#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
COL16A1	1307	hgsc.bcm.edu	37	1	32131184	32131184	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:32131184C>T	ENST00000373672.3	-	55	4008	c.3492G>A	c.(3490-3492)ccG>ccA	p.P1164P	COL16A1_ENST00000271069.6_Splice_Site_p.P1164P	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1164	Triple-helical region 2 (COL2) with 2 imperfections.			P -> T (in Ref. 1; AAA58427). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		CTTCACTCACCGGTGGGCCCG	0.632																																					p.P1164P	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.G3492A						.						82.0	86.0	85.0					1																	32131184		1975	4142	6117	SO:0001630	splice_region_variant	1307	exon55			ACTCACCGGTGGG	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3492+1G>A	chr1.hg19:g.32131184C>T		66.0	0.0		65.0	21.0	NM_001856	Q16593|Q59F89|Q71RG9	Silent	SNP	ENST00000373672.3	hg19	CCDS41297.1																																																																																			.	.		0.632	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	Silent
ERMAP	114625	hgsc.bcm.edu	37	1	43296622	43296622	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:43296622T>A	ENST00000372517.2	+	4	513	c.269T>A	c.(268-270)cTg>cAg	p.L90Q	ERMAP_ENST00000328249.3_5'UTR|ERMAP_ENST00000372514.3_Missense_Mutation_p.L90Q|ERMAP_ENST00000487556.1_Intron	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	90	Ig-like V-type.					cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GATGAAGATCTGATGCCGGAA	0.587																																					p.L90Q		Atlas-SNP	.											.	ERMAP	30	.	0			c.T269A						.						113.0	98.0	103.0					1																	43296622		2203	4300	6503	SO:0001583	missense	114625	exon4			AAGATCTGATGCC	AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.269T>A	chr1.hg19:g.43296622T>A	ENSP00000361595:p.Leu90Gln	166.0	0.0		137.0	74.0	NM_001017922	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Missense_Mutation	SNP	ENST00000372517.2	hg19	CCDS475.1	.	.	.	.	.	.	.	.	.	.	T	10.38	1.335536	0.24253	.	.	ENSG00000164010	ENST00000372517;ENST00000372514	T;T	0.64803	-0.12;-0.12	4.83	-1.73	0.08081	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.598870	0.04053	N	0.305068	T	0.24236	0.0587	N	0.00405	-1.535	0.09310	N	0.999991	B;B	0.23249	0.082;0.003	B;B	0.23275	0.045;0.008	T	0.18147	-1.0346	10	0.13108	T	0.6	.	5.0935	0.14721	0.604:0.0974:0.0:0.2986	.	151;90	B7Z3C6;Q96PL5	.;ERMAP_HUMAN	Q	90	ENSP00000361595:L90Q;ENSP00000361592:L90Q	ENSP00000361592:L90Q	L	+	2	0	ERMAP	43069209	0.207000	0.23482	0.000000	0.03702	0.581000	0.36288	0.265000	0.18515	-0.072000	0.12864	0.377000	0.23210	CTG	.	.		0.587	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000020180.1	NM_018538	
NRAS	4893	hgsc.bcm.edu	37	1	115256600	115256600	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:115256600C>T	ENST00000369535.4	-	3	365		c.e3-1			NM_002524.4	NP_002515.1	P01111	RASN_HUMAN	neuroblastoma RAS viral (v-ras) oncogene homolog						actin cytoskeleton organization (GO:0030036)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|GTP catabolic process (GO:0006184)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|leukocyte migration (GO:0050900)|MAPK cascade (GO:0000165)|negative regulation of cell differentiation (GO:0045596)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of skeletal muscle tissue development (GO:0048642)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Rac protein signal transduction (GO:0035022)|Ras protein signal transduction (GO:0007265)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of synaptic transmission, GABAergic (GO:0032228)|small GTPase mediated signal transduction (GO:0007264)|striated muscle cell differentiation (GO:0051146)|visual learning (GO:0008542)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|protein complex binding (GO:0032403)			NS(134)|adrenal_gland(9)|autonomic_ganglia(9)|biliary_tract(6)|bone(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(11)|eye(3)|haematopoietic_and_lymphoid_tissue(1115)|kidney(3)|large_intestine(105)|liver(10)|lung(42)|meninges(2)|ovary(7)|pancreas(5)|prostate(8)|skin(1144)|soft_tissue(37)|stomach(5)|testis(8)|thyroid(359)|upper_aerodigestive_tract(28)|urinary_tract(13)	3085	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TGTAAGAATCCTGGGGGTGTG	0.438		50	Mis		"""melanoma, MM, AML, thyroid"""				Noonan syndrome	TSP Lung(23;0.16)|Multiple Myeloma(1;<1E-6)																											.		Atlas-SNP	.		Dom	yes		1	1p13.2	4893	neuroblastoma RAS viral (v-ras) oncogene homolog		"""L, E"""	.	NRAS	3766	.	0			c.112-1G>A						.						93.0	95.0	95.0					1																	115256600		2203	4300	6503	SO:0001630	splice_region_variant	4893	exon4	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	AGAATCCTGGGGG	BC005219	CCDS877.1	1p13.2	2014-09-17			ENSG00000213281	ENSG00000213281			7989	protein-coding gene	gene with protein product		164790					Standard	NM_002524		Approved	N-ras	uc009wgu.3	P01111	OTTHUMG00000012059	ENST00000369535.4:c.112-1G>A	chr1.hg19:g.115256600C>T		63.0	0.0		60.0	38.0	NM_002524	Q14971|Q15104|Q15282	Splice_Site	SNP	ENST00000369535.4	hg19	CCDS877.1	.	.	.	.	.	.	.	.	.	.	C	17.92	3.507519	0.64410	.	.	ENSG00000213281	ENST00000369535	.	.	.	3.72	3.72	0.42706	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7925	0.85593	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRAS	115058123	1.000000	0.71417	1.000000	0.80357	0.810000	0.45777	7.547000	0.82146	2.378000	0.81104	0.655000	0.94253	.	.	.		0.438	NRAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033395.2	NM_002524	Intron
NBPF10	100132406	hgsc.bcm.edu	37	1	145367777	145367777	+	Missense_Mutation	SNP	G	G	T	rs200743139		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:145367777G>T	ENST00000342960.5	+	83	10408	c.10373G>T	c.(10372-10374)aGg>aTg	p.R3458M	NBPF10_ENST00000369338.1_Intron|NBPF10_ENST00000369339.3_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	755						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		gaaagaagaaggggaagaaaa	0.428																																					p.R3458M		Atlas-SNP	.											NBPF10,NS,carcinoma,0,1	NBPF10	221	.	0			c.G10373T						.																																			SO:0001583	missense	100132406	exon83			GAAGAAGGGGAAG	BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.10373G>T	chr1.hg19:g.145367777G>T	ENSP00000345684:p.Arg3458Met	3.0	0.0		7.0	5.0	NM_001039703	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	ENST00000342960.5	hg19	CCDS53355.1	.	.	.	.	.	.	.	.	.	.	.	10.39	1.335798	0.24253	.	.	ENSG00000163386	ENST00000369339;ENST00000342960	T	0.05258	3.47	.	.	.	.	.	.	.	.	T	0.03651	0.0104	L	0.51422	1.61	0.09310	N	1	.	.	.	.	.	.	T	0.38351	-0.9665	4	0.87932	D	0	.	.	.	.	.	.	.	.	M	578;3458	ENSP00000345684:R3458M	ENSP00000345684:R3458M	R	+	2	0	NBPF10	144079134	.	.	.	.	.	.	.	.	.	.	.	.	AGG	.	.		0.428	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_001039703	
TCHHL1	126637	hgsc.bcm.edu	37	1	152057498	152057498	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:152057498T>C	ENST00000368806.1	-	3	2724	c.2660A>G	c.(2659-2661)cAc>cGc	p.H887R		NM_001008536.1	NP_001008536.1	Q5QJ38	TCHL1_HUMAN	trichohyalin-like 1	887							calcium ion binding (GO:0005509)			breast(4)|endometrium(1)|kidney(2)|large_intestine(9)|lung(33)|ovary(2)|prostate(1)|skin(7)|stomach(1)	60	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.246)			TCTCTGAGGGTGACCTTGCTT	0.507																																					p.H887R		Atlas-SNP	.											.	TCHHL1	132	.	0			c.A2660G						.						161.0	156.0	157.0					1																	152057498		2203	4300	6503	SO:0001583	missense	126637	exon3			TGAGGGTGACCTT		CCDS30857.1	1q21.3	2011-10-11	2004-10-05	2006-01-27	ENSG00000182898	ENSG00000182898		"""S100 calcium binding proteins"""	31796	protein-coding gene	gene with protein product			"""S100 calcium binding protein A17"""	S100A17, THHL1			Standard	NM_001008536		Approved		uc001ezo.1	Q5QJ38	OTTHUMG00000013058	ENST00000368806.1:c.2660A>G	chr1.hg19:g.152057498T>C	ENSP00000357796:p.His887Arg	104.0	0.0		209.0	71.0	NM_001008536	B2RPK8|Q5VTJ9	Missense_Mutation	SNP	ENST00000368806.1	hg19	CCDS30857.1	.	.	.	.	.	.	.	.	.	.	.	0.012	-1.676200	0.00751	.	.	ENSG00000182898	ENST00000368806	T	0.23552	1.9	3.7	-3.25	0.05079	.	0.711616	0.11587	N	0.549165	T	0.02649	0.0080	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45454	-0.9260	10	0.02654	T	1	1.678	9.2382	0.37479	0.0:0.5568:0.0:0.4432	.	887	Q5QJ38	TCHL1_HUMAN	R	887	ENSP00000357796:H887R	ENSP00000357796:H887R	H	-	2	0	TCHHL1	150324122	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.679000	0.05203	-0.836000	0.04229	0.482000	0.46254	CAC	.	.		0.507	TCHHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000036638.2	XM_060104	
SLC27A3	11000	hgsc.bcm.edu	37	1	153745721	153745721	+	5'Flank	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:153745721C>T	ENST00000368661.3	+	0	0				INTS3_ENST00000512605.1_Missense_Mutation_p.S895F|INTS3_ENST00000318967.2_Missense_Mutation_p.S1035F|INTS3_ENST00000456435.1_Missense_Mutation_p.S895F|INTS3_ENST00000476843.1_3'UTR|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000435409.2_Missense_Mutation_p.S1035F	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			AAAGGGTCCTCTGCAGTGGGC	0.562																																					p.S1035F		Atlas-SNP	.											.	INTS3	83	.	0			c.C3104T						.						175.0	177.0	177.0					1																	153745721		2203	4300	6503	SO:0001631	upstream_gene_variant	65123	exon30			GGTCCTCTGCAGT	BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		chr1.hg19:g.153745721C>T	Exception_encountered	93.0	0.0		189.0	146.0	NM_023015	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	ENST00000368661.3	hg19	CCDS1053.1	.	.	.	.	.	.	.	.	.	.	C	18.43	3.623310	0.66901	.	.	ENSG00000143624	ENST00000318967;ENST00000456435;ENST00000435409;ENST00000512605	.	.	.	4.92	4.92	0.64577	.	0.000000	0.85682	D	0.000000	T	0.44159	0.1280	L	0.34521	1.04	0.29630	N	0.845506	D;D;D	0.64830	0.994;0.99;0.994	D;D;D	0.74348	0.983;0.962;0.983	T	0.28522	-1.0041	9	0.36615	T	0.2	.	13.5491	0.61721	0.0:1.0:0.0:0.0	.	895;1036;1035	Q68E01-3;Q68E01;Q68E01-2	.;INT3_HUMAN;.	F	1035;895;1035;895	.	ENSP00000318641:S1035F	S	+	2	0	INTS3	152012345	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	6.020000	0.70826	2.569000	0.86673	0.485000	0.47835	TCT	.	.		0.562	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_024330	
F5	2153	hgsc.bcm.edu	37	1	169555596	169555596	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:169555596A>C	ENST00000367797.3	-	1	230	c.29T>G	c.(28-30)gTc>gGc	p.V10G	F5_ENST00000546081.1_5'UTR|F5_ENST00000367796.3_Missense_Mutation_p.V10G	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	10					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	GACCACCAGGACCCAGAGGCG	0.647																																					p.V10G		Atlas-SNP	.											.	F5	301	.	0			c.T29G						.						54.0	43.0	47.0					1																	169555596		2203	4300	6503	SO:0001583	missense	2153	exon1			ACCAGGACCCAGA	M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.29T>G	chr1.hg19:g.169555596A>C	ENSP00000356771:p.Val10Gly	50.0	0.0		86.0	57.0	NM_000130	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	ENST00000367797.3	hg19	CCDS1281.1	.	.	.	.	.	.	.	.	.	.	A	16.46	3.130688	0.56828	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98567	-5.0;-5.0	5.41	3.08	0.35506	.	1.061280	0.07373	N	0.886136	D	0.93789	0.8014	L	0.29908	0.895	0.80722	D	1	P	0.49635	0.926	P	0.44597	0.454	D	0.88066	0.2797	10	0.87932	D	0	-4.3159	7.0736	0.25191	0.8193:0.0:0.1807:0.0	.	10	P12259	FA5_HUMAN	G	10	ENSP00000356771:V10G;ENSP00000356770:V10G	ENSP00000356770:V10G	V	-	2	0	F5	167822220	1.000000	0.71417	0.999000	0.59377	0.600000	0.36913	2.849000	0.48286	0.352000	0.24053	-0.290000	0.09829	GTC	.	.		0.647	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000083712.1	NM_000130	
SMG7	9887	hgsc.bcm.edu	37	1	183510238	183510238	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:183510238G>A	ENST00000347615.2	+	13	1534	c.1415G>A	c.(1414-1416)aGg>aAg	p.R472K	SMG7_ENST00000456731.2_Splice_Site_p.R430K|SMG7_ENST00000508461.1_Splice_Site_p.R430K|SMG7_ENST00000367537.3_Splice_Site_p.R501K|SMG7_ENST00000507469.1_Splice_Site_p.R472K|SMG7_ENST00000515829.2_Splice_Site_p.R472K	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	472					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						AATCAGCCAAGGTAAGTCTGG	0.478																																					p.R472K		Atlas-SNP	.											.	SMG7	165	.	0			c.G1415A						.						182.0	173.0	176.0					1																	183510238		2203	4300	6503	SO:0001630	splice_region_variant	9887	exon13			AGCCAAGGTAAGT	D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1415+1G>A	chr1.hg19:g.183510238G>A		343.0	0.0		518.0	75.0	NM_201569	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	ENST00000347615.2	hg19	CCDS1355.1	.	.	.	.	.	.	.	.	.	.	G	14.34	2.505476	0.44558	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.57	5.57	0.84162	.	0.050293	0.85682	D	0.000000	T	0.10252	0.0251	N	0.14661	0.345	0.53688	D	0.999979	B;B;B;B;B;B	0.28801	0.091;0.042;0.042;0.07;0.146;0.223	B;B;B;B;B;B	0.21151	0.015;0.015;0.015;0.033;0.024;0.026	T	0.07501	-1.0769	10	0.05351	T	0.99	-8.9689	12.8444	0.57821	0.0743:0.0:0.9257:0.0	.	430;501;430;472;472;472	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	K	430;501;430;430;472;472;472	ENSP00000407629:R430K;ENSP00000356507:R501K;ENSP00000426915:R430K;ENSP00000388390:R430K;ENSP00000340766:R472K;ENSP00000425133:R472K;ENSP00000421358:R472K	ENSP00000340766:R472K	R	+	2	0	SMG7	181776861	1.000000	0.71417	1.000000	0.80357	0.860000	0.49131	6.978000	0.76147	2.619000	0.88677	0.650000	0.86243	AGG	.	.		0.478	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000085432.1	NM_014837	Missense_Mutation
INTS7	25896	hgsc.bcm.edu	37	1	212118308	212118308	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:212118308C>G	ENST00000366994.3	-	19	2523	c.2419G>C	c.(2419-2421)Gct>Cct	p.A807P	INTS7_ENST00000366992.3_Missense_Mutation_p.A787P|INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366993.3_Missense_Mutation_p.A793P|INTS7_ENST00000440600.2_Missense_Mutation_p.A758P	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	807					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		GGTGACAGAGCAAGCTGGAAT	0.488																																					p.A807P		Atlas-SNP	.											.	INTS7	68	.	0			c.G2419C						.						60.0	58.0	58.0					1																	212118308		2203	4300	6503	SO:0001583	missense	25896	exon19			ACAGAGCAAGCTG	AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.2419G>C	chr1.hg19:g.212118308C>G	ENSP00000355961:p.Ala807Pro	69.0	0.0		123.0	5.0	NM_015434	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	ENST00000366994.3	hg19	CCDS1501.1	.	.	.	.	.	.	.	.	.	.	C	29.6	5.024062	0.93462	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.53640	0.7;0.68;0.61;0.69	5.64	5.64	0.86602	.	0.096924	0.64402	D	0.000001	T	0.69124	0.3076	M	0.65498	2.005	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.85130	0.996;0.991;0.996;0.997	T	0.68633	-0.5357	10	0.52906	T	0.07	-18.8202	19.7094	0.96085	0.0:1.0:0.0:0.0	.	758;787;793;807	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	P	807;793;787;758	ENSP00000355961:A807P;ENSP00000355960:A793P;ENSP00000355959:A787P;ENSP00000388908:A758P	ENSP00000355959:A787P	A	-	1	0	INTS7	210184931	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.591000	0.67536	2.662000	0.90505	0.655000	0.94253	GCT	.	.		0.488	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090142.1	NM_015434	
AGT	183	hgsc.bcm.edu	37	1	230838957	230838957	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:230838957G>A	ENST00000366667.4	-	5	1602	c.1388C>T	c.(1387-1389)gCt>gTt	p.A463V		NM_000029.3	NP_000020.1	P01019	ANGT_HUMAN	angiotensinogen (serpin peptidase inhibitor, clade A, member 8)	463					activation of NF-kappaB-inducing kinase activity (GO:0007250)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|angiotensin maturation (GO:0002003)|angiotensin mediated vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001998)|angiotensin-mediated drinking behavior (GO:0003051)|artery smooth muscle contraction (GO:0014824)|astrocyte activation (GO:0048143)|blood vessel development (GO:0001568)|blood vessel remodeling (GO:0001974)|branching involved in ureteric bud morphogenesis (GO:0001658)|catenin import into nucleus (GO:0035411)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|cellular lipid metabolic process (GO:0044255)|cellular protein metabolic process (GO:0044267)|cellular response to mechanical stimulus (GO:0071260)|cellular sodium ion homeostasis (GO:0006883)|cytokine secretion (GO:0050663)|ERK1 and ERK2 cascade (GO:0070371)|establishment of blood-nerve barrier (GO:0008065)|excretion (GO:0007588)|extracellular matrix organization (GO:0030198)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neurotrophin TRK receptor signaling pathway (GO:0051387)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of tissue remodeling (GO:0034104)|nitric oxide mediated signal transduction (GO:0007263)|ovarian follicle rupture (GO:0001543)|peristalsis (GO:0030432)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of activation of JAK2 kinase activity (GO:0010535)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytokine production (GO:0001819)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of epidermal growth factor receptor signaling pathway (GO:0045742)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of organ growth (GO:0046622)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of superoxide anion generation (GO:0032930)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of calcium ion transport (GO:0051924)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of norepinephrine secretion (GO:0014061)|regulation of proteolysis (GO:0030162)|regulation of renal output by angiotensin (GO:0002019)|regulation of renal sodium excretion (GO:0035813)|regulation of vasoconstriction (GO:0019229)|renal response to blood flow involved in circulatory renin-angiotensin regulation of systemic arterial blood pressure (GO:0001999)|renal system process (GO:0003014)|renin-angiotensin regulation of aldosterone production (GO:0002018)|response to cold (GO:0009409)|response to muscle activity involved in regulation of muscle adaptation (GO:0014873)|response to salt stress (GO:0009651)|small molecule metabolic process (GO:0044281)|smooth muscle cell differentiation (GO:0051145)|smooth muscle cell proliferation (GO:0048659)|stress-activated MAPK cascade (GO:0051403)|uterine smooth muscle contraction (GO:0070471)|vasodilation (GO:0042311)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	growth factor activity (GO:0008083)|hormone activity (GO:0005179)|serine-type endopeptidase inhibitor activity (GO:0004867)|superoxide-generating NADPH oxidase activator activity (GO:0016176)|type 1 angiotensin receptor binding (GO:0031702)|type 2 angiotensin receptor binding (GO:0031703)			endometrium(5)|kidney(1)|large_intestine(6)|lung(7)|pancreas(1)|prostate(5)	25	Breast(184;0.0735)|Ovarian(103;0.183)	all_cancers(173;4.64e-23)|all_epithelial(177;3.61e-18)|Breast(1374;0.00093)|all_neural(198;0.0604)|Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;4.4e-06)|Colorectal(1306;5.46e-06)|COAD - Colon adenocarcinoma(196;0.000256)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		ATCATACACAGCAAACAGGAA	0.587																																					p.A463V		Atlas-SNP	.											.	AGT	62	.	0			c.C1388T						.						149.0	133.0	138.0					1																	230838957		2203	4300	6503	SO:0001583	missense	183	exon5			TACACAGCAAACA	K02215	CCDS1585.1	1q42.2	2014-02-18	2005-08-18	2001-06-29	ENSG00000135744	ENSG00000135744		"""Serine (or cysteine) peptidase inhibitors"", ""Endogenous ligands"""	333	protein-coding gene	gene with protein product	"""alpha-1 antiproteinase, antitrypsin"""	106150		SERPINA8		6089875, 24172014	Standard	NM_000029		Approved		uc001hty.4	P01019	OTTHUMG00000037757	ENST00000366667.4:c.1388C>T	chr1.hg19:g.230838957G>A	ENSP00000355627:p.Ala463Val	153.0	0.0		264.0	105.0	NM_000029	Q16358|Q16359|Q96F91	Missense_Mutation	SNP	ENST00000366667.4	hg19	CCDS1585.1	.	.	.	.	.	.	.	.	.	.	G	13.87	2.367362	0.41902	.	.	ENSG00000135744	ENST00000366667;ENST00000430091	D	0.83419	-1.72	5.45	2.36	0.29203	Serpin domain (3);Protease inhibitor I4, serpin, conserved site (1);	0.353208	0.31636	N	0.007313	T	0.69851	0.3157	L	0.52011	1.625	0.09310	N	0.999998	P;P	0.49635	0.926;0.926	B;B	0.37833	0.259;0.259	T	0.62835	-0.6770	10	0.07325	T	0.83	.	8.0777	0.30726	0.2826:0.0:0.7174:0.0	.	463;463	B0ZBE2;P01019	.;ANGT_HUMAN	V	463;381	ENSP00000355627:A463V	ENSP00000355627:A463V	A	-	2	0	AGT	228905580	0.324000	0.24652	0.057000	0.19452	0.283000	0.27025	2.899000	0.48679	0.615000	0.30124	0.655000	0.94253	GCT	.	.		0.587	AGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000092102.1	NM_000029	
EDARADD	128178	hgsc.bcm.edu	37	1	236590697	236590697	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr1:236590697G>C	ENST00000334232.4	+	4	333	c.166G>C	c.(166-168)Gaa>Caa	p.E56Q	EDARADD_ENST00000359362.5_Missense_Mutation_p.E46Q	NM_145861.2	NP_665860.2	Q8WWZ3	EDAD_HUMAN	EDAR-associated death domain	56					cell differentiation (GO:0030154)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	cytoplasm (GO:0005737)				endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|stomach(1)	12	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.0232)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			cCTAGCTGAAGAATGTGATAC	0.318																																					p.E56Q		Atlas-SNP	.											.	EDARADD	31	.	0			c.G166C						.						30.0	32.0	31.0					1																	236590697		2199	4294	6493	SO:0001583	missense	128178	exon4			GCTGAAGAATGTG	AY028914	CCDS1610.1, CCDS31065.1	1q42.3	2013-05-22			ENSG00000186197	ENSG00000186197			14341	protein-coding gene	gene with protein product		606603				11780064	Standard	NM_145861		Approved		uc001hxu.1	Q8WWZ3	OTTHUMG00000039954	ENST00000334232.4:c.166G>C	chr1.hg19:g.236590697G>C	ENSP00000335076:p.Glu56Gln	263.0	0.0		417.0	65.0	NM_145861	A2VCK5|A8K7B5|B1AL54|B9ZVW5|Q5VYJ7	Missense_Mutation	SNP	ENST00000334232.4	hg19	CCDS1610.1	.	.	.	.	.	.	.	.	.	.	G	11.23	1.577957	0.28180	.	.	ENSG00000186197	ENST00000439430;ENST00000334232;ENST00000359362	T;T;D	0.81821	0.63;-0.98;-1.54	4.08	4.08	0.47627	.	0.239067	0.25391	U	0.031005	T	0.75810	0.3900	L	0.45228	1.405	0.28815	N	0.898019	P;B	0.34522	0.455;0.247	B;B	0.39771	0.309;0.214	T	0.71659	-0.4526	10	0.40728	T	0.16	.	12.0785	0.53657	0.0:0.0:1.0:0.0	.	46;56	A8K7B5;Q8WWZ3	.;EDAD_HUMAN	Q	34;56;46	ENSP00000405815:E34Q;ENSP00000335076:E56Q;ENSP00000352320:E46Q	ENSP00000335076:E56Q	E	+	1	0	EDARADD	234657320	0.814000	0.29104	0.515000	0.27774	0.073000	0.16967	3.731000	0.55013	2.542000	0.85734	0.655000	0.94253	GAA	.	.		0.318	EDARADD-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000096368.1	NM_145861	
ODC1	4953	hgsc.bcm.edu	37	2	10580969	10580969	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:10580969G>A	ENST00000234111.4	-	12	1777	c.1267C>T	c.(1267-1269)Ccc>Tcc	p.P423S	ODC1_ENST00000405333.1_Missense_Mutation_p.P423S	NM_002539.1	NP_002530.1	P11926	DCOR_HUMAN	ornithine decarboxylase 1	423					cellular nitrogen compound metabolic process (GO:0034641)|kidney development (GO:0001822)|polyamine metabolic process (GO:0006595)|positive regulation of cell proliferation (GO:0008284)|putrescine biosynthetic process from ornithine (GO:0033387)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|response to virus (GO:0009615)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ornithine decarboxylase activity (GO:0004586)|protein homodimerization activity (GO:0042803)			NS(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|ovary(1)|prostate(1)|skin(3)	19	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.11)|OV - Ovarian serous cystadenocarcinoma(76;0.161)	Spermine(DB00127)	GGGAAGTCGGGGTTCTGGAAT	0.512																																					p.P423S		Atlas-SNP	.											.	ODC1	40	.	0			c.C1267T						.						93.0	92.0	92.0					2																	10580969		2203	4300	6503	SO:0001583	missense	4953	exon12			AGTCGGGGTTCTG		CCDS1672.1	2p25	2012-10-02			ENSG00000115758	ENSG00000115758	4.1.1.17		8109	protein-coding gene	gene with protein product		165640					Standard	NM_002539		Approved	ODC	uc002rao.1	P11926	OTTHUMG00000090450	ENST00000234111.4:c.1267C>T	chr2.hg19:g.10580969G>A	ENSP00000234111:p.Pro423Ser	129.0	0.0		82.0	39.0	NM_002539	Q53TU3|Q6LDS9	Missense_Mutation	SNP	ENST00000234111.4	hg19	CCDS1672.1	.	.	.	.	.	.	.	.	.	.	G	10.76	1.441013	0.25900	.	.	ENSG00000115758	ENST00000234111;ENST00000405333;ENST00000537630	T;T	0.39787	1.06;1.06	5.82	4.92	0.64577	.	0.542887	0.22838	N	0.055011	T	0.28797	0.0714	N	0.22421	0.69	0.23855	N	0.996658	B	0.02656	0.0	B	0.01281	0.0	T	0.11717	-1.0576	10	0.08599	T	0.76	.	16.085	0.81038	0.0:0.0:0.8649:0.1351	.	423	P11926	DCOR_HUMAN	S	423;423;294	ENSP00000234111:P423S;ENSP00000385333:P423S	ENSP00000234111:P423S	P	-	1	0	ODC1	10498420	0.967000	0.33354	0.078000	0.20375	0.711000	0.40976	4.756000	0.62205	1.423000	0.47198	0.591000	0.81541	CCC	.	.		0.512	ODC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206896.2		
BIRC6	57448	hgsc.bcm.edu	37	2	32774378	32774378	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:32774378A>G	ENST00000421745.2	+	65	13109		c.e65-1			NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6						apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					AACAATTTTTAGGTTCTTGCC	0.348																																					.	Pancreas(94;175 1509 16028 18060 45422)	Atlas-SNP	.											.	BIRC6	838	.	0			c.12976-2A>G						.						95.0	92.0	93.0					2																	32774378		2203	4300	6503	SO:0001630	splice_region_variant	57448	exon65			ATTTTTAGGTTCT	AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.12976-1A>G	chr2.hg19:g.32774378A>G		413.0	0.0		269.0	105.0	NM_016252	Q9ULD1	Splice_Site	SNP	ENST00000421745.2	hg19	CCDS33175.2	.	.	.	.	.	.	.	.	.	.	A	19.69	3.874485	0.72180	.	.	ENSG00000115760	ENST00000421745	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9227	0.79589	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BIRC6	32627882	1.000000	0.71417	0.922000	0.36590	0.689000	0.40095	9.264000	0.95635	2.157000	0.67596	0.528000	0.53228	.	.	.		0.348	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318769.3	NM_016252	Intron
ALMS1	7840	hgsc.bcm.edu	37	2	73613065	73613065	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:73613065G>A	ENST00000264448.6	+	1	180	c.69G>A	c.(67-69)gaG>gaA	p.E23E	ALMS1_ENST00000409009.1_Silent_p.E23E|ALMS1_ENST00000377715.1_Silent_p.E23E	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	23	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						aggaggaggaggaggaagagg	0.687																																					p.E23E		Atlas-SNP	.											.	ALMS1	384	.	0			c.G69A						.						6.0	9.0	8.0					2																	73613065		1849	3831	5680	SO:0001819	synonymous_variant	7840	exon1			GGAGGAGGAGGAA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.69G>A	chr2.hg19:g.73613065G>A		551.0	0.0		444.0	30.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.687	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
HK2	3099	hgsc.bcm.edu	37	2	75113492	75113492	+	Silent	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:75113492C>T	ENST00000290573.2	+	14	2607	c.2007C>T	c.(2005-2007)gaC>gaT	p.D669D	HK2_ENST00000409174.1_Silent_p.D641D	NM_000189.4	NP_000180.2	P52789	HXK2_HUMAN	hexokinase 2	669	Catalytic.|Hexokinase type-1 2.				apoptotic mitochondrial changes (GO:0008637)|carbohydrate metabolic process (GO:0005975)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose transport (GO:0008645)|lactation (GO:0007595)|regulation of glucose import (GO:0046324)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|glucose binding (GO:0005536)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	43						GCTTTGAAGACCCTCACTGTG	0.537																																					p.D669D		Atlas-SNP	.											.	HK2	85	.	0			c.C2007T						.						229.0	186.0	201.0					2																	75113492		2203	4300	6503	SO:0001819	synonymous_variant	3099	exon14			TGAAGACCCTCAC		CCDS1956.1	2p13	2010-03-19			ENSG00000159399	ENSG00000159399	2.7.1.1		4923	protein-coding gene	gene with protein product		601125					Standard	NM_000189		Approved		uc002snd.3	P52789	OTTHUMG00000129972	ENST00000290573.2:c.2007C>T	chr2.hg19:g.75113492C>T		102.0	0.0		71.0	25.0	NM_000189	D6W5J2|Q8WU87|Q9UN82	Silent	SNP	ENST00000290573.2	hg19	CCDS1956.1																																																																																			.	.		0.537	HK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252238.2	NM_000189	
KIF5C	3800	hgsc.bcm.edu	37	2	149803415	149803415	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:149803415A>G	ENST00000435030.1	+	8	960	c.592A>G	c.(592-594)Atg>Gtg	p.M198V	KIF5C_ENST00000397413.1_5'Flank|KIF5C_ENST00000414838.2_Missense_Mutation_p.M103V			O60282	KIF5C_HUMAN	kinesin family member 5C	198	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.|Microtubule-binding.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mRNA transport (GO:0051028)|organelle organization (GO:0006996)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(13)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(221;0.108)		CTTTTCAGACATGAATGAACA	0.338																																					p.M198V		Atlas-SNP	.											.	KIF5C	166	.	0			c.A592G						.						90.0	82.0	85.0					2																	149803415		1841	4106	5947	SO:0001583	missense	3800	exon8			TCAGACATGAATG	AB011103	CCDS74586.1	2q23	2008-02-05			ENSG00000168280	ENSG00000168280		"""Kinesins"""	6325	protein-coding gene	gene with protein product		604593				7514426	Standard	NM_004522		Approved		uc010zbu.2	O60282	OTTHUMG00000153779	ENST00000435030.1:c.592A>G	chr2.hg19:g.149803415A>G	ENSP00000393379:p.Met198Val	202.0	0.0		152.0	64.0	NM_004522	O95079|Q2YDC5	Missense_Mutation	SNP	ENST00000435030.1	hg19		.	.	.	.	.	.	.	.	.	.	A	24.1	4.491804	0.84962	.	.	ENSG00000168280	ENST00000435030;ENST00000414838;ENST00000334436	T;T	0.74947	-0.89;-0.89	5.64	5.64	0.86602	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	T	0.81583	0.4853	.	.	.	0.80722	D	1	P	0.49185	0.92	P	0.52343	0.696	D	0.84016	0.0351	9	0.87932	D	0	.	16.0238	0.80522	1.0:0.0:0.0:0.0	.	198	O60282	KIF5C_HUMAN	V	198;103;101	ENSP00000393379:M198V;ENSP00000410115:M103V	ENSP00000334176:M101V	M	+	1	0	KIF5C	149511661	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.139000	0.94554	2.367000	0.80283	0.528000	0.53228	ATG	.	.		0.338	KIF5C-001	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000332562.3	NM_004522	
TTN	7273	hgsc.bcm.edu	37	2	179500897	179500897	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:179500897T>A	ENST00000591111.1	-	176	36702	c.36478A>T	c.(36478-36480)Agc>Tgc	p.S12160C	TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S4861C|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S4736C|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.S4928C|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.S11233C|TTN_ENST00000589042.1_Missense_Mutation_p.S13801C|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12160	Ig-like 81.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AACTCGCAGCTCAAGTACAAT	0.453																																					p.S13801C		Atlas-SNP	.											.	TTN	18412	.	0			c.A41401T						.						61.0	58.0	59.0					2																	179500897		2008	4172	6180	SO:0001583	missense	7273	exon226			CGCAGCTCAAGTA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36478A>T	chr2.hg19:g.179500897T>A	ENSP00000465570:p.Ser12160Cys	108.0	0.0		73.0	29.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.69	2.909197	0.52439	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.05199	3.48;3.48;3.48;3.48	5.8	5.8	0.92144	Immunoglobulin subtype (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.13415	0.0325	L	0.41492	1.28	0.41298	D	0.987024	D;D;D;D	0.61697	0.99;0.99;0.99;0.978	P;P;P;P	0.53722	0.733;0.733;0.733;0.733	T	0.00485	-1.1711	9	0.87932	D	0	.	16.1445	0.81555	0.0:0.0:0.0:1.0	.	4736;4861;4928;12160	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	C	11233;4736;4928;4861;4736	ENSP00000343764:S11233C;ENSP00000434586:S4736C;ENSP00000340554:S4928C;ENSP00000352154:S4861C	ENSP00000340554:S4928C	S	-	1	0	TTN	179209142	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.175000	0.71949	2.223000	0.72356	0.477000	0.44152	AGC	.	.		0.453	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZDBF2	57683	hgsc.bcm.edu	37	2	207174808	207174808	+	Silent	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:207174808A>G	ENST00000374423.3	+	5	5942	c.5556A>G	c.(5554-5556)gaA>gaG	p.E1852E		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	1852							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						AGTTTAGGGAAGGTCGTTTCC	0.423																																					p.E1852E		Atlas-SNP	.											.	ZDBF2	531	.	0			c.A5556G						.						79.0	75.0	76.0					2																	207174808		1874	4109	5983	SO:0001819	synonymous_variant	57683	exon5			TAGGGAAGGTCGT	AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.5556A>G	chr2.hg19:g.207174808A>G		164.0	0.0		107.0	43.0	NM_020923	Q6ZNP7|Q6ZSN8	Silent	SNP	ENST00000374423.3	hg19	CCDS46501.1																																																																																			.	.		0.423	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000336458.1	NM_020923	
COL4A3	1285	hgsc.bcm.edu	37	2	228141109	228141109	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr2:228141109G>T	ENST00000396578.3	+	27	2098	c.1936G>T	c.(1936-1938)Gga>Tga	p.G646*	AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000433324.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	646	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		AGGCCCTAGGGGAGAGCTCAG	0.498																																					p.G646X		Atlas-SNP	.											.	COL4A3	293	.	0			c.G1936T						.						68.0	70.0	69.0					2																	228141109		1889	4105	5994	SO:0001587	stop_gained	1285	exon27			CCTAGGGGAGAGC		CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.1936G>T	chr2.hg19:g.228141109G>T	ENSP00000379823:p.Gly646*	105.0	0.0		81.0	28.0	NM_000091	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Nonsense_Mutation	SNP	ENST00000396578.3	hg19	CCDS42829.1	.	.	.	.	.	.	.	.	.	.	G	40	7.940454	0.98571	.	.	ENSG00000169031	ENST00000396578;ENST00000328380;ENST00000335583;ENST00000396574;ENST00000315699	.	.	.	5.33	5.33	0.75918	.	0.000000	0.56097	D	0.000025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	14.8911	0.70609	0.0:0.0:1.0:0.0	.	.	.	.	X	646	.	ENSP00000323334:G646X	G	+	1	0	COL4A3	227849353	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	5.456000	0.66665	2.650000	0.89964	0.655000	0.94253	GGA	.	.		0.498	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331409.2	NM_000091	
CELSR3	1951	hgsc.bcm.edu	37	3	48698559	48698559	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr3:48698559G>A	ENST00000164024.4	-	1	1789	c.1509C>T	c.(1507-1509)cgC>cgT	p.R503R	CELSR3_ENST00000544264.1_Silent_p.R503R|RP11-148G20.1_ENST00000421275.1_RNA	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	503	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCATGTGCTCGCGGTCCACTC	0.677																																					p.R503R		Atlas-SNP	.											.	CELSR3	237	.	0			c.C1509T						.						24.0	21.0	22.0					3																	48698559		2201	4298	6499	SO:0001819	synonymous_variant	1951	exon1			GTGCTCGCGGTCC	AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.1509C>T	chr3.hg19:g.48698559G>A		129.0	0.0		131.0	33.0	NM_001407	O75092	Silent	SNP	ENST00000164024.4	hg19	CCDS2775.1																																																																																			.	.		0.677	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257523.1	NM_001407	
ITIH3	3699	hgsc.bcm.edu	37	3	52834993	52834993	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr3:52834993C>A	ENST00000449956.2	+	11	1220	c.1214C>A	c.(1213-1215)cCc>cAc	p.P405H	ITIH3_ENST00000416872.2_Missense_Mutation_p.P405H|ITIH3_ENST00000465243.2_3'UTR	NM_002217.3	NP_002208.3	Q06033	ITIH3_HUMAN	inter-alpha-trypsin inhibitor heavy chain 3	405	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(6)|ovary(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	25				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		GAGAGCAGACCCGAAAAAATC	0.542																																					p.P405H		Atlas-SNP	.											.	ITIH3	132	.	0			c.C1214A						.						127.0	129.0	128.0					3																	52834993		1952	4147	6099	SO:0001583	missense	3699	exon11			GCAGACCCGAAAA		CCDS46845.1	3p21.1	2011-10-26	2011-10-26		ENSG00000162267	ENSG00000162267			6168	protein-coding gene	gene with protein product	"""pre-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha-trypsin inhibitor heavy chain H3"""	146650	"""inter-alpha (globulin) inhibitor, H3 polypeptide"", ""inter-alpha (globulin) inhibitor H3"""			2465147, 10100603	Standard	NM_002217		Approved	H3P	uc003dfv.2	Q06033	OTTHUMG00000158956	ENST00000449956.2:c.1214C>A	chr3.hg19:g.52834993C>A	ENSP00000415769:p.Pro405His	158.0	0.0		162.0	30.0	NM_002217	Q3B7H5|Q53F06|Q6LAM2|Q99085	Missense_Mutation	SNP	ENST00000449956.2	hg19	CCDS46845.1	.	.	.	.	.	.	.	.	.	.	C	8.172	0.791978	0.16258	.	.	ENSG00000162267	ENST00000398670;ENST00000536431;ENST00000273291;ENST00000416872;ENST00000449956	D;D	0.84223	-1.82;-1.82	4.82	3.86	0.44501	von Willebrand factor, type A (3);	0.419833	0.26082	N	0.026459	D	0.83413	0.5249	L	0.56280	1.765	0.09310	N	1	P;P	0.51933	0.949;0.923	P;P	0.56343	0.753;0.796	T	0.72184	-0.4367	10	0.14252	T	0.57	-8.4461	3.3063	0.07001	0.2292:0.5825:0.0:0.1884	.	405;405	E7ET33;Q06033	.;ITIH3_HUMAN	H	405;393;400;405;405	ENSP00000413922:P405H;ENSP00000415769:P405H	ENSP00000273291:P400H	P	+	2	0	ITIH3	52810033	0.012000	0.17670	0.742000	0.31022	0.032000	0.12392	1.830000	0.39131	2.502000	0.84385	0.655000	0.94253	CCC	.	.		0.542	ITIH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352668.2	NM_002217	
CNTN3	5067	hgsc.bcm.edu	37	3	74334612	74334612	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr3:74334612C>T	ENST00000263665.6	-	19	2575	c.2548G>A	c.(2548-2550)Gaa>Aaa	p.E850K		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	850	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		CTGGATGATTCCTCCTTTCCA	0.493																																					p.E850K		Atlas-SNP	.											.	CNTN3	174	.	0			c.G2548A						.						170.0	150.0	157.0					3																	74334612		2203	4300	6503	SO:0001583	missense	5067	exon19			ATGATTCCTCCTT	AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.2548G>A	chr3.hg19:g.74334612C>T	ENSP00000263665:p.Glu850Lys	149.0	0.0		130.0	72.0	NM_020872	B9EK50|Q9H039	Missense_Mutation	SNP	ENST00000263665.6	hg19	CCDS33790.1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668143	0.29604	.	.	ENSG00000113805	ENST00000263665	T	0.54675	0.56	4.68	4.68	0.58851	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.451038	0.25578	N	0.029702	T	0.45478	0.1344	L	0.48935	1.535	0.41524	D	0.988417	B	0.14012	0.009	B	0.29176	0.099	T	0.31503	-0.9941	10	0.09338	T	0.73	.	13.2524	0.60060	0.0:0.7064:0.2936:0.0	.	850	Q9P232	CNTN3_HUMAN	K	850	ENSP00000263665:E850K	ENSP00000263665:E850K	E	-	1	0	CNTN3	74417302	0.994000	0.37717	0.015000	0.15790	0.232000	0.25224	2.340000	0.43974	2.269000	0.75478	0.655000	0.94253	GAA	.	.		0.493	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352306.1	NM_020872	
OR5H14	403273	hgsc.bcm.edu	37	3	97868504	97868504	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr3:97868504T>A	ENST00000437310.1	+	1	335	c.275T>A	c.(274-276)aTa>aAa	p.I92K	RP11-343D2.11_ENST00000508964.1_RNA	NM_001005514.1	NP_001005514.1	A6NHG9	O5H14_HUMAN	olfactory receptor, family 5, subfamily H, member 14	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	31						AGTAAGATGATATCTCTCTCT	0.393																																					p.I92K		Atlas-SNP	.											.	OR5H14	56	.	0			c.T275A						.						226.0	229.0	228.0					3																	97868504		2203	4299	6502	SO:0001583	missense	403273	exon1			AGATGATATCTCT		CCDS33798.1	3q11.2	2013-09-23			ENSG00000236032	ENSG00000236032		"""GPCR / Class A : Olfactory receptors"""	31286	protein-coding gene	gene with protein product							Standard	NM_001005514		Approved		uc003dsg.1	A6NHG9	OTTHUMG00000160079	ENST00000437310.1:c.275T>A	chr3.hg19:g.97868504T>A	ENSP00000401706:p.Ile92Lys	188.0	0.0		199.0	53.0	NM_001005514	B9EH15	Missense_Mutation	SNP	ENST00000437310.1	hg19	CCDS33798.1	.	.	.	.	.	.	.	.	.	.	T	14.49	2.549848	0.45383	.	.	ENSG00000236032	ENST00000437310	T	0.00484	7.08	2.49	1.27	0.21489	GPCR, rhodopsin-like superfamily (1);	0.396031	0.21269	N	0.077344	T	0.01695	0.0054	H	0.98849	4.35	0.22446	N	0.99909	P	0.49358	0.923	P	0.55345	0.774	T	0.33343	-0.9872	10	0.87932	D	0	.	4.4478	0.11606	0.0:0.3322:0.0:0.6678	.	92	A6NHG9	O5H14_HUMAN	K	92	ENSP00000401706:I92K	ENSP00000401706:I92K	I	+	2	0	OR5H14	99351194	1.000000	0.71417	0.024000	0.17045	0.071000	0.16799	5.078000	0.64425	0.198000	0.20407	0.164000	0.16699	ATA	.	.		0.393	OR5H14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359112.1		
A4GNT	51146	hgsc.bcm.edu	37	3	137849889	137849889	+	Silent	SNP	G	G	A	rs374392631		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr3:137849889G>A	ENST00000236709.3	-	2	411	c.210C>T	c.(208-210)tcC>tcT	p.S70S		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	70					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						CAGACTCTACGGAACAGGAGA	0.532																																					p.S70S		Atlas-SNP	.											.	A4GNT	42	.	0			c.C210T						.						102.0	102.0	102.0					3																	137849889		2203	4300	6503	SO:0001819	synonymous_variant	51146	exon2			CTCTACGGAACAG	AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.210C>T	chr3.hg19:g.137849889G>A		247.0	0.0		227.0	112.0	NM_016161	Q0VDK1|Q0VDK2	Silent	SNP	ENST00000236709.3	hg19	CCDS3097.1																																																																																			.	.		0.532	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357557.1	NM_016161	
FAM53A	152877	hgsc.bcm.edu	37	4	1657010	1657010	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:1657010C>A	ENST00000308132.6	-	4	769	c.577G>T	c.(577-579)Ggc>Tgc	p.G193C	FAM53A_ENST00000472884.2_Missense_Mutation_p.G193C|FAM53A_ENST00000461064.1_Missense_Mutation_p.G193C|FAM53A_ENST00000489363.1_Missense_Mutation_p.G193C	NM_001174070.1	NP_001167541.1	Q6NSI3	FA53A_HUMAN	family with sequence similarity 53, member A	193						nucleus (GO:0005634)				breast(2)|central_nervous_system(2)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10		all_epithelial(65;0.206)|Breast(71;0.212)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)			TCCACGAAGCCGCCGCTGGCG	0.751																																					p.G193C		Atlas-SNP	.											.	FAM53A	25	.	0			c.G577T						.						3.0	4.0	4.0					4																	1657010		1546	3374	4920	SO:0001583	missense	152877	exon4			CGAAGCCGCCGCT	BC070112	CCDS33939.1, CCDS75091.1	4p16.3	2005-08-09			ENSG00000174137	ENSG00000174137			31860	protein-coding gene	gene with protein product							Standard	NM_001013622		Approved	DNTNP	uc021xkl.1	Q6NSI3	OTTHUMG00000159855	ENST00000308132.6:c.577G>T	chr4.hg19:g.1657010C>A	ENSP00000310057:p.Gly193Cys	73.0	0.0		41.0	15.0	NM_001013622	Q6ZUL5	Missense_Mutation	SNP	ENST00000308132.6	hg19	CCDS33939.1	.	.	.	.	.	.	.	.	.	.	C	11.07	1.530876	0.27387	.	.	ENSG00000174137	ENST00000308132;ENST00000489363;ENST00000461064;ENST00000472884	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	4.21	3.35	0.38373	.	0.110085	0.39407	U	0.001372	T	0.63248	0.2495	M	0.68593	2.085	0.44201	D	0.997027	D;D	0.89917	1.0;1.0	D;D	0.81914	0.991;0.995	T	0.60786	-0.7194	10	0.35671	T	0.21	-0.3812	12.1503	0.54046	0.0:0.9142:0.0:0.0858	.	193;193	Q6NSI3;C9JYQ7	FA53A_HUMAN;.	C	193	ENSP00000310057:G193C;ENSP00000419044:G193C;ENSP00000418243:G193C;ENSP00000426260:G193C	ENSP00000310057:G193C	G	-	1	0	FAM53A	1626807	0.973000	0.33851	0.018000	0.16275	0.065000	0.16274	0.653000	0.24902	0.752000	0.32923	0.467000	0.42956	GGC	.	.		0.751	FAM53A-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359224.1	NM_001013622	
CLNK	116449	hgsc.bcm.edu	37	4	10567642	10567642	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:10567642C>G	ENST00000226951.6	-	6	522	c.283G>C	c.(283-285)Gaa>Caa	p.E95Q	CLNK_ENST00000507719.1_Missense_Mutation_p.E53Q|CLNK_ENST00000442825.2_Missense_Mutation_p.E53Q	NM_052964.2	NP_443196.2	Q7Z7G1	CLNK_HUMAN	cytokine-dependent hematopoietic cell linker	95					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|positive regulation of signal transduction (GO:0009967)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	intracellular (GO:0005622)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(1)	17						CCTGCATATTCAGATTCCTTT	0.428																																					p.E95Q	GBM(87;402 1286 6949 13902 35851)	Atlas-SNP	.											.	CLNK	85	.	0			c.G283C						.						55.0	54.0	54.0					4																	10567642		1860	4103	5963	SO:0001583	missense	116449	exon6			CATATTCAGATTC	AB032369	CCDS47024.1	4p16.1	2013-02-14			ENSG00000109684	ENSG00000109684		"""SH2 domain containing"""	17438	protein-coding gene	gene with protein product	"""mast cell immunoreceptor signal transducer"""	611434				10562326, 10744659	Standard	NM_052964		Approved	MIST	uc003gmo.4	Q7Z7G1	OTTHUMG00000160062	ENST00000226951.6:c.283G>C	chr4.hg19:g.10567642C>G	ENSP00000226951:p.Glu95Gln	78.0	0.0		51.0	22.0	NM_052964	Q05C27|Q9P2U9	Missense_Mutation	SNP	ENST00000226951.6	hg19	CCDS47024.1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.543609	0.45280	.	.	ENSG00000109684	ENST00000226951;ENST00000429087;ENST00000442825;ENST00000507719	T;T;T	0.52754	1.74;0.65;0.65	5.55	4.66	0.58398	.	0.089086	0.41605	D	0.000842	T	0.45776	0.1359	N	0.24115	0.695	0.30591	N	0.761542	D;P	0.60160	0.987;0.911	P;B	0.53518	0.728;0.382	T	0.50816	-0.8783	10	0.66056	D	0.02	-24.9468	13.2003	0.59763	0.0:0.8256:0.1743:0.0	.	53;95	Q7Z7G1-2;Q7Z7G1	.;CLNK_HUMAN	Q	95;95;53;53	ENSP00000226951:E95Q;ENSP00000390744:E53Q;ENSP00000427208:E53Q	ENSP00000226951:E95Q	E	-	1	0	CLNK	10176740	0.967000	0.33354	0.987000	0.45799	0.469000	0.32828	2.195000	0.42677	2.616000	0.88540	0.585000	0.79938	GAA	.	.		0.428	CLNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359047.1	NM_052964	
LPHN3	23284	hgsc.bcm.edu	37	4	62897286	62897286	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:62897286G>T	ENST00000514591.1	+	22	3674	c.3345G>T	c.(3343-3345)caG>caT	p.Q1115H	LPHN3_ENST00000508946.1_Missense_Mutation_p.Q1115H|LPHN3_ENST00000507625.1_Missense_Mutation_p.Q1174H|LPHN3_ENST00000512091.2_Missense_Mutation_p.Q1115H|LPHN3_ENST00000508693.1_Missense_Mutation_p.Q1183H|LPHN3_ENST00000509896.1_Missense_Mutation_p.Q1183H|LPHN3_ENST00000514157.1_Missense_Mutation_p.Q1106H|LPHN3_ENST00000514996.1_Missense_Mutation_p.Q1106H|LPHN3_ENST00000506700.1_Missense_Mutation_p.Q1106H|LPHN3_ENST00000506746.1_Missense_Mutation_p.Q1174H|LPHN3_ENST00000504896.1_Missense_Mutation_p.Q1115H|LPHN3_ENST00000506720.1_Missense_Mutation_p.Q1183H|LPHN3_ENST00000507164.1_Missense_Mutation_p.Q1174H|LPHN3_ENST00000545650.1_Missense_Mutation_p.Q1115H|LPHN3_ENST00000511324.1_Missense_Mutation_p.Q1174H			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1093					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						ATTCTCTACAGGGAATGTTTA	0.343																																					p.Q1115H		Atlas-SNP	.											.	LPHN3	800	.	0			c.G3345T						.						94.0	89.0	91.0					4																	62897286		1823	4083	5906	SO:0001583	missense	23284	exon20			TCTACAGGGAATG	AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3345G>T	chr4.hg19:g.62897286G>T	ENSP00000422533:p.Gln1115His	128.0	0.0		83.0	28.0	NM_015236	E9PE04|O94867|Q9NWK5	Missense_Mutation	SNP	ENST00000514591.1	hg19	CCDS54768.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.63|18.63	3.664606|3.664606	0.67700|0.67700	.|.	.|.	ENSG00000150471|ENSG00000150471	ENST00000502815|ENST00000512091;ENST00000514591;ENST00000509896;ENST00000511324;ENST00000506700;ENST00000545650;ENST00000295349;ENST00000280009;ENST00000507164;ENST00000508693;ENST00000507625;ENST00000514157;ENST00000504896;ENST00000508946;ENST00000506720;ENST00000506746;ENST00000514996	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.60424	.|0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19;0.19	5.49|5.49	4.65|4.65	0.58169|0.58169	.|GPCR, family 2-like (1);GPCR, family 2, secretin-like, conserved site (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.80470|0.80470	0.4629|0.4629	M|M	0.90977|0.90977	3.165|3.165	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.998;0.998	.|D;D;D	.|0.83275	.|0.996;0.996;0.994	D|D	0.85130|0.85130	0.0974|0.0974	5|10	.|0.87932	.|D	.|0	.|.	14.2726|14.2726	0.66159|0.66159	0.0716:0.0:0.9284:0.0|0.0716:0.0:0.9284:0.0	.|.	.|1115;1093;1115	.|E9PE04;Q9HAR2;Q9HAR2-2	.|.;LPHN3_HUMAN;.	W|H	564|1115;1115;1183;1174;1106;1115;1093;1115;1174;1183;1174;1106;1115;1115;1183;1174;1106	.|ENSP00000423388:Q1115H;ENSP00000422533:Q1115H;ENSP00000423787:Q1183H;ENSP00000425033:Q1174H;ENSP00000424120:Q1106H;ENSP00000439831:Q1115H;ENSP00000421476:Q1174H;ENSP00000424030:Q1183H;ENSP00000421372:Q1174H;ENSP00000425201:Q1106H;ENSP00000423434:Q1115H;ENSP00000421627:Q1115H;ENSP00000420931:Q1183H;ENSP00000425884:Q1174H;ENSP00000424258:Q1106H	.|ENSP00000280009:Q1115H	G|Q	+|+	1|3	0|2	LPHN3|LPHN3	62579881|62579881	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	3.422000|3.422000	0.52749|0.52749	1.322000|1.322000	0.45245|0.45245	0.655000|0.655000	0.94253|0.94253	GGG|CAG	.	.		0.343	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000361765.1		
FRAS1	80144	hgsc.bcm.edu	37	4	79360143	79360143	+	Silent	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:79360143T>C	ENST00000325942.6	+	40	5894	c.5454T>C	c.(5452-5454)gaT>gaC	p.D1818D	FRAS1_ENST00000264895.6_Silent_p.D1818D	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1818					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						ACCATCTGGATAATCAGATAT	0.383																																					p.D1818D		Atlas-SNP	.											.	FRAS1	779	.	0			c.T5454C						.						211.0	212.0	211.0					4																	79360143		1898	4106	6004	SO:0001819	synonymous_variant	80144	exon40			TCTGGATAATCAG	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.5454T>C	chr4.hg19:g.79360143T>C		72.0	0.0		52.0	24.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Silent	SNP	ENST00000325942.6	hg19	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	T	9.385	1.074084	0.20227	.	.	ENSG00000138759	ENST00000510944;ENST00000512123	.	.	.	5.92	2.1	0.27182	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3334	0.26596	0.2425:0.6293:0.0:0.1282	.	.	.	.	Q	268;47	.	.	X	+	1	0	FRAS1	79579167	0.958000	0.32768	0.998000	0.56505	0.972000	0.66771	0.042000	0.13949	0.094000	0.17404	-0.292000	0.09595	TAA	.	.		0.383	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
LRIT3	345193	hgsc.bcm.edu	37	4	110772751	110772751	+	Missense_Mutation	SNP	C	C	T	rs544073628	byFrequency	TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:110772751C>T	ENST00000594814.1	+	2	208	c.208C>T	c.(208-210)Cgc>Tgc	p.R70C	LRIT3_ENST00000327908.3_5'UTR|LRIT3_ENST00000379920.3_Missense_Mutation_p.R25C	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	70					regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		GACTGTCATCCGCAGAATCTC	0.507													C|||	3	0.000599042	0.0	0.0	5008	,	,		18474	0.0		0.0	False		,,,				2504	0.0031				p.R70C		Atlas-SNP	.											.	LRIT3	107	.	0			c.C208T						.						84.0	78.0	80.0					4																	110772751		692	1591	2283	SO:0001583	missense	345193	exon2			GTCATCCGCAGAA	AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.208C>T	chr4.hg19:g.110772751C>T	ENSP00000469759:p.Arg70Cys	104.0	0.0		89.0	36.0	NM_198506	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	ENST00000594814.1	hg19	CCDS3688.3	.	.	.	.	.	.	.	.	.	.	C	17.33	3.362117	0.61403	.	.	ENSG00000183423	ENST00000379920	T	0.59638	0.25	6.02	5.17	0.71159	.	.	.	.	.	T	0.71500	0.3347	L	0.49455	1.56	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.74349	-0.3694	9	0.66056	D	0.02	.	16.4149	0.83730	0.1392:0.8608:0.0:0.0	.	25	Q3SXY7	LRIT3_HUMAN	C	25	ENSP00000369252:R25C	ENSP00000369252:R25C	R	+	1	0	LRIT3	110992200	1.000000	0.71417	0.200000	0.23457	0.415000	0.31203	3.638000	0.54332	1.521000	0.48983	0.655000	0.94253	CGC	.	.		0.507	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335270.2	NM_198506	
LARP1B	55132	hgsc.bcm.edu	37	4	129028555	129028555	+	Intron	SNP	T	T	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:129028555T>G	ENST00000326639.6	+	9	1199				LARP1B_ENST00000264584.5_Intron|LARP1B_ENST00000512292.1_Intron|LARP1B_ENST00000394288.3_Intron|LARP1B_ENST00000354456.3_Intron|LARP1B_ENST00000432347.2_Nonstop_Mutation_p.*359E|LARP1B_ENST00000441387.1_Intron|LARP1B_ENST00000427266.1_Intron	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B							nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						tcagtttatttaGATTTGATA	0.294																																					p.X359E		Atlas-SNP	.											.	LARP1B	120	.	0			c.T1075G						.						16.0	18.0	17.0					4																	129028555		1281	2299	3580	SO:0001627	intron_variant	55132	exon9			TTTATTTAGATTT		CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.988+87T>G	chr4.hg19:g.129028555T>G		107.0	0.0		67.0	25.0	NM_032239	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	ENST00000326639.6	hg19	CCDS3738.1	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.620350	0.00828	.	.	ENSG00000138709	ENST00000432347	.	.	.	4.97	1.13	0.20643	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.285	0.10850	0.0:0.2814:0.2432:0.4754	.	.	.	.	E	359	.	.	X	+	1	0	LARP1B	129248005	0.076000	0.21285	0.000000	0.03702	0.015000	0.08874	0.400000	0.20932	0.037000	0.15575	0.460000	0.39030	TAG	.	.		0.294	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257173.2	NM_018078	
TMEM144	55314	hgsc.bcm.edu	37	4	159162713	159162713	+	Silent	SNP	A	A	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:159162713A>C	ENST00000296529.6	+	11	1375	c.855A>C	c.(853-855)gcA>gcC	p.A285A	TMEM144_ENST00000503404.1_3'UTR	NM_018342.4	NP_060812.2	Q7Z5S9	TM144_HUMAN	transmembrane protein 144	285						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|endometrium(1)|large_intestine(7)|lung(9)|prostate(1)	19	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.0539)		GGTTCATAGCAAATCACTCTC	0.398																																					p.A285A		Atlas-SNP	.											.	TMEM144	34	.	0			c.A855C						.						288.0	260.0	270.0					4																	159162713		2203	4300	6503	SO:0001819	synonymous_variant	55314	exon11			CATAGCAAATCAC	AK002017	CCDS3799.1	4q32.1	2008-02-05			ENSG00000164124	ENSG00000164124			25633	protein-coding gene	gene with protein product						12477932	Standard	NM_018342		Approved	FLJ11155	uc003ipx.3	Q7Z5S9	OTTHUMG00000162013	ENST00000296529.6:c.855A>C	chr4.hg19:g.159162713A>C		57.0	0.0		43.0	10.0	NM_018342	D3DP24|Q49A05|Q9NUT3	Silent	SNP	ENST00000296529.6	hg19	CCDS3799.1																																																																																			.	.		0.398	TMEM144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365597.1	NM_018342	
HCN1	348980	hgsc.bcm.edu	37	5	45267245	45267245	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr5:45267245G>T	ENST00000303230.4	-	7	1786	c.1729C>A	c.(1729-1731)Cca>Aca	p.P577T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	577					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						CTCATCATTGGATATTCCTCC	0.433																																					p.P577T		Atlas-SNP	.											.	HCN1	298	.	0			c.C1729A						.						165.0	151.0	156.0					5																	45267245		2203	4300	6503	SO:0001583	missense	348980	exon7			TCATTGGATATTC	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1729C>A	chr5.hg19:g.45267245G>T	ENSP00000307342:p.Pro577Thr	127.0	0.0		149.0	44.0	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	hg19	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	G	33	5.224588	0.95139	.	.	ENSG00000164588	ENST00000303230	D	0.98012	-4.66	5.91	5.91	0.95273	Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);	0.000000	0.64402	D	0.000002	D	0.99155	0.9708	H	0.94423	3.535	0.80722	D	1	D	0.71674	0.998	D	0.71414	0.973	D	0.99143	1.0856	10	0.87932	D	0	.	20.2963	0.98556	0.0:0.0:1.0:0.0	.	577	O60741	HCN1_HUMAN	T	577	ENSP00000307342:P577T	ENSP00000307342:P577T	P	-	1	0	HCN1	45303002	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.813000	0.96785	0.655000	0.94253	CCA	.	.		0.433	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
HCN1	348980	hgsc.bcm.edu	37	5	45645564	45645564	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr5:45645564A>G	ENST00000303230.4	-	2	629	c.572T>C	c.(571-573)aTc>aCc	p.I191T		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	191					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AAAATTCATGATCAGGTCCAA	0.378																																					p.I191T		Atlas-SNP	.											.	HCN1	298	.	0			c.T572C						.						96.0	93.0	94.0					5																	45645564		2203	4300	6503	SO:0001583	missense	348980	exon2			TTCATGATCAGGT	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.572T>C	chr5.hg19:g.45645564A>G	ENSP00000307342:p.Ile191Thr	98.0	0.0		110.0	34.0	NM_021072		Missense_Mutation	SNP	ENST00000303230.4	hg19	CCDS3952.1	.	.	.	.	.	.	.	.	.	.	A	15.72	2.917585	0.52546	.	.	ENSG00000164588	ENST00000303230	D	0.98732	-5.1	5.37	5.37	0.77165	Ion transport (1);	0.101606	0.41097	D	0.000944	D	0.97145	0.9067	L	0.39020	1.185	0.45528	D	0.998486	B	0.17268	0.021	B	0.32393	0.145	D	0.95460	0.8542	10	0.87932	D	0	.	15.3658	0.74519	1.0:0.0:0.0:0.0	.	191	O60741	HCN1_HUMAN	T	191	ENSP00000307342:I191T	ENSP00000307342:I191T	I	-	2	0	HCN1	45681321	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.038000	0.60285	0.454000	0.30748	ATC	.	.		0.378	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
PIK3R1	5295	hgsc.bcm.edu	37	5	67576424	67576424	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr5:67576424C>T	ENST00000521381.1	+	6	1319	c.703C>T	c.(703-705)Cag>Tag	p.Q235*	PIK3R1_ENST00000274335.5_Nonsense_Mutation_p.Q235*|PIK3R1_ENST00000396611.1_Nonsense_Mutation_p.Q235*|PIK3R1_ENST00000521657.1_Nonsense_Mutation_p.Q235*	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	235	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	CATACCTCATCAGTATTGGCT	0.333			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																											p.Q235X		Atlas-SNP	.		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	.	PIK3R1	869	.	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)	c.C703T						.						127.0	141.0	136.0					5																	67576424		2203	4300	6503	SO:0001587	stop_gained	5295	exon6			CCTCATCAGTATT	M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.703C>T	chr5.hg19:g.67576424C>T	ENSP00000428056:p.Gln235*	175.0	0.0		162.0	90.0	NM_181523	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Nonsense_Mutation	SNP	ENST00000521381.1	hg19	CCDS3993.1	.	.	.	.	.	.	.	.	.	.	C	36	5.844556	0.97016	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-15.2429	20.0361	0.97558	0.0:1.0:0.0:0.0	.	.	.	.	X	235	.	ENSP00000274335:Q235X	Q	+	1	0	PIK3R1	67612180	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.294000	0.78760	2.745000	0.94114	0.462000	0.41574	CAG	.	.		0.333	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254013.2	NM_181504	
PCDHGC3	5098	hgsc.bcm.edu	37	5	140857013	140857013	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr5:140857013C>T	ENST00000308177.3	+	1	1434	c.1330C>T	c.(1330-1332)Cgt>Tgt	p.R444C	PCDHGA4_ENST00000571252.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB2_ENST00000522605.1_Intron|RN7SL68P_ENST00000488078.2_RNA|PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_002588.2|NM_032402.1	NP_002579.2|NP_115778.1	Q9UN70	PCDGK_HUMAN	protocadherin gamma subfamily C, 3	444	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R444C(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(2)|urinary_tract(1)	29			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAATAGTGCGTGTTCAAGT	0.522																																					p.R444C		Atlas-SNP	.											PCDHGC3_ENST00000308177,colon,NS,0,2	PCDHGC3	173	.	2	Substitution - Missense(2)	large_intestine(2)	c.C1330T						.						124.0	124.0	124.0					5																	140857013		2203	4300	6503	SO:0001583	missense	5098	exon1			ATAGTGCGTGTTC	AF152337	CCDS4261.1, CCDS75347.1, CCDS75348.1	5q31	2010-01-26			ENSG00000240184	ENSG00000240184		"""Cadherins / Protocadherins : Clustered"""	8716	other	protocadherin	"""cadherin-like 2"", ""protocadherin 2"", ""protocadherin 43"""	603627		PCDH2		9360932, 8508762	Standard	NM_032402		Approved	PC-43, PC43, PCDH-GAMMA-C3		Q9UN70	OTTHUMG00000129613	ENST00000308177.3:c.1330C>T	chr5.hg19:g.140857013C>T	ENSP00000312070:p.Arg444Cys	150.0	0.0		128.0	77.0	NM_032402	O60622|Q08192|Q9Y5C4	Missense_Mutation	SNP	ENST00000308177.3	hg19	CCDS4261.1	.	.	.	.	.	.	.	.	.	.	C	9.017	0.984037	0.18889	.	.	ENSG00000240184	ENST00000308177	T	0.54279	0.58	5.19	0.914	0.19360	Cadherin (5);Cadherin-like (1);	.	.	.	.	T	0.48095	0.1481	M	0.62209	1.925	0.09310	N	1	P;D	0.57257	0.941;0.979	B;B	0.43360	0.417;0.409	T	0.37384	-0.9708	9	0.38643	T	0.18	.	8.9568	0.35823	0.4851:0.4446:0.0:0.0703	.	444;444	Q9UN70;Q9UN70-2	PCDGK_HUMAN;.	C	444	ENSP00000312070:R444C	ENSP00000312070:R444C	R	+	1	0	PCDHGC3	140837197	0.000000	0.05858	0.134000	0.22075	0.431000	0.31685	0.205000	0.17356	0.362000	0.24319	0.655000	0.94253	CGT	.	.		0.522	PCDHGC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251808.2	NM_002588	
TCOF1	6949	hgsc.bcm.edu	37	5	149758589	149758589	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr5:149758589A>G	ENST00000504761.2	+	15	2462	c.2462A>G	c.(2461-2463)cAg>cGg	p.Q821R	TCOF1_ENST00000506063.1_3'UTR|TCOF1_ENST00000445265.2_Missense_Mutation_p.Q744R|TCOF1_ENST00000377797.3_Missense_Mutation_p.Q821R|TCOF1_ENST00000513346.1_Missense_Mutation_p.Q821R|TCOF1_ENST00000323668.7_Missense_Mutation_p.Q744R|TCOF1_ENST00000451292.1_Missense_Mutation_p.Q821R|TCOF1_ENST00000439160.2_Missense_Mutation_p.Q821R|TCOF1_ENST00000394269.3_Missense_Mutation_p.Q821R			Q13428	TCOF_HUMAN	Treacher Collins-Franceschetti syndrome 1	821					skeletal system development (GO:0001501)|transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:0042790)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|transporter activity (GO:0005215)			NS(1)|breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	35		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAAGCCAAGCAGAGGTCTCCA	0.592																																					p.Q821R		Atlas-SNP	.											.	TCOF1	154	.	0			c.A2462G						.						66.0	68.0	67.0					5																	149758589		2203	4300	6503	SO:0001583	missense	6949	exon15			CCAAGCAGAGGTC		CCDS4306.1, CCDS47305.1, CCDS47306.1, CCDS47307.1, CCDS54936.1	5q32	2014-06-18			ENSG00000070814	ENSG00000070814			11654	protein-coding gene	gene with protein product		606847				1765376	Standard	NM_001008657		Approved	treacle, TCS	uc003lry.3	Q13428	OTTHUMG00000130081	ENST00000504761.2:c.2462A>G	chr5.hg19:g.149758589A>G	ENSP00000421655:p.Gln821Arg	197.0	0.0		147.0	84.0	NM_001135243	A0JLU0|B4E111|Q6SC72|Q7Z5W9|Q96A52|Q99408|Q99860	Missense_Mutation	SNP	ENST00000504761.2	hg19	CCDS54936.1	.	.	.	.	.	.	.	.	.	.	A	0.334	-0.954543	0.02285	.	.	ENSG00000070814	ENST00000451292;ENST00000377797;ENST00000445265;ENST00000323668;ENST00000439160;ENST00000394269;ENST00000427724;ENST00000504761;ENST00000513346	T;T;T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	4.84	-2.63	0.06133	Treacher Collins syndrome, treacle (1);	0.827549	0.10185	N	0.705343	T	0.48040	0.1478	L	0.59436	1.845	0.09310	N	1	B;B;B;B;B;B;B	0.25850	0.005;0.004;0.004;0.004;0.136;0.004;0.004	B;B;B;B;B;B;B	0.26517	0.007;0.004;0.004;0.004;0.07;0.004;0.004	T	0.44360	-0.9333	10	0.39692	T	0.17	-0.3141	0.2487	0.00202	0.3007:0.1411:0.1949:0.3632	.	330;821;744;821;821;744;821	B4DRA2;Q13428-7;Q13428-2;Q13428-6;Q13428;Q13428-8;Q13428-5	.;.;.;.;TCOF_HUMAN;.;.	R	821;821;744;744;821;821;821;821;821	ENSP00000400939:Q821R;ENSP00000367028:Q821R;ENSP00000409944:Q744R;ENSP00000325223:Q744R;ENSP00000406888:Q821R;ENSP00000377811:Q821R;ENSP00000390717:Q821R;ENSP00000421655:Q821R;ENSP00000427484:Q821R	ENSP00000325223:Q744R	Q	+	2	0	TCOF1	149738782	0.000000	0.05858	0.270000	0.24601	0.046000	0.14306	-0.501000	0.06398	-0.172000	0.10779	0.459000	0.35465	CAG	.	.		0.592	TCOF1-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000380552.1	NM_001008656	
FOXC1	2296	hgsc.bcm.edu	37	6	1612042	1612042	+	Silent	SNP	G	G	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr6:1612042G>C	ENST00000380874.2	+	1	1362	c.1362G>C	c.(1360-1362)ggG>ggC	p.G454G		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	454	Poly-Gly.				artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		gcggcggcggGGGAGGCCAGG	0.751																																					p.G454G	Pancreas(133;719 1821 3197 26645 35015)	Atlas-SNP	.											.	FOXC1	19	.	0			c.G1362C						.						1.0	1.0	1.0					6																	1612042		591	1329	1920	SO:0001819	synonymous_variant	2296	exon1			CGGCGGGGGAGGC	AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.1362G>C	chr6.hg19:g.1612042G>C		269.0	0.0		483.0	31.0	NM_001453	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Silent	SNP	ENST00000380874.2	hg19	CCDS4473.1																																																																																			.	.		0.751	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043450.1		
TREM1	54210	hgsc.bcm.edu	37	6	41250225	41250225	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr6:41250225A>G	ENST00000244709.4	-	2	377	c.314T>C	c.(313-315)gTg>gCg	p.V105A	TREM1_ENST00000589614.1_Missense_Mutation_p.V105A|TREM1_ENST00000334475.6_Missense_Mutation_p.V105A|TREM1_ENST00000591620.1_Missense_Mutation_p.V105A	NM_018643.3	NP_061113.1	Q9NP99	TREM1_HUMAN	triggering receptor expressed on myeloid cells 1	105	Ig-like V-type.				blood coagulation (GO:0007596)|chemokine metabolic process (GO:0050755)|cytokine secretion involved in immune response (GO:0002374)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|neutrophil mediated killing of gram-negative bacterium (GO:0070945)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scaffold protein binding (GO:0097110)			NS(1)|breast(2)|endometrium(2)|large_intestine(5)|lung(5)|skin(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					AGAATCTTCCACTTGAAGGTT	0.512																																					p.V105A		Atlas-SNP	.											.	TREM1	38	.	0			c.T314C						.						102.0	75.0	84.0					6																	41250225		2203	4300	6503	SO:0001583	missense	54210	exon2			TCTTCCACTTGAA	AF196329	CCDS4854.1, CCDS56427.1, CCDS59499.1	6p21.1	2013-01-11			ENSG00000124731	ENSG00000124731		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	17760	protein-coding gene	gene with protein product		605085				11922939, 10799849	Standard	NM_018643		Approved	TREM-1, CD354	uc003oqf.2	Q9NP99	OTTHUMG00000014674	ENST00000244709.4:c.314T>C	chr6.hg19:g.41250225A>G	ENSP00000244709:p.Val105Ala	82.0	0.0		171.0	17.0	NM_001242590	B4DWG2|K7EJW1|Q53FL8|Q5T2C9|Q86YU1	Missense_Mutation	SNP	ENST00000244709.4	hg19	CCDS4854.1	.	.	.	.	.	.	.	.	.	.	A	9.321	1.058110	0.19987	.	.	ENSG00000124731	ENST00000244709;ENST00000334475	T;T	0.64438	-0.1;-0.1	4.37	0.231	0.15377	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	0.188597	0.26159	N	0.025996	T	0.16727	0.0402	L	0.27053	0.805	0.09310	N	1	P;B	0.41910	0.764;0.376	B;B	0.41946	0.338;0.371	T	0.32295	-0.9912	10	0.06891	T	0.86	-5.9515	1.1955	0.01874	0.5214:0.1906:0.1042:0.1839	.	105;105	Q9NP99-2;Q9NP99	.;TREM1_HUMAN	A	105	ENSP00000244709:V105A;ENSP00000334284:V105A	ENSP00000244709:V105A	V	-	2	0	TREM1	41358203	0.000000	0.05858	0.056000	0.19401	0.242000	0.25591	-0.389000	0.07342	0.292000	0.22492	0.482000	0.46254	GTG	.	.		0.512	TREM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040505.2	NM_018643	
TOMM6	100188893	hgsc.bcm.edu	37	6	41757064	41757064	+	Nonstop_Mutation	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr6:41757064T>C	ENST00000398884.3	+	2	259	c.223T>C	c.(223-225)Tag>Cag	p.*75Q	RP11-298J23.9_ENST00000594586.1_RNA|TOMM6_ENST00000398881.3_Nonstop_Mutation_p.*75Q	NM_001134493.1	NP_001127965.1	Q96B49	TOM6_HUMAN	translocase of outer mitochondrial membrane 6 homolog (yeast)	0					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)											GCCAGGGGTGTAGCCAAGTAG	0.473																																					p.X75Q		Atlas-SNP	.											.	TOMM6	12	.	0			c.T223C						.						113.0	94.0	100.0					6																	41757064		692	1591	2283	SO:0001578	stop_lost	100188893	exon2			GGGGTGTAGCCAA	AF216754	CCDS47424.1	6p21.1	2010-08-05			ENSG00000214736	ENSG00000214736			34528	protein-coding gene	gene with protein product	"""over-expressed breast tumor protein"""					18331822	Standard	NM_001134493		Approved	OBTP	uc011dug.1	Q96B49	OTTHUMG00000137505	ENST00000398884.3:c.223T>C	chr6.hg19:g.41757064T>C	ENSP00000381859:p.*75Glnext*13	72.0	0.0		133.0	19.0	NM_001134493	B2DG15|Q9UH52	Missense_Mutation	SNP	ENST00000398884.3	hg19	CCDS47424.1	.	.	.	.	.	.	.	.	.	.	T	16.67	3.188887	0.57909	.	.	ENSG00000214736	ENST00000398884;ENST00000398881	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5985	0.68424	0.0:0.0:0.0:1.0	.	.	.	.	Q	75	.	.	X	+	1	0	TOMM6	41865042	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	4.874000	0.63064	2.333000	0.79357	0.533000	0.62120	TAG	.	.		0.473	TOMM6-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268822.1		
RUNX2	860	hgsc.bcm.edu	37	6	45390469	45390469	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr6:45390469G>A	ENST00000371438.1	+	2	556	c.198G>A	c.(196-198)caG>caA	p.Q66Q	RUNX2_ENST00000352853.5_Silent_p.Q134Q|RUNX2_ENST00000576263.1_Silent_p.Q66Q|RUNX2_ENST00000371432.3_Silent_p.Q52Q|RUNX2_ENST00000371436.6_Silent_p.Q66Q|RUNX2_ENST00000359524.5_Silent_p.Q52Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000541979.1_Silent_p.Q134Q|RUNX2_ENST00000465038.2_Silent_p.Q66Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	66	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcaacagcagcagcagc	0.731																																					p.Q66Q		Atlas-SNP	.											.	RUNX2	128	.	0			c.G198A						.						9.0	14.0	13.0					6																	45390469		1431	3046	4477	SO:0001819	synonymous_variant	860	exon3			GCAACAGCAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.198G>A	chr6.hg19:g.45390469G>A		66.0	0.0		149.0	7.0	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
SLC22A2	6582	hgsc.bcm.edu	37	6	160677694	160677694	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr6:160677694T>C	ENST00000366953.3	-	2	728	c.470A>G	c.(469-471)aAt>aGt	p.N157S	SLC22A2_ENST00000491092.1_Intron|SLC22A2_ENST00000366952.1_Missense_Mutation_p.N136S	NM_003058.3	NP_003049.2	O15244	S22A2_HUMAN	solute carrier family 22 (organic cation transporter), member 2	157					body fluid secretion (GO:0007589)|drug transmembrane transport (GO:0006855)|histamine transport (GO:0051608)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|organic cation transport (GO:0015695)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|steroid binding (GO:0005496)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(16)|prostate(2)|skin(1)	27		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.28e-17)|BRCA - Breast invasive adenocarcinoma(81;6.29e-06)	Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Chlorphenamine(DB01114)|Choline(DB00122)|Cimetidine(DB00501)|Cisplatin(DB00515)|Cladribine(DB00242)|Cocaine(DB00907)|Cytarabine(DB00987)|Daunorubicin(DB00694)|Desipramine(DB01151)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Famotidine(DB00927)|Flurazepam(DB00690)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Lamivudine(DB00709)|Levofloxacin(DB01137)|Memantine(DB01043)|Metformin(DB00331)|Metoprolol(DB00264)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Oxprenolol(DB01580)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Propranolol(DB00571)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Reserpine(DB00206)|Thiamine(DB00152)|Tubocurarine(DB01199)|Vinblastine(DB00570)|Zidovudine(DB00495)	GAATCCTACATTCACTGATGA	0.443																																					p.N157S		Atlas-SNP	.											.	SLC22A2	78	.	0			c.A470G						.						129.0	121.0	124.0					6																	160677694		2203	4300	6503	SO:0001583	missense	6582	exon2			CCTACATTCACTG	X98333	CCDS5276.1	6q25.3	2013-05-22			ENSG00000112499	ENSG00000112499		"""Solute carriers"""	10966	protein-coding gene	gene with protein product		602608				9605850	Standard	NM_003058		Approved	OCT2	uc003qtf.3	O15244	OTTHUMG00000015950	ENST00000366953.3:c.470A>G	chr6.hg19:g.160677694T>C	ENSP00000355920:p.Asn157Ser	134.0	0.0		129.0	38.0	NM_003058	Q5T7Q6|Q6PIQ8|Q8NG62|Q9NQB9	Missense_Mutation	SNP	ENST00000366953.3	hg19	CCDS5276.1	.	.	.	.	.	.	.	.	.	.	T	12.58	1.979359	0.34942	.	.	ENSG00000112499	ENST00000366953;ENST00000366952	T;T	0.73152	-0.72;-0.72	5.8	5.8	0.92144	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.050014	0.85682	D	0.000000	T	0.67050	0.2852	M	0.83312	2.635	0.40267	D	0.978246	B;B;P	0.36378	0.343;0.186;0.55	B;B;B	0.40901	0.343;0.302;0.259	T	0.68667	-0.5348	10	0.22706	T	0.39	.	16.1508	0.81622	0.0:0.0:0.0:1.0	.	157;157;157	O15244-3;O15244;O15244-2	.;S22A2_HUMAN;.	S	157;136	ENSP00000355920:N157S;ENSP00000355919:N136S	ENSP00000355919:N136S	N	-	2	0	SLC22A2	160597684	1.000000	0.71417	0.986000	0.45419	0.081000	0.17604	5.594000	0.67557	2.207000	0.71202	0.528000	0.53228	AAT	.	.		0.443	SLC22A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042943.1	NM_003058	
MYO1G	64005	hgsc.bcm.edu	37	7	45005789	45005789	+	Silent	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:45005789C>A	ENST00000258787.7	-	16	2176	c.2040G>T	c.(2038-2040)ctG>ctT	p.L680L		NM_033054.2	NP_149043.2	B0I1T2	MYO1G_HUMAN	myosin IG	680	Myosin motor.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|pancreas(1)|skin(4)	28						CGTCCCCCTGCAGCCCGTGCT	0.627																																					p.L680L		Atlas-SNP	.											.	MYO1G	86	.	0			c.G2040T						.						56.0	51.0	53.0					7																	45005789		2202	4300	6502	SO:0001819	synonymous_variant	64005	exon16			CCCCTGCAGCCCG	AF380932	CCDS34629.1	7p13-p11.2	2011-09-27			ENSG00000136286	ENSG00000136286		"""Myosins / Myosin superfamily : Class I"""	13880	protein-coding gene	gene with protein product	"""minor histocompatibility antigen HA-2"""	600642					Standard	NM_033054		Approved	HA-2	uc003tmh.2	B0I1T2	OTTHUMG00000155821	ENST00000258787.7:c.2040G>T	chr7.hg19:g.45005789C>A		31.0	0.0		56.0	19.0	NM_033054	Q8TEI9|Q8TES2|Q96BE2|Q96RI5|Q96RI6	Silent	SNP	ENST00000258787.7	hg19	CCDS34629.1																																																																																			.	.		0.627	MYO1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341832.2		
PON3	5446	hgsc.bcm.edu	37	7	94996796	94996796	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:94996796A>T	ENST00000265627.5	-	5	382	c.372T>A	c.(370-372)aaT>aaA	p.N124K	PON3_ENST00000427422.1_Missense_Mutation_p.N124K|PON3_ENST00000451904.1_Missense_Mutation_p.N124K|PON1_ENST00000542556.1_Intron	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	124					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	GATACACAGTATTGTCTACAT	0.338																																					p.N124K		Atlas-SNP	.											.	PON3	59	.	0			c.T372A						.						106.0	112.0	110.0					7																	94996796		2203	4300	6503	SO:0001583	missense	5446	exon5			CACAGTATTGTCT	L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.372T>A	chr7.hg19:g.94996796A>T	ENSP00000265627:p.Asn124Lys	82.0	0.0		140.0	55.0	NM_000940	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	ENST00000265627.5	hg19	CCDS5639.1	.	.	.	.	.	.	.	.	.	.	A	3.988	-0.004988	0.07773	.	.	ENSG00000105852	ENST00000265627;ENST00000427422	T;T	0.16743	2.32;2.32	4.78	-4.22	0.03800	Six-bladed beta-propeller, TolB-like (1);	0.383815	0.30235	N	0.010081	T	0.10380	0.0254	L	0.49778	1.585	0.09310	N	1	B;B	0.10296	0.003;0.001	B;B	0.11329	0.006;0.001	T	0.16867	-1.0388	10	0.49607	T	0.09	-0.2762	1.0575	0.01593	0.401:0.1062:0.2663:0.2265	.	172;124	B4E2I0;Q15166	.;PON3_HUMAN	K	124	ENSP00000265627:N124K;ENSP00000413276:N124K	ENSP00000265627:N124K	N	-	3	2	PON3	94834732	0.005000	0.15991	0.015000	0.15790	0.018000	0.09664	-0.349000	0.07731	-0.849000	0.04158	-0.449000	0.05564	AAT	.	.		0.338	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333007.1	NM_000940	
FBXO24	26261	hgsc.bcm.edu	37	7	100187289	100187289	+	Intron	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:100187289G>A	ENST00000241071.6	+	2	361				PCOLCE-AS1_ENST00000442166.2_RNA|FBXO24_ENST00000465843.1_Intron|FBXO24_ENST00000498195.1_Intron|FBXO24_ENST00000468962.1_Intron|FBXO24_ENST00000427939.2_Missense_Mutation_p.R9Q|FBXO24_ENST00000360609.2_Intron	NM_033506.2	NP_277041.1	O75426	FBX24_HUMAN	F-box protein 24						protein ubiquitination (GO:0016567)	ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(3)|skin(4)|urinary_tract(2)	28	Lung NSC(181;0.0261)|all_lung(186;0.0392)|Esophageal squamous(72;0.0439)					CAGCAGGAACGGGGGGGCCAA	0.647																																					p.R9Q		Atlas-SNP	.											FBXO24_ENST00000427939,NS,carcinoma,0,3	FBXO24	125	.	0			c.G26A						.						31.0	35.0	34.0					7																	100187289		692	1591	2283	SO:0001627	intron_variant	26261	exon1			AGGAACGGGGGGG	AF174604	CCDS5698.1, CCDS5699.1, CCDS5699.2, CCDS55138.1	7q22	2005-10-07	2004-06-15		ENSG00000106336	ENSG00000106336		"""F-boxes /  ""other"""""	13595	protein-coding gene	gene with protein product		609097	"""F-box only protein 24"""			10531035, 10531037	Standard	NM_012172		Approved	FBX24	uc011kjz.1	O75426	OTTHUMG00000159543	ENST00000241071.6:c.40-311G>A	chr7.hg19:g.100187289G>A		199.0	0.0		217.0	20.0	NM_012172	A4D2D4|B4DX91|B4DY42|Q9H0G1	Missense_Mutation	SNP	ENST00000241071.6	hg19	CCDS5698.1	.	.	.	.	.	.	.	.	.	.	g	4.423	0.078205	0.08485	.	.	ENSG00000106336	ENST00000427939	T	0.14022	2.54	2.59	0.365	0.16131	.	.	.	.	.	T	0.09555	0.0235	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31916	-0.9926	8	0.87932	D	0	.	4.4001	0.11383	0.2602:0.4827:0.2571:0.0	.	9	B4DX91	.	Q	9	ENSP00000416558:R9Q	ENSP00000416558:R9Q	R	+	2	0	FBXO24	100025225	0.719000	0.27986	0.002000	0.10522	0.217000	0.24651	0.736000	0.26130	0.416000	0.25844	-0.993000	0.02533	CGG	.	.		0.647	FBXO24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356104.1		
EPHB4	2050	hgsc.bcm.edu	37	7	100420008	100420008	+	Silent	SNP	A	A	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:100420008A>T	ENST00000358173.3	-	4	1161	c.693T>A	c.(691-693)ccT>ccA	p.P231P	RN7SL750P_ENST00000582814.1_RNA|EPHB4_ENST00000477446.1_5'UTR|EPHB4_ENST00000360620.3_Silent_p.P231P	NM_004444.4	NP_004435.3	P54760	EPHB4_HUMAN	EPH receptor B4	231	Cys-rich.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|ephrin receptor signaling pathway (GO:0048013)|heart morphogenesis (GO:0003007)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(3)	47	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGCTGGGGCCAGGGGCGGGGA	0.692																																					p.P231P	GBM(200;2113 3072 25865 52728)	Atlas-SNP	.											.	EPHB4	106	.	0			c.T693A						.						11.0	13.0	12.0					7																	100420008		2181	4257	6438	SO:0001819	synonymous_variant	2050	exon4			GGGGCCAGGGGCG	AY056047	CCDS5706.1	7q22	2013-02-11	2004-10-28		ENSG00000196411	ENSG00000196411		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3395	protein-coding gene	gene with protein product		600011	"""EphB4"""	HTK		8188704	Standard	NM_004444		Approved	Tyro11	uc003uwn.1	P54760	OTTHUMG00000157040	ENST00000358173.3:c.693T>A	chr7.hg19:g.100420008A>T		108.0	0.0		149.0	61.0	NM_004444	B5A970|B5A971|B5A972|Q7Z635|Q9BTA5|Q9BXP0	Silent	SNP	ENST00000358173.3	hg19	CCDS5706.1																																																																																			.	.		0.692	EPHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347222.1	NM_004444	
LHFPL3	375612	hgsc.bcm.edu	37	7	103969251	103969251	+	Silent	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:103969251C>T	ENST00000535008.1	+	1	148	c.24C>T	c.(22-24)gcC>gcT	p.A8A	LHFPL3_ENST00000401970.2_5'UTR|LHFPL3_ENST00000543266.1_Silent_p.A8A|LHFPL3_ENST00000424859.1_5'UTR			Q86UP9	LHPL3_HUMAN	lipoma HMGIC fusion partner-like 3	8						integral component of membrane (GO:0016021)		p.A8A(1)		kidney(1)|large_intestine(2)|lung(6)	9						ccgccgctgccgccgccgccg	0.721																																					p.A8A		Atlas-SNP	.											LHFPL3,NS,carcinoma,0,1	LHFPL3	24	.	1	Substitution - coding silent(1)	kidney(1)	c.C24T						.						11.0	14.0	13.0					7																	103969251		1949	4092	6041	SO:0001819	synonymous_variant	375612	exon1			CGCTGCCGCCGCC	AY260763		7q22.2	2006-06-13			ENSG00000187416	ENSG00000187416			6589	protein-coding gene	gene with protein product		609719	"""lipoma HMGIC fusion partner-like 4"""	LHFPL4		10329012	Standard	NM_199000		Approved		uc003vce.3	Q86UP9	OTTHUMG00000157273	ENST00000535008.1:c.24C>T	chr7.hg19:g.103969251C>T		38.0	0.0		50.0	2.0	NM_199000	A1L383|A4D0Q5	Silent	SNP	ENST00000535008.1	hg19																																																																																				.	.		0.721	LHFPL3-201	KNOWN	basic	protein_coding	protein_coding		NM_199000	
GCC1	79571	hgsc.bcm.edu	37	7	127225186	127225186	+	Silent	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:127225186C>T	ENST00000321407.2	-	1	475	c.51G>A	c.(49-51)ttG>ttA	p.L17L	GCC1_ENST00000497650.1_Intron	NM_024523.5	NP_078799.2	Q96CN9	GCC1_HUMAN	GRIP and coiled-coil domain containing 1	17					protein targeting to Golgi (GO:0000042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)				breast(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						TAGTCTCCAGCAAGTCCTTCT	0.552											OREG0003808	type=REGULATORY REGION|Gene=GCC1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.L17L		Atlas-SNP	.											.	GCC1	83	.	0			c.G51A						.						81.0	87.0	85.0					7																	127225186		2203	4300	6503	SO:0001819	synonymous_variant	79571	exon1			CTCCAGCAAGTCC	AF525417	CCDS5796.1	7q22.3	2004-03-05	2003-10-17		ENSG00000179562	ENSG00000179562			19095	protein-coding gene	gene with protein product		607418	"""golgi coiled-coil 1"""			10209125	Standard	NM_024523		Approved	FLJ22035, GCC88, GCC1P, MGC20706	uc003vma.3	Q96CN9	OTTHUMG00000023590	ENST00000321407.2:c.51G>A	chr7.hg19:g.127225186C>T		64.0	0.0	1555	101.0	50.0	NM_024523	Q9H6N7	Silent	SNP	ENST00000321407.2	hg19	CCDS5796.1																																																																																			.	.		0.552	GCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000059911.3	NM_024523	
ZNF282	8427	hgsc.bcm.edu	37	7	148895528	148895528	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr7:148895528A>T	ENST00000262085.3	+	2	374	c.269A>T	c.(268-270)cAg>cTg	p.Q90L	ZNF282_ENST00000479907.1_Missense_Mutation_p.Q90L	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	90					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CGAGAGCCCCAGTTGCCCACA	0.607																																					p.Q90L		Atlas-SNP	.											.	ZNF282	42	.	0			c.A269T						.						49.0	47.0	48.0					7																	148895528		2203	4300	6503	SO:0001583	missense	8427	exon2			AGCCCCAGTTGCC	D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.269A>T	chr7.hg19:g.148895528A>T	ENSP00000262085:p.Gln90Leu	91.0	0.0		134.0	69.0	NM_003575	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	ENST00000262085.3	hg19	CCDS5895.1	.	.	.	.	.	.	.	.	.	.	A	13.34	2.207887	0.39003	.	.	ENSG00000170265	ENST00000430197;ENST00000262085;ENST00000479907	T;T	0.07021	3.23;5.05	4.26	4.26	0.50523	.	0.000000	0.40554	N	0.001072	T	0.07324	0.0185	N	0.24115	0.695	0.36109	D	0.844665	P;B;B;B	0.41313	0.745;0.18;0.18;0.281	B;B;B;B	0.41813	0.367;0.052;0.11;0.11	T	0.30822	-0.9965	10	0.56958	D	0.05	-31.88	10.0483	0.42199	1.0:0.0:0.0:0.0	.	90;41;62;90	B4DRI5;Q86YG2;Q7Z2V4;Q9UDV7	.;.;.;ZN282_HUMAN	L	5;90;90	ENSP00000262085:Q90L;ENSP00000418840:Q90L	ENSP00000262085:Q90L	Q	+	2	0	ZNF282	148526461	0.988000	0.35896	0.998000	0.56505	0.797000	0.45037	2.740000	0.47418	1.704000	0.51252	0.260000	0.18958	CAG	.	.		0.607	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352746.1	NM_003575	
EXTL3	2137	hgsc.bcm.edu	37	8	28573960	28573960	+	Silent	SNP	G	G	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr8:28573960G>T	ENST00000220562.4	+	3	1286	c.384G>T	c.(382-384)ctG>ctT	p.L128L	EXTL3_ENST00000523149.1_Intron|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	128					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		AGCAGGACCTGCTCCAGCTCA	0.567																																					p.L128L		Atlas-SNP	.											.	EXTL3	83	.	0			c.G384T						.						47.0	41.0	43.0					8																	28573960		2203	4300	6503	SO:0001819	synonymous_variant	2137	exon3			GGACCTGCTCCAG	U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.384G>T	chr8.hg19:g.28573960G>T		66.0	0.0		60.0	15.0	NM_001440	D3DST8|O00225|Q53XT3	Silent	SNP	ENST00000220562.4	hg19	CCDS6070.1																																																																																			.	.		0.567	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000219987.3	NM_001440	
PREX2	80243	hgsc.bcm.edu	37	8	69046429	69046429	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr8:69046429G>C	ENST00000288368.4	+	32	4179	c.3902G>C	c.(3901-3903)tGg>tCg	p.W1301S		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1301					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						ATGGAAACTTGGGAAGCCAGC	0.493																																					p.W1301S		Atlas-SNP	.											.	PREX2	614	.	0			c.G3902C						.						113.0	104.0	107.0					8																	69046429		2203	4300	6503	SO:0001583	missense	80243	exon32			AAACTTGGGAAGC	AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3902G>C	chr8.hg19:g.69046429G>C	ENSP00000288368:p.Trp1301Ser	108.0	0.0		108.0	38.0	NM_024870	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	ENST00000288368.4	hg19	CCDS6201.1	.	.	.	.	.	.	.	.	.	.	G	10.01	1.233571	0.22626	.	.	ENSG00000046889	ENST00000288368	T	0.39229	1.09	5.42	4.53	0.55603	.	0.662276	0.15201	N	0.275005	T	0.21801	0.0525	N	0.08118	0	0.36684	D	0.879239	B	0.02656	0.0	B	0.01281	0.0	T	0.11203	-1.0597	10	0.45353	T	0.12	.	5.9928	0.19476	0.0748:0.1288:0.6457:0.1506	.	1301	Q70Z35	PREX2_HUMAN	S	1301	ENSP00000288368:W1301S	ENSP00000288368:W1301S	W	+	2	0	PREX2	69208983	0.950000	0.32346	0.984000	0.44739	0.991000	0.79684	1.693000	0.37742	1.282000	0.44496	-0.176000	0.13171	TGG	.	.		0.493	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378620.1	NM_025170	
ZNF696	79943	hgsc.bcm.edu	37	8	144375190	144375190	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr8:144375190C>G	ENST00000330143.3	+	2	428	c.19C>G	c.(19-21)Ccc>Gcc	p.P7A	ZNF696_ENST00000520333.1_Missense_Mutation_p.P7A|RP13-582O9.7_ENST00000607376.1_RNA|ZNF696_ENST00000521537.1_Missense_Mutation_p.P7A	NM_030895.2	NP_112157.2	Q9H7X3	ZN696_HUMAN	zinc finger protein 696	7					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.86e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			AGGAGGAGAGCCCACAGGTGC	0.522																																					p.P7A		Atlas-SNP	.											.	ZNF696	18	.	0			c.C19G						.						87.0	76.0	80.0					8																	144375190		2203	4300	6503	SO:0001583	missense	79943	exon2			GGAGAGCCCACAG	AK024191	CCDS6399.1	8q24.3	2013-01-08				ENSG00000185730		"""Zinc fingers, C2H2-type"""	25872	protein-coding gene	gene with protein product							Standard	NM_030895		Approved	FLJ14129	uc003yxy.4	Q9H7X3		ENST00000330143.3:c.19C>G	chr8.hg19:g.144375190C>G	ENSP00000328515:p.Pro7Ala	118.0	0.0		127.0	46.0	NM_030895	A0AVE2	Missense_Mutation	SNP	ENST00000330143.3	hg19	CCDS6399.1	.	.	.	.	.	.	.	.	.	.	C	0.599	-0.829883	0.02734	.	.	ENSG00000185730	ENST00000523891;ENST00000518575;ENST00000330143;ENST00000521537;ENST00000518432	T;T	0.06687	3.27;3.36	1.09	-2.13	0.07144	.	.	.	.	.	T	0.03220	0.0094	N	0.08118	0	0.09310	N	1	B	0.24132	0.098	B	0.14578	0.011	T	0.45220	-0.9276	9	0.21540	T	0.41	.	5.0439	0.14473	0.0:0.5056:0.0:0.4944	.	7	Q9H7X3	ZN696_HUMAN	A	23;7;7;7;7	ENSP00000427857:P7A;ENSP00000328515:P7A	ENSP00000328515:P7A	P	+	1	0	ZNF696	144446565	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.069000	0.11542	-0.873000	0.04032	-0.253000	0.11424	CCC	.	.		0.522	ZNF696-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381164.2	NM_030895	
MAMDC2	256691	hgsc.bcm.edu	37	9	72723289	72723289	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr9:72723289T>A	ENST00000377182.4	+	3	928	c.311T>A	c.(310-312)aTg>aAg	p.M104K	MAMDC2-AS1_ENST00000591368.1_RNA|MAMDC2-AS1_ENST00000414515.3_RNA	NM_153267.4	NP_694999.3	Q7Z304	MAMC2_HUMAN	MAM domain containing 2	104	MAM 1. {ECO:0000255|PROSITE- ProRule:PRU00128}.				peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)	endoplasmic reticulum (GO:0005783)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	glycosaminoglycan binding (GO:0005539)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	14						AACCTCTACATGAGATTTGAA	0.488																																					p.M104K		Atlas-SNP	.											.	MAMDC2	55	.	0			c.T311A						.						75.0	74.0	75.0					9																	72723289		2203	4300	6503	SO:0001583	missense	256691	exon3			TCTACATGAGATT	BC040299	CCDS6631.1	9q21.2	2008-02-05			ENSG00000165072	ENSG00000165072			23673	protein-coding gene	gene with protein product		612879					Standard	NM_153267		Approved	MGC21981	uc004ahm.2	Q7Z304	OTTHUMG00000019990	ENST00000377182.4:c.311T>A	chr9.hg19:g.72723289T>A	ENSP00000366387:p.Met104Lys	113.0	0.0		89.0	34.0	NM_153267	Q5VW47|Q8WX43|Q96BM4	Missense_Mutation	SNP	ENST00000377182.4	hg19	CCDS6631.1	.	.	.	.	.	.	.	.	.	.	T	16.20	3.056845	0.55325	.	.	ENSG00000165072	ENST00000377182	T	0.02158	4.42	5.93	5.93	0.95920	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.648767	0.16015	N	0.233581	T	0.03390	0.0098	L	0.32530	0.975	0.35152	D	0.76989	B	0.15719	0.014	B	0.24006	0.05	T	0.47736	-0.9094	10	0.40728	T	0.16	-6.8559	16.3701	0.83353	0.0:0.0:0.0:1.0	.	104	Q7Z304	MAMC2_HUMAN	K	104	ENSP00000366387:M104K	ENSP00000366387:M104K	M	+	2	0	MAMDC2	71913109	0.884000	0.30299	0.987000	0.45799	0.990000	0.78478	2.667000	0.46808	2.257000	0.74773	0.528000	0.53228	ATG	.	.		0.488	MAMDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052600.1	NM_153267	
PROSER2	254427	hgsc.bcm.edu	37	10	11912120	11912120	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr10:11912120G>A	ENST00000277570.5	+	4	1177	c.1023G>A	c.(1021-1023)ctG>ctA	p.L341L	PROSER2_ENST00000379200.1_Silent_p.L145L|PROSER2-AS1_ENST00000453242.1_RNA|PROSER2-AS1_ENST00000445498.1_RNA	NM_153256.3	NP_694988.3	Q86WR7	PRSR2_HUMAN	proline and serine rich 2	341																	GCCCGGCGCTGGCCAACGGCT	0.781																																					p.L341L		Atlas-SNP	.											.	.	.	.	0			c.G1023A						.						2.0	2.0	2.0					10																	11912120		1194	2378	3572	SO:0001819	synonymous_variant	254427	exon4			GGCGCTGGCCAAC	BC017269	CCDS7085.1	10p14	2014-02-19	2014-02-19	2012-12-05	ENSG00000148426	ENSG00000148426			23728	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 47"", ""proline and serine-rich protein 2"""	C10orf47		12477932	Standard	NM_153256		Approved	MGC35403	uc001ikx.3	Q86WR7	OTTHUMG00000017673	ENST00000277570.5:c.1023G>A	chr10.hg19:g.11912120G>A		10.0	0.0		26.0	7.0	NM_153256	D3DRR8|Q5W0J9|Q5W0K0|Q5W0K1|Q5W0K2|Q6PJC8|Q8N317	Silent	SNP	ENST00000277570.5	hg19	CCDS7085.1																																																																																			.	.		0.781	PROSER2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090189.2	NM_153256	
CUBN	8029	hgsc.bcm.edu	37	10	17169878	17169878	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr10:17169878T>C	ENST00000377833.4	-	3	363	c.298A>G	c.(298-300)Att>Gtt	p.I100V	CUBN_ENST00000377823.1_Missense_Mutation_p.I100V	NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	100					cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCAGACCAATTGCACTCCCT	0.323																																					p.I100V		Atlas-SNP	.											.	CUBN	515	.	0			c.A298G						.						210.0	206.0	208.0					10																	17169878		2202	4300	6502	SO:0001583	missense	8029	exon3			GACCAATTGCACT	AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.298A>G	chr10.hg19:g.17169878T>C	ENSP00000367064:p.Ile100Val	83.0	0.0		82.0	47.0	NM_001081	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	ENST00000377833.4	hg19	CCDS7113.1	.	.	.	.	.	.	.	.	.	.	T	1.333	-0.596367	0.03771	.	.	ENSG00000107611	ENST00000377833;ENST00000377823	T;D	0.88741	-0.91;-2.42	5.39	-1.93	0.07594	.	2.469160	0.01861	N	0.036620	T	0.74831	0.3768	N	0.01874	-0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.63910	-0.6530	10	0.28530	T	0.3	.	11.7449	0.51815	0.0:0.6798:0.0:0.3202	.	100	O60494	CUBN_HUMAN	V	100	ENSP00000367064:I100V;ENSP00000367054:I100V	ENSP00000367054:I100V	I	-	1	0	CUBN	17209884	0.000000	0.05858	0.000000	0.03702	0.056000	0.15407	-0.986000	0.03747	-0.593000	0.05844	-0.297000	0.09499	ATT	.	.		0.323	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047009.1	NM_001081	
HK1	3098	hgsc.bcm.edu	37	10	71158366	71158366	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr10:71158366G>A	ENST00000359426.6	+	17	2495	c.2391G>A	c.(2389-2391)ctG>ctA	p.L797L	HK1_ENST00000298649.3_Silent_p.L796L|HK1_ENST00000360289.2_Silent_p.L785L|HK1_ENST00000448642.2_Silent_p.L832L|HK1_ENST00000404387.2_Silent_p.L801L	NM_000188.2	NP_000179.2	P19367	HXK1_HUMAN	hexokinase 1	797	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cell death (GO:0008219)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|mannokinase activity (GO:0019158)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(14)|ovary(1)|urinary_tract(2)	35						GATTAGCACTGCTCCAGGTCC	0.622																																					p.L801L		Atlas-SNP	.											.	HK1	170	.	0			c.G2403A						.						43.0	37.0	39.0					10																	71158366		2203	4300	6503	SO:0001819	synonymous_variant	3098	exon20			AGCACTGCTCCAG	M75126	CCDS7289.1, CCDS7290.1, CCDS7291.1, CCDS7292.1	10q22	2014-09-17			ENSG00000156515	ENSG00000156515	2.7.1.1		4922	protein-coding gene	gene with protein product		142600					Standard	NM_033496		Approved		uc001jpi.4	P19367	OTTHUMG00000018380	ENST00000359426.6:c.2391G>A	chr10.hg19:g.71158366G>A		48.0	0.0		54.0	16.0	NM_033498	E9PCK0|O43443|O43444|O75574|Q5VTC3|Q96HC8|Q9NNZ4|Q9NNZ5	Silent	SNP	ENST00000359426.6	hg19	CCDS7292.1																																																																																			.	.		0.622	HK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048429.2	NM_000188	
ECHS1	1892	hgsc.bcm.edu	37	10	135180466	135180466	+	Silent	SNP	A	A	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr10:135180466A>T	ENST00000368547.3	-	5	901	c.546T>A	c.(544-546)gcT>gcA	p.A182A		NM_004092.3	NP_004083.3	P30084	ECHM_HUMAN	enoyl CoA hydratase, short chain, 1, mitochondrial	182					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enoyl-CoA hydratase activity (GO:0004300)			NS(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	10		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;1.62e-06)|OV - Ovarian serous cystadenocarcinoma(35;5.75e-06)|Epithelial(32;7.58e-06)		ACTTCCCAACAGCACGGGTGA	0.627																																					p.A182A	GBM(132;1720 1771 5373 10277 21402)	Atlas-SNP	.											.	ECHS1	31	.	0			c.T546A						.						67.0	52.0	57.0					10																	135180466		2202	4300	6502	SO:0001819	synonymous_variant	1892	exon5			CCCAACAGCACGG		CCDS7681.1	10q26.2-q26.3	2010-05-04	2010-04-30		ENSG00000127884	ENSG00000127884	4.2.1.17		3151	protein-coding gene	gene with protein product		602292	"""enoyl Coenzyme A hydratase, short chain, 1, mitochondrial"""			8012501	Standard	NM_004092		Approved	SCEH	uc001lmu.3	P30084	OTTHUMG00000019320	ENST00000368547.3:c.546T>A	chr10.hg19:g.135180466A>T		58.0	0.0		44.0	15.0	NM_004092	O00739|Q5VWY1|Q96H54	Silent	SNP	ENST00000368547.3	hg19	CCDS7681.1																																																																																			.	.		0.627	ECHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051156.1		
DRD2	1813	hgsc.bcm.edu	37	11	113281524	113281524	+	Missense_Mutation	SNP	G	G	T	rs79932566		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr11:113281524G>T	ENST00000362072.3	-	8	1601	c.1257C>A	c.(1255-1257)agC>agA	p.S419R	RP11-159N11.3_ENST00000546284.1_RNA|DRD2_ENST00000346454.3_Missense_Mutation_p.S390R|DRD2_ENST00000542968.1_Missense_Mutation_p.S419R|DRD2_ENST00000355319.2_Missense_Mutation_p.S421R|DRD2_ENST00000538967.1_Missense_Mutation_p.S421R|DRD2_ENST00000544518.1_Missense_Mutation_p.S418R	NM_000795.3	NP_000786.1	P14416	DRD2_HUMAN	dopamine receptor D2	419					activation of protein kinase activity (GO:0032147)|adenohypophysis development (GO:0021984)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adult walking behavior (GO:0007628)|arachidonic acid secretion (GO:0050482)|associative learning (GO:0008306)|auditory behavior (GO:0031223)|axonogenesis (GO:0007409)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|branching morphogenesis of a nerve (GO:0048755)|cellular calcium ion homeostasis (GO:0006874)|cerebral cortex GABAergic interneuron migration (GO:0021853)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|feeding behavior (GO:0007631)|G-protein coupled receptor internalization (GO:0002031)|grooming behavior (GO:0007625)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|long-term memory (GO:0007616)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, sleep (GO:0042321)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of insulin secretion (GO:0046676)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neurological system process involved in regulation of systemic arterial blood pressure (GO:0001976)|neuron-neuron synaptic transmission (GO:0007270)|orbitofrontal cortex development (GO:0021769)|peristalsis (GO:0030432)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|pigmentation (GO:0043473)|positive regulation of cytokinesis (GO:0032467)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of dopamine uptake involved in synaptic transmission (GO:0051586)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of receptor internalization (GO:0002092)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of urine volume (GO:0035810)|prepulse inhibition (GO:0060134)|protein localization (GO:0008104)|regulation of cAMP metabolic process (GO:0030814)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of heart rate (GO:0002027)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of potassium ion transport (GO:0043266)|regulation of sodium ion transport (GO:0002028)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, GABAergic (GO:0032228)|release of sequestered calcium ion into cytosol (GO:0051209)|response to amphetamine (GO:0001975)|response to axon injury (GO:0048678)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to hypoxia (GO:0001666)|response to inactivity (GO:0014854)|response to iron ion (GO:0010039)|response to light stimulus (GO:0009416)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to toxic substance (GO:0009636)|sensory perception of smell (GO:0007608)|striatum development (GO:0021756)|synapse assembly (GO:0007416)|synaptic transmission, dopaminergic (GO:0001963)|temperature homeostasis (GO:0001659)|visual learning (GO:0008542)|Wnt signaling pathway (GO:0016055)	acrosomal vesicle (GO:0001669)|axon (GO:0030424)|axon terminus (GO:0043679)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|sperm flagellum (GO:0036126)|synaptic vesicle membrane (GO:0030672)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)|identical protein binding (GO:0042802)|potassium channel regulator activity (GO:0015459)			endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(18)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	39		all_cancers(61;3.91e-16)|all_epithelial(67;2.95e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000977)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0494)		BRCA - Breast invasive adenocarcinoma(274;5.77e-06)|Epithelial(105;6.66e-05)|all cancers(92;0.000307)|OV - Ovarian serous cystadenocarcinoma(223;0.216)	Acepromazine(DB01614)|Acetophenazine(DB01063)|Alizapride(DB01425)|Amantadine(DB00915)|Amisulpride(DB06288)|Amoxapine(DB00543)|Amphetamine(DB00182)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Desipramine(DB01151)|Domperidone(DB01184)|Dopamine(DB00988)|Doxepin(DB01142)|Droperidol(DB00450)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Memantine(DB01043)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Metoclopramide(DB01233)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Perphenazine(DB00850)|Pimozide(DB01100)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prochlorperazine(DB00433)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sertindole(DB06144)|Sulpiride(DB00391)|Tetrabenazine(DB04844)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GGTTCACGGCGCTGTTGACAT	0.567																																					p.S419R		Atlas-SNP	.											.	DRD2	98	.	0			c.C1257A						.						266.0	195.0	219.0					11																	113281524		2201	4296	6497	SO:0001583	missense	1813	exon8			CACGGCGCTGTTG	M29066	CCDS8361.1, CCDS8362.1	11q22-q23	2012-08-08						"""GPCR / Class A : Dopamine receptors"""	3023	protein-coding gene	gene with protein product		126450					Standard	NM_000795		Approved		uc001poa.4	P14416		ENST00000362072.3:c.1257C>A	chr11.hg19:g.113281524G>T	ENSP00000354859:p.Ser419Arg	104.0	0.0		129.0	47.0	NM_000795	Q9NZR3|Q9UPA9	Missense_Mutation	SNP	ENST00000362072.3	hg19	CCDS8361.1	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556537	0.65425	.	.	ENSG00000149295	ENST00000355319;ENST00000346454;ENST00000362072;ENST00000544518;ENST00000542968;ENST00000538967	T;T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29;-1.29	5.62	0.915	0.19366	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.93635	0.7967	H	0.99794	4.785	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.92482	0.5993	10	0.87932	D	0	.	10.3645	0.44015	0.4574:0.0:0.5426:0.0	.	418;390;419	F8VUV1;P14416-2;P14416	.;.;DRD2_HUMAN	R	421;390;419;418;419;421	ENSP00000347474:S421R;ENSP00000278597:S390R;ENSP00000354859:S419R;ENSP00000441068:S418R;ENSP00000442172:S419R;ENSP00000438215:S421R	ENSP00000278597:S390R	S	-	3	2	DRD2	112786734	0.839000	0.29477	1.000000	0.80357	0.862000	0.49288	0.011000	0.13264	0.143000	0.18926	0.655000	0.94253	AGC	.	G|1.000;A|0.000		0.567	DRD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395834.1	NM_000795	
SLC4A8	9498	hgsc.bcm.edu	37	12	51857460	51857460	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr12:51857460T>A	ENST00000453097.2	+	11	1528	c.1311T>A	c.(1309-1311)caT>caA	p.H437Q	SLC4A8_ENST00000358657.3_Missense_Mutation_p.H464Q|SLC4A8_ENST00000394856.1_Missense_Mutation_p.H384Q|SLC4A8_ENST00000535225.2_Missense_Mutation_p.H384Q|SLC4A8_ENST00000514353.3_Missense_Mutation_p.H384Q	NM_001039960.2|NM_001258401.2	NP_001035049.1|NP_001245330.1			solute carrier family 4, sodium bicarbonate cotransporter, member 8											NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(18)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|stomach(2)|urinary_tract(5)	55				BRCA - Breast invasive adenocarcinoma(357;0.15)		AGGAACCACATGGGGGTCACA	0.453																																					p.H437Q		Atlas-SNP	.											.	SLC4A8	292	.	0			c.T1311A						.						106.0	108.0	107.0					12																	51857460		2203	4300	6503	SO:0001583	missense	9498	exon11			ACCACATGGGGGT	AB018282	CCDS44890.1, CCDS58232.1, CCDS58233.1, CCDS73470.1	12q13.13	2013-05-22			ENSG00000050438	ENSG00000050438		"""Solute carriers"""	11034	protein-coding gene	gene with protein product		605024				11133997	Standard	NM_001039960		Approved	NBC3	uc001rys.2	Q2Y0W8	OTTHUMG00000169489	ENST00000453097.2:c.1311T>A	chr12.hg19:g.51857460T>A	ENSP00000405812:p.His437Gln	148.0	0.0		85.0	37.0	NM_001039960		Missense_Mutation	SNP	ENST00000453097.2	hg19	CCDS44890.1	.	.	.	.	.	.	.	.	.	.	T	13.20	2.165626	0.38217	.	.	ENSG00000050438	ENST00000535225;ENST00000358657;ENST00000453097;ENST00000394856;ENST00000319957;ENST00000514353;ENST00000551071	T;T;T;T;T	0.76060	-0.36;-0.99;-0.98;-0.36;-0.36	5.42	0.377	0.16198	.	0.100410	0.64402	D	0.000002	T	0.64649	0.2617	L	0.50333	1.59	0.50467	D	0.999876	P;B;B;B;B;B	0.35077	0.483;0.013;0.382;0.053;0.029;0.029	B;B;B;B;B;B	0.41571	0.212;0.026;0.36;0.067;0.142;0.142	T	0.50833	-0.8781	10	0.21540	T	0.41	.	4.2938	0.10892	0.1482:0.332:0.0:0.5198	.	384;464;384;437;437;437	E7EML0;Q2Y0W8-2;F5GZ31;Q2Y0W8;Q2Y0W8-3;Q2Y0W8-6	.;.;.;S4A8_HUMAN;.;.	Q	384;464;437;384;437;384;384	ENSP00000441520:H384Q;ENSP00000351483:H464Q;ENSP00000405812:H437Q;ENSP00000378325:H384Q;ENSP00000442561:H384Q	ENSP00000315789:H437Q	H	+	3	2	SLC4A8	50143727	0.381000	0.25140	1.000000	0.80357	0.986000	0.74619	-0.397000	0.07269	0.108000	0.17862	0.533000	0.62120	CAT	.	.		0.453	SLC4A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404356.1	NM_004858	
SLC26A10	65012	hgsc.bcm.edu	37	12	58019464	58019464	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr12:58019464G>T	ENST00000320442.4	+	14	1939	c.1628G>T	c.(1627-1629)gGg>gTg	p.G543V	SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	543						integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					TATGCCCTGGGGAGCCTGTTA	0.637																																					p.G543V		Atlas-SNP	.											.	SLC26A10	89	.	0			c.G1628T						.						52.0	54.0	53.0					12																	58019464		2203	4300	6503	SO:0001583	missense	65012	exon14			CCCTGGGGAGCCT		CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1628G>T	chr12.hg19:g.58019464G>T	ENSP00000320217:p.Gly543Val	37.0	0.0		40.0	16.0	NM_133489	A6NMJ2|B6ZDQ3|Q6ZWI7	Missense_Mutation	SNP	ENST00000320442.4	hg19	CCDS8949.2	.	.	.	.	.	.	.	.	.	.	.	10.63	1.403390	0.25291	.	.	ENSG00000135502	ENST00000320442	D	0.92965	-3.14	4.62	2.2	0.27929	.	.	.	.	.	T	0.79452	0.4448	N	0.08118	0	0.80722	D	1	B	0.20671	0.047	B	0.17433	0.018	T	0.66748	-0.5845	9	0.31617	T	0.26	.	4.2778	0.10818	0.6862:0.2046:0.1092:0.0	.	543	Q8NG04	S2610_HUMAN	V	543	ENSP00000320217:G543V	ENSP00000320217:G543V	G	+	2	0	SLC26A10	56305731	1.000000	0.71417	0.996000	0.52242	0.761000	0.43186	1.226000	0.32563	0.364000	0.24374	-0.484000	0.04775	GGG	.	.		0.637	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250311.2		
PITPNM2	57605	hgsc.bcm.edu	37	12	123475098	123475098	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr12:123475098C>T	ENST00000542749.1	-	15	2626	c.2563G>A	c.(2563-2565)Gcc>Acc	p.A855T	PITPNM2_ENST00000280562.5_Missense_Mutation_p.A903T|PITPNM2_ENST00000392428.1_Missense_Mutation_p.A576T|PITPNM2_ENST00000320201.4_Missense_Mutation_p.A855T			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	855	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		TCACTCTGGGCGATGCTGGAT	0.627																																					p.A855T		Atlas-SNP	.											.	PITPNM2	105	.	0			c.G2563A						.						64.0	51.0	56.0					12																	123475098		2202	4300	6502	SO:0001583	missense	57605	exon16			TCTGGGCGATGCT	AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.2563G>A	chr12.hg19:g.123475098C>T	ENSP00000437611:p.Ala855Thr	42.0	0.0		25.0	9.0	NM_020845	Q9P271	Missense_Mutation	SNP	ENST00000542749.1	hg19	CCDS9242.1	.	.	.	.	.	.	.	.	.	.	C	29.1	4.975435	0.92919	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749	T;T;T;T	0.50813	1.24;1.07;0.73;1.07	5.35	5.35	0.76521	DDHD (2);	0.063724	0.64402	D	0.000008	T	0.59169	0.2174	L	0.37800	1.135	0.58432	D	0.999993	P;D	0.89917	0.723;1.0	B;D	0.91635	0.131;0.999	T	0.50566	-0.8813	10	0.17369	T	0.5	-36.4578	19.0766	0.93165	0.0:1.0:0.0:0.0	.	903;855	Q9BZ72-2;Q9BZ72	.;PITM2_HUMAN	T	903;855;576;855	ENSP00000280562:A903T;ENSP00000322218:A855T;ENSP00000376223:A576T;ENSP00000437611:A855T	ENSP00000280562:A903T	A	-	1	0	PITPNM2	122041051	1.000000	0.71417	0.997000	0.53966	0.910000	0.53928	6.055000	0.71103	2.495000	0.84180	0.462000	0.41574	GCC	.	.		0.627	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401342.1	NM_020845	
COL4A1	1282	hgsc.bcm.edu	37	13	110822980	110822980	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr13:110822980C>A	ENST00000375820.4	-	42	3777	c.3656G>T	c.(3655-3657)gGa>gTa	p.G1219V		NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	1219	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CCCCGGCTGTCCCTGGGGCCC	0.652																																					p.G1219V		Atlas-SNP	.											.	COL4A1	372	.	0			c.G3656T						.						23.0	28.0	26.0					13																	110822980		2203	4300	6503	SO:0001583	missense	1282	exon42			GGCTGTCCCTGGG	J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.3656G>T	chr13.hg19:g.110822980C>A	ENSP00000364979:p.Gly1219Val	85.0	0.0		187.0	47.0	NM_001845	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Missense_Mutation	SNP	ENST00000375820.4	hg19	CCDS9511.1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.299205	0.60195	.	.	ENSG00000187498	ENST00000375815;ENST00000375820;ENST00000397198	D	0.99488	-6.0	5.07	4.2	0.49525	.	0.115129	0.64402	D	0.000017	D	0.99677	0.9879	H	0.96518	3.835	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97501	1.0060	10	0.87932	D	0	.	15.2375	0.73441	0.0:0.8586:0.1413:0.0	.	1219	P02462	CO4A1_HUMAN	V	862;1219;868	ENSP00000364979:G1219V	ENSP00000364973:G862V	G	-	2	0	COL4A1	109620981	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	7.171000	0.77595	1.067000	0.40740	0.650000	0.86243	GGA	.	.		0.652	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000045759.3		
FOXG1	2290	hgsc.bcm.edu	37	14	29237416	29237416	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr14:29237416T>A	ENST00000313071.4	+	1	1130	c.931T>A	c.(931-933)Tcg>Acg	p.S311T	RP11-966I7.1_ENST00000546560.1_RNA|RP11-966I7.1_ENST00000551395.1_RNA|FOXG1_ENST00000382535.3_Missense_Mutation_p.S311T|RP11-966I7.1_ENST00000549487.1_RNA	NM_005249.4	NP_005240.3	P55316	FOXG1_HUMAN	forkhead box G1	311				RAGSLYWPMSPFLSLHHPR -> APAPSTGPCRPSCPCTTP (in Ref. 1; CAA52240 and 2; CAA55038). {ECO:0000305}.	aging (GO:0007568)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|dorsal/ventral pattern formation (GO:0009953)|inner ear morphogenesis (GO:0042472)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron fate determination (GO:0048664)|positive regulation of cell cycle (GO:0045787)|positive regulation of neuroblast proliferation (GO:0002052)|pyramidal neuron migration (GO:0021852)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(2)	43			LUAD - Lung adenocarcinoma(48;0.011)|Lung(238;0.0575)	GBM - Glioblastoma multiforme(265;0.00413)		CTGGCCCATGTCGCCCTTCCT	0.687																																					p.S311T		Atlas-SNP	.											.	FOXG1	92	.	0			c.T931A						.						59.0	70.0	66.0					14																	29237416		2203	4300	6503	SO:0001583	missense	2290	exon1			CCCATGTCGCCCT		CCDS9636.1	14q11-q13	2007-10-05	2007-05-16	2007-05-16	ENSG00000176165	ENSG00000176165		"""Forkhead boxes"""	3811	protein-coding gene	gene with protein product		164874	"""forkhead box G1B"", ""forkhead box G1C"", ""forkhead box G1A"""	FKHL2, FOXG1B, FKHL4, FKH2, FKHL1, FOXG1C, FKHL3, FOXG1A		7959731, 17260156	Standard	NM_005249		Approved	HFK2, QIN, BF1, HFK1, HFK3, HBF-3	uc001wqe.4	P55316	OTTHUMG00000140187	ENST00000313071.4:c.931T>A	chr14.hg19:g.29237416T>A	ENSP00000339004:p.Ser311Thr	89.0	0.0		50.0	10.0	NM_005249	A6NFY2|P55315|Q14488|Q86XT7	Missense_Mutation	SNP	ENST00000313071.4	hg19	CCDS9636.1	.	.	.	.	.	.	.	.	.	.	T	18.12	3.552654	0.65425	.	.	ENSG00000176165	ENST00000382535;ENST00000313071	D;D	0.94232	-3.38;-3.38	4.19	4.19	0.49359	.	0.144430	0.47852	U	0.000215	D	0.88599	0.6480	L	0.29908	0.895	0.58432	D	0.999992	B	0.22683	0.073	B	0.26094	0.066	D	0.84979	0.0887	10	0.35671	T	0.21	.	12.8951	0.58095	0.0:0.0:0.0:1.0	.	311	P55316	FOXG1_HUMAN	T	311	ENSP00000371975:S311T;ENSP00000339004:S311T	ENSP00000339004:S311T	S	+	1	0	FOXG1	28307167	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.066000	0.64351	1.522000	0.49001	0.260000	0.18958	TCG	.	.		0.687	FOXG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276559.3		
NID2	22795	hgsc.bcm.edu	37	14	52520493	52520493	+	Silent	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr14:52520493T>C	ENST00000216286.5	-	5	1232	c.1233A>G	c.(1231-1233)ccA>ccG	p.P411P	NID2_ENST00000541773.1_Silent_p.P358P	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	411					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GGTACGGTGGTGGGGTTTCCC	0.547																																					p.P411P		Atlas-SNP	.											.	NID2	201	.	0			c.A1233G						.						103.0	92.0	95.0					14																	52520493		2203	4300	6503	SO:0001819	synonymous_variant	22795	exon5			CGGTGGTGGGGTT	AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1233A>G	chr14.hg19:g.52520493T>C		152.0	0.0		104.0	35.0	NM_007361	A8K6I7|B4DU19|O43710	Silent	SNP	ENST00000216286.5	hg19	CCDS9706.1																																																																																			.	.		0.547	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276888.1		
UNC79	57578	hgsc.bcm.edu	37	14	94173074	94173074	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr14:94173074C>T	ENST00000393151.2	+	50	7732	c.7732C>T	c.(7732-7734)Cgc>Tgc	p.R2578C	UNC79_ENST00000555664.1_Missense_Mutation_p.R2539C|UNC79_ENST00000553484.1_Missense_Mutation_p.R2600C|UNC79_ENST00000256339.4_Missense_Mutation_p.R2401C			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	2578					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						ACTCCAGCTTCGCCTCCAGGC	0.587																																					p.R2401C		Atlas-SNP	.											.	UNC79	366	.	0			c.C7201T						.						71.0	77.0	75.0					14																	94173074		2203	4300	6503	SO:0001583	missense	57578	exon50			CAGCTTCGCCTCC	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.7732C>T	chr14.hg19:g.94173074C>T	ENSP00000376858:p.Arg2578Cys	124.0	0.0		93.0	35.0	NM_020818	B5MDL6|Q6ZUT7	Missense_Mutation	SNP	ENST00000393151.2	hg19		.	.	.	.	.	.	.	.	.	.	C	20.9	4.068233	0.76301	.	.	ENSG00000133958	ENST00000256339;ENST00000555664;ENST00000553484;ENST00000393151;ENST00000393153	T;T;T;T	0.33438	1.41;1.46;1.41;1.41	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.58623	0.2135	M	0.69823	2.125	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59300	-0.7480	10	0.87932	D	0	-19.5361	20.0407	0.97588	0.0:1.0:0.0:0.0	.	2600	C9JQL1	.	C	2401;2539;2600;2578;2600	ENSP00000256339:R2401C;ENSP00000450868:R2539C;ENSP00000451360:R2600C;ENSP00000376858:R2578C	ENSP00000256339:R2401C	R	+	1	0	KIAA1409	93242827	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.920000	0.70017	2.746000	0.94184	0.561000	0.74099	CGC	.	.		0.587	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
AHNAK2	113146	hgsc.bcm.edu	37	14	105415678	105415678	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr14:105415678C>T	ENST00000333244.5	-	7	6229	c.6110G>A	c.(6109-6111)aGc>aAc	p.S2037N	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2037						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGCTGAATGCTGAGGTCAGT	0.657																																					p.S2037N		Atlas-SNP	.											.	AHNAK2	719	.	0			c.G6110A						.						105.0	71.0	82.0					14																	105415678		1923	4055	5978	SO:0001583	missense	113146	exon7			TGAATGCTGAGGT	AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.6110G>A	chr14.hg19:g.105415678C>T	ENSP00000353114:p.Ser2037Asn	135.0	0.0		128.0	37.0	NM_138420	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	ENST00000333244.5	hg19	CCDS45177.1	.	.	.	.	.	.	.	.	.	.	-	9.084	0.999954	0.19121	.	.	ENSG00000185567	ENST00000333244	T	0.00873	5.59	3.87	1.93	0.25924	.	.	.	.	.	T	0.02047	0.0064	L	0.45470	1.425	0.09310	N	1	D	0.63046	0.992	P	0.59012	0.85	T	0.51036	-0.8756	9	0.20046	T	0.44	-24.5028	6.8111	0.23805	0.0:0.5564:0.3481:0.0955	.	2037	Q8IVF2	AHNK2_HUMAN	N	2037	ENSP00000353114:S2037N	ENSP00000353114:S2037N	S	-	2	0	AHNAK2	104486723	.	.	0.001000	0.08648	0.034000	0.12701	.	.	0.119000	0.18210	-0.494000	0.04653	AGC	.	.		0.657	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000410300.1	NM_138420	
CHRNA7	1139	hgsc.bcm.edu	37	15	32323130	32323130	+	Missense_Mutation	SNP	C	C	A	rs199819119		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr15:32323130C>A	ENST00000306901.3	+	2	182	c.85C>A	c.(85-87)Ctt>Att	p.L29I	CHRNA7_ENST00000454250.3_Missense_Mutation_p.L58I|CHRNA7_ENST00000455693.2_5'UTR	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	29					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	CCAGAGGAAGCTTTACAAGGA	0.617																																					p.L58I	Esophageal Squamous(193;529 2900 40232 43193)	Atlas-SNP	.											.	CHRNA7	57	.	0			c.C172A						.						60.0	57.0	58.0					15																	32323130		2201	4300	6501	SO:0001583	missense	1139	exon2			AGGAAGCTTTACA	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.85C>A	chr15.hg19:g.32323130C>A	ENSP00000303727:p.Leu29Ile	76.0	0.0		83.0	53.0	NM_001190455	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Missense_Mutation	SNP	ENST00000306901.3	hg19	CCDS10027.1	.	.	.	.	.	.	.	.	.	.	C	28.1	4.888069	0.91814	.	.	ENSG00000175344	ENST00000454250;ENST00000306901;ENST00000449991	D;D	0.83506	-1.73;-1.73	4.41	4.41	0.53225	Neurotransmitter-gated ion-channel ligand-binding (3);	0.076629	0.53938	N	0.000046	D	0.92984	0.7767	M	0.94063	3.49	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.998	D;D;D	0.97110	0.994;0.999;1.0	D	0.94747	0.7924	10	0.87932	D	0	.	14.8598	0.70372	0.0:1.0:0.0:0.0	.	29;45;29	F5H8K5;B1N7F6;P36544	.;.;ACHA7_HUMAN	I	58;29;29	ENSP00000407546:L58I;ENSP00000303727:L29I	ENSP00000303727:L29I	L	+	1	0	CHRNA7	30110422	1.000000	0.71417	0.998000	0.56505	0.980000	0.70556	6.789000	0.75110	2.190000	0.69967	0.491000	0.48974	CTT	.	.		0.617	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2		
TICRR	90381	hgsc.bcm.edu	37	15	90145127	90145127	+	Silent	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr15:90145127A>G	ENST00000268138.7	+	12	2592	c.2487A>G	c.(2485-2487)tcA>tcG	p.S829S	TICRR_ENST00000560985.1_Silent_p.S828S			Q7Z2Z1	TICRR_HUMAN	TOPBP1-interacting checkpoint and replication regulator	829					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|formation of translation preinitiation complex (GO:0001731)|mitotic DNA replication checkpoint (GO:0033314)|regulation of DNA-dependent DNA replication initiation (GO:0030174)|response to ionizing radiation (GO:0010212)	nucleus (GO:0005634)	chromatin binding (GO:0003682)										CTTTTTTGTCAAGTGCTCGTA	0.448																																					p.S829S		Atlas-SNP	.											.	.	.	.	0			c.A2487G						.						126.0	116.0	119.0					15																	90145127		1922	4136	6058	SO:0001819	synonymous_variant	90381	exon12			TTTGTCAAGTGCT	AK123612	CCDS10352.2	15q26.1	2012-07-11	2012-07-11	2012-07-11	ENSG00000140534	ENSG00000140534			28704	protein-coding gene	gene with protein product	"""TOPBP1-interacting replication-stimulating protein"", ""SLD3 homolog (S. cerevisiae)"""	613298	"""chromosome 15 open reading frame 42"""	C15orf42		20116089, 20080954	Standard	NM_152259		Approved	MGC45866, FLJ41618, Treslin, SLD3	uc002boe.3	Q7Z2Z1	OTTHUMG00000149648	ENST00000268138.7:c.2487A>G	chr15.hg19:g.90145127A>G		102.0	0.0		100.0	32.0	NM_152259	B2RE07|B3KVV9|D3IUT4|Q8N4X8|Q8NCH6|Q9BU55	Silent	SNP	ENST00000268138.7	hg19	CCDS10352.2																																																																																			.	.		0.448	TICRR-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000312856.1	NM_152259	
ABCC12	94160	hgsc.bcm.edu	37	16	48173219	48173219	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr16:48173219T>C	ENST00000311303.3	-	5	1031	c.686A>G	c.(685-687)tAt>tGt	p.Y229C	ABCC12_ENST00000416054.1_Missense_Mutation_p.Y229C|ABCC12_ENST00000448542.1_Missense_Mutation_p.Y229C	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	229	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				AAACAAAGAATAGCTATCACT	0.453																																					p.Y229C		Atlas-SNP	.											.	ABCC12	190	.	0			c.A686G						.						107.0	97.0	101.0					16																	48173219		2201	4300	6501	SO:0001583	missense	94160	exon5			AAAGAATAGCTAT	AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.686A>G	chr16.hg19:g.48173219T>C	ENSP00000311030:p.Tyr229Cys	165.0	0.0		172.0	46.0	NM_033226	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	ENST00000311303.3	hg19	CCDS10730.1	.	.	.	.	.	.	.	.	.	.	T	16.97	3.268187	0.59540	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000416054	D;D;D	0.89810	-2.57;-2.57;-2.57	5.88	5.88	0.94601	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.265286	0.38778	N	0.001580	D	0.91209	0.7230	L	0.44542	1.39	0.51233	D	0.999919	D;P	0.61697	0.99;0.89	P;P	0.61275	0.879;0.886	D	0.91565	0.5267	10	0.54805	T	0.06	.	15.284	0.73814	0.0:0.0:0.0:1.0	.	229;229	Q96J65-2;Q96J65	.;MRP9_HUMAN	C	229	ENSP00000311030:Y229C;ENSP00000401855:Y229C;ENSP00000413046:Y229C	ENSP00000311030:Y229C	Y	-	2	0	ABCC12	46730720	1.000000	0.71417	0.994000	0.49952	0.485000	0.33311	4.703000	0.61824	2.239000	0.73571	0.533000	0.62120	TAT	.	.		0.453	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256837.1	NM_033226	
PHF23	79142	hgsc.bcm.edu	37	17	7139048	7139048	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:7139048A>C	ENST00000320316.3	-	5	1335	c.1109T>G	c.(1108-1110)aTt>aGt	p.I370S	PHF23_ENST00000571362.1_Missense_Mutation_p.I303S|PHF23_ENST00000454255.2_Missense_Mutation_p.I366S|DVL2_ENST00000005340.5_5'Flank|PHF23_ENST00000576955.1_Missense_Mutation_p.I240S|DVL2_ENST00000575458.1_5'Flank|PHF23_ENST00000570753.1_5'Flank	NM_001284518.1|NM_024297.2	NP_001271447.1|NP_077273.2	Q9BUL5	PHF23_HUMAN	PHD finger protein 23	370							zinc ion binding (GO:0008270)			breast(4)|kidney(2)|large_intestine(6)|lung(3)	15						GGTCTTCTTAATCTTAGCACA	0.557																																					p.I370S		Atlas-SNP	.											.	PHF23	38	.	0			c.T1109G						.						149.0	150.0	150.0					17																	7139048		1924	4133	6057	SO:0001583	missense	79142	exon5			TTCTTAATCTTAG	AK122791	CCDS42250.1, CCDS67143.1, CCDS67144.1	17p13.1	2014-08-13			ENSG00000040633	ENSG00000040633		"""Zinc fingers, PHD-type"""	28428	protein-coding gene	gene with protein product		612910					Standard	NM_024297		Approved	MGC2941, FLJ16355	uc002gfa.3	Q9BUL5	OTTHUMG00000177972	ENST00000320316.3:c.1109T>G	chr17.hg19:g.7139048A>C	ENSP00000322579:p.Ile370Ser	57.0	0.0		30.0	17.0	NM_024297	A1DZ74|B3KVH8|B4DLK6|D3DTN4|Q8IZK0|Q96HG7|Q9H5X0	Missense_Mutation	SNP	ENST00000320316.3	hg19	CCDS42250.1	.	.	.	.	.	.	.	.	.	.	A	18.67	3.673403	0.67928	.	.	ENSG00000040633	ENST00000320316;ENST00000454255	D;D	0.85556	-2.0;-2.0	5.19	5.19	0.71726	Zinc finger, PHD-finger (1);Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	D	0.94522	0.8236	H	0.96365	3.81	0.58432	D	0.999993	D;D	0.89917	1.0;0.992	D;D	0.91635	0.999;0.989	D	0.95806	0.8837	10	0.87932	D	0	-6.5648	12.9762	0.58538	1.0:0.0:0.0:0.0	.	303;370	B4DLK6;Q9BUL5	.;PHF23_HUMAN	S	370;366	ENSP00000322579:I370S;ENSP00000414607:I366S	ENSP00000322579:I370S	I	-	2	0	PHF23	7079772	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	8.561000	0.90715	1.947000	0.56498	0.260000	0.18958	ATT	.	.		0.557	PHF23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440047.1	NM_024297	
KLHL10	317719	hgsc.bcm.edu	37	17	39998197	39998197	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:39998197C>T	ENST00000293303.4	+	2	470	c.317C>T	c.(316-318)cCg>cTg	p.P106L	KLHL10_ENST00000485613.1_3'UTR	NM_152467.3	NP_689680.2	Q6JEL2	KLH10_HUMAN	kelch-like family member 10	106	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell morphogenesis (GO:0000902)|fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia morphogenesis (GO:0048808)|male gonad development (GO:0008584)|protein ubiquitination (GO:0016567)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	26		Breast(137;0.000162)				CCTATCACACCGGACAATGTG	0.483																																					p.P106L		Atlas-SNP	.											.	KLHL10	67	.	0			c.C317T						.						125.0	117.0	119.0					17																	39998197		1990	4166	6156	SO:0001583	missense	317719	exon2			TCACACCGGACAA	AK057224	CCDS42340.1	17q21.2	2013-01-30	2013-01-30		ENSG00000161594	ENSG00000161594		"""Kelch-like"", ""BTB/POZ domain containing"""	18829	protein-coding gene	gene with protein product		608778	"""kelch-like 10 (Drosophila)"""				Standard	NM_152467		Approved	FLJ32662	uc010cxr.3	Q6JEL2	OTTHUMG00000152510	ENST00000293303.4:c.317C>T	chr17.hg19:g.39998197C>T	ENSP00000293303:p.Pro106Leu	187.0	0.0		235.0	52.0	NM_152467	Q6NW28|Q96MC0	Missense_Mutation	SNP	ENST00000293303.4	hg19	CCDS42340.1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647934	0.47258	.	.	ENSG00000161594	ENST00000293303;ENST00000438813	T;T	0.66280	-0.2;-0.2	5.58	5.58	0.84498	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.284900	0.38548	N	0.001643	T	0.42471	0.1204	N	0.14661	0.345	0.44261	D	0.997118	P;P	0.36378	0.529;0.55	B;B	0.25140	0.04;0.058	T	0.38542	-0.9656	9	.	.	.	.	18.1317	0.89604	0.0:1.0:0.0:0.0	.	100;106	B4DXV2;Q6JEL2	.;KLH10_HUMAN	L	106;100	ENSP00000293303:P106L;ENSP00000416221:P100L	.	P	+	2	0	KLHL10	37251723	0.000000	0.05858	0.984000	0.44739	0.934000	0.57294	0.559000	0.23485	2.620000	0.88729	0.655000	0.94253	CCG	.	.		0.483	KLHL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000326535.1	NM_152467	
DHX8	1659	hgsc.bcm.edu	37	17	41585264	41585264	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:41585264C>A	ENST00000262415.3	+	15	2269	c.2197C>A	c.(2197-2199)Ccc>Acc	p.P733T	DHX8_ENST00000540306.1_Missense_Mutation_p.P733T	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	733	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		CTATGAAGCTCCCATTTTCAC	0.438																																					p.P733T	NSCLC(56;1548 1661 49258 49987)	Atlas-SNP	.											.	DHX8	98	.	0			c.C2197A						.						119.0	114.0	116.0					17																	41585264		2203	4300	6503	SO:0001583	missense	1659	exon15			GAAGCTCCCATTT	D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2197C>A	chr17.hg19:g.41585264C>A	ENSP00000262415:p.Pro733Thr	108.0	0.0		171.0	107.0	NM_004941		Missense_Mutation	SNP	ENST00000262415.3	hg19	CCDS11464.1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620732	0.87460	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.03242	4.0;4.0	6.08	6.08	0.98989	DEAD-like helicase (2);	0.049309	0.85682	D	0.000000	T	0.29817	0.0745	H	0.94222	3.51	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.74023	0.982;0.916	T	0.23868	-1.0176	10	0.87932	D	0	.	19.6603	0.95864	0.0:1.0:0.0:0.0	.	733;733	F5H658;Q14562	.;DHX8_HUMAN	T	733	ENSP00000437886:P733T;ENSP00000262415:P733T	ENSP00000262415:P733T	P	+	1	0	DHX8	38940790	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.734000	0.84928	2.894000	0.99253	0.591000	0.81541	CCC	.	.		0.438	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000453485.1		
EFTUD2	9343	hgsc.bcm.edu	37	17	42956967	42956967	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:42956967C>T	ENST00000426333.2	-	9	956	c.659G>A	c.(658-660)cGc>cAc	p.R220H	EFTUD2_ENST00000591382.1_Missense_Mutation_p.R220H|EFTUD2_ENST00000592576.1_Missense_Mutation_p.R210H|EFTUD2_ENST00000402521.3_Missense_Mutation_p.R185H	NM_001142605.1|NM_001258354.1|NM_004247.3	NP_001136077.1|NP_001245283.1|NP_004238.3	Q15029	U5S1_HUMAN	elongation factor Tu GTP binding domain containing 2	220	tr-type G. {ECO:0000255|PROSITE- ProRule:PRU01059}.				gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	32		Prostate(33;0.109)				ATCTGAGATGCGCAAGCCAGC	0.478																																					p.R220H	Ovarian(10;65 485 10258 29980 30707)	Atlas-SNP	.											.	EFTUD2	85	.	0			c.G659A						.						110.0	95.0	100.0					17																	42956967		2203	4300	6503	SO:0001583	missense	9343	exon9			GAGATGCGCAAGC	D21163	CCDS11489.1, CCDS45707.1, CCDS59295.1	17q21.31	2014-08-12			ENSG00000108883	ENSG00000108883			30858	protein-coding gene	gene with protein product	"""U5 snRNP specific protein, 116 kD"""	603892				9233818	Standard	NM_004247		Approved	U5-116KD, Snrp116, Snu114, SNRNP116	uc002ihn.2	Q15029	OTTHUMG00000179865	ENST00000426333.2:c.659G>A	chr17.hg19:g.42956967C>T	ENSP00000392094:p.Arg220His	116.0	0.0		110.0	70.0	NM_004247	B4DK30|B4DMC0|D3DX58|K7EJ81|Q9BUR0	Missense_Mutation	SNP	ENST00000426333.2	hg19	CCDS11489.1	.	.	.	.	.	.	.	.	.	.	C	36	5.655679	0.96724	.	.	ENSG00000108883	ENST00000426333;ENST00000262414;ENST00000402521	T;T	0.80214	-1.35;-1.35	6.02	6.02	0.97574	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	D	0.000000	D	0.92925	0.7749	M	0.93150	3.385	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.99	D	0.93671	0.6990	10	0.87932	D	0	-6.9932	20.5373	0.99239	0.0:1.0:0.0:0.0	.	210;220	B4DMC0;Q15029	.;U5S1_HUMAN	H	220;210;185	ENSP00000392094:R220H;ENSP00000385873:R185H	ENSP00000262414:R210H	R	-	2	0	EFTUD2	40312493	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.857000	0.98124	0.650000	0.86243	CGC	.	.		0.478	EFTUD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448672.1	NM_004247	
OSBPL7	114881	hgsc.bcm.edu	37	17	45886525	45886525	+	Missense_Mutation	SNP	C	C	A	rs376859496		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:45886525C>A	ENST00000007414.3	-	20	2278	c.2087G>T	c.(2086-2088)cGt>cTt	p.R696L	OSBPL7_ENST00000392507.3_Missense_Mutation_p.R696L	NM_145798.2	NP_665741.1	Q9BZF2	OSBL7_HUMAN	oxysterol binding protein-like 7	696					cellular response to cholesterol (GO:0071397)|lipid transport (GO:0006869)|positive regulation of proteasomal protein catabolic process (GO:1901800)	autophagic vacuole (GO:0005776)|cytosol (GO:0005829)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)	cholesterol binding (GO:0015485)	p.R696H(1)		autonomic_ganglia(1)|endometrium(6)|kidney(2)|large_intestine(5)|liver(2)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	32						GTGGAGGACACGGCCACTCCG	0.637																																					p.R696L		Atlas-SNP	.											OSBPL7,NS,carcinoma,0,1	OSBPL7	65	.	1	Substitution - Missense(1)	endometrium(1)	c.G2087T						.						51.0	55.0	54.0					17																	45886525		2203	4300	6503	SO:0001583	missense	114881	exon20			AGGACACGGCCAC	AF392446	CCDS11515.1	17q21	2013-01-10				ENSG00000006025		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16387	protein-coding gene	gene with protein product		606735				14593528, 11735225	Standard	NM_145798		Approved	ORP7, MGC71150	uc002ilx.1	Q9BZF2		ENST00000007414.3:c.2087G>T	chr17.hg19:g.45886525C>A	ENSP00000007414:p.Arg696Leu	74.0	0.0		88.0	54.0	NM_145798	D3DTT6|Q6PIV6	Missense_Mutation	SNP	ENST00000007414.3	hg19	CCDS11515.1	.	.	.	.	.	.	.	.	.	.	C	18.82	3.705442	0.68615	.	.	ENSG00000006025	ENST00000007414;ENST00000392507	T;T	0.30448	1.53;1.53	5.0	5.0	0.66597	.	0.217614	0.43747	D	0.000529	T	0.34774	0.0909	L	0.48935	1.535	0.31875	N	0.619213	D	0.54601	0.967	P	0.52309	0.695	T	0.46105	-0.9215	10	0.51188	T	0.08	-15.9196	7.7644	0.28972	0.0:0.8204:0.0:0.1796	.	696	Q9BZF2	OSBL7_HUMAN	L	696	ENSP00000007414:R696L;ENSP00000376295:R696L	ENSP00000007414:R696L	R	-	2	0	OSBPL7	43241524	0.321000	0.24625	0.994000	0.49952	0.966000	0.64601	0.793000	0.26944	2.333000	0.79357	0.561000	0.74099	CGT	.	.		0.637	OSBPL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441367.1	NM_017731	
RSAD1	55316	hgsc.bcm.edu	37	17	48559662	48559662	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:48559662T>G	ENST00000258955.2	+	4	770	c.685T>G	c.(685-687)Tcc>Gcc	p.S229A		NM_018346.1	NP_060816.1	Q9HA92	RSAD1_HUMAN	radical S-adenosyl methionine domain containing 1	229					porphyrin-containing compound biosynthetic process (GO:0006779)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|coproporphyrinogen oxidase activity (GO:0004109)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	16	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			CTACCAGCTGTCCCTGGAGCG	0.687											OREG0024567	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.S229A		Atlas-SNP	.											.	RSAD1	36	.	0			c.T685G						.						64.0	64.0	64.0					17																	48559662		2203	4299	6502	SO:0001583	missense	55316	exon4			CAGCTGTCCCTGG	AK002026	CCDS11569.1	17q21.33	2004-11-08			ENSG00000136444	ENSG00000136444			25634	protein-coding gene	gene with protein product						12477932	Standard	NM_018346		Approved	FLJ11164	uc002iqw.1	Q9HA92	OTTHUMG00000162126	ENST00000258955.2:c.685T>G	chr17.hg19:g.48559662T>G	ENSP00000258955:p.Ser229Ala	119.0	0.0	955	140.0	81.0	NM_018346	B4DMW0|Q53HV8|Q86VC4|Q9BRY7|Q9NUS7	Missense_Mutation	SNP	ENST00000258955.2	hg19	CCDS11569.1	.	.	.	.	.	.	.	.	.	.	T	17.06	3.293146	0.60086	.	.	ENSG00000136444	ENST00000258955	T	0.23147	1.92	5.37	-0.612	0.11597	Elongator protein 3/MiaB/NifB (1);Radical SAM, alpha/beta horseshoe (1);	0.255459	0.36482	N	0.002576	T	0.19685	0.0473	L	0.41710	1.295	0.24466	N	0.99441	B	0.18461	0.028	B	0.13407	0.009	T	0.28586	-1.0039	10	0.87932	D	0	-9.6367	11.9622	0.53015	0.6486:0.0:0.0:0.3514	.	229	Q9HA92	RSAD1_HUMAN	A	229	ENSP00000258955:S229A	ENSP00000258955:S229A	S	+	1	0	RSAD1	45914661	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	1.533000	0.36040	-0.021000	0.14009	0.533000	0.62120	TCC	.	.		0.687	RSAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367413.1	NM_018346	
ABCA9	10350	hgsc.bcm.edu	37	17	66978770	66978770	+	Silent	SNP	C	C	T			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:66978770C>T	ENST00000340001.4	-	37	4864	c.4653G>A	c.(4651-4653)ctG>ctA	p.L1551L	ABCA9_ENST00000453985.2_Silent_p.L1513L|ABCA9_ENST00000370732.2_3'UTR	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1551					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					TATAGACCATCAGGGAGGAGA	0.463																																					p.L1551L		Atlas-SNP	.											.	ABCA9	192	.	0			c.G4653A						.						111.0	104.0	106.0					17																	66978770		2203	4300	6503	SO:0001819	synonymous_variant	10350	exon37			GACCATCAGGGAG	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.4653G>A	chr17.hg19:g.66978770C>T		109.0	0.0		119.0	30.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Silent	SNP	ENST00000340001.4	hg19	CCDS11681.1																																																																																			.	.		0.463	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
EVPL	2125	hgsc.bcm.edu	37	17	74015086	74015086	+	Missense_Mutation	SNP	C	C	T	rs201678162		TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:74015086C>T	ENST00000301607.3	-	11	1446	c.1193G>A	c.(1192-1194)cGa>cAa	p.R398Q	EVPL_ENST00000586740.1_Missense_Mutation_p.R398Q	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	398	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						ATCCCGGCTTCGCCGCTGCAG	0.672																																					p.R398Q		Atlas-SNP	.											.	EVPL	155	.	0			c.G1193A						.	C	GLN/ARG	0,4402		0,0,2201	17.0	19.0	18.0		1193	-4.5	0.0	17		18	1,8597		0,1,4298	yes	missense	EVPL	NM_001988.2	43	0,1,6499	TT,TC,CC		0.0116,0.0,0.0077	benign	398/2034	74015086	1,12999	2201	4299	6500	SO:0001583	missense	2125	exon11			CGGCTTCGCCGCT	U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1193G>A	chr17.hg19:g.74015086C>T	ENSP00000301607:p.Arg398Gln	108.0	0.0		121.0	45.0	NM_001988	A0AUV5	Missense_Mutation	SNP	ENST00000301607.3	hg19	CCDS11737.1	.	.	.	.	.	.	.	.	.	.	C	10.83	1.461988	0.26248	0.0	1.16E-4	ENSG00000167880	ENST00000301607	T	0.69685	-0.42	5.03	-4.47	0.03525	.	0.601694	0.16236	N	0.223365	T	0.49098	0.1537	L	0.47016	1.485	0.09310	N	1	B;B	0.27286	0.051;0.174	B;B	0.16289	0.013;0.015	T	0.29971	-0.9994	10	0.59425	D	0.04	-8.2166	6.6081	0.22735	0.1207:0.3504:0.0:0.5289	.	398;398	B7ZLH8;Q92817	.;EVPL_HUMAN	Q	398	ENSP00000301607:R398Q	ENSP00000301607:R398Q	R	-	2	0	EVPL	71526681	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-1.096000	0.03353	-1.051000	0.03226	-0.500000	0.04577	CGA	.	.		0.672	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000449483.1	NM_001988	
FZR1	51343	hgsc.bcm.edu	37	19	3531769	3531769	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr19:3531769G>A	ENST00000395095.3	+	8	778	c.778G>A	c.(778-780)Gca>Aca	p.A260T	FZR1_ENST00000313639.8_Missense_Mutation_p.A171T|FZR1_ENST00000441788.2_Missense_Mutation_p.A260T	NM_001136198.1	NP_001129670.1	Q9UM11	FZR_HUMAN	fizzy/cell division cycle 20 related 1 (Drosophila)	260					activation of anaphase-promoting complex activity (GO:0051488)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|lens fiber cell differentiation (GO:0070306)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell aging (GO:0090344)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of meiosis (GO:0040020)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(1)|kidney(4)|liver(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00253)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACGCAGCCGCAGGGAAGAA	0.672																																					p.A260T		Atlas-SNP	.											.	FZR1	42	.	0			c.G778A						.						61.0	60.0	60.0					19																	3531769		1907	3737	5644	SO:0001583	missense	51343	exon8			GCAGCCGCAGGGA	AF083810	CCDS12109.1, CCDS45916.1, CCDS45917.1	19p13.3	2013-01-10				ENSG00000105325		"""WD repeat domain containing"""	24824	protein-coding gene	gene with protein product		603619				9734353, 11003657	Standard	NM_016263		Approved	HCDH1, CDH1, HCDH, FZR, FZR2, KIAA1242, CDC20C	uc010dtk.2	Q9UM11		ENST00000395095.3:c.778G>A	chr19.hg19:g.3531769G>A	ENSP00000378529:p.Ala260Thr	152.0	0.0		126.0	8.0	NM_001136198	O75869|Q86U66|Q96NW8|Q9UI96|Q9ULH8|Q9UM10|Q9UNQ1|Q9Y2T8	Missense_Mutation	SNP	ENST00000395095.3	hg19	CCDS45916.1	.	.	.	.	.	.	.	.	.	.	G	16.07	3.019289	0.54576	.	.	ENSG00000105325	ENST00000441788;ENST00000395095;ENST00000313639	T;T;T	0.24151	1.87;1.87;5.27	5.18	5.18	0.71444	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.13543	0.0328	N	0.00595	-1.35	0.80722	D	1	B;P;D	0.71674	0.05;0.633;0.998	B;B;P	0.56865	0.006;0.074;0.808	T	0.33266	-0.9875	10	0.02654	T	1	-25.2369	17.2375	0.87004	0.0:0.0:1.0:0.0	.	260;171;260	Q9UM11;Q9UM11-3;Q9UM11-2	FZR_HUMAN;.;.	T	260;260;171	ENSP00000410369:A260T;ENSP00000378529:A260T;ENSP00000321800:A171T	ENSP00000321800:A171T	A	+	1	0	FZR1	3482769	1.000000	0.71417	0.280000	0.24747	0.717000	0.41224	7.687000	0.84139	2.426000	0.82243	0.561000	0.74099	GCA	.	.		0.672	FZR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452869.2	NM_016263	
CHAF1A	10036	hgsc.bcm.edu	37	19	4422571	4422571	+	Silent	SNP	G	G	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr19:4422571G>A	ENST00000301280.5	+	5	1127	c.1026G>A	c.(1024-1026)gaG>gaA	p.E342E		NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	342	Arg/Glu/Lys-rich.				cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGATCAGGAGCGTCTGGGCA	0.577								Chromatin Structure																													p.E342E		Atlas-SNP	.											.	CHAF1A	69	.	0			c.G1026A						.						34.0	31.0	32.0					19																	4422571		2197	4287	6484	SO:0001819	synonymous_variant	10036	exon5			TCAGGAGCGTCTG	U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1026G>A	chr19.hg19:g.4422571G>A		137.0	0.0		79.0	23.0	NM_005483	Q6NXG5|Q7Z7K3|Q9UJY8	Silent	SNP	ENST00000301280.5	hg19	CCDS32875.1																																																																																			.	.		0.577	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458310.2	NM_005483	
ZNF627	199692	hgsc.bcm.edu	37	19	11727702	11727702	+	Silent	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr19:11727702A>G	ENST00000361113.5	+	4	592	c.384A>G	c.(382-384)ccA>ccG	p.P128P	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						GACGTGAACCAAATGAATATC	0.448																																					p.P128P	Melanoma(112;173 1614 10731 17751 23322)	Atlas-SNP	.											.	ZNF627	43	.	0			c.A384G						.						122.0	124.0	124.0					19																	11727702		2157	4274	6431	SO:0001819	synonymous_variant	199692	exon4			TGAACCAAATGAA	AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.384A>G	chr19.hg19:g.11727702A>G		167.0	0.0		173.0	70.0	NM_145295	O14846|Q4KMP9|Q6NT81|Q9BRG4	Silent	SNP	ENST00000361113.5	hg19	CCDS42502.1																																																																																			.	.		0.448	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000458875.1	NM_145295	
PGLS	25796	hgsc.bcm.edu	37	19	17626986	17626986	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr19:17626986A>G	ENST00000252603.2	+	2	337	c.293A>G	c.(292-294)cAt>cGt	p.H98R	CTD-3131K8.3_ENST00000596192.1_RNA	NM_012088.2	NP_036220.1	O95336	6PGL_HUMAN	6-phosphogluconolactonase	98					carbohydrate metabolic process (GO:0005975)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	6-phosphogluconolactonase activity (GO:0017057)|monosaccharide binding (GO:0048029)			endometrium(1)|lung(1)	2						CTGCAGACGCATCTTCTCTCC	0.537																																					p.H98R		Atlas-SNP	.											.	PGLS	12	.	0			c.A293G						.						111.0	79.0	90.0					19																	17626986		2203	4300	6503	SO:0001583	missense	25796	exon2			AGACGCATCTTCT	AJ243972	CCDS12361.1	19p13.2	2008-02-05				ENSG00000130313	3.1.1.31		8903	protein-coding gene	gene with protein product		604951				10518023	Standard	NM_012088		Approved	6PGL	uc002ngw.3	O95336		ENST00000252603.2:c.293A>G	chr19.hg19:g.17626986A>G	ENSP00000252603:p.His98Arg	115.0	0.0		81.0	26.0	NM_012088		Missense_Mutation	SNP	ENST00000252603.2	hg19	CCDS12361.1	.	.	.	.	.	.	.	.	.	.	A	10.24	1.296777	0.23650	.	.	ENSG00000130313	ENST00000252603	T	0.41400	1.0	5.08	5.08	0.68730	Glucosamine/galactosamine-6-phosphate isomerase (1);6-phosphogluconolactonase, DevB-type (1);	0.241291	0.42821	D	0.000643	T	0.45558	0.1348	L	0.60012	1.86	0.38377	D	0.945033	P	0.35411	0.5	P	0.45232	0.474	T	0.41574	-0.9501	10	0.16896	T	0.51	-29.1705	11.2135	0.48813	1.0:0.0:0.0:0.0	.	98	O95336	6PGL_HUMAN	R	98	ENSP00000252603:H98R	ENSP00000252603:H98R	H	+	2	0	PGLS	17487986	1.000000	0.71417	1.000000	0.80357	0.030000	0.12068	5.441000	0.66569	1.889000	0.54706	0.459000	0.35465	CAT	.	.		0.537	PGLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464154.1		
SIGLEC1	6614	hgsc.bcm.edu	37	20	3679945	3679945	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr20:3679945C>A	ENST00000344754.4	-	7	1689	c.1690G>T	c.(1690-1692)Gcg>Tcg	p.A564S	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.A564S	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	564	Ig-like C2-type 5.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						CTGGAGGCCGCGGGGAGCAGG	0.672																																					p.A564S		Atlas-SNP	.											.	SIGLEC1	210	.	0			c.G1690T						.						24.0	21.0	22.0					20																	3679945		2203	4297	6500	SO:0001583	missense	6614	exon7			AGGCCGCGGGGAG	AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1690G>T	chr20.hg19:g.3679945C>A	ENSP00000341141:p.Ala564Ser	155.0	0.0		157.0	86.0	NM_023068	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	ENST00000344754.4	hg19	CCDS13060.1	.	.	.	.	.	.	.	.	.	.	C	9.316	1.056711	0.19907	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.10960	2.82;2.82	5.46	0.803	0.18691	Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin (1);Immunoglobulin-like fold (1);	0.546274	0.15423	N	0.263131	T	0.04861	0.0131	N	0.05306	-0.075	0.09310	N	1	B;B	0.24882	0.113;0.092	B;B	0.38954	0.286;0.15	T	0.48410	-0.9038	10	0.06494	T	0.89	.	3.2682	0.06873	0.1841:0.5118:0.0:0.3041	.	564;564	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	S	564	ENSP00000341141:A564S;ENSP00000202578:A564S	ENSP00000202578:A564S	A	-	1	0	SIGLEC1	3627945	0.000000	0.05858	0.004000	0.12327	0.739000	0.42172	-0.435000	0.06931	0.669000	0.31146	0.655000	0.94253	GCG	.	.		0.672	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000077761.2	NM_023068	
TP53	7157	hgsc.bcm.edu	37	17	7576863	7576863	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr17:7576863delA	ENST00000269305.4	-	9	1172	c.983delT	c.(982-984)ttcfs	p.F328fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.F328fs|TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Frame_Shift_Del_p.F328fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.F328fs|TP53_ENST00000359597.4_Frame_Shift_Del_p.F328fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	328	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		F -> L (in a sporadic cancer; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.T329fs*8(3)|p.F328S(1)|p.?(1)|p.F328fs*9(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGAAGGGTGAAATATTCTCC	0.438		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.F328fs	Pancreas(47;798 1329 9957 10801)	Atlas-INDEL	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53,sinonasal_and_nasal_cavity,lymphoid_neoplasm,0,3	TP53	33396	.	14	Whole gene deletion(8)|Insertion - Frameshift(4)|Substitution - Missense(1)|Unknown(1)	bone(4)|upper_aerodigestive_tract(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|stomach(1)|pancreas(1)	c.984delC						.						122.0	114.0	117.0					17																	7576863		2203	4300	6503	SO:0001589	frameshift_variant	7157	exon9	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	.	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.983delT	chr17.hg19:g.7576863delA	ENSP00000269305:p.Phe328fs	186.0	0.0		68.0	41.0	NM_001126112	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	ENST00000269305.4	hg19	CCDS11118.1																																																																																			.	.		0.438	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
WNK3	65267	hgsc.bcm.edu	37	X	54264775	54264776	+	Splice_Site	DEL	CT	CT	-			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	CT	CT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chrX:54264775_54264776delCT	ENST00000375159.2	-	18	4012_4013	c.4013_4014delAG	c.(4012-4014)cag>c	p.Q1338fs	WNK3_ENST00000354646.2_Splice_Site_p.Q1338fs|WNK3_ENST00000375169.3_Splice_Site_p.Q1291fs			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1338					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AGACACAAACCTGGAACCGACC	0.426																																					p.1338_1338del		Atlas-INDEL	.											.	WNK3	218	.	0			c.4014_4014del						.																																			SO:0001630	splice_region_variant	65267	exon19			.	AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4014+1AG>-	chrX.hg19:g.54264775_54264776delCT		67.0	0.0		65.0	49.0	NM_020922	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Frame_Shift_Del	DEL	ENST00000375159.2	hg19	CCDS14357.1																																																																																			.	.		0.426	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000056799.2	NM_020922	Frame_Shift_Del
TMEM165	55858	hgsc.bcm.edu	37	4	56284075	56284077	+	In_Frame_Del	DEL	CAA	CAA	-			TCGA-DD-AACE-01A-11D-A40R-10	TCGA-DD-AACE-10A-01D-A40U-10	CAA	CAA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	4b4d8378-ded6-4a8c-9839-6e437ce1d88a	ba4f8145-e3ba-4242-a382-1c87a35ed636	g.chr4:56284075_56284077delCAA	ENST00000381334.5	+	4	948_950	c.715_717delCAA	c.(715-717)caadel	p.Q239del	TMEM165_ENST00000514904.1_3'UTR|TMEM165_ENST00000506198.1_Intron|TMEM165_ENST00000542052.1_In_Frame_Del_p.Q176del	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165	239					cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			CATTTTTGTTCAAGCTCTTACAT	0.399																																					p.238_239del		Atlas-INDEL	.											.	TMEM165	12	.	0			c.714_716del						.																																			SO:0001651	inframe_deletion	55858	exon4			.	AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.715_717delCAA	chr4.hg19:g.56284075_56284077delCAA	ENSP00000370736:p.Gln239del	255.0	0.0		159.0	60.0	NM_018475	A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	In_Frame_Del	DEL	ENST00000381334.5	hg19	CCDS3499.1																																																																																			.	.		0.399	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250646.4	NM_018475	
