#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
RPS6KA1	6195	hgsc.bcm.edu	37	1	26900660	26900660	+	Silent	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:26900660C>A	ENST00000374168.2	+	22	2330	c.2176C>A	c.(2176-2178)Cga>Aga	p.R726R	RPS6KA1_ENST00000530003.1_Silent_p.R710R|RPS6KA1_ENST00000374166.4_Silent_p.R715R|RPS6KA1_ENST00000374162.2_Silent_p.R634R|RPS6KA1_ENST00000526792.1_Silent_p.R634R|RPS6KA1_ENST00000531382.1_Silent_p.R735R	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	726					axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		GGCCCAGCGGCGAGTGAGGAA	0.627																																					p.R735R		Atlas-SNP	.											.	RPS6KA1	65	.	0			c.C2203A						.						114.0	97.0	103.0					1																	26900660		2203	4300	6503	SO:0001819	synonymous_variant	6195	exon21			CAGCGGCGAGTGA	BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.2176C>A	chr1.hg19:g.26900660C>A		58.0	0.0		44.0	15.0	NM_001006665	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Silent	SNP	ENST00000374168.2	hg19	CCDS284.1																																																																																			.	.		0.627	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011431.1	NM_002953	
STIL	6491	hgsc.bcm.edu	37	1	47746604	47746604	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:47746604G>A	ENST00000360380.3	-	13	1889	c.1526C>T	c.(1525-1527)cCt>cTt	p.P509L	STIL_ENST00000371877.3_Missense_Mutation_p.P509L|STIL_ENST00000396221.2_Missense_Mutation_p.P509L|STIL_ENST00000337817.5_Missense_Mutation_p.P509L|STIL_ENST00000243182.6_Missense_Mutation_p.P509L	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	509					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				CTTATAGGCAGGTGGCTGTCT	0.423																																					p.P509L		Atlas-SNP	.											.	STIL	91	.	0			c.C1526T						.						94.0	90.0	91.0					1																	47746604		2203	4300	6503	SO:0001583	missense	6491	exon12			TAGGCAGGTGGCT	M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1526C>T	chr1.hg19:g.47746604G>A	ENSP00000353544:p.Pro509Leu	123.0	0.0		119.0	50.0	NM_003035	Q5T0C5|Q68CN9	Missense_Mutation	SNP	ENST00000360380.3	hg19	CCDS548.1	.	.	.	.	.	.	.	.	.	.	G	2.344	-0.350347	0.05173	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.44083	2.27;2.27;2.29;2.27;2.27;0.93	4.96	4.04	0.47022	.	0.896444	0.09985	N	0.730472	T	0.25494	0.0620	N	0.08118	0	0.09310	N	0.999999	B;B;B;B;B	0.10296	0.003;0.003;0.003;0.003;0.003	B;B;B;B;B	0.12156	0.004;0.007;0.004;0.007;0.004	T	0.17137	-1.0379	10	0.40728	T	0.16	-6.1906	10.4565	0.44553	0.1691:0.0:0.8309:0.0	.	509;462;509;509;509	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	L	509;509;509;509;509;462	ENSP00000353544:P509L;ENSP00000337367:P509L;ENSP00000360944:P509L;ENSP00000379523:P509L;ENSP00000243182:P509L;ENSP00000411664:P462L	ENSP00000243182:P509L	P	-	2	0	STIL	47519191	0.937000	0.31787	0.318000	0.25279	0.063000	0.16089	3.395000	0.52558	1.318000	0.45170	-0.150000	0.13652	CCT	.	.		0.423	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021649.2	NM_003035	
ITLN1	55600	hgsc.bcm.edu	37	1	160849202	160849202	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:160849202C>T	ENST00000326245.3	-	7	803	c.688G>A	c.(688-690)Gaa>Aaa	p.E230K	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	230	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			GCAGTGAATTCCCCTGAAAAC	0.488																																					p.E230K		Atlas-SNP	.											.	ITLN1	45	.	0			c.G688A						.						91.0	81.0	84.0					1																	160849202		2203	4300	6503	SO:0001583	missense	55600	exon7			TGAATTCCCCTGA	AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.688G>A	chr1.hg19:g.160849202C>T	ENSP00000323587:p.Glu230Lys	82.0	0.0		100.0	32.0	NM_017625	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	ENST00000326245.3	hg19	CCDS1211.1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657680	0.47467	.	.	ENSG00000179914	ENST00000326245	T	0.18810	2.19	3.96	3.96	0.45880	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.172533	0.37304	N	0.002157	T	0.17789	0.0427	M	0.89214	3.015	0.20764	N	0.999853	B	0.17038	0.02	B	0.23150	0.044	T	0.11155	-1.0599	10	0.40728	T	0.16	-17.238	13.5475	0.61713	0.0:1.0:0.0:0.0	.	230	Q8WWA0	ITLN1_HUMAN	K	230	ENSP00000323587:E230K	ENSP00000323587:E230K	E	-	1	0	ITLN1	159115826	0.034000	0.19679	0.044000	0.18714	0.358000	0.29455	0.894000	0.28350	2.016000	0.59253	0.655000	0.94253	GAA	.	.		0.488	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071462.1	NM_017625	
RGS5	8490	hgsc.bcm.edu	37	1	163117258	163117258	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:163117258C>A	ENST00000313961.5	-	5	697	c.420G>T	c.(418-420)atG>atT	p.M140I	RGS5_ENST00000527988.1_Missense_Mutation_p.M32I|RGS5_ENST00000530507.1_Missense_Mutation_p.M144I|RGS5_ENST00000367903.3_Missense_Mutation_p.M160I	NM_001254749.1|NM_003617.3	NP_001241678.1|NP_003608.1	O15539	RGS5_HUMAN	regulator of G-protein signaling 5	140	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(1)|lung(12)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	20			LUSC - Lung squamous cell carcinoma(543;0.187)			CCAGGTTCTTCATTGTGATGT	0.478																																					p.M144I		Atlas-SNP	.											.	RGS5	29	.	0			c.G432T						.						149.0	140.0	143.0					1																	163117258		2203	4300	6503	SO:0001583	missense	8490	exon5			GTTCTTCATTGTG	AF030108	CCDS1244.1, CCDS55652.1, CCDS58041.1	1q23.1	2008-02-05	2007-08-14		ENSG00000143248	ENSG00000143248		"""Regulators of G-protein signaling"""	10001	protein-coding gene	gene with protein product		603276	"""regulator of G-protein signalling 5"""			9747037	Standard	NM_003617		Approved		uc021pdt.1	O15539	OTTHUMG00000034441	ENST00000313961.5:c.420G>T	chr1.hg19:g.163117258C>A	ENSP00000319308:p.Met140Ile	117.0	0.0		152.0	52.0	NM_001254749	E9PMP5|Q53XA9|Q599J0	Missense_Mutation	SNP	ENST00000313961.5	hg19	CCDS1244.1	.	.	.	.	.	.	.	.	.	.	C	12.77	2.039002	0.35989	.	.	ENSG00000143248	ENST00000313961;ENST00000367903;ENST00000530507;ENST00000527988	T;T;T;T	0.01871	4.59;4.59;4.59;4.59	5.76	5.76	0.90799	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.406007	0.31257	N	0.007978	T	0.00906	0.0030	N	0.12569	0.235	0.37266	D	0.907191	B	0.02656	0.0	B	0.01281	0.0	T	0.59118	-0.7514	9	0.40728	T	0.16	.	17.4698	0.87642	0.0:1.0:0.0:0.0	.	140	O15539	RGS5_HUMAN	I	140;160;144;32	ENSP00000319308:M140I;ENSP00000356879:M160I;ENSP00000433001:M144I;ENSP00000432313:M32I	ENSP00000319308:M140I	M	-	3	0	RGS5	161383882	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	2.516000	0.45520	2.713000	0.92767	0.655000	0.94253	ATG	.	.		0.478	RGS5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083264.1	NM_003617	
PBX1	5087	hgsc.bcm.edu	37	1	164769105	164769105	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:164769105G>A	ENST00000420696.2	+	4	868	c.680G>A	c.(679-681)cGt>cAt	p.R227H	PBX1_ENST00000560641.1_Missense_Mutation_p.R122H|PBX1_ENST00000540236.1_Missense_Mutation_p.R227H|PBX1_ENST00000559240.1_Missense_Mutation_p.R227H|PBX1_ENST00000401534.1_Missense_Mutation_p.R227H|PBX1_ENST00000367897.1_Missense_Mutation_p.R227H|PBX1_ENST00000540246.1_Missense_Mutation_p.R122H	NM_001204961.1|NM_001204963.1|NM_002585.3	NP_001191890.1|NP_001191892.1|NP_002576.1	P40424	PBX1_HUMAN	pre-B-cell leukemia homeobox 1	227					adrenal gland development (GO:0030325)|anterior/posterior pattern specification (GO:0009952)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic hemopoiesis (GO:0035162)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system development (GO:0048706)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|organ morphogenesis (GO:0009887)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|proximal/distal pattern formation (GO:0009954)|regulation of ossification (GO:0030278)|sex differentiation (GO:0007548)|spleen development (GO:0048536)|steroid biosynthetic process (GO:0006694)|thymus development (GO:0048538)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)		EWSR1/PBX1(3)	large_intestine(1)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	4						ATGATCCTGCGTTCCCGATTT	0.612			T	"""TCF3, EWSR1"""	"""pre B-ALL, myoepithelioma"""																																p.R227H		Atlas-SNP	.		Dom	yes		1	1q23	5087	pre-B-cell leukemia transcription factor 1		"""L, M"""	.	PBX1	60	.	0			c.G680A						.						117.0	94.0	102.0					1																	164769105		2203	4300	6503	SO:0001583	missense	5087	exon4			TCCTGCGTTCCCG	M86546	CCDS1246.1, CCDS55654.1	1q23.3	2011-06-20	2007-01-30		ENSG00000185630	ENSG00000185630		"""Homeoboxes / TALE class"""	8632	protein-coding gene	gene with protein product		176310	"""pre-B-cell leukemia transcription factor 1"""				Standard	NM_002585		Approved		uc001gct.3	P40424	OTTHUMG00000034307	ENST00000420696.2:c.680G>A	chr1.hg19:g.164769105G>A	ENSP00000405890:p.Arg227His	106.0	0.0		107.0	32.0	NM_001204963	B4DSC1|F5H4U9|Q5T488	Missense_Mutation	SNP	ENST00000420696.2	hg19	CCDS1246.1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849231	0.91277	.	.	ENSG00000185630	ENST00000420696;ENST00000367897;ENST00000540236;ENST00000401534;ENST00000540246	T;T;T;T;T	0.39229	1.09;1.09;1.09;1.09;1.09	5.64	5.64	0.86602	PBX (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	M	0.87758	2.905	.	.	.	B;P;P;P;P	0.52692	0.31;0.726;0.858;0.88;0.955	B;B;B;P;P	0.54706	0.149;0.444;0.316;0.563;0.759	T	0.67245	-0.5719	9	0.87932	D	0	-8.2355	19.3125	0.94195	0.0:0.0:1.0:0.0	.	122;227;227;227;227	B7Z774;A8K5V0;F5H4U9;P40424;Q53YC7	.;.;.;PBX1_HUMAN;.	H	227;227;227;227;122	ENSP00000405890:R227H;ENSP00000356872:R227H;ENSP00000439943:R227H;ENSP00000384856:R227H;ENSP00000440869:R122H	ENSP00000356872:R227H	R	+	2	0	PBX1	163035729	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	9.338000	0.96553	2.653000	0.90120	0.655000	0.94253	CGT	.	.		0.612	PBX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000082864.4	NM_002585	
TPR	7175	hgsc.bcm.edu	37	1	186304629	186304629	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:186304629C>T	ENST00000367478.4	-	34	5048	c.4752G>A	c.(4750-4752)agG>agA	p.R1584R		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1584					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		AGGCTCCATTCCTTTGTTTAA	0.353			T	NTRK1	papillary thyroid																																p.R1584R		Atlas-SNP	.		Dom	yes		1	1q25	7175	translocated promoter region		E	.	TPR	441	.	0			c.G4752A						.						150.0	135.0	140.0					1																	186304629		1853	4098	5951	SO:0001819	synonymous_variant	7175	exon34			TCCATTCCTTTGT	U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.4752G>A	chr1.hg19:g.186304629C>T		94.0	0.0		76.0	9.0	NM_003292	Q15655|Q5SWY0|Q99968	Silent	SNP	ENST00000367478.4	hg19	CCDS41446.1																																																																																			.	.		0.353	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086353.2	NM_003292	
ASPM	259266	hgsc.bcm.edu	37	1	197065148	197065148	+	Silent	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:197065148A>G	ENST00000367409.4	-	19	9223	c.8967T>C	c.(8965-8967)taT>taC	p.Y2989Y	ASPM_ENST00000294732.7_Silent_p.Y1404Y|ASPM_ENST00000367408.1_Silent_p.Y654Y	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2989					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						CTAGTTTGGTATAGAAGCAAC	0.348																																					p.Y2989Y		Atlas-SNP	.											.	ASPM	444	.	0			c.T8967C						.						108.0	117.0	114.0					1																	197065148		2203	4299	6502	SO:0001819	synonymous_variant	259266	exon19			TTTGGTATAGAAG	AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.8967T>C	chr1.hg19:g.197065148A>G		81.0	0.0		108.0	42.0	NM_018136	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	ENST00000367409.4	hg19	CCDS1389.1																																																																																			.	.		0.348	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000088256.1	NM_018136	
NUAK2	81788	hgsc.bcm.edu	37	1	205277742	205277742	+	Silent	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:205277742C>A	ENST00000367157.3	-	3	597	c.471G>T	c.(469-471)cgG>cgT	p.R157R		NM_030952.1	NP_112214.1			NUAK family, SNF1-like kinase, 2											breast(3)|kidney(3)|large_intestine(4)|lung(4)|ovary(3)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	23	Breast(84;0.186)		BRCA - Breast invasive adenocarcinoma(75;0.117)			AGACGATCTGCCGGAAGAAAT	0.572																																					p.R157R		Atlas-SNP	.											.	NUAK2	107	.	0			c.G471T						.						64.0	59.0	61.0					1																	205277742		2203	4300	6503	SO:0001819	synonymous_variant	81788	exon3			GATCTGCCGGAAG	AK074830	CCDS1453.1	1q32.1	2008-02-05			ENSG00000163545	ENSG00000163545			29558	protein-coding gene	gene with protein product	"""SNF1/AMP activated protein kinase"""	608131				11230166	Standard	NM_030952		Approved	SNARK, FLJ90349	uc001hce.3	Q9H093	OTTHUMG00000037196	ENST00000367157.3:c.471G>T	chr1.hg19:g.205277742C>A		92.0	0.0		123.0	53.0	NM_030952		Silent	SNP	ENST00000367157.3	hg19	CCDS1453.1																																																																																			.	.		0.572	NUAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090390.1	NM_030952	
OR14A16	284532	hgsc.bcm.edu	37	1	247978833	247978833	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:247978833A>T	ENST00000357627.1	-	1	198	c.199T>A	c.(199-201)Ttg>Atg	p.L67M		NM_001001966.1	NP_001001966.1	Q8NHC5	O14AG_HUMAN	olfactory receptor, family 14, subfamily A, member 16	67						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(32)|skin(2)|stomach(1)	45						CAGAGATCCAAGAAAGATAGA	0.433																																					p.L67M	Ovarian(112;180 1586 15073 21914 33526)	Atlas-SNP	.											.	OR14A16	90	.	0			c.T199A						.						73.0	74.0	74.0					1																	247978833		2203	4300	6503	SO:0001583	missense	284532	exon1			GATCCAAGAAAGA	BK004366	CCDS31097.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000196772	ENSG00000196772		"""GPCR / Class A : Olfactory receptors"""	15022	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AT, member 1"""	OR5AT1			Standard	NM_001001966		Approved		uc001idm.1	Q8NHC5	OTTHUMG00000040199	ENST00000357627.1:c.199T>A	chr1.hg19:g.247978833A>T	ENSP00000350248:p.Leu67Met	205.0	0.0		287.0	45.0	NM_001001966	Q6IF96	Missense_Mutation	SNP	ENST00000357627.1	hg19	CCDS31097.1	.	.	.	.	.	.	.	.	.	.	A	13.56	2.272788	0.40194	.	.	ENSG00000196772	ENST00000357627	T	0.14391	2.51	3.32	-2.19	0.07015	GPCR, rhodopsin-like superfamily (1);	2.080570	0.02996	U	0.147493	T	0.34424	0.0897	M	0.75777	2.31	0.09310	N	1	D	0.71674	0.998	D	0.68353	0.957	T	0.35699	-0.9778	10	0.87932	D	0	.	6.9312	0.24442	0.4113:0.1391:0.4496:0.0	.	67	Q8NHC5	O14AG_HUMAN	M	67	ENSP00000350248:L67M	ENSP00000350248:L67M	L	-	1	2	OR14A16	246045456	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	-2.580000	0.00907	-0.555000	0.06142	0.481000	0.45027	TTG	.	.		0.433	OR14A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096856.1	NM_001001966	
APOB	338	hgsc.bcm.edu	37	2	21256268	21256268	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:21256268G>A	ENST00000233242.1	-	9	1154	c.1027C>T	c.(1027-1029)Cag>Tag	p.Q343*	APOB_ENST00000399256.4_Nonsense_Mutation_p.Q343*	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	343	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTAGCTCTCTGGATATTTTGC	0.458																																					p.Q343X		Atlas-SNP	.											.	APOB	761	.	0			c.C1027T						.						150.0	144.0	146.0					2																	21256268		2203	4300	6503	SO:0001587	stop_gained	338	exon9			CTCTCTGGATATT	M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1027C>T	chr2.hg19:g.21256268G>A	ENSP00000233242:p.Gln343*	76.0	0.0		62.0	28.0	NM_000384	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Nonsense_Mutation	SNP	ENST00000233242.1	hg19	CCDS1703.1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990275	0.74589	.	.	ENSG00000084674	ENST00000233242;ENST00000535079;ENST00000399256	.	.	.	5.53	3.68	0.42216	.	0.111526	0.40222	N	0.001146	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	.	14.3639	0.66792	0.0:0.0:0.614:0.386	.	.	.	.	X	343	.	ENSP00000233242:Q343X	Q	-	1	0	APOB	21109773	1.000000	0.71417	0.666000	0.29783	0.083000	0.17756	2.443000	0.44881	0.764000	0.33197	0.655000	0.94253	CAG	.	.		0.458	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207571.1		
IMP4	92856	hgsc.bcm.edu	37	2	131103253	131103253	+	Silent	SNP	C	C	T	rs201275845		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:131103253C>T	ENST00000259239.3	+	5	1128	c.420C>T	c.(418-420)caC>caT	p.H140H	IMP4_ENST00000409935.1_Silent_p.H140H	NM_033416.1	NP_219484.1	Q96G21	IMP4_HUMAN	IMP4, U3 small nucleolar ribonucleoprotein	140	Brix. {ECO:0000255|PROSITE- ProRule:PRU00034}.				rRNA processing (GO:0006364)	nucleolus (GO:0005730)|ribonucleoprotein complex (GO:0030529)				central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|skin(1)|urinary_tract(1)	18	Colorectal(110;0.1)					TGGTCGTTCACGAGCATCGGG	0.662																																					p.H140H		Atlas-SNP	.											.	IMP4	35	.	0			c.C420T						.						54.0	56.0	55.0					2																	131103253		2203	4300	6503	SO:0001819	synonymous_variant	92856	exon5			CGTTCACGAGCAT	BC010042	CCDS2160.1	2q21.1	2014-02-19	2014-02-19		ENSG00000136718	ENSG00000136718			30856	protein-coding gene	gene with protein product		612981	"""IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			8619474, 9110174, 12655004	Standard	NM_033416		Approved	MGC19606, BXDC4	uc002tra.1	Q96G21	OTTHUMG00000131627	ENST00000259239.3:c.420C>T	chr2.hg19:g.131103253C>T		66.0	0.0		59.0	25.0	NM_033416	Q3ZTT3	Silent	SNP	ENST00000259239.3	hg19	CCDS2160.1	.	.	.	.	.	.	.	.	.	.	C	1.148	-0.647416	0.03506	.	.	ENSG00000136718	ENST00000452955	.	.	.	5.06	-10.1	0.00402	.	.	.	.	.	T	0.61825	0.2378	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72899	-0.4152	4	.	.	.	-24.2336	16.8772	0.86055	0.0:0.2819:0.0:0.7181	.	.	.	.	M	129	.	.	T	+	2	0	IMP4	130819723	0.002000	0.14202	0.136000	0.22124	0.233000	0.25261	-1.893000	0.01609	-2.171000	0.00775	-0.436000	0.05848	ACG	.	C|0.999;T|0.001		0.662	IMP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254520.2	NM_033416	
FAM168B	130074	hgsc.bcm.edu	37	2	131812878	131812878	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:131812878T>A	ENST00000409185.1	-	5	549	c.442A>T	c.(442-444)Atg>Ttg	p.M148L	FAM168B_ENST00000389915.3_Missense_Mutation_p.M148L	NM_001009993.2	NP_001009993.2	A1KXE4	F168B_HUMAN	family with sequence similarity 168, member B	148						cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(3)|lung(2)	5						CCAGCCACCATGCCCATGGTG	0.632																																					p.M148L		Atlas-SNP	.											.	FAM168B	15	.	0			c.A442T						.						92.0	103.0	99.0					2																	131812878		2077	4197	6274	SO:0001583	missense	130074	exon5			CCACCATGCCCAT		CCDS42755.1	2q21.1	2008-08-08			ENSG00000152102	ENSG00000152102			27016	protein-coding gene	gene with protein product							Standard	NM_001009993		Approved	KIAA0280L	uc002tsd.3	A1KXE4	OTTHUMG00000153473	ENST00000409185.1:c.442A>T	chr2.hg19:g.131812878T>A	ENSP00000387051:p.Met148Leu	103.0	0.0		79.0	37.0	NM_001009993	Q2TAZ6|Q6NZ40	Missense_Mutation	SNP	ENST00000409185.1	hg19	CCDS42755.1	.	.	.	.	.	.	.	.	.	.	T	27.0	4.791850	0.90453	.	.	ENSG00000152102	ENST00000409185;ENST00000389915	.	.	.	5.54	5.54	0.83059	.	0.071529	0.85682	D	0.000000	T	0.61615	0.2361	L	0.32530	0.975	0.80722	D	1	B	0.24533	0.105	P	0.44623	0.455	T	0.54820	-0.8236	9	0.11485	T	0.65	-12.7669	13.9286	0.63978	0.0:0.0:0.0:1.0	.	148	A1KXE4	F168B_HUMAN	L	148	.	ENSP00000374565:M148L	M	-	1	0	FAM168B	131529348	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.812000	0.69194	2.227000	0.72691	0.533000	0.62120	ATG	.	.		0.632	FAM168B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331299.2	NM_001009993	
PKP4	8502	hgsc.bcm.edu	37	2	159481723	159481723	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:159481723G>A	ENST00000389759.3	+	7	1049	c.937G>A	c.(937-939)Ggg>Agg	p.G313R	PKP4_ENST00000389757.3_Missense_Mutation_p.G313R	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	313					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CGCCAGAGTGGGGTCCCCACT	0.632										HNSCC(62;0.18)																											p.G313R		Atlas-SNP	.											.	PKP4	133	.	0			c.G937A						.						47.0	45.0	46.0					2																	159481723		2203	4300	6503	SO:0001583	missense	8502	exon7			AGAGTGGGGTCCC	X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.937G>A	chr2.hg19:g.159481723G>A	ENSP00000374409:p.Gly313Arg	122.0	0.0		110.0	39.0	NM_001005476	Q86W91	Missense_Mutation	SNP	ENST00000389759.3	hg19	CCDS33305.1	.	.	.	.	.	.	.	.	.	.	G	21.8	4.195294	0.78902	.	.	ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759	T;T	0.75704	-0.96;-0.95	5.87	5.87	0.94306	.	0.052726	0.85682	D	0.000000	D	0.83797	0.5332	L	0.54323	1.7	0.80722	D	1	D;D;D;D	0.63880	0.989;0.961;0.969;0.993	D;P;P;D	0.66979	0.913;0.886;0.827;0.948	T	0.80730	-0.1252	10	0.39692	T	0.17	-8.2235	20.5827	0.99408	0.0:0.0:1.0:0.0	.	165;313;313;165	Q6LCG8;Q99569-2;Q99569;F8W7E2	.;.;PKP4_HUMAN;.	R	165;313;313	ENSP00000374407:G313R;ENSP00000374409:G313R	ENSP00000374407:G313R	G	+	1	0	PKP4	159189969	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	5.742000	0.68646	2.941000	0.99782	0.655000	0.94253	GGG	.	.		0.632	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333250.1		
TANC1	85461	hgsc.bcm.edu	37	2	160027239	160027239	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:160027239C>T	ENST00000263635.6	+	10	1511	c.1274C>T	c.(1273-1275)tCc>tTc	p.S425F	TANC1_ENST00000454300.1_Missense_Mutation_p.S319F	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	425					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						GCAATCATTTCCAAGTTGGTG	0.498																																					p.S425F		Atlas-SNP	.											.	TANC1	157	.	0			c.C1274T						.						110.0	123.0	119.0					2																	160027239		1936	4132	6068	SO:0001583	missense	85461	exon10			TCATTTCCAAGTT	AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.1274C>T	chr2.hg19:g.160027239C>T	ENSP00000263635:p.Ser425Phe	234.0	1.0		256.0	127.0	NM_033394	C9JD88|Q49AI8	Missense_Mutation	SNP	ENST00000263635.6	hg19	CCDS42766.1	.	.	.	.	.	.	.	.	.	.	C	26.9	4.785479	0.90282	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.22336	1.96;1.96	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.49762	0.1576	M	0.77103	2.36	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.964	D;D;P	0.87578	0.996;0.998;0.791	T	0.42548	-0.9445	10	0.38643	T	0.18	.	19.2792	0.94046	0.0:1.0:0.0:0.0	.	417;319;425	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	F	319;425	ENSP00000396339:S319F;ENSP00000263635:S425F	ENSP00000263635:S425F	S	+	2	0	TANC1	159735485	1.000000	0.71417	0.997000	0.53966	0.948000	0.59901	4.858000	0.62947	2.632000	0.89209	0.655000	0.94253	TCC	.	.		0.498	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333135.1		
ZAK	51776	hgsc.bcm.edu	37	2	174047653	174047653	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:174047653A>G	ENST00000375213.3	+	4	397	c.319A>G	c.(319-321)Att>Gtt	p.I107V	MLK7-AS1_ENST00000419609.1_RNA|MLTK_ENST00000539448.1_Missense_Mutation_p.I107V|MLTK_ENST00000338983.3_Missense_Mutation_p.I107V|MLTK_ENST00000431503.2_Missense_Mutation_p.I6V|MLTK_ENST00000480606.1_3'UTR|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000409176.2_Missense_Mutation_p.I107V	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		107	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										TATGGATCACATTATGACCTG	0.363																																					p.I107V		Atlas-SNP	.											.	ZAK	62	.	0			c.A319G						.						74.0	76.0	75.0					2																	174047653		2203	4299	6502	SO:0001583	missense	0	exon4			GATCACATTATGA																												ENST00000375213.3:c.319A>G	chr2.hg19:g.174047653A>G	ENSP00000364361:p.Ile107Val	443.0	1.0		439.0	174.0	NM_133646	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Missense_Mutation	SNP	ENST00000375213.3	hg19	CCDS42777.1	.	.	.	.	.	.	.	.	.	.	A	17.48	3.400021	0.62177	.	.	ENSG00000091436	ENST00000539448;ENST00000409176;ENST00000338983;ENST00000431503;ENST00000375213;ENST00000422149	D;D;D;D;D;D	0.89050	-2.46;-2.46;-2.46;-2.46;-2.46;-2.46	5.74	5.74	0.90152	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.044394	0.85682	D	0.000000	D	0.85570	0.5727	L	0.28344	0.845	0.58432	D	0.999999	B;B;P;B;B	0.44776	0.143;0.118;0.843;0.143;0.004	B;B;P;B;B	0.44860	0.191;0.12;0.462;0.191;0.006	D	0.87237	0.2264	10	0.59425	D	0.04	.	16.0343	0.80612	1.0:0.0:0.0:0.0	.	107;107;107;107;107	A8K710;Q9NYL2-2;Q9NYL2;D4Q8H0;Q9NYL2-3	.;.;MLTK_HUMAN;.;.	V	107;107;107;6;107;107	ENSP00000439414:I107V;ENSP00000387259:I107V;ENSP00000340257:I107V;ENSP00000399787:I6V;ENSP00000364361:I107V;ENSP00000411923:I107V	ENSP00000340257:I107V	I	+	1	0	AC013461.1	173755899	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.113000	0.71553	2.198000	0.70561	0.533000	0.62120	ATT	.	.		0.363	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255401.1		
SCRN3	79634	hgsc.bcm.edu	37	2	175292518	175292518	+	Silent	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:175292518A>G	ENST00000272732.6	+	8	1252	c.1170A>G	c.(1168-1170)caA>caG	p.Q390Q	SCRN3_ENST00000409673.3_Silent_p.Q383Q|SCRN3_ENST00000548921.1_3'UTR	NM_001193528.1|NM_024583.4	NP_001180457.1|NP_078859.2	Q0VDG4	SCRN3_HUMAN	secernin 3	390							dipeptidase activity (GO:0016805)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|urinary_tract(3)	13			OV - Ovarian serous cystadenocarcinoma(117;0.229)			CAATCCTTCAAAACAAGCATC	0.299																																					p.Q390Q		Atlas-SNP	.											.	SCRN3	76	.	0			c.A1170G						.						79.0	78.0	78.0					2																	175292518		2202	4295	6497	SO:0001819	synonymous_variant	79634	exon8			CCTTCAAAACAAG	AF279776	CCDS2258.1, CCDS54420.1	2q31	2008-02-05			ENSG00000144306	ENSG00000144306			30382	protein-coding gene	gene with protein product		614967				12221138	Standard	NM_024583		Approved	FLJ23142	uc002uiq.3	Q0VDG4	OTTHUMG00000132332	ENST00000272732.6:c.1170A>G	chr2.hg19:g.175292518A>G		410.0	0.0		451.0	126.0	NM_024583	B4DI11|C9JPC1|D3DPE0|Q7L1C5|Q9H5R5	Silent	SNP	ENST00000272732.6	hg19	CCDS2258.1																																																																																			.	.		0.299	SCRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255451.2	NM_024583	
DNAH7	56171	hgsc.bcm.edu	37	2	196619135	196619135	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:196619135G>T	ENST00000312428.6	-	63	11790	c.11690C>A	c.(11689-11691)aCa>aAa	p.T3897K	DNAH7_ENST00000409063.1_Missense_Mutation_p.T380K	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3897					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						AATAGGAATTGTGTATTTCCT	0.483																																					p.T3897K		Atlas-SNP	.											.	DNAH7	512	.	0			c.C11690A						.						122.0	120.0	121.0					2																	196619135		1915	4123	6038	SO:0001583	missense	56171	exon63			GGAATTGTGTATT	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11690C>A	chr2.hg19:g.196619135G>T	ENSP00000311273:p.Thr3897Lys	153.0	0.0		144.0	43.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	G	1.593	-0.528666	0.04112	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.07114	3.22;3.22	5.55	5.55	0.83447	Dynein heavy chain (1);	0.000000	0.85682	D	0.000000	T	0.05227	0.0139	N	0.05280	-0.08	0.80722	D	1	B	0.21225	0.053	B	0.28011	0.085	T	0.20306	-1.0279	10	0.02654	T	1	.	19.2868	0.94082	0.0:0.0:1.0:0.0	.	3897	Q8WXX0	DYH7_HUMAN	K	3897;380	ENSP00000311273:T3897K;ENSP00000386912:T380K	ENSP00000311273:T3897K	T	-	2	0	DNAH7	196327380	1.000000	0.71417	0.980000	0.43619	0.279000	0.26890	4.191000	0.58372	2.885000	0.99019	0.655000	0.94253	ACA	.	.		0.483	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
NRP2	8828	hgsc.bcm.edu	37	2	206562324	206562324	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:206562324G>A	ENST00000357785.5	+	2	161	c.130G>A	c.(130-132)Ggt>Agt	p.G44S	NRP2_ENST00000357118.4_Missense_Mutation_p.G44S|NRP2_ENST00000540841.1_Missense_Mutation_p.G44S|NRP2_ENST00000412873.2_Missense_Mutation_p.G44S|NRP2_ENST00000355117.4_Missense_Mutation_p.G44S|NRP2_ENST00000540178.1_Missense_Mutation_p.G44S|NRP2_ENST00000417189.1_Missense_Mutation_p.G44S|NRP2_ENST00000272849.3_Missense_Mutation_p.G44S|NRP2_ENST00000360409.3_Missense_Mutation_p.G44S			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						CACCTCTCCCGGTTACCCCCA	0.498																																					p.G44S		Atlas-SNP	.											.	NRP2	179	.	0			c.G130A						.						306.0	293.0	298.0					2																	206562324		2203	4300	6503	SO:0001583	missense	8828	exon2			TCTCCCGGTTACC	AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.130G>A	chr2.hg19:g.206562324G>A	ENSP00000350432:p.Gly44Ser	150.0	0.0		115.0	51.0	NM_201279	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	ENST00000357785.5	hg19	CCDS46496.1	.	.	.	.	.	.	.	.	.	.	G	32	5.128780	0.94473	.	.	ENSG00000118257	ENST00000340626;ENST00000360409;ENST00000540178;ENST00000540841;ENST00000355117;ENST00000450507;ENST00000417189;ENST00000357118;ENST00000357785;ENST00000412873;ENST00000272849	T;T;T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.49;1.23;1.23;1.23;1.23;1.23	5.28	5.28	0.74379	CUB (5);	0.000000	0.85682	D	0.000000	T	0.60077	0.2241	M	0.61703	1.905	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;1.0;1.0	T	0.63042	-0.6725	10	0.87932	D	0	-17.0866	18.9047	0.92455	0.0:0.0:1.0:0.0	.	44;44;44;44;44;44	O60462-2;O60462-3;O60462;O60462-4;O60462-5;E9PF66	.;.;NRP2_HUMAN;.;.;.	S	44	ENSP00000353582:G44S;ENSP00000439658:G44S;ENSP00000439261:G44S;ENSP00000347238:G44S;ENSP00000404279:G44S;ENSP00000387519:G44S;ENSP00000349632:G44S;ENSP00000350432:G44S;ENSP00000407626:G44S;ENSP00000272849:G44S	ENSP00000272849:G44S	G	+	1	0	NRP2	206270569	1.000000	0.71417	0.450000	0.26969	0.995000	0.86356	9.869000	0.99810	2.450000	0.82876	0.655000	0.94253	GGT	.	.		0.498	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000336467.1		
TRIP12	9320	hgsc.bcm.edu	37	2	230656743	230656743	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr2:230656743C>T	ENST00000283943.5	-	28	4207	c.4029G>A	c.(4027-4029)agG>agA	p.R1343R	TRIP12_ENST00000389044.4_Silent_p.R1391R|TRIP12_ENST00000389045.3_Silent_p.R1073R	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1343					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AAAACTGCAGCCTGTGTCTTA	0.393																																					p.R1343R		Atlas-SNP	.											.	TRIP12	207	.	0			c.G4029A						.						128.0	126.0	127.0					2																	230656743		2203	4300	6503	SO:0001819	synonymous_variant	9320	exon28			CTGCAGCCTGTGT	L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.4029G>A	chr2.hg19:g.230656743C>T		250.0	1.0		300.0	133.0	NM_004238	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Silent	SNP	ENST00000283943.5	hg19	CCDS33391.1																																																																																			.	.		0.393	TRIP12-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000331861.3	NM_004238	
EPM2AIP1	9852	hgsc.bcm.edu	37	3	37034022	37034022	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:37034022C>T	ENST00000322716.5	-	1	773	c.547G>A	c.(547-549)Gct>Act	p.A183T	MLH1_ENST00000435176.1_5'Flank|MLH1_ENST00000455445.2_5'Flank|MLH1_ENST00000231790.2_5'Flank|MLH1_ENST00000539477.1_5'Flank|MLH1_ENST00000458205.2_5'Flank|MLH1_ENST00000536378.1_5'Flank	NM_014805.3	NP_055620.1	Q7L775	EPMIP_HUMAN	EPM2A (laforin) interacting protein 1	183					positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of glycogen biosynthetic process (GO:0045725)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(12)|ovary(2)	27						GCCACAAAAGCCTGGTCGTCC	0.498																																					p.A183T		Atlas-SNP	.											.	EPM2AIP1	47	.	0			c.G547A						.						74.0	74.0	74.0					3																	37034022		1935	4130	6065	SO:0001583	missense	9852	exon1			CAAAAGCCTGGTC	AB018309	CCDS46790.1	3p22.1	2003-03-26							19735	protein-coding gene	gene with protein product		607911					Standard	NM_014805		Approved	KIAA0766, FLJ11207	uc003cgk.3	Q7L775		ENST00000322716.5:c.547G>A	chr3.hg19:g.37034022C>T	ENSP00000406027:p.Ala183Thr	93.0	0.0		61.0	11.0	NM_014805	O94866|Q9H3L3	Missense_Mutation	SNP	ENST00000322716.5	hg19	CCDS46790.1	.	.	.	.	.	.	.	.	.	.	C	11.28	1.590723	0.28357	.	.	ENSG00000178567	ENST00000322716	T	0.08807	3.05	5.26	4.34	0.51931	.	.	.	.	.	T	0.05547	0.0146	N	0.25647	0.755	0.29997	N	0.816353	B	0.24576	0.106	B	0.20955	0.032	T	0.15896	-1.0421	9	0.02654	T	1	-4.7113	11.8748	0.52541	0.0:0.8252:0.1748:0.0	.	183	Q7L775	EPMIP_HUMAN	T	183	ENSP00000406027:A183T	ENSP00000406027:A183T	A	-	1	0	EPM2AIP1	37009026	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.049000	0.41288	2.731000	0.93534	0.557000	0.71058	GCT	.	.		0.498	EPM2AIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000470593.1	NM_014805	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266098	41266098	+	Missense_Mutation	SNP	A	A	G	rs121913396|rs121913416		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:41266098A>G	ENST00000349496.5	+	3	375	c.95A>G	c.(94-96)gAc>gGc	p.D32G	CTNNB1_ENST00000396185.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000396183.3_Missense_Mutation_p.D32G|CTNNB1_ENST00000453024.1_Missense_Mutation_p.D25G|CTNNB1_ENST00000405570.1_Missense_Mutation_p.D32G	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	32			D -> A (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.|D -> G (in PTR and hepatocellular carcinoma). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629}.|D -> Y (in PTR, hepatoblastoma and hepatocellular carcinoma; dbSNP:rs28931588). {ECO:0000269|PubMed:10192393, ECO:0000269|PubMed:10435629, ECO:0000269|PubMed:11703283, ECO:0000269|PubMed:9927029}.|Missing (in hepatocellular carcinoma). {ECO:0000269|PubMed:10435629}.		adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.D32G(65)|p.A5_A80del(53)|p.D32V(33)|p.D32A(16)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.WQQQSYLD25?(5)|p.W25_D32del(4)|p.?(4)|p.V22_G38del(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.S23_S33del(2)|p.V22_S33del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.Y30_S33del(2)|p.A5_Q143>E(1)|p.A13_R151del(1)|p.S29_H36del(1)|p.D32del(1)|p.M14_S45del(1)|p.Q28_D32>H(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.H24_G38del(1)|p.S23_I35del(1)|p.Y30_A97del(1)|p.W25_S33del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.D32fs*9(1)|p.A20_I35del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.Y30_A80del(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.W25_I35del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.A5_I35del(1)|p.D32_H36del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTTACCTGGACTCTGGAATC	0.483	D32V(HEC265_ENDOMETRIUM)|D32V(HEC6_ENDOMETRIUM)	15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.D32G	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,gallbladder,other,+1,128	CTNNB1	4904	.	260	Deletion - In frame(120)|Substitution - Missense(114)|Complex - deletion inframe(16)|Unknown(7)|Deletion - Frameshift(3)	liver(154)|large_intestine(24)|pancreas(19)|central_nervous_system(16)|stomach(14)|endometrium(7)|skin(7)|ovary(4)|prostate(3)|pituitary(3)|small_intestine(2)|NS(2)|adrenal_gland(1)|soft_tissue(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|urinary_tract(1)	c.A95G						.						92.0	77.0	82.0					3																	41266098		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACCTGGACTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.95A>G	chr3.hg19:g.41266098A>G	ENSP00000344456:p.Asp32Gly	165.0	1.0		138.0	35.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308122	0.81247	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.50001	0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76;0.76	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.69788	0.3150	M	0.79614	2.46	0.80722	D	1	D	0.89917	1.0	D	0.74674	0.984	T	0.74137	-0.3762	10	0.87932	D	0	0.3843	16.0676	0.80897	1.0:0.0:0.0:0.0	.	32	P35222	CTNB1_HUMAN	G	25;32;32;32;32;25;32;32;32	ENSP00000400508:D25G;ENSP00000385604:D32G;ENSP00000412219:D32G;ENSP00000379486:D32G;ENSP00000344456:D32G;ENSP00000411226:D25G;ENSP00000379488:D32G;ENSP00000409302:D32G;ENSP00000401599:D32G	ENSP00000344456:D32G	D	+	2	0	CTNNB1	41241102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	GAC	.	.		0.483	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TRAK1	22906	hgsc.bcm.edu	37	3	42265035	42265035	+	Missense_Mutation	SNP	G	G	T	rs546729861		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:42265035G>T	ENST00000327628.5	+	16	3068	c.2668G>T	c.(2668-2670)Gta>Tta	p.V890L	TRAK1_ENST00000487159.1_3'UTR|TRAK1_ENST00000396175.1_Missense_Mutation_p.V832L|RNU4-78P_ENST00000410940.1_RNA	NM_001042646.2	NP_001036111.1	Q9UPV9	TRAK1_HUMAN	trafficking protein, kinesin binding 1	890					endosome to lysosome transport (GO:0008333)|protein O-linked glycosylation (GO:0006493)|protein targeting (GO:0006605)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	22						CAGAGGCCTGGTACCTGAGGG	0.662																																					p.V890L	GBM(44;195 884 22595 31865 41850)	Atlas-SNP	.											.	TRAK1	188	.	0			c.G2668T						.						31.0	34.0	33.0					3																	42265035		1967	4137	6104	SO:0001583	missense	22906	exon16			GGCCTGGTACCTG		CCDS2695.1, CCDS43072.1, CCDS58826.1, CCDS74922.1	3p22.1	2012-03-05			ENSG00000182606	ENSG00000182606			29947	protein-coding gene	gene with protein product	"""OGT(O Glc NAc transferase) interacting protein 106 KDa"", ""O-linked N-acetylglucosamine transferase interacting protein 106"", ""milton homolog 1 (Drosophila)"""	608112				10470851, 12435728, 16380713, 20230862	Standard	NM_014965		Approved	OIP106, KIAA1042, MILT1	uc003cky.4	Q9UPV9	OTTHUMG00000131795	ENST00000327628.5:c.2668G>T	chr3.hg19:g.42265035G>T	ENSP00000328998:p.Val890Leu	87.0	0.0		64.0	34.0	NM_001042646	E9PDS2|J3KNT7|Q63HR0|Q659B5|Q96B69	Missense_Mutation	SNP	ENST00000327628.5	hg19	CCDS43072.1	.	.	.	.	.	.	.	.	.	.	G	14.83	2.651623	0.47362	.	.	ENSG00000182606	ENST00000327628;ENST00000396175	T;T	0.08370	3.11;3.1	4.74	4.74	0.60224	.	0.445672	0.20342	N	0.094201	T	0.06325	0.0163	N	0.14661	0.345	0.80722	D	1	B;B	0.17038	0.02;0.02	B;B	0.17433	0.018;0.011	T	0.42103	-0.9471	10	0.18276	T	0.48	.	16.882	0.86065	0.0:0.0:1.0:0.0	.	832;890	C9JC32;Q9UPV9	.;TRAK1_HUMAN	L	890;832	ENSP00000328998:V890L;ENSP00000379478:V832L	ENSP00000328998:V890L	V	+	1	0	TRAK1	42240039	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	3.904000	0.56325	2.482000	0.83794	0.591000	0.81541	GTA	.	.		0.662	TRAK1-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343413.1	NM_014965	
FAM19A1	407738	hgsc.bcm.edu	37	3	68466449	68466449	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:68466449G>A	ENST00000478136.1	+	3	628	c.138G>A	c.(136-138)gtG>gtA	p.V46V	FAM19A1_ENST00000491017.1_3'UTR|FAM19A1_ENST00000496687.1_Silent_p.V46V	NM_213609.3	NP_998774.2	Q7Z5A9	F19A1_HUMAN	family with sequence similarity 19 (chemokine (C-C motif)-like), member A1	46						endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(1)|kidney(1)|lung(3)|ovary(1)	7		Lung NSC(201;0.0117)		BRCA - Breast invasive adenocarcinoma(55;7.7e-05)|Epithelial(33;0.000937)|KIRC - Kidney renal clear cell carcinoma(39;0.0579)|Kidney(39;0.0743)		CGTGTGAAGTGATAGCAGCAC	0.483																																					p.V46V		Atlas-SNP	.											.	FAM19A1	58	.	0			c.G138A						.						106.0	103.0	104.0					3																	68466449		1965	4145	6110	SO:0001819	synonymous_variant	407738	exon3			TGAAGTGATAGCA	AY325114	CCDS54606.1	3p14.1	2005-01-20			ENSG00000183662	ENSG00000183662			21587	protein-coding gene	gene with protein product						15028294	Standard	NM_213609		Approved	TAFA-1	uc003dnd.3	Q7Z5A9	OTTHUMG00000158745	ENST00000478136.1:c.138G>A	chr3.hg19:g.68466449G>A		126.0	0.0		108.0	13.0	NM_213609	A8K0V3|Q8TCL8	Silent	SNP	ENST00000478136.1	hg19	CCDS54606.1																																																																																			.	.		0.483	FAM19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352004.1	NM_213609	
ROBO2	6092	hgsc.bcm.edu	37	3	77671422	77671422	+	Missense_Mutation	SNP	C	C	A	rs376068100		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:77671422C>A	ENST00000461745.1	+	23	4499	c.3599C>A	c.(3598-3600)cCg>cAg	p.P1200Q	ROBO2_ENST00000332191.8_Missense_Mutation_p.P1200Q|ROBO2_ENST00000487694.3_Missense_Mutation_p.P1216Q	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	1200					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		CCAGTTCCACCGTTAGGTTAT	0.408																																					p.P1200Q		Atlas-SNP	.											ROBO2_ENST00000487694,colon,carcinoma,0,4	ROBO2	527	.	0			c.C3599A						.						107.0	107.0	107.0					3																	77671422		1893	4118	6011	SO:0001583	missense	6092	exon23			TTCCACCGTTAGG	AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.3599C>A	chr3.hg19:g.77671422C>A	ENSP00000417164:p.Pro1200Gln	124.0	1.0		149.0	77.0	NM_002942	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	ENST00000461745.1	hg19	CCDS43109.1	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864022	0.32884	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000461745;ENST00000332191	T;T;T	0.72725	-0.68;-0.63;-0.47	5.56	5.56	0.83823	.	0.000000	0.45606	D	0.000343	T	0.81446	0.4824	L	0.48642	1.525	0.30094	N	0.8080229999999999	P;D;P	0.89917	0.933;1.0;0.933	B;D;B	0.91635	0.397;0.999;0.397	T	0.82554	-0.0399	9	0.87932	D	0	.	19.5083	0.95130	0.0:1.0:0.0:0.0	.	1216;1200;1200	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	Q	1216;1216;1200;1200	ENSP00000417335:P1216Q;ENSP00000417164:P1200Q;ENSP00000327536:P1200Q	ENSP00000327536:P1200Q	P	+	2	0	ROBO2	77754112	1.000000	0.71417	0.999000	0.59377	0.202000	0.24057	7.487000	0.81328	2.611000	0.88343	0.650000	0.86243	CCG	.	.		0.408	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000352600.2	XM_031246	
SLCO2A1	6578	hgsc.bcm.edu	37	3	133674014	133674014	+	Missense_Mutation	SNP	C	C	T	rs148547180		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:133674014C>T	ENST00000310926.4	-	4	694	c.421G>A	c.(421-423)Gag>Aag	p.E141K	SLCO2A1_ENST00000493729.1_Intron|SLCO2A1_ENST00000478651.1_5'Flank	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	141					lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	TGGCAGAGCTCGGCCTGCAAG	0.627																																					p.E141K		Atlas-SNP	.											SLCO2A1,NS,carcinoma,0,1	SLCO2A1	72	.	0			c.G421A						.	C	LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	48.0	48.0	48.0		421	4.3	0.6	3	dbSNP_134	48	0,8600		0,0,4300	no	missense	SLCO2A1	NM_005630.2	56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	141/644	133674014	1,13005	2203	4300	6503	SO:0001583	missense	6578	exon4			AGAGCTCGGCCTG		CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.421G>A	chr3.hg19:g.133674014C>T	ENSP00000311291:p.Glu141Lys	76.0	0.0		80.0	25.0	NM_005630	Q86V98|Q8IUN2	Missense_Mutation	SNP	ENST00000310926.4	hg19	CCDS3084.1	.	.	.	.	.	.	.	.	.	.	C	7.457	0.643906	0.14451	2.27E-4	0.0	ENSG00000174640	ENST00000310926	T	0.38240	1.15	5.18	4.31	0.51392	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.941565	0.08803	N	0.891450	T	0.24198	0.0586	N	0.20807	0.61	0.80722	D	1	B	0.18166	0.026	B	0.14578	0.011	T	0.07065	-1.0792	10	0.35671	T	0.21	.	6.9043	0.24301	0.0:0.703:0.1443:0.1527	.	141	Q92959	SO2A1_HUMAN	K	141	ENSP00000311291:E141K	ENSP00000311291:E141K	E	-	1	0	SLCO2A1	135156704	0.062000	0.20869	0.620000	0.29132	0.078000	0.17371	0.942000	0.29017	1.324000	0.45282	0.462000	0.41574	GAG	.	C|1.000;T|0.000		0.627	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357131.1	NM_005630	
MUC4	4585	hgsc.bcm.edu	37	3	195507945	195507946	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:195507945_195507946GG>TT	ENST00000463781.3	-	2	10964_10965	c.10505_10506CC>AA	c.(10504-10506)aCC>aAA	p.T3502K	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.T3502K|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GAAGAGTGCTGGTGTCACCTGT	0.604																																					p.T3502T|p.T3502N		Atlas-SNP	.											.	MUC4	1505	.	0			c.C10506A|c.C10505A						.																																			SO:0001583	missense	4585	exon2			AGTGCTGGTGTCA|GTGCTGGTGTCAC	AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.10505_10506delinsTT	chr3.hg19:g.195507945_195507946delinsTT	ENSP00000417498:p.Thr3502Lys	244.0|243.0	0.0		216.0|213.0	38.0|36.0	NM_018406	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent|Missense_Mutation	SNP	ENST00000463781.3	hg19	CCDS54700.1																																																																																			.	.		0.604	MUC4-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000324081.6	NM_018406	
STK32B	55351	hgsc.bcm.edu	37	4	5461929	5461929	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr4:5461929G>A	ENST00000282908.5	+	9	1305	c.883G>A	c.(883-885)Gca>Aca	p.A295T	STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000510398.1_Missense_Mutation_p.A248T|RN7SKP275_ENST00000364626.1_RNA|STK32B_ENST00000512636.1_Missense_Mutation_p.A218T	NM_018401.1	NP_060871.1			serine/threonine kinase 32B									p.A295T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						GTTCAAGAAGGCACTGATGCC	0.587											OREG0016061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.A295T		Atlas-SNP	.											STK32B,colon,carcinoma,0,1	STK32B	87	.	1	Substitution - Missense(1)	large_intestine(1)	c.G883A						.						157.0	129.0	138.0					4																	5461929		2203	4300	6503	SO:0001583	missense	55351	exon9			AAGAAGGCACTGA	AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.883G>A	chr4.hg19:g.5461929G>A	ENSP00000282908:p.Ala295Thr	99.0	0.0	626	67.0	21.0	NM_018401		Missense_Mutation	SNP	ENST00000282908.5	hg19	CCDS3380.1	.	.	.	.	.	.	.	.	.	.	G	7.326	0.618000	0.14129	.	.	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.24538	1.85;1.85;1.85	4.51	2.77	0.32553	Protein kinase-like domain (1);	0.161832	0.28354	N	0.015656	T	0.14657	0.0354	L	0.27053	0.805	0.24748	N	0.992998	B	0.18610	0.029	B	0.14023	0.01	T	0.17806	-1.0357	10	0.33141	T	0.24	.	5.1475	0.14993	0.1781:0.0:0.6589:0.163	.	295	Q9NY57	ST32B_HUMAN	T	295;218;248	ENSP00000282908:A295T;ENSP00000423209:A218T;ENSP00000420984:A248T	ENSP00000282908:A295T	A	+	1	0	STK32B	5512830	0.625000	0.27111	0.199000	0.23439	0.088000	0.18126	0.251000	0.18257	0.453000	0.26858	-0.309000	0.09137	GCA	.	.		0.587	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206854.4	NM_018401	
ANK2	287	hgsc.bcm.edu	37	4	114208800	114208800	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr4:114208800A>C	ENST00000357077.4	+	19	2172	c.2119A>C	c.(2119-2121)Aaa>Caa	p.K707Q	ANK2_ENST00000264366.6_Missense_Mutation_p.K707Q|ANK2_ENST00000394537.3_Missense_Mutation_p.K707Q|ANK2_ENST00000506722.1_Missense_Mutation_p.K686Q	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	707					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CCAGGAAGATAAAGTGAATGT	0.418																																					p.K707Q		Atlas-SNP	.											.	ANK2	576	.	0			c.A2119C						.						130.0	112.0	118.0					4																	114208800		2203	4300	6503	SO:0001583	missense	287	exon19			GAAGATAAAGTGA	M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.2119A>C	chr4.hg19:g.114208800A>C	ENSP00000349588:p.Lys707Gln	81.0	0.0		41.0	16.0	NM_001148	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	ENST00000357077.4	hg19	CCDS3702.1	.	.	.	.	.	.	.	.	.	.	A	13.69	2.311235	0.40895	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;T;T;T;T;T;T	0.64438	-0.06;-0.06;-0.06;-0.06;-0.1;-0.06;-0.06	5.49	4.29	0.51040	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000036	T	0.63224	0.2493	N	0.14661	0.345	0.80722	D	1	D;D;D;D;P	0.76494	0.999;0.998;0.998;0.975;0.734	D;D;D;P;P	0.76575	0.988;0.925;0.969;0.757;0.562	T	0.65026	-0.6268	10	0.46703	T	0.11	.	12.6506	0.56759	0.8617:0.1383:0.0:0.0	.	707;707;707;686;686	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	Q	686;653;686;722;707;707;707;686	ENSP00000423799:K686Q;ENSP00000421011:K653Q;ENSP00000421067:K686Q;ENSP00000424722:K722Q;ENSP00000378044:K707Q;ENSP00000349588:K707Q;ENSP00000264366:K707Q	ENSP00000264366:K707Q	K	+	1	0	ANK2	114428249	1.000000	0.71417	1.000000	0.80357	0.010000	0.07245	6.048000	0.71046	0.880000	0.35969	-0.323000	0.08544	AAA	.	.		0.418	ANK2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000256422.2	NM_001148	
FBXL7	23194	hgsc.bcm.edu	37	5	15928473	15928473	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr5:15928473A>T	ENST00000504595.1	+	3	1083	c.602A>T	c.(601-603)gAc>gTc	p.D201V	FBXL7_ENST00000510662.1_Missense_Mutation_p.D154V|FBXL7_ENST00000329673.7_Missense_Mutation_p.D189V	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	201					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						CGGCTCACAGACCGAGGGCTG	0.602																																					p.D201V		Atlas-SNP	.											.	FBXL7	138	.	0			c.A602T						.						40.0	45.0	43.0					5																	15928473		2084	4208	6292	SO:0001583	missense	23194	exon3			TCACAGACCGAGG	AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.602A>T	chr5.hg19:g.15928473A>T	ENSP00000423630:p.Asp201Val	113.0	0.0		144.0	67.0	NM_012304	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	ENST00000504595.1	hg19	CCDS54833.1	.	.	.	.	.	.	.	.	.	.	A	20.1	3.935533	0.73442	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.46819	0.86;0.86;0.86	5.36	4.19	0.49359	.	0.000000	0.85682	D	0.000000	T	0.74504	0.3725	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.79403	-0.1818	10	0.72032	D	0.01	.	10.9576	0.47366	0.9261:0.0:0.0739:0.0	.	201	Q9UJT9	FBXL7_HUMAN	V	201;154;189	ENSP00000423630:D201V;ENSP00000425184:D154V;ENSP00000329632:D189V	ENSP00000329632:D189V	D	+	2	0	FBXL7	15981473	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	9.300000	0.96151	0.875000	0.35847	0.459000	0.35465	GAC	.	.		0.602	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000366117.1	NM_012304	
RNF180	285671	hgsc.bcm.edu	37	5	63510007	63510007	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr5:63510007G>T	ENST00000389100.4	+	4	926	c.854G>T	c.(853-855)aGt>aTt	p.S285I	RNF180_ENST00000296615.6_Missense_Mutation_p.S285I|RNF180_ENST00000381081.2_Intron	NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	285	Interaction with ZIC2. {ECO:0000250}.				adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		AATCCATCCAGTTTTGATCCT	0.428																																					p.S285I		Atlas-SNP	.											.	RNF180	94	.	0			c.G854T						.						85.0	92.0	90.0					5																	63510007		2203	4300	6503	SO:0001583	missense	285671	exon4			CATCCAGTTTTGA	AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.854G>T	chr5.hg19:g.63510007G>T	ENSP00000373752:p.Ser285Ile	108.0	0.0		102.0	22.0	NM_001113561	Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	ENST00000389100.4	hg19	CCDS47219.1	.	.	.	.	.	.	.	.	.	.	G	14.10	2.433355	0.43224	.	.	ENSG00000164197	ENST00000296615;ENST00000389100	T	0.54479	0.57	5.98	3.15	0.36227	.	0.547089	0.20944	N	0.082871	T	0.44286	0.1286	L	0.51422	1.61	0.80722	D	1	P;P	0.45474	0.8;0.859	B;B	0.40444	0.293;0.329	T	0.42344	-0.9457	10	0.87932	D	0	-4.8301	7.7947	0.29140	0.1451:0.2482:0.6067:0.0	.	285;285	Q86T96;Q86T96-2	RN180_HUMAN;.	I	285	ENSP00000373752:S285I	ENSP00000296615:S285I	S	+	2	0	RNF180	63545763	0.997000	0.39634	0.995000	0.50966	0.990000	0.78478	0.880000	0.28159	0.802000	0.34089	-0.165000	0.13383	AGT	.	.		0.428	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368394.1	NM_178532	
MAST4	375449	hgsc.bcm.edu	37	5	66398386	66398386	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr5:66398386T>A	ENST00000403625.2	+	9	1388	c.1093T>A	c.(1093-1095)Tgt>Agt	p.C365S	MAST4_ENST00000490016.2_Missense_Mutation_p.C176S|MAST4_ENST00000261569.7_Missense_Mutation_p.C171S|MAST4_ENST00000404260.3_Missense_Mutation_p.C368S|MAST4_ENST00000403666.1_Missense_Mutation_p.C176S|MAST4_ENST00000405643.1_Missense_Mutation_p.C186S	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	368						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCCCGCCTGCTGTGACCATGA	0.393																																					p.C365S		Atlas-SNP	.											.	MAST4	218	.	0			c.T1093A						.						131.0	126.0	127.0					5																	66398386		1874	4112	5986	SO:0001583	missense	375449	exon9			GCCTGCTGTGACC	AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.1093T>A	chr5.hg19:g.66398386T>A	ENSP00000385727:p.Cys365Ser	233.0	0.0		186.0	42.0	NM_001164664	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	ENST00000403625.2	hg19	CCDS54861.1	.	.	.	.	.	.	.	.	.	.	T	19.11	3.763654	0.69878	.	.	ENSG00000069020	ENST00000404260;ENST00000403625;ENST00000490016;ENST00000403666;ENST00000405643;ENST00000380908;ENST00000261569;ENST00000432399	T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62	5.4	5.4	0.78164	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.172789	0.39083	U	0.001462	T	0.21427	0.0516	N	0.12182	0.205	0.38245	D	0.941436	P;B;B;B;B	0.37688	0.605;0.392;0.34;0.057;0.066	B;B;B;B;B	0.39379	0.298;0.262;0.237;0.113;0.071	T	0.14924	-1.0455	10	0.30854	T	0.27	-8.0332	15.4348	0.75137	0.0:0.0:0.0:1.0	.	186;368;171;176;176	E7EWQ5;O15021;O15021-2;O15021-3;D6RAK1	.;MAST4_HUMAN;.;.;.	S	368;365;176;176;186;186;171;171	ENSP00000385048:C368S;ENSP00000385727:C365S;ENSP00000421739:C176S;ENSP00000384313:C176S;ENSP00000384099:C186S;ENSP00000261569:C171S	ENSP00000261569:C171S	C	+	1	0	MAST4	66434142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.048000	0.60808	0.533000	0.62120	TGT	.	.		0.393	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000326324.2		
C5orf47	133491	hgsc.bcm.edu	37	5	173416302	173416302	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr5:173416302G>A	ENST00000340147.6	+	1	141	c.36G>A	c.(34-36)tcG>tcA	p.S12S	C5orf47_ENST00000522195.1_Intron	NM_001144954.1	NP_001138426.1	Q569G3	CE047_HUMAN	chromosome 5 open reading frame 47	12										kidney(1)|prostate(1)	2						AGCAGGACTCGGCGCGCTTCG	0.697																																					p.S12S		Atlas-SNP	.											.	C5orf47	14	.	0			c.G36A						.						19.0	34.0	29.0					5																	173416302		692	1590	2282	SO:0001819	synonymous_variant	133491	exon1			GGACTCGGCGCGC		CCDS47343.1	5q35.2	2012-02-24			ENSG00000185056	ENSG00000185056			27026	protein-coding gene	gene with protein product						12477932	Standard	NM_001144954		Approved	LOC133491	uc003mcw.4	Q569G3	OTTHUMG00000163349	ENST00000340147.6:c.36G>A	chr5.hg19:g.173416302G>A		111.0	0.0		93.0	22.0	NM_001144954	Q8IYU7	Silent	SNP	ENST00000340147.6	hg19	CCDS47343.1																																																																																			.	.		0.697	C5orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000372926.1	NM_001144954	
CD83	9308	hgsc.bcm.edu	37	6	14118268	14118268	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr6:14118268A>T	ENST00000379153.3	+	2	296	c.125A>T	c.(124-126)cAg>cTg	p.Q42L		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	42	Ig-like V-type.				defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				TGGGATCCGCAGGTTCCCTAC	0.617																																					p.Q42L		Atlas-SNP	.											.	CD83	23	.	0			c.A125T						.						27.0	28.0	28.0					6																	14118268		2203	4300	6503	SO:0001583	missense	9308	exon2			ATCCGCAGGTTCC	Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.125A>T	chr6.hg19:g.14118268A>T	ENSP00000368450:p.Gln42Leu	51.0	0.0		68.0	25.0	NM_004233	Q5THX9	Missense_Mutation	SNP	ENST00000379153.3	hg19	CCDS4532.1	.	.	.	.	.	.	.	.	.	.	A	9.875	1.199915	0.22121	.	.	ENSG00000112149	ENST00000379153	T	0.64991	-0.13	4.56	-6.73	0.01749	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.543413	0.18136	N	0.150580	T	0.18467	0.0443	L	0.35854	1.095	0.09310	N	1	B	0.12013	0.005	B	0.17433	0.018	T	0.20207	-1.0282	10	0.22109	T	0.4	-2.8511	5.2775	0.15657	0.2678:0.0:0.4507:0.2815	.	42	Q01151	CD83_HUMAN	L	42	ENSP00000368450:Q42L	ENSP00000368450:Q42L	Q	+	2	0	CD83	14226247	0.000000	0.05858	0.009000	0.14445	0.256000	0.26092	-0.644000	0.05415	-1.439000	0.01962	-0.669000	0.03829	CAG	.	.		0.617	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000039916.1		
ZBTB12	221527	hgsc.bcm.edu	37	6	31868141	31868141	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr6:31868141C>T	ENST00000375527.2	-	2	1117	c.942G>A	c.(940-942)ggG>ggA	p.G314G	EHMT2_ENST00000375537.4_5'Flank|C2_ENST00000469372.1_Intron|C2_ENST00000452323.2_5'Flank|EHMT2_ENST00000375530.4_5'Flank	NM_181842.2	NP_862825.1	Q9Y330	ZBT12_HUMAN	zinc finger and BTB domain containing 12	314	Gly-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(5)|prostate(1)|skin(1)	10						cccggctgccccccgccccca	0.716																																					p.G314G		Atlas-SNP	.											.	ZBTB12	25	.	0			c.G942A						.						4.0	5.0	5.0					6																	31868141		1919	3769	5688	SO:0001819	synonymous_variant	221527	exon2			GCTGCCCCCCGCC	BC043609	CCDS4727.1	6p21.31	2013-01-08	2004-04-15	2004-04-16	ENSG00000204366	ENSG00000204366		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	19066	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 46"""	C6orf46		9545376	Standard	NM_181842		Approved	G10, NG35, D6S59E	uc003nyd.1	Q9Y330	OTTHUMG00000031169	ENST00000375527.2:c.942G>A	chr6.hg19:g.31868141C>T		33.0	0.0		43.0	9.0	NM_181842	B0UY00|Q5JQ98	Silent	SNP	ENST00000375527.2	hg19	CCDS4727.1																																																																																			.	.		0.716	ZBTB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076315.2	NM_181842	
GRM4	2914	hgsc.bcm.edu	37	6	34004308	34004308	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr6:34004308C>G	ENST00000538487.2	-	9	2022	c.1579G>C	c.(1579-1581)Ggt>Cgt	p.G527R	GRM4_ENST00000535756.1_Missense_Mutation_p.G394R|GRM4_ENST00000455714.2_Missense_Mutation_p.G387R|GRM4_ENST00000374181.4_Missense_Mutation_p.G527R|GRM4_ENST00000609222.1_Missense_Mutation_p.G394R|GRM4_ENST00000545715.1_5'UTR|GRM4_ENST00000374177.3_Missense_Mutation_p.G411R|GRM4_ENST00000544773.2_Missense_Mutation_p.G358R	NM_000841.2|NM_001256811.1	NP_000832.1|NP_001243740.1	Q14833	GRM4_HUMAN	glutamate receptor, metabotropic 4	527					activation of MAPK activity (GO:0000187)|adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|learning (GO:0007612)|neurotransmitter secretion (GO:0007269)|positive regulation of MAPK cascade (GO:0043410)|regulation of neuron apoptotic process (GO:0043523)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic active zone membrane (GO:0048787)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(9)|liver(1)|lung(19)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48						TTCCGCTCACCCGGTTGGCAG	0.632																																					p.G527R		Atlas-SNP	.											.	GRM4	317	.	0			c.G1579C						.						56.0	47.0	50.0					6																	34004308		2203	4300	6503	SO:0001583	missense	2914	exon9			GCTCACCCGGTTG	U92457	CCDS4787.1, CCDS59010.1, CCDS59011.1, CCDS59012.1, CCDS75432.1	6p21.3	2012-08-29			ENSG00000124493	ENSG00000124493		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4596	protein-coding gene	gene with protein product		604100				8738157, 9473604	Standard	NM_000841		Approved	GPRC1D, mGlu4, MGLUR4	uc010jvh.4	Q14833	OTTHUMG00000014538	ENST00000538487.2:c.1579G>C	chr6.hg19:g.34004308C>G	ENSP00000440556:p.Gly527Arg	61.0	0.0		71.0	17.0	NM_000841	B3KVL9|B7Z1T9|B7Z1U6|F5GXM5|Q5SZ84|Q6ZMQ2	Missense_Mutation	SNP	ENST00000538487.2	hg19	CCDS4787.1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536246	0.64972	.	.	ENSG00000124493	ENST00000374181;ENST00000374177;ENST00000545715;ENST00000535756;ENST00000544773;ENST00000538487;ENST00000455714	D;D;D;D;D;D;D	0.95137	-3.62;-3.62;-3.62;-3.62;-3.62;-3.62;-3.62	4.79	4.79	0.61399	GPCR, family 3, nine cysteines domain (1);	0.000000	0.85682	D	0.000000	D	0.98277	0.9429	H	0.96943	3.91	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;0.999	D;D;D;D;D	0.97110	0.996;0.993;1.0;1.0;0.973	D	0.99624	1.0984	10	0.87932	D	0	.	17.6327	0.88113	0.0:1.0:0.0:0.0	.	480;358;387;527;394	B7ZLU9;B7Z1T9;F5GXM5;Q14833;B3KVL9	.;.;.;GRM4_HUMAN;.	R	527;411;219;394;358;527;387	ENSP00000363296:G527R;ENSP00000363292:G411R;ENSP00000445533:G219R;ENSP00000437925:G394R;ENSP00000437730:G358R;ENSP00000440556:G527R;ENSP00000398456:G387R	ENSP00000363292:G411R	G	-	1	0	GRM4	34112286	1.000000	0.71417	0.438000	0.26821	0.473000	0.32948	7.644000	0.83416	2.481000	0.83766	0.551000	0.68910	GGT	.	.		0.632	GRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040213.2		
TRERF1	55809	hgsc.bcm.edu	37	6	42196221	42196221	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr6:42196221G>A	ENST00000372922.4	-	18	4027	c.3465C>T	c.(3463-3465)ccC>ccT	p.P1155P	TRERF1_ENST00000541110.1_Silent_p.P1175P|TRERF1_ENST00000340840.2_Silent_p.P1084P|TRERF1_ENST00000372917.4_Silent_p.P1084P|TRERF1_ENST00000354325.2_Silent_p.P1072P	NM_033502.2	NP_277037.1	Q96PN7	TREF1_HUMAN	transcriptional regulating factor 1	1155	Interacts with CREBBP.				cholesterol catabolic process (GO:0006707)|homeostatic process (GO:0042592)|multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hormone biosynthetic process (GO:0046885)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|steroid biosynthetic process (GO:0006694)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding, bending (GO:0008301)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(7)|kidney(1)|large_intestine(12)|lung(13)|ovary(3)|pancreas(1)|skin(3)|urinary_tract(2)	45	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			CATCCTTGATGGGTTTGATCA	0.597																																					p.P1155P		Atlas-SNP	.											.	TRERF1	124	.	0			c.C3465T						.						150.0	154.0	152.0					6																	42196221		2203	4300	6503	SO:0001819	synonymous_variant	55809	exon18			CTTGATGGGTTTG	AF297872	CCDS4867.1, CCDS75455.1	6p21.1-p12.1	2012-09-25			ENSG00000124496	ENSG00000124496			18273	protein-coding gene	gene with protein product		610322	"""breast cancer anti-estrogen resistance 2"""	BCAR2		11349124	Standard	XM_005249223		Approved	TReP-132, HSA277276, RAPA, dJ139D8.5	uc003osd.2	Q96PN7	OTTHUMG00000014698	ENST00000372922.4:c.3465C>T	chr6.hg19:g.42196221G>A		65.0	0.0		100.0	30.0	NM_033502	Q05GC6|Q7Z6T2|Q7Z6T3|Q9NQ72|Q9NQ73|Q9NUN9	Silent	SNP	ENST00000372922.4	hg19	CCDS4867.1																																																																																			.	.		0.597	TRERF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040551.2	NM_033502	
TNRC18	84629	hgsc.bcm.edu	37	7	5427597	5427597	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr7:5427597T>C	ENST00000430969.1	-	5	2206	c.1858A>G	c.(1858-1860)Aaa>Gaa	p.K620E	TNRC18_ENST00000399537.4_Missense_Mutation_p.K620E	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	620							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		GGCTCGGGTTTCATGGTGCCC	0.692																																					p.K620E		Atlas-SNP	.											.	TNRC18	311	.	0			c.A1858G						.						6.0	10.0	9.0					7																	5427597		1980	4099	6079	SO:0001583	missense	84629	exon5			CGGGTTTCATGGT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.1858A>G	chr7.hg19:g.5427597T>C	ENSP00000395538:p.Lys620Glu	140.0	0.0		105.0	28.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	t	13.04	2.118578	0.37436	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000413081	T;T	0.22945	1.94;1.93	4.83	4.83	0.62350	.	.	.	.	.	T	0.46541	0.1398	M	0.73962	2.25	0.31015	N	0.71881	D	0.67145	0.996	P	0.57620	0.824	T	0.56842	-0.7912	9	0.87932	D	0	.	14.419	0.67171	0.0:0.0:0.0:1.0	.	620	O15417	TNC18_HUMAN	E	620;620;22	ENSP00000382452:K620E;ENSP00000395538:K620E	ENSP00000382452:K620E	K	-	1	0	TNRC18	5394123	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	4.058000	0.57463	1.804000	0.52760	0.454000	0.30748	AAA	.	.		0.692	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
ANK1	286	hgsc.bcm.edu	37	8	41542087	41542087	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr8:41542087G>A	ENST00000347528.4	-	37	4595	c.4512C>T	c.(4510-4512)taC>taT	p.Y1504Y	ANK1_ENST00000352337.4_Silent_p.Y1504Y|ANK1_ENST00000265709.8_Silent_p.Y1545Y|ANK1_ENST00000289734.7_Silent_p.Y1504Y|ANK1_ENST00000379758.2_Silent_p.Y1504Y|ANK1_ENST00000396942.1_Silent_p.Y1504Y|ANK1_ENST00000396945.1_Silent_p.Y1504Y	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	1504	55 kDa regulatory domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			GTGACAGCGAGTAGTCGCGGT	0.612																																					p.Y1545Y		Atlas-SNP	.											.	ANK1	497	.	0			c.C4635T						.						84.0	64.0	71.0					8																	41542087		2203	4300	6503	SO:0001819	synonymous_variant	286	exon38			CAGCGAGTAGTCG	M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.4512C>T	chr8.hg19:g.41542087G>A		46.0	0.0		73.0	48.0	NM_001142446	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	ENST00000347528.4	hg19	CCDS6119.1	.	.	.	.	.	.	.	.	.	.	G	3.508	-0.100308	0.06967	.	.	ENSG00000029534	ENST00000520299	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	T	0.59932	0.2230	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58457	-0.7633	4	.	.	.	.	8.7271	0.34476	0.0782:0.0:0.7711:0.1507	.	.	.	.	F	826	.	.	L	-	1	0	ANK1	41661244	0.995000	0.38212	1.000000	0.80357	0.315000	0.28087	0.523000	0.22925	2.572000	0.86782	0.655000	0.94253	CTC	.	.		0.612	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000317297.1	NM_020475	
XKR9	389668	hgsc.bcm.edu	37	8	71646299	71646299	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr8:71646299T>A	ENST00000408926.3	+	5	1296	c.762T>A	c.(760-762)tgT>tgA	p.C254*	XKR9_ENST00000520030.1_Nonsense_Mutation_p.C254*|XKR9_ENST00000520273.1_Intron	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	254						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			CCCAGTTTTGTACTTGTATAA	0.279																																					p.C254X		Atlas-SNP	.											.	XKR9	43	.	0			c.T762A						.						121.0	120.0	120.0					8																	71646299		2201	4297	6498	SO:0001587	stop_gained	389668	exon5			GTTTTGTACTTGT	AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.762T>A	chr8.hg19:g.71646299T>A	ENSP00000386141:p.Cys254*	107.0	0.0		228.0	20.0	NM_001011720	B2RNS9|B9EH74	Nonsense_Mutation	SNP	ENST00000408926.3	hg19	CCDS34905.1	.	.	.	.	.	.	.	.	.	.	T	28.6	4.938285	0.92526	.	.	ENSG00000221947	ENST00000408926;ENST00000520030	.	.	.	4.89	2.45	0.29901	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	-19.1733	7.8315	0.29344	0.0:0.3387:0.0:0.6613	.	.	.	.	X	254	.	ENSP00000386141:C254X	C	+	3	2	XKR9	71808853	1.000000	0.71417	0.978000	0.43139	0.107000	0.19398	1.193000	0.32162	0.340000	0.23745	0.460000	0.39030	TGT	.	.		0.279	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378752.1	NM_001011720	
CSMD3	114788	hgsc.bcm.edu	37	8	113317133	113317133	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr8:113317133G>T	ENST00000297405.5	-	52	8327	c.8083C>A	c.(8083-8085)Cca>Aca	p.P2695T	CSMD3_ENST00000352409.3_Missense_Mutation_p.P2625T|CSMD3_ENST00000455883.2_Intron|CSMD3_ENST00000343508.3_Missense_Mutation_p.P2655T	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2695	Sushi 16. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TTGATGCTTGGACATGTAACA	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																											p.P2695T		Atlas-SNP	.											.	CSMD3	2325	.	0			c.C8083A						.						64.0	54.0	58.0					8																	113317133		2203	4300	6503	SO:0001583	missense	114788	exon52			TGCTTGGACATGT	AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8083C>A	chr8.hg19:g.113317133G>T	ENSP00000297405:p.Pro2695Thr	124.0	0.0		188.0	25.0	NM_198123	Q96PZ3	Missense_Mutation	SNP	ENST00000297405.5	hg19	CCDS6315.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111483	0.77210	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000352409	T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27	5.18	5.18	0.71444	Complement control module (3);Sushi/SCR/CCP (3);	0.083622	0.48286	D	0.000195	D	0.83972	0.5370	M	0.87900	2.915	0.54753	D	0.999984	P;D	0.76494	0.923;0.999	P;D	0.74023	0.811;0.982	D	0.83958	0.0320	10	0.36615	T	0.2	.	19.0673	0.93116	0.0:0.0:1.0:0.0	.	2695;2655	Q7Z407;Q7Z407-2	CSMD3_HUMAN;.	T	2655;2695;1965;2625	ENSP00000345799:P2655T;ENSP00000297405:P2695T;ENSP00000341558:P1965T;ENSP00000343124:P2625T	ENSP00000297405:P2695T	P	-	1	0	CSMD3	113386309	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.923000	0.87546	2.547000	0.85894	0.655000	0.94253	CCA	.	.		0.378	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347141.1	NM_052900	
DMRT1	1761	hgsc.bcm.edu	37	9	842074	842074	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr9:842074G>A	ENST00000382276.3	+	1	385	c.236G>A	c.(235-237)tGc>tAc	p.C79Y	DMRT1_ENST00000569227.1_5'Flank	NM_021951.2	NP_068770.2	Q9Y5R6	DMRT1_HUMAN	doublesex and mab-3 related transcription factor 1	79					cell morphogenesis (GO:0000902)|germ cell migration (GO:0008354)|intracellular signal transduction (GO:0035556)|male germ cell proliferation (GO:0002176)|male sex determination (GO:0030238)|male sex differentiation (GO:0046661)|negative regulation of meiosis (GO:0045835)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oocyte development (GO:0048599)|positive regulation of male gonad development (GO:2000020)|positive regulation of meiosis I (GO:0060903)|positive regulation of mitosis (GO:0045840)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of nodal signaling pathway (GO:1900107)|Sertoli cell development (GO:0060009)|Sertoli cell differentiation (GO:0060008)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|lung(10)|ovary(1)	13		all_lung(10;2.66e-10)|Lung NSC(10;2.82e-10)|Breast(48;0.232)		Lung(218;0.037)		TGCGCACGCTGCAGGAACCAC	0.701																																					p.C79Y		Atlas-SNP	.											.	DMRT1	38	.	0			c.G236A						.						5.0	5.0	5.0					9																	842074		2065	4086	6151	SO:0001583	missense	1761	exon1			CACGCTGCAGGAA	AF130728	CCDS6442.1	9p24.3	2014-01-21			ENSG00000137090	ENSG00000137090			2934	protein-coding gene	gene with protein product	"""DM domain expressed in testis 1"""	602424				9490411, 10332030	Standard	XM_006716732		Approved	DMT1, CT154	uc003zgv.3	Q9Y5R6	OTTHUMG00000019435	ENST00000382276.3:c.236G>A	chr9.hg19:g.842074G>A	ENSP00000371711:p.Cys79Tyr	69.0	0.0		83.0	42.0	NM_021951	B2R913|Q6T1H8|Q6T1H9|Q8IW77	Missense_Mutation	SNP	ENST00000382276.3	hg19	CCDS6442.1	.	.	.	.	.	.	.	.	.	.	G	25.4	4.631948	0.87660	.	.	ENSG00000137090	ENST00000451501;ENST00000382276	D	0.82984	-1.67	4.05	4.05	0.47172	DM DNA-binding (6);	0.000000	0.85682	D	0.000000	D	0.94699	0.8290	H	0.98370	4.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.998;1.0	D	0.97211	0.9871	10	0.87932	D	0	.	16.5834	0.84720	0.0:0.0:1.0:0.0	.	79;79	Q9Y5R6;Q6T1H9	DMRT1_HUMAN;.	Y	79	ENSP00000371711:C79Y	ENSP00000371711:C79Y	C	+	2	0	DMRT1	832074	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.911000	0.92721	1.960000	0.56953	0.561000	0.74099	TGC	.	.		0.701	DMRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051489.2	NM_021951	
ELAVL2	1993	hgsc.bcm.edu	37	9	23762193	23762193	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr9:23762193T>C	ENST00000397312.2	-	2	314	c.40A>G	c.(40-42)Aca>Gca	p.T14A	ELAVL2_ENST00000544538.1_Missense_Mutation_p.T14A|ELAVL2_ENST00000462649.1_5'Flank|ELAVL2_ENST00000380110.4_Missense_Mutation_p.T43A|ELAVL2_ENST00000223951.6_Missense_Mutation_p.T14A|ELAVL2_ENST00000380117.1_Missense_Mutation_p.T14A	NM_004432.3	NP_004423.2	Q12926	ELAV2_HUMAN	ELAV like neuron-specific RNA binding protein 2	14					regulation of transcription, DNA-templated (GO:0006355)		mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(20)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(1;2.18e-156)|Lung(42;2.15e-28)|LUSC - Lung squamous cell carcinoma(38;1.02e-19)		CCATTGGCTGTGTTATTGCAA	0.413																																					p.T14A		Atlas-SNP	.											.	ELAVL2	80	.	0			c.A40G						.						309.0	284.0	292.0					9																	23762193		2203	4299	6502	SO:0001583	missense	1993	exon2			TGGCTGTGTTATT	BC030692	CCDS6515.1, CCDS55298.1	9p21	2013-10-03	2013-10-03		ENSG00000107105	ENSG00000107105		"""RNA binding motif (RRM) containing"""	3313	protein-coding gene	gene with protein product	"""Hu antigen B"""	601673	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2"", ""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 2 (Hu antigen B)"""			8812435	Standard	NM_004432		Approved	HuB, HEL-N1	uc003zpu.3	Q12926	OTTHUMG00000019700	ENST00000397312.2:c.40A>G	chr9.hg19:g.23762193T>C	ENSP00000380479:p.Thr14Ala	143.0	0.0		137.0	45.0	NM_001171195	D3DRK3|Q13235|Q59G15|Q8NEM4|Q9H1Q8	Missense_Mutation	SNP	ENST00000397312.2	hg19	CCDS6515.1	.	.	.	.	.	.	.	.	.	.	T	10.35	1.326561	0.24080	.	.	ENSG00000107105	ENST00000223951;ENST00000397312;ENST00000544538;ENST00000380110;ENST00000380117;ENST00000359598;ENST00000440102	T;T;T;T;T	0.13657	2.57;2.97;2.97;2.97;2.91	5.92	5.92	0.95590	.	0.053959	0.64402	D	0.000001	T	0.09069	0.0224	N	0.12182	0.205	0.47994	D	0.999562	B;B	0.09022	0.0;0.002	B;B	0.09377	0.001;0.004	T	0.30297	-0.9983	10	0.17832	T	0.49	.	16.371	0.83361	0.0:0.0:0.0:1.0	.	14;14	Q12926;Q12926-2	ELAV2_HUMAN;.	A	14;14;14;14;14;42;14	ENSP00000223951:T14A;ENSP00000380479:T14A;ENSP00000440998:T14A;ENSP00000369460:T14A;ENSP00000412602:T14A	ENSP00000223951:T14A	T	-	1	0	ELAVL2	23752193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.704000	0.61831	2.267000	0.75376	0.477000	0.44152	ACA	.	.		0.413	ELAVL2-201	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051943.2	NM_004432	
HINT2	84681	hgsc.bcm.edu	37	9	35813496	35813496	+	Silent	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr9:35813496G>T	ENST00000259667.5	-	3	314	c.273C>A	c.(271-273)gtC>gtA	p.V91V	HINT2_ENST00000474908.1_5'UTR|SPAG8_ENST00000484764.1_5'Flank|SPAG8_ENST00000340291.2_5'Flank|SPAG8_ENST00000396638.2_5'Flank|AL133410.1_ENST00000582432.1_RNA|SPAG8_ENST00000479751.1_5'Flank|TMEM8B_ENST00000377996.1_5'Flank	NM_032593.2	NP_115982.1	Q9BX68	HINT2_HUMAN	histidine triad nucleotide binding protein 2	91	HIT. {ECO:0000255|PROSITE- ProRule:PRU00464}.				apoptotic process (GO:0006915)|steroid biosynthetic process (GO:0006694)	mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)|nucleotide binding (GO:0000166)			NS(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	7	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)			TCTTAGGAATGACCAGGAAGT	0.582											OREG0019179	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V91V	GBM(185;1694 2122 5473 25431 37228)	Atlas-SNP	.											.	HINT2	15	.	0			c.C273A						.						57.0	55.0	56.0					9																	35813496		2203	4300	6503	SO:0001819	synonymous_variant	84681	exon3			AGGAATGACCAGG	AY033094	CCDS6594.1	9p11.2	2005-12-20			ENSG00000137133	ENSG00000137133			18344	protein-coding gene	gene with protein product		609997					Standard	NM_032593		Approved		uc003zyh.3	Q9BX68	OTTHUMG00000019886	ENST00000259667.5:c.273C>A	chr9.hg19:g.35813496G>T		104.0	0.0	858	83.0	24.0	NM_032593	Q5TCW3	Silent	SNP	ENST00000259667.5	hg19	CCDS6594.1																																																																																			.	.		0.582	HINT2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052390.1	NM_032593	
TRPM3	80036	hgsc.bcm.edu	37	9	73151320	73151320	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr9:73151320G>A	ENST00000377110.3	-	25	4916	c.4673C>T	c.(4672-4674)gCc>gTc	p.A1558V	TRPM3_ENST00000396285.1_Missense_Mutation_p.A1417V|TRPM3_ENST00000423814.3_Missense_Mutation_p.A1585V|TRPM3_ENST00000360823.2_Missense_Mutation_p.A1420V|TRPM3_ENST00000396292.4_Missense_Mutation_p.A1430V|TRPM3_ENST00000377105.1_Missense_Mutation_p.A1417V|TRPM3_ENST00000377111.2_Intron|TRPM3_ENST00000396280.5_Missense_Mutation_p.A1407V|TRPM3_ENST00000408909.2_Missense_Mutation_p.A1417V|TRPM3_ENST00000358082.3_Missense_Mutation_p.A1420V|TRPM3_ENST00000377106.1_Missense_Mutation_p.A1430V|TRPM3_ENST00000357533.2_Missense_Mutation_p.A1562V			Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	1583					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						TGCTTGAGGGGCATTGACACA	0.483																																					p.A1558V		Atlas-SNP	.											.	TRPM3	700	.	0			c.C4673T						.						97.0	90.0	93.0					9																	73151320		2203	4300	6503	SO:0001583	missense	80036	exon25			TGAGGGGCATTGA	AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377110.3:c.4673C>T	chr9.hg19:g.73151320G>A	ENSP00000366314:p.Ala1558Val	113.0	0.0		88.0	56.0	NM_001007471	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	ENST00000377110.3	hg19	CCDS43835.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.069013	0.55539	.	.	ENSG00000083067	ENST00000377110;ENST00000377106;ENST00000360823;ENST00000377105;ENST00000357533;ENST00000408909;ENST00000396285;ENST00000396292;ENST00000358082;ENST00000423814	T;T;T;T;T;T;T;T;T;T	0.56776	0.53;0.47;0.47;0.44;0.53;0.44;0.45;0.47;0.47;0.53	5.87	5.87	0.94306	.	0.057558	0.64402	D	0.000001	T	0.48447	0.1500	L	0.27053	0.805	0.48571	D	0.999677	B;B;B;B;B;B;B	0.33612	0.419;0.026;0.19;0.295;0.288;0.253;0.19	B;B;B;B;B;B;B	0.38500	0.275;0.014;0.068;0.068;0.143;0.059;0.068	T	0.39231	-0.9624	10	0.38643	T	0.18	-20.6562	20.2181	0.98305	0.0:0.0:1.0:0.0	.	1558;1548;1562;1420;1417;1530;1417	Q9HCF6-2;Q9HCF6-4;A2A3F7;A2A3F4;G5E9G1;Q9HCF6-8;A2A3F3	.;.;.;.;.;.;.	V	1558;1430;1420;1417;1562;1417;1417;1430;1420;1585	ENSP00000366314:A1558V;ENSP00000366310:A1430V;ENSP00000354066:A1420V;ENSP00000366309:A1417V;ENSP00000350140:A1562V;ENSP00000386127:A1417V;ENSP00000379581:A1417V;ENSP00000379587:A1430V;ENSP00000350791:A1420V;ENSP00000389542:A1585V	ENSP00000350140:A1562V	A	-	2	0	TRPM3	72341140	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	9.230000	0.95299	2.785000	0.95823	0.655000	0.94253	GCC	.	.		0.483	TRPM3-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214158.3	NM_206945	
AGPAT2	10555	hgsc.bcm.edu	37	9	139568320	139568320	+	Missense_Mutation	SNP	C	C	A	rs11545228		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr9:139568320C>A	ENST00000371696.2	-	6	786	c.721G>T	c.(721-723)Gtc>Ttc	p.V241F	AGPAT2_ENST00000538402.1_Missense_Mutation_p.V241F|AGPAT2_ENST00000371694.3_Missense_Mutation_p.V209F	NM_006412.3	NP_006403.2	O15120	PLCB_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 2	241					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|epidermis development (GO:0008544)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)			endometrium(1)|large_intestine(1)|lung(2)|prostate(2)	6	all_cancers(76;0.0893)|all_epithelial(76;0.231)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.87e-06)|Epithelial(140;0.000123)		AGCGCAGGGACGTCCGCCGCA	0.667																																					p.V241F		Atlas-SNP	.											.	AGPAT2	17	.	0			c.G721T						.						40.0	40.0	40.0					9																	139568320		2192	4295	6487	SO:0001583	missense	10555	exon6			CAGGGACGTCCGC	AF000237	CCDS7003.1, CCDS35181.1	9q34.3	2013-02-05	2013-02-05		ENSG00000169692	ENSG00000169692	2.3.1.51	"""1-acylglycerol-3-phosphate O-acyltransferases"""	325	protein-coding gene	gene with protein product	"""LPAAT-beta"", ""lysophosphatidic acid acyltransferase, beta"""	603100	"""Berardinelli-Seip congenital lipodystrophy"", ""1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta)"""	BSCL		9242711, 9212163	Standard	NM_006412		Approved		uc004cii.1	O15120	OTTHUMG00000020936	ENST00000371696.2:c.721G>T	chr9.hg19:g.139568320C>A	ENSP00000360761:p.Val241Phe	127.0	0.0		83.0	54.0	NM_006412	O00516|O15106|Q5VUD3|Q5VUD4|Q9BSV7|Q9BWR7	Missense_Mutation	SNP	ENST00000371696.2	hg19	CCDS7003.1	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242802	0.39598	.	.	ENSG00000169692	ENST00000371694;ENST00000371696;ENST00000538402	D;D;D	0.93953	-3.32;-3.32;-3.32	5.23	0.704	0.18121	.	0.395578	0.24033	N	0.042179	D	0.96116	0.8734	M	0.87328	2.875	0.41433	D	0.987874	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.965	D	0.94909	0.8063	10	0.72032	D	0.01	-40.9283	9.6943	0.40147	0.0:0.5952:0.0:0.4048	rs11545228;rs17845113;rs17857906	209;241	O15120-2;O15120	.;PLCB_HUMAN	F	209;241;241	ENSP00000360759:V209F;ENSP00000360761:V241F;ENSP00000438919:V241F	ENSP00000360759:V209F	V	-	1	0	AGPAT2	138688141	0.988000	0.35896	0.011000	0.14972	0.003000	0.03518	0.820000	0.27323	0.220000	0.20860	-0.150000	0.13652	GTC	.	C|1.000		0.667	AGPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055090.1	NM_006412	
ADARB2	105	hgsc.bcm.edu	37	10	1405325	1405325	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr10:1405325C>A	ENST00000381312.1	-	3	1300	c.975G>T	c.(973-975)aaG>aaT	p.K325N	RP11-398B16.2_ENST00000432987.1_RNA	NM_018702.3	NP_061172.1	Q9NS39	RED2_HUMAN	adenosine deaminase, RNA-specific, B2 (non-functional)	325	DRBM 2. {ECO:0000255|PROSITE- ProRule:PRU00266}.				mRNA processing (GO:0006397)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(17)|prostate(2)|skin(1)|urinary_tract(1)	41		all_epithelial(10;0.059)|Colorectal(49;0.0815)		all cancers(11;0.0224)|GBM - Glioblastoma multiforme(2;0.0414)|Epithelial(11;0.165)		CCCGGGCCAGCTTCTTGCTGC	0.726																																					p.K325N		Atlas-SNP	.											.	ADARB2	95	.	0			c.G975T						.						6.0	7.0	7.0					10																	1405325		2072	4107	6179	SO:0001583	missense	105	exon3			GGCCAGCTTCTTG	AF034837	CCDS7058.1	10p15.3	2013-05-20	2013-05-20		ENSG00000185736	ENSG00000185736	3.5.-.-		227	protein-coding gene	gene with protein product	"""RED2 homolog (rat)"""	602065	"""adenosine deaminase, RNA-specific, B2 (RED2 homolog rat)"", ""adenosine deaminase, RNA-specific, B2"""			9272162, 10836796	Standard	NM_018702		Approved	RED2, hRED2, ADAR3	uc009xhq.3	Q9NS39	OTTHUMG00000017543	ENST00000381312.1:c.975G>T	chr10.hg19:g.1405325C>A	ENSP00000370713:p.Lys325Asn	25.0	0.0		29.0	11.0	NM_018702	B2RPJ5|Q5VUT6|Q5VW42	Missense_Mutation	SNP	ENST00000381312.1	hg19	CCDS7058.1	.	.	.	.	.	.	.	.	.	.	C	25.7	4.662592	0.88251	.	.	ENSG00000185736	ENST00000381312	D	0.86230	-2.09	5.24	5.24	0.73138	Double-stranded RNA-binding (3);Double-stranded RNA-binding-like (1);	0.096500	0.64402	D	0.000001	D	0.96074	0.8721	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97510	1.0066	10	0.87932	D	0	-43.8987	18.8514	0.92232	0.0:1.0:0.0:0.0	.	325	Q9NS39	RED2_HUMAN	N	325	ENSP00000370713:K325N	ENSP00000370713:K325N	K	-	3	2	ADARB2	1395325	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	3.891000	0.56227	2.445000	0.82738	0.561000	0.74099	AAG	.	.		0.726	ADARB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046426.1	NM_018702	
PFKFB3	5209	hgsc.bcm.edu	37	10	6262815	6262815	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr10:6262815G>A	ENST00000379775.4	+	8	1148	c.818G>A	c.(817-819)aGc>aAc	p.S273N	PFKFB3_ENST00000317350.4_Missense_Mutation_p.S273N|PFKFB3_ENST00000379789.4_Missense_Mutation_p.S253N|PFKFB3_ENST00000379785.1_Missense_Mutation_p.S273N|PFKFB3_ENST00000536985.1_3'UTR|PFKFB3_ENST00000540253.1_Missense_Mutation_p.S287N|PFKFB3_ENST00000360521.2_Missense_Mutation_p.S273N|PFKFB3_ENST00000379782.3_Missense_Mutation_p.S273N	NM_004566.3	NP_004557.1	Q16875	F263_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3	273	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|liver(2)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)	22						GGCCTGTCCAGCCGGGGCAAG	0.662																																					p.S273N		Atlas-SNP	.											.	PFKFB3	82	.	0			c.G818A						.						38.0	42.0	41.0					10																	6262815		2203	4299	6502	SO:0001583	missense	5209	exon8			TGTCCAGCCGGGG		CCDS7078.1, CCDS44353.1, CCDS60479.1	10p15.1	2008-05-14			ENSG00000170525	ENSG00000170525			8874	protein-coding gene	gene with protein product		605319				9146922, 10072580	Standard	NM_004566		Approved		uc001ije.3	Q16875	OTTHUMG00000017621	ENST00000379775.4:c.818G>A	chr10.hg19:g.6262815G>A	ENSP00000369100:p.Ser273Asn	44.0	0.0		50.0	8.0	NM_004566	B7Z955|O43622|O75902|Q5VX15|Q5VX18|Q5VX19	Missense_Mutation	SNP	ENST00000379775.4	hg19	CCDS7078.1	.	.	.	.	.	.	.	.	.	.	G	13.50	2.254403	0.39896	.	.	ENSG00000170525	ENST00000379789;ENST00000379784;ENST00000540253;ENST00000317350;ENST00000379785;ENST00000379782;ENST00000360521;ENST00000379775;ENST00000358499	T;T;T;T;T;T;T	0.71698	-0.59;-0.59;-0.59;-0.59;-0.59;-0.59;-0.59	5.93	-3.76	0.04359	Histidine phosphatase superfamily, clade-1 (2);	1.102000	0.06548	N	0.744417	T	0.59142	0.2172	L	0.56280	1.765	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.44802	-0.9304	10	0.35671	T	0.21	0.0404	4.3813	0.11295	0.0924:0.1686:0.1984:0.5407	.	287;273;273;253	B7Z955;Q16875-2;Q16875;Q5VX15	.;.;F263_HUMAN;.	N	253;34;287;273;273;273;273;273;273	ENSP00000369115:S253N;ENSP00000446384:S287N;ENSP00000369105:S273N;ENSP00000369111:S273N;ENSP00000369108:S273N;ENSP00000353712:S273N;ENSP00000369100:S273N	ENSP00000369105:S273N	S	+	2	0	PFKFB3	6302821	0.000000	0.05858	0.709000	0.30452	0.979000	0.70002	-0.070000	0.11523	-0.429000	0.07329	0.561000	0.74099	AGC	.	.		0.662	PFKFB3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046647.1		
PSAP	5660	hgsc.bcm.edu	37	10	73594188	73594188	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr10:73594188C>T	ENST00000394936.3	-	2	262	c.115G>A	c.(115-117)Gcg>Acg	p.A39T	PSAP_ENST00000394934.1_Missense_Mutation_p.A39T			P07602	SAP_HUMAN	prosaposin	39	Saposin A-type 1. {ECO:0000255|PROSITE- ProRule:PRU00414}.				blood coagulation (GO:0007596)|cellular response to organic substance (GO:0071310)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|glycosphingolipid metabolic process (GO:0006687)|lipid transport (GO:0006869)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catalytic activity (GO:0043085)|prostate gland growth (GO:0060736)|regulation of lipid metabolic process (GO:0019216)|regulation of MAPK cascade (GO:0043408)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|lipid binding (GO:0008289)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	13						CAGTCGGACGCCGTCTTCACA	0.607																																					p.A39T		Atlas-SNP	.											.	PSAP	43	.	0			c.G115A						.						50.0	41.0	44.0					10																	73594188		2203	4300	6503	SO:0001583	missense	5660	exon2			CGGACGCCGTCTT	BC004275	CCDS7311.1	10q21-q22	2014-01-30	2008-07-31		ENSG00000197746	ENSG00000197746		"""Endogenous ligands"""	9498	protein-coding gene	gene with protein product	"""variant Gaucher disease and variant metachromatic leukodystrophy"""	176801	"""sphingolipid activator protein-1"""	SAP1, GLBA		2717620	Standard	NM_001042465		Approved		uc001jsm.3	P07602	OTTHUMG00000018429	ENST00000394936.3:c.115G>A	chr10.hg19:g.73594188C>T	ENSP00000378394:p.Ala39Thr	65.0	0.0		89.0	36.0	NM_001042466	P07292|P15793|P78538|P78541|P78546|P78547|P78558|Q53Y86|Q6IBQ6|Q92739|Q92740|Q92741|Q92742	Missense_Mutation	SNP	ENST00000394936.3	hg19	CCDS7311.1	.	.	.	.	.	.	.	.	.	.	C	22.6	4.306115	0.81247	.	.	ENSG00000197746	ENST00000394936;ENST00000373120;ENST00000357471;ENST00000394934;ENST00000394929;ENST00000404083	T;T	0.80033	-1.33;-1.33	5.67	5.67	0.87782	Saposin type A (3);	0.047988	0.85682	D	0.000000	D	0.91327	0.7265	M	0.86805	2.84	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92312	0.5858	10	0.87932	D	0	3.834	18.5336	0.91001	0.0:1.0:0.0:0.0	.	39	P07602	SAP_HUMAN	T	39;39;39;39;39;42	ENSP00000378394:A39T;ENSP00000378392:A39T	ENSP00000350063:A39T	A	-	1	0	PSAP	73264194	1.000000	0.71417	0.873000	0.34254	0.253000	0.25986	6.364000	0.73086	2.680000	0.91292	0.563000	0.77884	GCG	.	.		0.607	PSAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000048553.1	NM_002778	
PDZD7	79955	hgsc.bcm.edu	37	10	102770594	102770594	+	IGR	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr10:102770594T>A								LZTS2 (3001 upstream) : PDZD7 (6494 downstream)																							TATCTTCCTCTTCCGGGAAGC	0.662																																					p.E684D		Atlas-SNP	.											.	PDZD7	101	.	0			c.A2052T						.																																			SO:0001628	intergenic_variant	79955	exon15			TTCCTCTTCCGGG																													chr10.hg19:g.102770594T>A		461.0	0.0		550.0	216.0	NM_001195263		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	C	2.102	-0.405932	0.04832	.	.	ENSG00000186862	ENST00000393462	.	.	.	5.3	2.45	0.29901	.	.	.	.	.	T	0.46288	0.1385	N	0.24115	0.695	0.80722	D	1	.	.	.	.	.	.	T	0.12041	-1.0563	6	0.23302	T	0.38	.	10.8216	0.46608	0.0:0.6517:0.0:0.3483	.	.	.	.	D	684	.	ENSP00000377106:E684D	E	-	3	2	PDZD7	102760584	0.068000	0.21057	0.324000	0.25361	0.001000	0.01503	0.369000	0.20416	-0.190000	0.10465	-2.304000	0.00258	GAA	.	.	0	0.662								
RPLP2	6181	hgsc.bcm.edu	37	11	812569	812569	+	Silent	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:812569G>T	ENST00000321153.4	+	4	601	c.207G>T	c.(205-207)ggG>ggT	p.G69G	RPLP2_ENST00000530797.1_Silent_p.G69G|RPLP2_ENST00000532004.1_3'UTR|SNORA52_ENST00000362915.1_RNA	NM_001004.3	NP_000995.1	P05387	RLA2_HUMAN	ribosomal protein, large, P2	69					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1		all_cancers(49;1.13e-08)|all_epithelial(84;2.95e-05)|Breast(177;0.000286)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.159)|all_lung(207;0.198)		all cancers(45;1.45e-25)|Epithelial(43;1.17e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.76e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CTGCTGGTGGGGCTGTAGCCG	0.632																																					p.G69G		Atlas-SNP	.											.	RPLP2	2	.	0			c.G207T						.						59.0	48.0	52.0					11																	812569		2203	4299	6502	SO:0001819	synonymous_variant	6181	exon4			TGGTGGGGCTGTA	M17887	CCDS7717.1	11p15.5	2011-07-29			ENSG00000177600	ENSG00000177600		"""L ribosomal proteins"""	10377	protein-coding gene	gene with protein product	"""60S acidic ribosomal protein P2"", ""acidic ribosomal phosphoprotein P2"""	180530		D11S2243E		3323886	Standard	NM_001004		Approved	P2, RPP2, MGC71408, LP2	uc001lrq.1	P05387	OTTHUMG00000133317	ENST00000321153.4:c.207G>T	chr11.hg19:g.812569G>T		43.0	0.0		32.0	10.0	NM_001004	Q6FG96	Silent	SNP	ENST00000321153.4	hg19	CCDS7717.1	.	.	.	.	.	.	.	.	.	.	G	7.661	0.684927	0.14973	.	.	ENSG00000177600	ENST00000530398	.	.	.	4.82	-0.824	0.10812	.	0.000000	0.85682	D	0.000000	T	0.54447	0.1859	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51411	-0.8709	6	0.59425	D	0.04	-12.9596	3.7639	0.08615	0.3469:0.0:0.1896:0.4635	.	.	.	.	V	46	.	ENSP00000433443:G46V	G	+	2	0	RPLP2	802569	0.772000	0.28567	0.994000	0.49952	0.704000	0.40688	-0.188000	0.09642	0.163000	0.19507	0.561000	0.74099	GGG	.	.		0.632	RPLP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257115.2	NM_001004	
FOLH1	2346	hgsc.bcm.edu	37	11	49214430	49214430	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:49214430A>G	ENST00000256999.2	-	4	688	c.428T>C	c.(427-429)tTa>tCa	p.L143S	FOLH1_ENST00000343844.4_5'UTR|FOLH1_ENST00000356696.3_Missense_Mutation_p.L143S|FOLH1_ENST00000340334.7_Missense_Mutation_p.L128S|FOLH1_ENST00000533034.1_Missense_Mutation_p.L128S	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	143					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TGGTTCAAATAATGATGTGTT	0.313																																					p.L143S		Atlas-SNP	.											.	FOLH1	141	.	0			c.T428C						.						62.0	69.0	67.0					11																	49214430		2201	4295	6496	SO:0001583	missense	2346	exon4			TCAAATAATGATG	M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.428T>C	chr11.hg19:g.49214430A>G	ENSP00000256999:p.Leu143Ser	191.0	0.0		143.0	24.0	NM_004476	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	ENST00000256999.2	hg19	CCDS7946.1	.	.	.	.	.	.	.	.	.	.	A	10.49	1.364573	0.24684	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000533034;ENST00000389724	T;T;T;T	0.54479	0.57;0.57;0.57;0.57	3.45	3.45	0.39498	.	0.000000	0.38720	N	0.001599	T	0.47040	0.1424	M	0.64404	1.975	0.80722	D	1	B;B;B;B;B	0.23128	0.065;0.056;0.004;0.03;0.08	B;B;B;B;B	0.26770	0.073;0.029;0.005;0.059;0.03	T	0.38585	-0.9654	10	0.22706	T	0.39	.	9.9921	0.41877	1.0:0.0:0.0:0.0	.	128;128;128;143;143	Q04609-9;Q04609-7;A4UU13;Q04609-8;Q04609	.;.;.;.;FOLH1_HUMAN	S	143;143;128;128;143	ENSP00000256999:L143S;ENSP00000349129:L143S;ENSP00000344131:L128S;ENSP00000431463:L128S	ENSP00000256999:L143S	L	-	2	0	FOLH1	49171006	0.997000	0.39634	0.983000	0.44433	0.980000	0.70556	6.246000	0.72405	1.454000	0.47793	0.329000	0.21502	TTA	.	.		0.313	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390896.1	NM_004476	
TNKS1BP1	85456	hgsc.bcm.edu	37	11	57080662	57080662	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:57080662G>A	ENST00000532437.1	-	4	1811	c.1500C>T	c.(1498-1500)atC>atT	p.I500I	TNKS1BP1_ENST00000530920.1_5'Flank|TNKS1BP1_ENST00000358252.3_Silent_p.I500I			Q9C0C2	TB182_HUMAN	tankyrase 1 binding protein 1, 182kDa	500	Acidic.|Pro-rich.				gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|RNA metabolic process (GO:0016070)|telomere maintenance via telomerase (GO:0007004)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nuclear telomeric heterochromatin (GO:0005724)|nucleus (GO:0005634)	ankyrin binding (GO:0030506)|enzyme binding (GO:0019899)			breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(11)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	64		all_epithelial(135;0.21)				TGGCTTCAGTGATGGGGGAGG	0.647																																					p.I500I		Atlas-SNP	.											.	TNKS1BP1	148	.	0			c.C1500T						.						17.0	20.0	19.0					11																	57080662		1993	4010	6003	SO:0001819	synonymous_variant	85456	exon5			TTCAGTGATGGGG	AB051528	CCDS7951.1	11q12.2	2008-07-21			ENSG00000149115	ENSG00000149115			19081	protein-coding gene	gene with protein product		607104				11854288	Standard	NM_033396		Approved	TAB182, KIAA1741, FLJ45975	uc001njs.3	Q9C0C2	OTTHUMG00000167022	ENST00000532437.1:c.1500C>T	chr11.hg19:g.57080662G>A		73.0	0.0		52.0	10.0	NM_033396	A7E2F8|Q6PJ35|Q6ZV74	Silent	SNP	ENST00000532437.1	hg19	CCDS7951.1																																																																																			.	.		0.647	TNKS1BP1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000392455.1	NM_033396	
MS4A6E	245802	hgsc.bcm.edu	37	11	60107405	60107405	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:60107405C>T	ENST00000300182.4	+	3	486	c.421C>T	c.(421-423)Ctg>Ttg	p.L141L		NM_139249.2	NP_640342.1	Q96DS6	M4A6E_HUMAN	membrane-spanning 4-domains, subfamily A, member 6E	141						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(9)|stomach(1)	13						CACTGCTGTGCTGCAGTGGAA	0.473																																					p.L141L		Atlas-SNP	.											.	MS4A6E	22	.	0			c.C421T						.						231.0	211.0	218.0					11																	60107405		2203	4300	6503	SO:0001819	synonymous_variant	245802	exon3			GCTGTGCTGCAGT	AF354931	CCDS7984.1	11q12	2008-03-25				ENSG00000166926			14285	protein-coding gene	gene with protein product		608402				11486273	Standard	NM_139249		Approved		uc001npd.3	Q96DS6		ENST00000300182.4:c.421C>T	chr11.hg19:g.60107405C>T		63.0	0.0		35.0	17.0	NM_139249	Q3MIL2|Q8NE56|Q96PG4|Q96PG5	Silent	SNP	ENST00000300182.4	hg19	CCDS7984.1																																																																																			.	.		0.473	MS4A6E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000394296.1		
TEX40	25858	hgsc.bcm.edu	37	11	64070996	64070996	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:64070996T>A	ENST00000328404.6	+	3	415	c.395T>A	c.(394-396)aTg>aAg	p.M132K	TEX40_ENST00000539943.1_Missense_Mutation_p.M90K|ESRRA_ENST00000405666.1_5'Flank|ESRRA_ENST00000406310.1_5'Flank|RP11-783K16.10_ENST00000539086.1_RNA|ESRRA_ENST00000000442.6_5'Flank	NM_001039496.1	NP_001034585.1	Q9NTU4	TEX40_HUMAN	testis expressed 40	132					cell differentiation (GO:0030154)|male meiosis (GO:0007140)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)											GCGAAGCACATGCCCCATCGA	0.557																																					p.M132K		Atlas-SNP	.											.	.	.	.	0			c.T395A						.						57.0	60.0	59.0					11																	64070996		2015	4175	6190	SO:0001583	missense	25858	exon3			AGCACATGCCCCA			11q13.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000219435	ENSG00000219435			19231	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 20"""	C11orf20			Standard	NM_001039496		Approved	DKFZP566E164	uc009ypm.3	Q9NTU4	OTTHUMG00000167820	ENST00000328404.6:c.395T>A	chr11.hg19:g.64070996T>A	ENSP00000330877:p.Met132Lys	68.0	0.0		56.0	20.0	NM_001039496		Missense_Mutation	SNP	ENST00000328404.6	hg19		.	.	.	.	.	.	.	.	.	.	T	2.914	-0.224602	0.06061	.	.	ENSG00000219435	ENST00000328404;ENST00000539943	T;T	0.39997	1.06;1.05	3.39	-1.87	0.07737	.	.	.	.	.	T	0.14743	0.0356	N	0.02539	-0.55	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.31392	-0.9945	9	0.14252	T	0.57	1.6415	7.4432	0.27196	0.0:0.4305:0.0:0.5695	.	132	Q9NTU4	CK020_HUMAN	K	132;90	ENSP00000330877:M132K;ENSP00000443917:M90K	ENSP00000330877:M132K	M	+	2	0	C11orf20	63827572	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.330000	0.07925	-0.391000	0.07763	-1.044000	0.02363	ATG	.	.		0.557	TEX40-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_001039496	
CNTN5	53942	hgsc.bcm.edu	37	11	100211261	100211261	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:100211261T>C	ENST00000524871.1	+	22	3087	c.2797T>C	c.(2797-2799)Tct>Cct	p.S933P	CNTN5_ENST00000524560.1_3'UTR|CNTN5_ENST00000528682.1_Missense_Mutation_p.S933P|CNTN5_ENST00000418526.2_Missense_Mutation_p.S859P|CNTN5_ENST00000279463.3_Missense_Mutation_p.S933P	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	933	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		AGGGAATGAGTCTTTCGTCAT	0.413																																					p.S933P		Atlas-SNP	.											.	CNTN5	324	.	0			c.T2797C						.						94.0	94.0	94.0					11																	100211261		1926	4150	6076	SO:0001583	missense	53942	exon21			AATGAGTCTTTCG	AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.2797T>C	chr11.hg19:g.100211261T>C	ENSP00000435637:p.Ser933Pro	171.0	0.0		141.0	43.0	NM_001243270	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Missense_Mutation	SNP	ENST00000524871.1	hg19	CCDS53696.1	.	.	.	.	.	.	.	.	.	.	T	12.33	1.906925	0.33628	.	.	ENSG00000149972	ENST00000528682;ENST00000524871;ENST00000418526;ENST00000279463	T;T;T;T	0.53423	0.62;0.62;0.62;0.62	5.18	5.18	0.71444	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.196018	0.46145	D	0.000317	T	0.36744	0.0978	N	0.17248	0.465	0.47009	D	0.999286	P;P	0.47191	0.664;0.891	B;P	0.45377	0.346;0.478	T	0.13764	-1.0497	9	.	.	.	.	14.1943	0.65659	0.0:0.0:0.0:1.0	.	859;933	O94779-2;O94779	.;CNTN5_HUMAN	P	933;933;859;933	ENSP00000436185:S933P;ENSP00000435637:S933P;ENSP00000393229:S859P;ENSP00000279463:S933P	.	S	+	1	0	CNTN5	99716471	1.000000	0.71417	0.965000	0.40720	0.006000	0.05464	4.146000	0.58072	1.952000	0.56665	0.482000	0.46254	TCT	.	.		0.413	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395148.2	NM_014361	
KBTBD3	143879	hgsc.bcm.edu	37	11	105923599	105923600	+	Missense_Mutation	DNP	CA	CA	AT			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C|A	C|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:105923599_105923600CA>AT	ENST00000526793.1	-	3	1975_1976	c.1816_1817TG>AT	c.(1816-1818)TGg>ATg	p.W606M	KBTBD3_ENST00000534815.1_Missense_Mutation_p.W527M|KBTBD3_ENST00000531837.1_Missense_Mutation_p.W606M	NM_152433.3	NP_689646.2	Q8NAB2	KBTB3_HUMAN	kelch repeat and BTB (POZ) domain containing 3	602										NS(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|prostate(1)	25		Melanoma(852;0.000878)|Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0017)|Breast(348;0.0321)		BRCA - Breast invasive adenocarcinoma(274;5.43e-05)|Epithelial(105;0.00418)|all cancers(92;0.0299)		ATTAGAAAACCATGGGTCTCTG	0.356																																					p.W606L|p.W606R		Atlas-SNP	.											.	KBTBD3	59	.	0			c.G1817T|c.T1816A						.																																			SO:0001583	missense	143879	exon3			GAAAACCATGGGT|AAAACCATGGGTC	AK055247	CCDS8334.1	11q22.3	2013-01-08	2003-12-12	2003-12-17		ENSG00000182359		"""BTB/POZ domain containing"""	22934	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 3"""	BKLHD3			Standard	NM_198439		Approved		uc001pjb.3	Q8NAB2		ENST00000526793.1:c.1816_1817delinsAT	chr11.hg19:g.105923599_105923600delinsAT	ENSP00000436262:p.Trp606Met	134.0	0.0		122.0|123.0	31.0	NM_152433	Q6N066|Q86X38|Q96NK5	Missense_Mutation	SNP	ENST00000526793.1	hg19	CCDS8334.1																																																																																			.	.		0.356	KBTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388705.2	NM_152433	
KMT2A	4297	hgsc.bcm.edu	37	11	118374231	118374231	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:118374231C>A	ENST00000389506.5	+	27	7615	c.7615C>A	c.(7615-7617)Ctg>Atg	p.L2539M	KMT2A_ENST00000534358.1_Missense_Mutation_p.L2542M|KMT2A_ENST00000354520.4_Missense_Mutation_p.L2501M			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2539					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										CAAAAATGCCCTGAAAGAAAG	0.458																																					p.L2542M		Atlas-SNP	.											.	MLL	548	.	0			c.C7624A						.						62.0	59.0	60.0					11																	118374231		2200	4296	6496	SO:0001583	missense	4297	exon27			AATGCCCTGAAAG	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	ENST00000389506.5:c.7615C>A	chr11.hg19:g.118374231C>A	ENSP00000374157:p.Leu2539Met	111.0	0.0		73.0	24.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Missense_Mutation	SNP	ENST00000389506.5	hg19	CCDS31686.1	.	.	.	.	.	.	.	.	.	.	C	7.111	0.575989	0.13623	.	.	ENSG00000118058	ENST00000534358;ENST00000389506;ENST00000354520;ENST00000359313	D;D;D	0.81739	-1.53;-1.53;-1.5	5.95	2.47	0.30058	.	0.369458	0.27019	N	0.021325	T	0.62588	0.2440	N	0.19112	0.55	0.09310	N	1	P;P	0.37955	0.612;0.612	B;B	0.33890	0.172;0.172	T	0.57207	-0.7851	10	0.59425	D	0.04	.	6.7541	0.23503	0.1272:0.6366:0.0:0.2363	.	2542;2539	E9PQG7;Q03164	.;MLL1_HUMAN	M	2542;2539;2501;1449	ENSP00000436786:L2542M;ENSP00000374157:L2539M;ENSP00000346516:L2501M	ENSP00000346516:L2501M	L	+	1	2	MLL	117879441	0.212000	0.23540	0.903000	0.35520	0.905000	0.53344	1.695000	0.37763	0.765000	0.33221	0.655000	0.94253	CTG	.	.		0.458	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
TAS2R42	353164	hgsc.bcm.edu	37	12	11339508	11339508	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr12:11339508C>T	ENST00000334266.1	-	1	35	c.36G>A	c.(34-36)ctG>ctA	p.L12L		NM_181429.1	NP_852094.1	Q7RTR8	T2R42_HUMAN	taste receptor, type 2, member 42	12					sensory perception of taste (GO:0050909)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|kidney(2)|lung(4)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11			OV - Ovarian serous cystadenocarcinoma(49;0.0455)			CTGCTATTGCCAGAATCAGAA	0.378																																					p.L12L	Melanoma(15;352 722 10077 19546 48810)	Atlas-SNP	.											.	TAS2R42	30	.	0			c.G36A						.						79.0	83.0	82.0					12																	11339508		2203	4300	6503	SO:0001819	synonymous_variant	353164	exon1			TATTGCCAGAATC	AX097739, AB199241	CCDS31747.1	12p13	2012-08-22			ENSG00000186136	ENSG00000186136		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18888	protein-coding gene	gene with protein product		613966				12679530	Standard	NM_181429		Approved	T2R24, T2R55, hT2R55, TAS2R55	uc001qzr.1	Q7RTR8	OTTHUMG00000168567	ENST00000334266.1:c.36G>A	chr12.hg19:g.11339508C>T		62.0	0.0		76.0	20.0	NM_181429	A2RRP4|Q645X0	Silent	SNP	ENST00000334266.1	hg19	CCDS31747.1																																																																																			.	.		0.378	TAS2R42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000400243.1	NM_181429	
SP1	6667	hgsc.bcm.edu	37	12	53775951	53775951	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr12:53775951C>T	ENST00000327443.4	+	3	318	c.220C>T	c.(220-222)Ccc>Tcc	p.P74S	SP1_ENST00000426431.2_Missense_Mutation_p.P67S	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	74	Repressor domain.|Ser/Thr-rich.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		AATTGAGTCACCCAATGAGAA	0.557											OREG0021870	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.P74S		Atlas-SNP	.											.	SP1	57	.	0			c.C220T						.						61.0	60.0	60.0					12																	53775951		2203	4300	6503	SO:0001583	missense	6667	exon3			GAGTCACCCAATG	J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.220C>T	chr12.hg19:g.53775951C>T	ENSP00000329357:p.Pro74Ser	57.0	0.0	995	54.0	10.0	NM_138473	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	ENST00000327443.4	hg19	CCDS8857.1	.	.	.	.	.	.	.	.	.	.	C	16.23	3.065361	0.55432	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.11821	2.76;2.74	4.13	4.13	0.48395	.	0.000000	0.53938	D	0.000046	T	0.27278	0.0669	L	0.60455	1.87	0.53005	D	0.999967	D	0.64830	0.994	P	0.55345	0.774	T	0.03278	-1.1053	10	0.72032	D	0.01	.	15.6957	0.77494	0.0:1.0:0.0:0.0	.	74	P08047	SP1_HUMAN	S	74;67	ENSP00000329357:P74S;ENSP00000404263:P67S	ENSP00000329357:P74S	P	+	1	0	SP1	52062218	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.129000	0.77225	2.306000	0.77630	0.467000	0.42956	CCC	.	.		0.557	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407044.1		
HSP90B1	7184	hgsc.bcm.edu	37	12	104327962	104327962	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr12:104327962A>G	ENST00000299767.5	+	5	822	c.640A>G	c.(640-642)Aaa>Gaa	p.K214E		NM_003299.2	NP_003290.1	P14625	ENPL_HUMAN	heat shock protein 90kDa beta (Grp94), member 1	214					actin rod assembly (GO:0031247)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular response to ATP (GO:0071318)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|protein folding (GO:0006457)|protein transport (GO:0015031)|regulation of phosphoprotein phosphatase activity (GO:0043666)|response to hypoxia (GO:0001666)|sequestering of calcium ion (GO:0051208)|toll-like receptor signaling pathway (GO:0002224)	cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|low-density lipoprotein particle receptor binding (GO:0050750)|protein phosphatase binding (GO:0019903)|RNA binding (GO:0003723)|virion binding (GO:0046790)			central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(4)	29					Rifabutin(DB00615)	TGTCACTTCAAAACACAACAA	0.453																																					p.K214E		Atlas-SNP	.											.	HSP90B1	72	.	0			c.A640G						.						103.0	97.0	99.0					12																	104327962		2203	4300	6503	SO:0001583	missense	7184	exon5			ACTTCAAAACACA	AY040226	CCDS9094.1	12q24.2-q24.3	2011-09-02	2006-02-24	2006-02-24		ENSG00000166598		"""Heat shock proteins / HSPC"""	12028	protein-coding gene	gene with protein product		191175	"""tumor rejection antigen (gp96) 1"""	TRA1		16269234	Standard	NM_003299		Approved	GP96, GRP94	uc001tkb.2	P14625	OTTHUMG00000170118	ENST00000299767.5:c.640A>G	chr12.hg19:g.104327962A>G	ENSP00000299767:p.Lys214Glu	238.0	0.0		229.0	21.0	NM_003299	Q96A97	Missense_Mutation	SNP	ENST00000299767.5	hg19	CCDS9094.1	.	.	.	.	.	.	.	.	.	.	A	32	5.152833	0.94645	.	.	ENSG00000166598	ENST00000299767;ENST00000537375	D	0.89746	-2.56	5.93	5.93	0.95920	Heat shock protein Hsp90, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.000000	0.85682	D	0.000000	D	0.97266	0.9106	H	0.99600	4.65	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99143	1.0856	10	0.87932	D	0	.	16.3943	0.83563	1.0:0.0:0.0:0.0	.	240;214	Q59FC6;P14625	.;ENPL_HUMAN	E	214	ENSP00000299767:K214E	ENSP00000299767:K214E	K	+	1	0	HSP90B1	102852092	1.000000	0.71417	0.944000	0.38274	0.994000	0.84299	9.336000	0.96533	2.281000	0.76405	0.533000	0.62120	AAA	.	.		0.453	HSP90B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407349.1	NM_003299	
ATP12A	479	hgsc.bcm.edu	37	13	25283923	25283923	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr13:25283923A>T	ENST00000381946.3	+	19	2887	c.2720A>T	c.(2719-2721)aAg>aTg	p.K907M	ATP12A_ENST00000218548.6_Missense_Mutation_p.K913M			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	907					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		GAATGGGAGAAGGACTACGTG	0.542																																					p.K913M	Pancreas(156;1582 1935 18898 22665 26498)	Atlas-SNP	.											.	ATP12A	172	.	0			c.A2738T						.						127.0	123.0	124.0					13																	25283923		2203	4300	6503	SO:0001583	missense	479	exon19			GGGAGAAGGACTA	L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.2720A>T	chr13.hg19:g.25283923A>T	ENSP00000371372:p.Lys907Met	84.0	0.0		94.0	20.0	NM_001185085	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Missense_Mutation	SNP	ENST00000381946.3	hg19	CCDS31948.1	.	.	.	.	.	.	.	.	.	.	A	9.707	1.155956	0.21454	.	.	ENSG00000075673	ENST00000218548;ENST00000381946	D;D	0.88586	-2.4;-2.4	5.79	-1.37	0.09056	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	1.083730	0.06933	N	0.811393	D	0.83422	0.5251	L	0.28192	0.835	0.09310	N	1	P;P	0.35982	0.531;0.53	P;B	0.45474	0.482;0.44	T	0.73078	-0.4096	10	0.87932	D	0	.	1.6346	0.02740	0.3959:0.2735:0.0804:0.2502	.	913;907	P54707-2;P54707	.;AT12A_HUMAN	M	913;907	ENSP00000218548:K913M;ENSP00000371372:K907M	ENSP00000218548:K913M	K	+	2	0	ATP12A	24181923	0.001000	0.12720	0.000000	0.03702	0.003000	0.03518	1.520000	0.35899	-0.448000	0.07128	-0.313000	0.08912	AAG	.	.		0.542	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044199.1	NM_001676	
VWA8	23078	hgsc.bcm.edu	37	13	42385467	42385467	+	Silent	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr13:42385467A>G	ENST00000379310.3	-	17	2025	c.1957T>C	c.(1957-1959)Tta>Cta	p.L653L	VWA8_ENST00000281496.6_Silent_p.L653L	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	653						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GATGCCGCTAATGATTGTGCC	0.388																																					p.L653L		Atlas-SNP	.											.	.	.	.	0			c.T1957C						.						112.0	113.0	113.0					13																	42385467		2203	4300	6503	SO:0001819	synonymous_variant	23078	exon17			CCGCTAATGATTG	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1957T>C	chr13.hg19:g.42385467A>G		116.0	0.0		94.0	11.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Silent	SNP	ENST00000379310.3	hg19	CCDS41881.1																																																																																			.	.		0.388	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
ING1	3621	hgsc.bcm.edu	37	13	111371917	111371917	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr13:111371917G>A	ENST00000375774.3	+	2	1369	c.907G>A	c.(907-909)Gag>Aag	p.E303K	ING1_ENST00000338450.7_Missense_Mutation_p.E116K|ING1_ENST00000333219.7_Missense_Mutation_p.E160K|ING1_ENST00000375775.3_Missense_Mutation_p.E91K	NM_005537.4	NP_005528.3	Q9UK53	ING1_HUMAN	inhibitor of growth family, member 1	303					cell cycle (GO:0007049)|chromatin modification (GO:0016568)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell death (GO:0010941)	nucleus (GO:0005634)	methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(6)|lung(1)|ovary(1)	12	all_lung(23;3.61e-05)|Lung NSC(43;0.00144)|Lung SC(71;0.0753)|all_neural(89;0.077)|Medulloblastoma(90;0.148)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CGAGAACCGTGAGAACGCGTC	0.652																																					p.E303K		Atlas-SNP	.											.	ING1	106	.	0			c.G907A						.						51.0	42.0	45.0					13																	111371917		2200	4299	6499	SO:0001583	missense	3621	exon2			AACCGTGAGAACG		CCDS9515.1, CCDS9516.1, CCDS9517.1, CCDS9518.1	13q34	2013-01-28			ENSG00000153487	ENSG00000153487		"""Zinc fingers, PHD-type"""	6062	protein-coding gene	gene with protein product	"""inhibitor of growth 1"", ""tumor suppressor ING1"", ""growth inhibitor ING1"", ""growth inhibitory protein ING1"""	601566				8944021, 9186514	Standard	NM_198219		Approved	p33ING1, p33ING1b, p24ING1c, p33, p47, p47ING1a	uc001vri.3	Q9UK53	OTTHUMG00000017346	ENST00000375774.3:c.907G>A	chr13.hg19:g.111371917G>A	ENSP00000364929:p.Glu303Lys	239.0	0.0		289.0	69.0	NM_005537	O00532|O43658|Q53ZR3|Q5T9G8|Q5T9G9|Q5T9H0|Q5T9H1|Q9H007|Q9HD98|Q9HD99|Q9NS83|Q9P0U6|Q9UBC6|Q9UIJ1|Q9UIJ2|Q9UIJ3|Q9UIJ4|Q9UK52	Missense_Mutation	SNP	ENST00000375774.3	hg19	CCDS9517.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.381824	0.42207	.	.	ENSG00000153487	ENST00000338450;ENST00000333219;ENST00000375775;ENST00000375774	T;T;T;T	0.42513	0.97;0.97;0.97;0.97	5.36	5.36	0.76844	.	0.049125	0.85682	D	0.000000	T	0.59376	0.2189	L	0.60455	1.87	0.58432	D	0.999998	D;P;D	0.69078	0.997;0.877;0.99	P;B;D	0.72982	0.815;0.411;0.979	T	0.51332	-0.8719	10	0.12430	T	0.62	-37.3868	19.0766	0.93165	0.0:0.0:1.0:0.0	.	303;160;116	Q9UK53;Q5T9H0;Q9UK53-4	ING1_HUMAN;.;.	K	116;160;91;303	ENSP00000345202:E116K;ENSP00000328436:E160K;ENSP00000364930:E91K;ENSP00000364929:E303K	ENSP00000328436:E160K	E	+	1	0	ING1	110169918	1.000000	0.71417	0.945000	0.38365	0.133000	0.20885	7.219000	0.78000	2.506000	0.84524	0.491000	0.48974	GAG	.	.		0.652	ING1-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000045770.2	NM_005537	
CUL4A	8451	hgsc.bcm.edu	37	13	113882334	113882334	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr13:113882334G>T	ENST00000375440.4	+	4	497	c.413G>T	c.(412-414)tGc>tTc	p.C138F	CUL4A_ENST00000326335.4_Missense_Mutation_p.C38F|CUL4A_ENST00000463426.1_3'UTR|CUL4A_ENST00000451881.1_Missense_Mutation_p.C38F|CUL4A_ENST00000375441.3_Missense_Mutation_p.C38F	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	138					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			ATTAACACGTGCTGGCAGGAC	0.383																																					p.C138F		Atlas-SNP	.											.	CUL4A	50	.	0			c.G413T						.						85.0	82.0	83.0					13																	113882334		2203	4300	6503	SO:0001583	missense	8451	exon4			ACACGTGCTGGCA	U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.413G>T	chr13.hg19:g.113882334G>T	ENSP00000364589:p.Cys138Phe	116.0	0.0		110.0	40.0	NM_001008895	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	ENST00000375440.4	hg19	CCDS41908.1	.	.	.	.	.	.	.	.	.	.	G	14.72	2.620332	0.46736	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78	5.51	5.51	0.81932	Cullin, N-terminal (1);Cullin repeat-like-containing domain (1);	0.047489	0.85682	D	0.000000	T	0.71298	0.3323	L	0.59436	1.845	0.80722	D	1	B	0.14438	0.01	B	0.20384	0.029	T	0.66980	-0.5786	10	0.09843	T	0.71	-28.2997	19.4545	0.94882	0.0:0.0:1.0:0.0	.	138	Q13619	CUL4A_HUMAN	F	38;38;38;138	ENSP00000364590:C38F;ENSP00000389118:C38F;ENSP00000322132:C38F;ENSP00000364589:C138F	ENSP00000322132:C38F	C	+	2	0	CUL4A	112930335	1.000000	0.71417	0.998000	0.56505	0.363000	0.29612	9.553000	0.98118	2.590000	0.87494	0.650000	0.86243	TGC	.	.		0.383	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045888.3	NM_003589	
L3HYPDH	112849	hgsc.bcm.edu	37	14	59953512	59953512	+	5'Flank	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr14:59953512G>A	ENST00000247194.4	-	0	0				JKAMP_ENST00000356057.5_Missense_Mutation_p.G37E|JKAMP_ENST00000425728.2_Missense_Mutation_p.G23E|JKAMP_ENST00000554271.1_Missense_Mutation_p.G43E|JKAMP_ENST00000557560.1_3'UTR|RP11-701B16.2_ENST00000554253.1_RNA|JKAMP_ENST00000261247.9_Missense_Mutation_p.G29E|JKAMP_ENST00000556985.1_Missense_Mutation_p.G29E	NM_144581.1	NP_653182.1	Q96EM0	T3HPD_HUMAN	L-3-hydroxyproline dehydratase (trans-)						metabolic process (GO:0008152)		hydro-lyase activity (GO:0016836)|trans-L-3-hydroxyproline dehydratase activity (GO:0050346)									L-Proline(DB00172)	GAAATATATGGAGAATGTGGG	0.299																																					p.G29E		Atlas-SNP	.											JKAMP_ENST00000356057,NS,carcinoma,0,2	JKAMP	49	.	0			c.G86A						.						82.0	80.0	81.0					14																	59953512		1791	4067	5858	SO:0001631	upstream_gene_variant	51528	exon2			TATATGGAGAATG	AI762327	CCDS9739.1	14q23.1	2012-08-15	2012-08-15	2012-08-15	ENSG00000126790	ENSG00000126790	4.2.1.77		20488	protein-coding gene	gene with protein product	"""trans-L-3-hydroxyproline dehydratase"""	614811	"""chromosome 14 open reading frame 149"""	C14orf149		22528483	Standard	NM_144581		Approved	FLJ25436	uc001xee.1	Q96EM0	OTTHUMG00000028941		chr14.hg19:g.59953512G>A	Exception_encountered	85.0	0.0		96.0	17.0	NM_016475	Q96LJ5	Missense_Mutation	SNP	ENST00000247194.4	hg19	CCDS9739.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.942180	0.73672	.	.	ENSG00000050130	ENST00000261247;ENST00000425728;ENST00000556985;ENST00000554271;ENST00000554795;ENST00000356057	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.77405	0.4125	M	0.66939	2.045	0.58432	D	0.999999	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	D;D;D;D	0.66847	0.947;0.947;0.947;0.947	T	0.78780	-0.2070	9	0.56958	D	0.05	-14.4716	18.4684	0.90763	0.0:0.0:1.0:0.0	.	43;23;37;29	G3V2M4;Q9P055-3;Q9P055-5;Q9P055-4	.;.;.;.	E	29;23;29;43;37;37	.	ENSP00000261247:G29E	G	+	2	0	JKAMP	59023265	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.802000	0.62539	2.541000	0.85698	0.655000	0.94253	GGA	.	.		0.299	L3HYPDH-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000072254.5	NM_144581	
FLRT2	23768	hgsc.bcm.edu	37	14	86089391	86089391	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr14:86089391G>A	ENST00000330753.4	+	2	2300	c.1533G>A	c.(1531-1533)gaG>gaA	p.E511E	FLRT2_ENST00000554746.1_Silent_p.E511E	NM_013231.4	NP_037363.1	O43155	FLRT2_HUMAN	fibronectin leucine rich transmembrane protein 2	511	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)|regulation of neuron migration (GO:2001222)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(21)|lung(27)|ovary(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	73				BRCA - Breast invasive adenocarcinoma(234;0.0319)		TTTGTTCAGAGGCCACCACCC	0.557																																					p.E511E		Atlas-SNP	.											.	FLRT2	168	.	0			c.G1533A						.						122.0	114.0	117.0					14																	86089391		2203	4300	6503	SO:0001819	synonymous_variant	23768	exon2			TTCAGAGGCCACC	AF169676	CCDS9877.1	14q24-q32	2013-02-11				ENSG00000185070		"""Fibronectin type III domain containing"""	3761	protein-coding gene	gene with protein product		604807				10644439, 16872596	Standard	XM_005267490		Approved		uc001xvr.3	O43155		ENST00000330753.4:c.1533G>A	chr14.hg19:g.86089391G>A		150.0	0.0		153.0	40.0	NM_013231	A0AV84|B7ZLP3	Silent	SNP	ENST00000330753.4	hg19	CCDS9877.1																																																																																			.	.		0.557	FLRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413193.1		
TMC3	342125	hgsc.bcm.edu	37	15	81625501	81625501	+	Silent	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr15:81625501A>T	ENST00000359440.5	-	22	2697	c.2562T>A	c.(2560-2562)ccT>ccA	p.P854P	RP11-761I4.3_ENST00000559781.1_RNA|RP11-761I4.3_ENST00000560851.1_RNA|RP11-761I4.3_ENST00000560973.1_RNA|TMC3_ENST00000558726.1_Silent_p.P855P	NM_001080532.1	NP_001074001.1			transmembrane channel-like 3											autonomic_ganglia(2)|breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	34						TTCGGAAAAGAGGTTCTGAGT	0.537																																					p.P854P		Atlas-SNP	.											.	TMC3	112	.	0			c.T2562A						.						146.0	143.0	144.0					15																	81625501		1987	4184	6171	SO:0001819	synonymous_variant	342125	exon22			GAAAAGAGGTTCT	AY263163	CCDS45324.1	15q24.3	2006-11-24				ENSG00000188869			22995	protein-coding gene	gene with protein product						12906855, 12812529	Standard	NM_001080532		Approved		uc021ssk.1	Q7Z5M5		ENST00000359440.5:c.2562T>A	chr15.hg19:g.81625501A>T		135.0	0.0		115.0	14.0	NM_001080532		Silent	SNP	ENST00000359440.5	hg19	CCDS45324.1																																																																																			.	.		0.537	TMC3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000417795.3	NM_181841	
ZSCAN2	54993	hgsc.bcm.edu	37	15	85164886	85164886	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr15:85164886C>A	ENST00000448803.2	+	3	1752	c.1460C>A	c.(1459-1461)tCc>tAc	p.S487Y	ZSCAN2_ENST00000485222.2_Intron|ZSCAN2_ENST00000541040.1_Intron|ZSCAN2_ENST00000327179.6_Missense_Mutation_p.S486Y|ZSCAN2_ENST00000538076.1_Intron|ZSCAN2_ENST00000546148.1_Missense_Mutation_p.S487Y|ZSCAN2_ENST00000358472.3_Missense_Mutation_p.S337Y	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	487					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		AGCTGGAGCTCCAACCTCCTC	0.577																																					p.S487Y		Atlas-SNP	.											.	ZSCAN2	43	.	0			c.C1460A						.						87.0	78.0	81.0					15																	85164886		2203	4299	6502	SO:0001583	missense	54993	exon3			GGAGCTCCAACCT	BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.1460C>A	chr15.hg19:g.85164886C>A	ENSP00000410198:p.Ser487Tyr	65.0	0.0		78.0	10.0	NM_181877	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Missense_Mutation	SNP	ENST00000448803.2	hg19	CCDS10329.2	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926048	0.52759	.	.	ENSG00000176371	ENST00000448803;ENST00000546148;ENST00000358472;ENST00000327179;ENST00000379353	T;T;T;T	0.18502	2.21;2.21;2.21;2.21	4.87	4.87	0.63330	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000040	T	0.30947	0.0781	L	0.38649	1.16	0.80722	D	1	D;P	0.89917	1.0;0.649	D;B	0.74674	0.984;0.092	T	0.01561	-1.1324	9	.	.	.	-34.5536	15.4721	0.75446	0.0:1.0:0.0:0.0	.	487;487	A8K5A9;Q7Z7L9	.;ZSCA2_HUMAN	Y	487;487;337;486;468	ENSP00000410198:S487Y;ENSP00000445451:S487Y;ENSP00000351257:S337Y;ENSP00000325123:S486Y	.	S	+	2	0	ZSCAN2	82965890	0.000000	0.05858	1.000000	0.80357	0.996000	0.88848	0.269000	0.18589	2.237000	0.73441	0.655000	0.94253	TCC	.	.		0.577	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000396956.1	NM_017894	
CENPT	80152	hgsc.bcm.edu	37	16	67862725	67862725	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr16:67862725C>T	ENST00000562787.1	-	14	1850	c.1302G>A	c.(1300-1302)gaG>gaA	p.E434E	CENPT_ENST00000564817.1_Silent_p.E379E|CENPT_ENST00000440851.2_Silent_p.E434E|CENPT_ENST00000562947.1_5'Flank|CENPT_ENST00000219172.3_Silent_p.E434E	NM_025082.3	NP_079358.3	Q96BT3	CENPT_HUMAN	centromere protein T	434					chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|kinetochore assembly (GO:0051382)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(2)|lung(6)|urinary_tract(1)	10		Acute lymphoblastic leukemia(13;0.000299)|all_hematologic(13;0.0184)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00429)|Epithelial(162;0.019)|all cancers(182;0.124)		CCAACAGAGGCTCTGCAGGCT	0.582																																					p.E434E		Atlas-SNP	.											.	CENPT	26	.	0			c.G1302A						.						56.0	62.0	60.0					16																	67862725		1915	4125	6040	SO:0001819	synonymous_variant	80152	exon14			CAGAGGCTCTGCA	AK056097	CCDS42182.1	16q22.1	2013-11-05	2006-06-15	2006-06-15		ENSG00000102901			25787	protein-coding gene	gene with protein product		611510	"""chromosome 16 open reading frame 56"""	C16orf56		16622420, 16622419	Standard	NM_025082		Approved	FLJ13111, CENP-T	uc002eun.4	Q96BT3		ENST00000562787.1:c.1302G>A	chr16.hg19:g.67862725C>T		62.0	0.0		69.0	17.0	NM_025082	Q96I29|Q96IC6|Q96NK9|Q9H901	Silent	SNP	ENST00000562787.1	hg19	CCDS42182.1																																																																																			.	.		0.582	CENPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000422020.1	NM_025082	
TP53	7157	hgsc.bcm.edu	37	17	7577095	7577095	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:7577095G>C	ENST00000269305.4	-	8	1032	c.843C>G	c.(841-843)gaC>gaG	p.D281E	TP53_ENST00000420246.2_Missense_Mutation_p.D281E|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Missense_Mutation_p.D281E|TP53_ENST00000455263.2_Missense_Mutation_p.D281E|TP53_ENST00000445888.2_Missense_Mutation_p.D281E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281E(28)|p.R282W(10)|p.0?(8)|p.D281D(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282fs*24(1)|p.D281R(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTGCGCCGGTCTCTCCCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.D281E	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000455263,NS,adenocarcinoma,-1,1	TP53	33396	.	72	Substitution - Missense(39)|Deletion - In frame(8)|Whole gene deletion(8)|Substitution - coding silent(5)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - Frameshift(1)|Insertion - In frame(1)	skin(12)|upper_aerodigestive_tract(8)|ovary(8)|haematopoietic_and_lymphoid_tissue(7)|breast(6)|lung(5)|central_nervous_system(4)|bone(4)|urinary_tract(3)|oesophagus(3)|liver(3)|stomach(2)|endometrium(2)|large_intestine(1)|vulva(1)|genital_tract(1)|pancreas(1)|prostate(1)	c.C843G						.						82.0	70.0	74.0					17																	7577095		2203	4300	6503	SO:0001583	missense	7157	exon8	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	GCGCCGGTCTCTC	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.843C>G	chr17.hg19:g.7577095G>C	ENSP00000269305:p.Asp281Glu	89.0	0.0		64.0	40.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.105939	0.77096	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	4.99	0.696	0.18075	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	M	0.92649	3.33	0.53005	D	0.999961	D;D;D;P	0.71674	0.993;0.998;0.995;0.916	D;D;D;D	0.91635	0.965;0.999;0.951;0.943	D	0.98567	1.0644	10	0.87932	D	0	-25.6697	7.6418	0.28298	0.4422:0.0:0.5578:0.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	281;281;281;281;281;270;149	ENSP00000352610:D281E;ENSP00000269305:D281E;ENSP00000398846:D281E;ENSP00000391127:D281E;ENSP00000391478:D281E;ENSP00000425104:D149E	ENSP00000269305:D281E	D	-	3	2	TP53	7517820	1.000000	0.71417	0.915000	0.36163	0.964000	0.63967	1.949000	0.40313	0.286000	0.22352	0.462000	0.41574	GAC	.	.		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
RPL19	6143	hgsc.bcm.edu	37	17	37357506	37357506	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:37357506C>T	ENST00000225430.4	+	2	108	c.46C>T	c.(46-48)Cgc>Tgc	p.R16C	RPL19_ENST00000582193.1_Missense_Mutation_p.R14C|RPL19_ENST00000579260.1_Missense_Mutation_p.R14C|RPL19_ENST00000579374.1_Missense_Mutation_p.R13C	NM_000981.3	NP_000972.1	P84098	RL19_HUMAN	ribosomal protein L19	16					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7						TAGTGTCCTCCGCTGTGGCAA	0.498																																					p.R16C		Atlas-SNP	.											.	RPL19	18	.	0			c.C46T						.						90.0	87.0	88.0					17																	37357506		1894	4120	6014	SO:0001583	missense	6143	exon2			GTCCTCCGCTGTG		CCDS42312.1	17q12	2012-09-20			ENSG00000108298	ENSG00000108298		"""L ribosomal proteins"""	10312	protein-coding gene	gene with protein product	"""60S ribosomal protein L19"", ""ribosomal protein L19, cytosolic, N-terminus truncated"""	180466				1577483	Standard	XM_005257564		Approved	FLJ27452, MGC71997, DKFZp779D216, L19	uc002hrq.1	P84098	OTTHUMG00000178979	ENST00000225430.4:c.46C>T	chr17.hg19:g.37357506C>T	ENSP00000225430:p.Arg16Cys	50.0	0.0		66.0	11.0	NM_000981	B2R4K2|P14118|P22908|Q502Y6|Q7Z6E4	Missense_Mutation	SNP	ENST00000225430.4	hg19	CCDS42312.1	.	.	.	.	.	.	.	.	.	.	c	15.76	2.927553	0.52759	.	.	ENSG00000108298	ENST00000225430	.	.	.	4.7	3.68	0.42216	Ribosomal protein L19/L19e conserved site (1);Ribosomal protein L19/L19e (2);Ribosomal protein L19/L19e, domain 1 (1);	0.068449	0.64402	D	0.000018	T	0.45657	0.1353	L	0.40543	1.245	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.45527	-0.9255	9	0.46703	T	0.11	.	9.5757	0.39457	0.1407:0.7818:0.0:0.0775	.	16	P84098	RL19_HUMAN	C	16	.	ENSP00000225430:R16C	R	+	1	0	RPL19	34611032	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	4.680000	0.61656	2.169000	0.68431	0.313000	0.20887	CGC	.	.		0.498	RPL19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000444190.1	NM_000981	
ABCC3	8714	hgsc.bcm.edu	37	17	48746279	48746279	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:48746279A>C	ENST00000285238.8	+	15	2016	c.1936A>C	c.(1936-1938)Agc>Cgc	p.S646R		NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	646	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	CACTCTGCACAGGTACCAGCT	0.597																																					p.S646R		Atlas-SNP	.											.	ABCC3	138	.	0			c.A1936C						.						102.0	74.0	83.0					17																	48746279		2203	4300	6503	SO:0001630	splice_region_variant	8714	exon15			CTGCACAGGTACC	Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1937+1A>C	chr17.hg19:g.48746279A>C		76.0	0.0		86.0	37.0	NM_003786	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	ENST00000285238.8	hg19	CCDS32681.1	.	.	.	.	.	.	.	.	.	.	A	6.733	0.503938	0.12822	.	.	ENSG00000108846	ENST00000285238	D	0.90620	-2.7	4.8	3.71	0.42584	ABC transporter-like (1);	0.237616	0.40222	N	0.001157	T	0.81702	0.4878	N	0.21508	0.67	0.45541	D	0.998491	P	0.48503	0.911	P	0.45037	0.467	T	0.77965	-0.2389	10	0.32370	T	0.25	-31.5622	2.6457	0.04983	0.6218:0.0:0.1667:0.2115	.	646	O15438	MRP3_HUMAN	R	646	ENSP00000285238:S646R	ENSP00000285238:S646R	S	+	1	0	ABCC3	46101278	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	1.475000	0.35409	1.935000	0.56089	0.397000	0.26171	AGC	.	.		0.597	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368083.2	NM_020038	Missense_Mutation
EXOC7	23265	hgsc.bcm.edu	37	17	74093950	74093950	+	Missense_Mutation	SNP	C	C	A	rs117225564		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:74093950C>A	ENST00000335146.7	-	5	620	c.567G>T	c.(565-567)gaG>gaT	p.E189D	EXOC7_ENST00000467929.2_Missense_Mutation_p.E148D|EXOC7_ENST00000405575.4_Missense_Mutation_p.E189D|EXOC7_ENST00000589210.1_Missense_Mutation_p.E189D|EXOC7_ENST00000332065.5_Missense_Mutation_p.E189D|EXOC7_ENST00000607838.1_Missense_Mutation_p.E189D|EXOC7_ENST00000411744.2_Missense_Mutation_p.E189D			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	189					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGGCAGGTGCTCCAGGGTCA	0.597																																					p.E189D		Atlas-SNP	.											.	EXOC7	47	.	0			c.G567T						.						104.0	86.0	92.0					17																	74093950		2203	4300	6503	SO:0001583	missense	23265	exon5			CAGGTGCTCCAGG	BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.567G>T	chr17.hg19:g.74093950C>A	ENSP00000334100:p.Glu189Asp	124.0	0.0		144.0	63.0	NM_001145298	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	ENST00000335146.7	hg19	CCDS45782.1	.	.	.	.	.	.	.	.	.	.	C	18.78	3.697089	0.68386	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744;ENST00000405068;ENST00000420116	.	.	.	4.99	4.99	0.66335	Cullin repeat-like-containing domain (1);	0.111990	0.64402	D	0.000013	T	0.63686	0.2532	L	0.55481	1.735	0.80722	D	1	P;B;P;B;P;B;D;B	0.71674	0.707;0.114;0.509;0.294;0.819;0.131;0.998;0.043	P;B;B;B;B;B;D;B	0.65987	0.518;0.038;0.034;0.199;0.337;0.044;0.94;0.025	T	0.59096	-0.7518	9	0.07030	T	0.85	-36.6713	11.1089	0.48221	0.0:0.9157:0.0:0.0843	.	189;189;148;148;189;189;189;189	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5-4;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;.;EXOC7_HUMAN;.;.	D	189;109;189;189;189;148;189;189;74	.	ENSP00000333806:E189D	E	-	3	2	EXOC7	71605545	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	0.757000	0.26433	2.598000	0.87819	0.563000	0.77884	GAG	.	C|0.999;T|0.001		0.597	EXOC7-006	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000319768.2	NM_015219	
RALBP1	10928	hgsc.bcm.edu	37	18	9535711	9535711	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr18:9535711G>A	ENST00000019317.4	+	10	1967	c.1744G>A	c.(1744-1746)Gag>Aag	p.E582K	RALBP1_ENST00000383432.3_Missense_Mutation_p.E582K			Q15311	RBP1_HUMAN	ralA binding protein 1	582					ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	TGAGGAGCGCGAGGCCATCAT	0.557																																					p.E582K		Atlas-SNP	.											.	RALBP1	48	.	0			c.G1744A						.						21.0	19.0	20.0					18																	9535711		2203	4299	6502	SO:0001583	missense	10928	exon10			GAGCGCGAGGCCA	L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1744G>A	chr18.hg19:g.9535711G>A	ENSP00000019317:p.Glu582Lys	103.0	0.0		87.0	22.0	NM_006788	D3DUI0	Missense_Mutation	SNP	ENST00000019317.4	hg19	CCDS11845.1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081002	0.76528	.	.	ENSG00000017797	ENST00000019317;ENST00000383432	T;T	0.11277	2.79;2.79	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.11793	0.0287	M	0.63843	1.955	0.80722	D	1	P	0.47302	0.893	B	0.30105	0.111	T	0.15350	-1.0440	10	0.36615	T	0.2	-13.122	18.7058	0.91637	0.0:0.0:1.0:0.0	.	582	Q15311	RBP1_HUMAN	K	582	ENSP00000019317:E582K;ENSP00000372924:E582K	ENSP00000019317:E582K	E	+	1	0	RALBP1	9525711	1.000000	0.71417	0.961000	0.40146	0.870000	0.49936	9.144000	0.94629	2.478000	0.83669	0.655000	0.94253	GAG	.	.		0.557	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254479.1	NM_006788	
SPIRE1	56907	hgsc.bcm.edu	37	18	12464951	12464951	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr18:12464951T>C	ENST00000409402.4	-	11	1678	c.1411A>G	c.(1411-1413)Acg>Gcg	p.T471A	SPIRE1_ENST00000464481.1_5'UTR|SPIRE1_ENST00000453447.2_Missense_Mutation_p.T337A|SPIRE1_ENST00000410092.3_Missense_Mutation_p.T457A|SPIRE1_ENST00000383356.2_Missense_Mutation_p.T298A|SPIRE1_ENST00000309836.5_Missense_Mutation_p.T260A	NM_001128626.1	NP_001122098.1			spire-type actin nucleation factor 1											breast(3)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)	28						TTGTGCAGCGTTTCTTCCTGA	0.453																																					p.T471A		Atlas-SNP	.											.	SPIRE1	120	.	0			c.A1411G						.						75.0	62.0	66.0					18																	12464951		2203	4300	6503	SO:0001583	missense	56907	exon11			GCAGCGTTTCTTC	AL833817	CCDS32790.2, CCDS45829.1, CCDS45830.1	18p11.21	2013-08-27	2013-08-27		ENSG00000134278	ENSG00000134278			30622	protein-coding gene	gene with protein product		609216	"""spire homolog 1 (Drosophila)"", ""spire family actin nucleation factor 1"""			10574461, 11747823	Standard	NM_001128626		Approved	spir-1, KIAA1135	uc002kre.3	Q08AE8	OTTHUMG00000153940	ENST00000409402.4:c.1411A>G	chr18.hg19:g.12464951T>C	ENSP00000387266:p.Thr471Ala	38.0	0.0		43.0	20.0	NM_001128626		Missense_Mutation	SNP	ENST00000409402.4	hg19	CCDS45829.1	.	.	.	.	.	.	.	.	.	.	T	0.968	-0.700975	0.03255	.	.	ENSG00000134278	ENST00000453447;ENST00000409402;ENST00000410092;ENST00000309836;ENST00000383356	T;T;T;T;T	0.42513	0.98;1.59;1.56;0.98;0.97	5.49	-3.27	0.05048	.	0.787769	0.12303	N	0.480905	T	0.25975	0.0633	L	0.46157	1.445	0.09310	N	1	B;B;B	0.12013	0.005;0.001;0.004	B;B;B	0.10450	0.005;0.002;0.004	T	0.36744	-0.9735	10	0.08179	T	0.78	-3.1922	6.2809	0.21007	0.1592:0.3839:0.0:0.4569	.	457;260;471	Q08AE8-2;B4DWX0;Q08AE8	.;.;SPIR1_HUMAN	A	337;471;457;260;298	ENSP00000407050:T337A;ENSP00000387266:T471A;ENSP00000387226:T457A;ENSP00000309661:T260A;ENSP00000372847:T298A	ENSP00000309661:T260A	T	-	1	0	SPIRE1	12454951	0.046000	0.20272	0.023000	0.16930	0.461000	0.32589	-0.096000	0.11059	-0.334000	0.08463	0.460000	0.39030	ACG	.	.		0.453	SPIRE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000333109.2	XM_290818	
FAM210A	125228	hgsc.bcm.edu	37	18	13681644	13681644	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr18:13681644A>T	ENST00000322247.3	-	3	820	c.433T>A	c.(433-435)Tct>Act	p.S145T	FAM210A_ENST00000588475.1_5'UTR|FAM210A_ENST00000402563.1_Missense_Mutation_p.S145T	NM_001098801.1	NP_001092271.1	Q96ND0	F210A_HUMAN	family with sequence similarity 210, member A	145	DUF1279.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)											CAAACACCAGAAGTTATTAGA	0.333																																					p.S145T		Atlas-SNP	.											.	.	.	.	0			c.T433A						.						81.0	79.0	80.0					18																	13681644		2203	4300	6503	SO:0001583	missense	125228	exon3			CACCAGAAGTTAT	AK055618	CCDS11866.1	18p11.21	2011-11-24	2011-11-24	2011-11-24	ENSG00000177150	ENSG00000177150			28346	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 19"""	C18orf19		14702039	Standard	NM_152352		Approved	MGC24180, HsT2329	uc010dli.3	Q96ND0	OTTHUMG00000131719	ENST00000322247.3:c.433T>A	chr18.hg19:g.13681644A>T	ENSP00000323635:p.Ser145Thr	189.0	0.0		162.0	48.0	NM_001098801	D3DUJ4	Missense_Mutation	SNP	ENST00000322247.3	hg19	CCDS11866.1	.	.	.	.	.	.	.	.	.	.	A	27.4	4.824976	0.90955	.	.	ENSG00000177150	ENST00000322247;ENST00000402563	T;T	0.40476	1.03;1.03	5.51	5.51	0.81932	Domain of unknown function DUF1279 (1);	0.000000	0.85682	D	0.000000	T	0.71126	0.3303	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.78191	-0.2300	10	0.72032	D	0.01	-21.9681	15.6324	0.76920	1.0:0.0:0.0:0.0	.	145	Q96ND0	CR019_HUMAN	T	145	ENSP00000323635:S145T;ENSP00000386115:S145T	ENSP00000323635:S145T	S	-	1	0	C18orf19	13671644	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.198000	0.94994	2.080000	0.62538	0.533000	0.62120	TCT	.	.		0.333	FAM210A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254637.1	NM_152352	
TPGS1	91978	hgsc.bcm.edu	37	19	519039	519039	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:519039G>A	ENST00000359315.5	+	2	697	c.489G>A	c.(487-489)ccG>ccA	p.P163P		NM_033513.2	NP_277048.2	Q6ZTW0	TPGS1_HUMAN	tubulin polyglutamylase complex subunit 1	163					adult behavior (GO:0030534)|multicellular organismal development (GO:0007275)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|synaptic transmission (GO:0007268)|vesicle localization (GO:0051648)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|motile cilium (GO:0031514)	tubulin-glutamic acid ligase activity (GO:0070740)										TGGTGGCGCCGCTGCTGCGCA	0.726																																					p.P163P		Atlas-SNP	.											.	.	.	.	0			c.G489A						.						5.0	8.0	7.0					19																	519039		1999	4033	6032	SO:0001819	synonymous_variant	91978	exon2			GGCGCCGCTGCTG	BC009520	CCDS42454.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000141933	ENSG00000141933			25058	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 20"""	C19orf20		11441184, 12972506	Standard	NM_033513		Approved	GTRGEO22, PGs1	uc002lou.3	Q6ZTW0		ENST00000359315.5:c.489G>A	chr19.hg19:g.519039G>A		62.0	0.0		49.0	21.0	NM_033513	Q96GE2	Silent	SNP	ENST00000359315.5	hg19	CCDS42454.1																																																																																			.	.		0.726	TPGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451887.2	NM_033513	
PLPPR3	79948	hgsc.bcm.edu	37	19	815228	815228	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:815228A>G	ENST00000520876.3	-	4	439	c.361T>C	c.(361-363)Tgc>Cgc	p.C121R	MIR3187_ENST00000583431.1_RNA|LPPR3_ENST00000359894.2_Missense_Mutation_p.C121R	NM_001270366.1	NP_001257295.1	Q6T4P5	LPPR3_HUMAN		121						integral component of membrane (GO:0016021)	phosphatidate phosphatase activity (GO:0008195)										TTGAAGTTGCAGCCGCCGGCG	0.697																																					p.C121R		Atlas-SNP	.											.	.	.	.	0			c.T361C						.						18.0	23.0	21.0					19																	815228		2170	4274	6444	SO:0001583	missense	0	exon4			AGTTGCAGCCGCC																												ENST00000520876.3:c.361T>C	chr19.hg19:g.815228A>G	ENSP00000430297:p.Cys121Arg	57.0	0.0		56.0	39.0	NM_001270366	Q86XQ4|Q96EH1|Q9BQF9|Q9HAJ4	Missense_Mutation	SNP	ENST00000520876.3	hg19	CCDS58636.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.515767	0.85495	.	.	ENSG00000129951	ENST00000300947;ENST00000359894;ENST00000520876;ENST00000521445	T;T	0.50813	0.73;0.73	4.32	4.32	0.51571	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.68851	0.3046	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.73757	-0.3882	10	0.87932	D	0	-30.2469	11.4343	0.50060	1.0:0.0:0.0:0.0	.	121;121;121	Q6T4P5-2;Q6T4P5;Q6T4P5-3	.;LPPR3_HUMAN;.	R	121	ENSP00000352962:C121R;ENSP00000430297:C121R	ENSP00000300947:C121R	C	-	1	0	AC006273.1	766228	1.000000	0.71417	1.000000	0.80357	0.893000	0.52053	7.024000	0.76443	1.585000	0.49928	0.374000	0.22700	TGC	.	.		0.697	LPPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379096.3		
GTF2F1	2962	hgsc.bcm.edu	37	19	6387475	6387475	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:6387475T>C	ENST00000394456.5	-	5	886	c.422A>G	c.(421-423)cAc>cGc	p.H141R	GTF2F1_ENST00000429701.2_Intron|CTB-180A7.6_ENST00000599584.1_RNA	NM_002096.2	NP_002087.2	P35269	T2FA_HUMAN	general transcription factor IIF, polypeptide 1, 74kDa	141					7-methylguanosine mRNA capping (GO:0006370)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cell junction (GO:0030054)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIIF complex (GO:0005674)	catalytic activity (GO:0003824)|DNA binding (GO:0003677)|phosphatase activator activity (GO:0019211)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)	16						GTACCAGTTGTGCACGGGGAA	0.627																																					p.H141R		Atlas-SNP	.											.	GTF2F1	39	.	0			c.A422G						.						160.0	141.0	147.0					19																	6387475		2203	4300	6503	SO:0001583	missense	2962	exon5			CAGTTGTGCACGG		CCDS12165.1	19p13.3	2010-03-23	2002-08-29		ENSG00000125651	ENSG00000125651		"""General transcription factors"""	4652	protein-coding gene	gene with protein product		189968	"""general transcription factor IIF, polypeptide 1 (74kD subunit)"""			1734284	Standard	NM_002096		Approved	TFIIF, BTF4, RAP74, TF2F1	uc002meq.2	P35269	OTTHUMG00000168087	ENST00000394456.5:c.422A>G	chr19.hg19:g.6387475T>C	ENSP00000377969:p.His141Arg	95.0	0.0		91.0	62.0	NM_002096	B2RCS0|Q9BWN0	Missense_Mutation	SNP	ENST00000394456.5	hg19	CCDS12165.1	.	.	.	.	.	.	.	.	.	.	T	15.93	2.976948	0.53720	.	.	ENSG00000125651	ENST00000394456;ENST00000542045	T	0.41400	1.0	5.39	5.39	0.77823	Transcription Factor IIF, Rap30/Rap74, interaction (1);	0.281476	0.39083	N	0.001462	T	0.38612	0.1047	L	0.55990	1.75	0.80722	D	1	B	0.19583	0.037	B	0.21360	0.034	T	0.25916	-1.0118	10	0.48119	T	0.1	-44.3265	10.5418	0.45037	0.0:0.0:0.1621:0.8379	.	141	P35269	T2FA_HUMAN	R	141;201	ENSP00000377969:H141R	ENSP00000377969:H141R	H	-	2	0	GTF2F1	6338475	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	2.502000	0.45398	2.024000	0.59613	0.533000	0.62120	CAC	.	.		0.627	GTF2F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398033.1	NM_002096	
MUC16	94025	hgsc.bcm.edu	37	19	9089258	9089258	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:9089258A>T	ENST00000397910.4	-	1	2760	c.2557T>A	c.(2557-2559)Tct>Act	p.S853T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	853	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAAGGAGTAGATGAAGAAAAT	0.453																																					p.S853T		Atlas-SNP	.											.	MUC16	4315	.	0			c.T2557A						.						107.0	103.0	105.0					19																	9089258		1939	4137	6076	SO:0001583	missense	94025	exon1			GAGTAGATGAAGA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.2557T>A	chr19.hg19:g.9089258A>T	ENSP00000381008:p.Ser853Thr	100.0	0.0		95.0	66.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	a	3.896	-0.022967	0.07634	.	.	ENSG00000181143	ENST00000397910	T	0.02552	4.25	1.45	1.45	0.22620	.	.	.	.	.	T	0.01661	0.0053	N	0.14661	0.345	.	.	.	D	0.55172	0.97	B	0.37387	0.248	T	0.46555	-0.9183	8	0.87932	D	0	.	5.0127	0.14321	1.0:0.0:0.0:0.0	.	853	B5ME49	.	T	853	ENSP00000381008:S853T	ENSP00000381008:S853T	S	-	1	0	MUC16	8950258	0.000000	0.05858	0.003000	0.11579	0.015000	0.08874	-0.029000	0.12329	0.918000	0.36919	0.172000	0.16884	TCT	.	.		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ZNF726	730087	hgsc.bcm.edu	37	19	24115522	24115522	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:24115522A>T	ENST00000594466.1	+	4	709	c.604A>T	c.(604-606)Aaa>Taa	p.K202*	CTB-92J24.3_ENST00000596326.1_RNA|ZNF726_ENST00000575986.1_Intron|ZNF726_ENST00000334589.5_Intron|ZNF726_ENST00000322487.7_Nonsense_Mutation_p.K202*	NM_001244038.1	NP_001230967.1	A6NNF4	ZN726_HUMAN	zinc finger protein 726	202					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GAAGTCCTACAAATGTAAAGA	0.318																																					p.K202X		Atlas-SNP	.											.	.	.	.	0			c.A604T						.																																			SO:0001587	stop_gained	730087	exon4			TCCTACAAATGTA	DQ036016, BC046415	CCDS59372.1	19p12	2013-01-08			ENSG00000213967	ENSG00000213967		"""Zinc fingers, C2H2-type"", ""-"""	32462	protein-coding gene	gene with protein product							Standard	NM_001244038		Approved		uc021urw.1	A6NNF4	OTTHUMG00000167681	ENST00000594466.1:c.604A>T	chr19.hg19:g.24115522A>T	ENSP00000471516:p.Lys202*	70.0	0.0		70.0	30.0	NM_001244038	M0R0X8|Q86Y87	Nonsense_Mutation	SNP	ENST00000594466.1	hg19	CCDS59372.1	.	.	.	.	.	.	.	.	.	.	a	9.076	0.998112	0.19043	.	.	ENSG00000213967	ENST00000322487	.	.	.	0.823	-0.497	0.12023	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.7868	0.08703	0.6826:0.0:0.3174:0.0	.	.	.	.	X	202	.	ENSP00000317125:K202X	K	+	1	0	ZNF726	23907362	0.000000	0.05858	0.244000	0.24202	0.243000	0.25628	-2.800000	0.00761	0.166000	0.19597	0.165000	0.16767	AAA	.	.		0.318	ZNF726-005	PUTATIVE	not_best_in_genome_evidence|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000466443.1	XM_001715134	
LILRA2	11027	hgsc.bcm.edu	37	19	55086934	55086934	+	Silent	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:55086934C>T	ENST00000251377.3	+	6	1000	c.867C>T	c.(865-867)caC>caT	p.H289H	LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391737.1_Silent_p.H277H|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000391738.3_Silent_p.H289H|LILRA2_ENST00000251376.3_Silent_p.H289H			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	289	Ig-like C2-type 3.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		GCCCCTCCCACGGGGGCCAGT	0.652																																					p.H289H		Atlas-SNP	.											.	LILRA2	99	.	0			c.C867T						.						49.0	51.0	50.0					19																	55086934		2203	4299	6502	SO:0001819	synonymous_variant	11027	exon5			CTCCCACGGGGGC	U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.867C>T	chr19.hg19:g.55086934C>T		160.0	0.0		141.0	42.0	NM_001130917	O75020	Silent	SNP	ENST00000251377.3	hg19	CCDS46179.1																																																																																			.	.		0.652	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000140813.2		
RPN2	6185	hgsc.bcm.edu	37	20	35812641	35812641	+	Silent	SNP	G	G	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:35812641G>T	ENST00000237530.6	+	2	383	c.72G>T	c.(70-72)acG>acT	p.T24T	RPN2_ENST00000373622.5_Silent_p.T24T	NM_002951.3	NP_002942.2	P04844	RPN2_HUMAN	ribophorin II	24					aging (GO:0007568)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|gene expression (GO:0010467)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	autophagic vacuole membrane (GO:0000421)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|oligosaccharyltransferase complex (GO:0008250)|rough endoplasmic reticulum (GO:0005791)	ribosome binding (GO:0043022)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|skin(2)|stomach(1)	24		Myeloproliferative disorder(115;0.00878)				GGGCTCTGACGCCCACTCACT	0.522																																					p.T24T		Atlas-SNP	.											.	RPN2	45	.	0			c.G72T						.						134.0	106.0	116.0					20																	35812641		2203	4300	6503	SO:0001819	synonymous_variant	6185	exon2			TCTGACGCCCACT	Y00282	CCDS13291.1, CCDS46599.1	20q12-q13.1	2013-03-06			ENSG00000118705	ENSG00000118705			10382	protein-coding gene	gene with protein product	"""oligosaccharyltransferase complex subunit (non-catalytic)"""	180490					Standard	NM_002951		Approved	SWP1, RPNII, RIBIIR, RPN-II	uc002xgp.3	P04844	OTTHUMG00000032409	ENST00000237530.6:c.72G>T	chr20.hg19:g.35812641G>T		137.0	0.0		145.0	25.0	NM_002951	Q5JYR6|Q6IBA5|Q96E21|Q9BUQ3|Q9UBE1	Silent	SNP	ENST00000237530.6	hg19	CCDS13291.1																																																																																			.	.		0.522	RPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079076.2	NM_002951	
EMILIN3	90187	hgsc.bcm.edu	37	20	39992390	39992390	+	Silent	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:39992390C>A	ENST00000332312.3	-	3	594	c.402G>T	c.(400-402)acG>acT	p.T134T		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	134						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)		p.T134T(1)		biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				CCCCATGGTCCGTGAGGTGCT	0.627																																					p.T134T		Atlas-SNP	.											EMILIN3,caecum,carcinoma,0,1	EMILIN3	63	.	1	Substitution - coding silent(1)	large_intestine(1)	c.G402T						.						97.0	82.0	87.0					20																	39992390		2203	4300	6503	SO:0001819	synonymous_variant	90187	exon3			ATGGTCCGTGAGG	AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.402G>T	chr20.hg19:g.39992390C>A		121.0	0.0		125.0	22.0	NM_052846	Q495S5|Q495S6|Q495S7|Q76KT4	Silent	SNP	ENST00000332312.3	hg19	CCDS13316.1																																																																																			.	.		0.627	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000106876.2	XM_029741	
PTPRT	11122	hgsc.bcm.edu	37	20	40827954	40827954	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:40827954T>A	ENST00000373187.1	-	16	2416	c.2417A>T	c.(2416-2418)aAa>aTa	p.K806I	PTPRT_ENST00000373201.1_Missense_Mutation_p.K796I|PTPRT_ENST00000373184.1_Missense_Mutation_p.K796I|PTPRT_ENST00000373190.1_Missense_Mutation_p.K806I|PTPRT_ENST00000373198.4_Missense_Mutation_p.K825I|PTPRT_ENST00000373193.3_Missense_Mutation_p.K809I|PTPRT_ENST00000356100.2_Missense_Mutation_p.K815I			O14522	PTPRT_HUMAN	protein tyrosine phosphatase, receptor type, T	806					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|protein tyrosine phosphatase activity (GO:0004725)			NS(2)|breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(12)|large_intestine(26)|liver(1)|lung(63)|ovary(8)|pancreas(2)|prostate(5)|skin(35)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	176		Myeloproliferative disorder(115;0.00452)|Lung NSC(126;0.0573)|all_lung(126;0.0783)				GGTGGTGGGTTTGTCGGCAGA	0.557																																					p.K825I		Atlas-SNP	.											.	PTPRT	372	.	0			c.A2474T						.						184.0	195.0	191.0					20																	40827954		2046	4199	6245	SO:0001583	missense	11122	exon17			GTGGGTTTGTCGG	AF043644	CCDS42874.1, CCDS68127.1	20q12-q13	2013-02-11			ENSG00000196090	ENSG00000196090		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9682	protein-coding gene	gene with protein product		608712				9486824, 9602027	Standard	NM_133170		Approved	RPTPrho, KIAA0283	uc010ggj.3	O14522	OTTHUMG00000033040	ENST00000373187.1:c.2417A>T	chr20.hg19:g.40827954T>A	ENSP00000362283:p.Lys806Ile	136.0	0.0		128.0	16.0	NM_133170	A8E4R6|O43655|O75664|Q5W0X9|Q5W0Y1|Q9BR24|Q9BR28|Q9H0Y8|Q9NTL1|Q9NU72|Q9UBD2|Q9UJL7	Missense_Mutation	SNP	ENST00000373187.1	hg19	CCDS42874.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.176104	0.78564	.	.	ENSG00000196090	ENST00000373190;ENST00000373187;ENST00000373193;ENST00000356100;ENST00000373198;ENST00000373184;ENST00000373201	T;T;T;T;T;T;T	0.37752	1.18;1.19;1.2;1.2;1.19;1.2;1.2	6.03	6.03	0.97812	.	0.046442	0.85682	D	0.000000	T	0.44746	0.1308	L	0.52573	1.65	0.53688	D	0.999972	P;P	0.47034	0.889;0.823	P;B	0.48454	0.578;0.374	T	0.38222	-0.9671	10	0.62326	D	0.03	.	16.5582	0.84512	0.0:0.0:0.0:1.0	.	828;806	O14522-1;O14522	.;PTPRT_HUMAN	I	806;806;809;815;828;796;796	ENSP00000362286:K806I;ENSP00000362283:K806I;ENSP00000362289:K809I;ENSP00000348408:K815I;ENSP00000362294:K828I;ENSP00000362280:K796I;ENSP00000362297:K796I	ENSP00000348408:K815I	K	-	2	0	PTPRT	40261368	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	5.632000	0.67819	2.308000	0.77769	0.533000	0.62120	AAA	.	.		0.557	PTPRT-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000080315.1		
NCOA5	57727	hgsc.bcm.edu	37	20	44692024	44692024	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:44692024C>T	ENST00000290231.6	-	7	1289	c.1125G>A	c.(1123-1125)atG>atA	p.M375I		NM_020967.2	NP_066018.1	Q9HCD5	NCOA5_HUMAN	nuclear receptor coactivator 5	375					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|skin(2)|urinary_tract(1)	21		Myeloproliferative disorder(115;0.0122)				TGCTGCTCCTCATCAGCCGCT	0.567																																					p.M375I		Atlas-SNP	.											.	NCOA5	58	.	0			c.G1125A						.						60.0	54.0	56.0					20																	44692024		2203	4300	6503	SO:0001583	missense	57727	exon7			GCTCCTCATCAGC		CCDS13392.1	20q12-q13.12	2008-07-02			ENSG00000124160	ENSG00000124160			15909	protein-coding gene	gene with protein product	"""coactivator independent of AF-2"""					11780052, 11113208	Standard	XM_005260474		Approved	bA465L10.6, CIA	uc002xre.3	Q9HCD5	OTTHUMG00000032639	ENST00000290231.6:c.1125G>A	chr20.hg19:g.44692024C>T	ENSP00000290231:p.Met375Ile	35.0	0.0		43.0	26.0	NM_020967	B2RTV9|E1P5R0|Q6HA99|Q9H1F2|Q9H2T2|Q9H4Y9	Missense_Mutation	SNP	ENST00000290231.6	hg19	CCDS13392.1	.	.	.	.	.	.	.	.	.	.	C	8.872	0.949552	0.18356	.	.	ENSG00000124160	ENST00000290231	T	0.39787	1.06	5.41	3.31	0.37934	.	0.437392	0.28796	N	0.014106	T	0.17662	0.0424	N	0.03608	-0.345	0.22171	N	0.999313	B	0.02656	0.0	B	0.04013	0.001	T	0.08827	-1.0703	10	0.49607	T	0.09	-12.6995	5.3686	0.16127	0.1485:0.6233:0.1442:0.084	.	375	Q9HCD5	NCOA5_HUMAN	I	375	ENSP00000290231:M375I	ENSP00000290231:M375I	M	-	3	0	NCOA5	44125431	0.991000	0.36638	0.970000	0.41538	0.759000	0.43091	0.366000	0.20365	1.478000	0.48253	0.561000	0.74099	ATG	.	.		0.567	NCOA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079559.1	NM_020967	
SYCP2	10388	hgsc.bcm.edu	37	20	58489238	58489238	+	Silent	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:58489238G>A	ENST00000357552.3	-	11	928	c.703C>T	c.(703-705)Ctg>Ttg	p.L235L	SYCP2_ENST00000371001.2_Silent_p.L235L			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	235					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TGATGTGCCAGTTCTTGTCTT	0.299																																					p.L235L		Atlas-SNP	.											.	SYCP2	204	.	0			c.C703T						.						91.0	87.0	88.0					20																	58489238		2202	4295	6497	SO:0001819	synonymous_variant	10388	exon10			GTGCCAGTTCTTG	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.703C>T	chr20.hg19:g.58489238G>A		133.0	0.0		160.0	11.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Silent	SNP	ENST00000357552.3	hg19	CCDS13482.1																																																																																			.	.		0.299	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
SRMS	6725	hgsc.bcm.edu	37	20	62172284	62172284	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:62172284G>A	ENST00000217188.1	-	8	1394	c.1354C>T	c.(1354-1356)Ccg>Tcg	p.P452S		NM_080823.2	NP_543013.1	Q9H3Y6	SRMS_HUMAN	src-related kinase lacking C-terminal regulatory tyrosine and N-terminal myristylation sites	452	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		P -> L (in dbSNP:rs8120713). {ECO:0000269|PubMed:17344846}.		peptidyl-tyrosine autophosphorylation (GO:0038083)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|prostate(2)|stomach(1)	19	all_cancers(38;2.51e-11)|all_epithelial(29;8.27e-13)		Epithelial(9;9.69e-09)|all cancers(9;5.84e-08)|BRCA - Breast invasive adenocarcinoma(10;3.63e-06)			ACCTCCGCCGGGCAGGCAGCC	0.687																																					p.P452S		Atlas-SNP	.											.	SRMS	48	.	0			c.C1354T						.						61.0	65.0	63.0					20																	62172284		2202	4297	6499	SO:0001583	missense	6725	exon8			CCGCCGGGCAGGC		CCDS13525.1	20q13.33	2013-02-14	2003-08-22		ENSG00000125508	ENSG00000125508		"""SH2 domain containing"""	11298	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 148"""	C20orf148		7935409	Standard	NM_080823		Approved	SRM, dJ697K14.1	uc002yfi.1	Q9H3Y6	OTTHUMG00000032977	ENST00000217188.1:c.1354C>T	chr20.hg19:g.62172284G>A	ENSP00000217188:p.Pro452Ser	45.0	0.0		47.0	7.0	NM_080823		Missense_Mutation	SNP	ENST00000217188.1	hg19	CCDS13525.1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.362583	0.41902	.	.	ENSG00000125508	ENST00000217188	T	0.10763	2.84	5.17	2.92	0.33932	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.226361	0.31370	N	0.007769	T	0.12220	0.0297	L	0.47016	1.485	0.44388	D	0.997299	P	0.35944	0.529	B	0.41917	0.37	T	0.04178	-1.0971	10	0.66056	D	0.02	.	7.1483	0.25595	0.1577:0.1748:0.6675:0.0	.	452	Q9H3Y6	SRMS_HUMAN	S	452	ENSP00000217188:P452S	ENSP00000217188:P452S	P	-	1	0	SRMS	61642728	1.000000	0.71417	0.988000	0.46212	0.054000	0.15201	4.452000	0.60054	1.150000	0.42419	0.655000	0.94253	CCG	.	.		0.687	SRMS-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080148.1	NM_080823	
DSCAM	1826	hgsc.bcm.edu	37	21	41416170	41416170	+	Missense_Mutation	SNP	G	G	A	rs36025081		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr21:41416170G>A	ENST00000400454.1	-	31	5695	c.5218C>T	c.(5218-5220)Ccc>Tcc	p.P1740S		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	1740					cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				CTCGCTGTGGGCCCAGCCTTG	0.592																																					p.P1740S	Melanoma(134;970 1778 1785 21664 32388)	Atlas-SNP	.											.	DSCAM	347	.	0			c.C5218T						.						77.0	86.0	83.0					21																	41416170		2131	4240	6371	SO:0001583	missense	1826	exon31			CTGTGGGCCCAGC	AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.5218C>T	chr21.hg19:g.41416170G>A	ENSP00000383303:p.Pro1740Ser	53.0	0.0		68.0	5.0	NM_001271534	O60468	Missense_Mutation	SNP	ENST00000400454.1	hg19	CCDS42929.1	.	.	.	.	.	.	.	.	.	.	g	19.59	3.856661	0.71834	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;T	0.58060	0.36;0.46	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.60586	0.2280	L	0.27053	0.805	0.52501	D	0.999954	D	0.89917	1.0	D	0.83275	0.996	T	0.52660	-0.8546	10	0.14656	T	0.56	.	19.4936	0.95062	0.0:0.0:1.0:0.0	.	1740	O60469	DSCAM_HUMAN	S	1740;1492	ENSP00000383303:P1740S;ENSP00000385342:P1492S	ENSP00000383303:P1740S	P	-	1	0	DSCAM	40338040	1.000000	0.71417	0.993000	0.49108	0.536000	0.34869	9.751000	0.98889	2.605000	0.88082	0.655000	0.94253	CCC	.	.		0.592	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195029.1	NM_001389	
LIF	3976	hgsc.bcm.edu	37	22	30640879	30640879	+	Silent	SNP	C	C	T	rs368278663		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr22:30640879C>T	ENST00000249075.3	-	2	218	c.63G>A	c.(61-63)gcG>gcA	p.A21A	RP1-102K2.8_ENST00000608354.1_RNA|LIF_ENST00000403987.3_Intron|RP1-102K2.8_ENST00000593843.1_RNA	NM_002309.4	NP_002300.1	P15018	LIF_HUMAN	leukemia inhibitory factor	21					blood vessel remodeling (GO:0001974)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|immune response (GO:0006955)|leukemia inhibitory factor signaling pathway (GO:0048861)|lung alveolus development (GO:0048286)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|multicellular organismal development (GO:0007275)|muscle organ morphogenesis (GO:0048644)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of hormone secretion (GO:0046888)|negative regulation of meiosis (GO:0045835)|neuron development (GO:0048666)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cell proliferation (GO:0008284)|positive regulation of histone H3-K27 acetylation (GO:1901676)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein localization to nucleus (GO:1900182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|spongiotrophoblast differentiation (GO:0060708)|stem cell maintenance (GO:0019827)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|leukemia inhibitory factor receptor binding (GO:0005146)|receptor binding (GO:0005102)|RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001135)			breast(1)|lung(3)|skin(3)	7			Epithelial(10;0.171)			GGGGGCTCCCCGCCCCATGTT	0.597																																					p.A21A		Atlas-SNP	.											.	LIF	18	.	0			c.G63A						.	C		0,4406		0,0,2203	131.0	116.0	121.0		63	-8.8	0.0	22		121	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	LIF	NM_002309.3		0,2,6501	TT,TC,CC		0.0233,0.0,0.0154		21/203	30640879	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	3976	exon2			GCTCCCCGCCCCA		CCDS13872.1, CCDS58799.1	22q12.2	2012-02-09	2012-02-09		ENSG00000128342	ENSG00000128342			6596	protein-coding gene	gene with protein product	"""differentiation inhibitory activity"", ""differentiation-inducing factor"", ""hepatocyte-stimulating factor III"", ""cholinergic differentiation factor"", ""human interleukin in DA cells"""	159540				1714745, 8058719	Standard	NM_002309		Approved	CDF, DIA, HILDA	uc003agz.3	P15018	OTTHUMG00000150910	ENST00000249075.3:c.63G>A	chr22.hg19:g.30640879C>T		125.0	0.0		127.0	6.0	NM_002309	B2RCW7|B5MC23|Q52LZ2	Silent	SNP	ENST00000249075.3	hg19	CCDS13872.1																																																																																			.	.		0.597	LIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320508.1	NM_002309	
NAP1L3	4675	hgsc.bcm.edu	37	X	92927344	92927344	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chrX:92927344C>A	ENST00000373079.3	-	1	1223	c.960G>T	c.(958-960)aaG>aaT	p.K320N	FAM133A_ENST00000332647.4_5'Flank|NAP1L3_ENST00000475430.2_Missense_Mutation_p.K313N|FAM133A_ENST00000538690.1_5'Flank|FAM133A_ENST00000355813.5_5'Flank|FAM133A_ENST00000322139.4_5'Flank	NM_004538.5	NP_004529.2	Q99457	NP1L3_HUMAN	nucleosome assembly protein 1-like 3	320					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	34						TGTCAACATTCTTTAAAACAA	0.438																																					p.K320N		Atlas-SNP	.											.	NAP1L3	81	.	0			c.G960T						.						60.0	55.0	57.0					X																	92927344		2203	4298	6501	SO:0001583	missense	4675	exon1			AACATTCTTTAAA		CCDS14465.1	Xq21.3-q22	2008-08-01			ENSG00000186310	ENSG00000186310			7639	protein-coding gene	gene with protein product		300117				8976385	Standard	NM_004538		Approved	MB20, NPL3, MGC26312	uc004efq.3	Q99457	OTTHUMG00000021974	ENST00000373079.3:c.960G>T	chrX.hg19:g.92927344C>A	ENSP00000362171:p.Lys320Asn	212.0	0.0		117.0	37.0	NM_004538	B2RCM0|O60788	Missense_Mutation	SNP	ENST00000373079.3	hg19	CCDS14465.1	.	.	.	.	.	.	.	.	.	.	C	15.16	2.752359	0.49362	.	.	ENSG00000186310	ENST00000373079;ENST00000543136	T	0.28255	1.62	3.68	2.81	0.32909	.	0.048073	0.85682	D	0.000000	T	0.49218	0.1544	M	0.76002	2.32	0.32679	N	0.515783	D	0.89917	1.0	D	0.91635	0.999	T	0.59300	-0.7480	10	0.72032	D	0.01	.	6.0749	0.19909	0.0:0.8573:0.0:0.1427	.	320	Q99457	NP1L3_HUMAN	N	320;313	ENSP00000362171:K320N	ENSP00000362171:K320N	K	-	3	2	NAP1L3	92814000	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	1.818000	0.39012	0.923000	0.37045	0.529000	0.55759	AAG	.	.		0.438	NAP1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057449.1	NM_004538	
ACACA	31	hgsc.bcm.edu	37	17	35486338	35486338	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:35486338delT	ENST00000394406.2	-	47	5976	c.5786delA	c.(5785-5787)aagfs	p.K1929fs	ACACA_ENST00000335166.5_Frame_Shift_Del_p.K1851fs|ACACA_ENST00000360679.3_Frame_Shift_Del_p.K1871fs|ACACA_ENST00000361253.5_Frame_Shift_Del_p.K55fs|ACACA_ENST00000353139.5_Frame_Shift_Del_p.K1966fs	NM_198836.1	NP_942133.1	Q13085	ACACA_HUMAN	acetyl-CoA carboxylase alpha	1929	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|lipid homeostasis (GO:0055088)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|malonyl-CoA biosynthetic process (GO:2001295)|multicellular organismal protein metabolic process (GO:0044268)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|small molecule metabolic process (GO:0044281)|tissue homeostasis (GO:0001894)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(2)|breast(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(24)|lung(23)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	83		Breast(25;0.00157)|Ovarian(249;0.15)			Biotin(DB00121)	GTATGGGGTCTTTGTGGGAAC	0.473																																					p.K1966fs	Colon(23;82 258 739 2117 10493 24037 27661 34815 35438 36249)	Atlas-INDEL	.											.	ACACA	395	.	0			c.5898delG						.						155.0	129.0	138.0					17																	35486338		2203	4300	6503	SO:0001589	frameshift_variant	31	exon47			.	U19822	CCDS11317.1, CCDS11318.1, CCDS42302.1, CCDS42303.1	17q21	2014-05-06	2010-04-30		ENSG00000132142	ENSG00000278540	6.4.1.2		84	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 1"""	200350	"""acetyl-Coenzyme A carboxylase alpha"""	ACAC, ACC			Standard	NM_198837		Approved	ACC1	uc002hno.3	Q13085	OTTHUMG00000188463	ENST00000394406.2:c.5786delA	chr17.hg19:g.35486338delT	ENSP00000377928:p.Lys1929fs	143.0	0.0		128.0	46.0	NM_198834	B2RP68|Q6KEV6|Q6XDA8|Q7Z2G8|Q7Z561|Q7Z563|Q7Z564|Q86WB2|Q86WB3	Frame_Shift_Del	DEL	ENST00000394406.2	hg19	CCDS11317.1																																																																																			.	.		0.473	ACACA-009	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256696.1	NM_198836	
PGLYRP2	114770	hgsc.bcm.edu	37	19	15586526	15586526	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:15586526delG	ENST00000340880.4	-	2	1435	c.955delC	c.(955-957)cgafs	p.R320fs	PGLYRP2_ENST00000292609.4_Frame_Shift_Del_p.R320fs	NM_052890.3	NP_443122.3	Q96PD5	PGRP2_HUMAN	peptidoglycan recognition protein 2	320					defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|growth of symbiont in host (GO:0044117)|innate immune response (GO:0045087)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of natural killer cell differentiation involved in immune response (GO:0032827)|pattern recognition receptor signaling pathway (GO:0002221)|peptide amidation (GO:0001519)|peptidoglycan catabolic process (GO:0009253)|regulation of inflammatory response (GO:0050727)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)	N-acetylmuramoyl-L-alanine amidase activity (GO:0008745)|peptidoglycan binding (GO:0042834)|peptidoglycan receptor activity (GO:0016019)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(3)|prostate(2)|skin(3)|stomach(2)|urinary_tract(1)	28						TTCTGCCGTCGGAAGTTGCTG	0.637																																					p.R319fs		Atlas-INDEL	.											.	PGLYRP2	116	.	0			c.956delG						.						45.0	44.0	44.0					19																	15586526		2203	4300	6503	SO:0001589	frameshift_variant	114770	exon2			.	AY358156	CCDS12330.2	19p13.12	2010-04-27			ENSG00000161031	ENSG00000161031	3.5.1.28		30013	protein-coding gene	gene with protein product	"""peptidoglycan recognition protein L precursor"", ""peptidoglycan recognition protein-like"", ""N-acetylmuramoyl-L-alanine amidase"""	608199				11461926, 12669421, 14506276	Standard	NM_052890		Approved	PGRP-L, PGLYRPL, TAGL-like, tagL, tagL-alpha, tagl-beta, PGRPL	uc002nbf.4	Q96PD5	OTTHUMG00000150690	ENST00000340880.4:c.955delC	chr19.hg19:g.15586526delG	ENSP00000345968:p.Arg320fs	78.0	0.0		64.0	17.0	NM_052890	A8K050|A8K8C7|B2RMZ2|B7ZM33|Q68CK1|Q96N74|Q9UC60	Frame_Shift_Del	DEL	ENST00000340880.4	hg19	CCDS12330.2																																																																																			.	.		0.637	PGLYRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319626.1	NM_052890	
KMT2A	4297	hgsc.bcm.edu	37	11	118374237	118374238	+	Frame_Shift_Ins	INS	-	-	TC			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr11:118374237_118374238insTC	ENST00000389506.5	+	27	7621_7622	c.7621_7622insTC	c.(7621-7623)gaafs	p.E2541fs	KMT2A_ENST00000534358.1_Frame_Shift_Ins_p.E2544fs|KMT2A_ENST00000354520.4_Frame_Shift_Ins_p.E2503fs			Q03164	KMT2A_HUMAN	lysine (K)-specific methyltransferase 2A	2541					anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|DNA methylation (GO:0006306)|embryonic hemopoiesis (GO:0035162)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|histone H4-K16 acetylation (GO:0043984)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cellular response to drug (GO:2001040)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transporter activity (GO:0032411)|protein complex assembly (GO:0006461)|regulation of histone H3-K4 methylation (GO:0051569)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleus (GO:0005634)	AT DNA binding (GO:0003680)|chromatin binding (GO:0003682)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|identical protein binding (GO:0042802)|lysine-acetylated histone binding (GO:0070577)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)										TGCCCTGAAAGAAAGTAGTCCT	0.46																																					p.E2544fs		Atlas-INDEL	.											.	MLL	548	.	0			c.7630_7631insTC						.																																			SO:0001589	frameshift_variant	4297	exon27			.	L04284	CCDS31686.1, CCDS55791.1	11q23	2014-09-17	2013-05-09	2013-05-09	ENSG00000118058	ENSG00000118058		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7132	protein-coding gene	gene with protein product		159555	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog)"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila)"""	MLL		1720549	Standard	NM_001197104		Approved	TRX1, HRX, ALL-1, HTRX1, CXXC7, MLL1A		Q03164	OTTHUMG00000166337	Exception_encountered	chr11.hg19:g.118374237_118374238insTC	ENSP00000374157:p.Glu2541fs	105.0	0.0		73.0	24.0	NM_001197104	E9PQG7|Q13743|Q13744|Q14845|Q16364|Q59FF2|Q6UBD1|Q9HBJ3|Q9UD94|Q9UMA3	Frame_Shift_Ins	INS	ENST00000389506.5	hg19	CCDS31686.1																																																																																			.	.		0.460	KMT2A-015	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000399085.2	NM_005933	
PLCL2	23228	hgsc.bcm.edu	37	3	17051428	17051429	+	Frame_Shift_Ins	INS	-	-	A	rs77416948		TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr3:17051428_17051429insA	ENST00000418129.2	+	2	677_678	c.212_213insA	c.(211-216)ggaaaafs	p.GK71fs	PLCL2_ENST00000432376.1_Frame_Shift_Ins_p.GK71fs|PLCL2_ENST00000396755.2_Frame_Shift_Ins_p.GK71fs|PLCL2_ENST00000460467.1_3'UTR	NM_001144382.1	NP_001137854.1	Q9UPR0	PLCL2_HUMAN	phospholipase C-like 2	197					B cell proliferation involved in immune response (GO:0002322)|B-1a B cell differentiation (GO:0002337)|gamma-aminobutyric acid signaling pathway (GO:0007214)|intracellular signal transduction (GO:0035556)|lipid metabolic process (GO:0006629)|negative regulation of B cell receptor signaling pathway (GO:0050859)|positive regulation of receptor binding (GO:1900122)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GABA receptor binding (GO:0050811)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)	p.G71E(2)		breast(4)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(2)|skin(7)|urinary_tract(1)	43						GTGAGAACAGGAAAAAACACAG	0.416																																					p.G71fs		Atlas-INDEL	.											PLCL2,NS,carcinoma,0,2	PLCL2	145	.	2	Substitution - Missense(2)	cervix(1)|skin(1)	c.212_213insA						.																																			SO:0001589	frameshift_variant	23228	exon2			.	AB029015	CCDS33713.1, CCDS74911.1	3p25.3-p25.1	2008-03-18	2002-02-18	2002-02-22	ENSG00000154822	ENSG00000154822			9064	protein-coding gene	gene with protein product		614276	"""phospholipase C, epsilon 2"""	PLCE2		10470851	Standard	NM_015184		Approved	KIAA1092	uc011awd.2	Q9UPR0	OTTHUMG00000155467	ENST00000418129.2:c.218dupA	chr3.hg19:g.17051434_17051434dupA	ENSP00000409637:p.Gly71fs	185.0	0.0		172.0	38.0	NM_015184	A8K5V4|Q8N498|Q9H8L0|Q9UFP9	Frame_Shift_Ins	INS	ENST00000418129.2	hg19	CCDS33713.1																																																																																			.	.		0.416	PLCL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340250.3		
CHGB	1114	hgsc.bcm.edu	37	20	5903753	5903754	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr20:5903753_5903754insG	ENST00000378961.4	+	4	1167_1168	c.963_964insG	c.(964-966)gggfs	p.G322fs		NM_001819.2	NP_001810.2	P05060	SCG1_HUMAN	chromogranin B (secretogranin 1)	322						extracellular region (GO:0005576)|secretory granule (GO:0030141)	hormone activity (GO:0005179)			breast(7)|kidney(2)|large_intestine(8)|lung(19)|ovary(1)|pancreas(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)	47						TGGCCAGTTTAGGGGAAAAGAG	0.545																																					p.L321fs		Atlas-INDEL	.											.	CHGB	112	.	0			c.963_964insG						.																																			SO:0001589	frameshift_variant	1114	exon4			.		CCDS13092.1	20p12.3	2013-09-19			ENSG00000089199	ENSG00000089199			1930	protein-coding gene	gene with protein product	"""secretogranin B"""	118920		SCG1		3608978	Standard	NM_001819		Approved		uc002wmg.3	P05060	OTTHUMG00000031821	ENST00000378961.4:c.967dupG	chr20.hg19:g.5903757_5903757dupG	ENSP00000368244:p.Gly322fs	145.0	0.0		186.0	33.0	NM_001819	A8K021|Q59EU9|Q6IBS6|Q9BQV6|Q9UC25|Q9UJA6	Frame_Shift_Ins	INS	ENST00000378961.4	hg19	CCDS13092.1																																																																																			.	.		0.545	CHGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077897.2	NM_001819	
FASN	2194	hgsc.bcm.edu	37	17	80050789	80050793	+	Frame_Shift_Del	DEL	ATCTG	ATCTG	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	ATCTG	ATCTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr17:80050789_80050793delATCTG	ENST00000306749.2	-	6	976_980	c.758_762delCAGAT	c.(757-762)acagatfs	p.TD253fs		NM_004104.4	NP_004095.4	P49327	FAS_HUMAN	fatty acid synthase	253	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)|skin(2)|urinary_tract(1)	34	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		OV - Ovarian serous cystadenocarcinoma(97;0.0211)|BRCA - Breast invasive adenocarcinoma(99;0.0237)		Cerulenin(DB01034)|Orlistat(DB01083)	CCTTGAAGCCATCTGTATTGGTGCC	0.688																																					p.253_255del	Colon(59;314 1043 11189 28578 32273)	Atlas-INDEL	.											.	FASN	154	.	0			c.759_763del						.																																			SO:0001589	frameshift_variant	2194	exon6			.	U26644	CCDS11801.1	17q25	2012-01-31			ENSG00000169710	ENSG00000169710	2.3.1.85	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	3594	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 27X, member 1"""	600212				7835891, 7567999, 19027726	Standard	NM_004104		Approved	FAS, SDR27X1	uc002kdu.3	P49327		ENST00000306749.2:c.758_762delCAGAT	chr17.hg19:g.80050789_80050793delATCTG	ENSP00000304592:p.Thr253fs	91.0	0.0		93.0	37.0	NM_004104	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Frame_Shift_Del	DEL	ENST00000306749.2	hg19	CCDS11801.1																																																																																			.	.		0.688	FASN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000442369.1	NM_004104	
ST3GAL2	6483	hgsc.bcm.edu	37	16	70432255	70432255	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr16:70432255delA	ENST00000393640.4	-	1	2286	c.179delT	c.(178-180)ctcfs	p.L60fs	ST3GAL2_ENST00000342907.2_Frame_Shift_Del_p.L60fs|RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000566097.1_5'Flank			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	60					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				CTCCTTGCTGAGGCGCTGCAG	0.657																																					p.L60fs		Atlas-INDEL	.											.	ST3GAL2	23	.	0			c.180delC						.						48.0	51.0	50.0					16																	70432255		2198	4300	6498	SO:0001589	frameshift_variant	6483	exon2			.	U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.179delT	chr16.hg19:g.70432255delA	ENSP00000377257:p.Leu60fs	79.0	0.0		80.0	19.0	NM_006927	O00654	Frame_Shift_Del	DEL	ENST00000393640.4	hg19	CCDS10890.1																																																																																			.	.		0.657	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268968.1	NM_006927	
SSU72	29101	hgsc.bcm.edu	37	1	1500211	1500211	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr1:1500211delC	ENST00000291386.3	-	2	477	c.166delG	c.(166-168)gatfs	p.D56fs	SSU72_ENST00000359060.4_Frame_Shift_Del_p.D56fs	NM_014188.2	NP_054907.1	Q9NP77	SSU72_HUMAN	SSU72 RNA polymerase II CTD phosphatase homolog (S. cerevisiae)	56					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|mRNA polyadenylation (GO:0006378)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	CTD phosphatase activity (GO:0008420)			large_intestine(2)|lung(5)	7	all_cancers(77;0.00125)|all_epithelial(69;0.000703)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.03e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.04e-37)|OV - Ovarian serous cystadenocarcinoma(86;3.72e-23)|GBM - Glioblastoma multiforme(42;1.2e-07)|Colorectal(212;0.000188)|COAD - Colon adenocarcinoma(227;0.000214)|Kidney(185;0.00254)|STAD - Stomach adenocarcinoma(132;0.00645)|BRCA - Breast invasive adenocarcinoma(365;0.00837)|KIRC - Kidney renal clear cell carcinoma(229;0.037)|Lung(427;0.205)		GTTTTGAAATCATAAACATTG	0.483																																					p.D56fs		Atlas-INDEL	.											.	SSU72	15	.	0			c.167delA						.						150.0	150.0	150.0					1																	1500211		2203	4300	6503	SO:0001589	frameshift_variant	29101	exon2			.	AJ276409	CCDS32.1	1p36	2010-03-24	2006-04-04		ENSG00000160075	ENSG00000160075			25016	protein-coding gene	gene with protein product			"""Ssu72 RNA polymerase II CTD phosphatase homolog (yeast)"""			15125841, 15659578	Standard	NM_014188		Approved	HSPC182	uc001agd.3	Q9NP77	OTTHUMG00000000576	ENST00000291386.3:c.166delG	chr1.hg19:g.1500211delC	ENSP00000291386:p.Asp56fs	110.0	0.0		103.0	40.0	NM_014188	Q9BZS6|Q9H933	Frame_Shift_Del	DEL	ENST00000291386.3	hg19	CCDS32.1																																																																																			.	.		0.483	SSU72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000001366.1	NM_014188	
NAP1L5	266812	hgsc.bcm.edu	37	4	89618757	89618768	+	In_Frame_Del	DEL	TGACCAGCCGCG	TGACCAGCCGCG	-	rs546469739|rs561100902	byFrequency	TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	TGACCAGCCGCG	TGACCAGCCGCG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr4:89618757_89618768delTGACCAGCCGCG	ENST00000323061.5	-	1	618_629	c.138_149delCGCGGCTGGTCA	c.(136-150)agcgcggctggtcag>agg	p.46_50SAAGQ>R	HERC3_ENST00000264345.3_Intron|HERC3_ENST00000402738.1_Intron|HERC3_ENST00000543130.1_Intron	NM_153757.2	NP_715638.1	Q96NT1	NP1L5_HUMAN	nucleosome assembly protein 1-like 5	46					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)		p.G49V(1)		endometrium(2)|lung(3)|skin(1)|upper_aerodigestive_tract(1)	7				OV - Ovarian serous cystadenocarcinoma(123;0.000181)		CTCAGCCATCTGACCAGCCGCGCTGTCAGGGT	0.646																																					p.47_50del		Atlas-INDEL	.											.	NAP1L5	23	.	1	Substitution - Missense(1)	endometrium(1)	c.139_150del						.																																			SO:0001651	inframe_deletion	266812	exon1			.	NM_153757	CCDS3632.1	4q21-q22	2006-04-12			ENSG00000177432	ENSG00000177432			19968	protein-coding gene	gene with protein product		612203				12383514	Standard	NM_153757		Approved	DRLM	uc003hrx.3	Q96NT1	OTTHUMG00000130950	ENST00000323061.5:c.138_149delCGCGGCTGGTCA	chr4.hg19:g.89618757_89618768delTGACCAGCCGCG	ENSP00000320488:p.Ser46_Gln50delinsArg	63.0	0.0		38.0	29.0	NM_153757		In_Frame_Del	DEL	ENST00000323061.5	hg19	CCDS3632.1																																																																																			.	.		0.646	NAP1L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253551.1	NM_153757	
USP54	159195	hgsc.bcm.edu	37	10	75296083	75296083	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr10:75296083delG	ENST00000339859.4	-	10	1188	c.1088delC	c.(1087-1089)cctfs	p.P364fs	USP54_ENST00000408019.1_Frame_Shift_Del_p.P364fs|USP54_ENST00000428547.1_Frame_Shift_Del_p.P214fs|USP54_ENST00000497106.1_5'UTR|USP54_ENST00000394811.2_5'UTR|USP54_ENST00000319786.7_Frame_Shift_Del_p.P364fs			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	364					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					AGCTTGGGGAGGCAGGTCCTG	0.552																																					p.P363fs	Colon(195;880 2046 8854 25025 38456)	Atlas-INDEL	.											.	USP54	178	.	0			c.1089delT						.						88.0	94.0	92.0					10																	75296083		1990	4164	6154	SO:0001589	frameshift_variant	159195	exon9			.	AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.1088delC	chr10.hg19:g.75296083delG	ENSP00000345216:p.Pro364fs	113.0	0.0		107.0	19.0	NM_152586	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Frame_Shift_Del	DEL	ENST00000339859.4	hg19	CCDS7329.2																																																																																			.	.		0.552	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316563.2	NM_152586	
KEAP1	9817	hgsc.bcm.edu	37	19	10610330	10610330	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACB-01A-11D-A40R-10	TCGA-DD-AACB-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	8c89647e-854d-47b7-bf48-df5f8112ba84	035d1a22-9937-469e-a65c-1e9eb89fc338	g.chr19:10610330delC	ENST00000171111.5	-	2	927	c.380delG	c.(379-381)ggtfs	p.G127fs	KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Frame_Shift_Del_p.G127fs	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	127	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)				breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	GGGGTGGATACCCTCAATGGA	0.597																																					p.G127fs		Atlas-INDEL	.											.	KEAP1	182	.	0			c.381delT						.						127.0	102.0	110.0					19																	10610330		2203	4300	6503	SO:0001589	frameshift_variant	9817	exon2			.	AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.380delG	chr19.hg19:g.10610330delC	ENSP00000171111:p.Gly127fs	76.0	0.0		69.0	50.0	NM_012289	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Frame_Shift_Del	DEL	ENST00000171111.5	hg19	CCDS12239.1																																																																																			.	.		0.597	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452000.1	NM_012289	
