.9976|-7.9976	13.2925|13.2925	0.60278|0.60278	0.0:0.3033:0.6967:0.0|0.0:0.3033:0.6967:0.0	.|.	18;94;95|.	B4DES6;B4DSM5;Q96ME7|.	.;.;ZN512_HUMAN|.	V|L	94;95;94;18|6	.|.	ENSP00000347648:G95V|.	G|V	+|+	2|1	0|0	ZNF512|ZNF512	27675960|27675960	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.992000|0.992000	0.81027|0.81027	3.510000|3.510000	0.53393|0.53393	1.464000|1.464000	0.47987|0.47987	0.655000|0.655000	0.94253|0.94253	GGT|GTG	.	.		0.408	ZNF512-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000215029.2	NM_032434	
HAAO	23498	hgsc.bcm.edu	37	2	43015676	43015676	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:43015676C>T	ENST00000294973.6	-	2	207	c.152G>A	c.(151-153)gGt>gAt	p.G51D		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						TACCTCTTCACCCTCTTCGAT	0.602																																					p.G51D		Atlas-SNP	.											.	HAAO	26	.	0			c.G152A						.						249.0	173.0	199.0					2																	43015676		2203	4300	6503	SO:0001583	missense	23498	exon2			TCTTCACCCTCTT	Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.152G>A	2.37:g.43015676C>T	ENSP00000294973:p.Gly51Asp	49.0	0.0		61.0	30.0	NM_012205		Missense_Mutation	SNP	ENST00000294973.6	37	CCDS33187.1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290516	0.80914	.	.	ENSG00000162882	ENST00000294973;ENST00000431905	T;T	0.37235	1.21;1.21	5.44	4.56	0.56223	Cupin, RmlC-type (1);	0.000000	0.85682	D	0.000000	T	0.64136	0.2571	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70092	-0.4967	10	0.66056	D	0.02	.	12.4725	0.55795	0.0:0.916:0.0:0.084	.	51	P46952	3HAO_HUMAN	D	51;17	ENSP00000294973:G51D;ENSP00000412601:G17D	ENSP00000294973:G51D	G	-	2	0	HAAO	42869180	1.000000	0.71417	0.995000	0.50966	0.964000	0.63967	5.910000	0.69931	2.554000	0.86153	0.655000	0.94253	GGT	.	.		0.602	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000325948.2		
ABCG8	64241	hgsc.bcm.edu	37	2	44102319	44102319	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:44102319T>G	ENST00000272286.2	+	11	1613	c.1523T>G	c.(1522-1524)aTc>aGc	p.I508S		NM_022437.2	NP_071882.1	Q9H221	ABCG8_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 8	508	ABC transmembrane type-2.				ATP catabolic process (GO:0006200)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|excretion (GO:0007588)|intestinal cholesterol absorption (GO:0030299)|negative regulation of intestinal cholesterol absorption (GO:0045796)|negative regulation of intestinal phytosterol absorption (GO:0010949)|phospholipid transport (GO:0015914)|response to drug (GO:0042493)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein heterodimerization activity (GO:0046982)|sterol transporter activity (GO:0015248)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(21)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)			Ezetimibe(DB00973)	TGTGCCTACATCATCATCTAC	0.552																																					p.I508S		Atlas-SNP	.											.	ABCG8	98	.	0			c.T1523G						.						85.0	79.0	81.0					2																	44102319		2203	4300	6503	SO:0001583	missense	64241	exon11			CCTACATCATCAT	AF320294	CCDS1815.1	2p21	2012-03-14	2008-07-31		ENSG00000143921	ENSG00000143921		"""ATP binding cassette transporters / subfamily G"""	13887	protein-coding gene	gene with protein product	"""gallbladder disease 4"", ""sterolin 2"""	605460	"""ATP-binding cassette, sub-family G (WHITE), member 8 (sterolin 2)"""			11099417, 17626266	Standard	NM_022437		Approved	GBD4	uc002rtq.3	Q9H221	OTTHUMG00000128756	ENST00000272286.2:c.1523T>G	2.37:g.44102319T>G	ENSP00000272286:p.Ile508Ser	50.0	0.0		42.0	14.0	NM_022437	Q53QN8	Missense_Mutation	SNP	ENST00000272286.2	37	CCDS1815.1	.	.	.	.	.	.	.	.	.	.	T	9.207	1.030060	0.19512	.	.	ENSG00000143921	ENST00000272286	T	0.70749	-0.51	4.62	3.46	0.39613	ABC-2 type transporter (1);	0.516766	0.21777	N	0.069269	T	0.51278	0.1665	N	0.14661	0.345	0.09310	N	0.999997	B;B	0.20459	0.045;0.024	B;B	0.21151	0.031;0.033	T	0.38286	-0.9668	10	0.33141	T	0.24	.	9.8422	0.41006	0.0:0.0815:0.0:0.9185	.	507;508	Q9H221-2;Q9H221	.;ABCG8_HUMAN	S	508	ENSP00000272286:I508S	ENSP00000272286:I508S	I	+	2	0	ABCG8	43955823	0.998000	0.40836	0.009000	0.14445	0.786000	0.44442	3.690000	0.54713	0.642000	0.30620	0.383000	0.25322	ATC	.	.		0.552	ABCG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250671.1	NM_022437	
C2orf81	388963	hgsc.bcm.edu	37	2	74642264	74642264	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:74642264G>C	ENST00000517883.1	-	1	1446	c.755C>G	c.(754-756)tCc>tGc	p.S252C	C2orf81_ENST00000290390.5_Missense_Mutation_p.S320C			A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	313										endometrium(3)|kidney(1)	4						CTGCTGGCAGGACGCGGAGGG	0.726																																					p.S320C		Atlas-SNP	.											C2orf81,colon,carcinoma,-1,1	C2orf81	23	1	0			c.C959G						.						4.0	8.0	7.0					2																	74642264		643	1536	2179	SO:0001583	missense	388963	exon4			TGGCAGGACGCGG	AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000517883.1:c.755C>G	2.37:g.74642264G>C	ENSP00000431103:p.Ser252Cys	116.0	0.0		125.0	5.0	NM_001145054		Missense_Mutation	SNP	ENST00000517883.1	37		.	.	.	.	.	.	.	.	.	.	g	16.04	3.011334	0.54361	.	.	ENSG00000159239	ENST00000517883;ENST00000290390	.	.	.	5.0	0.747	0.18371	.	2.205130	0.02226	N	0.064447	T	0.40067	0.1102	L	0.36672	1.1	0.09310	N	1	D	0.61697	0.99	P	0.53313	0.723	T	0.16867	-1.0388	9	0.49607	T	0.09	0.3431	4.5547	0.12131	0.0828:0.3083:0.4689:0.14	.	320	G3XAA6	.	C	252;320	.	ENSP00000290390:S320C	S	-	2	0	C2orf81	74495772	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.256000	0.08757	0.211000	0.20683	0.556000	0.70494	TCC	.	.		0.726	C2orf81-002	PUTATIVE	basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000377683.1	NM_001145054	
AMER3	205147	hgsc.bcm.edu	37	2	131522066	131522066	+	Silent	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:131522066C>A	ENST00000423981.1	+	2	2531	c.2421C>A	c.(2419-2421)ggC>ggA	p.G807G	AMER3_ENST00000321420.4_Silent_p.G807G	NM_001105193.1|NM_001105194.1|NM_001105195.1|NM_152698.2	NP_001098663.1|NP_001098664.1|NP_001098665.1|NP_689911.2	Q8N944	AMER3_HUMAN	APC membrane recruitment protein 3	807					Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	lipid binding (GO:0008289)										GTTCCCAGGGCCACCATCCAG	0.667																																					p.G807G		Atlas-SNP	.											.	.	.	.	0			c.C2421A						.						11.0	12.0	12.0					2																	131522066		2197	4293	6490	SO:0001819	synonymous_variant	205147	exon2			CCAGGGCCACCAT	AK095696	CCDS2164.1	2q21.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000178171	ENSG00000178171		"""-"""	26771	protein-coding gene	gene with protein product			"""family with sequence similarity 123C"""	FAM123C		20843316	Standard	NM_001105195		Approved	FLJ38377	uc002trw.2	Q8N944	OTTHUMG00000131637	ENST00000423981.1:c.2421C>A	2.37:g.131522066C>A		66.0	0.0		97.0	33.0	NM_152698	B7ZLH6	Silent	SNP	ENST00000423981.1	37	CCDS2164.1																																																																																			.	.		0.667	AMER3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254531.3	NM_152698	
MFF	56947	hgsc.bcm.edu	37	2	228197291	228197291	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr2:228197291C>T	ENST00000353339.3	+	5	857	c.416C>T	c.(415-417)cCt>cTt	p.P139L	MFF_ENST00000524634.1_5'UTR|MFF_ENST00000337110.7_Missense_Mutation_p.P113L|MFF_ENST00000392059.1_Missense_Mutation_p.P139L|MFF_ENST00000476924.1_3'UTR|MFF_ENST00000349901.7_Missense_Mutation_p.P113L|MFF_ENST00000304593.9_Missense_Mutation_p.P113L|MFF_ENST00000409616.1_Missense_Mutation_p.P113L|MFF_ENST00000409565.1_Missense_Mutation_p.P113L|MFF_ENST00000354503.6_Missense_Mutation_p.P113L	NM_001277061.1	NP_001263990.1	Q9GZY8	MFF_HUMAN	mitochondrial fission factor	139					mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial fusion (GO:0008053)|mitochondrion morphogenesis (GO:0070584)|peroxisome fission (GO:0016559)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homooligomerization (GO:0051260)|protein targeting to mitochondrion (GO:0006626)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|integral component of mitochondrial membrane (GO:0032592)|mitochondrial outer membrane (GO:0005741)|peroxisome (GO:0005777)|synapse (GO:0045202)	protein homodimerization activity (GO:0042803)			breast(3)|endometrium(2)|kidney(3)|large_intestine(7)|lung(4)|stomach(2)	21						CCTACAACCCCTCAAAATGAA	0.388																																					p.P139L		Atlas-SNP	.											.	MFF	48	.	0			c.C416T						.						176.0	192.0	187.0					2																	228197291		2203	4300	6503	SO:0001583	missense	56947	exon5			CAACCCCTCAAAA	AF258660	CCDS2465.1, CCDS63139.1, CCDS63140.1, CCDS63141.1, CCDS63142.1, CCDS74662.1	2q36	2008-05-29	2008-05-29	2008-05-29	ENSG00000168958	ENSG00000168958			24858	protein-coding gene	gene with protein product		614785	"""chromosome 2 open reading frame 33"""	C2orf33		18353969	Standard	NM_001277061		Approved	GL004	uc002voy.4	Q9GZY8	OTTHUMG00000133180	ENST00000353339.3:c.416C>T	2.37:g.228197291C>T	ENSP00000302037:p.Pro139Leu	256.0	0.0		140.0	57.0	NM_020194	Q567U1|Q658R6|Q9BVZ1|Q9H690|Q9NRG8	Missense_Mutation	SNP	ENST00000353339.3	37	CCDS2465.1	.	.	.	.	.	.	.	.	.	.	C	22.3	4.269825	0.80469	.	.	ENSG00000168958	ENST00000304593;ENST00000353339;ENST00000354503;ENST00000409565;ENST00000452930;ENST00000409616;ENST00000337110;ENST00000349901;ENST00000392059	T;T	0.34072	1.38;1.38	5.02	5.02	0.67125	.	0.165377	0.53938	D	0.000050	T	0.54319	0.1851	L	0.49350	1.555	0.80722	D	1	D;B;B;P;D;P	0.76494	0.994;0.284;0.004;0.467;0.999;0.815	P;B;B;B;D;P	0.65233	0.9;0.188;0.013;0.103;0.933;0.5	T	0.55598	-0.8116	10	0.59425	D	0.04	-18.5936	18.6891	0.91576	0.0:1.0:0.0:0.0	.	113;113;113;113;113;139	Q9GZY8-4;Q9GZY8-3;Q9GZY8-5;C9JHF5;Q9GZY8-2;Q9GZY8	.;.;.;.;.;MFF_HUMAN	L	113;139;113;113;113;113;113;113;139	ENSP00000302037:P139L;ENSP00000375912:P139L	ENSP00000304898:P113L	P	+	2	0	MFF	227905535	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.123000	0.50453	2.478000	0.83669	0.563000	0.77884	CCT	.	.		0.388	MFF-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256887.2	NM_020194	
TTLL3	26140	hgsc.bcm.edu	37	3	9867563	9867563	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:9867563C>T	ENST00000547186.1	+	8	1021	c.805C>T	c.(805-807)Ccc>Tcc	p.P269S	TTLL3_ENST00000397241.1_Missense_Mutation_p.P57S|ARPC4-TTLL3_ENST00000397256.1_Missense_Mutation_p.P330S|TTLL3_ENST00000426895.4_Missense_Mutation_p.P412S|TTLL3_ENST00000455274.1_Missense_Mutation_p.P57S|TTLL3_ENST00000383827.1_Missense_Mutation_p.P57S|TTLL3_ENST00000430793.1_Missense_Mutation_p.P57S|TTLL3_ENST00000427853.3_Missense_Mutation_p.P57S|TTLL3_ENST00000466245.1_3'UTR	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	269	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					GGCCGTGGTACCCCAGATAGA	0.607																																					p.P412S		Atlas-SNP	.											.	TTLL3	51	.	0			c.C1234T						.						80.0	69.0	73.0					3																	9867563		2203	4300	6503	SO:0001583	missense	26140	exon8			GTGGTACCCCAGA		CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.805C>T	3.37:g.9867563C>T	ENSP00000446659:p.Pro269Ser	351.0	1.0		318.0	158.0	NM_001025930	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	ENST00000547186.1	37		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.5|25.5	4.649280|4.649280	0.87958|0.87958	.|.	.|.	ENSG00000250151;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021;ENSG00000214021|ENSG00000214021	ENST00000397256;ENST00000426895;ENST00000547186;ENST00000397241;ENST00000427853;ENST00000443148;ENST00000383827;ENST00000455274;ENST00000430793|ENST00000310252;ENST00000452823	T;T;T;T;T;T;T;T;T|.	0.46451|.	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87|.	4.86|4.86	3.97|3.97	0.46021|0.46021	.|.	0.075472|.	0.53938|.	U|.	0.000049|.	T|T	0.69124|0.69124	0.3076|0.3076	M|M	0.64676|0.64676	1.99|1.99	0.58432|0.58432	D|D	0.999997|0.999997	D;D;D;D;D;D|.	0.71674|.	0.998;0.969;0.998;0.972;0.975;0.981|.	D;P;D;D;D;P|.	0.70016|.	0.967;0.868;0.936;0.919;0.951;0.871|.	T|T	0.68164|0.68164	-0.5481|-0.5481	10|5	0.87932|.	D|.	0|.	.|.	12.556|12.556	0.56254|0.56254	0.0:0.9182:0.0:0.0818|0.0:0.9182:0.0:0.0818	.|.	208;57;57;57;269;330|.	B4DM47;Q9Y4R7-2;B2RCJ2;Q9Y4R7-5;Q9Y4R7;E7ETI0|.	.;.;.;.;TTLL3_HUMAN;.|.	S|I	330;412;269;57;57;207;57;57;57|224;186	ENSP00000380427:P330S;ENSP00000392549:P412S;ENSP00000446659:P269S;ENSP00000380416:P57S;ENSP00000394462:P57S;ENSP00000398097:P207S;ENSP00000373338:P57S;ENSP00000409632:P57S;ENSP00000403874:P57S|.	ENSP00000380416:P57S|.	P|T	+|+	1|2	0|0	ARPC4-TTLL3;TTLL3|TTLL3	9842563|9842563	1.000000|1.000000	0.71417|0.71417	0.987000|0.987000	0.45799|0.45799	0.990000|0.990000	0.78478|0.78478	5.691000|5.691000	0.68249|0.68249	2.420000|2.420000	0.82092|0.82092	0.561000|0.561000	0.74099|0.74099	CCC|ACC	.	.		0.607	TTLL3-203	KNOWN	basic	protein_coding	protein_coding		NM_001025930.2	
PLCL2	23228	hgsc.bcm.edu	37	3	17053189	17053189	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:17053189A>G	ENST00000418129.2	+	2	2438	c.1973A>G	c.(1972-1974)tAt>tGt	p.Y658C	PLCL2_ENST00000432376.1_Missense_Mutation_p.Y658C|PLCL2_ENST00000396755.2_Missense_Mutation_p.Y658C	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	784	PI-PLC Y-box. {ECO:0000255|PROSITE- ProRule:PRU00271}.				B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						CCTTATGTCTATGTTGAAATC	0.428																																					p.Y658C		Atlas-SNP	.											.	PLCL2	145	.	0			c.A1973G						.						76.0	76.0	76.0					3																	17053189		2203	4300	6503	SO:0001583	missense	23228	exon2			ATGTCTATGTTGA	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.1973A>G	3.37:g.17053189A>G	ENSP00000409637:p.Tyr658Cys	132.0	0.0		92.0	42.0	NM_015184	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Missense_Mutation	SNP	ENST00000418129.2	37	CCDS33713.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	5.697|5.697	0.313067|0.313067	0.10789|0.10789	.|.	.|.	ENSG00000154822|ENSG00000154822	ENST00000419842|ENST00000418129;ENST00000285094;ENST00000396755;ENST00000432376	.|T;T;T	.|0.68765	.|-0.35;-0.35;-0.35	4.96|4.96	4.96|4.96	0.65561|0.65561	.|C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	.|0.057327	.|0.64402	.|D	.|0.000001	T|T	0.59074|0.59074	0.2167|0.2167	.|.	.|.	.|.	0.58432|0.58432	D|D	0.999999|0.999999	.|B	.|0.11235	.|0.004	.|B	.|0.17979	.|0.02	T|T	0.55872|0.55872	-0.8072|-0.8072	4|9	.|0.38643	.|T	.|0.18	.|.	14.9278|14.9278	0.70893|0.70893	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|784	.|Q9UPR0	.|PLCL2_HUMAN	V|C	402|658;785;658;658	.|ENSP00000409637:Y658C;ENSP00000379979:Y658C;ENSP00000412836:Y658C	.|ENSP00000285094:Y785C	M|Y	+|+	1|2	0|0	PLCL2|PLCL2	17028193|17028193	1.000000|1.000000	0.71417|0.71417	0.983000|0.983000	0.44433|0.44433	0.018000|0.018000	0.09664|0.09664	7.386000|7.386000	0.79775|0.79775	1.983000|1.983000	0.57843|0.57843	0.459000|0.459000	0.35465|0.35465	ATG|TAT	.	.		0.428	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
NGLY1	55768	hgsc.bcm.edu	37	3	25777623	25777623	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:25777623C>G	ENST00000280700.5	-	7	1181	c.1021G>C	c.(1021-1023)Gtc>Ctc	p.V341L	NGLY1_ENST00000467224.1_5'Flank|NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000396649.3_Missense_Mutation_p.V341L|NGLY1_ENST00000428257.1_Intron|NGLY1_ENST00000417874.2_Missense_Mutation_p.V299L	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	341					glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						GGAGAATAGACTTCTGTCCAG	0.413																																					p.V341L		Atlas-SNP	.											.	NGLY1	57	.	0			c.G1021C						.						50.0	47.0	48.0					3																	25777623		2203	4300	6503	SO:0001583	missense	55768	exon7			AATAGACTTCTGT	AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1021G>C	3.37:g.25777623C>G	ENSP00000280700:p.Val341Leu	146.0	0.0		68.0	22.0	NM_018297	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Missense_Mutation	SNP	ENST00000280700.5	37	CCDS33719.1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.114416	0.77210	.	.	ENSG00000151092	ENST00000280700;ENST00000396649;ENST00000417874	T;T;T	0.38401	1.14;1.14;1.14	5.66	5.66	0.87406	Transglutaminase-like (2);	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	H	0.94423	3.535	0.80722	D	1	B;B;B	0.34255	0.085;0.445;0.355	B;B;B	0.34779	0.123;0.177;0.189	T	0.66740	-0.5847	10	0.62326	D	0.03	-10.8079	20.1253	0.97977	0.0:1.0:0.0:0.0	.	299;341;341	B4DJE9;Q96IV0-3;Q96IV0	.;.;NGLY1_HUMAN	L	341;341;299	ENSP00000280700:V341L;ENSP00000379886:V341L;ENSP00000389888:V299L	ENSP00000280700:V341L	V	-	1	0	NGLY1	25752627	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.894000	0.63206	2.832000	0.97577	0.655000	0.94253	GTC	.	.		0.413	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340832.2		
EOMES	8320	hgsc.bcm.edu	37	3	27763429	27763429	+	Silent	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:27763429T>G	ENST00000295743.4	-	1	560	c.357A>C	c.(355-357)gcA>gcC	p.A119A	EOMES_ENST00000449599.1_Silent_p.A119A|EOMES_ENST00000461503.1_Intron|EOMES_ENST00000537516.1_Intron			O95936	EOMES_HUMAN	eomesodermin	119	Ala-rich.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell differentiation involved in embryonic placenta development (GO:0060706)|cerebral cortex neuron differentiation (GO:0021895)|cerebral cortex regionalization (GO:0021796)|endoderm formation (GO:0001706)|endodermal cell fate specification (GO:0001714)|interferon-gamma production (GO:0032609)|mesoderm formation (GO:0001707)|mesodermal to mesenchymal transition involved in gastrulation (GO:0060809)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|olfactory bulb development (GO:0021772)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of neuron differentiation (GO:0045664)|skeletal muscle cell differentiation (GO:0035914)|stem cell maintenance (GO:0019827)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)	21						cggcggcggctgcagcggcgg	0.766																																					p.A119A		Atlas-SNP	.											.	EOMES	65	.	0			c.A357C						.						1.0	1.0	1.0					3																	27763429		553	1356	1909	SO:0001819	synonymous_variant	8320	exon1			GGCGGCTGCAGCG	BC025363	CCDS2646.1, CCDS63585.1	3p24.1	2011-06-13	2010-06-24		ENSG00000163508	ENSG00000163508		"""T-boxes"""	3372	protein-coding gene	gene with protein product	"""T-box brain2"""	604615	"""eomesodermin (Xenopus laevis) homolog"""			9888994, 9434949	Standard	NM_005442		Approved	TBR2	uc003cdy.4	O95936	OTTHUMG00000130570	ENST00000295743.4:c.357A>C	3.37:g.27763429T>G		29.0	0.0		65.0	18.0	NM_005442	B7Z4I2|B7ZA51|G3XAI5|Q8TAZ2|Q9UPM7	Silent	SNP	ENST00000295743.4	37	CCDS2646.1																																																																																			.	.		0.766	EOMES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252995.1	NM_005442	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266101	41266101	+	Missense_Mutation	SNP	C	C	T	rs121913416|rs121913400		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:41266101C>T	ENST00000349496.5	+	3	378	c.98C>T	c.(97-99)tCt>tTt	p.S33F	CTNNB1_ENST00000405570.1_Missense_Mutation_p.S33F|CTNNB1_ENST00000396185.3_Missense_Mutation_p.S33F|CTNNB1_ENST00000453024.1_Missense_Mutation_p.S26F|CTNNB1_ENST00000396183.3_Missense_Mutation_p.S33F	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	33			Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> F (in PTR, MDB and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:10666372}.|S -> L (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|S -> Y (in colorectal cancer and PTR; enhances transactivation of target genes). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:9065402}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.S33C(168)|p.S33F(97)|p.S33Y(60)|p.A5_A80del(53)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.S33L(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S33N(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.S29_H36del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.D32_H36>D(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TACCTGGACTCTGGAATCCAT	0.488	S33C(SKMEL1_SKIN)|S33F(SW1573_LUNG)|S33Y(SW48_LARGE_INTESTINE)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.S33F	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,0,435	CTNNB1	4904	435	468	Substitution - Missense(331)|Deletion - In frame(111)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(165)|central_nervous_system(82)|large_intestine(40)|endometrium(37)|stomach(32)|skin(21)|ovary(20)|pituitary(19)|pancreas(12)|lung(7)|biliary_tract(6)|soft_tissue(4)|bone(4)|breast(3)|prostate(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|parathyroid(2)|small_intestine(2)|thyroid(1)|NS(1)|urinary_tract(1)|adrenal_gland(1)	c.C98T						.						92.0	77.0	82.0					3																	41266101		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	TGGACTCTGGAAT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.98C>T	3.37:g.41266101C>T	ENSP00000344456:p.Ser33Phe	154.0	0.0		70.0	22.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	37	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.498846	0.85069	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50813	0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73;0.73	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.72053	0.3413	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74188	-0.3746	10	0.87932	D	0	-10.7796	19.9596	0.97236	0.0:1.0:0.0:0.0	.	33	P35222	CTNB1_HUMAN	F	26;33;33;33;33;26;33;33;33	ENSP00000400508:S26F;ENSP00000385604:S33F;ENSP00000412219:S33F;ENSP00000379486:S33F;ENSP00000344456:S33F;ENSP00000411226:S26F;ENSP00000379488:S33F;ENSP00000409302:S33F;ENSP00000401599:S33F	ENSP00000344456:S33F	S	+	2	0	CTNNB1	41241105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.726000	0.93360	0.655000	0.94253	TCT	.	.		0.488	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CDCP1	64866	hgsc.bcm.edu	37	3	45152154	45152154	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:45152154C>A	ENST00000296129.1	-	4	969	c.835G>T	c.(835-837)Gag>Tag	p.E279*	CDCP1_ENST00000425231.2_Nonsense_Mutation_p.E279*|CDCP1_ENST00000490471.1_5'Flank	NM_022842.3	NP_073753.3	Q9H5V8	CDCP1_HUMAN	CUB domain containing protein 1	279						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|skin(4)|urinary_tract(1)	29				BRCA - Breast invasive adenocarcinoma(193;0.00928)|KIRC - Kidney renal clear cell carcinoma(197;0.0519)|Kidney(197;0.0651)		TCAACCCGCTCCTCCTTCCTC	0.577																																					p.E279X		Atlas-SNP	.											.	CDCP1	61	.	0			c.G835T						.						125.0	118.0	121.0					3																	45152154		2203	4300	6503	SO:0001587	stop_gained	64866	exon4			CCCGCTCCTCCTT	AF468010	CCDS2727.1, CCDS46812.1	3p21.3	2006-03-28			ENSG00000163814	ENSG00000163814		"""CD molecules"""	24357	protein-coding gene	gene with protein product		611735				11466621	Standard	NM_022842		Approved	CD318, SIMA135	uc003com.3	Q9H5V8	OTTHUMG00000133090	ENST00000296129.1:c.835G>T	3.37:g.45152154C>A	ENSP00000296129:p.Glu279*	156.0	0.0		155.0	75.0	NM_178181	Q49UB4|Q6NT71|Q6U9Y2|Q8WU91|Q96QU7|Q9H676|Q9H8C2	Nonsense_Mutation	SNP	ENST00000296129.1	37	CCDS2727.1	.	.	.	.	.	.	.	.	.	.	C	36	5.802050	0.96960	.	.	ENSG00000163814	ENST00000296129;ENST00000425231	.	.	.	5.87	3.95	0.45737	.	0.459206	0.26650	N	0.023218	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	16.3177	0.82934	0.0:0.7506:0.2494:0.0	.	.	.	.	X	279	.	ENSP00000296129:E279X	E	-	1	0	CDCP1	45127158	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	2.299000	0.43611	1.593000	0.50029	0.655000	0.94253	GAG	.	.		0.577	CDCP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256748.3	NM_022842	
FEZF2	55079	hgsc.bcm.edu	37	3	62356922	62356922	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:62356922C>A	ENST00000283268.3	-	4	1384	c.1090G>T	c.(1090-1092)Gaa>Taa	p.E364*	FEZF2_ENST00000475839.1_Nonsense_Mutation_p.E364*|PTPRG-AS1_ENST00000495542.1_RNA|PTPRG-AS1_ENST00000490916.1_RNA|FEZF2_ENST00000486811.1_Nonsense_Mutation_p.E364*	NM_018008.3	NP_060478.3	Q8TBJ5	FEZF2_HUMAN	FEZ family zinc finger 2	364					axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cerebral cortex GABAergic interneuron migration (GO:0021853)|dendrite development (GO:0016358)|dentate gyrus development (GO:0021542)|forebrain anterior/posterior pattern specification (GO:0021797)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|lung(8)|skin(1)	20		Lung SC(41;0.0262)		BRCA - Breast invasive adenocarcinoma(55;0.000221)|KIRC - Kidney renal clear cell carcinoma(15;0.00834)|Kidney(15;0.00957)		CCGCAAAATTCGCAGACGAAG	0.572																																					p.E364X	NSCLC(170;1772 2053 12525 15604 23984)	Atlas-SNP	.											.	FEZF2	46	.	0			c.G1090T						.						110.0	107.0	108.0					3																	62356922		2203	4300	6503	SO:0001587	stop_gained	55079	exon4			AAAATTCGCAGAC	AF064845	CCDS2897.1	3p21.1	2013-01-08	2006-08-15	2006-08-15	ENSG00000153266	ENSG00000153266		"""Zinc fingers, C2H2-type"""	13506	protein-coding gene	gene with protein product		607414	"""zinc finger protein 312"""	ZNF312			Standard	NM_018008		Approved	FLJ10142, FKSG36, TOF, FEZL, Zfp312	uc003dli.2	Q8TBJ5	OTTHUMG00000158705	ENST00000283268.3:c.1090G>T	3.37:g.62356922C>A	ENSP00000283268:p.Glu364*	94.0	0.0		79.0	31.0	NM_018008	A8K349|Q9BZ91|Q9NWB9	Nonsense_Mutation	SNP	ENST00000283268.3	37	CCDS2897.1	.	.	.	.	.	.	.	.	.	.	C	37	6.259302	0.97421	.	.	ENSG00000153266	ENST00000486811;ENST00000283268;ENST00000475839	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-18.9899	20.6525	0.99598	0.0:1.0:0.0:0.0	.	.	.	.	X	364	.	ENSP00000283268:E364X	E	-	1	0	FEZF2	62331962	1.000000	0.71417	1.000000	0.80357	0.118000	0.20060	7.818000	0.86416	2.890000	0.99128	0.585000	0.79938	GAA	.	.		0.572	FEZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351813.1	NM_018008	
ADAMTS9	56999	hgsc.bcm.edu	37	3	64582563	64582563	+	Silent	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:64582563C>T	ENST00000498707.1	-	27	4464	c.4122G>A	c.(4120-4122)gaG>gaA	p.E1374E	ADAMTS9_ENST00000295903.4_Silent_p.E1346E	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1374	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		AGGCTCTTTGCTCATCAGGTT	0.498																																					p.E1374E		Atlas-SNP	.											.	ADAMTS9	206	.	0			c.G4122A						.						112.0	94.0	100.0					3																	64582563		2203	4300	6503	SO:0001819	synonymous_variant	56999	exon27			TCTTTGCTCATCA	AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4122G>A	3.37:g.64582563C>T		74.0	0.0		61.0	21.0	NM_182920	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Silent	SNP	ENST00000498707.1	37	CCDS2903.1	.	.	.	.	.	.	.	.	.	.	C	9.687	1.150868	0.21371	.	.	ENSG00000163638	ENST00000481060	.	.	.	5.4	3.59	0.41128	.	.	.	.	.	T	0.62768	0.2455	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59963	-0.7355	4	.	.	.	.	12.2158	0.54406	0.0:0.8604:0.0:0.1396	.	.	.	.	N	430	.	.	S	-	2	0	ADAMTS9	64557603	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.177000	0.42509	0.821000	0.34540	0.591000	0.81541	AGC	.	.		0.498	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351891.1		
FRMD4B	23150	hgsc.bcm.edu	37	3	69362608	69362608	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr3:69362608C>A	ENST00000398540.3	-	2	306	c.223G>T	c.(223-225)Gtt>Ttt	p.V75F	FRMD4B_ENST00000542259.1_Missense_Mutation_p.V21F	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	75	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		CCTACCTGAACCAGCAGCTCC	0.577																																					p.V75F		Atlas-SNP	.											.	FRMD4B	90	.	0			c.G223T						.						53.0	56.0	55.0					3																	69362608		2060	4184	6244	SO:0001583	missense	23150	exon2			CCTGAACCAGCAG	AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.223G>T	3.37:g.69362608C>A	ENSP00000381549:p.Val75Phe	92.0	0.0		56.0	24.0	NM_015123	Q8TAI3	Missense_Mutation	SNP	ENST00000398540.3	37	CCDS46863.1	.	.	.	.	.	.	.	.	.	.	C	29.4	4.999024	0.93227	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000473029;ENST00000460709;ENST00000459638;ENST00000497880	T;T;T;T;T;T	0.80304	-1.36;-1.36;-1.36;-1.36;-1.36;-1.36	6.08	6.08	0.98989	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);	0.000000	0.85682	D	0.000000	D	0.89451	0.6719	M	0.71206	2.165	0.80722	D	1	D;P	0.67145	0.996;0.938	D;P	0.70487	0.969;0.906	D	0.89263	0.3599	10	0.72032	D	0.01	-15.967	19.4349	0.94788	0.0:1.0:0.0:0.0	.	180;75	Q6PEW6;Q9Y2L6	.;FRM4B_HUMAN	F	75;21;21;21;21;21	ENSP00000381549:V75F;ENSP00000437658:V21F;ENSP00000418373:V21F;ENSP00000418023:V21F;ENSP00000417550:V21F;ENSP00000417765:V21F	ENSP00000381549:V75F	V	-	1	0	FRMD4B	69445298	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.500000	0.73687	2.894000	0.99253	0.655000	0.94253	GTT	.	.		0.577	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352111.1		
PDE6B	5158	hgsc.bcm.edu	37	4	619713	619713	+	Missense_Mutation	SNP	C	C	A	rs537263212		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr4:619713C>A	ENST00000496514.1	+	1	319	c.298C>A	c.(298-300)Cgc>Agc	p.R100S	PDE6B_ENST00000255622.6_Missense_Mutation_p.R100S			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	100	GAF 1.		R -> H (in RP40). {ECO:0000269|PubMed:22334370}.		cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GTACCGCCAGCGCAACGGCGT	0.672																																					p.R100S	GBM(71;463 1194 9848 25922 46834)	Atlas-SNP	.											.	PDE6B	80	.	0			c.C298A						.						13.0	12.0	12.0					4																	619713		2193	4289	6482	SO:0001583	missense	5158	exon1			CGCCAGCGCAACG	BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.298C>A	4.37:g.619713C>A	ENSP00000420295:p.Arg100Ser	68.0	0.0		87.0	47.0	NM_001145291	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	ENST00000496514.1	37	CCDS33932.1	.	.	.	.	.	.	.	.	.	.	C	18.35	3.604494	0.66445	.	.	ENSG00000133256	ENST00000255622;ENST00000496514	T;T	0.68479	-0.33;-0.33	4.98	4.04	0.47022	GAF (2);	0.000000	0.85682	D	0.000000	T	0.76673	0.4020	M	0.69248	2.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.75536	-0.3283	10	0.41790	T	0.15	.	9.3606	0.38192	0.3641:0.6359:0.0:0.0	.	100;100	P35913;P35913-2	PDE6B_HUMAN;.	S	100	ENSP00000255622:R100S;ENSP00000420295:R100S	ENSP00000255622:R100S	R	+	1	0	PDE6B	609713	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	0.754000	0.26390	2.326000	0.78906	0.561000	0.74099	CGC	.	.		0.672	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000358109.1	NM_000283	
NDNF	79625	hgsc.bcm.edu	37	4	121966814	121966814	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr4:121966814G>C	ENST00000379692.4	-	2	705	c.179C>G	c.(178-180)aCa>aGa	p.T60R		NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	60					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						CCTCTTAGGTGTATCTCTAAA	0.368																																					p.T60R		Atlas-SNP	.											.	NDNF	72	.	0			c.C179G						.						61.0	58.0	58.0					4																	121966814		1817	4081	5898	SO:0001583	missense	79625	exon2			TTAGGTGTATCTC	BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.179C>G	4.37:g.121966814G>C	ENSP00000369014:p.Thr60Arg	158.0	0.0		72.0	34.0	NM_024574	A8K0Q0|Q6UWE5|Q9H5P7	Missense_Mutation	SNP	ENST00000379692.4	37	CCDS3717.2	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908950	0.52439	.	.	ENSG00000173376	ENST00000379692;ENST00000515757;ENST00000511408	.	.	.	5.72	5.72	0.89469	.	0.048637	0.85682	D	0.000000	T	0.54598	0.1868	L	0.51422	1.61	0.58432	D	0.999999	P	0.41313	0.745	B	0.41236	0.351	T	0.53556	-0.8422	9	0.36615	T	0.2	-23.1078	14.7034	0.69171	0.0:0.0:0.8552:0.1448	.	60	Q8TB73	NDNF_HUMAN	R	60	.	ENSP00000369014:T60R	T	-	2	0	NDNF	122186264	1.000000	0.71417	0.996000	0.52242	0.886000	0.51366	7.500000	0.81588	2.717000	0.92951	0.655000	0.94253	ACA	.	.		0.368	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256532.2	NM_024574	
ADCY2	108	hgsc.bcm.edu	37	5	7698485	7698485	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:7698485A>G	ENST00000338316.4	+	7	1196	c.1107A>G	c.(1105-1107)atA>atG	p.I369M	ADCY2_ENST00000537121.1_Missense_Mutation_p.I189M	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	369					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GTGAAGCCATAAAGTAAGTGG	0.418																																					p.I369M		Atlas-SNP	.											.	ADCY2	337	.	0			c.A1107G						.						136.0	132.0	133.0					5																	7698485		2203	4300	6503	SO:0001583	missense	108	exon7			AGCCATAAAGTAA	AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.1107A>G	5.37:g.7698485A>G	ENSP00000342952:p.Ile369Met	53.0	0.0		28.0	15.0	NM_020546	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	ENST00000338316.4	37	CCDS3872.2	.	.	.	.	.	.	.	.	.	.	A	17.72	3.459733	0.63401	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	D;D	0.85088	-1.94;-1.94	5.8	0.245	0.15512	Adenylyl cyclase class-3/4/guanylyl cyclase (5);	0.000000	0.85682	D	0.000000	D	0.88306	0.6401	M	0.63208	1.945	0.38297	D	0.942866	D;D	0.89917	0.999;1.0	D;D	0.91635	0.999;0.999	D	0.85769	0.1354	10	0.87932	D	0	.	6.742	0.23441	0.4119:0.2473:0.0:0.3408	.	189;369	B7Z2C1;Q08462	.;ADCY2_HUMAN	M	369;220;189	ENSP00000342952:I369M;ENSP00000444803:I189M	ENSP00000342952:I369M	I	+	3	3	ADCY2	7751485	1.000000	0.71417	0.997000	0.53966	0.929000	0.56500	1.513000	0.35823	-0.179000	0.10654	-0.313000	0.08912	ATA	.	.		0.418	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206930.2	NM_020546	
C5orf22	55322	hgsc.bcm.edu	37	5	31541416	31541416	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:31541416G>A	ENST00000325366.9	+	6	1026	c.899G>A	c.(898-900)cGa>cAa	p.R300Q	C5orf22_ENST00000355907.3_5'UTR	NM_018356.2	NP_060826.2	Q49AR2	CE022_HUMAN	chromosome 5 open reading frame 22	300										kidney(3)|large_intestine(2)|lung(10)|ovary(2)|skin(1)	18						GTTGATACTCGAATTCATCAA	0.348																																					p.R300Q		Atlas-SNP	.											C5orf22,NS,carcinoma,0,1	C5orf22	48	1	0			c.G899A						.						108.0	109.0	109.0					5																	31541416		2203	4300	6503	SO:0001583	missense	55322	exon6			ATACTCGAATTCA	AK002055	CCDS3895.1	5p13.3	2012-02-22			ENSG00000082213	ENSG00000082213			25639	protein-coding gene	gene with protein product							Standard	NM_018356		Approved	FLJ11193	uc003jhj.4	Q49AR2	OTTHUMG00000131067	ENST00000325366.9:c.899G>A	5.37:g.31541416G>A	ENSP00000326879:p.Arg300Gln	104.0	0.0		48.0	24.0	NM_018356	Q8ND28|Q8WU61|Q9NUR1	Missense_Mutation	SNP	ENST00000325366.9	37	CCDS3895.1	.	.	.	.	.	.	.	.	.	.	G	35	5.457909	0.96240	.	.	ENSG00000082213	ENST00000325366;ENST00000543911	T	0.46451	0.87	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.69575	0.3126	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.74222	-0.3735	10	0.87932	D	0	-11.6748	19.2415	0.93886	0.0:0.0:1.0:0.0	.	300	Q49AR2	CE022_HUMAN	Q	300;35	ENSP00000326879:R300Q	ENSP00000326879:R300Q	R	+	2	0	C5orf22	31577173	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.884000	0.92432	2.538000	0.85594	0.591000	0.81541	CGA	.	.		0.348	C5orf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253726.2	NM_018356	
ADAMTS12	81792	hgsc.bcm.edu	37	5	33630934	33630934	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:33630934C>A	ENST00000504830.1	-	13	2308	c.1973G>T	c.(1972-1974)tGc>tTc	p.C658F	ADAMTS12_ENST00000504582.1_5'UTR|ADAMTS12_ENST00000352040.3_Intron	NM_030955.2	NP_112217.2	P58397	ATS12_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 12	658	Cys-rich.				cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of cellular response to hepatocyte growth factor stimulus (GO:2001113)|negative regulation of cellular response to vascular endothelial growth factor stimulus (GO:1902548)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of hepatocyte growth factor receptor signaling pathway (GO:1902203)|proteoglycan catabolic process (GO:0030167)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of endothelial tube morphogenesis (GO:1901509)|regulation of inflammatory response (GO:0050727)	extracellular matrix (GO:0031012)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(11)|large_intestine(31)|liver(1)|lung(135)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	216						GCCTTCAAAGCAAGGGGTACC	0.408										HNSCC(64;0.19)																											p.C658F		Atlas-SNP	.											.	ADAMTS12	464	.	0			c.G1973T						.						106.0	106.0	106.0					5																	33630934		2203	4300	6503	SO:0001583	missense	81792	exon13			TCAAAGCAAGGGG	AJ250725	CCDS34140.1	5q35	2008-07-18	2005-08-19		ENSG00000151388	ENSG00000151388		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14605	protein-coding gene	gene with protein product		606184	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 12"""			11279086	Standard	NM_030955		Approved		uc003jia.1	P58397	OTTHUMG00000162088	ENST00000504830.1:c.1973G>T	5.37:g.33630934C>A	ENSP00000422554:p.Cys658Phe	273.0	0.0		142.0	54.0	NM_030955	A2RRN9|A5D6V6|Q6UWL3	Missense_Mutation	SNP	ENST00000504830.1	37	CCDS34140.1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756722	0.89843	.	.	ENSG00000151388	ENST00000504830	T	0.73363	-0.74	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.90865	0.7130	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.93118	0.6522	10	0.87932	D	0	.	19.618	0.95643	0.0:1.0:0.0:0.0	.	658	P58397	ATS12_HUMAN	F	658	ENSP00000422554:C658F	ENSP00000422554:C658F	C	-	2	0	ADAMTS12	33666691	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.741000	0.84997	2.635000	0.89317	0.650000	0.86243	TGC	.	.		0.408	ADAMTS12-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367164.2	NM_030955	
TGFBI	7045	hgsc.bcm.edu	37	5	135388596	135388596	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:135388596A>G	ENST00000442011.2	+	8	1075	c.914A>G	c.(913-915)gAc>gGc	p.D305G	TGFBI_ENST00000305126.8_Splice_Site_p.D305G	NM_000358.2	NP_000349.1	Q15582	BGH3_HUMAN	transforming growth factor, beta-induced, 68kDa	305	FAS1 2. {ECO:0000255|PROSITE- ProRule:PRU00082}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)|integrin binding (GO:0005178)			breast(6)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TGGACCCCAGACCTGCTGAAC	0.572																																					p.D305G		Atlas-SNP	.											.	TGFBI	76	.	0			c.A914G						.						62.0	67.0	65.0					5																	135388596		2142	4247	6389	SO:0001630	splice_region_variant	7045	exon8			CCCCAGACCTGCT	M77349	CCDS47266.1	5q31	2008-02-05	2002-08-29		ENSG00000120708	ENSG00000120708			11771	protein-coding gene	gene with protein product		601692	"""transforming growth factor, beta-induced, 68kD"""	CSD3, LCD1, CSD1, CSD2		9463327	Standard	NM_000358		Approved	BIGH3, CDB1, CDGG1	uc003lbf.4	Q15582	OTTHUMG00000163213	ENST00000442011.2:c.914-1A>G	5.37:g.135388596A>G		82.0	0.0		49.0	21.0	NM_000358	D3DQB1|O14471|O14472|O14476|O43216|O43217|O43218|O43219|Q53XM1	Missense_Mutation	SNP	ENST00000442011.2	37	CCDS47266.1	.	.	.	.	.	.	.	.	.	.	A	14.28	2.487155	0.44249	.	.	ENSG00000120708	ENST00000442011;ENST00000398813;ENST00000305126	D;D	0.90732	-2.72;-2.72	5.65	5.65	0.86999	FAS1 domain (5);	0.000000	0.85682	D	0.000000	D	0.92024	0.7473	L	0.28504	0.86	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.99	D	0.91247	0.5026	9	.	.	.	.	16.1566	0.81673	1.0:0.0:0.0:0.0	.	38;305	B9ZVW9;Q15582	.;BGH3_HUMAN	G	305;38;305	ENSP00000416330:D305G;ENSP00000306306:D305G	.	D	+	2	0	TGFBI	135416495	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	4.659000	0.61504	2.268000	0.75426	0.533000	0.62120	GAC	.	.		0.572	TGFBI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372108.1		Missense_Mutation
PCDHA1	56147	hgsc.bcm.edu	37	5	140168107	140168107	+	Silent	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:140168107G>C	ENST00000504120.2	+	1	2232	c.2232G>C	c.(2230-2232)gcG>gcC	p.A744A	PCDHA1_ENST00000394633.3_Intron|PCDHA1_ENST00000378133.3_Silent_p.A744A	NM_018900.2	NP_061723.1	Q9Y5I3	PCDA1_HUMAN	protocadherin alpha 1	744	5 X 4 AA repeats of P-X-X-P.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(34)|prostate(3)|skin(4)|upper_aerodigestive_tract(5)|urinary_tract(3)	70			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTCCAGCGCGTTGGGGAGCT	0.657																																					p.A744A		Atlas-SNP	.											PCDHA1_ENST00000504120,NS,carcinoma,+2,2	PCDHA1	387	2	0			c.G2232C						.						45.0	41.0	42.0					5																	140168107		2203	4300	6503	SO:0001819	synonymous_variant	56147	exon1			CAGCGCGTTGGGG	AF152479	CCDS54912.1, CCDS54913.1	5q31	2010-11-26				ENSG00000204970		"""Cadherins / Protocadherins : Clustered"""	8663	other	complex locus constituent	"""KIAA0345-like 13"""	606307				10380929	Standard	NM_018900		Approved			Q9Y5I3		ENST00000504120.2:c.2232G>C	5.37:g.140168107G>C		164.0	0.0		152.0	64.0	NM_031410	O75288|Q9NRT7	Silent	SNP	ENST00000504120.2	37	CCDS54913.1																																																																																			.	.		0.657	PCDHA1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000389127.1	NM_018900	
CAMK2A	815	hgsc.bcm.edu	37	5	149602646	149602646	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:149602646C>T	ENST00000348628.6	-	17	2004	c.1339G>A	c.(1339-1341)Gcc>Acc	p.A447T	CAMK2A_ENST00000351010.6_5'UTR|CAMK2A_ENST00000398376.3_Missense_Mutation_p.A458T	NM_015981.3|NM_171825.2	NP_057065.2|NP_741960.1	Q9UQM7	KCC2A_HUMAN	calcium/calmodulin-dependent protein kinase II alpha	447					calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|kinase activity (GO:0016301)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)	15		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCCGACTGGGCGGTGCGTGGG	0.642																																					p.A458T		Atlas-SNP	.											CAMK2A,NS,carcinoma,+2,1	CAMK2A	42	1	0			c.G1372A						.						64.0	74.0	71.0					5																	149602646		2201	4298	6499	SO:0001583	missense	815	exon18			ACTGGGCGGTGCG	AB023185	CCDS43386.1, CCDS43387.1	5q32	2013-09-20	2008-10-30		ENSG00000070808	ENSG00000070808	2.7.11.17		1460	protein-coding gene	gene with protein product	"""CaM-kinase II alpha chain"", ""calcium/calmodulin-dependent protein kinase II alpha-B subunit"", ""CaM kinase II alpha subunit"", ""CaMK-II alpha subunit"", ""calcium/calmodulin-dependent protein kinase type II alpha chain"""	114078	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha"""	CAMKA		10231032, 3475713	Standard	NM_015981		Approved	KIAA0968, CaMKIINalpha	uc003lrt.2	Q9UQM7	OTTHUMG00000134281	ENST00000348628.6:c.1339G>A	5.37:g.149602646C>T	ENSP00000261793:p.Ala447Thr	59.0	0.0		61.0	24.0	NM_015981	Q9UL21|Q9Y2H4|Q9Y352	Missense_Mutation	SNP	ENST00000348628.6	37	CCDS43386.1	.	.	.	.	.	.	.	.	.	.	C	12.12	1.844078	0.32606	.	.	ENSG00000070808	ENST00000348628;ENST00000398376	T;T	0.43294	0.95;0.95	5.15	5.15	0.70609	Protein kinase-like domain (1);Calcium/calmodulin-dependent protein kinase II, association-domain (1);	0.000000	0.64402	U	0.000001	T	0.24392	0.0591	N	0.05230	-0.09	0.45150	D	0.998166	B;B;B	0.12630	0.006;0.002;0.006	B;B;B	0.18263	0.004;0.021;0.004	T	0.10590	-1.0623	10	0.10377	T	0.69	.	18.6945	0.91596	0.0:1.0:0.0:0.0	.	447;458;447	Q9UQM7;A8K161;Q7LDD5	KCC2A_HUMAN;.;.	T	447;458	ENSP00000261793:A447T;ENSP00000381412:A458T	ENSP00000261793:A447T	A	-	1	0	CAMK2A	149582839	0.395000	0.25254	0.992000	0.48379	0.929000	0.56500	1.077000	0.30741	2.419000	0.82065	0.555000	0.69702	GCC	.	.		0.642	CAMK2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258869.2	NM_015981	
RNF145	153830	hgsc.bcm.edu	37	5	158586026	158586026	+	Silent	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:158586026C>A	ENST00000424310.2	-	11	2003	c.1644G>T	c.(1642-1644)gtG>gtT	p.V548V	RNF145_ENST00000519865.1_Silent_p.V548V|RNF145_ENST00000518284.1_5'UTR|RNF145_ENST00000518802.1_Silent_p.V578V|RNF145_ENST00000520638.1_Silent_p.V562V|RNF145_ENST00000521606.2_Silent_p.V565V|RNF145_ENST00000274542.2_Silent_p.V576V	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145	548						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AAGGCGTGATCACAGCAGATT	0.433																																					p.V578V		Atlas-SNP	.											.	RNF145	110	.	0			c.G1734T						.						47.0	49.0	48.0					5																	158586026		2195	4283	6478	SO:0001819	synonymous_variant	153830	exon11			CGTGATCACAGCA	BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.1644G>T	5.37:g.158586026C>A		65.0	0.0		32.0	12.0	NM_001199380	B7Z903|B7Z949|E7EVI7|Q8IVP7	Silent	SNP	ENST00000424310.2	37	CCDS56390.1																																																																																			.	.		0.433	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374048.1	NM_144726	
GABRA6	2559	hgsc.bcm.edu	37	5	161115970	161115970	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr5:161115970G>T	ENST00000274545.5	+	4	674	c.241G>T	c.(241-243)Gtt>Ttt	p.V81F	GABRA6_ENST00000523217.1_Intron|GABRA6_ENST00000522269.1_3'UTR|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	81					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)	p.V81F(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TACGATGGATGTTTTTTTCCG	0.403										TCGA Ovarian(5;0.080)																											p.V81F		Atlas-SNP	.											GABRA6,NS,carcinoma,0,1	GABRA6	139	1	1	Substitution - Missense(1)	endometrium(1)	c.G241T						.						79.0	80.0	80.0					5																	161115970		2203	4299	6502	SO:0001583	missense	2559	exon4			ATGGATGTTTTTT		CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.241G>T	5.37:g.161115970G>T	ENSP00000274545:p.Val81Phe	49.0	0.0		39.0	20.0	NM_000811	A8K096|Q4VAV2	Missense_Mutation	SNP	ENST00000274545.5	37	CCDS4356.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.082017|4.082017	0.76528|0.76528	.|.	.|.	ENSG00000145863|ENSG00000145863	ENST00000520000|ENST00000274545;ENST00000517823	.|T;T	.|0.80994	.|-1.44;-1.44	5.65|5.65	5.65|5.65	0.86999|0.86999	.|Neurotransmitter-gated ion-channel ligand-binding (3);	.|0.054895	.|0.64402	.|D	.|0.000001	T|T	0.75117|0.75117	0.3806|0.3806	L|L	0.28115|0.28115	0.83|0.83	0.80722|0.80722	D|D	1|1	.|B	.|0.27700	.|0.186	.|B	.|0.37387	.|0.248	T|T	0.74659|0.74659	-0.3591|-0.3591	5|10	.|0.87932	.|D	.|0	.|.	13.3239|13.3239	0.60449|0.60449	0.0722:0.0:0.9278:0.0|0.0722:0.0:0.9278:0.0	.|.	.|81	.|Q16445	.|GBRA6_HUMAN	I|F	20|81;28	.|ENSP00000274545:V81F;ENSP00000430212:V28F	.|ENSP00000274545:V81F	M|V	+|+	3|1	0|0	GABRA6|GABRA6	161048548|161048548	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.942000|0.942000	0.58702|0.58702	7.895000|7.895000	0.87343|0.87343	2.824000|2.824000	0.97209|0.97209	0.655000|0.655000	0.94253|0.94253	ATG|GTT	.	.		0.403	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252707.2		
FOXC1	2296	hgsc.bcm.edu	37	6	1612042	1612042	+	Silent	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:1612042G>C	ENST00000380874.2	+	1	1362	c.1362G>C	c.(1360-1362)ggG>ggC	p.G454G		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	454	Poly-Gly.				artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		gcggcggcggGGGAGGCCAGG	0.751																																					p.G454G	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.G1362C						.						1.0	1.0	1.0					6																	1612042		591	1329	1920	SO:0001819	synonymous_variant	2296	exon1			CGGCGGGGGAGGC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1362G>C	6.37:g.1612042G>C		188.0	0.0		346.0	31.0	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Silent	SNP	ENST00000380874.2	37	CCDS4473.1																																																																																			.	.		0.751	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
VPS52	6293	hgsc.bcm.edu	37	6	33231576	33231576	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:33231576G>C	ENST00000445902.2	-	16	1919	c.1701C>G	c.(1699-1701)aaC>aaG	p.N567K	VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000436044.2_Missense_Mutation_p.N442K|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	567					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TCATGTCATAGTTGTTGATCA	0.502																																					p.N567K		Atlas-SNP	.											.	VPS52	56	.	0			c.C1701G						.						118.0	101.0	107.0					6																	33231576		2203	4300	6503	SO:0001583	missense	6293	exon16			GTCATAGTTGTTG	AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1701C>G	6.37:g.33231576G>C	ENSP00000409952:p.Asn567Lys	85.0	0.0		72.0	4.0	NM_022553	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	ENST00000445902.2	37	CCDS4770.2	.	.	.	.	.	.	.	.	.	.	G	25.6	4.655637	0.88056	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	D	0.82976	0.5154	M	0.89601	3.045	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85677	0.1298	9	0.87932	D	0	-19.2835	16.3679	0.83341	0.0:0.0:1.0:0.0	.	378;567	B3KMF7;Q8N1B4	.;VPS52_HUMAN	K	567;545;442	.	ENSP00000414785:N545K	N	-	3	2	VPS52	33339554	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.007000	0.88571	2.819000	0.97034	0.573000	0.79308	AAC	.	.		0.502	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076598.2	NM_022553	
USP45	85015	hgsc.bcm.edu	37	6	99883624	99883624	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:99883624C>T	ENST00000327681.6	-	18	2945	c.2413G>A	c.(2413-2415)Gcc>Acc	p.A805T	USP45_ENST00000369233.2_Missense_Mutation_p.A757T|USP45_ENST00000539675.1_Missense_Mutation_p.A98T|USP45_ENST00000500704.2_Missense_Mutation_p.A805T|USP45_ENST00000392738.2_Missense_Mutation_p.A485T	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	805	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		AGAAGGTAGGCTTGTGCACTA	0.358																																					p.A805T		Atlas-SNP	.											.	USP45	56	.	0			c.G2413A						.						120.0	123.0	122.0					6																	99883624		2203	4300	6503	SO:0001583	missense	85015	exon18			GGTAGGCTTGTGC	AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.2413G>A	6.37:g.99883624C>T	ENSP00000333376:p.Ala805Thr	62.0	0.0		22.0	8.0	NM_001080481	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	ENST00000327681.6	37	CCDS34501.1	.	.	.	.	.	.	.	.	.	.	C	34	5.397139	0.96009	.	.	ENSG00000123552	ENST00000392738;ENST00000500704;ENST00000327681;ENST00000539675;ENST00000369233	T;T;T;T;T	0.55588	0.51;3.21;3.21;0.51;0.51	5.75	5.75	0.90469	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.057388	0.64402	D	0.000002	T	0.79493	0.4455	H	0.94306	3.52	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.84590	0.0666	10	0.87932	D	0	.	19.9376	0.97146	0.0:1.0:0.0:0.0	.	805;485	Q70EL2;Q70EL2-3	UBP45_HUMAN;.	T	485;805;805;98;757	ENSP00000376495:A485T;ENSP00000424372:A805T;ENSP00000333376:A805T;ENSP00000439569:A98T;ENSP00000358236:A757T	ENSP00000333376:A805T	A	-	1	0	USP45	99990345	1.000000	0.71417	1.000000	0.80357	0.720000	0.41350	7.060000	0.76692	2.711000	0.92665	0.655000	0.94253	GCC	.	.		0.358	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041609.2	NM_032929	
SEC63	11231	hgsc.bcm.edu	37	6	108194082	108194082	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:108194082C>T	ENST00000369002.4	-	20	2248	c.2069G>A	c.(2068-2070)gGa>gAa	p.G690E		NM_007214.4	NP_009145.1	Q9UGP8	SEC63_HUMAN	SEC63 homolog (S. cerevisiae)	690	SEC63 2.				liver development (GO:0001889)|multicellular organismal aging (GO:0010259)|nitrogen compound metabolic process (GO:0006807)|posttranslational protein targeting to membrane (GO:0006620)|posttranslational protein targeting to membrane, translocation (GO:0031204)|protein targeting to membrane (GO:0006612)|renal system development (GO:0072001)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(87;5.35e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00225)|Colorectal(196;0.0294)		BRCA - Breast invasive adenocarcinoma(108;0.0079)|Epithelial(106;0.0356)|all cancers(137;0.0525)|OV - Ovarian serous cystadenocarcinoma(136;0.054)		ctgataatttccaggcttgcc	0.373																																					p.G690E		Atlas-SNP	.											.	SEC63	79	.	0			c.G2069A						.						37.0	36.0	37.0					6																	108194082		2092	4094	6186	SO:0001583	missense	11231	exon20			TAATTTCCAGGCT	BC048287	CCDS5061.1	6q21	2011-09-05	2006-09-12		ENSG00000025796	ENSG00000025796		"""Heat shock proteins / DNAJ (HSP40)"""	21082	protein-coding gene	gene with protein product		608648	"""SEC63-like (S. cerevisiae)"""			10219736, 10543453	Standard	NM_007214		Approved	SEC63L, PRO2507, ERdj2, DNAJC23	uc003psc.4	Q9UGP8	OTTHUMG00000015316	ENST00000369002.4:c.2069G>A	6.37:g.108194082C>T	ENSP00000357998:p.Gly690Glu	203.0	0.0		89.0	39.0	NM_007214	O95380|Q5THN4|Q86VS9|Q8IWL0|Q9NTE0	Missense_Mutation	SNP	ENST00000369002.4	37	CCDS5061.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.499067	0.85069	.	.	ENSG00000025796	ENST00000369002;ENST00000437345	T	0.60548	0.18	4.93	4.93	0.64822	Sec63 domain (2);	0.000000	0.85682	D	0.000000	T	0.79563	0.4467	M	0.92507	3.315	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.84115	0.0403	10	0.87932	D	0	-18.4453	17.4262	0.87527	0.0:1.0:0.0:0.0	.	690;690	Q9UGP8;B3KQF0	SEC63_HUMAN;.	E	690;308	ENSP00000357998:G690E	ENSP00000357998:G690E	G	-	2	0	SEC63	108300775	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	3.160000	0.50739	2.725000	0.93324	0.591000	0.81541	GGA	.	.		0.373	SEC63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041705.4	NM_007214	
REV3L	5980	hgsc.bcm.edu	37	6	111652972	111652972	+	Silent	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:111652972T>C	ENST00000358835.3	-	25	8395	c.7941A>G	c.(7939-7941)aaA>aaG	p.K2647K	REV3L_ENST00000435970.1_Silent_p.K2569K|REV3L_ENST00000368802.3_Silent_p.K2647K|REV3L_ENST00000368805.1_Silent_p.K2647K			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	2647					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TACAGCCAAATTTGAACTCAT	0.363								DNA polymerases (catalytic subunits)																													p.K2647K		Atlas-SNP	.											.	REV3L	386	.	0			c.A7941G						.						109.0	106.0	107.0					6																	111652972		2203	4300	6503	SO:0001819	synonymous_variant	5980	exon24			GCCAAATTTGAAC	AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.7941A>G	6.37:g.111652972T>C		115.0	0.0		42.0	16.0	NM_002912	O43214|Q5TC33	Silent	SNP	ENST00000358835.3	37	CCDS5091.2																																																																																			.	.		0.363	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043695.1	NM_002912	
LAMA2	3908	hgsc.bcm.edu	37	6	129723605	129723605	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:129723605T>C	ENST00000421865.2	+	39	5748	c.5699T>C	c.(5698-5700)tTg>tCg	p.L1900S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	1900	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GCAGCTCAGTTGAATGACTCA	0.413																																					p.L1900S		Atlas-SNP	.											.	LAMA2	481	.	0			c.T5699C						.						123.0	92.0	103.0					6																	129723605		2203	4300	6503	SO:0001583	missense	3908	exon39			CTCAGTTGAATGA	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.5699T>C	6.37:g.129723605T>C	ENSP00000400365:p.Leu1900Ser	68.0	0.0		26.0	16.0	NM_000426	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	ENST00000421865.2	37	CCDS5138.1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.133415	0.77662	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.24151	1.87	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000004	T	0.44456	0.1294	M	0.73598	2.24	0.52099	D	0.999946	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.996	T	0.49542	-0.8929	10	0.87932	D	0	.	15.8438	0.78871	0.0:0.0:0.0:1.0	.	1900;1900	A6NF00;P24043	.;LAMA2_HUMAN	S	1900	ENSP00000400365:L1900S	ENSP00000346769:L1900S	L	+	2	0	LAMA2	129765298	1.000000	0.71417	0.955000	0.39395	0.921000	0.55340	6.862000	0.75484	2.132000	0.65825	0.454000	0.30748	TTG	.	.		0.413	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
KIAA1244	57221	hgsc.bcm.edu	37	6	138483281	138483281	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:138483281A>G	ENST00000251691.4	+	1	224	c.58A>G	c.(58-60)Atc>Gtc	p.I20V		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		GTACAAAGCCATCAAGGAGAG	0.697																																					p.I20V		Atlas-SNP	.											.	KIAA1244	236	.	0			c.A58G						.						40.0	51.0	47.0					6																	138483281		1937	4142	6079	SO:0001583	missense	57221	exon1			AAAGCCATCAAGG	AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.58A>G	6.37:g.138483281A>G	ENSP00000251691:p.Ile20Val	144.0	0.0		220.0	85.0	NM_020340		Missense_Mutation	SNP	ENST00000251691.4	37	CCDS5189.2	.	.	.	.	.	.	.	.	.	.	A	14.33	2.504165	0.44558	.	.	ENSG00000112379	ENST00000251691	T	0.19394	2.15	4.07	4.07	0.47477	.	.	.	.	.	T	0.09291	0.0229	L	0.43152	1.355	0.35530	D	0.802199	B	0.25312	0.123	B	0.18871	0.023	T	0.05632	-1.0873	9	0.62326	D	0.03	-13.3507	12.2239	0.54449	1.0:0.0:0.0:0.0	.	20	Q5TH69	BIG3_HUMAN	V	20	ENSP00000251691:I20V	ENSP00000251691:I20V	I	+	1	0	KIAA1244	138524974	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.935000	0.56560	1.487000	0.48415	0.374000	0.22700	ATC	.	.		0.697	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042425.4	NM_020340	
REPS1	85021	hgsc.bcm.edu	37	6	139234056	139234056	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:139234056T>C	ENST00000450536.2	-	16	2391	c.1817A>G	c.(1816-1818)gAt>gGt	p.D606G	REPS1_ENST00000258062.5_Missense_Mutation_p.D605G|REPS1_ENST00000367663.4_Missense_Mutation_p.D579G|REPS1_ENST00000415951.2_Missense_Mutation_p.D579G|REPS1_ENST00000409812.2_Missense_Mutation_p.D515G			Q96D71	REPS1_HUMAN	RALBP1 associated Eps domain containing 1	606					receptor-mediated endocytosis (GO:0006898)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|SH3 domain binding (GO:0017124)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(2)	19				GBM - Glioblastoma multiforme(68;0.000434)|OV - Ovarian serous cystadenocarcinoma(155;0.000548)		GCCATCGGCATCCACTGGGCG	0.473																																					p.D605G		Atlas-SNP	.											REPS1,NS,carcinoma,0,1	REPS1	58	1	0			c.A1814G						.						92.0	80.0	85.0					6																	139234056		2203	4300	6503	SO:0001583	missense	85021	exon16			TCGGCATCCACTG		CCDS5193.2, CCDS47488.1, CCDS69212.1, CCDS69213.1	6q24.1	2013-01-10			ENSG00000135597	ENSG00000135597		"""EF-hand domain containing"""	15578	protein-coding gene	gene with protein product		614825					Standard	XM_005267177		Approved		uc011edr.2	Q96D71	OTTHUMG00000015685	ENST00000450536.2:c.1817A>G	6.37:g.139234056T>C	ENSP00000392065:p.Asp606Gly	59.0	1.0		35.0	15.0	NM_031922	B7ZBZ8|B7ZBZ9|B7ZC00|J3KP76|Q5JWJ5|Q5JWJ6|Q5JWJ7|Q8NDR7|Q8WU62|Q9BXY9	Missense_Mutation	SNP	ENST00000450536.2	37		.	.	.	.	.	.	.	.	.	.	T	17.46	3.394232	0.62066	.	.	ENSG00000135597	ENST00000450536;ENST00000367663;ENST00000529597;ENST00000409812;ENST00000258062;ENST00000415951;ENST00000367668;ENST00000530255	T;T;T;T;T;T	0.31510	1.51;1.49;1.49;1.53;1.51;1.59	6.07	6.07	0.98685	.	0.051097	0.85682	D	0.000000	T	0.28764	0.0713	N	0.22421	0.69	0.44627	D	0.997606	P;P;D;P;B	0.67145	0.873;0.89;0.996;0.799;0.001	P;B;P;B;B	0.61874	0.461;0.272;0.895;0.272;0.001	T	0.05599	-1.0875	10	0.37606	T	0.19	-18.2411	16.6407	0.85098	0.0:0.0:0.0:1.0	.	605;554;515;606;579	Q96D71-3;B2R7D3;Q96D71-2;Q96D71;E9PMG1	.;.;.;REPS1_HUMAN;.	G	606;579;564;515;605;579;554;129	ENSP00000392065:D606G;ENSP00000356635:D579G;ENSP00000434251:D564G;ENSP00000386699:D515G;ENSP00000258062:D605G;ENSP00000397941:D579G	ENSP00000258062:D605G	D	-	2	0	REPS1	139275749	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.421000	0.66447	2.326000	0.78906	0.533000	0.62120	GAT	.	.		0.473	REPS1-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000042447.3		
MTRF1L	54516	hgsc.bcm.edu	37	6	153316417	153316417	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:153316417T>C	ENST00000367233.5	-	3	376	c.377A>G	c.(376-378)gAa>gGa	p.E126G	MTRF1L_ENST00000367231.5_Missense_Mutation_p.E126G|MTRF1L_ENST00000464135.1_5'UTR|MTRF1L_ENST00000367230.1_Missense_Mutation_p.E126G	NM_019041.5	NP_061914.3	Q9UGC7	RF1ML_HUMAN	mitochondrial translational release factor 1-like	126						mitochondrion (GO:0005739)	translation release factor activity, codon specific (GO:0016149)			endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	10		Ovarian(120;0.125)		OV - Ovarian serous cystadenocarcinoma(155;4.24e-10)|BRCA - Breast invasive adenocarcinoma(81;0.0888)		CAAATCATTTTCATCTGTTTC	0.308																																					p.E126G		Atlas-SNP	.											.	MTRF1L	21	.	0			c.A377G						.						25.0	25.0	25.0					6																	153316417		2194	4295	6489	SO:0001583	missense	54516	exon3			TCATTTTCATCTG	BC011873	CCDS5243.1, CCDS47502.1, CCDS75540.1	6q25-q26	2008-02-05			ENSG00000112031	ENSG00000112031			21051	protein-coding gene	gene with protein product		613542					Standard	NM_019041		Approved		uc003qpi.4	Q9UGC7	OTTHUMG00000015857	ENST00000367233.5:c.377A>G	6.37:g.153316417T>C	ENSP00000356202:p.Glu126Gly	165.0	0.0		69.0	31.0	NM_019041	B3KTA0|Q3KR06|Q5TF44|Q5TF50|Q96CC5|Q96EX4|Q96K40	Missense_Mutation	SNP	ENST00000367233.5	37	CCDS5243.1	.	.	.	.	.	.	.	.	.	.	T	12.72	2.022417	0.35701	.	.	ENSG00000112031	ENST00000367233;ENST00000367231;ENST00000367230;ENST00000414771	T;T;T;T	0.45668	0.89;0.89;0.89;2.76	5.43	2.99	0.34606	Peptide chain release factor (2);	0.655706	0.16258	N	0.222370	T	0.15305	0.0369	L	0.49350	1.555	0.21473	N	0.999673	B;B;B;B	0.12630	0.002;0.005;0.001;0.006	B;B;B;B	0.12156	0.003;0.003;0.003;0.007	T	0.24261	-1.0165	10	0.30078	T	0.28	-5.9767	7.4452	0.27207	0.0:0.0758:0.1442:0.7801	.	126;126;126;126	B4DMX1;Q9UGC7-2;Q9UGC7-4;Q9UGC7	.;.;.;RF1ML_HUMAN	G	126;126;126;13	ENSP00000356202:E126G;ENSP00000356200:E126G;ENSP00000356199:E126G;ENSP00000414383:E13G	ENSP00000356199:E126G	E	-	2	0	MTRF1L	153358110	0.984000	0.35163	0.984000	0.44739	0.985000	0.73830	2.576000	0.46033	0.351000	0.24027	0.477000	0.44152	GAA	.	.		0.308	MTRF1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042764.1	NM_019041	
PLG	5340	hgsc.bcm.edu	37	6	161134133	161134133	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr6:161134133T>A	ENST00000308192.9	+	5	586	c.523T>A	c.(523-525)Tac>Aac	p.Y175N	PLG_ENST00000462918.1_3'UTR	NM_000301.3	NP_000292.1	P00747	PLMN_HUMAN	plasminogen	175	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-cell adhesion mediated by cadherin (GO:2000048)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of fibrinolysis (GO:0051918)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of fibrinolysis (GO:0051919)|tissue remodeling (GO:0048771)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	apolipoprotein binding (GO:0034185)|protein domain specific binding (GO:0019904)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(19)|ovary(1)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)	59				OV - Ovarian serous cystadenocarcinoma(65;5.24e-17)|BRCA - Breast invasive adenocarcinoma(81;7.08e-06)	Alteplase(DB00009)|Aminocaproic Acid(DB00513)|Anistreplase(DB00029)|Aprotinin(DB06692)|Reteplase(DB00015)|Streptokinase(DB00086)|Tenecteplase(DB00031)|Tranexamic Acid(DB00302)|Urokinase(DB00013)	GAGATATGACTACTGCGACAT	0.468																																					p.Y175N		Atlas-SNP	.											.	PLG	150	.	0			c.T523A						.						147.0	143.0	144.0					6																	161134133		2203	4300	6503	SO:0001583	missense	5340	exon5			TATGACTACTGCG	M74220	CCDS5279.1, CCDS55074.1	6q26	2012-10-02			ENSG00000122194	ENSG00000122194			9071	protein-coding gene	gene with protein product		173350					Standard	NM_000301		Approved		uc003qtm.4	P00747	OTTHUMG00000015957	ENST00000308192.9:c.523T>A	6.37:g.161134133T>A	ENSP00000308938:p.Tyr175Asn	53.0	0.0		49.0	15.0	NM_000301	Q15146|Q5TEH4|Q6PA00	Missense_Mutation	SNP	ENST00000308192.9	37	CCDS5279.1	.	.	.	.	.	.	.	.	.	.	T	13.72	2.322488	0.41096	.	.	ENSG00000122194	ENST00000308192	T	0.66460	-0.21	5.11	5.11	0.69529	Kringle (4);Kringle-like fold (1);	0.000000	0.35903	U	0.002905	T	0.75627	0.3875	M	0.91459	3.21	0.46654	D	0.99914	P	0.50066	0.931	P	0.51615	0.675	T	0.82446	-0.0453	10	0.72032	D	0.01	.	14.1696	0.65500	0.0:0.0:0.0:1.0	.	175	P00747	PLMN_HUMAN	N	175	ENSP00000308938:Y175N	ENSP00000308938:Y175N	Y	+	1	0	PLG	161054123	0.968000	0.33430	0.864000	0.33941	0.330000	0.28571	1.849000	0.39318	2.054000	0.61138	0.528000	0.53228	TAC	.	.		0.468	PLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042959.2	NM_000301	
CHPF2	54480	hgsc.bcm.edu	37	7	150935715	150935715	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr7:150935715G>C	ENST00000035307.2	+	4	3780	c.2267G>C	c.(2266-2268)cGt>cCt	p.R756P	RP4-548D19.3_ENST00000607902.1_RNA|CHPF2_ENST00000495645.1_Missense_Mutation_p.R748P|MIR671_ENST00000390183.1_RNA	NM_019015.1	NP_061888.1	Q9P2E5	CHPF2_HUMAN	chondroitin polymerizing factor 2	756					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(4)|prostate(1)|skin(3)	17						CTAGGGGGCCGTGCCCAGCTG	0.622																																					p.R756P		Atlas-SNP	.											.	CHPF2	52	.	0			c.G2267C						.						17.0	17.0	17.0					7																	150935715		2200	4300	6500	SO:0001583	missense	54480	exon4			GGGGCCGTGCCCA	AB037823	CCDS34779.1, CCDS64803.1	7q36.1	2013-02-19			ENSG00000033100	ENSG00000033100	2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	29270	protein-coding gene	gene with protein product		608037				10718198, 12145278, 18316376	Standard	NM_019015		Approved	KIAA1402, ChSy-3, CSGlcA-T	uc003wjr.1	Q9P2E5	OTTHUMG00000157380	ENST00000035307.2:c.2267G>C	7.37:g.150935715G>C	ENSP00000035307:p.Arg756Pro	69.0	0.0		95.0	23.0	NM_019015	B2DBD8|Q6P2I4|Q6UXD2	Missense_Mutation	SNP	ENST00000035307.2	37	CCDS34779.1	.	.	.	.	.	.	.	.	.	.	G	23.2	4.388043	0.82902	.	.	ENSG00000033100	ENST00000495645;ENST00000035307	T;T	0.16743	2.32;2.32	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.45478	0.1344	M	0.82056	2.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.46442	-0.9191	10	0.54805	T	0.06	-12.2	17.0841	0.86606	0.0:0.0:1.0:0.0	.	756;748	Q9P2E5;G5E9W2	CHPF2_HUMAN;.	P	748;756	ENSP00000418914:R748P;ENSP00000035307:R756P	ENSP00000035307:R756P	R	+	2	0	CHPF2	150566648	1.000000	0.71417	0.993000	0.49108	0.997000	0.91878	9.648000	0.98483	2.492000	0.84095	0.655000	0.94253	CGT	.	.		0.622	CHPF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348648.2	NM_019015	
XKR6	286046	hgsc.bcm.edu	37	8	10782179	10782179	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:10782179A>G	ENST00000416569.2	-	2	952	c.926T>C	c.(925-927)aTc>aCc	p.I309T	XKR6_ENST00000304437.2_Missense_Mutation_p.I30T	NM_173683.3	NP_775954.2	Q5GH73	XKR6_HUMAN	XK, Kell blood group complex subunit-related family, member 6	309						integral component of membrane (GO:0016021)				breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(8)|ovary(2)|prostate(1)|skin(3)	31				Lung(29;0.0407)|COAD - Colon adenocarcinoma(149;0.0555)		CTGGAGCATGATGTAGAGCTG	0.647																																					p.I309T		Atlas-SNP	.											.	XKR6	85	.	0			c.T926C						.						87.0	84.0	85.0					8																	10782179		2203	4300	6503	SO:0001583	missense	286046	exon2			AGCATGATGTAGA	BC024146	CCDS5978.2	8p23.1	2009-05-27	2006-01-12	2005-07-28	ENSG00000171044	ENSG00000171044			27806	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 7"", ""chromosome 8 open reading frame 21"", ""X Kell blood group precursor-related family, member 6"", ""chromosome 8 open reading frame 5"""	C8orf7, C8orf21, C8orf5			Standard	NM_173683		Approved		uc003wtk.1	Q5GH73	OTTHUMG00000129351	ENST00000416569.2:c.926T>C	8.37:g.10782179A>G	ENSP00000416707:p.Ile309Thr	64.0	0.0		38.0	17.0	NM_173683	Q8TBA0	Missense_Mutation	SNP	ENST00000416569.2	37	CCDS5978.2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	22.8|22.8	4.341404|4.341404	0.81911|0.81911	.|.	.|.	ENSG00000171044|ENSG00000171044	ENST00000304437;ENST00000416569|ENST00000382461	T;T|.	0.74106|.	-0.81;-0.81|.	4.84|4.84	4.84|4.84	0.62591|0.62591	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.80380|0.80380	0.4612|0.4612	M|M	0.90705|0.90705	3.14|3.14	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.80764|.	0.994|.	D|D	0.84462|0.84462	0.0594|0.0594	10|5	0.87932|.	D|.	0|.	-0.4384|-0.4384	13.5992|13.5992	0.62010|0.62010	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	309|.	Q5GH73|.	XKR6_HUMAN|.	T|P	30;309|86	ENSP00000307120:I30T;ENSP00000416707:I309T|.	ENSP00000307120:I30T|.	I|S	-|-	2|1	0|0	XKR6|XKR6	10819589|10819589	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.894000|0.894000	0.52154|0.52154	9.095000|9.095000	0.94175|0.94175	1.797000|1.797000	0.52628|0.52628	0.375000|0.375000	0.23000|0.23000	ATC|TCA	.	.		0.647	XKR6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383958.1	NM_173683	
PSD3	23362	hgsc.bcm.edu	37	8	18662113	18662113	+	Splice_Site	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:18662113C>A	ENST00000327040.8	-	6	1932		c.e6-1		PSD3_ENST00000286485.8_Splice_Site|PSD3_ENST00000440756.2_Splice_Site|PSD3_ENST00000523619.1_Splice_Site	NM_015310.3	NP_056125.3	Q9NYI0	PSD3_HUMAN	pleckstrin and Sec7 domain containing 3						neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20				Colorectal(111;0.0281)|READ - Rectum adenocarcinoma(644;0.183)		AAATTCGTTGCTATAAGAAAA	0.373																																					.		Atlas-SNP	.											.	PSD3	142	.	0			c.1830-1G>T						.						98.0	102.0	100.0					8																	18662113		2203	4300	6503	SO:0001630	splice_region_variant	23362	exon7			TCGTTGCTATAAG	AF243495	CCDS34854.1, CCDS43720.1	8p21.3	2013-01-10			ENSG00000156011	ENSG00000156011		"""Pleckstrin homology (PH) domain containing"""	19093	protein-coding gene	gene with protein product		614440					Standard	NM_206909		Approved	KIAA0942, HCA67, EFA6R, DKFZp761K1423	uc003wza.3	Q9NYI0	OTTHUMG00000163711	ENST00000327040.8:c.1830-1G>T	8.37:g.18662113C>A		101.0	0.0		46.0	22.0	NM_015310	A6NFQ4|E9KL50|Q6B003|Q9Y2F1	Splice_Site	SNP	ENST00000327040.8	37	CCDS43720.1	.	.	.	.	.	.	.	.	.	.	C	14.62	2.589004	0.46110	.	.	ENSG00000156011	ENST00000327040;ENST00000440756;ENST00000286485;ENST00000523619;ENST00000520858;ENST00000519851;ENST00000521027	.	.	.	6.07	6.07	0.98685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1532	0.89682	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PSD3	18706393	1.000000	0.71417	0.998000	0.56505	0.455000	0.32408	6.959000	0.76031	2.885000	0.99019	0.655000	0.94253	.	.	.		0.373	PSD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000374867.1	NM_015310	Intron
ADAM28	10863	hgsc.bcm.edu	37	8	24199212	24199212	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:24199212A>C	ENST00000265769.4	+	16	1882	c.1772A>C	c.(1771-1773)gAa>gCa	p.E591A	ADAM28_ENST00000397649.3_Missense_Mutation_p.E338A|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	591	Cys-rich.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		TTTGATCCTGAAGACACAAGT	0.413																																					p.E591A	NSCLC(193;488 2149 22258 34798 40734)	Atlas-SNP	.											.	ADAM28	100	.	0			c.A1772C						.						206.0	195.0	199.0					8																	24199212		2203	4300	6503	SO:0001583	missense	10863	exon16			ATCCTGAAGACAC	AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1772A>C	8.37:g.24199212A>C	ENSP00000265769:p.Glu591Ala	199.0	0.0		106.0	53.0	NM_014265	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	ENST00000265769.4	37	CCDS34865.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.307|6.307	0.424674|0.424674	0.11928|0.11928	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000265769;ENST00000397649|ENST00000521629;ENST00000518326	T;T|.	0.01725|.	4.77;4.67|.	5.82|5.82	5.82|5.82	0.92795|0.92795	ADAM, cysteine-rich (1);|.	.|.	.|.	.|.	.|.	T|.	0.66703|.	0.2816|.	M|M	0.68317|0.68317	2.08|2.08	0.33797|0.33797	D|D	0.626131|0.626131	D;D|.	0.56746|.	0.977;0.977|.	P;P|.	0.52424|.	0.698;0.698|.	T|.	0.76152|.	-0.3064|.	9|.	0.07813|.	T|.	0.8|.	.|.	12.574|12.574	0.56354|0.56354	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	591;591|.	B2RMV5;Q9UKQ2|.	.;ADA28_HUMAN|.	A|C	591;338|223;16	ENSP00000265769:E591A;ENSP00000380770:E338A|.	ENSP00000265769:E591A|.	E|X	+|+	2|3	0|0	ADAM28|ADAM28	24255157|24255157	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.126000|0.126000	0.20510|0.20510	2.739000|2.739000	0.47409|0.47409	2.236000|2.236000	0.73375|0.73375	0.523000|0.523000	0.50628|0.50628	GAA|TGA	.	.		0.413	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375441.2	NM_021778	
SLCO5A1	81796	hgsc.bcm.edu	37	8	70744717	70744717	+	Silent	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:70744717C>A	ENST00000260126.4	-	2	898	c.192G>T	c.(190-192)gtG>gtT	p.V64V	RP11-159H10.3_ENST00000528800.2_RNA|SLCO5A1_ENST00000530307.1_Silent_p.V64V|SLCO5A1_ENST00000528658.1_5'UTR|RP11-159H10.3_ENST00000533300.1_RNA|RP11-159H10.3_ENST00000501104.2_RNA|SLCO5A1_ENST00000524945.1_Silent_p.V64V	NM_030958.2	NP_112220.2	Q9H2Y9	SO5A1_HUMAN	solute carrier organic anion transporter family, member 5A1	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	53	Breast(64;0.0654)		Epithelial(68;0.0141)|OV - Ovarian serous cystadenocarcinoma(28;0.0315)|all cancers(69;0.0594)			CCGAAGAATCCACACAGCCAA	0.642											OREG0018815	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V64V		Atlas-SNP	.											.	SLCO5A1	142	.	0			c.G192T						.						36.0	40.0	39.0					8																	70744717		2203	4300	6503	SO:0001819	synonymous_variant	81796	exon2			AGAATCCACACAG	AF205075	CCDS6205.1, CCDS55242.1, CCDS55243.1	8q13.1	2013-05-22	2003-11-25	2003-11-26	ENSG00000137571	ENSG00000137571		"""Solute carriers"""	19046	protein-coding gene	gene with protein product		613543	"""solute carrier family 21 (organic anion transporter), member 15"""	SLC21A15		12507753	Standard	NM_030958		Approved	OATPRP4, OATP-J, OATP5A1	uc003xyl.3	Q9H2Y9	OTTHUMG00000165121	ENST00000260126.4:c.192G>T	8.37:g.70744717C>A		78.0	0.0	1124	105.0	68.0	NM_030958	A4QPC2|B2RPF7|B3KMU7|E9PKK5|G3V1C0	Silent	SNP	ENST00000260126.4	37	CCDS6205.1																																																																																			.	.		0.642	SLCO5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381990.3	NM_030958	
SPAG1	6674	hgsc.bcm.edu	37	8	101206459	101206459	+	Missense_Mutation	SNP	A	A	C	rs56246127	byFrequency	TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:101206459A>C	ENST00000388798.2	+	10	1250	c.1059A>C	c.(1057-1059)aaA>aaC	p.K353N	SPAG1_ENST00000251809.3_Missense_Mutation_p.K353N|SPAG1_ENST00000520508.1_Missense_Mutation_p.K353N|SPAG1_ENST00000520643.1_Missense_Mutation_p.K353N	NM_003114.4	NP_003105.2	Q07617	SPAG1_HUMAN	sperm associated antigen 1	353					axonemal dynein complex assembly (GO:0070286)|single fertilization (GO:0007338)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	all_cancers(14;2.35e-05)|all_epithelial(15;5.2e-08)|Lung NSC(17;0.000283)|all_lung(17;0.000823)	Breast(495;0.195)	Epithelial(11;1.12e-09)|all cancers(13;1.26e-07)|OV - Ovarian serous cystadenocarcinoma(57;4.37e-05)|STAD - Stomach adenocarcinoma(118;0.0525)	KIRC - Kidney renal clear cell carcinoma(542;0.00178)|READ - Rectum adenocarcinoma(644;0.236)		AAGAAGGAAAAAGCGGAAGAA	0.358																																					p.K353N		Atlas-SNP	.											.	SPAG1	80	.	0			c.A1059C						.						64.0	64.0	64.0					8																	101206459		2203	4300	6503	SO:0001583	missense	6674	exon10			AGGAAAAAGCGGA	AF311312	CCDS34930.1	8q22	2014-01-21			ENSG00000104450	ENSG00000104450		"""Tetratricopeptide (TTC) repeat domain containing"""	11212	protein-coding gene	gene with protein product		603395				16368546	Standard	NM_172218		Approved	SP75, FLJ32920, HSD-3.8, TPIS, CT140	uc003yjh.2	Q07617	OTTHUMG00000164706	ENST00000388798.2:c.1059A>C	8.37:g.101206459A>C	ENSP00000373450:p.Lys353Asn	577.0	0.0		370.0	20.0	NM_003114	A6NP70|B3KQ58|G3XAM3|Q7Z5G1	Missense_Mutation	SNP	ENST00000388798.2	37	CCDS34930.1	.	.	.	.	.	.	.	.	.	.	A	0.762	-0.768896	0.02974	.	.	ENSG00000104450	ENST00000520643;ENST00000251809;ENST00000520508;ENST00000388798	T;T;T;T	0.63417	2.83;-0.04;2.83;-0.04	5.39	0.943	0.19531	.	0.615169	0.15977	N	0.235509	T	0.48370	0.1496	L	0.41824	1.3	0.09310	N	1	P;P	0.44195	0.828;0.804	B;B	0.41764	0.366;0.16	T	0.32188	-0.9916	10	0.32370	T	0.25	-15.8264	6.443	0.21861	0.5813:0.0:0.4187:0.0	.	353;353	Q07617;G3XAM3	SPAG1_HUMAN;.	N	353	ENSP00000427716:K353N;ENSP00000251809:K353N;ENSP00000428070:K353N;ENSP00000373450:K353N	ENSP00000251809:K353N	K	+	3	2	SPAG1	101275635	0.154000	0.22792	0.011000	0.14972	0.025000	0.11179	1.135000	0.31454	0.261000	0.21753	-0.425000	0.05940	AAA	.	.		0.358	SPAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379853.2	NM_172218	
EFR3A	23167	hgsc.bcm.edu	37	8	132966069	132966069	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:132966069C>T	ENST00000254624.5	+	6	718	c.493C>T	c.(493-495)Cga>Tga	p.R165*	EFR3A_ENST00000519656.1_Nonsense_Mutation_p.R129*|EFR3A_ENST00000334503.4_Nonsense_Mutation_p.R165*	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	165						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			TTATAGGATACGAATTGCTGG	0.348																																					p.R165X		Atlas-SNP	.											.	EFR3A	96	.	0			c.C493T						.						29.0	26.0	27.0					8																	132966069		2200	4282	6482	SO:0001587	stop_gained	23167	exon6			AGGATACGAATTG	D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.493C>T	8.37:g.132966069C>T	ENSP00000254624:p.Arg165*	97.0	0.0		48.0	10.0	NM_015137	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Nonsense_Mutation	SNP	ENST00000254624.5	37	CCDS34942.2	.	.	.	.	.	.	.	.	.	.	C	34	5.298382	0.95574	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000519656	.	.	.	5.6	3.77	0.43336	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0935	5.6691	0.17713	0.144:0.6428:0.139:0.0743	.	.	.	.	X	165;129;165;165;129	.	ENSP00000254624:R165X	R	+	1	2	EFR3A	133035251	1.000000	0.71417	0.973000	0.42090	0.716000	0.41182	4.744000	0.62118	0.693000	0.31634	0.484000	0.47621	CGA	.	.		0.348	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000318886.1	NM_015137	
COL22A1	169044	hgsc.bcm.edu	37	8	139856352	139856352	+	Silent	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr8:139856352G>T	ENST00000303045.6	-	4	1154	c.708C>A	c.(706-708)acC>acA	p.T236T	COL22A1_ENST00000435777.1_Silent_p.T236T	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	236					extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TTCCTCCATTGGTGTGCTTAA	0.458										HNSCC(7;0.00092)																											p.T236T		Atlas-SNP	.											.	COL22A1	390	.	0			c.C708A						.						374.0	326.0	342.0					8																	139856352		2203	4300	6503	SO:0001819	synonymous_variant	169044	exon4			TCCATTGGTGTGC	AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.708C>A	8.37:g.139856352G>T		79.0	0.0		64.0	20.0	NM_152888	B7ZMH0|C9K0G4|Q8IVT9	Silent	SNP	ENST00000303045.6	37	CCDS6376.1																																																																																			.	.		0.458	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000315905.2	XM_291257	
VCP	7415	hgsc.bcm.edu	37	9	35068306	35068306	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr9:35068306T>G	ENST00000358901.6	-	2	966	c.71A>C	c.(70-72)aAt>aCt	p.N24T		NM_007126.3	NP_009057.1	P55072	TERA_HUMAN	valosin containing protein	24					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|aggresome assembly (GO:0070842)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|positive regulation of Lys63-specific deubiquitinase activity (GO:1903007)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein K63-linked deubiquitination (GO:1903006)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|retrograde protein transport, ER to cytosol (GO:0030970)|translesion synthesis (GO:0019985)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Hrd1p ubiquitin ligase complex (GO:0000836)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|proteasome complex (GO:0000502)|site of double-strand break (GO:0035861)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|deubiquitinase activator activity (GO:0035800)|lipid binding (GO:0008289)|poly(A) RNA binding (GO:0044822)|polyubiquitin binding (GO:0031593)|protein domain specific binding (GO:0019904)|protein phosphatase binding (GO:0019903)|ubiquitin-specific protease binding (GO:1990381)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	24			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			AATTAACCGATTGGGACGGTT	0.473																																					p.N24T		Atlas-SNP	.											.	VCP	64	.	0			c.A71C						.						342.0	308.0	320.0					9																	35068306		2203	4300	6503	SO:0001583	missense	7415	exon2			AACCGATTGGGAC	AC004472	CCDS6573.1	9p13.3	2014-09-17	2011-01-25		ENSG00000165280	ENSG00000165280		"""ATPases / AAA-type"""	12666	protein-coding gene	gene with protein product		601023	"""valosin-containing protein"""			8595912, 7553851	Standard	NM_007126		Approved	IBMPFD, p97	uc003zvy.2	P55072	OTTHUMG00000019855	ENST00000358901.6:c.71A>C	9.37:g.35068306T>G	ENSP00000351777:p.Asn24Thr	73.0	0.0		59.0	25.0	NM_007126	B2R5T8|Q0V924|Q2TAI5|Q969G7|Q9UCD5	Missense_Mutation	SNP	ENST00000358901.6	37	CCDS6573.1	.	.	.	.	.	.	.	.	.	.	T	19.84	3.902443	0.72754	.	.	ENSG00000165280	ENST00000358901	D	0.83075	-1.68	6.06	6.06	0.98353	Aspartate decarboxylase-like fold (2);	0.000000	0.85682	D	0.000000	D	0.86785	0.6016	M	0.91300	3.195	0.80722	D	1	P	0.46395	0.877	B	0.42214	0.38	D	0.87026	0.2132	10	0.28530	T	0.3	-1.4889	15.1804	0.72952	0.0:0.0:0.0:1.0	.	24	P55072	TERA_HUMAN	T	24	ENSP00000351777:N24T	ENSP00000351777:N24T	N	-	2	0	VCP	35058306	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.922000	0.87538	2.324000	0.78689	0.533000	0.62120	AAT	.	.		0.473	VCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052290.1	NM_007126	
COL5A1	1289	hgsc.bcm.edu	37	9	137703411	137703411	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr9:137703411G>A	ENST00000371817.3	+	46	4070	c.3656G>A	c.(3655-3657)gGc>gAc	p.G1219D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	1219	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGTCCCAGAGGCTTTCCTGGA	0.652											OREG0019605	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G1219D		Atlas-SNP	.											.	COL5A1	323	.	0			c.G3656A						.						21.0	21.0	21.0					9																	137703411		2144	4217	6361	SO:0001583	missense	1289	exon46			CCAGAGGCTTTCC	D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.3656G>A	9.37:g.137703411G>A	ENSP00000360882:p.Gly1219Asp	132.0	0.0	1635	117.0	45.0	NM_000093	Q15094|Q5SUX4	Missense_Mutation	SNP	ENST00000371817.3	37	CCDS6982.1	.	.	.	.	.	.	.	.	.	.	G	17.31	3.358006	0.61403	.	.	ENSG00000130635	ENST00000371817	D	0.99619	-6.28	4.0	4.0	0.46444	.	0.000000	0.85682	U	0.000000	D	0.99764	0.9904	H	0.96720	3.87	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.96824	0.9606	10	0.87932	D	0	.	16.112	0.81271	0.0:0.0:1.0:0.0	.	1219	P20908	CO5A1_HUMAN	D	1219	ENSP00000360882:G1219D	ENSP00000360882:G1219D	G	+	2	0	COL5A1	136843232	1.000000	0.71417	0.197000	0.23402	0.601000	0.36947	9.718000	0.98758	1.780000	0.52325	0.544000	0.68410	GGC	.	.		0.652	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054954.2	NM_000093	
ANAPC2	29882	hgsc.bcm.edu	37	9	140077646	140077646	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr9:140077646G>A	ENST00000323927.2	-	6	1221	c.1217C>T	c.(1216-1218)gCg>gTg	p.A406V		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	406					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		CACGCGCAGCGCCTTGATGGC	0.627																																					p.A406V		Atlas-SNP	.											.	ANAPC2	57	.	0			c.C1217T						.						138.0	137.0	137.0					9																	140077646		2203	4300	6503	SO:0001583	missense	29882	exon6			CGCAGCGCCTTGA	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1217C>T	9.37:g.140077646G>A	ENSP00000314004:p.Ala406Val	101.0	0.0		104.0	40.0	NM_013366	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	37	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	G	31	5.066762	0.93898	.	.	ENSG00000176248	ENST00000323927	T	0.71579	-0.58	4.83	4.83	0.62350	.	0.050390	0.85682	D	0.000000	T	0.80199	0.4579	M	0.62723	1.935	0.80722	D	1	D;D	0.76494	0.999;0.998	D;P	0.63877	0.919;0.868	T	0.79797	-0.1652	10	0.42905	T	0.14	-14.5684	15.4405	0.75178	0.0:0.0:1.0:0.0	.	406;403	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	V	406	ENSP00000314004:A406V	ENSP00000314004:A406V	A	-	2	0	ANAPC2	139197467	1.000000	0.71417	0.957000	0.39632	0.817000	0.46193	9.112000	0.94314	2.515000	0.84797	0.561000	0.74099	GCG	.	.		0.627	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
CUBN	8029	hgsc.bcm.edu	37	10	17113430	17113430	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr10:17113430C>T	ENST00000377833.4	-	19	2685	c.2620G>A	c.(2620-2622)Gtt>Att	p.V874I		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	874	CUB 4. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CTTACCTCAACATAATCTGTT	0.363																																					p.V874I		Atlas-SNP	.											.	CUBN	515	.	0			c.G2620A						.						72.0	71.0	71.0					10																	17113430		2203	4300	6503	SO:0001583	missense	8029	exon19			CCTCAACATAATC	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.2620G>A	10.37:g.17113430C>T	ENSP00000367064:p.Val874Ile	116.0	0.0		69.0	6.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	37	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	C	4.433	0.080178	0.08533	.	.	ENSG00000107611	ENST00000377833	T	0.37411	1.2	5.47	-5.88	0.02290	CUB (5);	0.805314	0.10456	N	0.672549	T	0.26231	0.0640	L	0.38175	1.15	0.80722	D	1	B	0.11235	0.004	B	0.19148	0.024	T	0.43393	-0.9394	10	0.09843	T	0.71	.	18.8206	0.92096	0.0:0.7513:0.0:0.2487	.	874	O60494	CUBN_HUMAN	I	874	ENSP00000367064:V874I	ENSP00000367064:V874I	V	-	1	0	CUBN	17153436	0.990000	0.36364	0.888000	0.34837	0.566000	0.35808	0.228000	0.17814	-1.017000	0.03367	-0.540000	0.04249	GTT	.	.		0.363	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
KIAA1217	56243	hgsc.bcm.edu	37	10	24727389	24727389	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr10:24727389C>T	ENST00000376454.3	+	5	857	c.827C>T	c.(826-828)aCt>aTt	p.T276I	KIAA1217_ENST00000430453.2_Missense_Mutation_p.T197I|KIAA1217_ENST00000458595.1_Missense_Mutation_p.T276I|KIAA1217_ENST00000376462.1_Missense_Mutation_p.T196I|KIAA1217_ENST00000376452.3_Missense_Mutation_p.T276I	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	276					embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						ACACCAAAAACTATGAATGGA	0.398																																					p.T276I		Atlas-SNP	.											.	KIAA1217	235	.	0			c.C827T						.						208.0	178.0	188.0					10																	24727389		2203	4300	6503	SO:0001583	missense	56243	exon5			CAAAAACTATGAA	BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.827C>T	10.37:g.24727389C>T	ENSP00000365637:p.Thr276Ile	104.0	0.0		69.0	27.0	NM_019590	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Missense_Mutation	SNP	ENST00000376454.3	37	CCDS31165.1	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348988	0.41599	.	.	ENSG00000120549	ENST00000376462;ENST00000376456;ENST00000458595;ENST00000376454;ENST00000376452;ENST00000438429;ENST00000430453	T;T;T;T;T;T;T	0.62364	0.03;0.03;0.03;0.03;0.03;0.03;0.03	5.46	5.46	0.80206	.	0.227354	0.45606	D	0.000352	T	0.52565	0.1742	L	0.31664	0.95	0.34613	D	0.717826	P;P;P;P	0.42203	0.554;0.601;0.634;0.773	B;B;B;B	0.40506	0.218;0.331;0.3;0.316	T	0.57562	-0.7790	10	0.14252	T	0.57	.	19.3041	0.94153	0.0:1.0:0.0:0.0	.	276;276;276;276	Q5T5P2-7;A6NLF3;Q5T5P2;Q5T5P2-2	.;.;SKT_HUMAN;.	I	196;276;276;276;276;126;197	ENSP00000365645:T196I;ENSP00000365639:T276I;ENSP00000392625:T276I;ENSP00000365637:T276I;ENSP00000365635:T276I;ENSP00000404798:T126I;ENSP00000389680:T197I	ENSP00000365635:T276I	T	+	2	0	KIAA1217	24767395	1.000000	0.71417	0.483000	0.27378	0.669000	0.39330	4.321000	0.59209	2.583000	0.87209	0.573000	0.79308	ACT	.	.		0.398	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000047223.2	NM_019590	
GRID1	2894	hgsc.bcm.edu	37	10	87966273	87966273	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr10:87966273G>A	ENST00000327946.7	-	3	453	c.368C>T	c.(367-369)tCg>tTg	p.S123L		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	123					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)	p.S123L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						GGTGCGTGGCGACCCTCCCGG	0.627										Multiple Myeloma(13;0.14)																											p.S123L		Atlas-SNP	.											GRID1,extremity,malignant_melanoma,0,1	GRID1	204	1	1	Substitution - Missense(1)	skin(1)	c.C368T						.						182.0	114.0	137.0					10																	87966273		2203	4300	6503	SO:0001583	missense	2894	exon3			CGTGGCGACCCTC	AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.368C>T	10.37:g.87966273G>A	ENSP00000330148:p.Ser123Leu	88.0	0.0		94.0	36.0	NM_017551	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	ENST00000327946.7	37	CCDS31236.1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.315816	0.81469	.	.	ENSG00000182771	ENST00000327946	D	0.87029	-2.2	6.06	6.06	0.98353	Extracellular ligand-binding receptor (1);	0.156570	0.43579	D	0.000554	D	0.84465	0.5478	L	0.44542	1.39	0.80722	D	1	D	0.53462	0.96	B	0.41374	0.355	D	0.84894	0.0838	10	0.46703	T	0.11	.	19.609	0.95594	0.0:0.0:1.0:0.0	.	123	Q9ULK0	GRID1_HUMAN	L	123	ENSP00000330148:S123L	ENSP00000330148:S123L	S	-	2	0	GRID1	87956253	1.000000	0.71417	0.462000	0.27118	0.902000	0.53008	9.863000	0.99569	2.882000	0.98803	0.655000	0.94253	TCG	.	.		0.627	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049148.3	XM_043613	
LZTS2	84445	hgsc.bcm.edu	37	10	102770318	102770318	+	IGR	SNP	G	G	T	rs397516634		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr10:102770318G>T	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		tgcggctacggctgcggctac	0.706																																					p.S776R	Esophageal Squamous(8;38 437 13604 19902 37640)	Atlas-SNP	.											.	PDZD7	101	.	0			c.C2328A						.																																			SO:0001628	intergenic_variant	79955	exon15			GCTACGGCTGCGG	AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		10.37:g.102770318G>T		362.0	0.0		438.0	216.0	NM_001195263		Missense_Mutation	SNP	ENST00000370220.1	37	CCDS7507.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.174087	0.38413	.	.	ENSG00000186862	ENST00000393462	.	.	.	5.41	2.24	0.28232	.	.	.	.	.	T	0.34542	0.0901	L	0.27053	0.805	0.80722	D	1	.	.	.	.	.	.	T	0.05354	-1.0890	6	0.09338	T	0.73	.	5.4482	0.16548	0.2673:0.1418:0.591:0.0	.	.	.	.	R	776	.	ENSP00000377106:S776R	S	-	3	2	PDZD7	102760308	0.942000	0.31987	0.998000	0.56505	0.773000	0.43773	0.818000	0.27295	0.165000	0.19558	0.561000	0.74099	AGC	.	.		0.706	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049872.1	XM_046743	
MUC2	4583	hgsc.bcm.edu	37	11	1093375	1093375	+	Missense_Mutation	SNP	C	C	T	rs552937801	byFrequency	TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr11:1093375C>T	ENST00000441003.2	+	30	5221	c.5194C>T	c.(5194-5196)Cca>Tca	p.P1732S	MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_Missense_Mutation_p.P20S|MUC2_ENST00000359061.5_Missense_Mutation_p.P1699S	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	tacggtgaccccaaccccaac	0.657																																					p.P1732S		Atlas-SNP	.											.	MUC2	614	.	0			c.C5194T						.																																			SO:0001583	missense	4583	exon30			GTGACCCCAACCC	L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5194C>T	11.37:g.1093375C>T	ENSP00000415183:p.Pro1732Ser	39.0	0.0		39.0	5.0	NM_002457	Q14878	Missense_Mutation	SNP	ENST00000441003.2	37		.	.	.	.	.	.	.	.	.	.	C	0.065	-1.214378	0.01555	.	.	ENSG00000198788	ENST00000441003;ENST00000359061;ENST00000333592	T;T;T	0.10288	3.1;3.17;2.89	1.49	-1.27	0.09347	.	498.391000	0.02047	N	0.049780	T	0.06050	0.0157	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.28902	-1.0029	9	0.20519	T	0.43	.	2.7543	0.05288	0.4674:0.3566:0.0:0.176	.	1732	E7EUV1	.	S	1732;1699;20	ENSP00000415183:P1732S;ENSP00000351956:P1699S;ENSP00000331373:P20S	ENSP00000331373:P20S	P	+	1	0	MUC2	1083375	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.627000	0.00874	-0.601000	0.05783	-1.152000	0.01820	CCA	.	.		0.657	MUC2-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000345894.2	NM_002457	
MYEOV	26579	hgsc.bcm.edu	37	11	69063143	69063143	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr11:69063143T>C	ENST00000308946.3	+	3	676	c.226T>C	c.(226-228)Tcc>Ccc	p.S76P	MYEOV_ENST00000441339.2_Missense_Mutation_p.S76P|MYEOV_ENST00000535407.1_Missense_Mutation_p.S18P	NM_138768.2	NP_620123.2	Q96EZ4	MYEOV_HUMAN	myeloma overexpressed	76										endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|urinary_tract(1)	24	all_lung(4;2.21e-19)|Lung NSC(4;6.13e-19)|Melanoma(5;0.00128)		LUSC - Lung squamous cell carcinoma(11;3.33e-11)|STAD - Stomach adenocarcinoma(18;0.00654)|LUAD - Lung adenocarcinoma(13;0.0713)	Kidney(183;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(183;3.23e-08)|Lung(977;0.00361)|LUSC - Lung squamous cell carcinoma(976;0.0153)		AGCCGGCAGATCCCGGGGCCG	0.607																																					p.S76P		Atlas-SNP	.											.	MYEOV	42	.	0			c.T226C						.						50.0	59.0	56.0					11																	69063143		2200	4294	6494	SO:0001583	missense	26579	exon3			GGCAGATCCCGGG	AJ223366	CCDS8190.1, CCDS73340.1	11q13.2	2013-03-27	2013-03-27			ENSG00000172927			7563	protein-coding gene	gene with protein product		605625	"""myeloma overexpressed (in a subset of t(11;14) positive multiple myelomas)"""			10753852	Standard	XM_005273908		Approved	OCIM	uc001oov.3	Q96EZ4		ENST00000308946.3:c.226T>C	11.37:g.69063143T>C	ENSP00000308330:p.Ser76Pro	66.0	0.0		73.0	36.0	NM_138768	Q9UGN6|Q9UGN7	Missense_Mutation	SNP	ENST00000308946.3	37	CCDS8190.1	.	.	.	.	.	.	.	.	.	.	T	8.577	0.881480	0.17467	.	.	ENSG00000172927	ENST00000441339;ENST00000308946;ENST00000535407	T;T;T	0.24350	1.87;1.87;1.86	1.38	-1.15	0.09709	.	.	.	.	.	T	0.11580	0.0282	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.25222	-1.0138	9	0.87932	D	0	.	5.4883	0.16761	0.0:0.7029:0.0:0.2971	.	76	Q96EZ4	MYEOV_HUMAN	P	76;76;18	ENSP00000412482:S76P;ENSP00000308330:S76P;ENSP00000438100:S18P	ENSP00000308330:S76P	S	+	1	0	MYEOV	68819719	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.389000	0.07342	-0.347000	0.08299	-0.512000	0.04463	TCC	.	.		0.607	MYEOV-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396548.1		
FDXACB1	91893	hgsc.bcm.edu	37	11	111742145	111742145	+	IGR	SNP	C	C	G	rs10708475|rs200786242		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr11:111742145C>G	ENST00000260257.4	-	0	2789				ALG9_ENST00000524880.1_Missense_Mutation_p.R254P|ALG9_ENST00000527377.1_5'UTR|ALG9_ENST00000398006.2_5'Flank|ALG9_ENST00000531154.1_5'Flank|ALG9_ENST00000527228.1_5'UTR	NM_138378.2	NP_612387.1	Q9BRP7	FDXA1_HUMAN	ferredoxin-fold anticodon binding domain containing 1						phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA processing (GO:0008033)		ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(3)	19						GCAGCCGGGGCGCGTATCCCC	0.711																																					p.A21P		Atlas-SNP	.											.	ALG9	77	.	0			c.G61C						.						1.0	1.0	1.0					11																	111742145		776	1973	2749	SO:0001628	intergenic_variant	79796	exon2			CCGGGGCGCGTAT		CCDS44729.1	11q23.1	2011-04-15			ENSG00000255561	ENSG00000255561			25110	protein-coding gene	gene with protein product	"""hypothetical protein BC006136"""						Standard	NR_038364		Approved	LOC91893, hCG_2033039	uc001pmc.4	Q9BRP7	OTTHUMG00000166795		11.37:g.111742145C>G		650.0	0.0		759.0	35.0	NM_001077690	A0PJW7|B4DUU2	Missense_Mutation	SNP	ENST00000260257.4	37	CCDS44729.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.83|11.83	1.756102|1.756102	0.31137|0.31137	.|.	.|.	ENSG00000086848|ENSG00000086848	ENST00000428306|ENST00000428306	.|.	.|.	.|.	4.98|4.98	0.976|0.976	0.19727|0.19727	.|.	.|.	.|.	.|.	.|.	.|T	.|0.17831	.|0.0428	N|N	0.14661|0.14661	0.345|0.345	0.09310|0.09310	N|N	0.99999|0.99999	.|B;B	.|0.21147	.|0.0;0.052	.|B;B	.|0.16722	.|0.0;0.016	.|T	.|0.23940	.|-1.0174	.|8	.|0.26408	.|T	.|0.33	.|.	4.2702|4.2702	0.10783|0.10783	0.1565:0.5847:0.0:0.2588|0.1565:0.5847:0.0:0.2588	.|.	.|21;21	.|Q9H6U8-3;Q9H6U8	.|.;ALG9_HUMAN	.|P	-1|254	.|.	.|ENSP00000387627:A254P	.|A	-|-	.|1	.|0	ALG9|ALG9	111247355|111247355	0.130000|0.130000	0.22417|0.22417	0.101000|0.101000	0.21167|0.21167	0.687000|0.687000	0.40016|0.40016	0.758000|0.758000	0.26447|0.26447	0.032000|0.032000	0.15435|0.15435	-0.291000|-0.291000	0.09656|0.09656	.|GCC	.	.		0.711	FDXACB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391497.1	NM_138378	
APOA1	335	hgsc.bcm.edu	37	11	116706843	116706843	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr11:116706843T>G	ENST00000236850.4	-	4	850	c.485A>C	c.(484-486)cAa>cCa	p.Q162P	AP006216.12_ENST00000444200.1_RNA|APOA1_ENST00000375323.1_Missense_Mutation_p.Q162P|APOA1_ENST00000359492.2_Missense_Mutation_p.Q162P|APOA1_ENST00000375329.2_Missense_Mutation_p.Q140P|APOA1_ENST00000375320.1_Missense_Mutation_p.Q162P	NM_000039.1	NP_000030.1	P02647	APOA1_HUMAN	apolipoprotein A-I	162	10 X approximate tandem repeats.				adrenal gland development (GO:0030325)|blood coagulation (GO:0007596)|blood vessel endothelial cell migration (GO:0043534)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endothelial cell proliferation (GO:0001935)|G-protein coupled receptor signaling pathway (GO:0007186)|glucocorticoid metabolic process (GO:0008211)|high-density lipoprotein particle assembly (GO:0034380)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|integrin-mediated signaling pathway (GO:0007229)|lipid storage (GO:0019915)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein metabolic process (GO:0042157)|negative chemotaxis (GO:0050919)|negative regulation of cell adhesion molecule production (GO:0060354)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of lipase activity (GO:0060192)|negative regulation of response to cytokine stimulus (GO:0060761)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of very-low-density lipoprotein particle remodeling (GO:0010903)|organ regeneration (GO:0031100)|peptidyl-methionine modification (GO:0018206)|peripheral nervous system axon regeneration (GO:0014012)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of hydrolase activity (GO:0051345)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of transferase activity (GO:0051347)|protein oxidation (GO:0018158)|protein stabilization (GO:0050821)|regulation of Cdc42 protein signal transduction (GO:0032489)|regulation of intestinal cholesterol absorption (GO:0030300)|regulation of protein phosphorylation (GO:0001932)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to nutrient (GO:0007584)|retinoid metabolic process (GO:0001523)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|triglyceride homeostasis (GO:0070328)	blood microparticle (GO:0072562)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|high-density lipoprotein particle (GO:0034364)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule lumen (GO:0034774)|spherical high-density lipoprotein particle (GO:0034366)|very-low-density lipoprotein particle (GO:0034361)|vesicle (GO:0031982)	apolipoprotein A-I receptor binding (GO:0034191)|apolipoprotein receptor binding (GO:0034190)|beta-amyloid binding (GO:0001540)|chemorepellent activity (GO:0045499)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|enzyme binding (GO:0019899)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor binding (GO:0070653)|identical protein binding (GO:0042802)|lipase inhibitor activity (GO:0055102)|phosphatidylcholine-sterol O-acyltransferase activator activity (GO:0060228)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)			cervix(1)|endometrium(1)|lung(4)|prostate(1)|skin(2)	9	all_hematologic(175;0.0487)	Breast(348;0.0126)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.0564)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;8.54e-06)|Epithelial(105;1.59e-05)|all cancers(92;0.000162)|OV - Ovarian serous cystadenocarcinoma(223;0.148)		CAGCTTCTCTTGCAGCTCGTG	0.687																																					p.Q162P		Atlas-SNP	.											.	APOA1	19	.	0			c.A485C						.						24.0	25.0	24.0					11																	116706843		2201	4291	6492	SO:0001583	missense	335	exon4			TTCTCTTGCAGCT	X02162	CCDS8378.1	11q23-q24	2014-09-17			ENSG00000118137	ENSG00000118137		"""Apolipoproteins"""	600	protein-coding gene	gene with protein product		107680					Standard	NM_000039		Approved		uc001ppv.1	P02647	OTTHUMG00000046112	ENST00000236850.4:c.485A>C	11.37:g.116706843T>G	ENSP00000236850:p.Gln162Pro	51.0	0.0		40.0	18.0	NM_000039	A8K866|Q6LDN9|Q6Q785|Q9UCS8|Q9UCT8	Missense_Mutation	SNP	ENST00000236850.4	37	CCDS8378.1	.	.	.	.	.	.	.	.	.	.	T	14.95	2.688098	0.48097	.	.	ENSG00000118137	ENST00000375320;ENST00000359492;ENST00000375329;ENST00000375323;ENST00000236850	T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02	5.17	4.03	0.46877	Apolipoprotein/apolipophorin (1);	0.950518	0.08651	U	0.913947	D	0.87977	0.6314	M	0.83012	2.62	0.38490	D	0.947941	D	0.54964	0.969	D	0.66847	0.947	T	0.81743	-0.0793	10	0.56958	D	0.05	-4.7239	9.7196	0.40295	0.0:0.0834:0.0:0.9166	.	162	P02647	APOA1_HUMAN	P	162;162;140;162;162	ENSP00000364469:Q162P;ENSP00000352471:Q162P;ENSP00000364478:Q140P;ENSP00000364472:Q162P;ENSP00000236850:Q162P	ENSP00000236850:Q162P	Q	-	2	0	APOA1	116212053	0.996000	0.38824	0.714000	0.30535	0.033000	0.12548	2.672000	0.46850	0.799000	0.34018	0.379000	0.24179	CAA	.	.		0.687	APOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106281.2	NM_000039	
CEP164	22897	hgsc.bcm.edu	37	11	117222658	117222658	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr11:117222658A>G	ENST00000278935.3	+	5	494	c.347A>G	c.(346-348)aAg>aGg	p.K116R		NM_001271933.1|NM_014956.4	NP_001258862.1|NP_055771.4	Q9UPV0	CE164_HUMAN	centrosomal protein 164kDa	116	Interaction with ATRIP.|Lys-rich.				cilium assembly (GO:0042384)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary transition fiber (GO:0097539)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|kidney(7)|large_intestine(12)|lung(18)|ovary(3)|prostate(3)	47	all_hematologic(175;0.0487)	Breast(348;0.00908)|Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;4e-05)|Epithelial(105;0.0008)		aaaaaaaaaaaggaaaagaaa	0.502																																					p.K116R		Atlas-SNP	.											CEP164,caecum,carcinoma,0,1	CEP164	121	1	0			c.A347G						.						33.0	34.0	34.0					11																	117222658		2201	4296	6497	SO:0001583	missense	22897	exon4			AAAAAAAGGAAAA	AB028975	CCDS31683.1	11q23.3	2014-02-20			ENSG00000110274	ENSG00000110274			29182	protein-coding gene	gene with protein product		614848				10470851, 14654843	Standard	NM_014956		Approved	KIAA1052, NPHP15	uc001prc.3	Q9UPV0	OTTHUMG00000167070	ENST00000278935.3:c.347A>G	11.37:g.117222658A>G	ENSP00000278935:p.Lys116Arg	87.0	0.0		53.0	3.0	NM_001271933	Q6PKH9|Q7Z2X9|Q9NVS0|Q9UFJ6	Missense_Mutation	SNP	ENST00000278935.3	37	CCDS31683.1	.	.	.	.	.	.	.	.	.	.	A	15.14	2.744661	0.49151	.	.	ENSG00000110274	ENST00000533153;ENST00000278935;ENST00000525416;ENST00000545330;ENST00000533570;ENST00000529538	T;T;T;T	0.76060	-0.34;-0.03;-0.29;-0.99	5.95	4.82	0.62117	.	0.243999	0.29172	N	0.012934	T	0.80221	0.4583	M	0.62723	1.935	0.34770	D	0.733632	D;P;B;D	0.56521	0.959;0.482;0.023;0.976	P;B;B;P	0.56960	0.65;0.11;0.01;0.81	D	0.85776	0.1358	10	0.62326	D	0.03	-27.2573	11.2799	0.49188	0.9276:0.0:0.0724:0.0	.	116;70;116;116	E9PI34;B7Z884;Q9UPV0;Q9UPV0-2	.;.;CE164_HUMAN;.	R	70;116;70;70;116;116	ENSP00000436034:K70R;ENSP00000278935:K116R;ENSP00000435759:K70R;ENSP00000431302:K116R	ENSP00000278935:K116R	K	+	2	0	CEP164	116727868	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	8.713000	0.91408	1.068000	0.40764	0.533000	0.62120	AAG	.	.		0.502	CEP164-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392893.1	NM_014956	
PLEKHG6	55200	hgsc.bcm.edu	37	12	6424240	6424240	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr12:6424240C>T	ENST00000396988.3	+	4	594	c.364C>T	c.(364-366)Ccc>Tcc	p.P122S	PLEKHG6_ENST00000449001.2_Missense_Mutation_p.P90S|PLEKHG6_ENST00000536531.1_Missense_Mutation_p.P122S|PLEKHG6_ENST00000011684.7_Missense_Mutation_p.P122S	NM_001144856.1	NP_001138328.1	Q3KR16	PKHG6_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 6	122						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(4)	23						GCCCCGGCTGCCCCCTGAGGA	0.642																																					p.P122S		Atlas-SNP	.											.	PLEKHG6	62	.	0			c.C364T						.						76.0	70.0	72.0					12																	6424240		2203	4300	6503	SO:0001583	missense	55200	exon4			CGGCTGCCCCCTG	AK001527	CCDS8541.1, CCDS44808.1	12p13.31	2013-01-11			ENSG00000008323	ENSG00000008323		"""Pleckstrin homology (PH) domain containing"""	25562	protein-coding gene	gene with protein product		611743					Standard	NM_018173		Approved	FLJ10665	uc001qnr.3	Q3KR16	OTTHUMG00000168266	ENST00000396988.3:c.364C>T	12.37:g.6424240C>T	ENSP00000380185:p.Pro122Ser	61.0	0.0		47.0	16.0	NM_001144856	Q3SWR1|Q8N1P1|Q8WYY1|Q9H8F4|Q9NVK9	Missense_Mutation	SNP	ENST00000396988.3	37	CCDS8541.1	.	.	.	.	.	.	.	.	.	.	C	23.9	4.468019	0.84533	.	.	ENSG00000008323	ENST00000011684;ENST00000536531;ENST00000396988;ENST00000449001	T;T;T;T	0.72051	-0.49;-0.31;-0.49;-0.62	5.0	5.0	0.66597	.	0.000000	0.51477	D	0.000086	D	0.83096	0.5180	M	0.77103	2.36	0.80722	D	1	P;D;D	0.89917	0.953;1.0;0.999	P;D;D	0.76575	0.821;0.988;0.946	D	0.84419	0.0570	10	0.59425	D	0.04	-19.2803	13.6539	0.62327	0.0:1.0:0.0:0.0	.	90;122;122	Q3KR16-2;F5H731;Q3KR16	.;.;PKHG6_HUMAN	S	122;122;122;90	ENSP00000011684:P122S;ENSP00000442836:P122S;ENSP00000380185:P122S;ENSP00000393194:P90S	ENSP00000011684:P122S	P	+	1	0	PLEKHG6	6294501	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.047000	0.64232	2.600000	0.87896	0.591000	0.81541	CCC	.	.		0.642	PLEKHG6-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399031.1	NM_018173	
CLEC2D	29121	hgsc.bcm.edu	37	12	9833543	9833543	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr12:9833543C>G	ENST00000290855.6	+	2	108	c.86C>G	c.(85-87)tCt>tGt	p.S29C	CLEC2D_ENST00000487752.1_3'UTR|CLEC2D_ENST00000261339.6_Intron|CLEC2D_ENST00000543300.1_Missense_Mutation_p.S29C|CLEC2D_ENST00000545918.1_Intron|CLEC2D_ENST00000261340.7_Missense_Mutation_p.S29C	NM_013269.5	NP_037401.1	Q9UHP7	CLC2D_HUMAN	C-type lectin domain family 2, member D	29					cell surface receptor signaling pathway (GO:0007166)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|stomach(1)	9						AAAGAGCATTCTATTAAAGCT	0.313																																					p.S29C		Atlas-SNP	.											.	CLEC2D	54	.	0			c.C86G						.						129.0	124.0	126.0					12																	9833543		2202	4297	6499	SO:0001583	missense	29121	exon2			AGCATTCTATTAA	AF133299	CCDS8602.1, CCDS31741.1, CCDS55800.1, CCDS55801.1, CCDS55802.1	12p13.31	2011-05-24	2005-09-29		ENSG00000069493	ENSG00000069493		"""C-type lectin domain containing"""	14351	protein-coding gene	gene with protein product	"""C-type lectin related f"", ""lectin-like transcript 1"""	605659	"""C-type lectin superfamily 2, member D"""				Standard	NM_013269		Approved	LLT1, CLAX, OCIL	uc001qwf.3	Q9UHP7	OTTHUMG00000168369	ENST00000290855.6:c.86C>G	12.37:g.9833543C>G	ENSP00000290855:p.Ser29Cys	72.0	0.0		26.0	8.0	NM_001004419	D6CI39|D6CI40|D6CI41|Q6YID5|Q8WUP7|Q9HD37|Q9HD38	Missense_Mutation	SNP	ENST00000290855.6	37	CCDS8602.1	.	.	.	.	.	.	.	.	.	.	C	10.80	1.451488	0.26074	.	.	ENSG00000069493	ENST00000261340;ENST00000290855;ENST00000543300;ENST00000430909;ENST00000544322	T;T;T;T;T	0.11277	4.42;4.57;2.83;4.32;2.79	1.31	1.31	0.21738	.	.	.	.	.	T	0.13841	0.0335	N	0.19112	0.55	0.18873	N	0.999989	D;D	0.71674	0.998;0.989	D;D	0.67725	0.953;0.924	T	0.23476	-1.0187	8	.	.	.	-1.3815	6.0258	0.19654	0.0:1.0:0.0:0.0	.	29;29	Q9UHP7;Q9UHP7-3	CLC2D_HUMAN;.	C	29;29;29;8;3	ENSP00000261340:S29C;ENSP00000290855:S29C;ENSP00000443065:S29C;ENSP00000413045:S8C;ENSP00000437861:S3C	.	S	+	2	0	CLEC2D	9724810	0.001000	0.12720	0.026000	0.17262	0.055000	0.15305	0.002000	0.13061	1.051000	0.40369	0.436000	0.28706	TCT	.	.		0.313	CLEC2D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000335424.2	NM_013269	
TMBIM6	7009	hgsc.bcm.edu	37	12	50153095	50153095	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr12:50153095A>G	ENST00000267115.5	+	8	690	c.605A>G	c.(604-606)gAt>gGt	p.D202G	TMBIM6_ENST00000423828.1_Missense_Mutation_p.D260G|TMBIM6_ENST00000395006.4_Missense_Mutation_p.D202G|TMBIM6_ENST00000547798.1_Missense_Mutation_p.D165G|TMBIM6_ENST00000549385.1_Missense_Mutation_p.D202G|TMBIM6_ENST00000552699.1_Missense_Mutation_p.D260G	NM_003217.2	NP_003208.2	P55061	BI1_HUMAN	transmembrane BAX inhibitor motif containing 6	202					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleus (GO:0005634)				lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						GGAGATCAAGATTATATCTGG	0.438																																					p.D260G		Atlas-SNP	.											.	TMBIM6	26	.	0			c.A779G						.						166.0	152.0	157.0					12																	50153095		2203	4300	6503	SO:0001583	missense	7009	exon8			ATCAAGATTATAT	X75861	CCDS31797.1, CCDS44875.1	12q13.12	2013-10-08	2008-09-17	2008-09-17	ENSG00000139644	ENSG00000139644			11723	protein-coding gene	gene with protein product	"""BAX inhibitor 1"""	600748	"""testis enhanced gene transcript"""	TEGT		8530040, 9660918	Standard	NM_001098576		Approved	BI-1, BAXI1	uc001ruy.2	P55061	OTTHUMG00000169652	ENST00000267115.5:c.605A>G	12.37:g.50153095A>G	ENSP00000267115:p.Asp202Gly	67.0	0.0		36.0	16.0	NM_001098576	B2R5M4|F8W034|O14938|Q643A7|Q96J50	Missense_Mutation	SNP	ENST00000267115.5	37	CCDS31797.1	.	.	.	.	.	.	.	.	.	.	A	28.5	4.928452	0.92389	.	.	ENSG00000139644	ENST00000552699;ENST00000267115;ENST00000549385;ENST00000423828;ENST00000542631;ENST00000552370;ENST00000395006;ENST00000547798	T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.71962	0.3402	M	0.92412	3.305	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.79676	-0.1704	10	0.87932	D	0	.	14.3706	0.66836	1.0:0.0:0.0:0.0	.	260;202	F8W034;P55061	.;BI1_HUMAN	G	260;202;202;260;202;202;202;165	ENSP00000446734:D260G;ENSP00000267115:D202G;ENSP00000448036:D202G;ENSP00000389277:D260G;ENSP00000450158:D202G;ENSP00000378454:D202G;ENSP00000447030:D165G	ENSP00000267115:D202G	D	+	2	0	TMBIM6	48439362	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.284000	0.89912	2.240000	0.73641	0.528000	0.53228	GAT	.	.		0.438	TMBIM6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405289.1	NM_003217	
INHBE	83729	hgsc.bcm.edu	37	12	57850023	57850023	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr12:57850023A>G	ENST00000266646.2	+	2	661	c.445A>G	c.(445-447)Agg>Ggg	p.R149G	INHBE_ENST00000551553.1_3'UTR	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	149					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						GGGACCAAGGAGGAGGCGCCA	0.617											OREG0021944	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.R149G	GBM(191;1808 2166 15720 36624 50371)	Atlas-SNP	.											.	INHBE	38	.	0			c.A445G						.						152.0	147.0	149.0					12																	57850023		2203	4300	6503	SO:0001583	missense	83729	exon2			CCAAGGAGGAGGC		CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.445A>G	12.37:g.57850023A>G	ENSP00000266646:p.Arg149Gly	102.0	0.0	1026	69.0	31.0	NM_031479		Missense_Mutation	SNP	ENST00000266646.2	37	CCDS8939.1	.	.	.	.	.	.	.	.	.	.	A	0.385	-0.926804	0.02377	.	.	ENSG00000139269	ENST00000547970;ENST00000266646	T;T	0.81330	-1.48;-0.17	4.5	2.07	0.26955	Transforming growth factor-beta, N-terminal (1);	0.427931	0.20301	N	0.095035	T	0.67373	0.2886	L	0.39898	1.24	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.50259	-0.8849	10	0.22706	T	0.39	-4.2841	5.9334	0.19152	0.7434:0.1664:0.0902:0.0	.	149	P58166	INHBE_HUMAN	G	94;149	ENSP00000450212:R94G;ENSP00000266646:R149G	ENSP00000266646:R149G	R	+	1	2	INHBE	56136290	0.000000	0.05858	0.012000	0.15200	0.008000	0.06430	0.125000	0.15749	0.323000	0.23307	-0.313000	0.08912	AGG	.	.		0.617	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000406773.1	NM_031479	
EXOC5	10640	hgsc.bcm.edu	37	14	57686092	57686092	+	Missense_Mutation	SNP	T	T	C	rs370435401		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr14:57686092T>C	ENST00000413566.2	-	14	1833	c.1474A>G	c.(1474-1476)Att>Gtt	p.I492V	EXOC5_ENST00000340918.7_Missense_Mutation_p.I427V	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	492					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						AGATGAAAAATAGTATTGGCC	0.313													T|||	1	0.000199681	0.0	0.0	5008	,	,		15036	0.001		0.0	False		,,,				2504	0.0				p.I492V		Atlas-SNP	.											EXOC5,NS,carcinoma,+2,1	EXOC5	45	1	0			c.A1474G						.						51.0	46.0	47.0					14																	57686092		1828	4058	5886	SO:0001583	missense	10640	exon14			GAAAAATAGTATT	U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1474A>G	14.37:g.57686092T>C	ENSP00000389934:p.Ile492Val	404.0	1.0		149.0	54.0	NM_006544	B2R6C5	Missense_Mutation	SNP	ENST00000413566.2	37	CCDS45111.1	.	.	.	.	.	.	.	.	.	.	T	16.36	3.100964	0.56183	.	.	ENSG00000070367	ENST00000413566;ENST00000340918	T;T	0.58210	0.41;0.35	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.41834	0.1176	N	0.21194	0.64	0.80722	D	1	P;B	0.36110	0.537;0.361	B;B	0.36666	0.203;0.23	T	0.42932	-0.9422	10	0.49607	T	0.09	-12.5892	15.3357	0.74250	0.0:0.0:0.0:1.0	.	427;492	F8W9B8;O00471	.;EXOC5_HUMAN	V	492;427	ENSP00000389934:I492V;ENSP00000342100:I427V	ENSP00000342100:I427V	I	-	1	0	EXOC5	56755845	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.159000	0.64923	2.087000	0.62958	0.528000	0.53228	ATT	.	.		0.313	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412905.1	NM_006544	
IFT43	112752	hgsc.bcm.edu	37	14	76488730	76488730	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr14:76488730G>T	ENST00000314067.6	+	3	242	c.208G>T	c.(208-210)Gct>Tct	p.A70S	IFT43_ENST00000238628.6_Missense_Mutation_p.A70S|IFT43_ENST00000553338.1_3'UTR|IFT43_ENST00000556742.1_Missense_Mutation_p.A70S	NM_001102564.1	NP_001096034.1	Q96FT9	IFT43_HUMAN	intraflagellar transport 43	70					cilium morphogenesis (GO:0060271)|intraciliary retrograde transport (GO:0035721)	cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)				endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						TTCCGTGAAGGCTTCGAAGTG	0.478																																					p.A70S		Atlas-SNP	.											.	IFT43	63	.	0			c.G208T						.						141.0	141.0	141.0					14																	76488730		2203	4300	6503	SO:0001583	missense	112752	exon3			GTGAAGGCTTCGA	BC010436	CCDS9847.1, CCDS41973.1, CCDS58330.1	14q24.3	2014-07-03	2014-07-03	2011-06-09				"""Intraflagellar transport homologs"""	29669	protein-coding gene	gene with protein product		614068	"""chromosome 14 open reading frame 179"", ""intraflagellar transport 43 homolog (Chlamydomonas)"""	C14orf179		21378380	Standard	NM_052873		Approved	FLJ32173, MGC16028	uc010asm.1	Q96FT9		ENST00000314067.6:c.208G>T	14.37:g.76488730G>T	ENSP00000324177:p.Ala70Ser	192.0	0.0		60.0	43.0	NM_001102564	B3KPT6|B4DZI9|G3V385|O95418|Q9ULA9	Missense_Mutation	SNP	ENST00000314067.6	37	CCDS41973.1	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.155818	0.00325	.	.	ENSG00000119650	ENST00000314067;ENST00000238628;ENST00000556742	T;T	0.38077	1.16;1.16	4.7	-9.39	0.00619	.	2.866800	0.00848	N	0.001801	T	0.10723	0.0262	N	0.02142	-0.665	0.09310	N	1	B;B;B;B	0.11235	0.004;0.004;0.004;0.0	B;B;B;B	0.08055	0.003;0.003;0.003;0.001	T	0.18209	-1.0344	10	0.16896	T	0.51	-15.0556	3.3446	0.07131	0.5156:0.0979:0.208:0.1786	.	70;70;70;70	Q96FT9;Q96FT9-3;Q96FT9-2;G3V385	IFT43_HUMAN;.;.;.	S	70	ENSP00000324177:A70S;ENSP00000238628:A70S	ENSP00000238628:A70S	A	+	1	0	IFT43	75558483	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.865000	0.01649	-2.611000	0.00445	-1.887000	0.00540	GCT	.	.		0.478	IFT43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_052873	
RTF1	23168	hgsc.bcm.edu	37	15	41771302	41771302	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr15:41771302C>T	ENST00000389629.4	+	16	1832	c.1820C>T	c.(1819-1821)tCc>tTc	p.S607F		NM_015138.4	NP_055953.3	Q92541	RTF1_HUMAN	Rtf1, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)	607					DNA-templated transcription, initiation (GO:0006352)|endodermal cell fate commitment (GO:0001711)|histone H3-K4 trimethylation (GO:0080182)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(1)	18		all_cancers(109;1.79e-19)|all_epithelial(112;8.18e-17)|Lung NSC(122;3.16e-11)|all_lung(180;8.14e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;1.15e-16)|GBM - Glioblastoma multiforme(113;1.81e-06)|BRCA - Breast invasive adenocarcinoma(123;0.119)		CTCTCTCAGTCCAGAGACCCA	0.463																																					p.S607F		Atlas-SNP	.											.	RTF1	76	.	0			c.C1820T						.						86.0	82.0	83.0					15																	41771302		2203	4300	6503	SO:0001630	splice_region_variant	23168	exon16			CTCAGTCCAGAGA	D87440	CCDS32200.2	15q14	2004-03-03	2005-07-20	2005-07-20	ENSG00000137815	ENSG00000137815			28996	protein-coding gene	gene with protein product		611633	"""KIAA0252"""	KIAA0252		15632063	Standard	NM_015138		Approved		uc001zny.3	Q92541	OTTHUMG00000133744	ENST00000389629.4:c.1819-1C>T	15.37:g.41771302C>T		68.0	0.0		60.0	20.0	NM_015138	Q96BX6	Missense_Mutation	SNP	ENST00000389629.4	37	CCDS32200.2	.	.	.	.	.	.	.	.	.	.	C	19.49	3.838150	0.71373	.	.	ENSG00000137815	ENST00000389629	.	.	.	5.47	5.47	0.80525	.	0.053218	0.85682	D	0.000000	T	0.55369	0.1916	L	0.43923	1.385	0.80722	D	1	P	0.44578	0.838	B	0.41271	0.352	T	0.61451	-0.7060	9	0.72032	D	0.01	-9.0335	19.3293	0.94278	0.0:1.0:0.0:0.0	.	607	Q92541	RTF1_HUMAN	F	607	.	ENSP00000374280:S607F	S	+	2	0	RTF1	39558594	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	6.962000	0.76048	2.574000	0.86865	0.563000	0.77884	TCC	.	.		0.463	RTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000258111.1	NM_015138	Missense_Mutation
TYRO3	7301	hgsc.bcm.edu	37	15	41854916	41854916	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr15:41854916G>A	ENST00000263798.3	+	4	804	c.580G>A	c.(580-582)Ggg>Agg	p.G194R	TYRO3_ENST00000559066.1_Splice_Site_p.G149R	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	194	Ig-like C2-type 2.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AAATGTAACAGGTGAGCAGCC	0.577																																					p.G194R		Atlas-SNP	.											.	TYRO3	169	.	0			c.G580A						.						22.0	22.0	22.0					15																	41854916		2203	4300	6503	SO:0001630	splice_region_variant	7301	exon4			GTAACAGGTGAGC	D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.580+1G>A	15.37:g.41854916G>A		55.0	0.0		45.0	19.0	NM_006293	O14953|Q86VR3	Missense_Mutation	SNP	ENST00000263798.3	37	CCDS10080.1	.	.	.	.	.	.	.	.	.	.	g	23.9	4.471522	0.84533	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.12039	2.72	4.8	3.89	0.44902	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.40640	N	0.001058	T	0.37320	0.0999	M	0.78456	2.415	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.29058	-1.0024	10	0.87932	D	0	-18.1417	12.8527	0.57867	0.0787:0.0:0.9213:0.0	.	194	Q06418	TYRO3_HUMAN	R	126;194	ENSP00000263798:G194R	ENSP00000263798:G194R	G	+	1	0	TYRO3	39642208	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.377000	0.79668	1.239000	0.43787	0.472000	0.43445	GGG	.	.		0.577	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252693.2		Missense_Mutation
TLN2	83660	hgsc.bcm.edu	37	15	62999360	62999360	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr15:62999360C>T	ENST00000561311.1	+	19	2310	c.2080C>T	c.(2080-2082)Caa>Taa	p.Q694*	TLN2_ENST00000306829.6_Nonsense_Mutation_p.Q694*			Q9Y4G6	TLN2_HUMAN	talin 2	694					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GAATGTTGCCCAAGTGGCCGA	0.493																																					p.Q694X		Atlas-SNP	.											.	TLN2	253	.	0			c.C2080T						.						132.0	110.0	117.0					15																	62999360		2203	4300	6503	SO:0001587	stop_gained	83660	exon17			GTTGCCCAAGTGG	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.2080C>T	15.37:g.62999360C>T	ENSP00000453508:p.Gln694*	92.0	0.0		64.0	21.0	NM_015059	A6NLB8	Nonsense_Mutation	SNP	ENST00000561311.1	37	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	c	43	10.104317	0.99337	.	.	ENSG00000171914	ENST00000306829	.	.	.	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	-12.4641	19.6558	0.95837	0.0:1.0:0.0:0.0	.	.	.	.	X	694	.	ENSP00000303476:Q694X	Q	+	1	0	TLN2	60786652	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.743000	0.85020	2.719000	0.93026	0.655000	0.94253	CAA	.	.		0.493	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
PDIA2	64714	hgsc.bcm.edu	37	16	336642	336642	+	Silent	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr16:336642T>C	ENST00000219406.6	+	9	1347	c.1329T>C	c.(1327-1329)atT>atC	p.I443I	PDIA2_ENST00000404312.1_Silent_p.I440I	NM_006849.2	NP_006840.2	Q13087	PDIA2_HUMAN	protein disulfide isomerase family A, member 2	443	Thioredoxin 2. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein retention in ER lumen (GO:0006621)|regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902175)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(4)|kidney(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	17		all_cancers(16;6.71e-07)|all_epithelial(16;1.59e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00769)|all_lung(18;0.0186)				ACATCATCATTGCTGAGCTGG	0.602																																					p.I443I		Atlas-SNP	.											.	PDIA2	51	.	0			c.T1329C						.						48.0	51.0	50.0					16																	336642		2156	4243	6399	SO:0001819	synonymous_variant	64714	exon9			CATCATTGCTGAG	U19948	CCDS42089.1	16p13.3	2009-11-20	2005-06-29	2005-03-03	ENSG00000185615	ENSG00000185615	5.3.4.1	"""Protein disulfide isomerases"""	14180	protein-coding gene	gene with protein product		608012	"""protein disulfide isomerase, pancreatic"", ""protein disulfide isomerase-associated 2"""	PDIP		8561901	Standard	NM_006849		Approved	PDA2, PDI, PDIR	uc002cgo.1	Q13087	OTTHUMG00000064891	ENST00000219406.6:c.1329T>C	16.37:g.336642T>C		90.0	0.0		60.0	20.0	NM_006849	A6ZJ64|B4DI27|Q2WGM4|Q4TT67|Q6B010|Q96KJ6|Q9BW95	Silent	SNP	ENST00000219406.6	37	CCDS42089.1																																																																																			.	.		0.602	PDIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000139315.3	NM_006849	
SRL	6345	hgsc.bcm.edu	37	16	4242284	4242284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr16:4242284A>G	ENST00000399609.3	-	6	1304	c.1292T>C	c.(1291-1293)aTt>aCt	p.I431T	SRL_ENST00000537996.1_Missense_Mutation_p.I389T	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	890	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						GGCCCGCTCAATCTTCTCCAG	0.552																																					p.I431T		Atlas-SNP	.											.	SRL	56	.	0			c.T1292C						.						74.0	78.0	77.0					16																	4242284		1895	4103	5998	SO:0001583	missense	6345	exon6			CGCTCAATCTTCT	AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.1292T>C	16.37:g.4242284A>G	ENSP00000382518:p.Ile431Thr	140.0	0.0		111.0	56.0	NM_001098814		Missense_Mutation	SNP	ENST00000399609.3	37	CCDS42113.1	.	.	.	.	.	.	.	.	.	.	A	20.5	4.002624	0.74932	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	T;T	0.36699	1.24;1.24	5.83	5.83	0.93111	.	0.000000	0.85682	U	0.000000	T	0.44477	0.1295	M	0.68952	2.095	0.80722	D	1	P	0.50272	0.933	P	0.44811	0.461	T	0.50197	-0.8856	10	0.87932	D	0	-11.4226	16.1905	0.81986	1.0:0.0:0.0:0.0	.	431	Q86TD4-2	.	T	431;889;389	ENSP00000382518:I431T;ENSP00000440350:I389T	ENSP00000333285:I889T	I	-	2	0	SRL	4182285	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	9.339000	0.96797	2.212000	0.71576	0.533000	0.62120	ATT	.	.		0.552	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438087.1	XM_064152	
USP7	7874	hgsc.bcm.edu	37	16	8992449	8992449	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr16:8992449G>A	ENST00000344836.4	-	24	2777	c.2579C>T	c.(2578-2580)aCt>aTt	p.T860I	USP7_ENST00000381886.4_Missense_Mutation_p.T844I|USP7_ENST00000535863.1_Missense_Mutation_p.T761I	NM_003470.2	NP_003461.2	Q93009	UBP7_HUMAN	ubiquitin specific peptidase 7 (herpes virus-associated)	860					maintenance of DNA methylation (GO:0010216)|multicellular organismal development (GO:0007275)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|protein deubiquitination (GO:0016579)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|transcription-coupled nucleotide-excision repair (GO:0006283)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|p53 binding (GO:0002039)|protein C-terminus binding (GO:0008022)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(13)|lung(20)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	48						ATCTCTTAAAGTACCTTCATA	0.338																																					p.T860I		Atlas-SNP	.											.	USP7	116	.	0			c.C2579T						.						69.0	72.0	71.0					16																	8992449		2197	4300	6497	SO:0001583	missense	7874	exon24			CTTAAAGTACCTT	Z72499	CCDS32385.1, CCDS66941.1	16p13.3	2008-04-11	2005-08-08			ENSG00000187555		"""Ubiquitin-specific peptidases"""	12630	protein-coding gene	gene with protein product		602519	"""ubiquitin specific protease 7 (herpes virus-associated)"""	HAUSP		12838346, 9925944	Standard	NM_003470		Approved		uc002czl.2	Q93009		ENST00000344836.4:c.2579C>T	16.37:g.8992449G>A	ENSP00000343535:p.Thr860Ile	62.0	0.0		33.0	14.0	NM_003470	A6NMY8|B7Z815|H0Y3G8	Missense_Mutation	SNP	ENST00000344836.4	37	CCDS32385.1	.	.	.	.	.	.	.	.	.	.	G	22.9	4.347182	0.82022	.	.	ENSG00000187555	ENST00000344836;ENST00000381886;ENST00000535863;ENST00000544549	T;T	0.08634	3.07;3.09	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	M	0.68317	2.08	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.64237	0.923;0.923	T	0.00010	-1.2455	10	0.42905	T	0.14	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	860;844	Q93009;B7Z815	UBP7_HUMAN;.	I	860;868;761;761	ENSP00000343535:T860I;ENSP00000443646:T761I	ENSP00000343535:T860I	T	-	2	0	USP7	8899950	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.491000	0.97954	2.941000	0.99782	0.655000	0.94253	ACT	.	.		0.338	USP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434268.2		
PDXDC1	23042	hgsc.bcm.edu	37	16	15069069	15069069	+	Silent	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr16:15069069C>T	ENST00000396410.4	+	1	110	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	PDXDC1_ENST00000455313.2_Silent_p.L5L|PDXDC1_ENST00000563679.1_Intron|PDXDC1_ENST00000325823.7_Intron|PDXDC1_ENST00000535621.2_Silent_p.L5L|PDXDC1_ENST00000450288.2_Silent_p.L5L|PDXDC1_ENST00000447912.2_Intron|PDXDC1_ENST00000569715.1_Silent_p.L5L	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	5					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						GGACGCGTCCCTGGAGAAGGT	0.721																																					p.L5L		Atlas-SNP	.											.	PDXDC1	59	.	0			c.C13T						.						6.0	10.0	9.0					16																	15069069		1769	3522	5291	SO:0001819	synonymous_variant	23042	exon1			GCGTCCCTGGAGA	AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.13C>T	16.37:g.15069069C>T		52.0	0.0		105.0	53.0	NM_015027	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	ENST00000396410.4	37	CCDS32393.1																																																																																			.	.		0.721	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000389065.2	NM_015027	
CDH15	1013	hgsc.bcm.edu	37	16	89260253	89260253	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr16:89260253C>T	ENST00000289746.2	+	13	2148	c.2083C>T	c.(2083-2085)Cgc>Tgc	p.R695C		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	695					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CCCGCAGGGCCGCCTGCACCC	0.677																																					p.R695C		Atlas-SNP	.											.	CDH15	54	.	0			c.C2083T						.						13.0	17.0	15.0					16																	89260253		2141	4243	6384	SO:0001583	missense	1013	exon13			CAGGGCCGCCTGC	D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.2083C>T	16.37:g.89260253C>T	ENSP00000289746:p.Arg695Cys	100.0	0.0		86.0	42.0	NM_004933		Missense_Mutation	SNP	ENST00000289746.2	37	CCDS10976.1	.	.	.	.	.	.	.	.	.	.	C	14.43	2.533399	0.45073	.	.	ENSG00000129910	ENST00000289746	T	0.77620	-1.11	4.52	0.197	0.15164	Cadherin, cytoplasmic domain (1);	1.799820	0.03367	N	0.198394	T	0.79505	0.4457	L	0.37750	1.13	0.09310	N	1	D	0.69078	0.997	D	0.63793	0.918	T	0.62831	-0.6771	10	0.38643	T	0.18	.	4.0149	0.09639	0.1613:0.4729:0.0:0.3658	.	695	P55291	CAD15_HUMAN	C	695	ENSP00000289746:R695C	ENSP00000289746:R695C	R	+	1	0	CDH15	87787754	0.002000	0.14202	0.000000	0.03702	0.020000	0.10135	0.040000	0.13905	0.015000	0.14971	0.557000	0.71058	CGC	.	.		0.677	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000269920.1	NM_004933	
MPDU1	9526	hgsc.bcm.edu	37	17	7490856	7490856	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:7490856A>C	ENST00000250124.6	+	7	947	c.731A>C	c.(730-732)aAa>aCa	p.K244T	MPDU1_ENST00000396501.4_3'UTR|MPDU1_ENST00000423172.2_Intron	NM_004870.3	NP_004861.2	O75352	MPU1_HUMAN	mannose-P-dolichol utilization defect 1	244					dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|oligosaccharide biosynthetic process (GO:0009312)|protein folding (GO:0006457)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(1)	7						CACAAGCAGAAAAAGGCGCAG	0.572																																					p.K244T		Atlas-SNP	.											.	MPDU1	14	.	0			c.A731C						.						84.0	83.0	84.0					17																	7490856		2203	4300	6503	SO:0001583	missense	9526	exon7			AGCAGAAAAAGGC	AF038961	CCDS11115.1	17p13.1-p12	2008-07-03			ENSG00000129255	ENSG00000129255			7207	protein-coding gene	gene with protein product		604041				8663248, 9653160, 11733564	Standard	NM_004870		Approved	SL15, Lec35, PQLC5, CDGIf	uc002ghw.3	O75352	OTTHUMG00000108147	ENST00000250124.6:c.731A>C	17.37:g.7490856A>C	ENSP00000250124:p.Lys244Thr	65.0	0.0		35.0	28.0	NM_004870	B3KQP1|B4DT74|Q9BUU8	Missense_Mutation	SNP	ENST00000250124.6	37	CCDS11115.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	13.41|13.41	2.230082|2.230082	0.39399|0.39399	.|.	.|.	ENSG00000129255|ENSG00000129255	ENST00000359822|ENST00000250124	.|T	.|0.76839	.|-1.05	5.38|5.38	5.38|5.38	0.77491|0.77491	.|.	0.429988|.	0.22246|.	N|.	0.062618|.	T|T	0.79522|0.79522	0.4460|0.4460	M|M	0.78456|0.78456	2.415|2.415	0.80722|0.80722	D|D	1|1	.|P	.|0.51791	.|0.948	.|P	.|0.45037	.|0.467	T|T	0.82857|0.82857	-0.0250|-0.0250	7|9	0.59425|0.72032	D|D	0.04|0.01	-0.2512|-0.2512	11.7153|11.7153	0.51650|0.51650	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|244	.|O75352	.|MPU1_HUMAN	D|T	243|244	.|ENSP00000250124:K244T	ENSP00000352876:E243D|ENSP00000250124:K244T	E|K	+|+	3|2	2|0	MPDU1|MPDU1	7431580|7431580	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.183000|0.183000	0.23260|0.23260	3.965000|3.965000	0.56788|0.56788	2.254000|2.254000	0.74563|0.74563	0.533000|0.533000	0.62120|0.62120	GAA|AAA	.	.		0.572	MPDU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000226950.4		
PER1	5187	hgsc.bcm.edu	37	17	8049752	8049752	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:8049752G>A	ENST00000317276.4	-	16	2213	c.1976C>T	c.(1975-1977)aCc>aTc	p.T659I	PER1_ENST00000354903.5_Missense_Mutation_p.T643I|PER1_ENST00000578089.1_5'UTR|PER1_ENST00000581082.1_Missense_Mutation_p.T639I	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	659	Required for phosphorylation by CSNK1E. {ECO:0000250}.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GGCTGAGGAGGTGGTATAGGA	0.592			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																													p.T659I		Atlas-SNP	.		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	.	PER1	104	.	0			c.C1976T						.						81.0	86.0	84.0					17																	8049752		2203	4300	6503	SO:0001583	missense	5187	exon16			GAGGAGGTGGTAT	AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.1976C>T	17.37:g.8049752G>A	ENSP00000314420:p.Thr659Ile	48.0	0.0		26.0	14.0	NM_002616	B2RPA8|B4DI49|D3DTR3	Missense_Mutation	SNP	ENST00000317276.4	37	CCDS11131.1	.	.	.	.	.	.	.	.	.	.	G	11.88	1.769948	0.31320	.	.	ENSG00000179094	ENST00000317276;ENST00000354903	T;T	0.39787	2.45;1.06	5.28	4.3	0.51218	.	0.397228	0.26349	N	0.024881	T	0.31104	0.0786	L	0.34521	1.04	0.28987	N	0.888274	B;B	0.33583	0.418;0.181	B;B	0.26969	0.075;0.046	T	0.31586	-0.9938	10	0.72032	D	0.01	-1.5602	13.2862	0.60245	0.0:0.0:0.8401:0.1599	.	643;659	B4DI49;O15534	.;PER1_HUMAN	I	659;643	ENSP00000314420:T659I;ENSP00000346979:T643I	ENSP00000314420:T659I	T	-	2	0	PER1	7990477	0.883000	0.30277	0.275000	0.24674	0.334000	0.28698	2.525000	0.45598	1.350000	0.45770	0.563000	0.77884	ACC	.	.		0.592	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441481.2		
DNAH9	1770	hgsc.bcm.edu	37	17	11797765	11797765	+	Silent	SNP	C	C	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:11797765C>A	ENST00000262442.4	+	59	11426	c.11358C>A	c.(11356-11358)acC>acA	p.T3786T	DNAH9_ENST00000454412.2_Silent_p.T3786T|DNAH9_ENST00000608377.1_Silent_p.T98T|DNAH9_ENST00000396001.2_3'UTR	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3786					cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGACGGGCACCGCCAGCCCCG	0.517																																					p.T3786T		Atlas-SNP	.											DNAH9,NS,carcinoma,0,1	DNAH9	695	1	0			c.C11358A						.						87.0	87.0	87.0					17																	11797765		2203	4300	6503	SO:0001819	synonymous_variant	1770	exon59			GGGCACCGCCAGC	U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.11358C>A	17.37:g.11797765C>A		47.0	0.0		15.0	11.0	NM_001372	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	ENST00000262442.4	37	CCDS11160.1																																																																																			.	.		0.517	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252756.2	NM_001372	
SLC46A1	113235	hgsc.bcm.edu	37	17	26723213	26723213	+	3'UTR	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:26723213A>G	ENST00000440501.1	-	0	4934				SARM1_ENST00000457710.3_Missense_Mutation_p.I661V|SLC46A1_ENST00000584729.1_5'UTR|SARM1_ENST00000379061.4_3'UTR|SLC46A1_ENST00000321666.5_3'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	CATTGAGAAGATCATCCGCTT	0.602																																					p.I694V		Atlas-SNP	.											SARM1,colon,carcinoma,-1,1	SARM1	40	1	0			c.A2080G						.						85.0	75.0	78.0					17																	26723213		2203	4300	6503	SO:0001624	3_prime_UTR_variant	23098	exon10			GAGAAGATCATCC	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*3459T>C	17.37:g.26723213A>G		48.0	0.0		69.0	35.0	NM_015077	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Missense_Mutation	SNP	ENST00000440501.1	37		.	.	.	.	.	.	.	.	.	.	A	13.60	2.286217	0.40394	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	4.84	4.84	0.62591	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.000000	0.85682	D	0.000000	T	0.43077	0.1231	.	.	.	0.80722	D	1	B	0.28082	0.2	B	0.28385	0.089	T	0.30001	-0.9993	8	0.19590	T	0.45	-20.2746	11.1654	0.48539	0.846:0.154:0.0:0.0	.	695	Q6SZW1	SARM1_HUMAN	V	693;661	.	ENSP00000003834:I661V	I	+	1	0	SARM1	23747340	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.155000	0.71833	1.803000	0.52742	0.459000	0.35465	ATC	.	.		0.602	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
SLC46A1	113235	hgsc.bcm.edu	37	17	26723216	26723216	+	3'UTR	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:26723216A>G	ENST00000440501.1	-	0	4931				SARM1_ENST00000457710.3_Missense_Mutation_p.I662V|SLC46A1_ENST00000584729.1_5'UTR|SARM1_ENST00000379061.4_3'UTR|SLC46A1_ENST00000321666.5_3'UTR	NM_080669.4	NP_542400.2	Q96NT5	PCFT_HUMAN	solute carrier family 46 (folate transporter), member 1						cellular iron ion homeostasis (GO:0006879)|folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	folic acid binding (GO:0005542)|folic acid transporter activity (GO:0008517)|heme transporter activity (GO:0015232)|methotrexate transporter activity (GO:0015350)			lung(5)	5	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.153)	Folic Acid(DB00158)|Methotrexate(DB00563)|Sulfasalazine(DB00795)	TGAGAAGATCATCCGCTTCCT	0.607																																					p.I695V		Atlas-SNP	.											.	SARM1	40	.	0			c.A2083G						.						85.0	76.0	79.0					17																	26723216		2203	4300	6503	SO:0001624	3_prime_UTR_variant	23098	exon10			AAGATCATCCGCT	AK054669	CCDS74019.1, CCDS74020.1	17q11.2	2014-09-17	2007-09-24			ENSG00000076351		"""Solute carriers"""	30521	protein-coding gene	gene with protein product	"""heme carrier protein 1"", ""proton-coupled folate transporter"""	611672	"""solute carrier family 46, member 1"""			16143108, 17129779	Standard	XM_005277786		Approved	HCP1, MGC9564, PCFT	uc002hbf.2	Q96NT5		ENST00000440501.1:c.*3456T>C	17.37:g.26723216A>G		45.0	0.0		63.0	32.0	NM_015077	Q1HE20|Q86T92|Q8TEG3|Q96FL0	Missense_Mutation	SNP	ENST00000440501.1	37		.	.	.	.	.	.	.	.	.	.	A	9.897	1.205791	0.22205	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	4.84	4.84	0.62591	Toll/interleukin-1 receptor homology (TIR) domain (1);	0.068407	0.64402	D	0.000012	T	0.35828	0.0945	.	.	.	0.80722	D	1	B	0.19073	0.033	B	0.19666	0.026	T	0.25187	-1.0139	8	0.05436	T	0.98	-20.6578	14.4401	0.67309	1.0:0.0:0.0:0.0	.	696	Q6SZW1	SARM1_HUMAN	V	694;662	.	ENSP00000003834:I662V	I	+	1	0	SARM1	23747343	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.215000	0.42862	1.803000	0.52742	0.459000	0.35465	ATC	.	.		0.607	SLC46A1-202	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_080669	
KRT20	54474	hgsc.bcm.edu	37	17	39036387	39036387	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:39036387T>A	ENST00000167588.3	-	4	798	c.757A>T	c.(757-759)Aac>Tac	p.N253Y		NM_019010.2	NP_061883.1	P35900	K1C20_HUMAN	keratin 20	253	Coil 2.|Rod.				apoptotic process (GO:0006915)|cellular response to stress (GO:0033554)|intermediate filament organization (GO:0045109)|regulation of protein secretion (GO:0050708)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	14		Breast(137;0.000301)|Ovarian(249;0.15)				TCTTGAAGGTTCTTCTGGGCC	0.468																																					p.N253Y		Atlas-SNP	.											.	KRT20	38	.	0			c.A757T						.						218.0	189.0	199.0					17																	39036387		2203	4300	6503	SO:0001583	missense	54474	exon4			GAAGGTTCTTCTG	BC031559	CCDS11379.1	17q21.2	2013-01-16			ENSG00000171431	ENSG00000171431		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	20412	protein-coding gene	gene with protein product		608218				8359595, 12515621, 16831889	Standard	NM_019010		Approved	CK20, K20, MGC35423	uc002hvl.3	P35900	OTTHUMG00000133366	ENST00000167588.3:c.757A>T	17.37:g.39036387T>A	ENSP00000167588:p.Asn253Tyr	69.0	0.0		53.0	33.0	NM_019010	B2R6W7	Missense_Mutation	SNP	ENST00000167588.3	37	CCDS11379.1	.	.	.	.	.	.	.	.	.	.	T	17.78	3.472801	0.63737	.	.	ENSG00000171431	ENST00000167588	D	0.89681	-2.55	5.29	1.55	0.23275	Filament (1);	0.178499	0.38720	N	0.001582	D	0.91399	0.7286	M	0.89030	3	0.42093	D	0.991303	P	0.51537	0.946	P	0.49528	0.614	D	0.90731	0.4642	10	0.72032	D	0.01	.	10.4525	0.44531	0.3921:0.0:0.0:0.6079	.	253	P35900	K1C20_HUMAN	Y	253	ENSP00000167588:N253Y	ENSP00000167588:N253Y	N	-	1	0	KRT20	36289913	1.000000	0.71417	1.000000	0.80357	0.822000	0.46500	2.406000	0.44557	0.286000	0.22352	-0.669000	0.03829	AAC	.	.		0.468	KRT20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257202.2		
CDC27	996	hgsc.bcm.edu	37	17	45234727	45234727	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:45234727T>A	ENST00000066544.3	-	6	592	c.499A>T	c.(499-501)Aca>Tca	p.T167S	CDC27_ENST00000446365.2_Missense_Mutation_p.T106S|CDC27_ENST00000528748.1_5'UTR|CDC27_ENST00000531206.1_Missense_Mutation_p.T167S|CDC27_ENST00000527547.1_Missense_Mutation_p.T167S	NM_001114091.1|NM_001256.3	NP_001107563.1|NP_001247.3	P30260	CDC27_HUMAN	cell division cycle 27	167					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cell cycle (GO:0000278)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	protein phosphatase binding (GO:0019903)			NS(1)|breast(5)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(17)|large_intestine(18)|lung(11)|ovary(5)|pancreas(1)|prostate(19)|skin(5)|upper_aerodigestive_tract(2)	90						AATTTAAATGTTTGGTCAGGA	0.368																																					p.T167S		Atlas-SNP	.											CDC27_ENST00000531206,NS,carcinoma,+2,10	CDC27	337	10	0			c.A499T						.						73.0	73.0	73.0					17																	45234727		2203	4300	6503	SO:0001583	missense	996	exon6			TAAATGTTTGGTC	U00001	CCDS11509.1, CCDS45720.1, CCDS74090.1	17q21.32	2013-01-17	2013-01-17		ENSG00000004897	ENSG00000004897		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1728	protein-coding gene	gene with protein product	"""anaphase promoting complex subunit 3"""	116946	"""cell division cycle 27"", ""cell division cycle 27 homolog (S. cerevisiae)"""	D0S1430E, D17S978E		8234252	Standard	XM_005257892		Approved	APC3, ANAPC3, NUC2	uc002ile.4	P30260	OTTHUMG00000166429	ENST00000066544.3:c.499A>T	17.37:g.45234727T>A	ENSP00000066544:p.Thr167Ser	126.0	2.0		95.0	4.0	NM_001114091	G3V1C4|Q16349|Q96F35	Missense_Mutation	SNP	ENST00000066544.3	37	CCDS11509.1	.	.	.	.	.	.	.	.	.	.	T	14.73	2.623232	0.46840	.	.	ENSG00000004897	ENST00000066544;ENST00000531206;ENST00000446365;ENST00000527547;ENST00000526866	T;T;T;T;T	0.67171	-0.25;-0.25;0.04;-0.25;0.89	5.39	5.39	0.77823	.	0.119985	0.64402	D	0.000020	T	0.47192	0.1432	N	0.08118	0	0.39122	D	0.961682	P;P;P;B	0.38677	0.475;0.528;0.642;0.211	B;B;B;B	0.36092	0.049;0.217;0.204;0.067	T	0.59762	-0.7393	10	0.72032	D	0.01	-19.1215	13.3763	0.60741	0.0:0.0:0.0:1.0	.	106;167;167;167	B4DL80;G5EA36;G3V1C4;P30260	.;.;.;CDC27_HUMAN	S	167;167;106;167;167	ENSP00000066544:T167S;ENSP00000434614:T167S;ENSP00000392802:T106S;ENSP00000437339:T167S;ENSP00000432105:T167S	ENSP00000066544:T167S	T	-	1	0	CDC27	42589726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.374000	0.66167	2.053000	0.61076	0.528000	0.53228	ACA	.	.		0.368	CDC27-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389742.2		
NAT9	26151	hgsc.bcm.edu	37	17	72767893	72767893	+	Silent	SNP	A	A	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:72767893A>C	ENST00000357814.3	-	7	667	c.594T>G	c.(592-594)ccT>ccG	p.P198P	NAT9_ENST00000580216.1_5'Flank|NAT9_ENST00000578822.1_Silent_p.P203P|NAT9_ENST00000582870.1_Silent_p.P202P|NAT9_ENST00000580301.1_Silent_p.P197P|NAT9_ENST00000581136.1_Silent_p.P193P|NAT9_ENST00000580632.1_Silent_p.P198P|NAT9_ENST00000583757.1_3'UTR	NM_015654.3	NP_056469.2	Q9BTE0	NAT9_HUMAN	N-acetyltransferase 9 (GCN5-related, putative)	198						protein complex (GO:0043234)	N-acetyltransferase activity (GO:0008080)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)	8						CATCTCTGTAAGGCTTCTCTT	0.577																																					p.P198P		Atlas-SNP	.											.	NAT9	16	.	0			c.T594G						.						55.0	51.0	52.0					17																	72767893		2203	4300	6503	SO:0001819	synonymous_variant	26151	exon7			TCTGTAAGGCTTC	AK123115	CCDS11706.1	17q25.2	2011-11-25	2008-09-24		ENSG00000109065	ENSG00000109065			23133	protein-coding gene	gene with protein product			"""N-acetyltransferase 9"""			14608357	Standard	NM_015654		Approved	DKFZP564C103	uc002jlq.3	Q9BTE0		ENST00000357814.3:c.594T>G	17.37:g.72767893A>C		58.0	0.0		52.0	16.0	NM_015654	B2R7F0|Q9BTD0|Q9Y3T3	Silent	SNP	ENST00000357814.3	37	CCDS11706.1																																																																																			.	.		0.577	NAT9-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000443700.1	NM_015654	
NPLOC4	55666	hgsc.bcm.edu	37	17	79536080	79536080	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr17:79536080A>C	ENST00000331134.6	-	14	1626	c.1411T>G	c.(1411-1413)Ttt>Gtt	p.F471V	NPLOC4_ENST00000374747.5_Missense_Mutation_p.F471V|NPLOC4_ENST00000573876.1_5'Flank|NPLOC4_ENST00000539314.1_Missense_Mutation_p.F310V|NPLOC4_ENST00000572760.1_5'Flank	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	471					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			TCAATAGGAAATGGATTTTGC	0.363																																					p.F471V		Atlas-SNP	.											.	NPLOC4	27	.	0			c.T1411G						.						99.0	98.0	99.0					17																	79536080		1863	4106	5969	SO:0001583	missense	55666	exon14			TAGGAAATGGATT	AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.1411T>G	17.37:g.79536080A>C	ENSP00000331487:p.Phe471Val	129.0	0.0		121.0	61.0	NM_017921	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	ENST00000331134.6	37	CCDS45812.1	.	.	.	.	.	.	.	.	.	.	A	20.2	3.941528	0.73557	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.63	5.63	0.86233	Nuclear pore localisation protein NPL4 (1);	0.092279	0.85682	D	0.000000	D	0.86830	0.6027	H	0.95328	3.655	0.80722	D	1	D;D;D	0.71674	0.996;0.997;0.998	D;D;D	0.77557	0.99;0.928;0.957	D	0.90682	0.4606	9	0.87932	D	0	-18.1206	14.8257	0.70110	1.0:0.0:0.0:0.0	.	310;471;471	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	V	471;470;310	.	ENSP00000331487:F471V	F	-	1	0	NPLOC4	77146517	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	8.744000	0.91596	2.152000	0.67230	0.460000	0.39030	TTT	.	.		0.363	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440140.1		
EPB41L3	23136	hgsc.bcm.edu	37	18	5396258	5396258	+	Missense_Mutation	SNP	G	G	C	rs79592897	byFrequency	TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr18:5396258G>C	ENST00000341928.2	-	19	3255	c.2915C>G	c.(2914-2916)aCg>aGg	p.T972R	EPB41L3_ENST00000542652.2_5'UTR|EPB41L3_ENST00000542146.1_Missense_Mutation_p.T277R|EPB41L3_ENST00000400111.3_Missense_Mutation_p.T750R|EPB41L3_ENST00000544123.1_Missense_Mutation_p.T803R|EPB41L3_ENST00000342933.3_Missense_Mutation_p.T972R|EPB41L3_ENST00000427684.2_Missense_Mutation_p.T269R|EPB41L3_ENST00000540638.2_Missense_Mutation_p.T750R	NM_012307.2	NP_036439.2	Q9Y2J2	E41L3_HUMAN	erythrocyte membrane protein band 4.1-like 3	972	C-terminal (CTD).				apoptotic process (GO:0006915)|cortical actin cytoskeleton organization (GO:0030866)|cortical cytoskeleton organization (GO:0030865)|cytoskeletal anchoring at plasma membrane (GO:0007016)|myelin maintenance (GO:0043217)|neuron projection morphogenesis (GO:0048812)|paranodal junction assembly (GO:0030913)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|protein localization to plasma membrane (GO:0072659)|regulation of cell shape (GO:0008360)	axolemma (GO:0030673)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|juxtaparanode region of axon (GO:0044224)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(52)|ovary(5)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	105						CACTTCCTTCGTGGAAATTTC	0.473																																					p.T972R		Atlas-SNP	.											.	EPB41L3	222	.	0			c.C2915G						.						239.0	219.0	226.0					18																	5396258		2203	4300	6503	SO:0001583	missense	23136	exon19			TCCTTCGTGGAAA	AB023204	CCDS11838.1, CCDS62381.1, CCDS62382.1	18p11.32	2006-06-28			ENSG00000082397	ENSG00000082397			3380	protein-coding gene	gene with protein product		605331				9828140, 9892180	Standard	NM_012307		Approved	DAL1, KIAA0987, 4.1B	uc002kmt.1	Q9Y2J2	OTTHUMG00000131562	ENST00000341928.2:c.2915C>G	18.37:g.5396258G>C	ENSP00000343158:p.Thr972Arg	104.0	0.0		42.0	16.0	NM_012307	B7Z4I5|F5GX05|O95713|Q9BRP5	Missense_Mutation	SNP	ENST00000341928.2	37	CCDS11838.1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.326926	0.81690	.	.	ENSG00000082397	ENST00000341928;ENST00000540638;ENST00000544123;ENST00000545076;ENST00000427684;ENST00000542146;ENST00000342933;ENST00000400111	T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16	5.84	5.84	0.93424	Band 4.1, C-terminal (1);	0.196730	0.53938	D	0.000051	D	0.88496	0.6452	M	0.84219	2.685	0.53005	D	0.999965	D;D;D;P;P;P;D;P	0.89917	1.0;1.0;1.0;0.905;0.81;0.932;0.999;0.618	D;D;D;P;P;P;D;P	0.97110	0.998;1.0;0.994;0.688;0.474;0.821;0.988;0.657	D	0.89500	0.3763	10	0.87932	D	0	.	14.3232	0.66502	0.0705:0.0:0.9295:0.0	.	803;269;277;364;641;750;972;207	F5GX05;E7EUF8;F5H7W5;B7Z8M8;A8K968;Q9Y2J2-2;Q9Y2J2;B3KT50	.;.;.;.;.;.;E41L3_HUMAN;.	R	972;641;803;641;269;277;972;750	ENSP00000343158:T972R;ENSP00000441174:T803R;ENSP00000392195:T269R;ENSP00000442233:T277R;ENSP00000341138:T972R;ENSP00000382981:T750R	ENSP00000343158:T972R	T	-	2	0	EPB41L3	5386258	1.000000	0.71417	0.999000	0.59377	0.969000	0.65631	6.654000	0.74387	2.764000	0.94973	0.650000	0.86243	ACG	.	G|0.998;A|0.002		0.473	EPB41L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254424.1	NM_012307	
CBLN2	147381	hgsc.bcm.edu	37	18	70205486	70205486	+	Silent	SNP	G	G	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr18:70205486G>C	ENST00000269503.4	-	5	1373	c.600C>G	c.(598-600)ctC>ctG	p.L200L	CBLN2_ENST00000585159.1_Silent_p.L200L|CBLN2_ENST00000584764.1_Silent_p.L84L|CBLN2_ENST00000581073.1_Silent_p.L86L|CBLN2_ENST00000583651.1_5'UTR	NM_182511.3	NP_872317.1	Q8IUK8	CBLN2_HUMAN	cerebellin 2 precursor	200	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				positive regulation of synapse assembly (GO:0051965)	extracellular space (GO:0005615)				endometrium(2)|lung(15)	17		Esophageal squamous(42;0.131)				TCTCAAGTTTGAGATGCACTT	0.532																																					p.L200L		Atlas-SNP	.											CBLN2,NS,carcinoma,-1,1	CBLN2	41	1	0			c.C600G						.						117.0	111.0	113.0					18																	70205486		2203	4300	6503	SO:0001819	synonymous_variant	147381	exon5			AAGTTTGAGATGC	BC035789	CCDS11999.1	18q22.3	2007-11-19			ENSG00000141668	ENSG00000141668			1544	protein-coding gene	gene with protein product		600433				7877445	Standard	NM_182511		Approved		uc002lkv.2	Q8IUK8	OTTHUMG00000132825	ENST00000269503.4:c.600C>G	18.37:g.70205486G>C		108.0	0.0		77.0	34.0	NM_182511	Q53Z56	Silent	SNP	ENST00000269503.4	37	CCDS11999.1																																																																																			.	.		0.532	CBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256288.1	NM_182511	
CIRBP	1153	hgsc.bcm.edu	37	19	1271585	1271585	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:1271585G>A	ENST00000588030.1	+	5	645	c.385G>A	c.(385-387)Gag>Aag	p.E129K	CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000591935.1_Missense_Mutation_p.E129K|CIRBP_ENST00000589686.1_Missense_Mutation_p.E129K|CIRBP_ENST00000589710.1_Missense_Mutation_p.E129K|CIRBP_ENST00000587323.1_Missense_Mutation_p.E129K|CIRBP_ENST00000444172.2_Missense_Mutation_p.E76K|CIRBP_ENST00000588230.1_Missense_Mutation_p.E129K|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000585630.1_Missense_Mutation_p.E129K|CIRBP_ENST00000413636.2_Missense_Mutation_p.E95K|CIRBP_ENST00000586773.1_Missense_Mutation_p.E129K|CIRBP_ENST00000587896.1_Missense_Mutation_p.E129K|CIRBP_ENST00000589235.1_Missense_Mutation_p.E129K|CIRBP_ENST00000588090.1_Missense_Mutation_p.E129K|CIRBP_ENST00000320936.5_Missense_Mutation_p.E129K|CIRBP_ENST00000589660.1_Missense_Mutation_p.E129K|CIRBP_ENST00000586472.1_Missense_Mutation_p.E129K			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	129	Gly-rich.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAACCGGTTCGAGTCCAGGAG	0.627																																					p.E129K		Atlas-SNP	.											.	CIRBP	19	.	0			c.G385A						.						22.0	27.0	25.0					19																	1271585		2190	4277	6467	SO:0001583	missense	1153	exon5			CGGTTCGAGTCCA	D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.385G>A	19.37:g.1271585G>A	ENSP00000468788:p.Glu129Lys	61.0	0.0		58.0	23.0	NM_001280	B3KT17|B4E2X2	Missense_Mutation	SNP	ENST00000588030.1	37	CCDS12059.1	.	.	.	.	.	.	.	.	.	.	G	18.00	3.525886	0.64860	.	.	ENSG00000099622	ENST00000320936;ENST00000413636;ENST00000444172	T;T	0.73789	0.21;-0.78	4.23	3.18	0.36537	.	0.520575	0.20137	N	0.098463	T	0.51736	0.1692	L	0.29908	0.895	0.37410	D	0.913192	P;B;B;B	0.38504	0.634;0.034;0.377;0.088	B;B;B;B	0.23150	0.044;0.002;0.044;0.006	T	0.51647	-0.8679	10	0.13470	T	0.59	-8.4619	9.2426	0.37506	0.1044:0.0:0.8956:0.0	.	95;129;129;129	B4E2X2;Q53XX5;D6W5Y5;Q14011	.;.;.;CIRBP_HUMAN	K	129;95;76	ENSP00000322887:E129K;ENSP00000412831:E95K	ENSP00000322887:E129K	E	+	1	0	CIRBP	1222585	1.000000	0.71417	0.973000	0.42090	0.936000	0.57629	4.191000	0.58372	0.767000	0.33267	0.462000	0.41574	GAG	.	.		0.627	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449969.1	NM_001280	
TMED1	11018	hgsc.bcm.edu	37	19	10945612	10945612	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:10945612T>G	ENST00000214869.2	-	3	561	c.463A>C	c.(463-465)Aag>Cag	p.K155Q	TMED1_ENST00000591695.1_Intron|C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000588289.1_Missense_Mutation_p.K10Q	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	155					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						GGACACACCTTGATGTCCTCC	0.592																																					p.K155Q		Atlas-SNP	.											.	TMED1	22	.	0			c.A463C						.						167.0	160.0	162.0					19																	10945612		2203	4300	6503	SO:0001583	missense	11018	exon3			ACACCTTGATGTC	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.463A>C	19.37:g.10945612T>G	ENSP00000214869:p.Lys155Gln	61.0	0.0		44.0	17.0	NM_006858		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	T	9.514	1.106519	0.20632	.	.	ENSG00000099203	ENST00000214869	T	0.15834	2.39	5.02	5.02	0.67125	GOLD (1);	0.058548	0.64402	D	0.000003	T	0.15478	0.0373	L	0.36672	1.1	0.36480	D	0.867795	B	0.18013	0.025	B	0.19666	0.026	T	0.08994	-1.0695	10	0.34782	T	0.22	-34.4991	13.7375	0.62827	0.0:0.0:0.0:1.0	.	155	Q13445	TMED1_HUMAN	Q	155	ENSP00000214869:K155Q	ENSP00000214869:K155Q	K	-	1	0	TMED1	10806612	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	2.541000	0.45735	1.895000	0.54865	0.379000	0.24179	AAG	.	.		0.592	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
TMED1	11018	hgsc.bcm.edu	37	19	10945625	10945625	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:10945625T>G	ENST00000214869.2	-	3	548	c.450A>C	c.(448-450)aaA>aaC	p.K150N	TMED1_ENST00000591695.1_Intron|C19orf38_ENST00000592854.1_5'Flank|TMED1_ENST00000588289.1_Missense_Mutation_p.K5N	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1	150					cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						TGTCCTCCATTTTAACATCCA	0.587																																					p.K150N		Atlas-SNP	.											.	TMED1	22	.	0			c.A450C						.						174.0	164.0	168.0					19																	10945625		2203	4300	6503	SO:0001583	missense	11018	exon3			CTCCATTTTAACA	U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.450A>C	19.37:g.10945625T>G	ENSP00000214869:p.Lys150Asn	60.0	0.0		43.0	15.0	NM_006858		Missense_Mutation	SNP	ENST00000214869.2	37	CCDS12249.1	.	.	.	.	.	.	.	.	.	.	T	16.43	3.120503	0.56613	.	.	ENSG00000099203	ENST00000214869	T	0.19806	2.12	5.02	-1.68	0.08212	GOLD (1);	0.095235	0.64402	D	0.000001	T	0.38241	0.1033	M	0.84156	2.68	0.49389	D	0.99978	P	0.49447	0.924	P	0.60068	0.868	T	0.23583	-1.0184	10	0.33940	T	0.23	-30.1085	9.8445	0.41019	0.0:0.5911:0.0:0.4089	.	150	Q13445	TMED1_HUMAN	N	150	ENSP00000214869:K150N	ENSP00000214869:K150N	K	-	3	2	TMED1	10806625	0.999000	0.42202	0.952000	0.39060	0.943000	0.58893	0.684000	0.25364	-0.224000	0.09928	0.379000	0.24179	AAA	.	.		0.587	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452614.1	NM_006858	
SLC5A5	6528	hgsc.bcm.edu	37	19	18001706	18001706	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:18001706C>T	ENST00000222248.3	+	14	2010	c.1663C>T	c.(1663-1665)Cgc>Tgc	p.R555C		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	555					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						CCCCACCAAGCGCAGCACCCT	0.602																																					p.R555C	Melanoma(65;1008 1708 7910 46650)	Atlas-SNP	.											.	SLC5A5	67	.	0			c.C1663T						.						85.0	92.0	90.0					19																	18001706		2203	4300	6503	SO:0001583	missense	6528	exon14			ACCAAGCGCAGCA		CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1663C>T	19.37:g.18001706C>T	ENSP00000222248:p.Arg555Cys	60.0	0.0		53.0	22.0	NM_000453	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	ENST00000222248.3	37	CCDS12368.1	.	.	.	.	.	.	.	.	.	.	C	13.15	2.150244	0.37923	.	.	ENSG00000105641	ENST00000222248	D	0.85861	-2.04	4.71	3.62	0.41486	.	0.166361	0.46758	D	0.000272	D	0.88826	0.6542	M	0.69823	2.125	0.48696	D	0.999698	D	0.89917	1.0	P	0.60286	0.872	D	0.88515	0.3092	10	0.54805	T	0.06	.	10.2325	0.43264	0.3282:0.6718:0.0:0.0	.	555	Q92911	SC5A5_HUMAN	C	555	ENSP00000222248:R555C	ENSP00000222248:R555C	R	+	1	0	SLC5A5	17862706	0.999000	0.42202	0.993000	0.49108	0.037000	0.13140	0.659000	0.24994	2.457000	0.83068	0.491000	0.48974	CGC	.	.		0.602	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466690.1		
LSR	51599	hgsc.bcm.edu	37	19	35758280	35758280	+	Silent	SNP	A	A	G	rs112715995		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:35758280A>G	ENST00000361790.3	+	9	1716	c.1557A>G	c.(1555-1557)agA>agG	p.R519R	LSR_ENST00000360798.3_Silent_p.R451R|LSR_ENST00000354900.3_Silent_p.R500R|USF2_ENST00000343550.5_5'Flank|USF2_ENST00000379134.3_5'Flank|USF2_ENST00000595068.1_5'Flank|AD000684.2_ENST00000602262.1_RNA|USF2_ENST00000594064.1_5'Flank|USF2_ENST00000222305.3_5'Flank|LSR_ENST00000427250.1_Silent_p.R363R|LSR_ENST00000602122.1_Silent_p.R499R|LSR_ENST00000347609.4_Silent_p.R461R	NM_205834.3	NP_991403.1	Q86X29	LSR_HUMAN	lipolysis stimulated lipoprotein receptor	519					embryo development (GO:0009790)|liver development (GO:0001889)	chylomicron (GO:0042627)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|low-density lipoprotein particle (GO:0034362)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_lung(56;3.91e-09)|Lung NSC(56;5.64e-09)|Esophageal squamous(110;0.162)		Epithelial(14;1.33e-19)|OV - Ovarian serous cystadenocarcinoma(14;1.29e-18)|all cancers(14;7.11e-17)|LUSC - Lung squamous cell carcinoma(66;0.0417)			ATGGTGGGAGAAGCCGGGCCT	0.716																																					p.R519R		Atlas-SNP	.											.	LSR	60	.	0			c.A1557G						.						11.0	16.0	15.0					19																	35758280		2117	4161	6278	SO:0001819	synonymous_variant	51599	exon9			TGGGAGAAGCCGG	AF130366	CCDS12449.1, CCDS12450.1, CCDS12451.1, CCDS59376.1	19q13.12	2013-01-11			ENSG00000105699	ENSG00000105699		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29572	protein-coding gene	gene with protein product	"""lipolysis-stimulated remnant"", ""immunoglobulin-like domain containing receptor 3"""					10224102	Standard	NM_015925		Approved	LISCH7, ILDR3	uc002nyl.3	Q86X29		ENST00000361790.3:c.1557A>G	19.37:g.35758280A>G		94.0	0.0		83.0	9.0	NM_205834	A6NDW3|B4DKL4|E9PHD4|O00112|O00426|Q6ZT80|Q8NBM0|Q9BT33|Q9UQL3	Silent	SNP	ENST00000361790.3	37	CCDS12450.1																																																																																			.	.		0.716	LSR-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000465513.2	NM_015925	
FFAR2	2867	hgsc.bcm.edu	37	19	35940857	35940857	+	Missense_Mutation	SNP	G	G	T	rs539042139		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:35940857G>T	ENST00000599180.2	+	2	321	c.241G>T	c.(241-243)Gtc>Ttc	p.V81F	FFAR2_ENST00000246549.2_Missense_Mutation_p.V81F|FFAR2_ENST00000601590.1_Intron			O15552	FFAR2_HUMAN	free fatty acid receptor 2	81					cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to fatty acid (GO:0071398)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|leukocyte chemotaxis involved in inflammatory response (GO:0002232)|lipid storage (GO:0019915)|mucosal immune response (GO:0002385)|positive regulation of acute inflammatory response to non-antigenic stimulus (GO:0002879)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine production involved in immune response (GO:0002720)|positive regulation of interleukin-8 secretion (GO:2000484)|regulation of acute inflammatory response (GO:0002673)|regulation of peptide hormone secretion (GO:0090276)	cell projection (GO:0042995)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(6)|skin(1)|urinary_tract(1)	22	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCCCAAGGTCGTCTGCGCCCT	0.627																																					p.V81F	GBM(40;139 809 9833 23358 48736)	Atlas-SNP	.											.	FFAR2	39	.	0			c.G241T						.						58.0	46.0	50.0					19																	35940857		2203	4300	6503	SO:0001583	missense	2867	exon1			AAGGTCGTCTGCG	AF024690	CCDS12461.1	19q13.1	2012-08-08	2006-02-15	2006-02-15		ENSG00000126262		"""GPCR / Class A : Fatty acid receptors"""	4501	protein-coding gene	gene with protein product		603823	"""G protein-coupled receptor 43"""	GPR43		9344866	Standard	NM_005306		Approved	FFA2R	uc010eea.3	O15552		ENST00000599180.2:c.241G>T	19.37:g.35940857G>T	ENSP00000473159:p.Val81Phe	39.0	0.0		57.0	26.0	NM_005306	B0M0J9|Q4VAZ3|Q4VAZ5|Q4VBL5	Missense_Mutation	SNP	ENST00000599180.2	37	CCDS12461.1	.	.	.	.	.	.	.	.	.	.	G	6.324	0.427788	0.11987	.	.	ENSG00000126262	ENST00000246549	T	0.36878	1.23	5.48	-5.01	0.02991	GPCR, rhodopsin-like superfamily (1);	0.513281	0.18689	N	0.133935	T	0.16938	0.0407	N	0.12637	0.245	0.09310	N	0.999998	B	0.13145	0.007	B	0.15870	0.014	T	0.19031	-1.0318	10	0.54805	T	0.06	-12.1557	10.6757	0.45785	0.2136:0.5825:0.2039:0.0	.	81	O15552	FFAR2_HUMAN	F	81	ENSP00000246549:V81F	ENSP00000246549:V81F	V	+	1	0	FFAR2	40632697	0.165000	0.22948	0.000000	0.03702	0.002000	0.02628	0.705000	0.25675	-0.427000	0.07350	-0.254000	0.11334	GTC	.	.		0.627	FFAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466120.3	NM_005306	
NAPA	8775	hgsc.bcm.edu	37	19	47995285	47995285	+	Missense_Mutation	SNP	A	A	C	rs149012477	byFrequency	TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:47995285A>C	ENST00000263354.3	-	8	952	c.653T>G	c.(652-654)aTg>aGg	p.M218R	NAPA-AS1_ENST00000593284.1_RNA|NAPA_ENST00000595227.1_Missense_Mutation_p.M179R|NAPA-AS1_ENST00000594367.1_RNA	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha	218					apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		GGCGTTGAGCATGTCGATGCA	0.622																																					p.M218R	Ovarian(185;1135 2042 27703 31345 42493)	Atlas-SNP	.											.	NAPA	34	.	0			c.T653G						.						219.0	171.0	187.0					19																	47995285		2203	4300	6503	SO:0001583	missense	8775	exon8			TTGAGCATGTCGA	U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.653T>G	19.37:g.47995285A>C	ENSP00000263354:p.Met218Arg	51.0	0.0		48.0	18.0	NM_003827	A8K879|Q96IK3|Q9BVJ3	Missense_Mutation	SNP	ENST00000263354.3	37	CCDS12702.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.611197	0.28712	.	.	ENSG00000105402	ENST00000263354	T	0.75589	-0.95	5.24	4.23	0.50019	Tetratricopeptide-like helical (1);	0.117280	0.85682	D	0.000000	T	0.69851	0.3157	M	0.71581	2.175	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.63752	-0.6566	10	0.26408	T	0.33	-12.6147	9.973	0.41765	0.9193:0.0:0.0807:0.0	.	218	P54920	SNAA_HUMAN	R	218	ENSP00000263354:M218R	ENSP00000263354:M218R	M	-	2	0	NAPA	52687097	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	1.806000	0.38892	1.030000	0.39839	0.418000	0.28097	ATG	.	A|1.000;G|0.000		0.622	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466048.2	NM_003827	
TPRX1	284355	hgsc.bcm.edu	37	19	48305624	48305624	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:48305624A>T	ENST00000322175.3	-	2	799	c.644T>A	c.(643-645)aTc>aAc	p.I215N	TPRX1_ENST00000543508.1_Missense_Mutation_p.I205N|TPRX1_ENST00000535759.1_Missense_Mutation_p.I312N	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	215	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		tgggcctgagattgggcctga	0.667																																					p.I215N	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											.	TPRX1	46	.	0			c.T644A						.						13.0	10.0	11.0					19																	48305624		1860	3655	5515	SO:0001583	missense	284355	exon2			CCTGAGATTGGGC		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.644T>A	19.37:g.48305624A>T	ENSP00000323455:p.Ile215Asn	12.0	0.0		71.0	31.0	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	37	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	t	0.005	-2.226762	0.00283	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.40225	1.04;1.04;1.04	0.365	-0.73	0.11154	.	.	.	.	.	T	0.18002	0.0432	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21724	-1.0237	8	0.16896	T	0.51	.	.	.	.	.	215	Q8N7U7	TPRX1_HUMAN	N	215;312;205	ENSP00000323455:I215N;ENSP00000438832:I312N;ENSP00000438712:I205N	ENSP00000323455:I215N	I	-	2	0	TPRX1	52997436	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.499000	0.06413	-2.038000	0.00918	-2.153000	0.00332	ATC	.	.		0.667	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
TPRX1	284355	hgsc.bcm.edu	37	19	48305638	48305638	+	Silent	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:48305638T>C	ENST00000322175.3	-	2	785	c.630A>G	c.(628-630)ccA>ccG	p.P210P	TPRX1_ENST00000543508.1_Silent_p.P200P|TPRX1_ENST00000535759.1_Silent_p.P307P	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	210	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)	p.P210P(1)		endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		ggcctgagattgggcctggga	0.672																																					p.P210P	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											TPRX1,NS,carcinoma,0,1	TPRX1	46	1	1	Substitution - coding silent(1)	endometrium(1)	c.A630G						.						13.0	10.0	11.0					19																	48305638		1836	3551	5387	SO:0001819	synonymous_variant	284355	exon2			TGAGATTGGGCCT		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.630A>G	19.37:g.48305638T>C		61.0	0.0		79.0	23.0	NM_198479	A5D8Y3|B2RPL5	Silent	SNP	ENST00000322175.3	37	CCDS33066.1																																																																																			.	.		0.672	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
IZUMO1	284359	hgsc.bcm.edu	37	19	49244664	49244664	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:49244664A>G	ENST00000332955.2	-	9	1373	c.826T>C	c.(826-828)Tcg>Ccg	p.S276P	RASIP1_ENST00000594232.1_5'Flank|RASIP1_ENST00000222145.4_5'Flank	NM_182575.2	NP_872381.2	Q8IYV9	IZUM1_HUMAN	izumo sperm-egg fusion 1	276					cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			endometrium(4)|kidney(3)|large_intestine(4)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	17		all_lung(116;0.000156)|Lung NSC(112;0.000251)|all_epithelial(76;0.000761)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CTTATGGACGACTCCGTGGTC	0.552																																					p.S276P		Atlas-SNP	.											.	IZUMO1	30	.	0			c.T826C						.						64.0	69.0	67.0					19																	49244664		2203	4300	6503	SO:0001583	missense	284359	exon9			TGGACGACTCCGT	BC034769	CCDS12732.1	19q13.33	2014-07-23			ENSG00000182264	ENSG00000182264		"""-"""	28539	protein-coding gene	gene with protein product	"""oocyte binding/fusion factor"""	609278				15759005, 18952059, 19658160, 22957301	Standard	NM_182575		Approved	IZUMO, MGC34799, OBF	uc002pkj.3	Q8IYV9	OTTHUMG00000183324	ENST00000332955.2:c.826T>C	19.37:g.49244664A>G	ENSP00000327786:p.Ser276Pro	53.0	0.0		35.0	19.0	NM_182575	Q6Q8P6|Q6Q8P7	Missense_Mutation	SNP	ENST00000332955.2	37	CCDS12732.1	.	.	.	.	.	.	.	.	.	.	A	13.49	2.253735	0.39797	.	.	ENSG00000182264	ENST00000332955	T	0.23754	1.89	4.96	-9.93	0.00452	.	8.737100	0.00166	N	0.000001	T	0.12817	0.0311	N	0.22421	0.69	0.09310	N	1	B	0.09022	0.002	B	0.08055	0.003	T	0.10660	-1.0620	10	0.30078	T	0.28	0.7108	3.4906	0.07636	0.1483:0.1196:0.4509:0.2813	.	276	Q8IYV9	IZUM1_HUMAN	P	276	ENSP00000327786:S276P	ENSP00000327786:S276P	S	-	1	0	IZUMO1	53936476	0.000000	0.05858	0.000000	0.03702	0.549000	0.35272	-2.457000	0.01001	-2.774000	0.00363	0.482000	0.46254	TCG	.	.		0.552	IZUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466189.1	NM_182575	
VSIG10L	147645	hgsc.bcm.edu	37	19	51844521	51844521	+	Silent	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:51844521G>T	ENST00000335624.4	-	2	780	c.781C>A	c.(781-783)Cgg>Agg	p.R261R	CTD-2616J11.16_ENST00000594311.1_RNA|CTD-2616J11.16_ENST00000601148.1_RNA	NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	261						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						AGAACCCCCCGGGCCTGGTCA	0.677																																					p.R261R		Atlas-SNP	.											.	VSIG10L	40	.	0			c.C781A						.						10.0	16.0	14.0					19																	51844521		690	1589	2279	SO:0001819	synonymous_variant	147645	exon2			CCCCCCGGGCCTG		CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.781C>A	19.37:g.51844521G>T		44.0	0.0		73.0	31.0	NM_001163922		Silent	SNP	ENST00000335624.4	37	CCDS54300.1																																																																																			.	.		0.677	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464535.1	NM_001163922	
NLRP7	199713	hgsc.bcm.edu	37	19	55452329	55452329	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:55452329C>T	ENST00000590030.1	-	2	362	c.322G>A	c.(322-324)Gca>Aca	p.A108T	NLRP7_ENST00000446217.1_Missense_Mutation_p.A136T|NLRP7_ENST00000592784.1_Missense_Mutation_p.A108T|NLRP7_ENST00000448121.2_Missense_Mutation_p.A108T|NLRP7_ENST00000588756.1_Missense_Mutation_p.A108T|NLRP7_ENST00000340844.2_Missense_Mutation_p.A108T|NLRP7_ENST00000328092.5_Missense_Mutation_p.A108T			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	108							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TCTTCTTCTGCATCTCCCAGC	0.443																																					p.A108T		Atlas-SNP	.											.	NLRP7	411	.	0			c.G322A						.						252.0	201.0	218.0					19																	55452329		2203	4300	6503	SO:0001583	missense	199713	exon3			CTTCTGCATCTCC	AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.322G>A	19.37:g.55452329C>T	ENSP00000465520:p.Ala108Thr	55.0	0.0		37.0	10.0	NM_001127255	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	ENST00000590030.1	37	CCDS33109.1	.	.	.	.	.	.	.	.	.	.	C	0.075	-1.194146	0.01594	.	.	ENSG00000167634	ENST00000328092;ENST00000448121;ENST00000340844;ENST00000446217	T;T;T;T	0.73897	-0.73;-0.73;-0.79;-0.76	1.8	-3.6	0.04570	.	.	.	.	.	T	0.40670	0.1126	N	0.08118	0	0.09310	N	1	B;B;B;B	0.33477	0.005;0.013;0.167;0.413	B;B;B;B	0.29077	0.002;0.002;0.028;0.098	T	0.37244	-0.9714	9	0.13853	T	0.58	.	0.2545	0.00210	0.2056:0.289:0.2032:0.3021	.	136;108;108;108	E7EPM2;Q32MH9;Q8WX94;Q8WX94-2	.;.;NALP7_HUMAN;.	T	108;108;108;136	ENSP00000329568:A108T;ENSP00000409137:A108T;ENSP00000339491:A108T;ENSP00000414273:A136T	ENSP00000329568:A108T	A	-	1	0	NLRP7	60144141	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.461000	0.06712	-0.971000	0.03564	-1.401000	0.01141	GCA	.	.		0.443	NLRP7-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000451396.1	NM_139176	
DEFB129	140881	hgsc.bcm.edu	37	20	210326	210326	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr20:210326G>A	ENST00000246105.4	+	2	497	c.466G>A	c.(466-468)Gcc>Acc	p.A156T		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	156					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			CAGAGATTCTGCCACTGCCTC	0.512																																					p.A156T		Atlas-SNP	.											DEFB129,NS,carcinoma,0,2	DEFB129	24	2	0			c.G466A						.						125.0	112.0	116.0					20																	210326		2203	4300	6503	SO:0001583	missense	140881	exon2			GATTCTGCCACTG	AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.466G>A	20.37:g.210326G>A	ENSP00000246105:p.Ala156Thr	62.0	0.0		28.0	11.0	NM_080831	Q8NES7	Missense_Mutation	SNP	ENST00000246105.4	37	CCDS12992.1	.	.	.	.	.	.	.	.	.	.	G	14.88	2.666106	0.47677	.	.	ENSG00000125903	ENST00000246105	T	0.46063	0.88	4.26	2.27	0.28462	.	0.891435	0.09560	N	0.785724	T	0.36138	0.0956	L	0.32530	0.975	0.09310	N	1	D	0.58620	0.983	P	0.47864	0.559	T	0.15809	-1.0424	10	0.51188	T	0.08	-1.1742	6.0935	0.20007	0.1032:0.1901:0.7067:0.0	.	156	Q9H1M3	DB129_HUMAN	T	156	ENSP00000246105:A156T	ENSP00000246105:A156T	A	+	1	0	DEFB129	158326	0.002000	0.14202	0.001000	0.08648	0.040000	0.13550	0.768000	0.26590	0.732000	0.32470	0.462000	0.41574	GCC	.	.		0.512	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077430.2	NM_080831	
SLC32A1	140679	hgsc.bcm.edu	37	20	37357190	37357190	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr20:37357190A>G	ENST00000217420.1	+	2	1749	c.1486A>G	c.(1486-1488)Atc>Gtc	p.I496V		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	496					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGACGTCGCCATCTTCGTCAT	0.642																																					p.I496V		Atlas-SNP	.											.	SLC32A1	81	.	0			c.A1486G						.						23.0	23.0	23.0					20																	37357190		2202	4300	6502	SO:0001583	missense	140679	exon2			GTCGCCATCTTCG	AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.1486A>G	20.37:g.37357190A>G	ENSP00000217420:p.Ile496Val	123.0	0.0		104.0	42.0	NM_080552	Q8N489	Missense_Mutation	SNP	ENST00000217420.1	37	CCDS13307.1	.	.	.	.	.	.	.	.	.	.	A	16.32	3.091026	0.55968	.	.	ENSG00000101438	ENST00000217420	T	0.02236	4.38	4.95	4.95	0.65309	.	0.101862	0.64402	D	0.000004	T	0.03136	0.0092	N	0.21508	0.67	0.80722	D	1	P	0.39903	0.694	P	0.45610	0.487	T	0.64601	-0.6369	10	0.37606	T	0.19	-21.4989	12.8433	0.57815	1.0:0.0:0.0:0.0	.	496	Q9H598	VIAAT_HUMAN	V	496	ENSP00000217420:I496V	ENSP00000217420:I496V	I	+	1	0	SLC32A1	36790604	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.218000	0.95166	1.987000	0.57996	0.533000	0.62120	ATC	.	.		0.642	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079206.1	NM_080552	
EWSR1	2130	hgsc.bcm.edu	37	22	29695754	29695754	+	Missense_Mutation	SNP	G	G	A	rs201365388		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr22:29695754G>A	ENST00000397938.2	+	16	2163	c.1844G>A	c.(1843-1845)cGa>cAa	p.R615Q	EWSR1_ENST00000414183.2_Missense_Mutation_p.R620Q|EWSR1_ENST00000332035.6_Missense_Mutation_p.R559Q|EWSR1_ENST00000332050.6_Missense_Mutation_p.R542Q|EWSR1_ENST00000406548.1_Missense_Mutation_p.R614Q|EWSR1_ENST00000331029.7_Missense_Mutation_p.R577Q	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	615	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						GGAGGAAGACGAGGTGGCCCT	0.612			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.R620Q		Atlas-SNP	.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	EWSR1_ENST00000414183,brain,glioma,0,2	EWSR1	104	2	0			c.G1859A						.																																			SO:0001583	missense	2130	exon17			GAAGACGAGGTGG		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1844G>A	22.37:g.29695754G>A	ENSP00000381031:p.Arg615Gln	84.0	0.0		79.0	5.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	G	17.00	3.277579	0.59758	.	.	ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	D;D;D;D;D;D	0.96774	-4.05;-3.54;-3.67;-4.12;-3.68;-3.56	4.91	3.89	0.44902	.	0.000000	0.64402	U	0.000002	D	0.91653	0.7362	N	0.19112	0.55	0.38032	D	0.9352	B;B;B;B;B	0.14438	0.003;0.01;0.01;0.01;0.01	B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.001	D	0.88575	0.3132	10	0.52906	T	0.07	.	13.0918	0.59171	0.0784:0.0:0.9216:0.0	.	559;614;559;620;615	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.;.;.;.;EWS_HUMAN	Q	542;615;614;577;620;559	ENSP00000330896:R542Q;ENSP00000381031:R615Q;ENSP00000385726:R614Q;ENSP00000330516:R577Q;ENSP00000400142:R620Q;ENSP00000331699:R559Q	ENSP00000330516:R577Q	R	+	2	0	EWSR1	28025754	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.112000	0.89566	1.052000	0.40392	0.305000	0.20034	CGA	.	G|0.994;A|0.006		0.612	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
EWSR1	2130	hgsc.bcm.edu	37	22	29695793	29695793	+	Missense_Mutation	SNP	A	A	C	rs200316952		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr22:29695793A>C	ENST00000397938.2	+	16	2202	c.1883A>C	c.(1882-1884)cAg>cCg	p.Q628P	EWSR1_ENST00000414183.2_Missense_Mutation_p.Q633P|EWSR1_ENST00000332035.6_Missense_Mutation_p.Q572P|EWSR1_ENST00000332050.6_Missense_Mutation_p.Q555P|EWSR1_ENST00000406548.1_Missense_Mutation_p.Q627P|EWSR1_ENST00000331029.7_Missense_Mutation_p.Q590P	NM_001163285.1|NM_001163286.1|NM_005243.3|NM_013986.3	NP_001156757.1|NP_001156758.1|NP_005234.1|NP_053733.2	Q01844	EWS_HUMAN	EWS RNA-binding protein 1	628	Arg/Gly/Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		EWSR1/ATF1(347)|EWSR1/POU5F1(10)|EWSR1/PBX1(3)|EWSR1/DDIT3(45)|EWSR1/FEV(11)|EWSR1/CREB1(44)|EWSR1/SMARCA5(2)|EWSR1/ETV4(6)|EWSR1/ERG(178)|EWSR1/ZNF384(4)|EWSR1/ETV1(7)|EWSR1/FLI1(2569)|EWSR1/NR4A3(146)|EWSR1/SP3(3)|EWSR1/PATZ1(2)|EWSR1/WT1(234)|EWSR1/NFATC2(9)	breast(2)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TTGATGGAACAGATGGGAGGA	0.602			T	"""FLI1, ERG, ZNF278, NR4A3, FEV, ATF1, ETV1, ETV4, WT1, ZNF384, CREB1, POU5F1,  PBX1"""	"""Ewing sarcoma,  desmoplastic small round cell tumor , ALL, clear cell sarcoma, sarcoma, myoepithelioma"""																																p.Q633P		Atlas-SNP	.		Dom	yes		22	22q12	2130	Ewing sarcoma breakpoint region 1 (EWS)		"""L, M"""	EWSR1_ENST00000414183,NS,carcinoma,0,5	EWSR1	104	5	0			c.A1898C						.						28.0	31.0	30.0					22																	29695793		2203	4300	6503	SO:0001583	missense	2130	exon17			TGGAACAGATGGG		CCDS13851.1, CCDS13852.1, CCDS13852.2, CCDS54512.1, CCDS54513.1, CCDS54514.1	22q12.2	2013-05-24	2013-05-24		ENSG00000182944	ENSG00000182944		"""RNA binding motif (RRM) containing"""	3508	protein-coding gene	gene with protein product		133450	"""Ewing sarcoma breakpoint region 1"""			1522903	Standard	NM_005243		Approved	EWS	uc003aev.3	Q01844	OTTHUMG00000151107	ENST00000397938.2:c.1883A>C	22.37:g.29695793A>C	ENSP00000381031:p.Gln628Pro	82.0	0.0		77.0	5.0	NM_013986	B0QYK1|Q5THL0|Q92635|Q96FE8|Q96MN4|Q96MX4|Q9BWA2	Missense_Mutation	SNP	ENST00000397938.2	37	CCDS13851.1	.	.	.	.	.	.	.	.	.	.	A	15.98	2.991921	0.54041	.	.	ENSG00000182944	ENST00000332050;ENST00000397938;ENST00000406548;ENST00000331029;ENST00000414183;ENST00000332035	D;D;D;D;D;D	0.96522	-3.95;-3.43;-3.57;-4.04;-3.57;-3.42	5.17	5.17	0.71159	.	0.000000	0.49305	U	0.000144	D	0.94997	0.8381	L	0.36672	1.1	0.41806	D	0.989942	D;D;D;D;D	0.61080	0.989;0.963;0.963;0.963;0.963	P;B;B;B;B	0.50825	0.651;0.425;0.425;0.425;0.425	D	0.94641	0.7830	10	0.39692	T	0.17	.	15.0248	0.71659	1.0:0.0:0.0:0.0	.	572;627;572;633;628	Q96MN4;Q96FE8;B0QYK1;Q96MX4;Q01844	.;.;.;.;EWS_HUMAN	P	555;628;627;590;633;572	ENSP00000330896:Q555P;ENSP00000381031:Q628P;ENSP00000385726:Q627P;ENSP00000330516:Q590P;ENSP00000400142:Q633P;ENSP00000331699:Q572P	ENSP00000330516:Q590P	Q	+	2	0	EWSR1	28025793	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.616000	0.61197	1.946000	0.56461	0.455000	0.32223	CAG	.	A|0.997;C|0.003		0.602	EWSR1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000321345.1	NM_005243	
TST	7263	hgsc.bcm.edu	37	22	37407302	37407302	+	Silent	SNP	A	A	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr22:37407302A>G	ENST00000403892.3	-	2	1394	c.660T>C	c.(658-660)gaT>gaC	p.D220D	TST_ENST00000249042.3_Silent_p.D220D|Y_RNA_ENST00000516603.1_RNA	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	220	Rhodanese 2. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						TCTCGAAGCCATCCTCAGTCA	0.587																																					p.D220D		Atlas-SNP	.											.	TST	22	.	0			c.T660C						.						55.0	44.0	48.0					22																	37407302		2203	4300	6503	SO:0001819	synonymous_variant	7263	exon3			GAAGCCATCCTCA	Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.660T>C	22.37:g.37407302A>G		90.0	0.0		102.0	50.0	NM_003312	B3KRM1|Q6IB06	Silent	SNP	ENST00000403892.3	37	CCDS13938.1																																																																																			.	.		0.587	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318790.1		
TRIOBP	11078	hgsc.bcm.edu	37	22	38120691	38120691	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr22:38120691T>G	ENST00000406386.3	+	7	2383	c.2128T>G	c.(2128-2130)Tct>Gct	p.S710A		NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	710					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					CAGAGCCTCCTCTCCTAACAG	0.577																																					p.S710A		Atlas-SNP	.											TRIOBP_ENST00000344404,NS,carcinoma,0,1	TRIOBP	262	1	0			c.T2128G						.						171.0	186.0	181.0					22																	38120691		1944	4150	6094	SO:0001583	missense	11078	exon7			GCCTCCTCTCCTA	AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.2128T>G	22.37:g.38120691T>G	ENSP00000384312:p.Ser710Ala	157.0	0.0		149.0	57.0	NM_001039141	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Missense_Mutation	SNP	ENST00000406386.3	37	CCDS43015.1	.	.	.	.	.	.	.	.	.	.	T	18.34	3.602126	0.66445	.	.	ENSG00000100106	ENST00000406386;ENST00000417174	T	0.21361	2.01	4.35	4.35	0.52113	.	.	.	.	.	T	0.21631	0.0521	M	0.64404	1.975	0.80722	D	1	P	0.45715	0.865	B	0.40602	0.334	T	0.02365	-1.1170	9	0.33141	T	0.24	.	10.1536	0.42809	0.0:0.0:0.0:1.0	.	710	Q9H2D6	TARA_HUMAN	A	710	ENSP00000384312:S710A	ENSP00000384312:S710A	S	+	1	0	TRIOBP	36450637	0.478000	0.25917	0.191000	0.23289	0.010000	0.07245	1.135000	0.31454	1.977000	0.57605	0.456000	0.33151	TCT	.	.		0.577	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319439.2		
MICALL1	85377	hgsc.bcm.edu	37	22	38302534	38302534	+	Silent	SNP	G	G	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr22:38302534G>T	ENST00000215957.6	+	1	231	c.105G>T	c.(103-105)ctG>ctT	p.L35L		NM_033386.3	NP_203744.1	Q8N3F8	MILK1_HUMAN	MICAL-like 1	35	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|neuron projection development (GO:0031175)|protein localization to endosome (GO:0036010)|protein targeting to membrane (GO:0006612)|receptor-mediated endocytosis (GO:0006898)|retrograde transport, endosome to plasma membrane (GO:1990126)|slow endocytic recycling (GO:0032458)	extrinsic component of membrane (GO:0019898)|late endosome (GO:0005770)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	24	Melanoma(58;0.045)					GGGACGGCCTGGCCTTCTGCG	0.801																																					p.L35L		Atlas-SNP	.											.	MICALL1	53	.	0			c.G105T						.						5.0	5.0	5.0					22																	38302534		1818	3519	5337	SO:0001819	synonymous_variant	85377	exon1			CGGCCTGGCCTTC	BK000466	CCDS13961.1	22q13.1	2006-11-24			ENSG00000100139	ENSG00000100139			29804	protein-coding gene	gene with protein product	"""molecule interacting with Rab13"""					11258795, 12110185	Standard	NM_033386		Approved	MIRAB13, KIAA1668, MICAL-L1	uc003aui.3	Q8N3F8	OTTHUMG00000150670	ENST00000215957.6:c.105G>T	22.37:g.38302534G>T		23.0	0.0		37.0	14.0	NM_033386	Q5TI16|Q7RTP5|Q8N3N8|Q9BVL9|Q9BY92|Q9UH43|Q9UH44|Q9UH45	Silent	SNP	ENST00000215957.6	37	CCDS13961.1																																																																																			.	.		0.801	MICALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319545.4	NM_033386	
KAL1	3730	hgsc.bcm.edu	37	X	8553366	8553366	+	Silent	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:8553366C>T	ENST00000262648.3	-	6	947	c.798G>A	c.(796-798)gtG>gtA	p.V266V		NM_000216.2	NP_000207.2	P23352	KALM_HUMAN	Kallmann syndrome 1 sequence	266	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|chemotaxis (GO:0006935)	extracellular space (GO:0005615)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(1)	32						CATGCACATTCACAGCAGCCA	0.517																																					p.V266V		Atlas-SNP	.											.	KAL1	78	.	0			c.G798A						.						173.0	120.0	138.0					X																	8553366		2203	4300	6503	SO:0001819	synonymous_variant	3730	exon6			CACATTCACAGCA		CCDS14130.1	Xp22.32	2013-02-11			ENSG00000011201	ENSG00000011201		"""WAP four-disulfide core domain containing"", ""Fibronectin type III domain containing"""	6211	protein-coding gene	gene with protein product	"""anosmin-1"", ""WAP four-disulfide core domain 19"""	300836		KAL, ADMLX		11463336	Standard	NM_000216		Approved	KALIG-1, WFDC19	uc004csf.3	P23352	OTTHUMG00000021107	ENST00000262648.3:c.798G>A	X.37:g.8553366C>T		34.0	0.0		31.0	25.0	NM_000216	B2RPF8	Silent	SNP	ENST00000262648.3	37	CCDS14130.1																																																																																			.	.		0.517	KAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055692.1	NM_000216	
HEPH	9843	hgsc.bcm.edu	37	X	65408259	65408259	+	Silent	SNP	C	C	T			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:65408259C>T	ENST00000343002.2	+	4	1348	c.684C>T	c.(682-684)ctC>ctT	p.L228L	HEPH_ENST00000519389.1_Silent_p.L282L|HEPH_ENST00000419594.1_Silent_p.L231L|HEPH_ENST00000441993.2_Silent_p.L231L|HEPH_ENST00000374727.3_Silent_p.L231L|HEPH_ENST00000336279.5_5'UTR			Q9BQS7	HEPH_HUMAN	hephaestin	228	Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						ATTTCTTCCTCCTCTTCAGTG	0.488																																					p.L282L		Atlas-SNP	.											.	HEPH	224	.	0			c.C846T						.						105.0	78.0	87.0					X																	65408259		2203	4300	6503	SO:0001819	synonymous_variant	9843	exon5			CTTCCTCCTCTTC	AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.684C>T	X.37:g.65408259C>T		138.0	0.0		69.0	64.0	NM_138737	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Silent	SNP	ENST00000343002.2	37																																																																																				.	.		0.488	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000056995.1	NM_138737	
MED12	9968	hgsc.bcm.edu	37	X	70349274	70349274	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:70349274T>A	ENST00000374080.3	+	26	3718	c.3686T>A	c.(3685-3687)gTa>gAa	p.V1229E	MED12_ENST00000333646.6_Missense_Mutation_p.V1229E|MED12_ENST00000374102.1_Missense_Mutation_p.V1229E			Q93074	MED12_HUMAN	mediator complex subunit 12	1229					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					GCTGTGTTTGTACTTGGTACG	0.562			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome				OREG0019857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V1229E		Atlas-SNP	.		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	.	MED12	984	.	0			c.T3686A						.						41.0	43.0	43.0					X																	70349274		2063	4183	6246	SO:0001583	missense	9968	exon26			TGTTTGTACTTGG	U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.3686T>A	X.37:g.70349274T>A	ENSP00000363193:p.Val1229Glu	43.0	0.0	1121	44.0	36.0	NM_005120	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	ENST00000374080.3	37	CCDS43970.1	.	.	.	.	.	.	.	.	.	.	.	20.6	4.010611	0.75046	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.37411	1.2;1.2;1.2;1.2	5.09	5.09	0.68999	.	0.053332	0.85682	D	0.000000	T	0.47432	0.1445	L	0.48642	1.525	0.80722	D	1	P;P;P;P	0.52170	0.713;0.944;0.951;0.59	B;P;P;B	0.55871	0.433;0.462;0.786;0.258	T	0.48768	-0.9006	10	0.72032	D	0.01	-10.3987	14.2257	0.65858	0.0:0.0:0.0:1.0	.	1229;1076;1229;1229	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	E	1229;1229;1229;1229;1197	ENSP00000333125:V1229E;ENSP00000363215:V1229E;ENSP00000363193:V1229E;ENSP00000414203:V1197E	ENSP00000333125:V1229E	V	+	2	0	MED12	70265999	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.283000	0.78640	2.003000	0.58678	0.430000	0.28490	GTA	.	.		0.562	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000057105.1	NM_005120	
COL4A5	1287	hgsc.bcm.edu	37	X	107925029	107925029	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:107925029T>C	ENST00000361603.2	+	45	4353	c.4109T>C	c.(4108-4110)aTa>aCa	p.I1370T	COL4A5_ENST00000328300.6_Missense_Mutation_p.I1376T	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1370	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						CAGAGTATCATAATTAAAGGA	0.483									Alport syndrome with Diffuse Leiomyomatosis																												p.I1370T		Atlas-SNP	.											.	COL4A5	262	.	0			c.T4109C						.						113.0	100.0	104.0					X																	107925029		2203	4300	6503	SO:0001583	missense	1287	exon45	Familial Cancer Database		GTATCATAATTAA	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.4109T>C	X.37:g.107925029T>C	ENSP00000354505:p.Ile1370Thr	129.0	0.0		71.0	55.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	37	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	14.58	2.578862	0.46006	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.94000	-3.33;-2.61	4.86	4.86	0.63082	.	0.664334	0.15080	N	0.281691	D	0.86289	0.5897	N	0.19112	0.55	0.24919	N	0.991991	B;B	0.19583	0.037;0.018	B;B	0.19391	0.025;0.007	T	0.74009	-0.3802	10	0.21540	T	0.41	.	9.3044	0.37865	0.1625:0.0:0.0:0.8375	.	1373;1370	E7EVY4;P29400	.;CO4A5_HUMAN	T	1376;1370;1376	ENSP00000331902:I1376T;ENSP00000354505:I1370T	ENSP00000331902:I1376T	I	+	2	0	COL4A5	107811685	0.993000	0.37304	0.992000	0.48379	0.774000	0.43823	4.044000	0.57361	1.706000	0.51276	0.412000	0.27726	ATA	.	.		0.483	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
TENM1	10178	hgsc.bcm.edu	37	X	123514834	123514834	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:123514834T>A	ENST00000371130.3	-	31	7793	c.7730A>T	c.(7729-7731)aAg>aTg	p.K2577M	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.K2584M	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2577					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGACCCAAGCTTAATGAAGTA	0.493																																					p.K2584M		Atlas-SNP	.											.	.	.	.	0			c.A7751T						.						98.0	75.0	83.0					X																	123514834		2203	4300	6503	SO:0001583	missense	10178	exon32			CCAAGCTTAATGA	AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.7730A>T	X.37:g.123514834T>A	ENSP00000360171:p.Lys2577Met	103.0	0.0		67.0	61.0	NM_001163278	B2RTR5|Q5JZ17	Missense_Mutation	SNP	ENST00000371130.3	37	CCDS14609.1	.	.	.	.	.	.	.	.	.	.	T	18.06	3.538653	0.65085	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.91180	-2.8;-2.77	5.83	5.83	0.93111	.	0.047957	0.85682	D	0.000000	D	0.94650	0.8275	M	0.72353	2.195	0.80722	D	1	D;D;D	0.89917	0.996;0.999;1.0	P;D;D	0.72075	0.862;0.921;0.976	D	0.95135	0.8258	10	0.87932	D	0	.	15.1686	0.72850	0.0:0.0:0.0:1.0	.	2583;2584;2577	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	M	2577;2584	ENSP00000360171:K2577M;ENSP00000403954:K2584M	ENSP00000360171:K2577M	K	-	2	0	ODZ1	123342515	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	8.040000	0.89188	1.965000	0.57142	0.486000	0.48141	AAG	.	.		0.493	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058985.1	NM_014253	
MT-ND5	4540	hgsc.bcm.edu	37	M	12835	12835	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrM:12835G>A	ENST00000361567.2	+	1	499	c.499G>A	c.(499-501)Gca>Aca	p.A167T	MT-TG_ENST00000387429.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	167					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						ATGCCAACACAGCAGCCATTC	0.483																																					p.A167T		Atlas-SNP	.											.	.	.	.	0			c.G499A						.																																			SO:0001583	missense	0	exon1			AACACAGCAGCCA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.499G>A	M.37:g.12835G>A	ENSP00000354813:p.Ala167Thr	8.0	0.0		110.0	6.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	37																																																																																				.	.		0.483	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
PHTF1	10745	hgsc.bcm.edu	37	1	114249252	114249253	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr1:114249252_114249253insA	ENST00000369604.1	-	12	1844_1845	c.1361_1362insT	c.(1360-1362)atgfs	p.M454fs	PHTF1_ENST00000357783.2_Frame_Shift_Ins_p.M454fs|PHTF1_ENST00000474926.1_5'UTR|PHTF1_ENST00000393357.2_Frame_Shift_Ins_p.M454fs|PHTF1_ENST00000369596.2_Frame_Shift_Ins_p.M401fs|PHTF1_ENST00000369600.1_Frame_Shift_Ins_p.M401fs|PHTF1_ENST00000369598.1_Frame_Shift_Ins_p.M409fs|PHTF1_ENST00000447664.2_3'UTR			Q9UMS5	PHTF1_HUMAN	putative homeodomain transcription factor 1	454					transcription, DNA-templated (GO:0006351)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27	Lung SC(450;0.184)	all_cancers(81;3.78e-08)|all_epithelial(167;5.56e-08)|all_lung(203;6.97e-06)|Lung NSC(69;1.18e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CCAACACAGACATATCCATCTT	0.366																																					p.M454fs		Atlas-Indel	.											.	PHTF1	69	.	0			c.1362_1363insT						.																																			SO:0001589	frameshift_variant	10745	exon11			.	AJ011863	CCDS861.1	1p13-p11	2008-07-18			ENSG00000116793	ENSG00000116793			8939	protein-coding gene	gene with protein product		604950		PHTF		10395808	Standard	NM_006608		Approved		uc009wgp.1	Q9UMS5	OTTHUMG00000011800	ENST00000369604.1:c.1362dupT	1.37:g.114249253_114249253dupA	ENSP00000358617:p.Met454fs	349.0	0.0		162.0	57.0	NM_006608	Q5VWP7|Q5VWP8|Q9BUP2|Q9H1X8	Frame_Shift_Ins	INS	ENST00000369604.1	37	CCDS861.1																																																																																			.	.		0.366	PHTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000032666.1	NM_006608	
CDKN1B	1027	hgsc.bcm.edu	37	12	12871044	12871044	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr12:12871044delC	ENST00000228872.4	+	1	987	c.271delC	c.(271-273)cccfs	p.P92fs	CDKN1B_ENST00000396340.1_Frame_Shift_Del_p.P92fs|CDKN1B_ENST00000477087.1_Intron	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	92					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		CTACTACAGACCCCCGCGGCC	0.617																																					p.R90fs		Atlas-Indel	.											.	CDKN1B	48	.	0			c.270delA						.						47.0	57.0	54.0					12																	12871044		2203	4300	6503	SO:0001589	frameshift_variant	1027	exon1			.	AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.271delC	12.37:g.12871044delC	ENSP00000228872:p.Pro92fs	651.0	0.0		519.0	190.0	NM_004064	Q16307|Q5U0H2|Q9BUS6	Frame_Shift_Del	DEL	ENST00000228872.4	37	CCDS8653.1																																																																																			.	.		0.617	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313878.2	NM_004064	
NOX5	79400	hgsc.bcm.edu	37	15	69329420	69329432	+	Frame_Shift_Del	DEL	TTCATGGGCCCAA	TTCATGGGCCCAA	-	rs139472034		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	TTCATGGGCCCAA	TTCATGGGCCCAA	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr15:69329420_69329432delTTCATGGGCCCAA	ENST00000388866.3	+	8	1282_1294	c.1241_1253delTTCATGGGCCCAA	c.(1240-1254)tttcatgggcccaacfs	p.FHGPN414fs	NOX5_ENST00000448182.3_Frame_Shift_Del_p.FHGPN368fs|NOX5_ENST00000260364.5_Frame_Shift_Del_p.FHGPN396fs|NOX5_ENST00000530406.2_Frame_Shift_Del_p.FHGPN386fs|RP11-809H16.4_ENST00000559495.1_RNA|NOX5_ENST00000455873.3_Frame_Shift_Del_p.FHGPN379fs	NM_001184779.1|NM_024505.3	NP_001171708.1|NP_078781.3	Q96PH1	NOX5_HUMAN	NADPH oxidase, EF-hand calcium binding domain 5	414	Ferric oxidoreductase.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cytokine secretion (GO:0050663)|cytokinesis (GO:0000910)|endothelial cell proliferation (GO:0001935)|oxidation-reduction process (GO:0055114)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|proton transport (GO:0015992)|regulation of fusion of sperm to egg plasma membrane (GO:0043012)|regulation of proton transport (GO:0010155)|superoxide anion generation (GO:0042554)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|flavin adenine dinucleotide binding (GO:0050660)|heme binding (GO:0020037)|hydrogen ion channel activity (GO:0015252)|NADP binding (GO:0050661)|superoxide-generating NADPH oxidase activity (GO:0016175)			breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(18)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35						CTGCTCATCTTTCATGGGCCCAACTTCTGGAAG	0.573																																					p.414_418del		Atlas-Indel	.											.	NOX5	60	.	0			c.1240_1252del						.																																			SO:0001589	frameshift_variant	79400	exon8			.	AF317889	CCDS32276.1, CCDS32276.2, CCDS53953.1, CCDS53954.1	15q22.31	2013-01-10			ENSG00000255346	ENSG00000255346		"""EF-hand domain containing"""	14874	protein-coding gene	gene with protein product		606572				11483596	Standard	NM_001184779		Approved	NOX5A, NOX5B	uc002ars.2	Q96PH1	OTTHUMG00000133320	ENST00000388866.3:c.1241_1253delTTCATGGGCCCAA	15.37:g.69329420_69329432delTTCATGGGCCCAA	ENSP00000373518:p.Phe414fs	132.0	0.0		76.0	16.0	NM_024505	B2RBJ4|Q08AN2|Q08AN3|Q8TEQ1|Q8TER4|Q96PH2|Q96PJ8|Q96PJ9|Q9H6E0|Q9HAM8	Frame_Shift_Del	DEL	ENST00000388866.3	37	CCDS32276.2																																																																																			.	.		0.573	NOX5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000257124.2	NM_024505	
REEP6	92840	hgsc.bcm.edu	37	19	1495318	1495341	+	In_Frame_Del	DEL	TCTGCTGTTCGGCTACGGAGCGTC	TCTGCTGTTCGGCTACGGAGCGTC	-	rs200733401|rs371810396|rs537764971|rs79574672	byFrequency	TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	TCTGCTGTTCGGCTACGGAGCGTC	TCTGCTGTTCGGCTACGGAGCGTC	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr19:1495318_1495341delTCTGCTGTTCGGCTACGGAGCGTC	ENST00000233596.3	+	2	245_268	c.141_164delTCTGCTGTTCGGCTACGGAGCGTC	c.(139-165)tatctgctgttcggctacggagcgtct>tat	p.LLFGYGAS48del		NM_138393.1	NP_612402.1	Q96HR9	REEP6_HUMAN	receptor accessory protein 6	48					regulation of intracellular transport (GO:0032386)	apical part of cell (GO:0045177)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.G51V(1)|p.R118R(1)		lung(1)|ovary(1)	2		Acute lymphoblastic leukemia(61;5.61e-13)|all_hematologic(61;2.65e-08)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAAGCCTGTATCTGCTGTTCGGCTACGGAGCGTCTCTGCTGTGC	0.665																																					p.47_55del		Atlas-Indel	.											.	REEP6	21	.	2	Substitution - Missense(1)|Substitution - coding silent(1)	lung(2)	c.140_163del						.																																			SO:0001651	inframe_deletion	92840	exon2			.	BC008201	CCDS12070.1	19p13.3	2012-12-20	2006-02-08	2006-02-07	ENSG00000115255	ENSG00000115255		"""Receptor accessory proteins"""	30078	protein-coding gene	gene with protein product	"""polyposis locus protein 1-like 1"", ""deleted in polyposis 1-like 1"""	609346	"""chromosome 19 open reading frame 32"""	C19orf32		16271481, 15550249	Standard	NM_138393		Approved	DP1L1, FLJ25383	uc002ltc.3	Q96HR9	OTTHUMG00000180072	ENST00000233596.3:c.141_164delTCTGCTGTTCGGCTACGGAGCGTC	19.37:g.1495318_1495341delTCTGCTGTTCGGCTACGGAGCGTC	ENSP00000233596:p.Leu48_Ser55del	45.0	0.0		28.0	12.0	NM_138393	B2RE01|D6W5Z0|Q96LM0	In_Frame_Del	DEL	ENST00000233596.3	37	CCDS12070.1																																																																																			.	.		0.665	REEP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449623.1	NM_138393	
CD40	958	hgsc.bcm.edu	37	20	44756975	44756975	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chr20:44756975delT	ENST00000372285.3	+	8	725	c.653delT	c.(652-654)gtgfs	p.V218fs	CD40_ENST00000489304.1_3'UTR|CD40_ENST00000372276.3_Frame_Shift_Del_p.G198fs	NM_001250.4	NP_001241.1	P25942	TNR5_HUMAN	CD40 molecule, TNF receptor superfamily member 5	218					B cell proliferation (GO:0042100)|cellular calcium ion homeostasis (GO:0006874)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|inflammatory response (GO:0006954)|platelet activation (GO:0030168)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|protein complex assembly (GO:0006461)|regulation of immune response (GO:0050776)|regulation of immunoglobulin secretion (GO:0051023)	CD40 receptor complex (GO:0035631)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|enzyme binding (GO:0019899)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		Myeloproliferative disorder(115;0.0122)				ttAGAAAAGGTGGCCAAGAAG	0.498									Immune Deficiency with Hyper-IgM		OREG0025991	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V218fs		Atlas-Indel	.											CD40,NS,carcinoma,0,1	CD40	33	1	0			c.652delG						.																																			SO:0001589	frameshift_variant	958	exon8	Familial Cancer Database	Hypogammaglobulinemia with Hyper-IgM, HIGM type I-V, XLHIGM	.	X60592	CCDS13393.1, CCDS13394.1	20q12-q13.2	2014-09-17	2006-03-28	2005-01-14	ENSG00000101017	ENSG00000101017		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11919	protein-coding gene	gene with protein product		109535	"""tumor necrosis factor receptor superfamily, member 5"""	TNFRSF5		7687385, 2998589	Standard	XM_005260617		Approved	p50, Bp50	uc002xrg.1	P25942	OTTHUMG00000033053	ENST00000372285.3:c.653delT	20.37:g.44756975delT	ENSP00000361359:p.Val218fs	95.0	0.0	926	87.0	10.0	NM_001250	E1P5S9|Q53GN5|Q5JY15|Q5U007|Q7M4Q8|Q86YK5|Q9BYU0	Frame_Shift_Del	DEL	ENST00000372285.3	37	CCDS13393.1																																																																																			.	.		0.498	CD40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080376.1	NM_001250	
SUPT20HL1	100130302	hgsc.bcm.edu	37	X	24382442	24382453	+	IGR	DEL	TAGCTGCTGCTG	TAGCTGCTGCTG	-	rs112697166		TCGA-DD-AACA-01A-11D-A40R-10	TCGA-DD-AACA-10A-01D-A40U-10	TAGCTGCTGCTG	TAGCTGCTGCTG	.	.	.	.	Unknown	Untested	Somatic	Phase_I	WXS	none	.		Illumina HiSeq	fee6db1a-5aa7-490d-a841-3b5b430ec874	99678528-a049-4ed5-9eb9-d70563f8d53f	g.chrX:24382442_24382453delTAGCTGCTGCTG								AC004552.1 (15419 upstream) : PDK3 (100884 downstream)																							gctcctgctctagctgctgctgctgctcctgc	0.623																																					p.522_525del		Atlas-Indel	.											.	.	.	.	0			c.1564_1575del						.																																			SO:0001628	intergenic_variant	100130302	exon1			.																													X.37:g.24382442_24382453delTAGCTGCTGCTG		87.0	0.0		78.0	18.0	NM_001136234		In_Frame_Del	DEL		37																																																																																				.	.	0	0.623								
