#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CAMTA1	23261	hgsc.bcm.edu	37	1	7798171	7798171	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:7798171A>C	ENST00000303635.7	+	16	4018	c.3811A>C	c.(3811-3813)Aat>Cat	p.N1271H	CAMTA1_ENST00000439411.2_Missense_Mutation_p.N1271H	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	1271					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		GGAAGAGCCAAATATCAGGAA	0.527			T	WWTR1	epitheliod hemangioendothelioma																																p.N1271H		Atlas-SNP	.		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	.	CAMTA1	226	.	0			c.A3811C						.						67.0	64.0	65.0					1																	7798171		2203	4300	6503	SO:0001583	missense	23261	exon16			GAGCCAAATATCA	AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.3811A>C	chr1.hg19:g.7798171A>C	ENSP00000306522:p.Asn1271His	65.0	0.0		84.0	30.0	NM_015215	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Missense_Mutation	SNP	ENST00000303635.7	hg19	CCDS30576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.00|12.00	1.806086|1.806086	0.31961|0.31961	.|.	.|.	ENSG00000171735|ENSG00000171735	ENST00000303635;ENST00000439411;ENST00000414738;ENST00000303646|ENST00000495233	T;T|.	0.20463|.	2.07;2.08|.	4.87|4.87	4.87|4.87	0.63330|0.63330	.|.	0.531870|.	0.22050|.	N|.	0.065339|.	T|T	0.20088|0.20088	0.0483|0.0483	N|N	0.08118|0.08118	0|0	0.24320|0.24320	N|N	0.995041|0.995041	P;B;B;P|.	0.43352|.	0.804;0.291;0.412;0.511|.	B;B;B;B|.	0.40534|.	0.332;0.087;0.125;0.135|.	T|T	0.16958|0.16958	-1.0385|-1.0385	10|5	0.30078|.	T|.	0.28|.	-4.1565|-4.1565	9.028|9.028	0.36241|0.36241	0.7155:0.0:0.0:0.2845|0.7155:0.0:0.0:0.2845	.|.	1271;358;227;1271|.	Q9Y6Y1-2;B4DXR3;Q7Z7P1;Q9Y6Y1|.	.;.;.;CMTA1_HUMAN|.	H|H	1271;1271;358;227|227	ENSP00000306522:N1271H;ENSP00000402561:N1271H|.	ENSP00000306522:N1271H|.	N|Q	+|+	1|3	0|2	CAMTA1|CAMTA1	7720758|7720758	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.365000|2.365000	0.44196|0.44196	1.943000|1.943000	0.56356|0.56356	0.533000|0.533000	0.62120|0.62120	AAT|CAA	.	.		0.527	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000003588.3	NM_015215	
SRRM1	10250	hgsc.bcm.edu	37	1	24998064	24998064	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:24998064T>C	ENST00000323848.9	+	16	2903	c.2588T>C	c.(2587-2589)gTg>gCg	p.V863A	SRRM1_ENST00000447431.2_Missense_Mutation_p.V875A|SRRM1_ENST00000479034.1_3'UTR|SRRM1_ENST00000374389.4_Missense_Mutation_p.V872A	NM_005839.3	NP_005830.2	Q8IYB3	SRRM1_HUMAN	serine/arginine repetitive matrix 1	863	Ala-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	36		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00764)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0422)|OV - Ovarian serous cystadenocarcinoma(117;1.01e-24)|Colorectal(126;5.95e-08)|COAD - Colon adenocarcinoma(152;3.24e-06)|GBM - Glioblastoma multiforme(114;0.000148)|BRCA - Breast invasive adenocarcinoma(304;0.00177)|KIRC - Kidney renal clear cell carcinoma(1967;0.00348)|STAD - Stomach adenocarcinoma(196;0.00483)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.138)		GAAGAGCCAGTGGCAGCGCCA	0.488																																					p.V863A	Ovarian(68;897 1494 3282 17478)	Atlas-SNP	.											.	SRRM1	81	.	0			c.T2588C						.						50.0	51.0	51.0					1																	24998064		2203	4300	6503	SO:0001583	missense	10250	exon16			AGCCAGTGGCAGC	AF048977	CCDS255.1	1p36	2010-04-22			ENSG00000133226	ENSG00000133226			16638	protein-coding gene	gene with protein product	"""Ser/Arg-related nuclear matrix protein"", ""plenty of prolines 101-like"""	605975				9531537	Standard	NM_005839		Approved	SRM160, POP101, MGC39488	uc001bjm.3	Q8IYB3	OTTHUMG00000003320	ENST00000323848.9:c.2588T>C	chr1.hg19:g.24998064T>C	ENSP00000326261:p.Val863Ala	203.0	0.0		218.0	67.0	NM_005839	O60585|Q5VVN4	Missense_Mutation	SNP	ENST00000323848.9	hg19	CCDS255.1	.	.	.	.	.	.	.	.	.	.	T	8.417	0.845535	0.16963	.	.	ENSG00000133226	ENST00000323848;ENST00000447431;ENST00000374389	T;T;T	0.41065	1.01;1.01;1.01	5.95	3.6	0.41247	.	0.320352	0.26804	N	0.022414	T	0.18341	0.0440	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.03969	-1.0988	10	0.32370	T	0.25	-0.0034	7.2221	0.25994	0.7034:0.1507:0.0:0.1459	.	875;863	E9PCT1;Q8IYB3	.;SRRM1_HUMAN	A	863;875;872	ENSP00000326261:V863A;ENSP00000391430:V875A;ENSP00000363510:V872A	ENSP00000326261:V863A	V	+	2	0	SRRM1	24870651	0.999000	0.42202	0.233000	0.24025	0.015000	0.08874	1.311000	0.33562	0.479000	0.27511	-0.347000	0.07816	GTG	.	.		0.488	SRRM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000009292.2	NM_005839	
CTPS1	1503	hgsc.bcm.edu	37	1	41449049	41449049	+	Silent	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:41449049A>G	ENST00000372621.4	+	2	595	c.87A>G	c.(85-87)tcA>tcG	p.S29S	CTPS1_ENST00000475060.1_3'UTR|CTPS1_ENST00000543104.1_Silent_p.S36S|CTPS1_ENST00000372616.1_Silent_p.S29S|CTPS1_ENST00000541520.1_Intron	NM_001905.2	NP_001896.2			CTP synthase 1											endometrium(3)|lung(10)	13						TACTCAAGTCATGTGGTTTAC	0.393																																					p.S29S		Atlas-SNP	.											.	CTPS1	34	.	0			c.A87G						.						192.0	165.0	174.0					1																	41449049		2203	4300	6503	SO:0001819	synonymous_variant	1503	exon2			CAAGTCATGTGGT	BC009408	CCDS459.1	1p34.1	2012-05-02	2012-05-02	2012-05-02	ENSG00000171793	ENSG00000171793	6.3.4.2		2519	protein-coding gene	gene with protein product		123860	"""CTP synthase"""	CTPS		1783378	Standard	XM_005270536		Approved		uc001cgk.4	P17812	OTTHUMG00000005712	ENST00000372621.4:c.87A>G	chr1.hg19:g.41449049A>G		231.0	0.0		257.0	84.0	NM_001905		Silent	SNP	ENST00000372621.4	hg19	CCDS459.1																																																																																			.	.		0.393	CTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000015629.1	NM_001905	
CCDC17	149483	hgsc.bcm.edu	37	1	46087108	46087108	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:46087108G>A	ENST00000528266.1	-	10	1380	c.1233C>T	c.(1231-1233)tcC>tcT	p.S411S	CCDC17_ENST00000343901.2_Silent_p.S379S|CCDC17_ENST00000464739.1_Intron|CCDC17_ENST00000445048.2_Intron|CCDC17_ENST00000421127.2_Silent_p.S402S			Q96LX7	CCD17_HUMAN	coiled-coil domain containing 17	411										kidney(1)|large_intestine(1)|lung(1)|ovary(2)	5	Acute lymphoblastic leukemia(166;0.155)					CCCAAATCCAGGAAGCCTCAA	0.572																																					p.S411S		Atlas-SNP	.											.	CCDC17	54	.	0			c.C1233T						.						41.0	39.0	40.0					1																	46087108		2203	4298	6501	SO:0001819	synonymous_variant	149483	exon10			AATCCAGGAAGCC		CCDS44131.1, CCDS44131.2, CCDS53314.1	1p34.1	2014-02-12			ENSG00000159588	ENSG00000159588			26574	protein-coding gene	gene with protein product							Standard	NM_001190182		Approved	FLJ33084	uc010olt.2	Q96LX7	OTTHUMG00000007822	ENST00000528266.1:c.1233C>T	chr1.hg19:g.46087108G>A		250.0	0.0		234.0	84.0	NM_001114938	A1A4Y7|B4DNX7|B4E1Q5|C9J8L2|Q0P683|Q5T629	Silent	SNP	ENST00000528266.1	hg19	CCDS44131.2																																																																																			.	.		0.572	CCDC17-008	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000386833.1	NM_152500	
JAK1	3716	hgsc.bcm.edu	37	1	65305399	65305399	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:65305399A>G	ENST00000342505.4	-	20	2977	c.2729T>C	c.(2728-2730)cTg>cCg	p.L910P	JAK1_ENST00000465376.1_5'Flank	NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	910	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CTCAGGCTTCAGAGATTTAAC	0.478			Mis		ALL																																p.L910P		Atlas-SNP	.		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	JAK1,NS,carcinoma,0,2	JAK1	209	.	0			c.T2729C						.						150.0	138.0	142.0					1																	65305399		1917	4139	6056	SO:0001583	missense	3716	exon20			GGCTTCAGAGATT	M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.2729T>C	chr1.hg19:g.65305399A>G	ENSP00000343204:p.Leu910Pro	99.0	0.0		78.0	24.0	NM_002227	Q59GQ2|Q9UD26	Missense_Mutation	SNP	ENST00000342505.4	hg19	CCDS41346.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.517041	0.85495	.	.	ENSG00000162434	ENST00000342505	D	0.91351	-2.83	5.13	5.13	0.70059	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.94525	0.8237	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95349	0.8445	9	0.87932	D	0	-3.8222	15.1086	0.72338	1.0:0.0:0.0:0.0	.	910	P23458	JAK1_HUMAN	P	910	ENSP00000343204:L910P	ENSP00000343204:L910P	L	-	2	0	JAK1	65077987	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.703000	0.91344	2.146000	0.66826	0.533000	0.62120	CTG	.	.		0.478	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025791.1	NM_002227	
MAN1A2	10905	hgsc.bcm.edu	37	1	117948198	117948198	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:117948198A>T	ENST00000356554.3	+	3	1321	c.586A>T	c.(586-588)Agg>Tgg	p.R196W	MAN1A2_ENST00000482811.1_Intron	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	196					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		GGATAACTATAGGACATATGG	0.308																																					p.R196W	Ovarian(33;199 881 8228 13687 31538)	Atlas-SNP	.											.	MAN1A2	50	.	0			c.A586T						.						109.0	116.0	113.0					1																	117948198		2203	4299	6502	SO:0001583	missense	10905	exon3			AACTATAGGACAT	AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.586A>T	chr1.hg19:g.117948198A>T	ENSP00000348959:p.Arg196Trp	586.0	1.0		628.0	216.0	NM_006699	Q9H510	Missense_Mutation	SNP	ENST00000356554.3	hg19	CCDS895.1	.	.	.	.	.	.	.	.	.	.	A	21.6	4.177175	0.78564	.	.	ENSG00000198162	ENST00000356554	T	0.72835	-0.69	5.84	5.84	0.93424	.	0.089867	0.85682	D	0.000000	D	0.82595	0.5071	M	0.89214	3.015	0.50632	D	0.999883	P	0.52316	0.952	D	0.63957	0.92	D	0.86287	0.1671	10	0.87932	D	0	-15.6024	14.1576	0.65428	1.0:0.0:0.0:0.0	.	196	O60476	MA1A2_HUMAN	W	196	ENSP00000348959:R196W	ENSP00000348959:R196W	R	+	1	2	MAN1A2	117749721	0.999000	0.42202	0.954000	0.39281	0.979000	0.70002	4.038000	0.57318	2.220000	0.72140	0.533000	0.62120	AGG	.	.		0.308	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033593.1	NM_006699	
PDE4DIP	9659	hgsc.bcm.edu	37	1	144916634	144916634	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:144916634T>C	ENST00000369354.3	-	13	1910	c.1721A>G	c.(1720-1722)aAg>aGg	p.K574R	PDE4DIP_ENST00000313431.9_Missense_Mutation_p.K737R|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.K640R|PDE4DIP_ENST00000479408.2_Missense_Mutation_p.K361R|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.K737R|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.K711R|PDE4DIP_ENST00000369359.4_Missense_Mutation_p.K711R|PDE4DIP_ENST00000369349.3_Missense_Mutation_p.K574R|PDE4DIP_ENST00000369351.3_Missense_Mutation_p.K574R|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.K574R			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	574					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		CTCTTGTTCCTTCTGCCAACG	0.443			T	PDGFRB	MPD																																p.K737R		Atlas-SNP	.		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	.	PDE4DIP	817	.	0			c.A2210G						.						613.0	641.0	631.0					1																	144916634		2203	4296	6499	SO:0001583	missense	9659	exon9			TGTTCCTTCTGCC	AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.1721A>G	chr1.hg19:g.144916634T>C	ENSP00000358360:p.Lys574Arg	125.0	0.0		133.0	19.0	NM_001002811	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	ENST00000369354.3	hg19	CCDS30824.1	.	.	.	.	.	.	.	.	.	.	T	14.72	2.620675	0.46736	.	.	ENSG00000178104	ENST00000313382;ENST00000369354;ENST00000369356;ENST00000369353;ENST00000530740;ENST00000369359;ENST00000369351;ENST00000369349;ENST00000313431;ENST00000529945;ENST00000479408	T;T;T;T;T;T;T;T;T;T	0.64618	4.76;4.88;4.88;4.87;4.87;3.89;3.9;2.85;2.84;-0.11	5.83	5.83	0.93111	.	.	.	.	.	T	0.56277	0.1974	L	0.32530	0.975	0.80722	D	1	P;D;P;P;D;D	0.69078	0.921;0.968;0.865;0.935;0.993;0.997	P;P;B;P;P;D	0.63703	0.601;0.818;0.421;0.7;0.903;0.917	T	0.53933	-0.8368	9	0.18710	T	0.47	.	14.4902	0.67645	0.0:0.0:0.0:1.0	.	737;361;574;737;640;574	E9PL24;E9PQG4;Q5VU43-7;Q5VU43-2;Q5VU43-3;Q5VU43	.;.;.;.;.;MYOME_HUMAN	R	640;574;574;737;711;711;574;574;737;737;361	ENSP00000327209:K640R;ENSP00000358360:K574R;ENSP00000358363:K574R;ENSP00000435654:K711R;ENSP00000358366:K711R;ENSP00000358357:K574R;ENSP00000358355:K574R;ENSP00000316434:K737R;ENSP00000433392:K737R;ENSP00000436791:K361R	ENSP00000327209:K640R	K	-	2	0	PDE4DIP	143627991	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.192000	0.50989	2.364000	0.80123	0.524000	0.50904	AAG	.	.		0.443	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000038858.2	NM_022359	
FCRL5	83416	hgsc.bcm.edu	37	1	157509048	157509048	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:157509048G>C	ENST00000361835.3	-	7	1387	c.1230C>G	c.(1228-1230)atC>atG	p.I410M	FCRL5_ENST00000368190.3_Missense_Mutation_p.I410M|FCRL5_ENST00000368191.3_Missense_Mutation_p.I325M|FCRL5_ENST00000356953.4_Missense_Mutation_p.I410M|FCRL5_ENST00000368189.3_Missense_Mutation_p.I410M	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5	410	Ig-like C2-type 4.				negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				ACTGGTACAGGATGGGGAGTG	0.552																																					p.I410M		Atlas-SNP	.											.	FCRL5	177	.	0			c.C1230G						.						85.0	77.0	80.0					1																	157509048		2203	4300	6503	SO:0001583	missense	83416	exon7			GTACAGGATGGGG	AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1230C>G	chr1.hg19:g.157509048G>C	ENSP00000354691:p.Ile410Met	75.0	0.0		82.0	22.0	NM_031281	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	ENST00000361835.3	hg19	CCDS1165.1	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287377	0.40494	.	.	ENSG00000143297	ENST00000361835;ENST00000356953;ENST00000368190;ENST00000368191;ENST00000368189	T;T;T;T;T	0.12774	2.65;2.65;2.65;2.65;2.65	3.04	2.09	0.27110	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.159289	0.28933	N	0.013667	T	0.30947	0.0781	H	0.96269	3.795	0.18873	N	0.999989	D;D;D;D;D;D	0.89917	1.0;1.0;0.989;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;0.996;0.919;0.998;1.0;0.997	T	0.12760	-1.0535	10	0.72032	D	0.01	.	6.4583	0.21942	0.146:0.0:0.854:0.0	.	441;325;410;410;410;410	B4DW39;F5GXJ2;Q96RD9-3;A6NJE8;Q96RD9-4;Q96RD9	.;.;.;.;.;FCRL5_HUMAN	M	410;410;410;325;410	ENSP00000354691:I410M;ENSP00000349434:I410M;ENSP00000357173:I410M;ENSP00000357174:I325M;ENSP00000357172:I410M	ENSP00000349434:I410M	I	-	3	3	FCRL5	155775672	0.825000	0.29262	0.004000	0.12327	0.274000	0.26718	1.368000	0.34216	0.583000	0.29574	0.313000	0.20887	ATC	.	.		0.552	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000046263.1	NM_031281	
OR6P1	128366	hgsc.bcm.edu	37	1	158532619	158532619	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:158532619T>G	ENST00000334632.1	-	1	775	c.776A>C	c.(775-777)tAt>tCt	p.Y259S		NM_001160325.1	NP_001153797.1	Q8NGX9	OR6P1_HUMAN	olfactory receptor, family 6, subfamily P, member 1	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(4)|lung(1)	6						GGGCCGTGCATAGGTGAAGAG	0.517																																					p.Y259S		Atlas-SNP	.											.	OR6P1	47	.	0			c.A776C						.						156.0	125.0	134.0					1																	158532619		692	1591	2283	SO:0001583	missense	128366	exon1			CGTGCATAGGTGA	BK004193	CCDS53391.1	1q23.1	2012-08-09			ENSG00000186440	ENSG00000186440		"""GPCR / Class A : Olfactory receptors"""	15036	protein-coding gene	gene with protein product							Standard	NM_001160325		Approved		uc010pim.2	Q8NGX9	OTTHUMG00000019633	ENST00000334632.1:c.776A>C	chr1.hg19:g.158532619T>G	ENSP00000334721:p.Tyr259Ser	103.0	0.0		119.0	40.0	NM_001160325	Q6IFR9	Missense_Mutation	SNP	ENST00000334632.1	hg19	CCDS53391.1	.	.	.	.	.	.	.	.	.	.	T	11.69	1.714286	0.30413	.	.	ENSG00000186440	ENST00000334632	T	0.00282	8.31	4.91	4.91	0.64330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.40064	N	0.001192	T	0.00608	0.0020	H	0.96662	3.86	0.30412	N	0.779022	D	0.89917	1.0	D	0.91635	0.999	T	0.03051	-1.1078	10	0.87932	D	0	.	13.6559	0.62338	0.0:0.0:0.0:1.0	.	259	Q8NGX9	OR6P1_HUMAN	S	259	ENSP00000334721:Y259S	ENSP00000334721:Y259S	Y	-	2	0	OR6P1	156799243	0.991000	0.36638	1.000000	0.80357	0.014000	0.08584	2.437000	0.44828	2.063000	0.61619	0.482000	0.46254	TAT	.	.		0.517	OR6P1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051848.1		
SDCCAG8	10806	hgsc.bcm.edu	37	1	243434288	243434288	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:243434288C>G	ENST00000366541.3	+	3	347	c.229C>G	c.(229-231)Ctc>Gtc	p.L77V	SDCCAG8_ENST00000391846.1_Missense_Mutation_p.L77V|SDCCAG8_ENST00000343783.6_Intron|SDCCAG8_ENST00000355875.4_Missense_Mutation_p.L77V	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	77					establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		AGTTAATCAGCTCAAAGATTT	0.378																																					p.L77V		Atlas-SNP	.											.	SDCCAG8	73	.	0			c.C229G						.						114.0	106.0	109.0					1																	243434288		2203	4300	6503	SO:0001583	missense	10806	exon3			AATCAGCTCAAAG	AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.229C>G	chr1.hg19:g.243434288C>G	ENSP00000355499:p.Leu77Val	225.0	0.0		226.0	75.0	NM_006642	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Missense_Mutation	SNP	ENST00000366541.3	hg19	CCDS31075.1	.	.	.	.	.	.	.	.	.	.	C	21.0	4.074740	0.76415	.	.	ENSG00000054282	ENST00000355875;ENST00000391846;ENST00000366541	T;T	0.75477	-0.94;-0.55	5.52	4.59	0.56863	.	0.000000	0.85682	D	0.000000	D	0.83834	0.5340	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.84012	0.0349	10	0.54805	T	0.06	-3.856	12.4439	0.55639	0.0:0.916:0.0:0.084	.	77	Q86SQ7	SDCG8_HUMAN	V	77	ENSP00000348137:L77V;ENSP00000355499:L77V	ENSP00000348137:L77V	L	+	1	0	SDCCAG8	241500911	0.991000	0.36638	0.988000	0.46212	0.948000	0.59901	2.963000	0.49184	2.752000	0.94435	0.655000	0.94253	CTC	.	.		0.378	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000096485.1	NM_006642	
TMEM214	54867	hgsc.bcm.edu	37	2	27260542	27260542	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:27260542C>A	ENST00000238788.9	+	9	1186	c.1124C>A	c.(1123-1125)cCt>cAt	p.P375H	TMEM214_ENST00000404032.3_Missense_Mutation_p.P330H	NM_017727.4	NP_060197.4	Q6NUQ4	TM214_HUMAN	transmembrane protein 214	375					apoptotic process (GO:0006915)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(2)	18						AGAGCCACCCCTAGCTGTCCC	0.552																																					p.P375H		Atlas-SNP	.											.	TMEM214	41	.	0			c.C1124A						.						99.0	100.0	100.0					2																	27260542		1907	4121	6028	SO:0001583	missense	54867	exon9			CCACCCCTAGCTG		CCDS42664.1, CCDS46242.1	2p23.3	2013-06-19			ENSG00000119777	ENSG00000119777			25983	protein-coding gene	gene with protein product						23661706	Standard	NM_001083590		Approved	FLJ20254	uc002ria.4	Q6NUQ4	OTTHUMG00000151999	ENST00000238788.9:c.1124C>A	chr2.hg19:g.27260542C>A	ENSP00000238788:p.Pro375His	98.0	0.0		122.0	41.0	NM_017727	A6NNF2|B3KUI9|B5MCD8|D6W547|Q53SW1|Q69YH4|Q8NC45|Q8WZ37|Q9NXH2	Missense_Mutation	SNP	ENST00000238788.9	hg19	CCDS42664.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.980336|3.980336	0.74474|0.74474	.|.	.|.	ENSG00000119777|ENSG00000119777	ENST00000425720|ENST00000238788;ENST00000404032;ENST00000537397	.|T;T	.|0.51574	.|0.7;0.7	5.69|5.69	4.81|4.81	0.61882|0.61882	.|.	.|0.049473	.|0.85682	.|N	.|0.000000	T|T	0.66896|0.66896	0.2836|0.2836	M|M	0.72894|0.72894	2.215|2.215	0.54753|0.54753	D|D	0.999981|0.999981	.|D;D	.|0.89917	.|1.0;0.998	.|D;D	.|0.80764	.|0.994;0.986	T|T	0.70335|0.70335	-0.4900|-0.4900	5|10	.|0.62326	.|D	.|0.03	-8.2946|-8.2946	14.0468|14.0468	0.64710|0.64710	0.1512:0.8488:0.0:0.0|0.1512:0.8488:0.0:0.0	.|.	.|330;375	.|Q6NUQ4-2;Q6NUQ4	.|.;TM214_HUMAN	I|H	134|375;330;115	.|ENSP00000238788:P375H;ENSP00000384417:P330H	.|ENSP00000238788:P375H	L|P	+|+	1|2	2|0	TMEM214|TMEM214	27114046|27114046	1.000000|1.000000	0.71417|0.71417	0.892000|0.892000	0.35008|0.35008	0.962000|0.962000	0.63368|0.63368	4.496000|4.496000	0.60360|0.60360	1.400000|1.400000	0.46741|0.46741	-0.314000|-0.314000	0.08810|0.08810	CTA|CCT	.	.		0.552	TMEM214-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000324748.1	NM_017727	
CAPN14	440854	hgsc.bcm.edu	37	2	31414917	31414917	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:31414917C>T	ENST00000403897.3	-	11	1303	c.1162G>A	c.(1162-1164)Gag>Aag	p.E388K	CAPN14_ENST00000444918.2_Missense_Mutation_p.E388K	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	388	Domain III.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						CTGCCCTCCTCGGGCCTCCAG	0.627																																					p.E388K		Atlas-SNP	.											.	CAPN14	36	.	0			c.G1162A						.						25.0	32.0	30.0					2																	31414917		692	1591	2283	SO:0001583	missense	440854	exon11			CCTCCTCGGGCCT	AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.1162G>A	chr2.hg19:g.31414917C>T	ENSP00000385247:p.Glu388Lys	88.0	0.0		96.0	41.0	NM_001145122	B3KRU9	Missense_Mutation	SNP	ENST00000403897.3	hg19	CCDS46254.1	.	.	.	.	.	.	.	.	.	.	C	16.53	3.149773	0.57151	.	.	ENSG00000214711	ENST00000444918;ENST00000403897	D;D	0.88431	-2.38;-2.38	3.81	2.92	0.33932	Peptidase C2, calpain, large subunit, domain III (2);Peptidase C2, calpain, domain III (1);	2.111140	0.03873	U	0.275930	D	0.83839	0.5341	L	0.42686	1.345	0.32842	D	0.505492	P;P	0.42757	0.716;0.789	B;B	0.32465	0.146;0.09	T	0.77568	-0.2539	10	0.87932	D	0	.	7.7979	0.29158	0.0:0.7103:0.1911:0.0986	.	388;212	A8MX76;A8MX76-2	CAN14_HUMAN;.	K	388	ENSP00000398670:E388K;ENSP00000385247:E388K	ENSP00000385247:E388K	E	-	1	0	CAPN14	31268421	0.981000	0.34729	0.650000	0.29550	0.928000	0.56348	2.438000	0.44837	0.704000	0.31869	0.655000	0.94253	GAG	.	.		0.627	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000325010.1	NM_001145122	
XDH	7498	hgsc.bcm.edu	37	2	31625953	31625953	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:31625953A>G	ENST00000379416.3	-	3	206	c.158T>C	c.(157-159)gTg>gCg	p.V53A		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	53	2Fe-2S ferredoxin-type. {ECO:0000255|PROSITE-ProRule:PRU00465}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	GGAGAGCATCACTGTGCAAGC	0.577																																					p.V53A	Colon(66;682 1445 30109 40147)	Atlas-SNP	.											.	XDH	191	.	0			c.T158C						.						108.0	101.0	103.0					2																	31625953		2203	4300	6503	SO:0001583	missense	7498	exon3			AGCATCACTGTGC	D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.158T>C	chr2.hg19:g.31625953A>G	ENSP00000368727:p.Val53Ala	59.0	0.0		66.0	20.0	NM_000379	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	ENST00000379416.3	hg19	CCDS1775.1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.561967	0.86335	.	.	ENSG00000158125	ENST00000379416	T	0.58506	0.33	6.04	6.04	0.98038	Xanthine dehydrogenase, small subunit (1);Beta-grasp fold, ferredoxin-type (1);Ferredoxin (3);	0.000000	0.85682	D	0.000000	D	0.83087	0.5178	H	0.96333	3.805	0.80722	D	1	D	0.69078	0.997	D	0.68483	0.958	D	0.88314	0.2958	10	0.72032	D	0.01	.	15.5589	0.76223	1.0:0.0:0.0:0.0	.	53	P47989	XDH_HUMAN	A	53	ENSP00000368727:V53A	ENSP00000368727:V53A	V	-	2	0	XDH	31479457	1.000000	0.71417	0.997000	0.53966	0.906000	0.53458	6.761000	0.74945	2.317000	0.78254	0.459000	0.35465	GTG	.	.		0.577	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000216840.1	NM_000379	
SIX2	10736	hgsc.bcm.edu	37	2	45233483	45233483	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:45233483G>A	ENST00000303077.6	-	2	1021	c.702C>T	c.(700-702)agC>agT	p.S234S		NM_016932.4	NP_058628.3	Q9NPC8	SIX2_HUMAN	SIX homeobox 2	234					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|chondrocyte differentiation (GO:0002062)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|kidney development (GO:0001822)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|mesenchymal stem cell maintenance involved in nephron morphogenesis (GO:0072038)|mesenchymal stem cell proliferation (GO:0097168)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesodermal cell fate specification (GO:0007501)|middle ear morphogenesis (GO:0042474)|nephron development (GO:0072006)|nephron morphogenesis (GO:0072028)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein import into nucleus (GO:0006606)|regulation of branching involved in ureteric bud morphogenesis (GO:0090189)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(6)|large_intestine(3)|lung(8)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	22		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGGGCGGCGGGCTGAGGAGCA	0.701																																					p.S234S		Atlas-SNP	.											.	SIX2	39	.	0			c.C702T						.						63.0	68.0	66.0					2																	45233483		2203	4300	6503	SO:0001819	synonymous_variant	10736	exon2			CGGCGGGCTGAGG	AF136939	CCDS1822.1	2p21	2011-06-20	2007-07-13		ENSG00000170577	ENSG00000170577		"""Homeoboxes / SINE class"""	10888	protein-coding gene	gene with protein product		604994	"""sine oculis homeobox (Drosophila) homolog 2"", ""sine oculis homeobox homolog 2 (Drosophila)"""				Standard	NM_016932		Approved		uc002ruo.3	Q9NPC8	OTTHUMG00000152421	ENST00000303077.6:c.702C>T	chr2.hg19:g.45233483G>A		54.0	0.0		75.0	22.0	NM_016932	Q9BXH7	Silent	SNP	ENST00000303077.6	hg19	CCDS1822.1																																																																																			.	.		0.701	SIX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326188.2		
WDR33	55339	hgsc.bcm.edu	37	2	128466455	128466455	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:128466455C>A	ENST00000322313.4	-	21	3735	c.3577G>T	c.(3577-3579)Gaa>Taa	p.E1193*		NM_018383.4	NP_060853.3	Q9C0J8	WDR33_HUMAN	WD repeat domain 33	1193					mRNA processing (GO:0006397)|postreplication repair (GO:0006301)|spermatogenesis (GO:0007283)	collagen trimer (GO:0005581)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0695)		CGAAAATGTTCATGACCTGGC	0.517																																					p.E1193X		Atlas-SNP	.											.	WDR33	136	.	0			c.G3577T						.						49.0	47.0	48.0					2																	128466455		2203	4300	6503	SO:0001587	stop_gained	55339	exon21			AATGTTCATGACC		CCDS2150.1, CCDS42746.1, CCDS46407.1	2q21.1	2013-01-09			ENSG00000136709	ENSG00000136709		"""WD repeat domain containing"""	25651	protein-coding gene	gene with protein product						11162572	Standard	NM_001006622		Approved	FLJ11294, WDC146, NET14	uc002tpg.2	Q9C0J8	OTTHUMG00000131534	ENST00000322313.4:c.3577G>T	chr2.hg19:g.128466455C>A	ENSP00000325377:p.Glu1193*	50.0	0.0		64.0	27.0	NM_018383	Q05DP8|Q53FG9|Q587J1|Q69YF7|Q6NUQ0|Q9NUL1	Nonsense_Mutation	SNP	ENST00000322313.4	hg19	CCDS2150.1	.	.	.	.	.	.	.	.	.	.	C	43	10.241364	0.99367	.	.	ENSG00000136709	ENST00000322313	.	.	.	5.56	5.56	0.83823	.	0.063932	0.64402	D	0.000015	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07030	T	0.85	-15.8068	16.2544	0.82505	0.0:1.0:0.0:0.0	.	.	.	.	X	1193	.	ENSP00000325377:E1193X	E	-	1	0	WDR33	128182925	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.298000	0.51818	2.640000	0.89533	0.655000	0.94253	GAA	.	.		0.517	WDR33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331141.2	NM_018383	
COL4A4	1286	hgsc.bcm.edu	37	2	227924168	227924168	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:227924168G>T	ENST00000396625.3	-	28	2543	c.2336C>A	c.(2335-2337)cCa>cAa	p.P779Q	COL4A4_ENST00000329662.7_Missense_Mutation_p.P779Q	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	779	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TTTTATCCCTGGCACTCCTGA	0.572																																					p.P779Q		Atlas-SNP	.											.	COL4A4	215	.	0			c.C2336A						.						135.0	142.0	139.0					2																	227924168		1863	4085	5948	SO:0001583	missense	1286	exon28			ATCCCTGGCACTC		CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2336C>A	chr2.hg19:g.227924168G>T	ENSP00000379866:p.Pro779Gln	190.0	0.0		179.0	61.0	NM_000092	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Missense_Mutation	SNP	ENST00000396625.3	hg19	CCDS42828.1	.	.	.	.	.	.	.	.	.	.	G	15.99	2.994827	0.54041	.	.	ENSG00000081052	ENST00000396625;ENST00000329662	D;D	0.93712	-3.27;-3.27	5.99	4.18	0.49190	.	.	.	.	.	D	0.89753	0.6806	L	0.49571	1.57	0.19945	N	0.999941	P	0.37330	0.59	B	0.35182	0.197	T	0.80634	-0.1295	9	0.39692	T	0.17	.	9.3804	0.38311	0.0724:0.0:0.7839:0.1437	.	779	P53420	CO4A4_HUMAN	Q	779	ENSP00000379866:P779Q;ENSP00000328553:P779Q	ENSP00000328553:P779Q	P	-	2	0	COL4A4	227632412	1.000000	0.71417	0.054000	0.19295	0.828000	0.46876	5.485000	0.66850	0.852000	0.35287	0.655000	0.94253	CCA	.	.		0.572	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000313770.1	NM_000092	
CNTN6	27255	hgsc.bcm.edu	37	3	1367631	1367631	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:1367631C>A	ENST00000446702.2	+	9	1706	c.1079C>A	c.(1078-1080)cCa>cAa	p.P360Q	CNTN6_ENST00000539053.1_Missense_Mutation_p.P288Q|CNTN6_ENST00000350110.2_Missense_Mutation_p.P360Q			Q9UQ52	CNTN6_HUMAN	contactin 6	360	Ig-like C2-type 4.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CGACTCAACCCAGAGGTAAGC	0.358																																					p.P360Q		Atlas-SNP	.											CNTN6,NS,carcinoma,0,1	CNTN6	245	.	0			c.C1079A						.						95.0	92.0	93.0					3																	1367631		2203	4300	6503	SO:0001583	missense	27255	exon9			TCAACCCAGAGGT	AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1079C>A	chr3.hg19:g.1367631C>A	ENSP00000407822:p.Pro360Gln	117.0	0.0		104.0	26.0	NM_014461	Q2KHM2	Missense_Mutation	SNP	ENST00000446702.2	hg19	CCDS2557.1	.	.	.	.	.	.	.	.	.	.	C	13.32	2.201901	0.38905	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.66460	-0.21;-0.21;-0.21	5.26	4.39	0.52855	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.507528	0.18288	N	0.145790	T	0.63200	0.2491	L	0.45051	1.395	0.21878	N	0.999491	B	0.32467	0.372	B	0.39258	0.295	T	0.59241	-0.7491	10	0.56958	D	0.05	.	12.1998	0.54319	0.0:0.9213:0.0:0.0787	.	360	Q9UQ52	CNTN6_HUMAN	Q	360;288;360	ENSP00000407822:P360Q;ENSP00000442791:P288Q;ENSP00000341882:P360Q	ENSP00000341882:P360Q	P	+	2	0	CNTN6	1342631	0.188000	0.23250	0.779000	0.31741	0.854000	0.48673	1.590000	0.36654	1.227000	0.43598	0.650000	0.86243	CCA	.	.		0.358	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239235.2	NM_014461	
IQSEC1	9922	hgsc.bcm.edu	37	3	12963694	12963694	+	Silent	SNP	G	G	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:12963694G>T	ENST00000273221.4	-	5	2037	c.1821C>A	c.(1819-1821)gcC>gcA	p.A607A		NM_014869.5	NP_055684.3	Q6DN90	IQEC1_HUMAN	IQ motif and Sec7 domain 1	607	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleolus (GO:0005730)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATTTCCTGAGGGCCTCATCCA	0.622																																					p.A607A		Atlas-SNP	.											.	IQSEC1	88	.	0			c.C1821A						.						74.0	68.0	70.0					3																	12963694		2202	4300	6502	SO:0001819	synonymous_variant	9922	exon5			CCTGAGGGCCTCA	BC010267	CCDS33703.1, CCDS74902.1	3p25.2	2011-09-23			ENSG00000144711	ENSG00000144711			29112	protein-coding gene	gene with protein product	"""brefeldin A-resistant ARF-GEF2"""	610166				9872452, 8619474	Standard	NM_001134382		Approved	KIAA0763, GEP100, BRAG2, ARF-GEP100	uc011auw.2	Q6DN90	OTTHUMG00000155398	ENST00000273221.4:c.1821C>A	chr3.hg19:g.12963694G>T		80.0	0.0		77.0	16.0	NM_014869	O94863|Q96D85	Silent	SNP	ENST00000273221.4	hg19	CCDS33703.1	.	.	.	.	.	.	.	.	.	.	G	11.39	1.625736	0.28889	.	.	ENSG00000144711	ENST00000450726	.	.	.	4.84	0.263	0.15602	.	.	.	.	.	T	0.50990	0.1648	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40905	-0.9538	4	.	.	.	.	5.1968	0.15243	0.293:0.0:0.5109:0.1961	.	.	.	.	T	608	.	.	P	-	1	0	IQSEC1	12938694	0.684000	0.27642	0.998000	0.56505	0.999000	0.98932	-0.141000	0.10327	0.402000	0.25451	0.655000	0.94253	CCT	.	.		0.622	IQSEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339865.2	NM_014869	
GOLGA4	2803	hgsc.bcm.edu	37	3	37402755	37402755	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:37402755A>G	ENST00000361924.2	+	23	7059	c.6685A>G	c.(6685-6687)Atc>Gtc	p.I2229V	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Intron	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2229					Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						TCGCAGTGGTATCTTCTGAGT	0.353																																					p.I2229V		Atlas-SNP	.											.	GOLGA4	173	.	0			c.A6685G						.						185.0	160.0	168.0					3																	37402755		2203	4300	6503	SO:0001583	missense	2803	exon23			AGTGGTATCTTCT	U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6685A>G	chr3.hg19:g.37402755A>G	ENSP00000354486:p.Ile2229Val	107.0	0.0		119.0	37.0	NM_002078	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	ENST00000361924.2	hg19	CCDS2666.1	.	.	.	.	.	.	.	.	.	.	A	14.90	2.673577	0.47781	.	.	ENSG00000144674	ENST00000361924	T	0.24908	1.83	5.7	4.52	0.55395	.	.	.	.	.	T	0.16514	0.0397	N	0.08118	0	0.80722	D	1	D	0.53312	0.959	B	0.43950	0.437	T	0.05971	-1.0853	9	0.87932	D	0	.	12.939	0.58331	0.8646:0.1354:0.0:0.0	.	2229	Q13439	GOGA4_HUMAN	V	2229	ENSP00000354486:I2229V	ENSP00000354486:I2229V	I	+	1	0	GOLGA4	37377759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.894000	0.56250	0.971000	0.38288	0.460000	0.39030	ATC	.	.		0.353	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253339.2	NM_002078	
DLEC1	9940	hgsc.bcm.edu	37	3	38159099	38159099	+	Silent	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:38159099T>C	ENST00000308059.6	+	32	4503	c.4482T>C	c.(4480-4482)tcT>tcC	p.S1494S	DLEC1_ENST00000346219.3_Silent_p.S1494S|DLEC1_ENST00000452631.2_Silent_p.S1497S					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		AGCCCTGCTCTGGGGTGAGTG	0.592											OREG0015476	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S1494S		Atlas-SNP	.											.	DLEC1	278	.	0			c.T4482C						.						50.0	57.0	55.0					3																	38159099		2055	4212	6267	SO:0001819	synonymous_variant	9940	exon32			CTGCTCTGGGGTG	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.4482T>C	chr3.hg19:g.38159099T>C		120.0	0.0	876	126.0	27.0	NM_007337		Silent	SNP	ENST00000308059.6	hg19	CCDS2672.2																																																																																			.	.		0.592	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
CTNNB1	1499	hgsc.bcm.edu	37	3	41266110	41266110	+	Missense_Mutation	SNP	A	A	C	rs121913416		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:41266110A>C	ENST00000349496.5	+	3	387	c.107A>C	c.(106-108)cAt>cCt	p.H36P	CTNNB1_ENST00000396185.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000396183.3_Missense_Mutation_p.H36P|CTNNB1_ENST00000453024.1_Missense_Mutation_p.H29P|CTNNB1_ENST00000405570.1_Missense_Mutation_p.H36P	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	36					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.A5_A80del(53)|p.H36P(24)|p.A5_Q143del(7)|p.A5_A80>D(7)|p.Q28_H134del(5)|p.?(4)|p.V22_G38del(3)|p.H36R(3)|p.W25_I140del(3)|p.T3_A126del(2)|p.A5fs*7(2)|p.D32_S47del(2)|p.M5_N141>D(2)|p.L10_N141del(2)|p.A5_Y142>D(2)|p.A5_Q143>E(1)|p.I35_S37>T(1)|p.A13_R151del(1)|p.H36_E53>L(1)|p.D32_H36>D(1)|p.M14_S45del(1)|p.A20_N141del(1)|p.M1_A87del(1)|p.D11_Y142>H(1)|p.I35_K170del(1)|p.H24_G38del(1)|p.S29_H36del(1)|p.I35_T41del(1)|p.I35_G38del(1)|p.Y30_A97del(1)|p.V22_T102del(1)|p.A20_A80del(1)|p.V22_S71>A(1)|p.Q28_A43del(1)|p.A5_T59del(1)|p.M1_V173del(1)|p.E15_I140>V(1)|p.S23_A39del(1)|p.H24_M131del(1)|p.A21_A80del(1)|p.D32fs*9(1)|p.A5_T40del(1)|p.A5_E54del(1)|p.S33_S37del(1)|p.M8_A80del(1)|p.P16_K133del(1)|p.V22_Y64del(1)|p.Q28_Q61del(1)|p.A20_S111del(1)|p.Y30_T40del(1)|p.GIHS34?(1)|p.D32_H36del(1)|p.Y30_A80del(1)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TCTGGAATCCATTCTGGTGCC	0.498		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.H36P	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,NS,carcinoma,0,1	CTNNB1	4904	.	159	Deletion - In frame(104)|Substitution - Missense(27)|Complex - deletion inframe(18)|Unknown(7)|Deletion - Frameshift(3)	liver(119)|large_intestine(20)|stomach(7)|kidney(6)|small_intestine(2)|skin(2)|adrenal_gland(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)	c.A107C						.						95.0	80.0	85.0					3																	41266110		2203	4300	6503	SO:0001583	missense	1499	exon3	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	GAATCCATTCTGG	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.107A>C	chr3.hg19:g.41266110A>C	ENSP00000344456:p.His36Pro	158.0	0.0		175.0	52.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	15.41	2.824526	0.50739	.	.	ENSG00000168036	ENST00000426215;ENST00000405570;ENST00000431914;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185;ENST00000450969;ENST00000441708	T;T;T;T;T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88;0.88	5.76	5.76	0.90799	.	0.093481	0.85682	D	0.000000	T	0.51210	0.1661	M	0.64170	1.965	0.80722	D	1	P	0.40398	0.716	P	0.45946	0.498	T	0.54807	-0.8238	10	0.72032	D	0.01	-2.3155	16.0676	0.80897	1.0:0.0:0.0:0.0	.	36	P35222	CTNB1_HUMAN	P	29;36;36;36;36;29;36;36;36	ENSP00000400508:H29P;ENSP00000385604:H36P;ENSP00000412219:H36P;ENSP00000379486:H36P;ENSP00000344456:H36P;ENSP00000411226:H29P;ENSP00000379488:H36P;ENSP00000409302:H36P;ENSP00000401599:H36P	ENSP00000344456:H36P	H	+	2	0	CTNNB1	41241114	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.339000	0.96797	2.201000	0.70794	0.533000	0.62120	CAT	.	.		0.498	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
TRIM42	287015	hgsc.bcm.edu	37	3	140401928	140401928	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr3:140401928C>A	ENST00000286349.3	+	2	1157	c.966C>A	c.(964-966)gaC>gaA	p.D322E		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	322						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ATGGCCACGACACCATTAGCC	0.562																																					p.D322E		Atlas-SNP	.											.	TRIM42	143	.	0			c.C966A						.						215.0	188.0	197.0					3																	140401928		2203	4300	6503	SO:0001583	missense	287015	exon2			CCACGACACCATT	AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.966C>A	chr3.hg19:g.140401928C>A	ENSP00000286349:p.Asp322Glu	140.0	0.0		130.0	42.0	NM_152616	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	ENST00000286349.3	hg19	CCDS3113.1	.	.	.	.	.	.	.	.	.	.	C	15.68	2.904855	0.52333	.	.	ENSG00000155890	ENST00000286349	T	0.39997	1.05	5.46	4.58	0.56647	Zinc finger, B-box (2);	0.089094	0.48767	D	0.000163	T	0.19287	0.0463	N	0.12182	0.205	0.29538	N	0.852261	P	0.39535	0.677	B	0.36378	0.223	T	0.11421	-1.0588	10	0.07030	T	0.85	-28.4889	9.1765	0.37116	0.0:0.9033:0.0:0.0967	.	322	Q8IWZ5	TRI42_HUMAN	E	322	ENSP00000286349:D322E	ENSP00000286349:D322E	D	+	3	2	TRIM42	141884618	0.625000	0.27111	1.000000	0.80357	0.925000	0.55904	0.551000	0.23361	2.567000	0.86603	0.561000	0.74099	GAC	.	.		0.562	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359531.2	NM_152616	
EVC2	132884	hgsc.bcm.edu	37	4	5664973	5664973	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr4:5664973C>T	ENST00000344408.5	-	9	1059	c.1006G>A	c.(1006-1008)Gtt>Att	p.V336I	EVC2_ENST00000310917.2_Splice_Site_p.V256I|EVC2_ENST00000344938.1_Splice_Site_p.V336I	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	336					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TACTGCCAAACCTTCAGGAGA	0.498																																					p.V336I		Atlas-SNP	.											.	EVC2	202	.	0			c.G1006A						.						114.0	115.0	115.0					4																	5664973		2203	4300	6503	SO:0001630	splice_region_variant	132884	exon9			GCCAAACCTTCAG	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1006-1G>A	chr4.hg19:g.5664973C>T		87.0	0.0		78.0	19.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	hg19	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	C	12.32	1.903520	0.33628	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.76448	-1.02;-1.02;-1.02	5.27	4.42	0.53409	.	0.729745	0.13477	N	0.385008	T	0.72236	0.3435	L	0.57536	1.79	0.24000	N	0.996212	B	0.17667	0.023	B	0.15052	0.012	T	0.58340	-0.7653	10	0.22706	T	0.39	-2.3607	10.6002	0.45362	0.0:0.9082:0.0:0.0918	.	336	Q86UK5	LBN_HUMAN	I	336;256;336	ENSP00000339954:V336I;ENSP00000311683:V256I;ENSP00000342144:V336I	ENSP00000311683:V256I	V	-	1	0	EVC2	5715874	0.219000	0.23619	0.294000	0.24946	0.112000	0.19704	0.538000	0.23160	1.306000	0.44926	0.655000	0.94253	GTT	.	.		0.498	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	Missense_Mutation
REST	5978	hgsc.bcm.edu	37	4	57797002	57797002	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr4:57797002G>A	ENST00000309042.7	+	4	2292	c.1978G>A	c.(1978-1980)Ggg>Agg	p.G660R		NM_001193508.1|NM_005612.4	NP_001180437.1|NP_005603.3	Q13127	REST_HUMAN	RE1-silencing transcription factor	660	Pro-rich.				cardiac muscle cell myoblast differentiation (GO:0060379)|cellular response to drug (GO:0035690)|cellular response to electrical stimulus (GO:0071257)|cellular response to glucocorticoid stimulus (GO:0071385)|hematopoietic progenitor cell differentiation (GO:0002244)|histone H4 deacetylation (GO:0070933)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of amniotic stem cell differentiation (GO:2000798)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of dense core granule biogenesis (GO:2000706)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin secretion (GO:0046676)|negative regulation of mesenchymal stem cell differentiation (GO:2000740)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of transcription, DNA-templated (GO:0045893)|potassium ion transmembrane transport (GO:0071805)|regulation of transcription, DNA-templated (GO:0006355)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|outward rectifier potassium channel activity (GO:0015271)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(22)|ovary(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	50	Glioma(25;0.08)|all_neural(26;0.181)					GGTTCAGGAGGGGCCTGCTCA	0.617																																					p.G660R		Atlas-SNP	.											.	REST	104	.	0			c.G1978A						.						42.0	46.0	45.0					4																	57797002		2203	4300	6503	SO:0001583	missense	5978	exon4			CAGGAGGGGCCTG	U13879	CCDS3509.1	4q12	2008-02-05			ENSG00000084093	ENSG00000084093			9966	protein-coding gene	gene with protein product		600571				7871435, 7697725	Standard	NM_005612		Approved	NRSF, XBR	uc003hci.3	Q13127	OTTHUMG00000128770	ENST00000309042.7:c.1978G>A	chr4.hg19:g.57797002G>A	ENSP00000311816:p.Gly660Arg	105.0	0.0		113.0	36.0	NM_001193508	A2RUE0|B9EGJ0|Q12956|Q12957|Q13134|Q59ER1|Q8IWI3	Missense_Mutation	SNP	ENST00000309042.7	hg19	CCDS3509.1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338866	0.60963	.	.	ENSG00000084093	ENST00000309042;ENST00000358605	T	0.08193	3.12	3.24	3.24	0.37175	.	.	.	.	.	T	0.10337	0.0253	L	0.60455	1.87	0.09310	N	1	B;B	0.21520	0.047;0.057	B;B	0.21917	0.037;0.014	T	0.24297	-1.0164	9	0.17369	T	0.5	0.0593	12.7223	0.57149	0.0:0.0:1.0:0.0	.	637;660	F8WAN5;Q13127	.;REST_HUMAN	R	660;637	ENSP00000311816:G660R	ENSP00000311816:G660R	G	+	1	0	REST	57491759	0.009000	0.17119	0.024000	0.17045	0.416000	0.31233	1.730000	0.38125	1.771000	0.52183	0.462000	0.41574	GGG	.	.		0.617	REST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250691.2	NM_005612	
DSPP	1834	hgsc.bcm.edu	37	4	88537513	88537513	+	Missense_Mutation	SNP	A	A	C	rs112275895		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr4:88537513A>C	ENST00000282478.7	+	4	3732	c.3699A>C	c.(3697-3699)gaA>gaC	p.E1233D	DSPP_ENST00000399271.1_Missense_Mutation_p.E1233D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1233	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		acagcaatgaaagcagcgaca	0.547																																					p.E1233D		Atlas-SNP	.											.	DSPP	174	.	0			c.A3699C						.																																			SO:0001583	missense	1834	exon5			CAATGAAAGCAGC	AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3699A>C	chr4.hg19:g.88537513A>C	ENSP00000282478:p.Glu1233Asp	298.0	0.0		362.0	48.0	NM_014208	A8MUI0|O95815	Missense_Mutation	SNP	ENST00000282478.7	hg19	CCDS43248.1	.	.	.	.	.	.	.	.	.	.	A	0.010	-1.785366	0.00628	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88741	-2.42;-2.42	2.61	-5.21	0.02815	.	.	.	.	.	T	0.57213	0.2038	N	0.01048	-1.04	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57347	-0.7827	9	0.02654	T	1	.	0.7125	0.00926	0.2623:0.1881:0.1298:0.4197	.	1233	Q9NZW4	DSPP_HUMAN	D	1233	ENSP00000382213:E1233D;ENSP00000282478:E1233D	ENSP00000282478:E1233D	E	+	3	2	DSPP	88756537	0.003000	0.15002	0.000000	0.03702	0.000000	0.00434	-2.769000	0.00780	-2.252000	0.00699	-3.496000	0.00033	GAA	.	A|0.500;C|0.500		0.547	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000363616.3	NM_014208	
PCDH18	54510	hgsc.bcm.edu	37	4	138452132	138452132	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr4:138452132C>T	ENST00000344876.4	-	1	1497	c.1111G>A	c.(1111-1113)Gaa>Aaa	p.E371K	PCDH18_ENST00000507846.1_Missense_Mutation_p.E151K|PCDH18_ENST00000412923.2_Missense_Mutation_p.E371K|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000510305.1_Intron	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	371	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					GGATCCCCTTCAAAAATATAA	0.353																																					p.E371K		Atlas-SNP	.											.	PCDH18	229	.	0			c.G1111A						.						47.0	50.0	49.0					4																	138452132		2203	4299	6502	SO:0001583	missense	54510	exon1			CCCCTTCAAAAAT	AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1111G>A	chr4.hg19:g.138452132C>T	ENSP00000355082:p.Glu371Lys	207.0	0.0		238.0	77.0	NM_019035	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	ENST00000344876.4	hg19	CCDS34064.1	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706878	0.89018	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.76316	-1.01;-1.01;-1.01	5.92	5.92	0.95590	Cadherin (3);Cadherin-like (1);	0.000000	0.44097	D	0.000483	D	0.93979	0.8072	H	0.99197	4.465	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.95872	0.8892	10	0.87932	D	0	.	20.3167	0.98654	0.0:1.0:0.0:0.0	.	151;371;371	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	K	371;371;151	ENSP00000355082:E371K;ENSP00000390688:E371K;ENSP00000425903:E151K	ENSP00000355082:E371K	E	-	1	0	PCDH18	138671582	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	7.770000	0.85390	2.809000	0.96659	0.557000	0.71058	GAA	.	.		0.353	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000364614.1	NM_019035	
ALDH7A1	501	hgsc.bcm.edu	37	5	125918580	125918580	+	Silent	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr5:125918580T>C	ENST00000409134.3	-	5	699	c.480A>G	c.(478-480)ttA>ttG	p.L160L	ALDH7A1_ENST00000413020.1_5'UTR|ALDH7A1_ENST00000553117.1_Silent_p.L160L|ALDH7A1_ENST00000447989.2_Silent_p.L187L	NM_001182.4|NM_001201377.1	NP_001173.2|NP_001188306.1	P49419	AL7A1_HUMAN	aldehyde dehydrogenase 7 family, member A1	160					cellular aldehyde metabolic process (GO:0006081)|cellular nitrogen compound metabolic process (GO:0034641)|glycine betaine biosynthetic process from choline (GO:0019285)|lysine catabolic process (GO:0006554)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|betaine-aldehyde dehydrogenase activity (GO:0008802)|L-aminoadipate-semialdehyde dehydrogenase activity (GO:0004043)			endometrium(1)|kidney(4)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	16		all_cancers(142;0.24)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.0584)|Kidney(363;0.0934)	Epithelial(69;0.0417)|OV - Ovarian serous cystadenocarcinoma(64;0.068)|all cancers(49;0.109)		TCATCCTTGATAAACCAACAG	0.373																																					p.L187L		Atlas-SNP	.											.	ALDH7A1	57	.	0			c.A561G						.						115.0	104.0	108.0					5																	125918580		2203	4300	6503	SO:0001819	synonymous_variant	501	exon5			CCTTGATAAACCA	S74728	CCDS4137.2, CCDS56380.1	5q31	2013-06-03			ENSG00000164904	ENSG00000164904	1.2.1.31	"""Aldehyde dehydrogenases"""	877	protein-coding gene	gene with protein product	"""antiquitin 1"", ""26g turgor protein homolog"", ""alpha-aminoadipic semialdehyde dehydrogenase"", ""alpha-AASA dehydrogenase"", ""delta1-piperideine-6-carboxylate dehydrogenease"", ""P6c dehydrogenase"""	107323		ATQ1		9417906	Standard	NM_001182		Approved	EPD, PDE	uc003ktx.3	P49419	OTTHUMG00000128942	ENST00000409134.3:c.480A>G	chr5.hg19:g.125918580T>C		267.0	0.0		325.0	172.0	NM_001202404	B2R669|B4DIC7|B4DMA0|E7EPT3|O14619|Q6IPU8|Q9BUL4	Silent	SNP	ENST00000409134.3	hg19	CCDS4137.2																																																																																			.	.		0.373	ALDH7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250921.2	NM_001182	
POM121L2	94026	hgsc.bcm.edu	37	6	27279335	27279335	+	Silent	SNP	G	G	A	rs149082261	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:27279335G>A	ENST00000444565.1	-	1	614	c.615C>T	c.(613-615)ctC>ctT	p.L205L	POM121L2_ENST00000377451.2_Silent_p.L205L	NM_033482.3	NP_258443.2	Q96KW2	P12L2_HUMAN	POM121 transmembrane nucleoporin-like 2	205										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|skin(1)	7						CAAAAGAAGTGAGGGTTCCAT	0.527																																					p.L205L		Atlas-SNP	.											.	POM121L2	61	.	0			c.C615T						.						87.0	74.0	78.0					6																	27279335		692	1591	2283	SO:0001819	synonymous_variant	94026	exon1			AGAAGTGAGGGTT	AL021808	CCDS59497.1	6p21.3	2012-03-13	2012-03-13		ENSG00000158553	ENSG00000158553			13973	protein-coding gene	gene with protein product			"""POM121 membrane glycoprotein-like 2 (rat)"", ""POM121 membrane glycoprotein-like 2"""				Standard	NM_033482		Approved	POM121-L	uc011dku.1	Q96KW2	OTTHUMG00000014475	ENST00000444565.1:c.615C>T	chr6.hg19:g.27279335G>A		37.0	0.0		67.0	40.0	NM_033482	C9J1I7	Silent	SNP	ENST00000444565.1	hg19	CCDS59497.1																																																																																			.	G|0.999;T|0.001		0.527	POM121L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040143.2	NM_033482	
RGL2	5863	hgsc.bcm.edu	37	6	33259901	33259901	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:33259901T>G	ENST00000497454.1	-	18	2807	c.2312A>C	c.(2311-2313)aAg>aCg	p.K771T	WDR46_ENST00000477718.1_5'Flank|RGL2_ENST00000437840.2_5'UTR|WDR46_ENST00000374617.4_5'Flank|PFDN6_ENST00000463584.1_Intron	NM_001243738.1|NM_004761.4	NP_001230667.1|NP_004752.1	O15211	RGL2_HUMAN	ral guanine nucleotide dissociation stimulator-like 2	771					positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)	intracellular (GO:0005622)	Ras guanyl-nucleotide exchange factor activity (GO:0005088)			breast(2)|cervix(2)|endometrium(7)|kidney(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	34						CCGTGCAATCTTCCTCCCTGT	0.572																																					p.K771T		Atlas-SNP	.											.	RGL2	58	.	0			c.A2312C						.						62.0	54.0	57.0					6																	33259901		2203	4300	6503	SO:0001583	missense	5863	exon18			GCAATCTTCCTCC		CCDS4774.1	6p21.3	2010-02-17	2004-06-11	2004-06-16	ENSG00000237441	ENSG00000237441			9769	protein-coding gene	gene with protein product		602306	"""RAB2, member RAS oncogene family-like"""	RAB2L		8976381	Standard	NM_001243738		Approved	KE1.5, HKE1.5	uc003odv.3	O15211	OTTHUMG00000031072	ENST00000497454.1:c.2312A>C	chr6.hg19:g.33259901T>G	ENSP00000420211:p.Lys771Thr	82.0	0.0		107.0	22.0	NM_004761	B4DG72|Q5STK0|Q9Y3F3	Missense_Mutation	SNP	ENST00000497454.1	hg19	CCDS4774.1	.	.	.	.	.	.	.	.	.	.	T	15.44	2.833583	0.50951	.	.	ENSG00000237441	ENST00000497454	T	0.13778	2.56	5.5	5.5	0.81552	.	0.060904	0.64402	D	0.000004	T	0.08980	0.0222	N	0.19112	0.55	0.80722	D	1	D	0.53885	0.963	P	0.52554	0.702	T	0.06643	-1.0815	10	0.87932	D	0	.	12.0031	0.53243	0.0:0.0:0.0:1.0	.	771	O15211	RGL2_HUMAN	T	771	ENSP00000420211:K771T	ENSP00000420211:K771T	K	-	2	0	RGL2	33367879	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.553000	0.53713	2.084000	0.62774	0.448000	0.29417	AAG	.	.		0.572	RGL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076098.2		
RIMS1	22999	hgsc.bcm.edu	37	6	72806711	72806711	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:72806711C>A	ENST00000521978.1	+	3	305	c.305C>A	c.(304-306)gCg>gAg	p.A102E	RIMS1_ENST00000348717.5_Missense_Mutation_p.A102E|RIMS1_ENST00000520567.1_Missense_Mutation_p.A102E|RIMS1_ENST00000518273.1_Missense_Mutation_p.A102E|RIMS1_ENST00000522291.1_Missense_Mutation_p.A102E|RIMS1_ENST00000517960.1_Missense_Mutation_p.A102E|RIMS1_ENST00000491071.2_Missense_Mutation_p.A102E|RIMS1_ENST00000264839.7_Missense_Mutation_p.A102E	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	102	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				GGGGAAGAAGCGCGGCGTTAC	0.438																																					p.A102E		Atlas-SNP	.											RIMS1,NS,carcinoma,0,1	RIMS1	278	.	0			c.C305A						.						82.0	77.0	79.0					6																	72806711		1931	4135	6066	SO:0001583	missense	22999	exon3			AAGAAGCGCGGCG	AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.305C>A	chr6.hg19:g.72806711C>A	ENSP00000428417:p.Ala102Glu	204.0	0.0		119.0	63.0	NM_014989	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Missense_Mutation	SNP	ENST00000521978.1	hg19	CCDS47449.1	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787299	0.90367	.	.	ENSG00000079841	ENST00000491071;ENST00000350827;ENST00000352008;ENST00000348717;ENST00000349908;ENST00000346609;ENST00000264839;ENST00000517960;ENST00000518273;ENST00000520567;ENST00000522291;ENST00000521978	T;T;T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29;1.29;1.29	5.81	5.81	0.92471	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.093571	0.45361	D	0.000364	T	0.32285	0.0824	L	0.55481	1.735	0.80722	D	1	P	0.46784	0.884	B	0.43575	0.424	T	0.13282	-1.0515	10	0.59425	D	0.04	-17.8794	20.0804	0.97772	0.0:1.0:0.0:0.0	.	102	Q86UR5	RIMS1_HUMAN	E	102	ENSP00000430101:A102E;ENSP00000275037:A102E;ENSP00000264839:A102E;ENSP00000429959:A102E;ENSP00000430408:A102E;ENSP00000430502:A102E;ENSP00000430932:A102E;ENSP00000428417:A102E	ENSP00000264839:A102E	A	+	2	0	RIMS1	72863432	1.000000	0.71417	0.964000	0.40570	0.745000	0.42441	7.798000	0.85924	2.738000	0.93877	0.655000	0.94253	GCG	.	.		0.438	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000374968.1		
COL12A1	1303	hgsc.bcm.edu	37	6	75904605	75904605	+	Silent	SNP	T	T	C	rs201454637		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:75904605T>C	ENST00000322507.8	-	3	441	c.132A>G	c.(130-132)tcA>tcG	p.S44S	COL12A1_ENST00000483888.2_Silent_p.S44S|COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000416123.2_Silent_p.S44S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	44	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GTTTTGCCCATGACATATGAA	0.363																																					p.S44S		Atlas-SNP	.											.	COL12A1	385	.	0			c.A132G						.	T	,	0,3650		0,0,1825	112.0	106.0	108.0		132,	3.3	1.0	6		108	7,8155		0,7,4074	no	coding-synonymous,intron	COL12A1	NM_004370.5,NM_080645.2	,	0,7,5899	CC,CT,TT		0.0858,0.0,0.0593	,	44/3064,	75904605	7,11805	1825	4081	5906	SO:0001819	synonymous_variant	1303	exon3			TGCCCATGACATA	U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.132A>G	chr6.hg19:g.75904605T>C		72.0	0.0		61.0	33.0	NM_004370	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Silent	SNP	ENST00000322507.8	hg19	CCDS43482.1																																																																																			.	T|0.999;C|0.001		0.363	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041249.3	NM_004370	
NOD1	10392	hgsc.bcm.edu	37	7	30492539	30492539	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:30492539T>C	ENST00000222823.4	-	6	1019	c.494A>G	c.(493-495)gAg>gGg	p.E165G	NOD1_ENST00000423334.2_Missense_Mutation_p.E165G	NM_006092.2	NP_006083.1	Q9Y239	NOD1_HUMAN	nucleotide-binding oligomerization domain containing 1	165					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPK activity (GO:0000187)|apoptotic process (GO:0006915)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-8 biosynthetic process (GO:0042228)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of tumor necrosis factor production (GO:0032760)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|identical protein binding (GO:0042802)|peptidoglycan binding (GO:0042834)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|skin(2)	39						GCCAACCAGCTCCATGATGGT	0.597																																					p.E165G		Atlas-SNP	.											.	NOD1	79	.	0			c.A494G						.						124.0	103.0	110.0					7																	30492539		2203	4300	6503	SO:0001583	missense	10392	exon6			ACCAGCTCCATGA	AF126484	CCDS5427.1	7p15-p14	2006-12-08	2006-12-08	2006-12-08	ENSG00000106100	ENSG00000106100		"""Nucleotide-binding domain and leucine rich repeat containing"""	16390	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 1"", ""NLR family, CARD domain containing 1"""	605980	"""caspase recruitment domain family, member 4"""	CARD4		10224040, 10329646	Standard	NM_006092		Approved	NLRC1, CLR7.1	uc003tav.3	Q9Y239	OTTHUMG00000023923	ENST00000222823.4:c.494A>G	chr7.hg19:g.30492539T>C	ENSP00000222823:p.Glu165Gly	65.0	0.0		67.0	32.0	NM_006092	B4DTU3|Q549U4|Q8IWF5	Missense_Mutation	SNP	ENST00000222823.4	hg19	CCDS5427.1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.971382	0.53614	.	.	ENSG00000106100	ENST00000222823;ENST00000423334	T	0.73789	-0.78	5.56	5.56	0.83823	.	0.094006	0.64402	D	0.000001	D	0.83133	0.5188	M	0.68952	2.095	0.58432	D	0.999999	D;D	0.71674	0.995;0.998	P;P	0.61722	0.541;0.893	D	0.85292	0.1068	10	0.87932	D	0	.	14.9019	0.70687	0.0:0.0:0.0:1.0	.	165;165	B4DTU3;Q9Y239	.;NOD1_HUMAN	G	165	ENSP00000222823:E165G	ENSP00000222823:E165G	E	-	2	0	NOD1	30459064	1.000000	0.71417	1.000000	0.80357	0.451000	0.32288	6.259000	0.72494	2.110000	0.64415	0.533000	0.62120	GAG	.	.		0.597	NOD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250443.2		
ACHE	43	hgsc.bcm.edu	37	7	100491063	100491063	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:100491063T>A	ENST00000412389.1	-	1	946	c.791A>T	c.(790-792)aAt>aTt	p.N264I	ACHE_ENST00000302913.4_Missense_Mutation_p.N264I|ACHE_ENST00000497647.1_5'Flank|ACHE_ENST00000411582.1_Missense_Mutation_p.N264I|ACHE_ENST00000428317.1_Missense_Mutation_p.N264I|ACHE_ENST00000419336.2_Missense_Mutation_p.N264I|ACHE_ENST00000241069.5_Missense_Mutation_p.N264I			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	264					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CCAGGGTCCATTGGGGGCACC	0.721																																					p.N264I		Atlas-SNP	.											.	ACHE	80	.	0			c.A791T						.						22.0	25.0	24.0					7																	100491063		2201	4297	6498	SO:0001583	missense	43	exon2			GGTCCATTGGGGG		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.791A>T	chr7.hg19:g.100491063T>A	ENSP00000394976:p.Asn264Ile	34.0	0.0		55.0	23.0	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Missense_Mutation	SNP	ENST00000412389.1	hg19	CCDS5709.1	.	.	.	.	.	.	.	.	.	.	T	15.57	2.872199	0.51695	.	.	ENSG00000087085	ENST00000419336;ENST00000241069;ENST00000428317;ENST00000302913;ENST00000412389;ENST00000426415;ENST00000430554;ENST00000411582;ENST00000422451	T;T;T;T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96;1.96;1.96;1.96	4.95	3.78	0.43462	Carboxylesterase, type B (1);	0.099065	0.64402	D	0.000002	T	0.30262	0.0759	L	0.33668	1.02	0.53688	D	0.999975	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.997;0.998;0.999	T	0.01899	-1.1251	10	0.31617	T	0.26	.	8.6379	0.33959	0.0:0.0937:0.0:0.9063	.	264;264;264;264	B7WPI6;P22303-3;P22303-2;P22303	.;.;.;ACES_HUMAN	I	264	ENSP00000403474:N264I;ENSP00000241069:N264I;ENSP00000414858:N264I;ENSP00000303211:N264I;ENSP00000394976:N264I;ENSP00000397143:N264I;ENSP00000399725:N264I;ENSP00000404865:N264I	ENSP00000241069:N264I	N	-	2	0	ACHE	100328999	1.000000	0.71417	0.992000	0.48379	0.775000	0.43874	3.644000	0.54381	0.721000	0.32231	0.397000	0.26171	AAT	.	.		0.721	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
SLC13A4	26266	hgsc.bcm.edu	37	7	135370360	135370360	+	Silent	SNP	G	G	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:135370360G>C	ENST00000354042.4	-	14	2204	c.1515C>G	c.(1513-1515)acC>acG	p.T505T	C7orf73_ENST00000422968.1_Intron|SLC13A4_ENST00000491630.1_5'UTR	NM_012450.2	NP_036582.2	Q9UKG4	S13A4_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 4	505					sodium ion transmembrane transport (GO:0035725)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|skin(1)|upper_aerodigestive_tract(2)	24						ATGCCAGCAGGGTGACAGCCC	0.542																																					p.T505T		Atlas-SNP	.											.	SLC13A4	56	.	0			c.C1515G						.						201.0	175.0	184.0					7																	135370360		2203	4300	6503	SO:0001819	synonymous_variant	26266	exon14			CAGCAGGGTGACA	AF169301	CCDS5840.1	7q33	2013-07-18	2013-07-18		ENSG00000164707	ENSG00000164707		"""Solute carriers"""	15827	protein-coding gene	gene with protein product	"""sulphate transporter 1"""	604309	"""solute carrier family 13 (sodium/sulphate symporters), member 4"""			10535998	Standard	NM_012450		Approved	SUT-1, SUT1	uc003vta.3	Q9UKG4	OTTHUMG00000155539	ENST00000354042.4:c.1515C>G	chr7.hg19:g.135370360G>C		104.0	0.0		138.0	33.0	NM_012450	A4D1Q4|Q8N631	Silent	SNP	ENST00000354042.4	hg19	CCDS5840.1																																																																																			.	.		0.542	SLC13A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000340558.1	NM_012450	
ZNF282	8427	hgsc.bcm.edu	37	7	148892729	148892729	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:148892729G>A	ENST00000262085.3	+	1	153	c.48G>A	c.(46-48)caG>caA	p.Q16Q	ZNF282_ENST00000479907.1_Silent_p.Q16Q	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	16					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		TGGGCATCCAGGGCCTGGGGC	0.687																																					p.Q16Q		Atlas-SNP	.											.	ZNF282	42	.	0			c.G48A						.						13.0	15.0	14.0					7																	148892729		2198	4288	6486	SO:0001819	synonymous_variant	8427	exon1			CATCCAGGGCCTG	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.48G>A	chr7.hg19:g.148892729G>A		118.0	0.0		150.0	73.0	NM_003575	B4DRI5|O43691|Q6DKK0	Silent	SNP	ENST00000262085.3	hg19	CCDS5895.1																																																																																			.	.		0.687	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
ASIC3	9311	hgsc.bcm.edu	37	7	150745974	150745974	+	Start_Codon_SNP	SNP	T	T	C	rs143427620		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:150745974T>C	ENST00000349064.5	+	1	200	c.2T>C	c.(1-3)aTg>aCg	p.M1T	ASIC3_ENST00000357922.4_Start_Codon_SNP_p.M1T|ASIC3_ENST00000297512.8_Start_Codon_SNP_p.M1T	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	1					cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										GTTCTGGCCATGAAGCCCACC	0.637																																					p.M1T		Atlas-SNP	.											.	.	.	.	0			c.T2C						.	T	THR/MET,THR/MET,THR/MET	0,4368		0,0,2184	44.0	54.0	51.0		2,2,2	4.9	1.0	7	dbSNP_134	51	3,8581		0,3,4289	yes	missense,missense,missense	ACCN3	NM_004769.2,NM_020321.2,NM_020322.2	81,81,81	0,3,6473	CC,CT,TT		0.0349,0.0,0.0232	possibly-damaging,possibly-damaging,possibly-damaging	1/532,1/550,1/544	150745974	3,12949	2184	4292	6476	SO:0001582	initiator_codon_variant	9311	exon1			TGGCCATGAAGCC	AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.2T>C	chr7.hg19:g.150745974T>C	ENSP00000344838:p.Met1Thr	81.0	0.0		99.0	15.0	NM_020322	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	ENST00000349064.5	hg19	CCDS5916.1	.	.	.	.	.	.	.	.	.	.	T	16.60	3.168149	0.57476	0.0	3.49E-4	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.65732	-0.17;-0.14;-0.14	4.9	4.9	0.64082	.	0.808394	0.10083	U	0.718230	T	0.75664	0.3880	.	.	.	0.80722	D	1	D;B;D	0.69078	0.997;0.244;0.985	P;B;P	0.59221	0.854;0.099;0.834	T	0.73613	-0.3927	9	0.87932	D	0	-24.2573	12.7761	0.57448	0.0:0.0:0.0:1.0	.	1;1;1	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	T	1	ENSP00000350600:M1T;ENSP00000344838:M1T;ENSP00000297512:M1T	ENSP00000297512:M1T	M	+	2	0	ACCN3	150376907	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	2.473000	0.45145	1.974000	0.57490	0.374000	0.22700	ATG	.	T|1.000;C|0.000		0.637	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351725.1	NM_004769	Missense_Mutation
WDR60	55112	hgsc.bcm.edu	37	7	158705686	158705686	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr7:158705686A>T	ENST00000407559.3	+	13	1759	c.1601A>T	c.(1600-1602)cAg>cTg	p.Q534L		NM_018051.4	NP_060521.4	Q8WVS4	WDR60_HUMAN	WD repeat domain 60	534					cell projection organization (GO:0030030)	cilium (GO:0005929)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(3)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(4)|lung(16)|ovary(2)	35	Ovarian(565;0.152)	all_cancers(7;1.25e-09)|all_epithelial(9;0.000894)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)|STAD - Stomach adenocarcinoma(7;0.18)		GCATATGTTCAGTGTAACGAA	0.383																																					p.Q534L		Atlas-SNP	.											.	WDR60	94	.	0			c.A1601T						.						100.0	98.0	99.0					7																	158705686		1865	4097	5962	SO:0001583	missense	55112	exon13			ATGTTCAGTGTAA		CCDS47757.1	7q36.3	2013-11-15			ENSG00000126870	ENSG00000126870		"""WD repeat domain containing"""	21862	protein-coding gene	gene with protein product		615462				23910462	Standard	NM_018051		Approved	FLJ10300, FAP163	uc003woe.4	Q8WVS4	OTTHUMG00000151443	ENST00000407559.3:c.1601A>T	chr7.hg19:g.158705686A>T	ENSP00000384290:p.Gln534Leu	134.0	0.0		189.0	81.0	NM_018051	Q9NW58	Missense_Mutation	SNP	ENST00000407559.3	hg19	CCDS47757.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.411950	0.83340	.	.	ENSG00000126870	ENST00000407559	T	0.80994	-1.44	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.81133	0.4759	M	0.85777	2.775	0.80722	D	1	P;P	0.40431	0.717;0.476	B;B	0.35039	0.194;0.172	D	0.84599	0.0671	10	0.87932	D	0	-22.407	13.4283	0.61039	1.0:0.0:0.0:0.0	.	17;534	A4D230;Q8WVS4	.;WDR60_HUMAN	L	534	ENSP00000384290:Q534L	ENSP00000384290:Q534L	Q	+	2	0	WDR60	158398447	1.000000	0.71417	0.993000	0.49108	0.993000	0.82548	7.671000	0.83941	2.050000	0.60909	0.460000	0.39030	CAG	.	.		0.383	WDR60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322668.1	NM_018051	
FAM92A1	137392	hgsc.bcm.edu	37	8	94730901	94730901	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr8:94730901A>G	ENST00000518322.1	+	7	684		c.e7-1		FAM92A1_ENST00000423990.2_Intron|FAM92A1_ENST00000517718.1_Splice_Site|CTD-2006H14.2_ENST00000607706.1_RNA|FAM92A1_ENST00000519679.1_Splice_Site|RP11-10N23.2_ENST00000520562.1_RNA	NM_145269.3	NP_660312.2	A1XBS5	F92A1_HUMAN	family with sequence similarity 92, member A1											NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)	7	Breast(36;2.4e-06)		BRCA - Breast invasive adenocarcinoma(8;0.0168)			GGTTTTTTTTAGACTATATTT	0.269																																					.		Atlas-SNP	.											.	FAM92A1	22	.	0			c.544-2A>G						.						22.0	18.0	19.0					8																	94730901		1770	4036	5806	SO:0001630	splice_region_variant	137392	exon6			TTTTTTAGACTAT		CCDS47892.1, CCDS64933.1	8q22.1	2005-09-22			ENSG00000188343	ENSG00000188343			30452	protein-coding gene	gene with protein product						12477932	Standard	XM_005250783		Approved	FLJ38979	uc022ayd.1	A1XBS5	OTTHUMG00000164238	ENST00000518322.1:c.544-1A>G	chr8.hg19:g.94730901A>G		97.0	0.0		249.0	81.0	NM_145269	A1XBS4|Q32ND3|Q6AHW7|Q8N8R1|Q96L09	Splice_Site	SNP	ENST00000518322.1	hg19	CCDS47892.1	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274104	0.59649	.	.	ENSG00000188343	ENST00000518322;ENST00000341186;ENST00000540007;ENST00000517718;ENST00000521641;ENST00000519679	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.5602	0.84551	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM92A1	94800077	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	8.339000	0.90041	2.367000	0.80283	0.528000	0.53228	.	.	.		0.269	FAM92A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377890.4	NM_145269	Intron
SNX31	169166	hgsc.bcm.edu	37	8	101612592	101612592	+	Silent	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr8:101612592T>C	ENST00000311812.2	-	9	909	c.759A>G	c.(757-759)gaA>gaG	p.E253E	SNX31_ENST00000428383.2_Silent_p.E154E	NM_152628.3	NP_689841.3	Q8N9S9	SNX31_HUMAN	sorting nexin 31	253					protein transport (GO:0015031)	protein complex (GO:0043234)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|prostate(1)|skin(3)|urinary_tract(1)	26	all_cancers(14;4.01e-05)|all_epithelial(15;1.26e-07)|Lung NSC(17;0.000453)|all_lung(17;0.00125)		Epithelial(11;1.21e-11)|all cancers(13;2.62e-09)|OV - Ovarian serous cystadenocarcinoma(57;3.22e-06)|STAD - Stomach adenocarcinoma(118;0.206)			TTTGACTGTCTTCTTTCTGGA	0.358																																					p.E253E		Atlas-SNP	.											.	SNX31	66	.	0			c.A759G						.						217.0	200.0	206.0					8																	101612592		2202	4300	6502	SO:0001819	synonymous_variant	169166	exon9			ACTGTCTTCTTTC		CCDS6288.1	8q22.3	2011-05-03			ENSG00000174226	ENSG00000174226		"""Sorting nexins"""	28605	protein-coding gene	gene with protein product						16782399	Standard	NM_152628		Approved	MGC39715	uc003yjr.3	Q8N9S9	OTTHUMG00000164725	ENST00000311812.2:c.759A>G	chr8.hg19:g.101612592T>C		103.0	0.0		215.0	55.0	NM_152628	C9J6L9|Q8N0U9	Silent	SNP	ENST00000311812.2	hg19	CCDS6288.1																																																																																			.	.		0.358	SNX31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000379910.1	NM_152628	
DOCK8	81704	hgsc.bcm.edu	37	9	434955	434955	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr9:434955G>A	ENST00000453981.1	+	39	5171	c.5059G>A	c.(5059-5061)Gtg>Atg	p.V1687M	DOCK8_ENST00000382329.1_Missense_Mutation_p.V1154M|DOCK8_ENST00000469391.1_Missense_Mutation_p.V1587M|DOCK8_ENST00000432829.2_Missense_Mutation_p.V1619M			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	1687	DHR-2.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		CTACCTGCCCGTGGGCAGTGT	0.587																																					p.V1687M		Atlas-SNP	.											.	DOCK8	401	.	0			c.G5059A						.						85.0	82.0	83.0					9																	434955		2203	4300	6503	SO:0001583	missense	81704	exon39			CTGCCCGTGGGCA	AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.5059G>A	chr9.hg19:g.434955G>A	ENSP00000408464:p.Val1687Met	49.0	0.0		43.0	15.0	NM_203447	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Missense_Mutation	SNP	ENST00000453981.1	hg19	CCDS6440.2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081486	0.76528	.	.	ENSG00000107099	ENST00000453981;ENST00000287364;ENST00000432829;ENST00000469391;ENST00000382329	T;T;T;T	0.68624	2.51;-0.34;-0.34;-0.34	5.04	5.04	0.67666	.	0.059925	0.64402	D	0.000003	T	0.77698	0.4169	M	0.64567	1.98	0.80722	D	1	D;P;D	0.69078	0.997;0.948;0.964	P;P;P	0.62435	0.902;0.528;0.528	T	0.74272	-0.3719	10	0.28530	T	0.3	.	18.5837	0.91181	0.0:0.0:1.0:0.0	.	1587;1154;1687	E9PH09;A2A369;Q8NF50	.;.;DOCK8_HUMAN	M	1687;1655;1619;1587;1154	ENSP00000408464:V1687M;ENSP00000394888:V1619M;ENSP00000419438:V1587M;ENSP00000371766:V1154M	ENSP00000287364:V1655M	V	+	1	0	DOCK8	424955	1.000000	0.71417	0.959000	0.39883	0.989000	0.77384	4.654000	0.61469	2.615000	0.88500	0.609000	0.83330	GTG	.	.		0.587	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000171792.5	XM_036307	
ZFAND4	93550	hgsc.bcm.edu	37	10	46121665	46121665	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr10:46121665T>C	ENST00000344646.5	-	7	1821	c.1606A>G	c.(1606-1608)Aaa>Gaa	p.K536E	ZFAND4_ENST00000374370.1_5'UTR|ZFAND4_ENST00000374371.2_Intron|ZFAND4_ENST00000374366.3_Missense_Mutation_p.K462E	NM_001128324.2|NM_174890.2	NP_001121796.1|NP_777550.2	Q86XD8	ZFAN4_HUMAN	zinc finger, AN1-type domain 4	536							zinc ion binding (GO:0008270)										TCAGATCTTTTCCCAAGTGAA	0.378																																					p.K536E		Atlas-SNP	.											.	.	.	.	0			c.A1606G						.						82.0	85.0	84.0					10																	46121665		2203	4300	6503	SO:0001583	missense	93550	exon7			ATCTTTTCCCAAG	AF311324	CCDS7214.1, CCDS60520.1	10q11.22	2013-01-09	2011-11-10	2011-11-10	ENSG00000172671	ENSG00000172671		"""Zinc fingers, AN1-type domain containing"""	23504	protein-coding gene	gene with protein product			"""AN1, ubiquitin-like, homolog (Xenopus laevis)"""	ANUBL1			Standard	XM_005271837		Approved	FLJ40185	uc001jcp.4	Q86XD8	OTTHUMG00000018085	ENST00000344646.5:c.1606A>G	chr10.hg19:g.46121665T>C	ENSP00000339484:p.Lys536Glu	151.0	0.0		132.0	43.0	NM_001128324	A8K8V4|B2RAX2|Q5VVY5	Missense_Mutation	SNP	ENST00000344646.5	hg19	CCDS7214.1	.	.	.	.	.	.	.	.	.	.	T	25.5	4.644900	0.87859	.	.	ENSG00000172671	ENST00000344646;ENST00000374366;ENST00000374370	T;T	0.32515	1.45;1.47	5.73	5.73	0.89815	.	5.101160	0.00496	N	0.000146	T	0.61837	0.2379	M	0.75264	2.295	0.58432	D	0.999996	D	0.67145	0.996	D	0.66351	0.943	T	0.14755	-1.0461	10	0.87932	D	0	-13.0771	13.973	0.64252	0.0:0.0:0.0:1.0	.	536	Q86XD8	ANUB1_HUMAN	E	536;462;418	ENSP00000339484:K536E;ENSP00000363486:K462E	ENSP00000339484:K536E	K	-	1	0	ANUBL1	45441671	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.371000	0.79600	2.186000	0.69663	0.459000	0.35465	AAA	.	.		0.378	ZFAND4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047790.1	NM_174890	
MYPN	84665	hgsc.bcm.edu	37	10	69926386	69926386	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr10:69926386G>A	ENST00000358913.5	+	10	2424	c.1936G>A	c.(1936-1938)Gtg>Atg	p.V646M	MYPN_ENST00000354393.2_Missense_Mutation_p.V371M|MYPN_ENST00000540630.1_Missense_Mutation_p.V646M	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	646					sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						TTCTTCCCCCGTGAAAGAGCC	0.512																																					p.V646M		Atlas-SNP	.											.	MYPN	189	.	0			c.G1936A						.						40.0	40.0	40.0					10																	69926386		2203	4300	6503	SO:0001583	missense	84665	exon10			TCCCCCGTGAAAG	AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.1936G>A	chr10.hg19:g.69926386G>A	ENSP00000351790:p.Val646Met	163.0	0.0		151.0	19.0	NM_032578	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Missense_Mutation	SNP	ENST00000358913.5	hg19	CCDS7275.1	.	.	.	.	.	.	.	.	.	.	G	11.17	1.560993	0.27827	.	.	ENSG00000138347	ENST00000354393;ENST00000542332;ENST00000358913;ENST00000540630	T;T;T	0.58797	0.31;0.41;0.38	5.43	-2.38	0.06622	.	1.051730	0.07396	N	0.889937	T	0.36276	0.0961	N	0.24115	0.695	0.09310	N	1	P;P;P	0.46706	0.883;0.771;0.661	B;B;B	0.36666	0.212;0.23;0.105	T	0.25813	-1.0121	9	.	.	.	.	8.2643	0.31804	0.6831:0.0:0.137:0.1799	.	646;371;646	F5GWA6;Q86TC9-2;Q86TC9	.;.;MYPN_HUMAN	M	371;371;646;646	ENSP00000346369:V371M;ENSP00000351790:V646M;ENSP00000441668:V646M	.	V	+	1	0	MYPN	69596392	0.001000	0.12720	0.104000	0.21259	0.807000	0.45602	-0.123000	0.10611	-0.695000	0.05105	-0.140000	0.14226	GTG	.	.		0.512	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000048307.1	NM_032578	
CRTAC1	55118	hgsc.bcm.edu	37	10	99696049	99696049	+	Missense_Mutation	SNP	C	C	T	rs375692428	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr10:99696049C>T	ENST00000370597.3	-	3	654	c.299G>A	c.(298-300)cGc>cAc	p.R100H	CRTAC1_ENST00000298819.4_Missense_Mutation_p.R100H|CRTAC1_ENST00000370591.2_Missense_Mutation_p.R100H	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	100						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		GGGTGAGCTGCGCTCATCGAC	0.642													C|||	2	0.000399361	0.0	0.0	5008	,	,		18224	0.0		0.0	False		,,,				2504	0.002				p.R100H		Atlas-SNP	.											.	CRTAC1	86	.	0			c.G299A						.	C	HIS/ARG,HIS/ARG	0,4406		0,0,2203	64.0	53.0	57.0		299,299	4.8	1.0	10		57	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CRTAC1	NM_001206528.2,NM_018058.6	29,29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign,benign	100/646,100/662	99696049	1,13005	2203	4300	6503	SO:0001583	missense	55118	exon3			GAGCTGCGCTCAT	AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.299G>A	chr10.hg19:g.99696049C>T	ENSP00000359629:p.Arg100His	81.0	0.0		75.0	25.0	NM_001206528	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	ENST00000370597.3	hg19	CCDS31266.1	.	.	.	.	.	.	.	.	.	.	C	14.02	2.409456	0.42715	0.0	1.16E-4	ENSG00000095713	ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T	0.75938	-0.98;1.31;-0.13;-0.13	4.76	4.76	0.60689	.	0.058751	0.64402	D	0.000002	T	0.64271	0.2583	L	0.33485	1.01	0.49213	D	0.99976	B;B	0.19583	0.011;0.037	B;B	0.12156	0.004;0.007	T	0.59825	-0.7381	10	0.15066	T	0.55	-18.3388	17.7666	0.88480	0.0:1.0:0.0:0.0	.	100;100	Q9NQ79-2;Q9NQ79	.;CRAC1_HUMAN	H	100;100;92;100	ENSP00000359629:R100H;ENSP00000298819:R100H;ENSP00000310810:R92H;ENSP00000359623:R100H	ENSP00000298819:R100H	R	-	2	0	CRTAC1	99686039	0.998000	0.40836	1.000000	0.80357	0.665000	0.39181	1.563000	0.36364	2.204000	0.70986	0.313000	0.20887	CGC	.	.		0.642	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000049754.1	NM_018058	
CALHM2	51063	hgsc.bcm.edu	37	10	105207130	105207130	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr10:105207130A>G	ENST00000260743.5	-	4	1274	c.751T>C	c.(751-753)Ttt>Ctt	p.F251L	RP11-225H22.7_ENST00000608063.1_RNA|CALHM2_ENST00000369788.3_Missense_Mutation_p.F251L|CALHM2_ENST00000494180.1_5'Flank	NM_015916.4	NP_057000.2	Q9HA72	CAHM2_HUMAN	calcium homeostasis modulator 2	251					ion transport (GO:0006811)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)|skin(1)	11						ACAAAGCCAAAGAAGCGGCGC	0.617																																					p.F251L		Atlas-SNP	.											.	CALHM2	30	.	0			c.T751C						.						86.0	77.0	80.0					10																	105207130		2203	4300	6503	SO:0001583	missense	51063	exon4			AGCCAAAGAAGCG	BC000039	CCDS7549.1	10q24.33	2008-07-02	2008-07-02	2008-07-02	ENSG00000138172	ENSG00000138172			23493	protein-coding gene	gene with protein product		612235	"""family with sequence similarity 26, member B"""	FAM26B		18585350	Standard	NM_015916		Approved		uc001kxa.3	Q9HA72	OTTHUMG00000018990	ENST00000260743.5:c.751T>C	chr10.hg19:g.105207130A>G	ENSP00000260743:p.Phe251Leu	106.0	0.0		107.0	8.0	NM_015916	D3DR94|O95893|Q6ZUV9	Missense_Mutation	SNP	ENST00000260743.5	hg19	CCDS7549.1	.	.	.	.	.	.	.	.	.	.	A	34	5.341577	0.95783	.	.	ENSG00000138172	ENST00000369788;ENST00000260743	T;T	0.56444	0.46;0.46	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.73385	0.3580	M	0.84326	2.69	0.80722	D	1	D	0.69078	0.997	D	0.66497	0.944	T	0.78575	-0.2151	10	0.87932	D	0	-18.8865	15.3625	0.74492	1.0:0.0:0.0:0.0	.	251	Q9HA72	CAHM2_HUMAN	L	251	ENSP00000358803:F251L;ENSP00000260743:F251L	ENSP00000260743:F251L	F	-	1	0	CALHM2	105197120	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.296000	0.89940	2.045000	0.60652	0.459000	0.35465	TTT	.	.		0.617	CALHM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050159.1	NM_015916	
COL17A1	1308	hgsc.bcm.edu	37	10	105803274	105803274	+	Missense_Mutation	SNP	G	G	C	rs543835020	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr10:105803274G>C	ENST00000353479.5	-	35	2790	c.2500C>G	c.(2500-2502)Cct>Gct	p.P834A	COL17A1_ENST00000369733.3_Missense_Mutation_p.P834A	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	834	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GCACCTGGAGGTCCTGGGGGT	0.542																																					p.P834A		Atlas-SNP	.											.	COL17A1	149	.	0			c.C2500G						.						25.0	27.0	26.0					10																	105803274		2203	4300	6503	SO:0001583	missense	1308	exon35			CTGGAGGTCCTGG	M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.2500C>G	chr10.hg19:g.105803274G>C	ENSP00000340937:p.Pro834Ala	227.0	0.0		188.0	14.0	NM_000494	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	ENST00000353479.5	hg19	CCDS7554.1	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879548	0.51801	.	.	ENSG00000065618	ENST00000353479;ENST00000369733	D;D	0.96554	-4.05;-4.05	5.77	5.77	0.91146	.	0.000000	0.46442	D	0.000286	D	0.94608	0.8262	L	0.31476	0.935	0.80722	D	1	D	0.62365	0.991	P	0.58820	0.846	D	0.91037	0.4868	10	0.08179	T	0.78	-9.8049	10.8478	0.46753	0.0848:0.0:0.9152:0.0	.	834	Q9UMD9	COHA1_HUMAN	A	834	ENSP00000340937:P834A;ENSP00000358748:P834A	ENSP00000340937:P834A	P	-	1	0	COL17A1	105793264	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.524000	0.60552	2.724000	0.93272	0.561000	0.74099	CCT	.	.		0.542	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050181.1	NM_130778, NM_000494	
AHNAK	79026	hgsc.bcm.edu	37	11	62290619	62290619	+	Missense_Mutation	SNP	G	G	A	rs551324364		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr11:62290619G>A	ENST00000378024.4	-	5	11544	c.11270C>T	c.(11269-11271)cCc>cTc	p.P3757L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3757					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTGACTTTGGGGCCCTTCAG	0.468																																					p.P3757L		Atlas-SNP	.											.	AHNAK	532	.	0			c.C11270T						.						126.0	129.0	128.0					11																	62290619		2202	4299	6501	SO:0001583	missense	79026	exon5			ACTTTGGGGCCCT	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11270C>T	chr11.hg19:g.62290619G>A	ENSP00000367263:p.Pro3757Leu	85.0	0.0		89.0	29.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	17.97	3.517346	0.64634	.	.	ENSG00000124942	ENST00000378024	T	0.25912	1.77	5.33	5.33	0.75918	.	0.181406	0.26820	N	0.022337	T	0.67277	0.2876	H	0.96943	3.91	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79586	-0.1742	10	0.72032	D	0.01	-6.8964	18.6223	0.91326	0.0:0.0:1.0:0.0	.	3757	Q09666	AHNK_HUMAN	L	3757	ENSP00000367263:P3757L	ENSP00000367263:P3757L	P	-	2	0	AHNAK	62047195	1.000000	0.71417	0.331000	0.25455	0.010000	0.07245	5.658000	0.68003	2.493000	0.84123	0.579000	0.79373	CCC	.	.		0.468	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
STIP1	10963	hgsc.bcm.edu	37	11	63965043	63965043	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr11:63965043G>A	ENST00000305218.4	+	7	1025	c.878G>A	c.(877-879)cGa>cAa	p.R293Q	STIP1_ENST00000358794.5_Missense_Mutation_p.R340Q|STIP1_ENST00000538945.1_Missense_Mutation_p.R269Q	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	293					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						AGAGAAAACCGAGAAGACTAT	0.498																																					p.R293Q		Atlas-SNP	.											.	STIP1	63	.	0			c.G878A						.						64.0	67.0	66.0					11																	63965043		2201	4297	6498	SO:0001583	missense	10963	exon7			AAAACCGAGAAGA	BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.878G>A	chr11.hg19:g.63965043G>A	ENSP00000305958:p.Arg293Gln	81.0	0.0		111.0	14.0	NM_006819	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	ENST00000305218.4	hg19	CCDS8058.1	.	.	.	.	.	.	.	.	.	.	G	29.9	5.049361	0.93740	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945	T;T;T	0.16073	2.38;2.62;2.37	5.73	5.73	0.89815	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.19087	0.0458	M	0.67517	2.055	0.80722	D	1	P;P	0.46784	0.884;0.815	B;B	0.30646	0.118;0.072	T	0.05903	-1.0857	10	0.45353	T	0.12	-8.0877	19.059	0.93080	0.0:0.0:1.0:0.0	.	269;293	F5H0T1;P31948	.;STIP1_HUMAN	Q	340;293;269	ENSP00000351646:R340Q;ENSP00000305958:R293Q;ENSP00000445957:R269Q	ENSP00000305958:R293Q	R	+	2	0	STIP1	63721619	1.000000	0.71417	0.993000	0.49108	0.991000	0.79684	7.320000	0.79064	2.882000	0.98803	0.655000	0.94253	CGA	.	.		0.498	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396289.2	NM_006819	
SYVN1	84447	hgsc.bcm.edu	37	11	64898776	64898776	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr11:64898776A>G	ENST00000377190.3	-	8	821	c.727T>C	c.(727-729)Ttt>Ctt	p.F243L	SYVN1_ENST00000294256.8_Missense_Mutation_p.F243L|SYVN1_ENST00000307289.6_Missense_Mutation_p.F192L|SYVN1_ENST00000526121.1_5'UTR|SYVN1_ENST00000526060.1_Missense_Mutation_p.F243L	NM_172230.2	NP_757385.1	Q86TM6	SYVN1_HUMAN	synovial apoptosis inhibitor 1, synoviolin	243	Interaction with p53/TP53.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|in utero embryonic development (GO:0001701)|negative regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902236)|protein N-linked glycosylation via asparagine (GO:0018279)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						CGGATGGCAAAGAGTGGGAAG	0.582																																					p.F243L		Atlas-SNP	.											.	SYVN1	55	.	0			c.T727C						.						124.0	110.0	115.0					11																	64898776		2201	4297	6498	SO:0001583	missense	84447	exon8			TGGCAAAGAGTGG	AB085847	CCDS8097.1, CCDS31605.1	11q13	2013-01-09			ENSG00000162298	ENSG00000162298		"""RING-type (C3HC4) zinc fingers"""	20738	protein-coding gene	gene with protein product	"""HMG-coA reductase degradation 1 homolog (S. cerevisiae)"""	608046				12975321	Standard	NM_032431		Approved	HRD1, DER3	uc001odb.3	Q86TM6		ENST00000377190.3:c.727T>C	chr11.hg19:g.64898776A>G	ENSP00000366395:p.Phe243Leu	120.0	0.0		127.0	41.0	NM_172230	Q8N3K3|Q8N6E8|Q96JL5|Q96PK3	Missense_Mutation	SNP	ENST00000377190.3	hg19	CCDS31605.1	.	.	.	.	.	.	.	.	.	.	A	27.7	4.852810	0.91355	.	.	ENSG00000162298	ENST00000377190;ENST00000294256;ENST00000434219;ENST00000307289;ENST00000526060;ENST00000531018;ENST00000528487	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.63827	0.2544	M	0.84948	2.725	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.998	D;D;D	0.76071	0.978;0.987;0.979	T	0.64901	-0.6298	10	0.14656	T	0.56	-10.7716	12.7103	0.57086	1.0:0.0:0.0:0.0	.	192;243;243	Q86TM6-2;Q86TM6-3;Q86TM6	.;.;SYVN1_HUMAN	L	243;243;243;192;243;183;228	ENSP00000366395:F243L;ENSP00000294256:F243L;ENSP00000302035:F192L;ENSP00000436984:F243L;ENSP00000431215:F183L;ENSP00000431720:F228L	ENSP00000294256:F243L	F	-	1	0	SYVN1	64655352	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	8.973000	0.93428	1.883000	0.54544	0.460000	0.39030	TTT	.	.		0.582	SYVN1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000385274.1	NM_032431	
PRCP	5547	hgsc.bcm.edu	37	11	82536165	82536165	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr11:82536165C>T	ENST00000313010.3	-	9	1469		c.e9-1		PRCP_ENST00000535099.1_Splice_Site|PRCP_ENST00000525772.1_Splice_Site|PRCP_ENST00000393399.2_Splice_Site	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)						angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TTCACCATTGCTGCAAGTGAA	0.393																																					.		Atlas-SNP	.											.	PRCP	69	.	0			c.1275-1G>A						.						52.0	48.0	49.0					11																	82536165		2203	4300	6503	SO:0001630	splice_region_variant	5547	exon10			CCATTGCTGCAAG	BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.1275-1G>A	chr11.hg19:g.82536165C>T		71.0	0.0		58.0	15.0	NM_005040	A8MU24|B2R7B7|B3KRK5|B5BU34	Splice_Site	SNP	ENST00000313010.3	hg19	CCDS8262.1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008138	0.75046	.	.	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000535099	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2129	0.93765	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PRCP	82213813	1.000000	0.71417	0.998000	0.56505	0.881000	0.50899	6.484000	0.73621	2.629000	0.89072	0.467000	0.42956	.	.	.		0.393	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391792.1	NM_005040	Intron
C11orf73	51501	hgsc.bcm.edu	37	11	86017465	86017465	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr11:86017465T>G	ENST00000278483.3	+	2	435	c.209T>G	c.(208-210)cTa>cGa	p.L70R	C11orf73_ENST00000533986.1_Missense_Mutation_p.L70R|C11orf73_ENST00000530208.1_3'UTR	NM_016401.3	NP_057485.2	Q53FT3	HIKES_HUMAN	chromosome 11 open reading frame 73	70					cellular response to heat (GO:0034605)|Golgi organization (GO:0007030)|lung development (GO:0030324)|protein import into nucleus (GO:0006606)|protein transport (GO:0015031)	cell junction (GO:0030054)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)	Hsp70 protein binding (GO:0030544)|protein transporter activity (GO:0008565)			kidney(1)|large_intestine(1)|urinary_tract(1)	3		Acute lymphoblastic leukemia(157;1.17e-07)|all_hematologic(158;0.000556)				TGGCAACTCCTAGGATTTGTC	0.368																																					p.L70R		Atlas-SNP	.											.	C11orf73	9	.	0			c.T209G						.						64.0	65.0	65.0					11																	86017465		2202	4299	6501	SO:0001583	missense	51501	exon2			AACTCCTAGGATT	BC015991	CCDS8275.1	11q14.2	2013-03-12			ENSG00000149196	ENSG00000149196			26938	protein-coding gene	gene with protein product		614908				11042152, 22541429	Standard	NM_016401		Approved	HSPC138, HSPC179, Hikeshi, OPI10	uc001pbu.3	Q53FT3	OTTHUMG00000167212	ENST00000278483.3:c.209T>G	chr11.hg19:g.86017465T>G	ENSP00000278483:p.Leu70Arg	70.0	0.0		72.0	29.0	NM_016401	Q8WVE8|Q9NVQ2|Q9NZZ1|Q9P022|Q9P0N1	Missense_Mutation	SNP	ENST00000278483.3	hg19	CCDS8275.1	.	.	.	.	.	.	.	.	.	.	T	21.7	4.185282	0.78677	.	.	ENSG00000149196	ENST00000533986;ENST00000278483	T;T	0.58210	0.35;0.35	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000001	T	0.79358	0.4432	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.85384	0.1121	9	.	.	.	-18.5147	15.1285	0.72500	0.0:0.0:0.0:1.0	.	70;70	Q53FT3;E9PPG8	CK073_HUMAN;.	R	70	ENSP00000432699:L70R;ENSP00000278483:L70R	.	L	+	2	0	C11orf73	85695113	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.521000	0.81832	2.042000	0.60477	0.533000	0.62120	CTA	.	.		0.368	C11orf73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393747.1	NM_016401	
ITPR2	3709	hgsc.bcm.edu	37	12	26731667	26731667	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:26731667T>C	ENST00000381340.3	-	34	5025	c.4609A>G	c.(4609-4611)Atc>Gtc	p.I1537V		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1537					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	AAAGTTCTGATACAGGATTCC	0.408																																					p.I1537V		Atlas-SNP	.											.	ITPR2	270	.	0			c.A4609G						.						135.0	131.0	132.0					12																	26731667		1844	4091	5935	SO:0001583	missense	3709	exon34			TTCTGATACAGGA	D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.4609A>G	chr12.hg19:g.26731667T>C	ENSP00000370744:p.Ile1537Val	113.0	0.0		115.0	38.0	NM_002223	O94773	Missense_Mutation	SNP	ENST00000381340.3	hg19	CCDS41764.1	.	.	.	.	.	.	.	.	.	.	T	13.21	2.167694	0.38315	.	.	ENSG00000123104	ENST00000381340	T	0.68903	-0.36	5.12	3.98	0.46160	.	0.099123	0.64402	D	0.000002	T	0.62368	0.2422	M	0.64404	1.975	0.80722	D	1	B	0.14438	0.01	B	0.18263	0.021	T	0.60177	-0.7314	10	0.51188	T	0.08	.	10.6123	0.45429	0.0:0.0752:0.0:0.9248	.	1537	Q14571	ITPR2_HUMAN	V	1537	ENSP00000370744:I1537V	ENSP00000370744:I1537V	I	-	1	0	ITPR2	26622934	1.000000	0.71417	0.926000	0.36857	0.793000	0.44817	5.800000	0.69108	0.979000	0.38497	0.477000	0.44152	ATC	.	.		0.408	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402732.1	NM_002223	
ARID2	196528	hgsc.bcm.edu	37	12	46246408	46246408	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:46246408C>T	ENST00000334344.6	+	15	4674	c.4502C>T	c.(4501-4503)tCt>tTt	p.S1501F	ARID2_ENST00000457135.1_Missense_Mutation_p.S109F|ARID2_ENST00000444670.1_Missense_Mutation_p.S1111F|ARID2_ENST00000422737.1_Missense_Mutation_p.S1352F|ARID2_ENST00000479608.1_3'UTR	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	1501					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		GCCCTATCATCTGACGTTCGG	0.443			"""N, S, F"""		hepatocellular carcinoma																																p.S1501F		Atlas-SNP	.		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	.	ARID2	311	.	0			c.C4502T						.						106.0	100.0	102.0					12																	46246408		2203	4300	6503	SO:0001583	missense	196528	exon15			TATCATCTGACGT		CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.4502C>T	chr12.hg19:g.46246408C>T	ENSP00000335044:p.Ser1501Phe	161.0	0.0		189.0	62.0	NM_152641	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Missense_Mutation	SNP	ENST00000334344.6	hg19	CCDS31783.1	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773481	0.49786	.	.	ENSG00000189079	ENST00000334344;ENST00000549153;ENST00000338636;ENST00000422737;ENST00000444670;ENST00000457135	T	0.35973	1.28	6.02	6.02	0.97574	.	0.234273	0.45126	D	0.000388	T	0.35566	0.0936	N	0.24115	0.695	0.50313	D	0.999861	B;B;B	0.33857	0.25;0.429;0.412	B;B;B	0.40228	0.323;0.323;0.172	T	0.07654	-1.0761	10	0.44086	T	0.13	-7.333	20.5407	0.99260	0.0:1.0:0.0:0.0	.	1501;1111;1501	Q68CP9-3;F8W108;Q68CP9	.;.;ARID2_HUMAN	F	1501;618;618;1352;1111;109	ENSP00000335044:S1501F	ENSP00000335044:S1501F	S	+	2	0	ARID2	44532675	1.000000	0.71417	0.990000	0.47175	0.968000	0.65278	7.043000	0.76572	2.865000	0.98341	0.655000	0.94253	TCT	.	.		0.443	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318380.2	XM_350875	
WNT10B	7480	hgsc.bcm.edu	37	12	49364298	49364298	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:49364298G>A	ENST00000301061.4	-	2	363	c.15C>T	c.(13-15)ccC>ccT	p.P5P	WNT10B_ENST00000407467.1_Silent_p.P5P|WNT10B_ENST00000403957.1_Silent_p.P5P	NM_003394.3	NP_003385.2	O00744	WN10B_HUMAN	wingless-type MMTV integration site family, member 10B	5					bone trabecula formation (GO:0060346)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cell fate commitment (GO:0045165)|cellular response to cAMP (GO:0071320)|cellular response to hydrostatic pressure (GO:0071464)|cellular response to parathyroid hormone stimulus (GO:0071374)|cellular response to retinoic acid (GO:0071300)|chondrocyte differentiation (GO:0002062)|fungiform papilla development (GO:0061196)|G2/M transition of mitotic cell cycle (GO:0000086)|hematopoietic stem cell proliferation (GO:0071425)|lipid metabolic process (GO:0006629)|myoblast differentiation involved in skeletal muscle regeneration (GO:0014835)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|positive regulation of anagen (GO:0051885)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone mineralization (GO:0030501)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045899)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of skeletal muscle tissue development (GO:0048641)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|smoothened signaling pathway (GO:0007224)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)|receptor agonist activity (GO:0048018)			central_nervous_system(1)|large_intestine(5)|lung(12)|prostate(1)|skin(4)	23						GCCGCGGCCGGGGCTCCTCCA	0.672																																					p.P5P		Atlas-SNP	.											.	WNT10B	41	.	0			c.C15T						.						8.0	13.0	12.0					12																	49364298		2173	4264	6437	SO:0001819	synonymous_variant	7480	exon2			CGGCCGGGGCTCC	X97057	CCDS8775.1	12q13	2009-01-02			ENSG00000169884	ENSG00000169884		"""Wingless-type MMTV integration sites"""	12775	protein-coding gene	gene with protein product		601906				9121776, 9284937, 18515319	Standard	NM_003394		Approved	WNT-12, SHFM6	uc001rss.3	O00744	OTTHUMG00000150734	ENST00000301061.4:c.15C>T	chr12.hg19:g.49364298G>A		388.0	0.0		398.0	128.0	NM_003394	B2R7A5|O00747|Q4VAJ4|Q4VAJ5|Q8WZ97	Silent	SNP	ENST00000301061.4	hg19	CCDS8775.1																																																																																			.	.		0.672	WNT10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319864.1	NM_003394	
ERBB3	2065	hgsc.bcm.edu	37	12	56488188	56488188	+	Silent	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:56488188C>A	ENST00000267101.3	+	15	2147	c.1707C>A	c.(1705-1707)ggC>ggA	p.G569G	ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Silent_p.G510G|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	569					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CCACTCAGGGCTCTGATACTT	0.522																																					p.G569G		Atlas-SNP	.											.	ERBB3	350	.	0			c.C1707A						.						115.0	120.0	118.0					12																	56488188		2203	4300	6503	SO:0001819	synonymous_variant	2065	exon15			TCAGGGCTCTGAT	M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1707C>A	chr12.hg19:g.56488188C>A		37.0	0.0		24.0	7.0	NM_001982	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Silent	SNP	ENST00000267101.3	hg19	CCDS31833.1																																																																																			.	.		0.522	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407619.3		
PIP4K2C	79837	hgsc.bcm.edu	37	12	57995105	57995105	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:57995105C>A	ENST00000354947.5	+	9	1175	c.1159C>A	c.(1159-1161)Cat>Aat	p.H387N	PIP4K2C_ENST00000550465.1_Missense_Mutation_p.H369N|PIP4K2C_ENST00000540759.2_Missense_Mutation_p.H387N|PIP4K2C_ENST00000422156.3_Missense_Mutation_p.H339N			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	387	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					GAAAGCAGCTCATGCAGCCAA	0.473																																					p.H387N		Atlas-SNP	.											.	PIP4K2C	50	.	0			c.C1159A						.						76.0	79.0	78.0					12																	57995105		2203	4300	6503	SO:0001583	missense	79837	exon9			GCAGCTCATGCAG	AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.1159C>A	chr12.hg19:g.57995105C>A	ENSP00000347032:p.His387Asn	129.0	0.0		119.0	31.0	NM_001146258	B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	ENST00000354947.5	hg19	CCDS8946.1	.	.	.	.	.	.	.	.	.	.	C	18.28	3.588983	0.66105	.	.	ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000550465;ENST00000354947	T;T;T;T	0.32272	1.46;1.46;1.46;1.46	4.56	4.56	0.56223	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.55386	0.1917	M	0.75264	2.295	0.58432	D	0.999998	P;B;D	0.67145	0.877;0.41;0.996	P;B;D	0.70487	0.781;0.349;0.969	T	0.59048	-0.7527	10	0.56958	D	0.05	-14.9835	16.6342	0.85042	0.0:1.0:0.0:0.0	.	339;369;387	B4DM11;B4DY44;Q8TBX8	.;.;PI42C_HUMAN	N	339;387;369;387	ENSP00000412035:H339N;ENSP00000439878:H387N;ENSP00000447390:H369N;ENSP00000347032:H387N	ENSP00000347032:H387N	H	+	1	0	PIP4K2C	56281372	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	7.188000	0.77739	2.534000	0.85438	0.655000	0.94253	CAT	.	.		0.473	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407644.1	NM_024779	
IFNG	3458	hgsc.bcm.edu	37	12	68551852	68551852	+	Silent	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:68551852C>T	ENST00000229135.3	-	3	338	c.207G>A	c.(205-207)caG>caA	p.Q69Q	IFNG-AS1_ENST00000536914.1_RNA	NM_000619.2	NP_000610.2	P01579	IFNG_HUMAN	interferon, gamma	69					adaptive immune response (GO:0002250)|antigen processing and presentation (GO:0019882)|apoptotic process (GO:0006915)|CD8-positive, alpha-beta T cell differentiation involved in immune response (GO:0002302)|cell cycle arrest (GO:0007050)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to interleukin-18 (GO:0071351)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|extrinsic apoptotic signaling pathway (GO:0097191)|humoral immune response (GO:0006959)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003340)|negative regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072308)|negative regulation of myelination (GO:0031642)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neutrophil apoptotic process (GO:0001781)|neutrophil chemotaxis (GO:0030593)|positive regulation of calcidiol 1-monooxygenase activity (GO:0060559)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of fructose 1,6-bisphosphate 1-phosphatase activity (GO:0060550)|positive regulation of fructose 1,6-bisphosphate metabolic process (GO:0060552)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-23 production (GO:0032747)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of isotype switching to IgG isotypes (GO:0048304)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000309)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of vitamin D biosynthetic process (GO:0060557)|protein import into nucleus, translocation (GO:0000060)|regulation of insulin secretion (GO:0050796)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of the force of heart contraction (GO:0002026)|response to drug (GO:0042493)|response to virus (GO:0009615)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|interferon-gamma receptor binding (GO:0005133)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(5)|prostate(1)	12			Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.018)	GBM - Glioblastoma multiforme(7;0.000829)	Glucosamine(DB01296)|Olsalazine(DB01250)	CAATTTGGCTCTGCATTATTT	0.373																																					p.Q69Q		Atlas-SNP	.											.	IFNG	38	.	0			c.G207A						.						85.0	86.0	85.0					12																	68551852		2202	4300	6502	SO:0001819	synonymous_variant	3458	exon3			TTGGCTCTGCATT		CCDS8980.1	12q14	2007-10-17			ENSG00000111537	ENSG00000111537		"""Interferons"""	5438	protein-coding gene	gene with protein product		147570					Standard	NM_000619		Approved		uc001stw.1	P01579	OTTHUMG00000169113	ENST00000229135.3:c.207G>A	chr12.hg19:g.68551852C>T		78.0	0.0		79.0	20.0	NM_000619	B5BU88|Q53ZV4	Silent	SNP	ENST00000229135.3	hg19	CCDS8980.1																																																																																			.	.		0.373	IFNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402301.1		
NOS1	4842	hgsc.bcm.edu	37	12	117723914	117723914	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:117723914G>C	ENST00000338101.4	-	5	1289	c.1285C>G	c.(1285-1287)Ctg>Gtg	p.L429V	NOS1_ENST00000317775.6_Missense_Mutation_p.L429V|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		CCTACCTGCAGCTTGGACCAC	0.537																																					p.L429V	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.C1285G						.						118.0	118.0	118.0					12																	117723914		2168	4293	6461	SO:0001583	missense	4842	exon6			CCTGCAGCTTGGA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.1285C>G	chr12.hg19:g.117723914G>C	ENSP00000337459:p.Leu429Val	77.0	0.0		79.0	32.0	NM_000620		Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.998288	0.74818	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.59364	0.27;0.27	4.93	4.93	0.64822	Nitric oxide synthase, oxygenase domain (3);	0.000000	0.64402	D	0.000001	T	0.80363	0.4609	H	0.96142	3.775	0.80722	D	1	P	0.48230	0.907	P	0.53313	0.723	D	0.87174	0.2223	10	0.87932	D	0	-11.4483	18.3299	0.90264	0.0:0.0:1.0:0.0	.	429	P29475	NOS1_HUMAN	V	429	ENSP00000320758:L429V;ENSP00000337459:L429V	ENSP00000320758:L429V	L	-	1	2	NOS1	116208297	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.427000	0.66483	2.559000	0.86315	0.591000	0.81541	CTG	.	.		0.537	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
GPR183	1880	hgsc.bcm.edu	37	13	99947896	99947896	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr13:99947896G>A	ENST00000376414.4	-	2	587	c.504C>T	c.(502-504)atC>atT	p.I168I	UBAC2_ENST00000376440.2_Intron|UBAC2_ENST00000403766.3_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	168					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)			cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						ACATAGGGTTGATGAGGAGTG	0.428																																					p.I168I		Atlas-SNP	.											.	GPR183	38	.	0			c.C504T						.						125.0	105.0	112.0					13																	99947896		2203	4300	6503	SO:0001819	synonymous_variant	1880	exon2			AGGGTTGATGAGG	L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.504C>T	chr13.hg19:g.99947896G>A		95.0	0.0		119.0	25.0	NM_004951	B2R8N5|Q53F99|Q5JUH7	Silent	SNP	ENST00000376414.4	hg19	CCDS9492.1																																																																																			.	.		0.428	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045582.2	NM_004951	
OR10G2	26534	hgsc.bcm.edu	37	14	22102622	22102622	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr14:22102622T>G	ENST00000542433.1	-	1	474	c.377A>C	c.(376-378)gAc>gCc	p.D126A		NM_001005466.1	NP_001005466.1	Q8NGC3	O10G2_HUMAN	olfactory receptor, family 10, subfamily G, member 2	126						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)|stomach(2)	22	all_cancers(95;0.00113)	Acute lymphoblastic leukemia(2;0.0279)		GBM - Glioblastoma multiforme(265;0.0142)		TAGGTACCTGTCATAGGCCAT	0.542																																					p.D126A		Atlas-SNP	.											.	OR10G2	35	.	0			c.A377C						.						38.0	43.0	41.0					14																	22102622		2203	4294	6497	SO:0001583	missense	26534	exon1			TACCTGTCATAGG		CCDS32047.1	14q11.2	2013-09-24			ENSG00000255582	ENSG00000255582		"""GPCR / Class A : Olfactory receptors"""	8170	protein-coding gene	gene with protein product						8188290	Standard	NM_001005466		Approved		uc010tmc.2	Q8NGC3	OTTHUMG00000168890	ENST00000542433.1:c.377A>C	chr14.hg19:g.22102622T>G	ENSP00000445383:p.Asp126Ala	302.0	0.0		259.0	76.0	NM_001005466	B2RPD0	Missense_Mutation	SNP	ENST00000542433.1	hg19	CCDS32047.1	.	.	.	.	.	.	.	.	.	.	T	17.66	3.445246	0.63178	.	.	ENSG00000255582	ENST00000542433	T	0.55413	0.52	3.78	3.78	0.43462	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000323	T	0.81221	0.4777	H	0.98487	4.245	0.40470	D	0.980331	D	0.89917	1.0	D	0.87578	0.998	D	0.86602	0.1867	10	0.87932	D	0	-12.9343	10.4989	0.44794	0.0:0.0:0.0:1.0	.	126	Q8NGC3	O10G2_HUMAN	A	126	ENSP00000445383:D126A	ENSP00000445383:D126A	D	-	2	0	OR10G2	21172462	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.606000	0.82863	1.582000	0.49881	0.455000	0.32223	GAC	.	.		0.542	OR10G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401525.1		
SPATA7	55812	hgsc.bcm.edu	37	14	88892812	88892812	+	Silent	SNP	C	C	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr14:88892812C>G	ENST00000393545.4	+	6	898	c.609C>G	c.(607-609)ccC>ccG	p.P203P	SPATA7_ENST00000045347.7_Silent_p.P203P|SPATA7_ENST00000556553.1_Silent_p.P171P|SPATA7_ENST00000356583.5_Silent_p.P171P	NM_018418.4	NP_060888.2	Q9P0W8	SPAT7_HUMAN	spermatogenesis associated 7	203					response to stimulus (GO:0050896)|visual perception (GO:0007601)					cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)	18						GCAGAAGGCCCAGAAGCACAT	0.507																																					p.P203P		Atlas-SNP	.											.	SPATA7	58	.	0			c.C609G						.						62.0	60.0	61.0					14																	88892812		2203	4300	6503	SO:0001819	synonymous_variant	55812	exon6			AAGGCCCAGAAGC	AF144487	CCDS9883.1, CCDS32132.1	14q31.3	2011-02-17				ENSG00000042317			20423	protein-coding gene	gene with protein product		609868	"""Leber congenital amaurosis 3"""	LCA3		9799089, 19268277	Standard	NM_018418		Approved	HSD3	uc001xwq.3	Q9P0W8		ENST00000393545.4:c.609C>G	chr14.hg19:g.88892812C>G		144.0	0.0		134.0	35.0	NM_018418	Q5BKY5|Q8WX30|Q96HF3|Q9H0X0|Q9P0W7	Silent	SNP	ENST00000393545.4	hg19	CCDS9883.1																																																																																			.	.		0.507	SPATA7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410172.1		
BLM	641	hgsc.bcm.edu	37	15	91358483	91358483	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr15:91358483C>A	ENST00000355112.3	+	22	4346	c.4228C>A	c.(4228-4230)Ctt>Att	p.L1410I	BLM_ENST00000560509.1_Missense_Mutation_p.L1279I	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like	1410					alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			TAGACCGTTTCTTAAGCCTTC	0.423			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																												p.L1410I		Atlas-SNP	.	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	.	BLM	122	.	0			c.C4228A						.						141.0	133.0	135.0					15																	91358483		2198	4298	6496	SO:0001583	missense	641	exon22	Familial Cancer Database		CCGTTTCTTAAGC	U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.4228C>A	chr15.hg19:g.91358483C>A	ENSP00000347232:p.Leu1410Ile	89.0	0.0		89.0	10.0	NM_000057	Q52M96	Missense_Mutation	SNP	ENST00000355112.3	hg19	CCDS10363.1	.	.	.	.	.	.	.	.	.	.	C	14.13	2.443626	0.43429	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	T	0.61627	0.09	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.77798	0.4184	M	0.77103	2.36	0.28434	N	0.91713	D;D	0.69078	0.997;0.997	D;D	0.78314	0.991;0.991	T	0.73408	-0.3992	10	0.87932	D	0	-6.0224	18.3732	0.90420	0.0:1.0:0.0:0.0	.	1410;1410	B2RAN0;P54132	.;BLM_HUMAN	I	1410;1040	ENSP00000347232:L1410I	ENSP00000347232:L1410I	L	+	1	0	BLM	89159487	1.000000	0.71417	0.593000	0.28771	0.132000	0.20833	4.695000	0.61767	2.941000	0.99782	0.655000	0.94253	CTT	.	.		0.423	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313495.1		
ADAMTS17	170691	hgsc.bcm.edu	37	15	100514721	100514721	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr15:100514721G>A	ENST00000268070.4	-	22	3279	c.3174C>T	c.(3172-3174)tgC>tgT	p.C1058C	CTD-3076O17.1_ENST00000528696.3_RNA|CTD-3076O17.2_ENST00000559400.1_RNA	NM_139057.2	NP_620688.2	Q8TE56	ATS17_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 17	1058	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(11)|lung(24)|ovary(3)|prostate(2)	50	Lung NSC(78;0.00299)|all_lung(78;0.00457)|Melanoma(26;0.00571)		OV - Ovarian serous cystadenocarcinoma(32;0.0013)|LUSC - Lung squamous cell carcinoma(107;0.132)|Lung(145;0.161)	COAD - Colon adenocarcinoma(1;0.111)|all cancers(203;0.219)		GGATGACCCGGCAATATACCG	0.562																																					p.C1058C		Atlas-SNP	.											.	ADAMTS17	127	.	0			c.C3174T						.						117.0	94.0	102.0					15																	100514721		2203	4300	6503	SO:0001819	synonymous_variant	170691	exon22			GACCCGGCAATAT	AJ315735	CCDS10383.1	15q24	2014-01-28	2005-08-19		ENSG00000140470	ENSG00000140470		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17109	protein-coding gene	gene with protein product		607511	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 17"""			11867212	Standard	NM_139057		Approved	FLJ32769, FLJ16363	uc002bvv.1	Q8TE56	OTTHUMG00000149867	ENST00000268070.4:c.3174C>T	chr15.hg19:g.100514721G>A		95.0	0.0		84.0	26.0	NM_139057	Q2I7G4|Q6ZN75	Silent	SNP	ENST00000268070.4	hg19	CCDS10383.1																																																																																			.	.		0.562	ADAMTS17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313595.1	NM_139057	
TPSD1	23430	hgsc.bcm.edu	37	16	1306936	1306936	+	Silent	SNP	G	G	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:1306936G>T	ENST00000211076.3	+	3	541	c.393G>T	c.(391-393)ctG>ctT	p.L131L	TPSD1_ENST00000397534.2_Silent_p.L124L|RP11-616M22.5_ENST00000566997.1_RNA	NM_012217.2	NP_036349.1	Q9BZJ3	TRYD_HUMAN	tryptase delta 1	131	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(9)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)	20		Hepatocellular(780;0.00369)				ACATCGCCCTGCTGGAGCTGG	0.652																																					p.L131L		Atlas-SNP	.											.	TPSD1	47	.	0			c.G393T						.						65.0	65.0	65.0					16																	1306936		2199	4300	6499	SO:0001819	synonymous_variant	23430	exon3			CGCCCTGCTGGAG	AF206664	CCDS10432.1	16p13.3	2008-07-29			ENSG00000095917	ENSG00000095917	3.4.21.59		14118	protein-coding gene	gene with protein product	"""mMCP-7-like II"", ""mMCP-7-like I"", ""MMCP-7-LIKE-2"""	609272				9920877	Standard	NM_012217		Approved		uc002clb.1	Q9BZJ3	OTTHUMG00000128511	ENST00000211076.3:c.393G>T	chr16.hg19:g.1306936G>T		266.0	0.0		293.0	47.0	NM_012217	O95824|Q8TDI6|Q96L36|Q96RZ5|Q9H2Y6|Q9UQI8	Silent	SNP	ENST00000211076.3	hg19	CCDS10432.1																																																																																			.	.		0.652	TPSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250320.2		
PRKCB	5579	hgsc.bcm.edu	37	16	24202547	24202547	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:24202547A>T	ENST00000321728.7	+	16	2034	c.1859A>T	c.(1858-1860)aAa>aTa	p.K620I	PRKCB_ENST00000303531.7_Missense_Mutation_p.K620I	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	620	AGC-kinase C-terminal.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TATAAGCCAAAAGCTGTAAGT	0.473																																					p.K620I		Atlas-SNP	.											.	PRKCB	383	.	0			c.A1859T						.						106.0	111.0	109.0					16																	24202547		2197	4300	6497	SO:0001583	missense	5579	exon16			AGCCAAAAGCTGT	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1859A>T	chr16.hg19:g.24202547A>T	ENSP00000318315:p.Lys620Ile	112.0	0.0		101.0	37.0	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	hg19	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.687970	0.88639	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.55234	0.53;0.53	5.73	5.73	0.89815	AGC-kinase, C-terminal (2);Protein kinase-like domain (1);	0.107337	0.64402	D	0.000010	T	0.63896	0.2550	M	0.89095	3.005	0.58432	D	0.999999	B;B	0.09022	0.002;0.001	B;B	0.28849	0.058;0.095	T	0.66148	-0.5996	10	0.87932	D	0	.	13.9858	0.64334	1.0:0.0:0.0:0.0	.	620;620	P05771-2;P05771	.;KPCB_HUMAN	I	620	ENSP00000318315:K620I;ENSP00000305355:K620I	ENSP00000305355:K620I	K	+	2	0	PRKCB	24110048	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.497000	0.53295	2.189000	0.69895	0.528000	0.53228	AAA	.	.		0.473	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
ITGAD	3681	hgsc.bcm.edu	37	16	31409166	31409166	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:31409166G>C	ENST00000389202.2	+	5	412	c.363G>C	c.(361-363)aaG>aaC	p.K121N		NM_005353.2	NP_005344.2	Q13349	ITAD_HUMAN	integrin, alpha D	121					activated T cell proliferation (GO:0050798)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|immune response (GO:0006955)|integrin-mediated signaling pathway (GO:0007229)	cell surface (GO:0009986)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|liver(2)|lung(43)|ovary(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						CATACTCAAAGGGTTCCTGCC	0.642																																					p.K121N		Atlas-SNP	.											.	ITGAD	154	.	0			c.G363C						.						42.0	38.0	39.0					16																	31409166		2197	4300	6497	SO:0001583	missense	3681	exon5			CTCAAAGGGTTCC	U40274	CCDS32438.1	16p13.1-p11	2010-03-23				ENSG00000156886		"""CD molecules"", ""Integrins"""	6146	protein-coding gene	gene with protein product		602453				8666289, 9598326	Standard	NM_005353		Approved	CD11d, ADB2	uc002ebv.1	Q13349		ENST00000389202.2:c.363G>C	chr16.hg19:g.31409166G>C	ENSP00000373854:p.Lys121Asn	41.0	0.0		36.0	13.0	NM_005353	Q15575|Q15576	Missense_Mutation	SNP	ENST00000389202.2	hg19	CCDS32438.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.143|1.143	-0.649007|-0.649007	0.03506|0.03506	.|.	.|.	ENSG00000156886|ENSG00000156886	ENST00000444228;ENST00000389202|ENST00000316569	T|.	0.70516|.	-0.49|.	4.19|4.19	-0.674|-0.674	0.11369|0.11369	.|.	.|.	.|.	.|.	.|.	T|T	0.10551|0.10551	0.0258|0.0258	N|N	0.02412|0.02412	-0.56|-0.56	0.09310|0.09310	N|N	1|1	B;B;B|.	0.17268|.	0.021;0.007;0.004|.	B;B;B|.	0.18871|.	0.023;0.004;0.004|.	T|T	0.22452|0.22452	-1.0216|-1.0216	9|6	0.08599|0.46703	T|T	0.76|0.11	.|.	3.8259|3.8259	0.08853|0.08853	0.3627:0.0:0.4411:0.1962|0.3627:0.0:0.4411:0.1962	.|.	121;137;121|.	B7Z6V7;Q59H14;Q13349|.	.;.;ITAD_HUMAN|.	N|T	137;121|29	ENSP00000373854:K121N|.	ENSP00000373854:K121N|ENSP00000323325:R29T	K|R	+|+	3|2	2|0	ITGAD|ITGAD	31316667|31316667	0.001000|0.001000	0.12720|0.12720	0.128000|0.128000	0.21923|0.21923	0.213000|0.213000	0.24496|0.24496	-1.093000|-1.093000	0.03362|0.03362	-0.037000|-0.037000	0.13646|0.13646	-0.302000|-0.302000	0.09304|0.09304	AAG|AGG	.	.		0.642	ITGAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000432836.1	NM_005353	
HSF4	3299	hgsc.bcm.edu	37	16	67201742	67201742	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:67201742C>A	ENST00000521374.1	+	9	974	c.974C>A	c.(973-975)cCt>cAt	p.P325H	HSF4_ENST00000421453.1_Missense_Mutation_p.P295H|HSF4_ENST00000264009.8_Missense_Mutation_p.P325H|NOL3_ENST00000564053.1_5'Flank|HSF4_ENST00000584272.1_Missense_Mutation_p.P295H|NOL3_ENST00000432069.2_5'Flank			Q9ULV5	HSF4_HUMAN	heat shock transcription factor 4	325					camera-type eye development (GO:0043010)|cell development (GO:0048468)|histone H3-K9 demethylation (GO:0033169)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotrimerization (GO:0070207)|regulation of transcription, DNA-templated (GO:0006355)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	protein phosphatase binding (GO:0019903)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	12		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.0335)|all cancers(182;0.184)		CCGCCACTGCCTGTGGCTGTG	0.667																																					p.P325H		Atlas-SNP	.											.	HSF4	33	.	0			c.C974A						.						11.0	18.0	16.0					16																	67201742		1892	4092	5984	SO:0001583	missense	3299	exon11			CACTGCCTGTGGC	D87673	CCDS42175.1, CCDS45510.1	16q21	2013-01-22			ENSG00000102878	ENSG00000102878			5227	protein-coding gene	gene with protein product		602438	"""cataract, Marner"""	CTM		8972228, 10488131, 12089525	Standard	NM_001538		Approved		uc002erl.2	Q9ULV5	OTTHUMG00000178325	ENST00000521374.1:c.974C>A	chr16.hg19:g.67201742C>A	ENSP00000430947:p.Pro325His	106.0	0.0		95.0	4.0	NM_001040667	Q99472|Q9ULV6	Missense_Mutation	SNP	ENST00000521374.1	hg19	CCDS42175.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.2|27.2	4.805303|4.805303	0.90623|0.90623	.|.	.|.	ENSG00000102878|ENSG00000102878	ENST00000520304|ENST00000421453;ENST00000264009;ENST00000521374	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.060140	.|0.64402	.|D	.|0.000002	T|T	0.64757|0.64757	0.2627|0.2627	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P	.|0.61697	.|0.99;0.898	.|P;B	.|0.60473	.|0.875;0.428	T|T	0.66484|0.66484	-0.5912|-0.5912	5|9	.|0.59425	.|D	.|0.04	-2.5728|-2.5728	16.8974|16.8974	0.86104|0.86104	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|295;325	.|Q9ULV5-2;Q9ULV5	.|.;HSF4_HUMAN	M|H	1|295;325;325	.|.	.|ENSP00000264009:P325H	L|P	+|+	1|2	2|0	HSF4|HSF4	65759243|65759243	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	6.375000|6.375000	0.73137|0.73137	2.586000|2.586000	0.87340|0.87340	0.561000|0.561000	0.74099|0.74099	CTG|CCT	.	.		0.667	HSF4-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375080.1	NM_001538	
CTRL	1506	hgsc.bcm.edu	37	16	67963973	67963973	+	Missense_Mutation	SNP	C	C	T	rs142873279	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:67963973C>T	ENST00000574481.1	-	7	1220	c.659G>A	c.(658-660)tGc>tAc	p.C220Y	CTRL_ENST00000576408.1_5'Flank	NM_001907.2	NP_001898.1	P40313	CTRL_HUMAN	chymotrypsin-like	220	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				digestion (GO:0007586)|proteolysis (GO:0006508)	extracellular space (GO:0005615)	serine-type endopeptidase activity (GO:0004252)			kidney(1)|large_intestine(2)|urinary_tract(1)	4		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.00412)|Epithelial(162;0.018)|all cancers(182;0.118)		TCCCTTCTGGCAGACAAGAGG	0.562																																					p.C220Y		Atlas-SNP	.											.	CTRL	11	.	0			c.G659A						.						100.0	107.0	105.0					16																	67963973		2198	4300	6498	SO:0001583	missense	1506	exon7			TTCTGGCAGACAA		CCDS10852.1	16q22.1	2008-02-05			ENSG00000141086	ENSG00000141086			2524	protein-coding gene	gene with protein product		118888				8268911	Standard	NM_001907		Approved		uc002euw.3	P40313	OTTHUMG00000137552	ENST00000574481.1:c.659G>A	chr16.hg19:g.67963973C>T	ENSP00000458537:p.Cys220Tyr	107.0	0.0		112.0	37.0	NM_001907		Missense_Mutation	SNP	ENST00000574481.1	hg19	CCDS10852.1	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684589	0.68157	.	.	ENSG00000141086	ENST00000319955	.	.	.	5.74	3.79	0.43588	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.523574	0.22012	N	0.065847	T	0.62672	0.2447	M	0.74647	2.275	0.80722	D	1	P	0.42620	0.785	P	0.46237	0.508	T	0.66590	-0.5885	9	0.56958	D	0.05	-18.0625	11.0735	0.48016	0.0:0.7968:0.0:0.2032	.	220	P40313	CTRL_HUMAN	Y	220	.	ENSP00000322629:C220Y	C	-	2	0	CTRL	66521474	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	0.912000	0.28597	1.432000	0.47375	0.491000	0.48974	TGC	.	C|0.999;A|0.001		0.562	CTRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268886.3		
SENP3	26168	hgsc.bcm.edu	37	17	7466636	7466636	+	Silent	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:7466636G>A	ENST00000429205.2	+	2	292	c.243G>A	c.(241-243)gaG>gaA	p.E81E	SENP3_ENST00000578868.1_3'UTR|SENP3_ENST00000321337.7_Silent_p.E81E|SENP3-EIF4A1_ENST00000579777.1_RNA			Q9H4L4	SENP3_HUMAN	SUMO1/sentrin/SMT3 specific peptidase 3	81	Glu-rich.					cytoplasm (GO:0005737)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)	cysteine-type peptidase activity (GO:0008234)			central_nervous_system(1)|ovary(1)	2		Prostate(122;0.157)				aggaagaagaggaggaggagg	0.622																																					p.E81E		Atlas-SNP	.											.	SENP3	18	.	0			c.G243A						.																																			SO:0001819	synonymous_variant	26168	exon2			AGAAGAGGAGGAG	AK000923	CCDS73958.1	17p13	2012-05-02	2005-08-17			ENSG00000161956			17862	protein-coding gene	gene with protein product		612844	"""SUMO1/sentrin/SMT3 specific protease 3"""			10806345, 11230166	Standard	NM_015670		Approved	DKFZP586K0919, SSP3, DKFZp762A152, SMT3IP1, Ulp1	uc002ghm.3	Q9H4L4		ENST00000429205.2:c.243G>A	chr17.hg19:g.7466636G>A		98.0	0.0		117.0	6.0	NM_015670	Q66K15|Q86VS7|Q96PS4|Q9Y3W9	Silent	SNP	ENST00000429205.2	hg19																																																																																				.	.		0.622	SENP3-202	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding		NM_015670	
MYO18A	399687	hgsc.bcm.edu	37	17	27442455	27442455	+	Silent	SNP	C	C	T	rs368144764		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:27442455C>T	ENST00000527372.1	-	13	2412	c.2232G>A	c.(2230-2232)ccG>ccA	p.P744P	MYO18A_ENST00000354329.4_Silent_p.P744P|MYO18A_ENST00000533112.1_Silent_p.P744P|MYO18A_ENST00000531253.1_Silent_p.P744P	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	744	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CACTCAGTTTCGGGCCTGTGG	0.657																																					p.P744P	Esophageal Squamous(182;472 2015 7001 15270 22562)	Atlas-SNP	.											.	MYO18A	217	.	0			c.G2232A						.	C	,	0,3932		0,0,1966	31.0	40.0	37.0		2232,2232	1.1	1.0	17		37	1,8279		0,1,4139	no	coding-synonymous,coding-synonymous	MYO18A	NM_078471.3,NM_203318.1	,	0,1,6105	TT,TC,CC		0.0121,0.0,0.0082	,	744/2055,744/2040	27442455	1,12211	1966	4140	6106	SO:0001819	synonymous_variant	399687	exon13			CAGTTTCGGGCCT	D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.2232G>A	chr17.hg19:g.27442455C>T		67.0	0.0		66.0	23.0	NM_078471	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	ENST00000527372.1	hg19	CCDS45642.1																																																																																			.	.		0.657	MYO18A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000389396.1	NM_078471	
KRTAP4-11	653240	hgsc.bcm.edu	37	17	39274487	39274488	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:39274487_39274488GG>TT	ENST00000391413.2	-	1	118_119	c.80_81CC>AA	c.(79-81)cCC>cAA	p.P27Q		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	27	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CACAGCAGCTGGGGCGGCAGCA	0.634																																					p.P27P|p.P27H		Atlas-SNP	.											.	KRTAP4-11	94	.	0			c.C81A|c.C80A						.																																			SO:0001583	missense	653240	exon1			GCAGCTGGGGCGG|CAGCTGGGGCGGC	AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.80_81delinsTT	chr17.hg19:g.39274487_39274488delinsTT	ENSP00000375232:p.Pro27Gln	72.0|71.0	0.0		66.0|67.0	27.0	NM_033059	A0AUY2	Silent|Missense_Mutation	SNP	ENST00000391413.2	hg19	CCDS45675.1																																																																																			.	.		0.634	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257690.1		
RUNDC3A	10900	hgsc.bcm.edu	37	17	42389993	42389993	+	Silent	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:42389993C>T	ENST00000426726.3	+	2	427	c.153C>T	c.(151-153)atC>atT	p.I51I	AC003102.3_ENST00000588097.1_RNA|RUNDC3A_ENST00000590941.1_Silent_p.I51I|RUNDC3A_ENST00000225441.7_Silent_p.I51I	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	51	Interaction with RAP2A. {ECO:0000250}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CGGAGCCCATCGATGACTCAT	0.597																																					p.I51I	Pancreas(82;1061 1416 11136 20771 23901)	Atlas-SNP	.											RUNDC3A_ENST00000225441,colon,carcinoma,0,2	RUNDC3A	30	.	0			c.C153T						.						46.0	51.0	49.0					17																	42389993		2001	4174	6175	SO:0001819	synonymous_variant	10900	exon2			GCCCATCGATGAC	AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.153C>T	chr17.hg19:g.42389993C>T		49.0	0.0		38.0	14.0	NM_001144825	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Silent	SNP	ENST00000426726.3	hg19	CCDS45698.1																																																																																			.	.		0.597	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000403173.2	NM_006695	
SPATA20	64847	hgsc.bcm.edu	37	17	48626198	48626198	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:48626198A>G	ENST00000356488.4	+	4	424	c.341A>G	c.(340-342)cAc>cGc	p.H114R	SPATA20_ENST00000393244.3_Missense_Mutation_p.H70R|SPATA20_ENST00000511937.1_3'UTR|SPATA20_ENST00000006658.6_Missense_Mutation_p.H130R	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	114					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			CACTGGTGCCACATGATGGAA	0.617																																					p.H130R		Atlas-SNP	.											.	SPATA20	59	.	0			c.A389G						.						124.0	92.0	103.0					17																	48626198		2203	4300	6503	SO:0001583	missense	64847	exon5			GGTGCCACATGAT		CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.341A>G	chr17.hg19:g.48626198A>G	ENSP00000348878:p.His114Arg	72.0	0.0		71.0	30.0	NM_022827	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Missense_Mutation	SNP	ENST00000356488.4	hg19	CCDS58563.1	.	.	.	.	.	.	.	.	.	.	A	24.3	4.519018	0.85495	.	.	ENSG00000006282	ENST00000006658;ENST00000356488;ENST00000393244	T;T;T	0.51071	0.72;0.72;0.72	4.78	4.78	0.61160	Thioredoxin-like fold (2);Domain of unknown function DUF255 (1);	0.000000	0.85682	D	0.000000	T	0.73644	0.3613	M	0.89785	3.06	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.80473	-0.1367	10	0.87932	D	0	-18.7784	14.3103	0.66413	1.0:0.0:0.0:0.0	.	114;114;130	B4DZC5;Q8TB22;Q8TB22-2	.;SPT20_HUMAN;.	R	130;114;70	ENSP00000006658:H130R;ENSP00000348878:H114R;ENSP00000376935:H70R	ENSP00000006658:H130R	H	+	2	0	SPATA20	45981197	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.962000	0.93254	1.788000	0.52465	0.402000	0.26972	CAC	.	.		0.617	SPATA20-004	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000367651.1	NM_022827	
POLG2	11232	hgsc.bcm.edu	37	17	62488797	62488797	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr17:62488797T>C	ENST00000539111.2	-	3	849	c.782A>G	c.(781-783)cAg>cGg	p.Q261R		NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	261					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			TCTCCACCACTGGAGTCGATG	0.358																																					p.Q261R	Colon(3;18 21 435 17652 48887)	Atlas-SNP	.											.	POLG2	29	.	0			c.A782G						.						47.0	43.0	44.0					17																	62488797		2203	4300	6503	SO:0001583	missense	11232	exon3			CACCACTGGAGTC	U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.782A>G	chr17.hg19:g.62488797T>C	ENSP00000442563:p.Gln261Arg	1769.0	0.0		1900.0	604.0	NM_007215	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	ENST00000539111.2	hg19	CCDS32706.1	.	.	.	.	.	.	.	.	.	.	T	5.366	0.252741	0.10185	.	.	ENSG00000256525	ENST00000539111	T	0.77098	-1.07	5.44	3.15	0.36227	.	0.281419	0.32802	N	0.005638	T	0.69169	0.3081	L	0.50333	1.59	0.30041	N	0.812619	B;B	0.24823	0.112;0.112	B;B	0.19148	0.024;0.024	T	0.61850	-0.6978	10	0.33940	T	0.23	-4.096	10.6405	0.45590	0.418:0.0:0.0:0.582	.	261;261	E5KS15;Q9UHN1	.;DPOG2_HUMAN	R	261	ENSP00000442563:Q261R	ENSP00000442563:Q261R	Q	-	2	0	POLG2	59919259	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.313000	0.43735	0.408000	0.25621	-0.339000	0.08088	CAG	.	.		0.358	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000443820.1	NM_007215	
ATP5A1	498	hgsc.bcm.edu	37	18	43667308	43667308	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr18:43667308T>C	ENST00000398752.6	-	7	1071	c.950A>G	c.(949-951)cAg>cGg	p.Q317R	ATP5A1_ENST00000593152.2_Splice_Site_p.Q267R|ATP5A1_ENST00000282050.2_Splice_Site_p.Q317R|ATP5A1_ENST00000590665.1_Splice_Site_p.Q295R	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	317					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						TCCTTTGACCTGTTTGGATAA	0.353																																					p.Q317R		Atlas-SNP	.											.	ATP5A1	52	.	0			c.A950G						.						65.0	67.0	66.0					18																	43667308		2203	4299	6502	SO:0001630	splice_region_variant	498	exon7			TTGACCTGTTTGG	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.951+1A>G	chr18.hg19:g.43667308T>C		160.0	0.0		222.0	97.0	NM_004046	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	hg19	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	T	21.6	4.178808	0.78564	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	T;T	0.79454	-1.27;-1.27	4.53	4.53	0.55603	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.92031	0.7475	H	0.98980	4.39	0.80722	D	1	D	0.54047	0.964	P	0.62184	0.899	D	0.94810	0.7978	10	0.87932	D	0	-18.2648	13.8784	0.63667	0.0:0.0:0.0:1.0	.	317	P25705	ATPA_HUMAN	R	317;317;267	ENSP00000282050:Q317R;ENSP00000381736:Q317R	ENSP00000282050:Q317R	Q	-	2	0	ATP5A1	41921306	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.953000	0.87836	1.686000	0.51046	0.460000	0.39030	CAG	.	.		0.353	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	Missense_Mutation
ATP5A1	498	hgsc.bcm.edu	37	18	43667311	43667311	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr18:43667311T>C	ENST00000398752.6	-	7	1068	c.947A>G	c.(946-948)aAa>aGa	p.K316R	ATP5A1_ENST00000593152.2_Missense_Mutation_p.K266R|ATP5A1_ENST00000282050.2_Missense_Mutation_p.K316R|ATP5A1_ENST00000590665.1_Missense_Mutation_p.K294R	NM_001001935.2|NM_004046.5	NP_001001935.1|NP_004037.1	P25705	ATPA_HUMAN	ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit 1, cardiac muscle	316					ATP biosynthetic process (GO:0006754)|ATP catabolic process (GO:0006200)|ATP hydrolysis coupled proton transport (GO:0015991)|cellular metabolic process (GO:0044237)|embryo development (GO:0009790)|lipid metabolic process (GO:0006629)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|negative regulation of endothelial cell proliferation (GO:0001937)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|proton-transporting ATP synthase complex, catalytic core F(1) (GO:0045261)	ATP binding (GO:0005524)|MHC class I protein binding (GO:0042288)|poly(A) RNA binding (GO:0044822)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|transmembrane transporter activity (GO:0022857)			breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(8)|skin(1)|urinary_tract(1)	22						TTTGACCTGTTTGGATAAGTC	0.363																																					p.K316R		Atlas-SNP	.											.	ATP5A1	52	.	0			c.A947G						.						67.0	69.0	68.0					18																	43667311		2203	4300	6503	SO:0001583	missense	498	exon7			ACCTGTTTGGATA	D14710	CCDS11927.1, CCDS58620.1, CCDS59315.1	18q21	2012-10-12	2006-01-13		ENSG00000152234	ENSG00000152234	3.6.1.14	"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	823	protein-coding gene	gene with protein product		164360	"""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 2, non-cardiac muscle-like 2"", ""ATP synthase, H+ transporting, mitochondrial F1 complex, alpha subunit, isoform 1, cardiac muscle"""	ATP5AL2, ATPM		1830491	Standard	NM_001257334		Approved	ATP5A, hATP1, OMR, ORM	uc002lbr.2	P25705	OTTHUMG00000132637	ENST00000398752.6:c.947A>G	chr18.hg19:g.43667311T>C	ENSP00000381736:p.Lys316Arg	159.0	0.0		219.0	93.0	NM_004046	A8K092|B4DY56|K7ENP3|Q53XX6|Q8IXV2|Q96FB4|Q96HW2|Q96IR6|Q9BTV8	Missense_Mutation	SNP	ENST00000398752.6	hg19	CCDS11927.1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.446750	0.84101	.	.	ENSG00000152234	ENST00000282050;ENST00000398752;ENST00000542290	T;T	0.77750	-1.12;-1.12	4.53	4.53	0.55603	ATPase, F1/V1/A1 complex, alpha/beta subunit, nucleotide-binding domain (1);	0.045477	0.85682	D	0.000000	D	0.87410	0.6170	M	0.77820	2.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89157	0.3527	10	0.87932	D	0	-16.2311	13.8784	0.63667	0.0:0.0:0.0:1.0	.	316	P25705	ATPA_HUMAN	R	316;316;266	ENSP00000282050:K316R;ENSP00000381736:K316R	ENSP00000282050:K316R	K	-	2	0	ATP5A1	41921309	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.953000	0.87836	1.686000	0.51046	0.460000	0.39030	AAA	.	.		0.363	ATP5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255884.1	NM_004046	
SMAD4	4089	hgsc.bcm.edu	37	18	48593405	48593405	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr18:48593405G>A	ENST00000342988.3	+	10	1694	c.1156G>A	c.(1156-1158)Ggt>Agt	p.G386S	SMAD4_ENST00000588745.1_Missense_Mutation_p.G290S|SMAD4_ENST00000398417.2_Missense_Mutation_p.G386S	NM_005359.5	NP_005350.1	Q13485	SMAD4_HUMAN	SMAD family member 4	386	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.		G -> D (in JP/HHT; dbSNP:rs28936393). {ECO:0000269|PubMed:15031030}.		atrioventricular canal development (GO:0036302)|atrioventricular valve formation (GO:0003190)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|brainstem development (GO:0003360)|branching involved in ureteric bud morphogenesis (GO:0001658)|cardiac septum development (GO:0003279)|cell proliferation (GO:0008283)|developmental growth (GO:0048589)|endocardial cell differentiation (GO:0060956)|endoderm development (GO:0007492)|endothelial cell activation (GO:0042118)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|formation of anatomical boundary (GO:0048859)|gastrulation with mouth forming second (GO:0001702)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|metanephric mesenchyme morphogenesis (GO:0072133)|negative regulation of cell death (GO:0060548)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephrogenic mesenchyme morphogenesis (GO:0072134)|neural crest cell differentiation (GO:0014033)|neuron fate commitment (GO:0048663)|palate development (GO:0060021)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation involved in heart valve morphogenesis (GO:0003251)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of binding (GO:0051098)|regulation of hair follicle development (GO:0051797)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to transforming growth factor beta (GO:0071559)|sebaceous gland development (GO:0048733)|SMAD protein complex assembly (GO:0007183)|SMAD protein signal transduction (GO:0060395)|somite rostral/caudal axis specification (GO:0032525)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	activin responsive factor complex (GO:0032444)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transforming growth factor beta receptor, common-partner cytoplasmic mediator activity (GO:0030616)	p.0?(36)|p.G386R(5)|p.?(2)|p.G386C(1)		NS(2)|biliary_tract(19)|breast(9)|central_nervous_system(2)|endometrium(2)|gastrointestinal_tract_(site_indeterminate)(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(142)|liver(2)|lung(27)|oesophagus(4)|ovary(7)|pancreas(180)|prostate(3)|skin(1)|small_intestine(9)|stomach(5)|testis(2)|thyroid(19)|upper_aerodigestive_tract(10)|urinary_tract(2)|vulva(1)	454		all_cancers(7;0.203)|Colorectal(6;0.003)|all_epithelial(6;0.00336)		Colorectal(16;0.0032)|COAD - Colon adenocarcinoma(17;0.0708)|READ - Rectum adenocarcinoma(32;0.155)		CATAGGCAAAGGTGTGCAGTT	0.363																																					p.G386S		Atlas-SNP	.											SMAD4,colon,carcinoma,0,7	SMAD4	822	.	44	Whole gene deletion(36)|Substitution - Missense(6)|Unknown(2)	pancreas(26)|large_intestine(8)|breast(3)|stomach(2)|lung(2)|upper_aerodigestive_tract(1)|oesophagus(1)|ovary(1)	c.G1156A						.						200.0	165.0	177.0					18																	48593405		2203	4300	6503	SO:0001583	missense	4089	exon10			GGCAAAGGTGTGC	U44378	CCDS11950.1	18q21.1	2014-09-17	2006-11-06	2004-05-26	ENSG00000141646	ENSG00000141646		"""SMADs"""	6770	protein-coding gene	gene with protein product		600993	"""MAD, mothers against decapentaplegic homolog 4 (Drosophila)"", ""SMAD, mothers against DPP homolog 4 (Drosophila)"""	MADH4		8553070, 8774881	Standard	NM_005359		Approved	DPC4	uc010xdp.2	Q13485	OTTHUMG00000132696	ENST00000342988.3:c.1156G>A	chr18.hg19:g.48593405G>A	ENSP00000341551:p.Gly386Ser	134.0	0.0		142.0	42.0	NM_005359	A8K405	Missense_Mutation	SNP	ENST00000342988.3	hg19	CCDS11950.1	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957718	0.92726	.	.	ENSG00000141646	ENST00000342988;ENST00000544926;ENST00000398417	D;D	0.99872	-7.37;-7.37	5.65	4.78	0.61160	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.046058	0.85682	N	0.000000	D	0.99898	0.9951	H	0.96080	3.765	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96254	0.9185	10	0.87932	D	0	.	13.5117	0.61517	0.0761:0.0:0.9239:0.0	.	386	Q13485	SMAD4_HUMAN	S	386	ENSP00000341551:G386S;ENSP00000381452:G386S	ENSP00000341551:G386S	G	+	1	0	SMAD4	46847403	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.759000	0.98931	1.395000	0.46643	0.563000	0.77884	GGT	.	.		0.363	SMAD4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255993.3	NM_005359	
TXNL1	9352	hgsc.bcm.edu	37	18	54291666	54291666	+	Silent	SNP	T	T	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr18:54291666T>A	ENST00000217515.6	-	3	426	c.222A>T	c.(220-222)tcA>tcT	p.S74S	TXNL1_ENST00000590954.1_Silent_p.S74S|TXNL1_ENST00000540155.1_5'UTR	NM_004786.2	NP_004777.1	O43396	TXNL1_HUMAN	thioredoxin-like 1	74	Thioredoxin.				cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	disulfide oxidoreductase activity (GO:0015036)|protein disulfide oxidoreductase activity (GO:0015035)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4				READ - Rectum adenocarcinoma(59;0.193)|Colorectal(16;0.211)		TAGGTGTTGCTGATATATTGT	0.353																																					p.S74S		Atlas-SNP	.											.	TXNL1	30	.	0			c.A222T						.						177.0	175.0	175.0					18																	54291666		2203	4300	6503	SO:0001819	synonymous_variant	9352	exon3			TGTTGCTGATATA	AF003938	CCDS11961.1	18q21.31	2011-01-17	2004-05-06	2004-05-07	ENSG00000091164	ENSG00000091164			12436	protein-coding gene	gene with protein product	"""thioredoxin-like, 32kD"""	603049	"""thioredoxin-like, 32kDa"""	TXNL		9473519, 9668102	Standard	NM_004786		Approved	Txl, TRP32	uc002lgg.3	O43396	OTTHUMG00000132722	ENST00000217515.6:c.222A>T	chr18.hg19:g.54291666T>A		81.0	0.0		91.0	20.0	NM_004786		Silent	SNP	ENST00000217515.6	hg19	CCDS11961.1																																																																																			.	.		0.353	TXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256064.2		
SERPINB7	8710	hgsc.bcm.edu	37	18	61449699	61449699	+	Silent	SNP	C	C	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr18:61449699C>G	ENST00000398019.2	+	2	418	c.93C>G	c.(91-93)tcC>tcG	p.S31S	SERPINB7_ENST00000546027.1_Silent_p.S31S|SERPINB7_ENST00000540675.1_Silent_p.S31S|SERPINB7_ENST00000336429.2_Silent_p.S31S	NM_003784.3	NP_003775.1	O75635	SPB7_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 7	31					negative regulation of endopeptidase activity (GO:0010951)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of glomerular mesangial cell proliferation (GO:0072126)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of transforming growth factor beta1 production (GO:0032914)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(3)	27		Esophageal squamous(42;0.129)				TGTTCTTTTCCTCTCTGAGCC	0.483																																					p.S31S		Atlas-SNP	.											.	SERPINB7	66	.	0			c.C93G						.						127.0	101.0	110.0					18																	61449699		2203	4300	6503	SO:0001819	synonymous_variant	8710	exon2			CTTTTCCTCTCTG	AF027866	CCDS11988.1, CCDS58633.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166396	ENSG00000166396		"""Serine (or cysteine) peptidase inhibitors"""	13902	protein-coding gene	gene with protein product		603357	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 7"""			24172014	Standard	NM_003784		Approved	MEGSIN	uc002ljl.4	O75635	OTTHUMG00000060591	ENST00000398019.2:c.93C>G	chr18.hg19:g.61449699C>G		73.0	0.0		108.0	27.0	NM_001261830	B4DUW8|F5GZC0|Q1ED45|Q3KPG4	Silent	SNP	ENST00000398019.2	hg19	CCDS11988.1																																																																																			.	.		0.483	SERPINB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134007.1	NM_003784	
CREB3L3	84699	hgsc.bcm.edu	37	19	4171378	4171378	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:4171378A>G	ENST00000078445.2	+	9	1122		c.e9-1		CREB3L3_ENST00000595923.1_Splice_Site|CREB3L3_ENST00000602147.1_Splice_Site|CREB3L3_ENST00000602257.1_Splice_Site|CREB3L3_ENST00000252587.3_Splice_Site	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3						positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTCTCCACCAGGTCCTGTTG	0.607																																					.		Atlas-SNP	.											.	CREB3L3	53	.	0			c.973-2A>G						.						91.0	79.0	83.0					19																	4171378		2203	4300	6503	SO:0001630	splice_region_variant	84699	exon9			TCCACCAGGTCCT		CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.976-1A>G	chr19.hg19:g.4171378A>G		66.0	0.0		78.0	21.0	NM_001271995	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Splice_Site	SNP	ENST00000078445.2	hg19	CCDS12121.1	.	.	.	.	.	.	.	.	.	.	A	13.39	2.221787	0.39300	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8958	0.52656	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CREB3L3	4122378	1.000000	0.71417	0.988000	0.46212	0.273000	0.26683	6.155000	0.71833	1.700000	0.51204	0.459000	0.35465	.	.	.		0.607	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457922.1	NM_032607	Intron
KDM4B	23030	hgsc.bcm.edu	37	19	5131976	5131976	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:5131976T>C	ENST00000159111.4	+	13	2082	c.1864T>C	c.(1864-1866)Tcc>Ccc	p.S622P	KDM4B_ENST00000536461.1_Missense_Mutation_p.S656P	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	622					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						GCCCACCCGGTCCCCACTGTC	0.637																																					p.S622P		Atlas-SNP	.											.	KDM4B	120	.	0			c.T1864C						.						21.0	26.0	25.0					19																	5131976		2194	4294	6488	SO:0001583	missense	23030	exon13			ACCCGGTCCCCAC	AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.1864T>C	chr19.hg19:g.5131976T>C	ENSP00000159111:p.Ser622Pro	241.0	0.0		259.0	80.0	NM_015015	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	ENST00000159111.4	hg19	CCDS12138.1	.	.	.	.	.	.	.	.	.	.	T	21.5	4.153137	0.78001	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.53423	0.62;0.62	4.12	4.12	0.48240	.	0.126301	0.56097	D	0.000033	T	0.65144	0.2663	M	0.77103	2.36	0.43448	D	0.995637	D;D	0.71674	0.994;0.998	P;D	0.63381	0.865;0.914	T	0.68265	-0.5454	10	0.46703	T	0.11	-39.7167	13.1392	0.59426	0.0:0.0:0.0:1.0	.	656;622	F5GX28;O94953	.;KDM4B_HUMAN	P	622;656	ENSP00000159111:S622P;ENSP00000440495:S656P	ENSP00000159111:S622P	S	+	1	0	KDM4B	5082976	1.000000	0.71417	0.891000	0.34965	0.774000	0.43823	3.688000	0.54699	1.512000	0.48834	0.459000	0.35465	TCC	.	.		0.637	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000450558.1	NM_015015	
SLC35E1	79939	hgsc.bcm.edu	37	19	16678874	16678874	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:16678874C>A	ENST00000595753.1	-	3	616	c.599G>T	c.(598-600)tGc>tTc	p.C200F	CTD-3222D19.10_ENST00000597851.1_RNA|CTD-3222D19.2_ENST00000409035.1_Intron|SLC35E1_ENST00000431408.1_Missense_Mutation_p.C44F	NM_024881.4	NP_079157.3	Q96K37	S35E1_HUMAN	solute carrier family 35, member E1	200					transport (GO:0006810)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(2)|ovary(1)	15						AAGCGAGAAGCACAGCGTGGC	0.562																																					p.C200F		Atlas-SNP	.											.	SLC35E1	48	.	0			c.G599T						.						93.0	86.0	89.0					19																	16678874		2203	4300	6503	SO:0001583	missense	79939	exon3			GAGAAGCACAGCG	AK024313	CCDS12346.2	19p13.11	2013-05-22			ENSG00000127526	ENSG00000127526		"""Solute carriers"""	20803	protein-coding gene	gene with protein product							Standard	NM_024881		Approved	FLJ14251	uc010xph.2	Q96K37	OTTHUMG00000152575	ENST00000595753.1:c.599G>T	chr19.hg19:g.16678874C>A	ENSP00000470652:p.Cys200Phe	58.0	0.0		55.0	14.0	NM_024881	Q8NBQ2|Q96JV7	Missense_Mutation	SNP	ENST00000595753.1	hg19	CCDS12346.2	.	.	.	.	.	.	.	.	.	.	C	23.0	4.364801	0.82463	.	.	ENSG00000127526	ENST00000409648;ENST00000431408	T	0.62105	0.05	5.13	5.13	0.70059	Domain of unknown function DUF250 (1);	0.000000	0.85682	D	0.000000	T	0.71013	0.3290	L	0.44542	1.39	0.80722	D	1	D;P	0.71674	0.998;0.9	D;P	0.68943	0.961;0.668	T	0.65635	-0.6120	10	0.20046	T	0.44	-40.764	17.5838	0.87976	0.0:1.0:0.0:0.0	.	200;56	Q96K37;Q9H7U6	S35E1_HUMAN;.	F	200;44	ENSP00000397670:C44F	ENSP00000387152:C200F	C	-	2	0	SLC35E1	16539874	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.201000	0.77847	2.387000	0.81309	0.555000	0.69702	TGC	.	.		0.562	SLC35E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326809.2	NM_024881	
ZNF527	84503	hgsc.bcm.edu	37	19	37880628	37880629	+	Missense_Mutation	DNP	TG	TG	GT			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T|G	T|G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:37880628_37880629TG>GT	ENST00000436120.2	+	5	1784_1785	c.1677_1678TG>GT	c.(1675-1680)tgTGgg>tgGTgg	p.559_560CG>WW	ZNF527_ENST00000587349.1_Intron	NM_032453.1	NP_115829.1	Q8NB42	ZN527_HUMAN	zinc finger protein 527	559					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	33			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GTAGTGAATGTGGGAAGGCTTT	0.376																																					p.C559W|p.G560W		Atlas-SNP	.											.	ZNF527	78	.	0			c.T1677G|c.G1678T						.																																			SO:0001583	missense	84503	exon5			TGAATGTGGGAAG|GAATGTGGGAAGG	AB058732, AK091585	CCDS42559.1	19q13.1	2013-01-08			ENSG00000189164	ENSG00000189164		"""Zinc fingers, C2H2-type"", ""-"""	29385	protein-coding gene	gene with protein product						11347906	Standard	NM_032453		Approved	KIAA1829	uc010efk.1	Q8NB42	OTTHUMG00000048173	Exception_encountered	chr19.hg19:g.37880628_37880629delinsGT	ENSP00000390179:p.C559_G560delinsWW	61.0	0.0		48.0|47.0	20.0|19.0	NM_032453	B4DVL5	Missense_Mutation	SNP	ENST00000436120.2	hg19	CCDS42559.1																																																																																			.	.		0.376	ZNF527-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458434.1	NM_032453	
CKM	1158	hgsc.bcm.edu	37	19	45821217	45821217	+	Missense_Mutation	SNP	C	C	T	rs1803285		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:45821217C>T	ENST00000221476.3	-	3	388	c.214G>A	c.(214-216)Gtg>Atg	p.V72M		NM_001824.4	NP_001815.2	P06732	KCRM_HUMAN	creatine kinase, muscle	72	Phosphagen kinase N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00842}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|phosphocreatine biosynthetic process (GO:0046314)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.V72M(1)		cervix(1)|endometrium(1)|large_intestine(8)|lung(3)|prostate(2)|skin(2)	17		Ovarian(192;0.0336)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;2.29e-44)|Epithelial(262;1.05e-38)|GBM - Glioblastoma multiforme(486;3.56e-07)	Creatine(DB00148)	ACGCAGCCCACGGTCATGATG	0.592																																					p.V72M		Atlas-SNP	.											CKM,colon,carcinoma,0,1	CKM	40	.	1	Substitution - Missense(1)	large_intestine(1)	c.G214A						.						64.0	54.0	57.0					19																	45821217		2203	4300	6503	SO:0001583	missense	1158	exon3			AGCCCACGGTCAT	M14780	CCDS12659.1	19q13.32	2012-10-02			ENSG00000104879	ENSG00000104879	2.7.3.2		1994	protein-coding gene	gene with protein product		123310		CKMM			Standard	NM_001824		Approved		uc002pbd.4	P06732		ENST00000221476.3:c.214G>A	chr19.hg19:g.45821217C>T	ENSP00000221476:p.Val72Met	83.0	0.0		94.0	36.0	NM_001824	Q96QL9	Missense_Mutation	SNP	ENST00000221476.3	hg19	CCDS12659.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.649634	0.87958	.	.	ENSG00000104879	ENST00000221476	T	0.70399	-0.48	4.62	4.62	0.57501	ATP:guanido phosphotransferase, N-terminal (4);	0.070689	0.56097	D	0.000026	T	0.78078	0.4227	M	0.86097	2.795	0.58432	D	0.999999	D	0.54772	0.968	P	0.47626	0.552	D	0.83635	0.0147	10	0.87932	D	0	-32.9684	15.0581	0.71930	0.0:1.0:0.0:0.0	rs1803285	72	P06732	KCRM_HUMAN	M	72	ENSP00000221476:V72M	ENSP00000221476:V72M	V	-	1	0	CKM	50513057	1.000000	0.71417	0.995000	0.50966	0.986000	0.74619	7.283000	0.78640	2.418000	0.82041	0.650000	0.86243	GTG	.	.		0.592	CKM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000457569.1		
ZNF761	388561	hgsc.bcm.edu	37	19	53959745	53959745	+	RNA	SNP	T	T	G	rs146356671	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr19:53959745T>G	ENST00000454407.1	+	0	2437							Q86XN6	ZN761_HUMAN	zinc finger protein 761						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	30				GBM - Glioblastoma multiforme(134;0.00786)		AGAGAAACCTTACAAGTGTAA	0.383																																					p.Y662D		Atlas-SNP	.											.	ZNF761	104	.	0			c.T1984G						.						81.0	87.0	85.0					19																	53959745		2203	4300	6503			388561	exon7			AAACCTTACAAGT	AB107355		19q13.42	2007-10-05	2006-08-11	2006-08-11	ENSG00000160336	ENSG00000160336		"""Zinc fingers, C2H2-type"""	23179	protein-coding gene	gene with protein product							Standard	NM_001008401		Approved	KIAA2033, FLJ16231, FLJ35333	uc010eqp.3	Q86XN6	OTTHUMG00000156999		chr19.hg19:g.53959745T>G		77.0	0.0		87.0	33.0	NM_001008401	Q6ZNB9	Missense_Mutation	SNP	ENST00000454407.1	hg19																																																																																				.	T|0.999;C|0.001		0.383	ZNF761-203	KNOWN	basic	processed_transcript	processed_transcript		NM_001008401	
SLC4A11	83959	hgsc.bcm.edu	37	20	3214949	3214949	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr20:3214949T>G	ENST00000380056.3	-	4	398	c.351A>C	c.(349-351)ttA>ttC	p.L117F	SLC4A11_ENST00000380059.3_Missense_Mutation_p.L144F|SLC4A11_ENST00000539553.2_Missense_Mutation_p.L101F	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	117					bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TGAAGTTCTTTAACTTCAGGT	0.607																																					p.L144F	NSCLC(190;922 2139 10266 10292 38692)	Atlas-SNP	.											.	SLC4A11	188	.	0			c.A432C						.						57.0	55.0	56.0					20																	3214949		2203	4300	6503	SO:0001583	missense	83959	exon5			GTTCTTTAACTTC	AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.351A>C	chr20.hg19:g.3214949T>G	ENSP00000369396:p.Leu117Phe	87.0	0.0		92.0	24.0	NM_001174090	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Missense_Mutation	SNP	ENST00000380056.3	hg19	CCDS13052.1	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316836	0.40996	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553;ENST00000437836	D;D;D;D	0.83250	-1.66;-1.64;-1.63;-1.7	5.2	1.66	0.24008	Phosphotransferase/anion transporter (1);	0.387849	0.21342	N	0.076118	T	0.76097	0.3940	L	0.52364	1.645	0.58432	D	0.99999	B;B;B	0.30104	0.268;0.175;0.175	B;B;B	0.31442	0.13;0.101;0.101	T	0.69165	-0.5217	10	0.48119	T	0.1	.	8.2353	0.31622	0.0:0.2364:0.0:0.7636	.	101;144;117	G3V1M3;B4DKC8;Q8NBS3	.;.;S4A11_HUMAN	F	144;117;101;101	ENSP00000369399:L144F;ENSP00000369396:L117F;ENSP00000441370:L101F;ENSP00000404271:L101F	ENSP00000369396:L117F	L	-	3	2	SLC4A11	3162949	0.904000	0.30761	1.000000	0.80357	0.990000	0.78478	-0.036000	0.12185	0.290000	0.22444	0.533000	0.62120	TTA	.	.		0.607	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000077728.1		
RALGAPB	57148	hgsc.bcm.edu	37	20	37209925	37209925	+	IGR	SNP	A	A	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr20:37209925A>G	ENST00000262879.6	+	0	8661				ADIG_ENST00000373348.3_Missense_Mutation_p.D11G|ADIG_ENST00000537425.1_Missense_Mutation_p.D6G			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)						activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CTGGTGAACGACCTCACATTT	0.557																																					p.D11G		Atlas-SNP	.											.	ADIG	16	.	0			c.A32G						.						182.0	188.0	186.0					20																	37209925		1980	4158	6138	SO:0001628	intergenic_variant	149685	exon1			TGAACGACCTCAC	AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270		chr20.hg19:g.37209925A>G		118.0	0.0		108.0	27.0	NM_001018082	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	ENST00000262879.6	hg19	CCDS13305.1	.	.	.	.	.	.	.	.	.	.	A	17.70	3.453783	0.63290	.	.	ENSG00000182035	ENST00000537425;ENST00000373348	.	.	.	5.15	5.15	0.70609	.	0.667620	0.12253	N	0.485482	T	0.39989	0.1099	.	.	.	0.19775	N	0.999951	P	0.36633	0.562	B	0.38500	0.275	T	0.36553	-0.9743	8	0.62326	D	0.03	.	11.6597	0.51339	1.0:0.0:0.0:0.0	.	11	Q0VDE8	ADIG_HUMAN	G	6;11	.	ENSP00000362445:D11G	D	+	2	0	ADIG	36643339	0.701000	0.27806	0.187000	0.23214	0.945000	0.59286	4.660000	0.61511	2.053000	0.61076	0.533000	0.62120	GAC	.	.		0.557	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000079191.1	NM_020336	
DIDO1	11083	hgsc.bcm.edu	37	20	61528235	61528235	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr20:61528235G>A	ENST00000266070.4	-	7	2027	c.1702C>T	c.(1702-1704)Cca>Tca	p.P568S	DIDO1_ENST00000395343.1_Missense_Mutation_p.P568S|DIDO1_ENST00000395340.1_Missense_Mutation_p.P568S|DIDO1_ENST00000395335.2_Missense_Mutation_p.P568S	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	568					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GACTTCTTTGGCACGAGGTTT	0.577																																					p.P568S	Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	Atlas-SNP	.											DIDO1,NS,malignant_melanoma,0,1	DIDO1	321	.	0			c.C1702T						.						45.0	46.0	46.0					20																	61528235		2203	4300	6503	SO:0001583	missense	11083	exon7			TCTTTGGCACGAG	AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.1702C>T	chr20.hg19:g.61528235G>A	ENSP00000266070:p.Pro568Ser	135.0	0.0		156.0	47.0	NM_080797	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	ENST00000266070.4	hg19	CCDS33506.1	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324076	0.24080	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.12879	2.98;2.98;2.64;2.64	5.71	4.75	0.60458	.	0.175580	0.27130	N	0.020795	T	0.14570	0.0352	L	0.58669	1.825	0.80722	D	1	B;B	0.30281	0.275;0.18	B;B	0.26202	0.067;0.03	T	0.01874	-1.1256	10	0.42905	T	0.14	-12.1361	11.5841	0.50908	0.1401:0.0:0.8599:0.0	.	568;568	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	S	568	ENSP00000266070:P568S;ENSP00000378752:P568S;ENSP00000378749:P568S;ENSP00000378744:P568S	ENSP00000266070:P568S	P	-	1	0	DIDO1	60998680	0.988000	0.35896	0.913000	0.36048	0.076000	0.17211	1.575000	0.36493	2.685000	0.91497	0.563000	0.77884	CCA	.	.		0.577	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000080091.2	NM_080796	
APP	351	hgsc.bcm.edu	37	21	27372473	27372473	+	Missense_Mutation	SNP	G	G	T	rs557227002		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr21:27372473G>T	ENST00000346798.3	-	7	923	c.890C>A	c.(889-891)aCg>aAg	p.T297K	APP_ENST00000440126.3_Missense_Mutation_p.T292K|APP_ENST00000448388.2_Intron|APP_ENST00000354192.3_Intron|APP_ENST00000348990.5_Intron|APP_ENST00000439274.2_Missense_Mutation_p.T241K|APP_ENST00000359726.3_Intron|APP_ENST00000358918.3_Missense_Mutation_p.T297K|APP_ENST00000357903.3_Missense_Mutation_p.T297K	NM_000484.3	NP_000475.1	P05067	A4_HUMAN	amyloid beta (A4) precursor protein	297	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				adult locomotory behavior (GO:0008344)|axon cargo transport (GO:0008088)|axon midline choice point recognition (GO:0016199)|axonogenesis (GO:0007409)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|collateral sprouting in absence of injury (GO:0048669)|dendrite development (GO:0016358)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|ionotropic glutamate receptor signaling pathway (GO:0035235)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|mRNA polyadenylation (GO:0006378)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron differentiation (GO:0045665)|neuromuscular process controlling balance (GO:0050885)|neuron apoptotic process (GO:0051402)|neuron projection development (GO:0031175)|neuron remodeling (GO:0016322)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of multicellular organism growth (GO:0040014)|regulation of protein binding (GO:0043393)|regulation of synapse structure and activity (GO:0050803)|regulation of translation (GO:0006417)|response to oxidative stress (GO:0006979)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|suckling behavior (GO:0001967)|synaptic growth at neuromuscular junction (GO:0051124)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|ciliary rootlet (GO:0035253)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endosome (GO:0005768)|ER to Golgi transport vesicle (GO:0030134)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|receptor complex (GO:0043235)|spindle midzone (GO:0051233)|synapse (GO:0045202)	acetylcholine receptor binding (GO:0033130)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|peptidase activator activity (GO:0016504)|PTB domain binding (GO:0051425)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			endometrium(5)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	22		Breast(209;0.00295)				GCACGGCCCCGTCTCGGCTTG	0.517																																					p.T297K		Atlas-SNP	.											.	APP	90	.	0			c.C890A						.						79.0	66.0	70.0					21																	27372473		2203	4300	6503	SO:0001583	missense	351	exon7			GGCCCCGTCTCGG	M15533	CCDS13576.1, CCDS13577.1, CCDS33523.1, CCDS46638.1, CCDS46639.1, CCDS56211.1, CCDS56212.1, CCDS56213.1	21q21.2	2014-01-30	2008-07-31		ENSG00000142192	ENSG00000142192		"""Endogenous ligands"""	620	protein-coding gene	gene with protein product	"""peptidase nexin-II"""	104760	"""Alzheimer disease"""	AD1		1679289	Standard	NM_001136130		Approved		uc002ylz.3	P05067	OTTHUMG00000078438	ENST00000346798.3:c.890C>A	chr21.hg19:g.27372473G>T	ENSP00000284981:p.Thr297Lys	94.0	0.0		73.0	18.0	NM_001204302	B2R5V1|B4DII8|D3DSD1|D3DSD2|D3DSD3|P09000|P78438|Q13764|Q13778|Q13793|Q16011|Q16014|Q16019|Q16020|Q6GSC0|Q8WZ99|Q9BT38|Q9UC33|Q9UCA9|Q9UCB6|Q9UCC8|Q9UCD1|Q9UQ58	Missense_Mutation	SNP	ENST00000346798.3	hg19	CCDS13576.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.5|29.5	5.015149|5.015149	0.93404|0.93404	.|.	.|.	ENSG00000142192|ENSG00000142192	ENST00000448850|ENST00000346798;ENST00000357903;ENST00000358918;ENST00000440126;ENST00000439274	.|T;T;T;T;T	.|0.57752	.|0.38;0.38;0.38;0.38;0.38	5.08|5.08	5.08|5.08	0.68730|0.68730	.|Proteinase inhibitor I2, Kunitz metazoa (6);	.|0.105878	.|0.64402	.|D	.|0.000005	T|T	0.65344|0.65344	0.2682|0.2682	L|L	0.42487|0.42487	1.325|1.325	0.80722|0.80722	D|D	1|1	.|D;P;P;D	.|0.69078	.|0.997;0.919;0.901;0.997	.|P;P;P;D	.|0.64595	.|0.902;0.705;0.58;0.927	T|T	0.67929|0.67929	-0.5543|-0.5543	5|10	.|0.87932	.|D	.|0	-17.4333|-17.4333	18.2555|18.2555	0.90019|0.90019	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|241;292;297;297	.|E9PG40;B4DII8;P05067-8;P05067	.|.;.;.;A4_HUMAN	E|K	218|297;297;297;292;241	.|ENSP00000284981:T297K;ENSP00000350578:T297K;ENSP00000351796:T297K;ENSP00000387483:T292K;ENSP00000398879:T241K	.|ENSP00000284981:T297K	D|T	-|-	3|2	2|0	APP|APP	26294344|26294344	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.307000|7.307000	0.78920|0.78920	2.648000|2.648000	0.89879|0.89879	0.650000|0.650000	0.86243|0.86243	GAC|ACG	.	.		0.517	APP-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000171340.1	NM_000484	
SUSD2	56241	hgsc.bcm.edu	37	22	24581750	24581750	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr22:24581750C>T	ENST00000358321.3	+	8	1453	c.1192C>T	c.(1192-1194)Cgc>Tgc	p.R398C		NM_019601.3	NP_062547.1	Q9UGT4	SUSD2_HUMAN	sushi domain containing 2	398	AMOP. {ECO:0000255|PROSITE- ProRule:PRU00347}.				immune response (GO:0006955)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	26						ACCCCCGTTCCGCACGCCACC	0.672																																					p.R398C		Atlas-SNP	.											.	SUSD2	68	.	0			c.C1192T						.						29.0	27.0	28.0					22																	24581750		2201	4296	6497	SO:0001583	missense	56241	exon8			CCGTTCCGCACGC	AK026431	CCDS13824.1	22q11-q12	2005-08-16			ENSG00000099994	ENSG00000099994			30667	protein-coding gene	gene with protein product		615825				12477932	Standard	NM_019601		Approved	BK65A6.2, FLJ22778	uc002zzn.1	Q9UGT4	OTTHUMG00000150792	ENST00000358321.3:c.1192C>T	chr22.hg19:g.24581750C>T	ENSP00000351075:p.Arg398Cys	61.0	0.0		47.0	11.0	NM_019601	Q9H5Y6	Missense_Mutation	SNP	ENST00000358321.3	hg19	CCDS13824.1	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154112	0.57259	.	.	ENSG00000099994	ENST00000358321	T	0.21361	2.01	4.77	3.69	0.42338	AMOP (3);	0.755868	0.12111	N	0.498488	T	0.42449	0.1203	M	0.72118	2.19	0.09310	N	0.999998	D	0.89917	1.0	D	0.65773	0.938	T	0.11470	-1.0586	10	0.59425	D	0.04	-20.2557	11.0138	0.47677	0.2816:0.7184:0.0:0.0	.	398	Q9UGT4	SUSD2_HUMAN	C	398	ENSP00000351075:R398C	ENSP00000351075:R398C	R	+	1	0	SUSD2	22911750	0.002000	0.14202	0.362000	0.25862	0.926000	0.56050	0.092000	0.15066	2.396000	0.81511	0.456000	0.33151	CGC	.	.		0.672	SUSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320088.1	NM_019601	
ZBED4	9889	hgsc.bcm.edu	37	22	50279247	50279247	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr22:50279247A>T	ENST00000216268.5	+	2	2414	c.1937A>T	c.(1936-1938)gAg>gTg	p.E646V		NM_014838.2	NP_055653.2	O75132	ZBED4_HUMAN	zinc finger, BED-type containing 4	646						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(2)|large_intestine(11)|lung(20)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	44		all_cancers(38;8.58e-10)|all_epithelial(38;1.15e-08)|all_lung(38;0.000109)|Lung NSC(38;0.0018)|Breast(42;0.00191)|Ovarian(80;0.0164)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)|BRCA - Breast invasive adenocarcinoma(115;0.2)|LUAD - Lung adenocarcinoma(64;0.247)		GACACCAATGAGAAGTTTTAC	0.493																																					p.E646V		Atlas-SNP	.											.	ZBED4	102	.	0			c.A1937T						.						52.0	57.0	56.0					22																	50279247		2203	4300	6503	SO:0001583	missense	9889	exon2			CCAATGAGAAGTT	AB014537	CCDS33677.1	22q13.33	2013-05-03			ENSG00000100426	ENSG00000100426		"""Zinc fingers, BED-type"""	20721	protein-coding gene	gene with protein product		612552				23533661	Standard	NM_014838		Approved	KIAA0637	uc003bix.2	O75132	OTTHUMG00000150291	ENST00000216268.5:c.1937A>T	chr22.hg19:g.50279247A>T	ENSP00000216268:p.Glu646Val	74.0	0.0		86.0	24.0	NM_014838	B2RZH1|Q1ECU0|Q9UGG8	Missense_Mutation	SNP	ENST00000216268.5	hg19	CCDS33677.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.134213	0.77662	.	.	ENSG00000100426	ENST00000216268	T	0.48836	0.8	5.36	5.36	0.76844	.	0.120058	0.56097	D	0.000039	T	0.52224	0.1721	M	0.72118	2.19	0.58432	D	0.999997	D	0.54397	0.966	B	0.44315	0.446	T	0.59327	-0.7475	10	0.52906	T	0.07	-13.1138	15.3501	0.74376	1.0:0.0:0.0:0.0	.	646	O75132	ZBED4_HUMAN	V	646	ENSP00000216268:E646V	ENSP00000216268:E646V	E	+	2	0	ZBED4	48665251	1.000000	0.71417	0.992000	0.48379	0.963000	0.63663	8.723000	0.91458	2.017000	0.59298	0.533000	0.62120	GAG	.	.		0.493	ZBED4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317408.2	NM_014838	
USP9X	8239	hgsc.bcm.edu	37	X	41048571	41048571	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chrX:41048571G>A	ENST00000324545.8	+	26	4453	c.3820G>A	c.(3820-3822)Ggc>Agc	p.G1274S	USP9X_ENST00000378308.2_Missense_Mutation_p.G1274S	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1274					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						GACCAATGCAGGCAATGAGCC	0.383																																					p.G1274S	Ovarian(172;1807 2695 35459 49286)	Atlas-SNP	.											.	USP9X	385	.	0			c.G3820A						.						147.0	133.0	138.0					X																	41048571		2199	4300	6499	SO:0001583	missense	8239	exon26			AATGCAGGCAATG	X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.3820G>A	chrX.hg19:g.41048571G>A	ENSP00000316357:p.Gly1274Ser	116.0	0.0		227.0	11.0	NM_001039591	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	ENST00000324545.8	hg19	CCDS43930.1	.	.	.	.	.	.	.	.	.	.	G	9.927	1.213781	0.22289	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.02709	4.2;4.19	5.78	5.78	0.91487	.	0.046433	0.85682	D	0.000000	T	0.02083	0.0065	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.46527	-0.9185	10	0.06099	T	0.92	.	18.9742	0.92728	0.0:0.0:1.0:0.0	.	1274;1274	Q93008-1;Q93008	.;USP9X_HUMAN	S	1274	ENSP00000367558:G1274S;ENSP00000316357:G1274S	ENSP00000316357:G1274S	G	+	1	0	USP9X	40933515	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	9.444000	0.97578	2.429000	0.82318	0.513000	0.50165	GGC	.	.		0.383	USP9X-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000056250.4	NM_004652	
DRP2	1821	hgsc.bcm.edu	37	X	100507604	100507604	+	Silent	SNP	C	C	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chrX:100507604C>T	ENST00000395209.3	+	17	2403	c.1876C>T	c.(1876-1878)Ctg>Ttg	p.L626L	DRP2_ENST00000541709.1_Silent_p.L548L|DRP2_ENST00000402866.1_Silent_p.L626L|DRP2_ENST00000538510.1_Silent_p.L626L	NM_001939.2	NP_001930.2	Q13474	DRP2_HUMAN	dystrophin related protein 2	626					central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(10)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	31						GTACCGGAGTCTGAAGCAATT	0.507																																					p.L626L		Atlas-SNP	.											.	DRP2	98	.	0			c.C1876T						.						123.0	91.0	102.0					X																	100507604		2203	4300	6503	SO:0001819	synonymous_variant	1821	exon17			CGGAGTCTGAAGC	U43519	CCDS14480.2, CCDS55465.1	Xq22	2008-02-05			ENSG00000102385	ENSG00000102385			3032	protein-coding gene	gene with protein product		300052				8640231	Standard	NM_001939		Approved		uc004egz.2	Q13474	OTTHUMG00000022020	ENST00000395209.3:c.1876C>T	chrX.hg19:g.100507604C>T		171.0	1.0		229.0	162.0	NM_001939	A6ZKI5|A8K1B0|B1B1F3|B4DIZ0	Silent	SNP	ENST00000395209.3	hg19	CCDS14480.2																																																																																			.	.		0.507	DRP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000057522.3	NM_001939	
MT-CO3	4514	hgsc.bcm.edu	37	M	9655	9655	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chrM:9655G>A	ENST00000362079.2	+	1	449	c.449G>A	c.(448-450)aGt>aAt	p.S150N	MT-ND3_ENST00000361227.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ND5_ENST00000361567.2_5'Flank|MT-ND4_ENST00000361381.2_5'Flank|MT-TS1_ENST00000387416.2_RNA|MT-TG_ENST00000387429.1_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TK_ENST00000387421.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TH_ENST00000387441.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III	150					aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						AGCTCACCATAGTCTAATAGA	0.443																																					p.S150N		Atlas-SNP	.											.	.	.	.	0			c.G449A						.																																			SO:0001583	missense	5742	exon1			ACCATAGTCTAAT			mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414		ENST00000362079.2:c.449G>A	chrM.hg19:g.9655G>A	ENSP00000354982:p.Ser150Asn	14.0	0.0		47.0	28.0	ENST00000362079	Q14Y83	Missense_Mutation	SNP	ENST00000362079.2	hg19																																																																																				.	.		0.443	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024032	
SENP6	26054	hgsc.bcm.edu	37	6	76386867	76386867	+	Frame_Shift_Del	DEL	G	G	-			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:76386867delG	ENST00000447266.2	+	14	2221	c.1743delG	c.(1741-1743)gcgfs	p.A581fs	SENP6_ENST00000327284.8_Frame_Shift_Del_p.A574fs|SENP6_ENST00000370014.3_Frame_Shift_Del_p.A581fs|SENP6_ENST00000541192.1_Frame_Shift_Del_p.A177fs|SENP6_ENST00000370010.2_Frame_Shift_Del_p.A574fs	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	581					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				ATTTTTTTGCGAAAATTCCCT	0.333																																					p.A581fs		Atlas-INDEL	.											.	SENP6	189	.	0			c.1742delC						.						35.0	34.0	34.0					6																	76386867		1807	4066	5873	SO:0001589	frameshift_variant	26054	exon14			.		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1743delG	chr6.hg19:g.76386867delG	ENSP00000402527:p.Ala581fs	605.0	0.0		282.0	72.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Del	DEL	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.333	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
ZNF469	84627	hgsc.bcm.edu	37	16	88498840	88498841	+	Frame_Shift_Ins	INS	-	-	G			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr16:88498840_88498841insG	ENST00000437464.1	+	2	4878_4879	c.4878_4879insG	c.(4879-4881)gggfs	p.G1627fs	ZNF469_ENST00000565624.1_Frame_Shift_Ins_p.G1655fs	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	1627					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						AGGGGAGGCCTGGGGGGACGTG	0.663																																					p.P1626fs		Atlas-INDEL	.											.	ZNF469	121	.	0			c.4878_4879insG						.																																			SO:0001589	frameshift_variant	84627	exon2			.	AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.4884dupG	chr16.hg19:g.88498846_88498846dupG	ENSP00000402343:p.Gly1627fs	48.0	0.0		51.0	15.0	NM_001127464		Frame_Shift_Ins	INS	ENST00000437464.1	hg19	CCDS45544.1																																																																																			.	.		0.663	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NG_012236	
SENP6	26054	hgsc.bcm.edu	37	6	76386824	76386861	+	Frame_Shift_Del	DEL	TTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	TTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	-	rs561416792|rs202019332|rs373276113	byFrequency	TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	TTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	TTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr6:76386824_76386861delTTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	ENST00000447266.2	+	14	2178_2215	c.1700_1737delTTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	c.(1699-1737)attaatgaaattggtataaagaataacatctccaattttfs	p.INEIGIKNNISNF567fs	SENP6_ENST00000327284.8_Frame_Shift_Del_p.INEIGIKNNISNF560fs|SENP6_ENST00000370014.3_Frame_Shift_Del_p.INEIGIKNNISNF567fs|SENP6_ENST00000541192.1_Frame_Shift_Del_p.INEIGIKNNISNF163fs|SENP6_ENST00000370010.2_Frame_Shift_Del_p.INEIGIKNNISNF560fs	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	567					protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				GAAAGTATCATTAATGAAATTGGTATAAAGAATAACATCTCCAATTTTTTTGCGAAAA	0.311																																					p.567_579del		Atlas-INDEL	.											.	SENP6	189	.	0			c.1699_1736del						.																																			SO:0001589	frameshift_variant	26054	exon14			.		CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.1700_1737delTTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	chr6.hg19:g.76386824_76386861delTTAATGAAATTGGTATAAAGAATAACATCTCCAATTTT	ENSP00000402527:p.Ile567fs	436.0	0.0		218.0	25.0	NM_015571	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Frame_Shift_Del	DEL	ENST00000447266.2	hg19	CCDS47454.1																																																																																			.	.		0.311	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000041272.2	NM_015571	
MPHOSPH10	10199	hgsc.bcm.edu	37	2	71361819	71361824	+	In_Frame_Del	DEL	AGTGAC	AGTGAC	-	rs147873518		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	AGTGAC	AGTGAC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr2:71361819_71361824delAGTGAC	ENST00000244230.2	+	4	1342_1347	c.990_995delAGTGAC	c.(988-996)agagtgacc>agc	p.330_332RVT>S	MPHOSPH10_ENST00000498451.2_In_Frame_Del_p.330_332RVT>S	NM_005791.2	NP_005782.1	O00566	MPP10_HUMAN	M-phase phosphoprotein 10 (U3 small nucleolar ribonucleoprotein)	330					negative regulation of phosphatase activity (GO:0010923)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|rRNA processing (GO:0006364)	chromosome (GO:0005694)|nucleolus (GO:0005730)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(2)|pancreas(2)|skin(2)|stomach(1)	26						GCTTGAAAAGAGTGACCTTTGCTTTA	0.311																																					p.330_332del		Atlas-INDEL	.											.	MPHOSPH10	81	.	0			c.989_994del						.																																			SO:0001651	inframe_deletion	10199	exon4			.	X98494	CCDS1916.1	2p13.3	2014-06-12			ENSG00000124383	ENSG00000124383			7213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 106"""	605503				8885239, 9450966	Standard	NM_005791		Approved	MPP10, MPP10P, CT90, PPP1R106	uc002sht.2	O00566	OTTHUMG00000129715	ENST00000244230.2:c.990_995delAGTGAC	chr2.hg19:g.71361819_71361824delAGTGAC	ENSP00000244230:p.Arg330_Thr332delinsSer	301.0	0.0		273.0	60.0	NM_005791	A0AVJ8	In_Frame_Del	DEL	ENST00000244230.2	hg19	CCDS1916.1																																																																																			.	.		0.311	MPHOSPH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251924.2	NM_005791	
TMEM56	148534	hgsc.bcm.edu	37	1	95609466	95609466	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:95609466delC	ENST00000370203.4	+	2	300	c.9delC	c.(7-9)atcfs	p.I3fs	TMEM56_ENST00000463375.1_3'UTR|RP11-57H12.6_ENST00000604534.1_Frame_Shift_Del_p.I3fs	NM_001199679.1|NM_152487.2	NP_001186608.1|NP_689700.1	Q96MV1	TMM56_HUMAN	transmembrane protein 56	3						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(2)|skin(1)|urinary_tract(1)	12		all_lung(203;0.0232)|Lung NSC(277;0.0739)		all cancers(265;0.133)		ATATGGAGATCAACACAAAAC	0.313																																					p.I3fs		Atlas-INDEL	.											.	TMEM56	24	.	0			c.8delT						.						113.0	114.0	113.0					1																	95609466		2203	4300	6503	SO:0001589	frameshift_variant	148534	exon2			.		CCDS753.1	1p21.3	2008-02-05			ENSG00000152078	ENSG00000152078			26477	protein-coding gene	gene with protein product							Standard	NM_152487		Approved	FLJ31842	uc001drb.3	Q96MV1	OTTHUMG00000010847	ENST00000370203.4:c.9delC	chr1.hg19:g.95609466delC	ENSP00000359222:p.Ile3fs	111.0	0.0		117.0	25.0	NM_001199679	B2RPI2|D3DT48	Frame_Shift_Del	DEL	ENST00000370203.4	hg19	CCDS753.1																																																																																			.	.		0.313	TMEM56-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029935.1	NM_152487	
ACAD10	80724	hgsc.bcm.edu	37	12	112147442	112147443	+	Frame_Shift_Ins	INS	-	-	AACAAATCTAA	rs375834504		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr12:112147442_112147443insAACAAATCTAA	ENST00000313698.4	+	5	799_800	c.644_645insAACAAATCTAA	c.(643-648)ggaacafs	p.-219fs	ACAD10_ENST00000413681.3_3'UTR|ACAD10_ENST00000392636.2_5'UTR|ACAD10_ENST00000549590.1_Frame_Shift_Ins_p.-219fs|ACAD10_ENST00000455480.2_Frame_Shift_Ins_p.-219fs	NM_025247.5	NP_079523.3	Q6JQN1	ACD10_HUMAN	acyl-CoA dehydrogenase family, member 10							mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|hydrolase activity (GO:0016787)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(17)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(5)	47						GATGACCTTGGAACAAATCTAA	0.47																																					p.G215fs		Atlas-INDEL	.											.	ACAD10	93	.	0			c.644_645insAACAAATCTAA						.																																			SO:0001589	frameshift_variant	80724	exon5			.	AY323912	CCDS31903.1, CCDS44973.1	12q24.12	2012-10-02	2010-04-30		ENSG00000111271	ENSG00000111271			21597	protein-coding gene	gene with protein product		611181	"""acyl-Coenzyme A dehydrogenase family, member 10"""			15560374	Standard	NM_025247		Approved	MGC5601	uc009zvx.3	Q6JQN1	OTTHUMG00000169602	ENST00000313698.4:c.645_655dupAACAAATCTAA	chr12.hg19:g.112147443_112147453dupAACAAATCTAA	ENSP00000325137:p.Lys219fs	88.0	0.0		118.0	13.0	NM_001136538	G3XAJ0|Q8N828|Q8NAP2|Q96BX5	Frame_Shift_Ins	INS	ENST00000313698.4	hg19	CCDS31903.1																																																																																			.	.		0.470	ACAD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368307.1	NM_025247	
OR2T6	254879	hgsc.bcm.edu	37	1	248551453	248551453	+	Frame_Shift_Del	DEL	C	C	-	rs548026945		TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:248551453delC	ENST00000355728.2	+	1	544	c.544delC	c.(544-546)cccfs	p.P182fs		NM_001005471.1	NP_001005471.1	Q8NHC8	OR2T6_HUMAN	olfactory receptor, family 2, subfamily T, member 6	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|lung(38)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CTGTGAGGCACCCACCATGCT	0.527																																					p.A181fs		Atlas-INDEL	.											.	OR2T6	101	.	0			c.543delA						.						138.0	115.0	123.0					1																	248551453		2203	4300	6503	SO:0001589	frameshift_variant	254879	exon1			.	AF399481	CCDS31114.1	1q44	2012-08-09		2004-03-10	ENSG00000198104	ENSG00000198104		"""GPCR / Class A : Olfactory receptors"""	15018	protein-coding gene	gene with protein product				OR2T6P, OR2T9			Standard	NM_001005471		Approved	OST703	uc001iei.1	Q8NHC8	OTTHUMG00000040448	ENST00000355728.2:c.544delC	chr1.hg19:g.248551453delC	ENSP00000347965:p.Pro182fs	121.0	0.0		138.0	30.0	NM_001005471	A6NE36	Frame_Shift_Del	DEL	ENST00000355728.2	hg19	CCDS31114.1																																																																																			.	.		0.527	OR2T6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097344.1	NM_001005471	
METTL18	92342	hgsc.bcm.edu	37	1	169761806	169761807	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AACD-01A-11D-A40R-10	TCGA-DD-AACD-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	c59fe787-da95-4adc-aac0-30431d975acb	9f8086f5-832e-4885-8836-e959e0921ea7	g.chr1:169761806_169761807insT	ENST00000310392.4	-	2	1383_1384	c.1030_1031insA	c.(1030-1032)agafs	p.R344fs	METTL18_ENST00000303469.2_Frame_Shift_Ins_p.R344fs|C1orf112_ENST00000413811.2_5'Flank|C1orf112_ENST00000359326.4_5'Flank|C1orf112_ENST00000456684.1_5'Flank|C1orf112_ENST00000498289.1_Intron|C1orf112_ENST00000286031.6_5'Flank	NM_033418.2	NP_219486.1	O95568	MET18_HUMAN	methyltransferase like 18	344						cytoplasm (GO:0005737)	protein methyltransferase activity (GO:0008276)			kidney(1)|large_intestine(3)|lung(4)	8						AAAAACATCTCTTTCTTCTACA	0.327																																					p.R344fs		Atlas-INDEL	.											.	METTL18	23	.	0			c.1031_1032insA						.																																			SO:0001589	frameshift_variant	92342	exon2			.	AL035369	CCDS1284.1	1q24.2	2013-10-11	2011-03-02	2011-03-02	ENSG00000171806	ENSG00000171806			28793	protein-coding gene	gene with protein product	"""histidine protein methyltransferase 1"""	615255	"""chromosome 1 open reading frame 156"""	C1orf156		20864530	Standard	NM_033418		Approved	MGC9084, AsTP2, HPM1	uc001ggn.4	O95568	OTTHUMG00000035813	ENST00000310392.4:c.1031dupA	chr1.hg19:g.169761809_169761809dupT	ENSP00000307975:p.Arg344fs	298.0	0.0		339.0	107.0	NM_033418	B2R9T5	Frame_Shift_Ins	INS	ENST00000310392.4	hg19	CCDS1284.1																																																																																			.	.		0.327	METTL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087109.1	NM_033418	
