#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CCNL2	81669	hgsc.bcm.edu	37	1	1334013	1334013	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:1334013G>A	ENST00000400809.3	-	2	332	c.327C>T	c.(325-327)ttC>ttT	p.F109F	CCNL2_ENST00000408918.4_Silent_p.F109F|RP4-758J18.2_ENST00000448629.2_5'Flank|RP4-758J18.2_ENST00000576232.1_5'Flank|RP4-758J18.2_ENST00000444362.1_5'Flank|CCNL2_ENST00000408952.5_5'Flank	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2	109	Cyclin-like 1.				regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		TGGTATAAAAGAACCGCTGGA	0.488																																					p.F109F		Atlas-SNP	.											CCNL2_ENST00000408918,NS,carcinoma,0,2	CCNL2	54	.	0			c.C327T						.						107.0	112.0	111.0					1																	1334013		2203	4297	6500	SO:0001819	synonymous_variant	81669	exon2			ATAAAAGAACCGC	AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.327C>T	chr1.hg19:g.1334013G>A		214.0	2.0		146.0	83.0	NM_030937	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Silent	SNP	ENST00000400809.3	hg19	CCDS30557.1																																																																																			.	.		0.488	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000008146.2	NM_030937	
SPEN	23013	hgsc.bcm.edu	37	1	16255901	16255901	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:16255901A>T	ENST00000375759.3	+	11	3370	c.3166A>T	c.(3166-3168)Aga>Tga	p.R1056*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1056					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CAAACTGGACAGACTTAATAC	0.468																																					p.R1056X		Atlas-SNP	.											.	SPEN	374	.	0			c.A3166T						.						53.0	58.0	56.0					1																	16255901		2203	4300	6503	SO:0001587	stop_gained	23013	exon11			CTGGACAGACTTA		CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3166A>T	chr1.hg19:g.16255901A>T	ENSP00000364912:p.Arg1056*	190.0	0.0		182.0	69.0	NM_015001	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	ENST00000375759.3	hg19	CCDS164.1	.	.	.	.	.	.	.	.	.	.	A	41	8.983736	0.99025	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.5	5.5	0.81552	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.4715	15.7759	0.78214	1.0:0.0:0.0:0.0	.	.	.	.	X	1056	.	ENSP00000364912:R1056X	R	+	1	2	SPEN	16128488	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.977000	0.56874	2.308000	0.77769	0.533000	0.62120	AGA	.	.		0.468	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025993.1	NM_015001	
UBR4	23352	hgsc.bcm.edu	37	1	19464665	19464665	+	Silent	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:19464665C>A	ENST00000375254.3	-	60	8769	c.8742G>T	c.(8740-8742)cgG>cgT	p.R2914R	UBR4_ENST00000375226.2_Silent_p.R2890R|UBR4_ENST00000375267.2_Silent_p.R2914R|UBR4_ENST00000375217.2_Silent_p.R2907R	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	2914					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AAGCACTGCTCCGGCCAGATA	0.522																																					p.R2914R		Atlas-SNP	.											.	UBR4	415	.	0			c.G8742T						.						58.0	56.0	57.0					1																	19464665		2203	4300	6503	SO:0001819	synonymous_variant	23352	exon60			ACTGCTCCGGCCA	AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.8742G>T	chr1.hg19:g.19464665C>A		33.0	0.0		49.0	23.0	NM_020765	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	ENST00000375254.3	hg19	CCDS189.1																																																																																			.	.		0.522	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007085.1	NM_020765	
HSPG2	3339	hgsc.bcm.edu	37	1	22201403	22201403	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:22201403T>A	ENST00000374695.3	-	26	3474	c.3395A>T	c.(3394-3396)tAc>tTc	p.Y1132F		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	1132	Laminin EGF-like 5; second part. {ECO:0000255|PROSITE-ProRule:PRU00460}.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	CGGCCCACGGTACCCGGGTGG	0.692																																					p.Y1132F		Atlas-SNP	.											.	HSPG2	311	.	0			c.A3395T						.						34.0	32.0	33.0					1																	22201403		2200	4299	6499	SO:0001583	missense	3339	exon26			CCACGGTACCCGG	M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.3395A>T	chr1.hg19:g.22201403T>A	ENSP00000363827:p.Tyr1132Phe	164.0	0.0		153.0	60.0	NM_005529	Q16287|Q5SZI3|Q9H3V5	Missense_Mutation	SNP	ENST00000374695.3	hg19	CCDS30625.1	.	.	.	.	.	.	.	.	.	.	T	19.34	3.808435	0.70797	.	.	ENSG00000142798	ENST00000374695	T	0.61510	0.1	5.27	4.12	0.48240	EGF-like, laminin (2);EGF-like region, conserved site (2);	0.218239	0.23282	N	0.049895	T	0.76849	0.4045	M	0.86864	2.845	0.49915	D	0.999833	D	0.63046	0.992	D	0.76071	0.987	T	0.78473	-0.2190	10	0.72032	D	0.01	.	10.5147	0.44883	0.0:0.0:0.1631:0.8369	.	1132	P98160	PGBM_HUMAN	F	1132	ENSP00000363827:Y1132F	ENSP00000363827:Y1132F	Y	-	2	0	HSPG2	22073990	1.000000	0.71417	1.000000	0.80357	0.532000	0.34746	4.939000	0.63526	0.818000	0.34468	0.418000	0.28097	TAC	.	.		0.692	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000007598.1	NM_005529	
ZMYM6	9204	hgsc.bcm.edu	37	1	35452801	35452801	+	Silent	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:35452801T>A	ENST00000357182.4	-	16	4109	c.3882A>T	c.(3880-3882)tcA>tcT	p.S1294S	ZMYM6_ENST00000373340.2_Intron|ZMYM6_ENST00000493328.1_5'UTR|ZMYM6_ENST00000487874.1_Intron|ZMYM6NB_ENST00000373337.3_5'Flank|RP11-244H3.1_ENST00000417456.1_RNA	NM_007167.3	NP_009098.3	O95789	ZMYM6_HUMAN	zinc finger, MYM-type 6	1294					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(10)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	44		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.13)				TTTTTTGTTTTGACTCAGTCA	0.373																																					p.S1294S		Atlas-SNP	.											.	ZMYM6	110	.	0			c.A3882T						.						70.0	66.0	67.0					1																	35452801		1822	4077	5899	SO:0001819	synonymous_variant	9204	exon16			TTGTTTTGACTCA	AF055470	CCDS387.2	1p34.2	2014-05-12	2005-09-12	2005-09-12	ENSG00000163867	ENSG00000163867		"""Zinc fingers, MYM type"", ""Zinc fingers, BED-type"""	13050	protein-coding gene	gene with protein product	"""zinc finger, BED-type containing 7"""	613567	"""zinc finger protein 258"", ""zinc finger, MYM-type containing 6"""	ZNF258		10486218, 23533661	Standard	NM_007167		Approved	ZNF198L4, MYM, Buster2, ZBED7	uc001byh.3	O95789	OTTHUMG00000004163	ENST00000357182.4:c.3882A>T	chr1.hg19:g.35452801T>A		50.0	0.0		50.0	11.0	NM_007167	B4DRJ6|Q32Q23|Q4G108|Q5SVZ9|Q5SW00|Q69YL4|Q96IY0|Q9NWF1|Q9P2J4	Silent	SNP	ENST00000357182.4	hg19	CCDS387.2																																																																																			.	.		0.373	ZMYM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011999.1	NM_007167	
ZMYM4	9202	hgsc.bcm.edu	37	1	35851192	35851192	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:35851192A>T	ENST00000314607.6	+	10	1799	c.1719A>T	c.(1717-1719)gcA>gcT	p.A573A	ZMYM4_ENST00000373297.2_Intron	NM_005095.2	NP_005086.2	Q5VZL5	ZMYM4_HUMAN	zinc finger, MYM-type 4	573					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(16)|ovary(2)|prostate(3)|skin(2)	54		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTACTTCTGCAGGTAATATTG	0.323																																					p.A573A		Atlas-SNP	.											.	ZMYM4	143	.	0			c.A1719T						.						54.0	54.0	54.0					1																	35851192		2202	4300	6502	SO:0001630	splice_region_variant	9202	exon10			TTCTGCAGGTAAT	AB007885	CCDS389.1	1p34-p32	2013-01-08	2005-12-19	2005-12-19	ENSG00000146463	ENSG00000146463		"""Zinc fingers, MYM type"""	13055	protein-coding gene	gene with protein product		613568	"""zinc finger protein 262"""	ZNF262		10449923	Standard	NM_005095		Approved	KIAA0425, ZNF198L3, MYM	uc001byt.3	Q5VZL5	OTTHUMG00000004241	ENST00000314607.6:c.1720+1A>T	chr1.hg19:g.35851192A>T		67.0	0.0		73.0	29.0	NM_005095	A0JP19|A0JP20|O43308|Q5T5E1|Q5T5E2|Q7L3Q4	Silent	SNP	ENST00000314607.6	hg19	CCDS389.1																																																																																			.	.		0.323	ZMYM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012207.3	NM_005095	Silent
CYP4B1	1580	hgsc.bcm.edu	37	1	47278193	47278193	+	Silent	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:47278193G>T	ENST00000271153.4	+	4	429	c.393G>T	c.(391-393)ggG>ggT	p.G131G	CYP4B1_ENST00000371919.4_Silent_p.G116G|CYP4B1_ENST00000452782.2_5'UTR|CYP4B1_ENST00000371923.4_Silent_p.G131G			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	131					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	TTCTTGAGGGGCCCAAGTGGT	0.587																																					p.G131G		Atlas-SNP	.											.	CYP4B1	81	.	0			c.G393T						.						106.0	83.0	91.0					1																	47278193		2203	4300	6503	SO:0001819	synonymous_variant	1580	exon4			TGAGGGGCCCAAG	BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.393G>T	chr1.hg19:g.47278193G>T		94.0	0.0		80.0	30.0	NM_000779	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Silent	SNP	ENST00000271153.4	hg19	CCDS542.1																																																																																			.	.		0.587	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000021911.1	NM_000779	
AGBL4	84871	hgsc.bcm.edu	37	1	50317108	50317108	+	Silent	SNP	G	G	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:50317108G>C	ENST00000371839.1	-	2	233	c.117C>G	c.(115-117)ccC>ccG	p.P39P	AGBL4_ENST00000497451.1_5'UTR|AGBL4_ENST00000371836.1_Silent_p.P39P|AGBL4_ENST00000371838.1_Silent_p.P39P	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	39					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		GTCCTTTCTTGGGCTGTCCAC	0.353																																					p.P39P		Atlas-SNP	.											.	AGBL4	54	.	0			c.C117G						.						151.0	130.0	136.0					1																	50317108		692	1591	2283	SO:0001819	synonymous_variant	84871	exon2			TTTCTTGGGCTGT	AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.117C>G	chr1.hg19:g.50317108G>C		215.0	0.0		212.0	74.0	NM_032785	B3KT26|B4DG37	Silent	SNP	ENST00000371839.1	hg19	CCDS44137.1																																																																																			.	.		0.353	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000021346.4	NM_032785	
FOXD3	27022	hgsc.bcm.edu	37	1	63789824	63789824	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:63789824G>A	ENST00000371116.2	+	1	1095	c.1095G>A	c.(1093-1095)gcG>gcA	p.A365A	RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	365					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						gcACCACCGCGTCGCTCATCA	0.746																																					p.A365A	Pancreas(68;276 1750 11966 31252)	Atlas-SNP	.											.	FOXD3	15	.	0			c.G1095A						.						1.0	1.0	1.0					1																	63789824		858	1831	2689	SO:0001819	synonymous_variant	27022	exon1			CACCGCGTCGCTC	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.1095G>A	chr1.hg19:g.63789824G>A		19.0	0.0		12.0	6.0	NM_012183	Q9BYM2|Q9UDD1	Silent	SNP	ENST00000371116.2	hg19	CCDS624.1																																																																																			.	.		0.746	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
SLC44A5	204962	hgsc.bcm.edu	37	1	75672389	75672389	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:75672389C>G	ENST00000370855.5	-	24	2176	c.2063G>C	c.(2062-2064)aGa>aCa	p.R688T	SLC44A5_ENST00000370859.3_Intron|SLC44A5_ENST00000535611.1_Missense_Mutation_p.R558T	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	688				R -> I (in Ref. 1; BAC03655). {ECO:0000305}.	glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						TCCATCATTTCTTTCCAGATC	0.418																																					p.R688T		Atlas-SNP	.											SLC44A5,NS,carcinoma,0,1	SLC44A5	231	.	0			c.G2063C						.						148.0	142.0	144.0					1																	75672389		2203	4300	6503	SO:0001583	missense	204962	exon24			TCATTTCTTTCCA	BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.2063G>C	chr1.hg19:g.75672389C>G	ENSP00000359892:p.Arg688Thr	57.0	0.0		39.0	18.0	NM_152697	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Missense_Mutation	SNP	ENST00000370855.5	hg19	CCDS667.1	.	.	.	.	.	.	.	.	.	.	C	22.2	4.261379	0.80246	.	.	ENSG00000137968	ENST00000370855;ENST00000535611;ENST00000535790	T;T	0.24908	1.83;1.83	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	T	0.38026	0.1025	M	0.63208	1.945	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.74674	0.984;0.978	T	0.03945	-1.0990	10	0.19147	T	0.46	-10.5251	19.0095	0.92867	0.0:1.0:0.0:0.0	.	682;688	B7Z5Y4;Q8NCS7	.;CTL5_HUMAN	T	688;558;681	ENSP00000359892:R688T;ENSP00000443090:R558T	ENSP00000359892:R688T	R	-	2	0	SLC44A5	75444977	1.000000	0.71417	1.000000	0.80357	0.774000	0.43823	5.778000	0.68940	2.501000	0.84356	0.591000	0.81541	AGA	.	.		0.418	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000026921.1	NM_152697	
ODF2L	57489	hgsc.bcm.edu	37	1	86822189	86822189	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:86822189G>T	ENST00000359242.3	-	14	1737	c.1456C>A	c.(1456-1458)Ctg>Atg	p.L486M	ODF2L_ENST00000394731.1_Missense_Mutation_p.L326M|ODF2L_ENST00000370566.3_Intron|ODF2L_ENST00000524695.1_5'UTR|ODF2L_ENST00000317336.7_Missense_Mutation_p.L486M|ODF2L_ENST00000370567.1_Missense_Mutation_p.L457M|ODF2L_ENST00000294678.2_Missense_Mutation_p.L457M	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like	486						centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		CAGCACTGCAGACTCTCCTGA	0.557																																					p.L486M		Atlas-SNP	.											.	ODF2L	53	.	0			c.C1456A						.						91.0	84.0	87.0					1																	86822189		2203	4300	6503	SO:0001583	missense	57489	exon14			ACTGCAGACTCTC		CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.1456C>A	chr1.hg19:g.86822189G>T	ENSP00000359600:p.Leu486Met	41.0	0.0		70.0	25.0	NM_001007022	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Missense_Mutation	SNP	ENST00000359242.3	hg19	CCDS41354.2	.	.	.	.	.	.	.	.	.	.	G	16.40	3.112763	0.56398	.	.	ENSG00000122417	ENST00000359242;ENST00000460698;ENST00000317336;ENST00000370567;ENST00000394731;ENST00000294678	T;D;T;T;T;T	0.83673	1.37;-1.75;1.4;1.45;1.47;-1.37	6.16	3.19	0.36642	.	0.145714	0.46758	D	0.000271	T	0.79411	0.4441	L	0.53249	1.67	0.21105	N	0.99978	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.992;0.992;0.995	T	0.69997	-0.4993	10	0.33940	T	0.23	0.114	6.9813	0.24704	0.1572:0.1394:0.7034:0.0	.	457;457;486	Q9ULJ1-4;Q9ULJ1-3;Q9ULJ1	.;.;ODF2L_HUMAN	M	486;333;486;457;326;457	ENSP00000359600:L486M;ENSP00000433092:L333M;ENSP00000320165:L486M;ENSP00000359598:L457M;ENSP00000378219:L326M;ENSP00000294678:L457M	ENSP00000294678:L457M	L	-	1	2	ODF2L	86594777	0.939000	0.31865	0.552000	0.28243	0.716000	0.41182	1.412000	0.34714	0.423000	0.26033	-0.355000	0.07637	CTG	.	.		0.557	ODF2L-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000027873.2		
GBP2	2634	hgsc.bcm.edu	37	1	89587483	89587483	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:89587483T>C	ENST00000370466.3	-	2	435	c.167A>G	c.(166-168)aAc>aGc	p.N56S	GBP2_ENST00000463660.1_5'Flank	NM_004120.3	NP_004111.2	P32456	GBP2_HUMAN	guanylate binding protein 2, interferon-inducible	56	GB1/RHD3-type G.|GTPase domain (Globular). {ECO:0000250}.				cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|interferon-gamma-mediated signaling pathway (GO:0060333)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(1)	20		Lung NSC(277;0.0908)		all cancers(265;0.0151)|Epithelial(280;0.0284)		AGCCAGCTTGTTCATCAGGTA	0.522																																					p.N56S		Atlas-SNP	.											.	GBP2	58	.	0			c.A167G						.						192.0	155.0	167.0					1																	89587483		2203	4300	6503	SO:0001583	missense	2634	exon2			AGCTTGTTCATCA	BC073163	CCDS719.1	1p22.2	2008-02-05			ENSG00000162645	ENSG00000162645			4183	protein-coding gene	gene with protein product		600412				1715024	Standard	NM_004120		Approved		uc001dmz.1	P32456	OTTHUMG00000010662	ENST00000370466.3:c.167A>G	chr1.hg19:g.89587483T>C	ENSP00000359497:p.Asn56Ser	118.0	0.0		93.0	32.0	NM_004120	Q6GPH0|Q6IAU2|Q86TB0	Missense_Mutation	SNP	ENST00000370466.3	hg19	CCDS719.1	.	.	.	.	.	.	.	.	.	.	T	18.93	3.726831	0.69074	.	.	ENSG00000162645	ENST00000370466	T	0.79141	-1.24	3.43	3.43	0.39272	Guanylate-binding protein, N-terminal (1);	0.000000	0.64402	U	0.000003	T	0.80352	0.4607	M	0.85462	2.755	0.30948	N	0.725035	D	0.62365	0.991	P	0.57204	0.815	T	0.78046	-0.2357	10	0.87932	D	0	-20.762	10.1493	0.42782	0.0:0.0:0.0:1.0	.	56	P32456	GBP2_HUMAN	S	56	ENSP00000359497:N56S	ENSP00000359497:N56S	N	-	2	0	GBP2	89360071	1.000000	0.71417	0.818000	0.32626	0.871000	0.50021	5.343000	0.65976	1.542000	0.49330	0.402000	0.26972	AAC	.	.		0.522	GBP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000029406.2	NM_004120	
IGSF3	3321	hgsc.bcm.edu	37	1	117120047	117120047	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:117120047A>T	ENST00000369486.3	-	11	4237	c.3472T>A	c.(3472-3474)Tct>Act	p.S1158T	IGSF3_ENST00000369483.1_Missense_Mutation_p.S1178T|IGSF3_ENST00000318837.6_Missense_Mutation_p.S1178T	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1158					lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		TTCCCATCAGAGTTCTTGCTG	0.512																																					p.S1178T		Atlas-SNP	.											.	IGSF3	294	.	0			c.T3532A						.						122.0	120.0	121.0					1																	117120047		2203	4300	6503	SO:0001583	missense	3321	exon12			CATCAGAGTTCTT	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3472T>A	chr1.hg19:g.117120047A>T	ENSP00000358498:p.Ser1158Thr	172.0	0.0		160.0	67.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	A	17.13	3.310239	0.60414	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.03242	4.0;4.0;4.0	4.89	3.74	0.42951	.	0.157530	0.45606	D	0.000357	T	0.01695	0.0054	N	0.14661	0.345	0.30459	N	0.774477	D;D	0.57257	0.979;0.979	P;P	0.51777	0.679;0.679	T	0.46693	-0.9173	10	0.62326	D	0.03	-15.2187	9.0676	0.36473	0.6359:0.3641:0.0:0.0	.	1158;1178	O75054;A6NJZ6	IGSF3_HUMAN;.	T	1158;1178;1178	ENSP00000358498:S1158T;ENSP00000358495:S1178T;ENSP00000321184:S1178T	ENSP00000321184:S1178T	S	-	1	0	IGSF3	116921570	1.000000	0.71417	0.979000	0.43373	0.854000	0.48673	6.432000	0.73400	0.861000	0.35504	0.533000	0.62120	TCT	.	.		0.512	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
ISG20L2	81875	hgsc.bcm.edu	37	1	156696883	156696883	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:156696883C>T	ENST00000313146.6	-	1	1344	c.562G>A	c.(562-564)Ggc>Agc	p.G188S	RRNAD1_ENST00000368218.4_5'Flank|RRNAD1_ENST00000368216.4_5'Flank|RRNAD1_ENST00000524343.1_5'Flank|ISG20L2_ENST00000368219.1_Missense_Mutation_p.G188S|ISG20L2_ENST00000472824.2_5'Flank	NM_030980.1	NP_112242.1	Q9H9L3	I20L2_HUMAN	interferon stimulated exonuclease gene 20kDa-like 2	188	Exonuclease.				ribosome biogenesis (GO:0042254)	nucleus (GO:0005634)	exonuclease activity (GO:0004527)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	16	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GGTCCTGTGCCCACCATCTCA	0.512											OREG0013885	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.G188S		Atlas-SNP	.											.	ISG20L2	43	.	0			c.G562A						.						184.0	146.0	159.0					1																	156696883		2203	4300	6503	SO:0001583	missense	81875	exon1			CTGTGCCCACCAT	AK095697	CCDS1153.1	1q23.1	2013-10-11			ENSG00000143319	ENSG00000143319			25745	protein-coding gene	gene with protein product		611930				18065403	Standard	NM_030980		Approved	FLJ12671	uc001fps.1	Q9H9L3	OTTHUMG00000041301	ENST00000313146.6:c.562G>A	chr1.hg19:g.156696883C>T	ENSP00000323424:p.Gly188Ser	151.0	0.0	1780	154.0	61.0	NM_030980	D3DVC6|Q64KA2	Missense_Mutation	SNP	ENST00000313146.6	hg19	CCDS1153.1	.	.	.	.	.	.	.	.	.	.	C	36	5.756261	0.96898	.	.	ENSG00000143319	ENST00000313146;ENST00000368219	T;T	0.48836	0.8;0.8	5.17	5.17	0.71159	Exonuclease (1);Exonuclease, RNase T/DNA polymerase III (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.65407	0.2688	M	0.78801	2.425	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68337	-0.5435	10	0.66056	D	0.02	.	17.4015	0.87461	0.0:1.0:0.0:0.0	.	188	Q9H9L3	I20L2_HUMAN	S	188	ENSP00000323424:G188S;ENSP00000357202:G188S	ENSP00000323424:G188S	G	-	1	0	ISG20L2	154963507	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.431000	0.80335	2.692000	0.91855	0.655000	0.94253	GGC	.	.		0.512	ISG20L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000098969.1	NM_030980	
F11R	50848	hgsc.bcm.edu	37	1	160970507	160970507	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:160970507C>G	ENST00000368026.6	-	4	576	c.302G>C	c.(301-303)cGg>cCg	p.R101P	F11R_ENST00000537746.1_Intron|F11R_ENST00000289779.3_3'UTR|F11R_ENST00000472573.1_5'UTR	NM_016946.4	NP_058642.1	Q9Y624	JAM1_HUMAN	F11 receptor	101	Ig-like V-type 1.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|epithelial cell differentiation (GO:0030855)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|leukocyte migration (GO:0050900)|tight junction assembly (GO:0070830)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)	12	all_cancers(52;6.73e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00207)			AGTGTCTTCCCGTGTCACGGA	0.542																																					p.R101P		Atlas-SNP	.											.	F11R	29	.	0			c.G302C						.						181.0	126.0	144.0					1																	160970507		2203	4300	6503	SO:0001583	missense	50848	exon4			TCTTCCCGTGTCA	AF111713	CCDS1213.1	1q21.2-q21.3	2013-01-29	2003-02-07	2003-02-14	ENSG00000158769	ENSG00000158769		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14685	protein-coding gene	gene with protein product		605721	"""junctional adhesion molecule 1"""	JAM1		10395639, 7646439	Standard	NM_016946		Approved	PAM-1, JCAM, JAM-1, JAM-A, JAMA, CD321	uc009wtt.3	Q9Y624	OTTHUMG00000028602	ENST00000368026.6:c.302G>C	chr1.hg19:g.160970507C>G	ENSP00000357005:p.Arg101Pro	82.0	0.0		107.0	35.0	NM_016946	B7Z941	Missense_Mutation	SNP	ENST00000368026.6	hg19	CCDS1213.1	.	.	.	.	.	.	.	.	.	.	C	16.56	3.156836	0.57259	.	.	ENSG00000158769	ENST00000368026;ENST00000335772;ENST00000289779;ENST00000436182	T;T	0.64260	-0.09;-0.09	5.36	5.36	0.76844	Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin V-set, subgroup (1);Immunoglobulin-like fold (1);	0.133822	0.51477	N	0.000096	T	0.70988	0.3287	M	0.62154	1.92	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.993;0.998;0.998;0.997	T	0.68610	-0.5363	10	0.35671	T	0.21	.	16.5755	0.84635	0.0:1.0:0.0:0.0	.	105;101;101;101	B7Z5W1;Q6FIB4;Q9Y624;D3DVF0	.;.;JAM1_HUMAN;.	P	101;101;101;105	ENSP00000357005:R101P;ENSP00000394809:R105P	ENSP00000289779:R101P	R	-	2	0	F11R	159237131	1.000000	0.71417	0.992000	0.48379	0.016000	0.09150	2.701000	0.47094	2.495000	0.84180	0.563000	0.77884	CGG	.	.		0.542	F11R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071458.3	NM_016946	
CACNA1E	777	hgsc.bcm.edu	37	1	181725136	181725136	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:181725136G>T	ENST00000367573.2	+	29	4034	c.4034G>T	c.(4033-4035)gGc>gTc	p.G1345V	CACNA1E_ENST00000357570.5_Missense_Mutation_p.G1296V|CACNA1E_ENST00000526775.1_Missense_Mutation_p.G1326V|CACNA1E_ENST00000358338.5_Missense_Mutation_p.G1277V|CACNA1E_ENST00000360108.3_Missense_Mutation_p.G1326V|CACNA1E_ENST00000367570.1_Missense_Mutation_p.G1345V|CACNA1E_ENST00000367567.4_Missense_Mutation_p.G952V	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1345					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.G1345V(2)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						GAGGTGAAGGGCCGGGAATGG	0.493																																					p.G1345V		Atlas-SNP	.											CACNA1E_ENST00000367573,NS,carcinoma,0,2	CACNA1E	778	.	2	Substitution - Missense(2)	lung(2)	c.G4034T						.						88.0	89.0	89.0					1																	181725136		1960	4154	6114	SO:0001583	missense	777	exon29			TGAAGGGCCGGGA	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.4034G>T	chr1.hg19:g.181725136G>T	ENSP00000356545:p.Gly1345Val	155.0	0.0		137.0	46.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	G	16.29	3.082052	0.55861	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05;-5.05;-5.05;-5.05	5.6	5.6	0.85130	Ion transport (1);	0.212776	0.51477	D	0.000090	D	0.97201	0.9085	L	0.42245	1.32	0.58432	D	0.999994	B;B;B	0.31548	0.008;0.155;0.328	B;B;B	0.33521	0.059;0.158;0.165	D	0.96001	0.8993	10	0.34782	T	0.22	.	19.5773	0.95450	0.0:0.0:1.0:0.0	.	1326;1345;1345	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	V	1345;1326;1296;1277;952;1326;1345	ENSP00000356542:G1345V;ENSP00000434814:G1326V;ENSP00000350183:G1296V;ENSP00000351101:G1277V;ENSP00000356539:G952V;ENSP00000353222:G1326V;ENSP00000356545:G1345V	ENSP00000350183:G1296V	G	+	2	0	CACNA1E	179991759	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.835000	0.48175	2.788000	0.95919	0.650000	0.86243	GGC	.	.		0.493	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
AFTPH	54812	hgsc.bcm.edu	37	2	64796244	64796244	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:64796244G>T	ENST00000422803.1	+	4	2420	c.2106G>T	c.(2104-2106)tgG>tgT	p.W702C	AFTPH_ENST00000409933.1_Missense_Mutation_p.W702C|AFTPH_ENST00000487769.1_Intron|AFTPH_ENST00000238856.4_Missense_Mutation_p.W702C|AFTPH_ENST00000238855.7_Missense_Mutation_p.W702C|AFTPH_ENST00000409183.1_Missense_Mutation_p.W333C			Q6ULP2	AFTIN_HUMAN	aftiphilin	702					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						TAGATGTGTGGACTGAGCTAC	0.463																																					p.W702C		Atlas-SNP	.											.	AFTPH	117	.	0			c.G2106T						.						165.0	153.0	157.0					2																	64796244		2203	4300	6503	SO:0001583	missense	54812	exon4			TGTGTGGACTGAG	AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.2106G>T	chr2.hg19:g.64796244G>T	ENSP00000397726:p.Trp702Cys	85.0	0.0		100.0	39.0	NM_017657	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	ENST00000422803.1	hg19		.	.	.	.	.	.	.	.	.	.	G	20.4	3.979530	0.74360	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.65916	0.82;0.91;0.92;0.92;-0.18	4.8	4.8	0.61643	.	0.000000	0.85682	D	0.000000	T	0.79058	0.4382	M	0.72118	2.19	0.80722	D	1	D;D;P;D	0.89917	1.0;1.0;0.923;1.0	D;D;P;D	0.91635	0.998;0.999;0.894;0.998	T	0.82000	-0.0674	10	0.87932	D	0	-0.4091	18.2232	0.89907	0.0:0.0:1.0:0.0	.	702;702;702;702	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	C	702;702;702;702;333	ENSP00000238856:W702C;ENSP00000397726:W702C;ENSP00000238855:W702C;ENSP00000387071:W702C;ENSP00000386913:W333C	ENSP00000238855:W702C	W	+	3	0	AFTPH	64649748	1.000000	0.71417	0.979000	0.43373	0.980000	0.70556	9.693000	0.98684	2.362000	0.80069	0.650000	0.86243	TGG	.	.		0.463	AFTPH-202	KNOWN	basic	protein_coding	protein_coding		NM_017657	
CCDC93	54520	hgsc.bcm.edu	37	2	118735578	118735578	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:118735578T>A	ENST00000376300.2	-	8	786	c.649A>T	c.(649-651)Atg>Ttg	p.M217L	CCDC93_ENST00000460781.1_5'UTR|CCDC93_ENST00000319432.5_Missense_Mutation_p.M216L	NM_019044.4	NP_061917.3	Q567U6	CCD93_HUMAN	coiled-coil domain containing 93	217										breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(2)	29						ACCTTCTCCATTTTGCTCTGG	0.398																																					p.M217L		Atlas-SNP	.											.	CCDC93	70	.	0			c.A649T						.						166.0	139.0	148.0					2																	118735578		2203	4300	6503	SO:0001583	missense	54520	exon8			TCTCCATTTTGCT	BC028609	CCDS2121.2	2q14.1	2008-02-05			ENSG00000125633	ENSG00000125633			25611	protein-coding gene	gene with protein product						12477932	Standard	NM_019044		Approved	FLJ10996	uc002tlj.3	Q567U6	OTTHUMG00000058517	ENST00000376300.2:c.649A>T	chr2.hg19:g.118735578T>A	ENSP00000365477:p.Met217Leu	52.0	0.0		64.0	28.0	NM_019044	A8K3V7|Q4LE78|Q53TJ2|Q8TBX5|Q9H6R5|Q9NV15	Missense_Mutation	SNP	ENST00000376300.2	hg19	CCDS2121.2	.	.	.	.	.	.	.	.	.	.	T	3.712	-0.059415	0.07317	.	.	ENSG00000125633	ENST00000376300;ENST00000319432	T;T	0.16457	2.34;2.35	4.28	1.83	0.25207	.	0.744408	0.12434	N	0.469254	T	0.04815	0.0130	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43130	-0.9410	10	0.10377	T	0.69	-3.665	3.8996	0.09155	0.0:0.1998:0.1832:0.6171	.	217	Q567U6	CCD93_HUMAN	L	217;216	ENSP00000365477:M217L;ENSP00000324135:M216L	ENSP00000324135:M216L	M	-	1	0	CCDC93	118452048	0.918000	0.31147	1.000000	0.80357	0.771000	0.43674	0.111000	0.15458	0.280000	0.22209	0.459000	0.35465	ATG	.	.		0.398	CCDC93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000129615.1	NM_019044	
MARCO	8685	hgsc.bcm.edu	37	2	119752067	119752067	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:119752067G>T	ENST00000327097.4	+	17	1669	c.1534G>T	c.(1534-1536)Gag>Tag	p.E512*	MARCO_ENST00000541757.1_Nonsense_Mutation_p.E434*	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	512	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CAGCCACGAGGAGGACGCAGG	0.592																																					p.E512X	GBM(8;18 374 7467 11269 32796)	Atlas-SNP	.											.	MARCO	120	.	0			c.G1534T						.						119.0	97.0	104.0					2																	119752067		2203	4300	6503	SO:0001587	stop_gained	8685	exon17			CACGAGGAGGACG	AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1534G>T	chr2.hg19:g.119752067G>T	ENSP00000318916:p.Glu512*	65.0	0.0		56.0	16.0	NM_006770	B4DW79|Q9Y5S3	Nonsense_Mutation	SNP	ENST00000327097.4	hg19	CCDS2124.1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480332	0.84747	.	.	ENSG00000019169	ENST00000327097;ENST00000410021;ENST00000541757	.	.	.	5.25	4.38	0.52667	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.869	0.41162	0.0921:0.0:0.9079:0.0	.	.	.	.	X	512;458;434	.	.	E	+	1	0	MARCO	119468537	1.000000	0.71417	0.854000	0.33618	0.004000	0.04260	4.127000	0.57944	1.441000	0.47550	-0.137000	0.14449	GAG	.	.		0.592	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254190.2	NM_006770	
MCM6	4175	hgsc.bcm.edu	37	2	136622693	136622693	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:136622693T>A	ENST00000264156.2	-	7	1028	c.968A>T	c.(967-969)gAg>gTg	p.E323V	MCM6_ENST00000492091.1_5'Flank	NM_005915.5	NP_005906.2	Q14566	MCM6_HUMAN	minichromosome maintenance complex component 6	323					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(15)|prostate(2)|skin(1)	29				BRCA - Breast invasive adenocarcinoma(221;0.166)		CTTAATGCTCTCAGCTGTCTG	0.398																																					p.E323V	Ovarian(196;141 2104 8848 24991 25939)	Atlas-SNP	.											.	MCM6	64	.	0			c.A968T						.						191.0	175.0	180.0					2																	136622693		2203	4300	6503	SO:0001583	missense	4175	exon7			ATGCTCTCAGCTG		CCDS2179.1	2q14-q21	2008-02-05	2007-04-04		ENSG00000076003	ENSG00000076003			6949	protein-coding gene	gene with protein product	"""MIS5 homolog (S.pombe)"""	601806	"""minichromosome maintenance deficient (mis5, S. pombe) 6"", ""MCM6 minichromosome maintenance deficient 6 (MIS5 homolog, S. pombe) (S. cerevisiae)"", ""minichromosome maintenance deficient 6 homolog (S. cerevisiae)"""				Standard	NM_005915		Approved	Mis5	uc002tuw.4	Q14566	OTTHUMG00000131739	ENST00000264156.2:c.968A>T	chr2.hg19:g.136622693T>A	ENSP00000264156:p.Glu323Val	54.0	0.0		55.0	19.0	NM_005915	B2R6H2|Q13504|Q99859	Missense_Mutation	SNP	ENST00000264156.2	hg19	CCDS2179.1	.	.	.	.	.	.	.	.	.	.	T	20.1	3.932652	0.73442	.	.	ENSG00000076003	ENST00000264156	T	0.03801	3.8	5.59	5.59	0.84812	.	0.045250	0.85682	D	0.000000	T	0.10981	0.0268	M	0.75264	2.295	0.80722	D	1	P	0.36412	0.552	B	0.38500	0.275	T	0.01045	-1.1470	10	0.56958	D	0.05	-17.4913	15.7653	0.78120	0.0:0.0:0.0:1.0	.	323	Q14566	MCM6_HUMAN	V	323	ENSP00000264156:E323V	ENSP00000264156:E323V	E	-	2	0	MCM6	136339163	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.644000	0.83416	2.122000	0.65172	0.455000	0.32223	GAG	.	.		0.398	MCM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254658.1	NM_005915	
NEB	4703	hgsc.bcm.edu	37	2	152529088	152529088	+	Missense_Mutation	SNP	T	T	A	rs375155384		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:152529088T>A	ENST00000172853.10	-	37	4241	c.4094A>T	c.(4093-4095)cAg>cTg	p.Q1365L	NEB_ENST00000603639.1_Missense_Mutation_p.Q1365L|NEB_ENST00000397345.3_Missense_Mutation_p.Q1365L|NEB_ENST00000427231.2_Missense_Mutation_p.Q1365L|NEB_ENST00000604864.1_Missense_Mutation_p.Q1365L|NEB_ENST00000409198.1_Missense_Mutation_p.Q1365L			P20929	NEBU_HUMAN	nebulin	1365					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		ACGATCAGACTGCAGCTTTGC	0.473																																					p.Q1365L		Atlas-SNP	.											.	NEB	1697	.	0			c.A4094T						.	T	LEU/GLN,LEU/GLN,LEU/GLN	0,3920		0,0,1960	137.0	133.0	134.0		4094,4094,4094	5.9	1.0	2		134	1,8277		0,1,4138	no	missense,missense,missense	NEB	NM_001164507.1,NM_001164508.1,NM_004543.4	113,113,113	0,1,6098	AA,AT,TT		0.0121,0.0,0.0082	probably-damaging,probably-damaging,probably-damaging	1365/8526,1365/8526,1365/6670	152529088	1,12197	1960	4139	6099	SO:0001583	missense	4703	exon37			TCAGACTGCAGCT	X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.4094A>T	chr2.hg19:g.152529088T>A	ENSP00000172853:p.Gln1365Leu	98.0	0.0		91.0	45.0	NM_004543	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	ENST00000172853.10	hg19		.	.	.	.	.	.	.	.	.	.	T	22.4	4.287784	0.80803	0.0	1.21E-4	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.48836	0.8;0.8;0.8;0.8	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.73497	0.3594	M	0.86740	2.835	0.80722	D	1	D	0.71674	0.998	D	0.87578	0.998	T	0.78046	-0.2357	10	0.62326	D	0.03	.	16.3782	0.83418	0.0:0.0:0.0:1.0	.	1365	P20929	NEBU_HUMAN	L	1365	ENSP00000386259:Q1365L;ENSP00000380505:Q1365L;ENSP00000416578:Q1365L;ENSP00000172853:Q1365L	ENSP00000172853:Q1365L	Q	-	2	0	NEB	152237334	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	8.018000	0.88722	2.277000	0.76020	0.528000	0.53228	CAG	.	.		0.473	NEB-201	KNOWN	basic	protein_coding	protein_coding		NM_004543	
DHRS9	10170	hgsc.bcm.edu	37	2	169940058	169940058	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:169940058C>T	ENST00000327239.4	+	6	2037	c.533C>T	c.(532-534)cCa>cTa	p.P178L	DHRS9_ENST00000412271.1_Missense_Mutation_p.P178L|DHRS9_ENST00000436483.2_Missense_Mutation_p.P178L|DHRS9_ENST00000602501.1_Missense_Mutation_p.P178L|DHRS9_ENST00000357546.2_Missense_Mutation_p.P178L|DHRS9_ENST00000428522.1_Missense_Mutation_p.P178L|DHRS9_ENST00000421653.1_Missense_Mutation_p.P31L|DHRS9_ENST00000432060.2_Missense_Mutation_p.P238L	NM_005771.4	NP_005762.2	Q9BPW9	DHRS9_HUMAN	dehydrogenase/reductase (SDR family) member 9	178					9-cis-retinoic acid biosynthetic process (GO:0042904)|androgen metabolic process (GO:0008209)|epithelial cell differentiation (GO:0030855)|progesterone metabolic process (GO:0042448)|retinol metabolic process (GO:0042572)	integral component of endoplasmic reticulum membrane (GO:0030176)	alcohol dehydrogenase (NAD) activity (GO:0004022)|racemase and epimerase activity (GO:0016854)|retinol dehydrogenase activity (GO:0004745)|testosterone dehydrogenase (NAD+) activity (GO:0047035)			breast(1)|endometrium(3)|large_intestine(2)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	13						GGCTATACTCCATCCAAATAT	0.393																																					p.P178L		Atlas-SNP	.											.	DHRS9	29	.	0			c.C533T						.						71.0	67.0	68.0					2																	169940058		2203	4300	6503	SO:0001583	missense	10170	exon6			ATACTCCATCCAA	AF067174	CCDS2231.1, CCDS74600.1	2q31.1	2011-09-14			ENSG00000073737	ENSG00000073737		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	16888	protein-coding gene	gene with protein product	"""NADP-dependent retinol dehydrogenase/reductase"", ""3-alpha hydroxysteroid dehydrogenase"", ""retinol dehydrogenase homolog"", ""short chain dehydrogenase/reductase family 9C, member 4"""	612131				11304534, 11294878, 19027726	Standard	NM_001142270		Approved	RDHL, 3alpha-HSD, RETSDR8, RDH15, SDR9C4	uc010zde.2	Q9BPW9	OTTHUMG00000132180	ENST00000327239.4:c.533C>T	chr2.hg19:g.169940058C>T	ENSP00000316670:p.Pro178Leu	52.0	0.0		95.0	34.0	NM_005771	B7Z416|D3DPC1|Q5RKX1|Q9NRA9|Q9NRB0	Missense_Mutation	SNP	ENST00000327239.4	hg19	CCDS2231.1	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287639	0.23478	.	.	ENSG00000073737	ENST00000327239;ENST00000357546;ENST00000432060;ENST00000428522;ENST00000421653;ENST00000436483;ENST00000412271	D;D;D;D;D;D;D	0.92545	-2.15;-2.15;-2.15;-2.15;-3.06;-2.15;-2.15	5.93	2.24	0.28232	NAD(P)-binding domain (1);	0.395216	0.31648	N	0.007281	T	0.79185	0.4403	N	0.02697	-0.525	0.28071	N	0.932595	B;B	0.02656	0.0;0.0	B;B	0.11329	0.006;0.002	T	0.67280	-0.5710	10	0.31617	T	0.26	.	10.7832	0.46390	0.0:0.7492:0.0:0.2508	.	238;178	B7Z416;Q9BPW9	.;DHRS9_HUMAN	L	178;178;238;178;31;178;178	ENSP00000316670:P178L;ENSP00000350154:P178L;ENSP00000389241:P238L;ENSP00000388564:P178L;ENSP00000388066:P31L;ENSP00000407167:P178L;ENSP00000407747:P178L	ENSP00000316670:P178L	P	+	2	0	DHRS9	169648304	0.001000	0.12720	0.584000	0.28653	0.848000	0.48234	1.407000	0.34657	0.150000	0.19136	-0.123000	0.14984	CCA	.	.		0.393	DHRS9-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333612.3	NM_005771	
TTN	7273	hgsc.bcm.edu	37	2	179472543	179472543	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:179472543T>A	ENST00000591111.1	-	226	48272	c.48048A>T	c.(48046-48048)gaA>gaT	p.E16016D	TTN_ENST00000460472.2_Missense_Mutation_p.E8592D|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E8784D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E17657D|TTN_ENST00000342992.6_Missense_Mutation_p.E15089D|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E8717D|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16016	Fibronectin type-III 16. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CAGGTTGTGTTTCTCCAGGCG	0.433																																					p.E17657D		Atlas-SNP	.											.	TTN	18412	.	0			c.A52971T						.						95.0	90.0	91.0					2																	179472543		1901	4124	6025	SO:0001583	missense	7273	exon276			TTGTGTTTCTCCA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.48048A>T	chr2.hg19:g.179472543T>A	ENSP00000465570:p.Glu16016Asp	51.0	0.0		55.0	19.0	NM_001267550	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	11.74	1.727389	0.30593	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.45668	0.89;0.89;0.89;0.89	6.06	2.43	0.29744	Fibronectin, type III (2);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.24928	0.0605	N	0.16708	0.43	0.34907	D	0.747117	P;P;P;P	0.34462	0.454;0.454;0.454;0.454	B;B;B;B	0.29598	0.104;0.104;0.104;0.104	T	0.26292	-1.0107	9	0.87932	D	0	.	10.0208	0.42041	0.0:0.1818:0.0:0.8182	.	8592;8717;8784;16016	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	15089;8592;8784;8717;8592	ENSP00000343764:E15089D;ENSP00000434586:E8592D;ENSP00000340554:E8784D;ENSP00000352154:E8717D	ENSP00000340554:E8784D	E	-	3	2	TTN	179180788	1.000000	0.71417	0.998000	0.56505	0.977000	0.68977	0.985000	0.29578	0.181000	0.19994	0.533000	0.62120	GAA	.	.		0.433	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
DNAH7	56171	hgsc.bcm.edu	37	2	196749353	196749353	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:196749353A>T	ENST00000312428.6	-	35	5819	c.5719T>A	c.(5719-5721)Ttt>Att	p.F1907I		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	1907					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTTTCAGGAAATGGGACAGTT	0.413																																					p.F1907I		Atlas-SNP	.											.	DNAH7	512	.	0			c.T5719A						.						109.0	105.0	106.0					2																	196749353		1911	4117	6028	SO:0001583	missense	56171	exon35			CAGGAAATGGGAC	AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.5719T>A	chr2.hg19:g.196749353A>T	ENSP00000311273:p.Phe1907Ile	99.0	0.0		114.0	42.0	NM_018897	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	ENST00000312428.6	hg19	CCDS42794.1	.	.	.	.	.	.	.	.	.	.	A	11.50	1.658059	0.29425	.	.	ENSG00000118997	ENST00000312428	T	0.24723	1.84	5.67	4.51	0.55191	.	0.608298	0.16579	N	0.208291	T	0.18299	0.0439	L	0.39397	1.21	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.07966	-1.0745	10	0.22706	T	0.39	.	6.386	0.21561	0.7843:0.0:0.0747:0.141	.	1907	Q8WXX0	DYH7_HUMAN	I	1907	ENSP00000311273:F1907I	ENSP00000311273:F1907I	F	-	1	0	DNAH7	196457598	1.000000	0.71417	0.998000	0.56505	0.700000	0.40528	3.256000	0.51492	2.275000	0.75901	0.533000	0.62120	TTT	.	.		0.413	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335202.3	NM_018897	
ORC2	4999	hgsc.bcm.edu	37	2	201791508	201791508	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:201791508C>T	ENST00000234296.2	-	12	1282	c.1033G>A	c.(1033-1035)Gga>Aga	p.G345R	RN7SL694P_ENST00000584245.1_RNA	NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	345					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						ACACTGATTCCAGGAAAGAAG	0.373																																					p.G345R		Atlas-SNP	.											.	ORC2	48	.	0			c.G1033A						.						110.0	107.0	108.0					2																	201791508		2203	4300	6503	SO:0001583	missense	4999	exon12			TGATTCCAGGAAA		CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1033G>A	chr2.hg19:g.201791508C>T	ENSP00000234296:p.Gly345Arg	71.0	0.0		87.0	42.0	NM_006190	Q13204|Q53TX5	Missense_Mutation	SNP	ENST00000234296.2	hg19	CCDS2334.1	.	.	.	.	.	.	.	.	.	.	C	19.12	3.766852	0.69878	.	.	ENSG00000115942	ENST00000234296	T	0.44881	0.91	5.77	5.77	0.91146	.	0.236827	0.45126	D	0.000392	T	0.52224	0.1721	L	0.52126	1.63	0.35438	D	0.794656	P;D	0.56968	0.93;0.978	P;D	0.65233	0.756;0.933	T	0.61033	-0.7144	10	0.45353	T	0.12	-10.6798	7.8916	0.29682	0.0:0.8113:0.0:0.1887	.	345;345	B4DYU9;Q13416	.;ORC2_HUMAN	R	345	ENSP00000234296:G345R	ENSP00000234296:G345R	G	-	1	0	ORC2	201499753	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.684000	0.54671	2.890000	0.99128	0.585000	0.79938	GGA	.	.		0.373	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256191.2	NM_006190	
STK36	27148	hgsc.bcm.edu	37	2	219564008	219564008	+	Silent	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:219564008A>T	ENST00000295709.3	+	26	4020	c.3741A>T	c.(3739-3741)ccA>ccT	p.P1247P	STK36_ENST00000392106.2_Silent_p.P1226P|STK36_ENST00000392105.3_Silent_p.P1226P|STK36_ENST00000440309.1_Silent_p.P1247P	NM_015690.4	NP_056505.2			serine/threonine kinase 36											biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(20)|ovary(4)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	52		Renal(207;0.0915)		Epithelial(149;9.65e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(261;0.00984)		ACCCCCAGCCAAATGTGAAGG	0.562																																					p.P1247P		Atlas-SNP	.											.	STK36	111	.	0			c.A3741T						.						52.0	56.0	55.0					2																	219564008		2203	4300	6503	SO:0001819	synonymous_variant	27148	exon26			CCAGCCAAATGTG	AB033104	CCDS2421.1, CCDS58750.1	2q35	2010-06-25	2010-06-25		ENSG00000163482	ENSG00000163482			17209	protein-coding gene	gene with protein product	"""fused homolog (Drosophila)"""	607652	"""serine/threonine kinase 36 (fused homolog, Drosophila)"""			10806483	Standard	NM_001243313		Approved	KIAA1278, FU	uc002viu.3	Q9NRP7	OTTHUMG00000133079	ENST00000295709.3:c.3741A>T	chr2.hg19:g.219564008A>T		114.0	0.0		118.0	48.0	NM_015690		Silent	SNP	ENST00000295709.3	hg19	CCDS2421.1	.	.	.	.	.	.	.	.	.	.	A	8.424	0.847156	0.17034	.	.	ENSG00000163482	ENST00000431040	.	.	.	5.47	-3.42	0.04825	.	.	.	.	.	T	0.16769	0.0403	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27640	-1.0068	4	.	.	.	0.3	0.6469	0.00819	0.3172:0.2815:0.2061:0.1953	.	.	.	.	L	440	.	.	Q	+	2	0	STK36	219272252	0.000000	0.05858	0.967000	0.41034	0.985000	0.73830	-1.313000	0.02718	-0.143000	0.11334	0.459000	0.35465	CAA	.	.		0.562	STK36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256723.2		
DNER	92737	hgsc.bcm.edu	37	2	230312104	230312104	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:230312104A>T	ENST00000341772.4	-	8	1548	c.1414T>A	c.(1414-1416)Tgt>Agt	p.C472S		NM_139072.3	NP_620711.3	Q8NFT8	DNER_HUMAN	delta/notch-like EGF repeat containing	472	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				central nervous system development (GO:0007417)|endocytosis (GO:0006897)|glial cell differentiation (GO:0010001)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|skeletal muscle fiber development (GO:0048741)|synapse assembly (GO:0007416)	dendrite (GO:0030425)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|clathrin binding (GO:0030276)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(13)|liver(1)|lung(28)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	63		all_lung(227;0.00413)|Renal(207;0.0113)|Lung NSC(271;0.0211)|all_hematologic(139;0.105)|Acute lymphoblastic leukemia(138;0.175)		Epithelial(121;1.4e-11)|all cancers(144;7.7e-09)|LUSC - Lung squamous cell carcinoma(224;0.034)|Lung(119;0.0375)		CTGAGGGCACAGAAGTCAATA	0.602																																					p.C472S		Atlas-SNP	.											.	DNER	129	.	0			c.T1414A						.						51.0	46.0	48.0					2																	230312104		2203	4300	6503	SO:0001583	missense	92737	exon8			GGGCACAGAAGTC	AY358891	CCDS33390.1	2q36.3	2006-10-26			ENSG00000187957	ENSG00000187957			24456	protein-coding gene	gene with protein product		607299				11950833, 11997712	Standard	NM_139072		Approved	UNQ26, bet	uc002vpv.3	Q8NFT8	OTTHUMG00000153637	ENST00000341772.4:c.1414T>A	chr2.hg19:g.230312104A>T	ENSP00000345229:p.Cys472Ser	314.0	0.0		326.0	113.0	NM_139072	A6NP39|Q53R88|Q53TP7|Q53TQ5|Q8IYT0|Q8TB42|Q9NTF1|Q9UDM2	Missense_Mutation	SNP	ENST00000341772.4	hg19	CCDS33390.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403641	0.83230	.	.	ENSG00000187957	ENST00000341772;ENST00000543700	D	0.99992	-12.4	4.94	4.94	0.65067	EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.99988	0.9998	M	0.93507	3.425	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	D	0.99943	1.1432	10	0.87932	D	0	.	14.8962	0.70646	1.0:0.0:0.0:0.0	.	472	Q8NFT8	DNER_HUMAN	S	472;190	ENSP00000345229:C472S	ENSP00000345229:C472S	C	-	1	0	DNER	230020348	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	8.776000	0.91776	1.978000	0.57642	0.533000	0.62120	TGT	.	.		0.602	DNER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000331902.1	NM_139072	
GIGYF2	26058	hgsc.bcm.edu	37	2	233708845	233708845	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:233708845C>G	ENST00000409547.1	+	26	3290	c.2979C>G	c.(2977-2979)agC>agG	p.S993R	GIGYF2_ENST00000373566.3_Missense_Mutation_p.S1015R|GIGYF2_ENST00000409451.3_Missense_Mutation_p.S1014R|GIGYF2_ENST00000409480.1_Missense_Mutation_p.S1015R|GIGYF2_ENST00000409196.3_Missense_Mutation_p.S987R|GIGYF2_ENST00000452341.2_Missense_Mutation_p.Q836E|GIGYF2_ENST00000373563.4_Missense_Mutation_p.S993R	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	993	Gln-rich.				adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		GGAATGTCAGCAAACCTTCAG	0.522																																					p.S1014R		Atlas-SNP	.											.	GIGYF2	288	.	0			c.C3042G						.						51.0	49.0	50.0					2																	233708845		2202	4298	6500	SO:0001583	missense	26058	exon26			TGTCAGCAAACCT	U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.2979C>G	chr2.hg19:g.233708845C>G	ENSP00000386537:p.Ser993Arg	260.0	0.0		274.0	86.0	NM_001103147	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	ENST00000409547.1	hg19	CCDS33401.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.55|14.55	2.567778|2.567778	0.45798|0.45798	.|.	.|.	ENSG00000204120|ENSG00000204120	ENST00000452341|ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000426102	T|T;T;T;T;T;T;T	0.70045|0.73469	-0.45|-0.75;-0.75;-0.75;-0.75;-0.75;-0.74;-0.06	5.31|5.31	3.17|3.17	0.36434|0.36434	.|.	.|0.179769	.|0.64402	.|D	.|0.000011	T|T	0.63710|0.63710	0.2534|0.2534	L|L	0.47716|0.47716	1.5|1.5	0.22728|0.22728	N|N	0.998802|0.998802	P|P;B;B	0.51147|0.42409	0.942|0.779;0.201;0.201	P|B;B;B	0.52386|0.36030	0.697|0.216;0.143;0.143	T|T	0.56135|0.56135	-0.8029|-0.8029	9|10	0.87932|0.30854	D|T	0|0.27	-10.5152|-10.5152	12.6497|12.6497	0.56753|0.56753	0.0:0.791:0.0:0.209|0.0:0.791:0.0:0.209	.|.	836|1014;993;987	E9PC50|A6H8W4;Q6Y7W6;E9PBB0	.|.;PERQ2_HUMAN;.	E|R	836|1015;993;1015;993;987;1014;22	ENSP00000411505:Q836E|ENSP00000362667:S1015R;ENSP00000362664:S993R;ENSP00000386765:S1015R;ENSP00000386537:S993R;ENSP00000387070:S987R;ENSP00000387170:S1014R;ENSP00000415037:S22R	ENSP00000411505:Q836E|ENSP00000362664:S993R	Q|S	+|+	1|3	0|2	GIGYF2|GIGYF2	233417089|233417089	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.553000|0.553000	0.35397|0.35397	1.229000|1.229000	0.32600|0.32600	1.237000|1.237000	0.43756|0.43756	0.561000|0.561000	0.74099|0.74099	CAA|AGC	.	.		0.522	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000330316.2	NM_001103146	
RBM44	375316	hgsc.bcm.edu	37	2	238727032	238727032	+	Silent	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:238727032A>G	ENST00000409864.1	+	3	1727	c.1473A>G	c.(1471-1473)gtA>gtG	p.V491V	RBM44_ENST00000316997.4_Silent_p.V491V|RBM44_ENST00000444524.2_Intron			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	490						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		GACCTTCTGTAGTATCTACAT	0.393																																					p.V491V		Atlas-SNP	.											.	RBM44	167	.	0			c.A1473G						.						87.0	81.0	83.0					2																	238727032		1919	4133	6052	SO:0001819	synonymous_variant	375316	exon3			TTCTGTAGTATCT	AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.1473A>G	chr2.hg19:g.238727032A>G		246.0	0.0		211.0	91.0	NM_001080504	A0AUW3	Silent	SNP	ENST00000409864.1	hg19	CCDS46554.1																																																																																			.	.		0.393	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000328733.2	NM_001080504	
DYNC1LI1	51143	hgsc.bcm.edu	37	3	32568308	32568308	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr3:32568308C>T	ENST00000273130.4	-	13	1658	c.1555G>A	c.(1555-1557)Gaa>Aaa	p.E519K	DYNC1LI1_ENST00000432458.2_Missense_Mutation_p.E403K	NM_016141.3	NP_057225.2	Q9Y6G9	DC1L1_HUMAN	dynein, cytoplasmic 1, light intermediate chain 1	519					microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(1)|lung(3)|ovary(1)	7						GCTTCTCCTTCCGTAGGAGAT	0.398																																					p.E519K		Atlas-SNP	.											DYNC1LI1,NS,carcinoma,0,1	DYNC1LI1	23	.	0			c.G1555A						.						147.0	141.0	143.0					3																	32568308		2203	4300	6503	SO:0001583	missense	51143	exon13			CTCCTTCCGTAGG	AF078849	CCDS2654.1	3p23	2013-01-18	2005-11-25	2005-11-25	ENSG00000144635	ENSG00000144635		"""Cytoplasmic dyneins"""	18745	protein-coding gene	gene with protein product		615890	"""dynein, cytoplasmic, light intermediate polypeptide 1"""	DNCLI1		16260502	Standard	NM_016141		Approved		uc003cfb.4	Q9Y6G9	OTTHUMG00000130750	ENST00000273130.4:c.1555G>A	chr3.hg19:g.32568308C>T	ENSP00000273130:p.Glu519Lys	135.0	0.0		130.0	10.0	NM_016141	A2RRG7|Q53HC8|Q53HK7	Missense_Mutation	SNP	ENST00000273130.4	hg19	CCDS2654.1	.	.	.	.	.	.	.	.	.	.	C	31	5.069408	0.93950	.	.	ENSG00000144635	ENST00000273130;ENST00000432458	T;T	0.51574	1.98;0.7	5.53	5.53	0.82687	.	0.358552	0.32301	N	0.006288	T	0.58250	0.2109	N	0.22421	0.69	0.58432	D	0.999999	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	T	0.61671	-0.7015	10	0.66056	D	0.02	-31.1411	19.8132	0.96556	0.0:1.0:0.0:0.0	.	403;519	E9PHI6;Q9Y6G9	.;DC1L1_HUMAN	K	519;403	ENSP00000273130:E519K;ENSP00000407279:E403K	ENSP00000273130:E519K	E	-	1	0	DYNC1LI1	32543312	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.401000	0.59716	2.753000	0.94483	0.585000	0.79938	GAA	.	.		0.398	DYNC1LI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253250.1	NM_016141	
CTNNB1	1499	hgsc.bcm.edu	37	3	41268766	41268766	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr3:41268766A>T	ENST00000349496.5	+	7	1284	c.1004A>T	c.(1003-1005)aAa>aTa	p.K335I	CTNNB1_ENST00000396185.3_Missense_Mutation_p.K335I|CTNNB1_ENST00000405570.1_Missense_Mutation_p.K335I|CTNNB1_ENST00000453024.1_Missense_Mutation_p.K328I|CTNNB1_ENST00000396183.3_Missense_Mutation_p.K335I	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	335					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.K335I(8)	CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		ACTTACGAAAAACTACTGTGG	0.383		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												p.K335I	Colon(6;3 56 14213 18255)	Atlas-SNP	.		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	CTNNB1,colon,carcinoma,-1,11	CTNNB1	4904	.	8	Substitution - Missense(8)	liver(7)|kidney(1)	c.A1004T						.						110.0	108.0	109.0					3																	41268766		2203	4300	6503	SO:0001583	missense	1499	exon7	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	ACGAAAAACTACT	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1004A>T	chr3.hg19:g.41268766A>T	ENSP00000344456:p.Lys335Ile	110.0	0.0		104.0	41.0	NM_001098209	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Missense_Mutation	SNP	ENST00000349496.5	hg19	CCDS2694.1	.	.	.	.	.	.	.	.	.	.	A	29.8	5.040885	0.93685	.	.	ENSG00000168036	ENST00000405570;ENST00000396183;ENST00000349496;ENST00000453024;ENST00000396185	T;T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15;-0.15	5.5	5.5	0.81552	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.82148	0.4974	M	0.89287	3.02	0.80722	D	1	D;D	0.71674	0.995;0.998	D;D	0.75484	0.97;0.986	D	0.85830	0.1391	10	0.72032	D	0.01	-3.7939	15.5934	0.76558	1.0:0.0:0.0:0.0	.	263;335	B4DSW9;P35222	.;CTNB1_HUMAN	I	335;335;335;328;335	ENSP00000385604:K335I;ENSP00000379486:K335I;ENSP00000344456:K335I;ENSP00000411226:K328I;ENSP00000379488:K335I	ENSP00000344456:K335I	K	+	2	0	CTNNB1	41243770	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	9.339000	0.96797	2.094000	0.63399	0.482000	0.46254	AAA	.	.		0.383	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254182.2	NM_001098210	
CD200R1	131450	hgsc.bcm.edu	37	3	112693693	112693693	+	Silent	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr3:112693693A>T	ENST00000471858.1	-	1	244	c.12T>A	c.(10-12)ccT>ccA	p.P4P	CD200R1_ENST00000295863.4_Silent_p.P4P|CD200R1_ENST00000308611.3_Silent_p.P4P|CD200R1_ENST00000440122.2_Silent_p.P4P|CD200R1_ENST00000490004.1_Silent_p.P4P	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	4					regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						CAGTTCTCCAAGGGCAGAGCA	0.468																																					p.P4P		Atlas-SNP	.											.	CD200R1	91	.	0			c.T12A						.						207.0	178.0	188.0					3																	112693693		2203	4300	6503	SO:0001819	synonymous_variant	131450	exon1			TCTCCAAGGGCAG	AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.12T>A	chr3.hg19:g.112693693A>T		84.0	0.0		84.0	30.0	NM_138806	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Silent	SNP	ENST00000471858.1	hg19	CCDS2970.1																																																																																			.	.		0.468	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354467.1	NM_138806	
MRPL47	57129	hgsc.bcm.edu	37	3	179311574	179311574	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr3:179311574T>A	ENST00000476781.1	-	5	541	c.512A>T	c.(511-513)gAc>gTc	p.D171V	MRPL47_ENST00000392659.2_Missense_Mutation_p.D61V|MRPL47_ENST00000259038.2_Missense_Mutation_p.D151V	NM_020409.2	NP_065142.2	Q9HD33	RM47_HUMAN	mitochondrial ribosomal protein L47	171					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|stomach(1)	11	all_cancers(143;9.62e-16)|Ovarian(172;0.0172)|Breast(254;0.191)		OV - Ovarian serous cystadenocarcinoma(80;5.98e-26)|GBM - Glioblastoma multiforme(14;0.0169)|BRCA - Breast invasive adenocarcinoma(182;0.18)			TCCAAAGATGTCTCTTCTCCA	0.428																																					p.D171V		Atlas-SNP	.											.	MRPL47	31	.	0			c.A512T						.						140.0	142.0	142.0					3																	179311574		2203	4300	6503	SO:0001583	missense	57129	exon5			AAGATGTCTCTTC	AF285120	CCDS3232.1, CCDS3233.1	3q26.33	2012-11-14			ENSG00000136522	ENSG00000136522		"""Mitochondrial ribosomal proteins / large subunits"""	16652	protein-coding gene	gene with protein product	"""nasopharyngeal carcinoma metastasis-related 1"""	611852				11551941	Standard	NM_177988		Approved	CGI-204, NCM1	uc003fjz.3	Q9HD33	OTTHUMG00000157784	ENST00000476781.1:c.512A>T	chr3.hg19:g.179311574T>A	ENSP00000417602:p.Asp171Val	76.0	0.0		73.0	28.0	NM_020409	Q6XRG1|Q8N5D1	Missense_Mutation	SNP	ENST00000476781.1	hg19	CCDS3232.1	.	.	.	.	.	.	.	.	.	.	T	21.4	4.144660	0.77888	.	.	ENSG00000136522	ENST00000476781;ENST00000259038;ENST00000392659	T;T;T	0.48201	1.28;1.35;0.82	5.95	5.95	0.96441	.	0.316986	0.38272	N	0.001749	T	0.67618	0.2912	M	0.65498	2.005	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.72982	0.979;0.968	T	0.70565	-0.4837	10	0.87932	D	0	-15.2394	16.4116	0.83717	0.0:0.0:0.0:1.0	.	151;171	Q9HD33-2;Q9HD33	.;RM47_HUMAN	V	171;151;61	ENSP00000417602:D171V;ENSP00000259038:D151V;ENSP00000376427:D61V	ENSP00000259038:D151V	D	-	2	0	MRPL47	180794268	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	6.263000	0.72521	2.276000	0.75962	0.528000	0.53228	GAC	.	.		0.428	MRPL47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000349623.1	NM_020409	
EVC2	132884	hgsc.bcm.edu	37	4	5642462	5642462	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:5642462T>A	ENST00000344408.5	-	10	1302	c.1249A>T	c.(1249-1251)Agt>Tgt	p.S417C	EVC2_ENST00000310917.2_Missense_Mutation_p.S337C|EVC2_ENST00000344938.1_Missense_Mutation_p.S417C	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	417					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						aggtggccactgctggtgaga	0.453																																					p.S417C		Atlas-SNP	.											.	EVC2	202	.	0			c.A1249T						.						100.0	99.0	100.0					4																	5642462		2203	4300	6503	SO:0001583	missense	132884	exon10			GGCCACTGCTGGT	AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1249A>T	chr4.hg19:g.5642462T>A	ENSP00000342144:p.Ser417Cys	89.0	0.0		76.0	25.0	NM_147127	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	ENST00000344408.5	hg19	CCDS3382.2	.	.	.	.	.	.	.	.	.	.	T	11.46	1.646443	0.29246	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.78595	-1.19;-1.19;-1.19	4.25	-2.84	0.05751	.	0.537818	0.19199	N	0.120234	T	0.76076	0.3937	L	0.56769	1.78	0.09310	N	1	D	0.69078	0.997	P	0.60173	0.87	T	0.65672	-0.6111	10	0.56958	D	0.05	3.2052	1.3344	0.02142	0.136:0.2377:0.1401:0.4862	.	417	Q86UK5	LBN_HUMAN	C	417;337;417	ENSP00000339954:S417C;ENSP00000311683:S337C;ENSP00000342144:S417C	ENSP00000311683:S337C	S	-	1	0	EVC2	5693363	0.000000	0.05858	0.004000	0.12327	0.051000	0.14879	-0.774000	0.04684	-0.455000	0.07054	0.482000	0.46254	AGT	.	.		0.453	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000289822.2	NM_147127	
ALB	213	hgsc.bcm.edu	37	4	74277801	74277801	+	Missense_Mutation	SNP	G	G	A	rs78340021|rs36067576		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:74277801G>A	ENST00000503124.1	+	5	559	c.352G>A	c.(352-354)Gaa>Aaa	p.E118K	ALB_ENST00000401494.3_Missense_Mutation_p.E153K|ALB_ENST00000295897.4_Missense_Mutation_p.E268K|ALB_ENST00000509063.1_Missense_Mutation_p.E268K|ALB_ENST00000415165.2_Missense_Mutation_p.E76K|ALB_ENST00000505649.1_3'UTR			Q8TES7	FBF1_HUMAN	albumin	0					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)		p.V265fs*8(2)		NS(1)|endometrium(4)|kidney(1)|large_intestine(6)|liver(9)|lung(16)|ovary(3)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	48	Breast(15;0.00102)		Epithelial(6;4.8e-05)|OV - Ovarian serous cystadenocarcinoma(6;0.000263)|all cancers(17;0.000472)|Lung(101;0.103)|LUSC - Lung squamous cell carcinoma(112;0.154)			AGTCCACACGGAATGCTGCCA	0.453																																					p.E268K		Atlas-SNP	.											.	ALB	132	.	2	Deletion - Frameshift(2)	liver(2)	c.G802A	GRCh37	CM050168	ALB	M	rs36067576	.						201.0	182.0	189.0					4																	74277801		2203	4300	6503	SO:0001583	missense	213	exon7			CACACGGAATGCT	V00494	CCDS3555.1	4q13.3	2008-02-05	2006-06-30	2006-06-30	ENSG00000163631	ENSG00000163631			399	protein-coding gene	gene with protein product		103600				6292049, 6192711	Standard	NM_000477		Approved		uc003hgs.4	P02768	OTTHUMG00000129919	ENST00000503124.1:c.352G>A	chr4.hg19:g.74277801G>A	ENSP00000421027:p.Glu118Lys	105.0	0.0		89.0	31.0	NM_000477	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	ENST00000503124.1	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.180770|5.180770	0.94846|0.94846	.|.	.|.	ENSG00000163631|ENSG00000163631	ENST00000295897;ENST00000415165;ENST00000503124;ENST00000509063;ENST00000401494;ENST00000430202|ENST00000511370	T;T;T;T;T|.	0.71698|.	-0.59;-0.59;-0.59;-0.59;-0.59|.	6.02|6.02	6.02|6.02	0.97574|0.97574	Serum albumin-like (1);Serum albumin, N-terminal (3);|.	0.109676|.	0.64402|.	D|.	0.000010|.	T|T	0.78426|0.78426	0.4281|0.4281	M|M	0.77486|0.77486	2.375|2.375	0.51767|0.51767	D|D	0.999939|0.999939	D;D;D;D;D|.	0.89917|.	1.0;0.975;0.997;0.993;0.996|.	D;P;D;P;D|.	0.76575|.	0.988;0.832;0.95;0.902;0.942|.	T|T	0.76798|0.76798	-0.2826|-0.2826	10|5	0.87932|.	D|.	0|.	-42.9847|-42.9847	19.1045|19.1045	0.93287|0.93287	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	153;76;118;268;268|.	B7WNR0;C9JKR2;D6RHD5;A6NBZ8;P02768|.	.;.;.;.;ALBU_HUMAN|.	K|E	268;76;118;268;153;277|112	ENSP00000295897:E268K;ENSP00000401820:E76K;ENSP00000421027:E118K;ENSP00000422784:E268K;ENSP00000384695:E153K|.	ENSP00000295897:E268K|.	E|G	+|+	1|2	0|0	ALB|ALB	74496665|74496665	1.000000|1.000000	0.71417|0.71417	0.977000|0.977000	0.42913|0.42913	0.755000|0.755000	0.42902|0.42902	4.321000|4.321000	0.59209|0.59209	2.865000|2.865000	0.98341|0.98341	0.655000|0.655000	0.94253|0.94253	GAA|GGA	.	.		0.453	ALB-011	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000365419.1	NM_000477	
FRAS1	80144	hgsc.bcm.edu	37	4	79328978	79328978	+	Missense_Mutation	SNP	G	G	A	rs371136161		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:79328978G>A	ENST00000325942.6	+	31	4731	c.4291G>A	c.(4291-4293)Gac>Aac	p.D1431N	FRAS1_ENST00000264895.6_Missense_Mutation_p.D1431N	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	1431					cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						AGCCCAGAGCGACTCCTTCCG	0.502																																					p.D1431N		Atlas-SNP	.											.	FRAS1	779	.	0			c.G4291A						.	G	ASN/ASP,ASN/ASP	0,4172		0,0,2086	59.0	67.0	64.0		4291,4291	5.7	1.0	4		64	2,8434		0,2,4216	no	missense,missense	FRAS1	NM_001166133.1,NM_025074.6	23,23	0,2,6302	AA,AG,GG		0.0237,0.0,0.0159	probably-damaging,probably-damaging	1431/1977,1431/4013	79328978	2,12606	2086	4218	6304	SO:0001583	missense	80144	exon31			CAGAGCGACTCCT	AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.4291G>A	chr4.hg19:g.79328978G>A	ENSP00000326330:p.Asp1431Asn	150.0	0.0		188.0	66.0	NM_001166133	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	ENST00000325942.6	hg19	CCDS54772.1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619240	0.87460	0.0	2.37E-4	ENSG00000138759	ENST00000325942;ENST00000264895	T;T	0.48522	0.81;0.81	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.72252	0.3437	M	0.86178	2.8	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.65443	0.935;0.932	T	0.76052	-0.3100	10	0.66056	D	0.02	.	18.7528	0.91821	0.0:0.0:1.0:0.0	.	1431;1431	E9PHH6;A2RRR8	.;.	N	1431	ENSP00000326330:D1431N;ENSP00000264895:D1431N	ENSP00000264895:D1431N	D	+	1	0	FRAS1	79548002	1.000000	0.71417	0.995000	0.50966	0.865000	0.49528	8.884000	0.92432	2.671000	0.90904	0.585000	0.79938	GAC	.	.		0.502	FRAS1-001	NOVEL	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000362706.2		
PLAC8	51316	hgsc.bcm.edu	37	4	84026085	84026085	+	Silent	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:84026085T>C	ENST00000509973.1	-	2	159	c.36A>G	c.(34-36)gcA>gcG	p.A12A	PLAC8_ENST00000515389.1_Intron|PLAC8_ENST00000505406.1_Silent_p.A69A|PLAC8_ENST00000411416.2_Silent_p.A69A|PLAC8_ENST00000311507.4_Silent_p.A69A|PLAC8_ENST00000426923.2_Silent_p.A69A			Q9UHV8	PP13_HUMAN	placenta-specific 8	0	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|phospholipid metabolic process (GO:0006644)		carbohydrate binding (GO:0030246)|lysophospholipase activity (GO:0004622)			large_intestine(2)|lung(3)|ovary(1)	6		Hepatocellular(203;0.114)				GAGTCCTCATTGCGACGCTTG	0.443																																					p.A69A		Atlas-SNP	.											.	PLAC8	17	.	0			c.A207G						.						121.0	111.0	114.0					4																	84026085		2203	4300	6503	SO:0001819	synonymous_variant	51316	exon3			CCTCATTGCGACG	AF208846	CCDS3601.1	4q21.22	2006-05-20			ENSG00000145287	ENSG00000145287			19254	protein-coding gene	gene with protein product		607515				12758124, 12384430	Standard	NM_016619		Approved	onzin, C15	uc003hoe.3	Q9NZF1	OTTHUMG00000130294	ENST00000509973.1:c.36A>G	chr4.hg19:g.84026085T>C		228.0	0.0		217.0	83.0	NM_001130716	C5HZ15	Silent	SNP	ENST00000509973.1	hg19																																																																																				.	.		0.443	PLAC8-003	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000363078.1	NM_016619	
WDFY3	23001	hgsc.bcm.edu	37	4	85781608	85781608	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:85781608T>A	ENST00000295888.4	-	4	544	c.137A>T	c.(136-138)gAa>gTa	p.E46V	WDFY3_ENST00000322366.6_Missense_Mutation_p.E46V	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	46					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CTCTTCTTGTTCCTTCTGAGT	0.547																																					p.E46V		Atlas-SNP	.											.	WDFY3	314	.	0			c.A137T						.						150.0	137.0	142.0					4																	85781608		2203	4300	6503	SO:0001583	missense	23001	exon4			TCTTGTTCCTTCT	AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.137A>T	chr4.hg19:g.85781608T>A	ENSP00000295888:p.Glu46Val	94.0	0.0		104.0	35.0	NM_014991	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	ENST00000295888.4	hg19	CCDS3609.1	.	.	.	.	.	.	.	.	.	.	T	35	5.495060	0.96339	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000509172	T;T	0.70045	-0.45;-0.45	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.80423	0.4620	M	0.66939	2.045	0.80722	D	1	D;D	0.89917	1.0;0.995	D;P	0.73380	0.98;0.854	T	0.82544	-0.0404	10	0.87932	D	0	.	16.0204	0.80478	0.0:0.0:0.0:1.0	.	46;46	E2QRK8;Q8IZQ1	.;WDFY3_HUMAN	V	46	ENSP00000318466:E46V;ENSP00000295888:E46V	ENSP00000295888:E46V	E	-	2	0	WDFY3	86000632	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	7.806000	0.86020	2.174000	0.68829	0.533000	0.62120	GAA	.	.		0.547	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252811.2	NM_014991	
GYPB	2994	hgsc.bcm.edu	37	4	144920597	144920597	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:144920597T>A	ENST00000502664.1	-	3	193	c.142A>T	c.(142-144)Acg>Tcg	p.T48S	GYPB_ENST00000283126.7_Missense_Mutation_p.T48S|GYPB_ENST00000510196.2_5'UTR|GYPB_ENST00000429670.2_Missense_Mutation_p.T48S|GYPB_ENST00000513128.1_Missense_Mutation_p.T15S|RP11-673E1.4_ENST00000506982.1_RNA	NM_002100.4	NP_002091	P06028	GLPB_HUMAN	glycophorin B (MNS blood group)	48			T -> M (in S antigen and Mit antigen; dbSNP:rs7683365). {ECO:0000269|PubMed:11239234}.			integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|skin(1)	4	all_hematologic(180;0.158)					AGTTGTCCCGTTTCTCCTATA	0.323																																					p.T48S		Atlas-SNP	.											.	GYPB	17	.	0			c.A142T						.						47.0	51.0	50.0					4																	144920597		2182	4299	6481	SO:0001583	missense	2994	exon3			GTCCCGTTTCTCC		CCDS54809.1	4q31.21	2014-09-17	2006-02-23			ENSG00000250361		"""CD molecules"", ""Blood group antigens"""	4703	protein-coding gene	gene with protein product		111740	"""glycophorin B (includes Ss blood group)"", ""glycophorin B (Ss blood group)"""	MNS			Standard	NM_002100		Approved	GPB, SS, CD235b		P06028		ENST00000502664.1:c.142A>T	chr4.hg19:g.144920597T>A	ENSP00000427690:p.Thr48Ser	423.0	0.0		439.0	181.0	NM_002100	B8Q174|E2QBW7|Q0VAF4|Q58HE9|Q58HF0|Q58HF1|Q9UCH7	Missense_Mutation	SNP	ENST00000502664.1	hg19	CCDS54809.1	.	.	.	.	.	.	.	.	.	.	t	0.972	-0.699786	0.03279	.	.	ENSG00000250361	ENST00000283126;ENST00000502664;ENST00000513128;ENST00000429670	T;T;T;T	0.14266	2.52;2.52;2.52;3.15	1.85	-3.71	0.04424	.	1.054030	0.07555	N	0.916052	T	0.05044	0.0135	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.41016	-0.9532	9	0.12430	T	0.62	.	1.0137	0.01502	0.19:0.145:0.3852:0.2797	.	48	E2QBW7	.	S	48;48;15;48	ENSP00000283126:T48S;ENSP00000427690:T48S;ENSP00000425244:T15S;ENSP00000394200:T48S	ENSP00000283126:T48S	T	-	1	0	GYPB	145140047	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.151000	0.03175	-1.420000	0.02009	-1.667000	0.00748	ACG	.	.		0.323	GYPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364791.1	NM_002100	
NR3C2	4306	hgsc.bcm.edu	37	4	149357529	149357529	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:149357529T>A	ENST00000358102.3	-	2	846	c.484A>T	c.(484-486)Aga>Tga	p.R162*	NR3C2_ENST00000355292.3_Nonsense_Mutation_p.R162*|NR3C2_ENST00000512865.1_Nonsense_Mutation_p.R162*|NR3C2_ENST00000344721.4_Nonsense_Mutation_p.R162*|NR3C2_ENST00000511528.1_Nonsense_Mutation_p.R162*	NM_000901.4|NM_001166104.1	NP_000892.2|NP_001159576.1	P08235	MCR_HUMAN	nuclear receptor subfamily 3, group C, member 2	162	Modulating.				gene expression (GO:0010467)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|receptor complex (GO:0043235)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(14)|liver(1)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.0614)	Drospirenone(DB01395)|Eplerenone(DB00700)|Felodipine(DB01023)|Fludrocortisone(DB00687)|Fluticasone Propionate(DB00588)|Nimodipine(DB00393)|Progesterone(DB00396)|Spironolactone(DB00421)	ATAAATGATCTCAAGGGCGTG	0.463																																					p.R162X	Melanoma(27;428 957 40335 51025 51111)	Atlas-SNP	.											.	NR3C2	94	.	0			c.A484T						.						104.0	103.0	104.0					4																	149357529		2203	4300	6503	SO:0001587	stop_gained	4306	exon2			ATGATCTCAAGGG	M16801	CCDS3772.1, CCDS54811.1	4q31	2013-01-16			ENSG00000151623	ENSG00000151623		"""Nuclear hormone receptors"""	7979	protein-coding gene	gene with protein product		600983		MLR		2558856	Standard	NM_000901		Approved	MR	uc003ilj.4	P08235	OTTHUMG00000161455	ENST00000358102.3:c.484A>T	chr4.hg19:g.149357529T>A	ENSP00000350815:p.Arg162*	46.0	0.0		51.0	14.0	NM_001166104	B0ZBF5|B0ZBF7|Q2NKL1|Q96KQ8|Q96KQ9	Nonsense_Mutation	SNP	ENST00000358102.3	hg19	CCDS3772.1	.	.	.	.	.	.	.	.	.	.	T	37	6.128488	0.97310	.	.	ENSG00000151623	ENST00000344721;ENST00000355292;ENST00000358102;ENST00000512865;ENST00000544252;ENST00000342437;ENST00000511528	.	.	.	5.56	-0.276	0.12902	.	0.265869	0.35838	N	0.002953	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1596	0.81693	0.0:0.0:0.5715:0.4285	.	.	.	.	X	162	.	.	R	-	1	2	NR3C2	149576979	0.998000	0.40836	0.684000	0.30055	0.990000	0.78478	0.671000	0.25172	-0.235000	0.09767	0.383000	0.25322	AGA	.	.		0.463	NR3C2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364986.1		
LRBA	987	hgsc.bcm.edu	37	4	151935691	151935691	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:151935691A>G	ENST00000357115.3	-	2	347	c.104T>C	c.(103-105)cTg>cCg	p.L35P	LRBA_ENST00000535741.1_Missense_Mutation_p.L35P|LRBA_ENST00000507224.1_Missense_Mutation_p.L35P|LRBA_ENST00000510413.1_Missense_Mutation_p.L35P	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	35						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					CCCTGGTTTCAGAGACAATGC	0.522																																					p.L35P		Atlas-SNP	.											.	LRBA	253	.	0			c.T104C						.						63.0	55.0	58.0					4																	151935691		2203	4300	6503	SO:0001583	missense	987	exon2			GGTTTCAGAGACA	AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.104T>C	chr4.hg19:g.151935691A>G	ENSP00000349629:p.Leu35Pro	148.0	0.0		167.0	64.0	NM_006726	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Missense_Mutation	SNP	ENST00000357115.3	hg19	CCDS3773.1	.	.	.	.	.	.	.	.	.	.	A	23.4	4.408210	0.83340	.	.	ENSG00000198589	ENST00000535741;ENST00000510413;ENST00000357115;ENST00000507224	T;T;T;T	0.63744	0.37;0.52;0.37;-0.06	5.24	5.24	0.73138	.	0.540003	0.16201	N	0.224916	T	0.74726	0.3754	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.99	D;D;P	0.78314	0.991;0.951;0.885	T	0.75246	-0.3385	10	0.62326	D	0.03	.	13.3454	0.60571	1.0:0.0:0.0:0.0	.	35;35;35	P50851;Q6P1X2;P50851-2	LRBA_HUMAN;.;.	P	35	ENSP00000446299:L35P;ENSP00000421552:L35P;ENSP00000349629:L35P;ENSP00000422180:L35P	ENSP00000349629:L35P	L	-	2	0	LRBA	152155141	1.000000	0.71417	0.980000	0.43619	0.841000	0.47740	6.272000	0.72575	1.988000	0.58038	0.454000	0.30748	CTG	.	.		0.522	LRBA-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000364939.1		
MTNR1A	4543	hgsc.bcm.edu	37	4	187454913	187454913	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr4:187454913G>T	ENST00000307161.5	-	2	1184	c.983C>A	c.(982-984)gCc>gAc	p.A328D	RP11-215A19.2_ENST00000509111.1_Intron	NM_005958.3	NP_005949.1	P48039	MTR1A_HUMAN	melatonin receptor 1A	328					circadian rhythm (GO:0007623)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|mating behavior (GO:0007617)|positive regulation of cGMP biosynthetic process (GO:0030828)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	hormone binding (GO:0042562)|melatonin receptor activity (GO:0008502)|organic cyclic compound binding (GO:0097159)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	14		all_cancers(14;6.39e-56)|all_epithelial(14;1.48e-41)|all_lung(41;2.45e-15)|Lung NSC(41;7.26e-15)|Melanoma(20;1.91e-06)|Hepatocellular(41;0.00335)|Prostate(90;0.00996)|all_hematologic(60;0.014)|Colorectal(36;0.0161)|Renal(120;0.0183)|all_neural(102;0.202)		OV - Ovarian serous cystadenocarcinoma(60;7.63e-12)|BRCA - Breast invasive adenocarcinoma(30;6.68e-07)|GBM - Glioblastoma multiforme(59;3.44e-05)|LUSC - Lung squamous cell carcinoma(40;0.000106)|STAD - Stomach adenocarcinoma(60;0.000279)|READ - Rectum adenocarcinoma(43;0.159)	Agomelatine(DB06594)|Melatonin(DB01065)|Ramelteon(DB00980)	AACCCTATCGGCCACGTCGTT	0.463																																					p.A328D		Atlas-SNP	.											.	MTNR1A	46	.	0			c.C983A						.						134.0	131.0	132.0					4																	187454913		2203	4300	6503	SO:0001583	missense	4543	exon2			CTATCGGCCACGT		CCDS3848.1	4q35	2012-08-08				ENSG00000168412		"""GPCR / Class A : Melatonin receptors"""	7463	protein-coding gene	gene with protein product		600665				7558006	Standard	NM_005958		Approved	MEL-1A-R	uc003izd.1	P48039		ENST00000307161.5:c.983C>A	chr4.hg19:g.187454913G>T	ENSP00000302811:p.Ala328Asp	155.0	0.0		138.0	12.0	NM_005958	A0AVC5|B0M0L2	Missense_Mutation	SNP	ENST00000307161.5	hg19	CCDS3848.1	.	.	.	.	.	.	.	.	.	.	G	3.400	-0.122501	0.06795	.	.	ENSG00000168412	ENST00000307161	T	0.71934	-0.61	4.66	1.78	0.24846	.	0.416861	0.26971	N	0.021562	T	0.57154	0.2034	M	0.65975	2.015	0.26810	N	0.969029	B	0.20550	0.046	B	0.20184	0.028	T	0.37502	-0.9703	10	0.12430	T	0.62	-1.1541	0.9476	0.01369	0.2233:0.1312:0.3768:0.2687	.	328	P48039	MTR1A_HUMAN	D	328	ENSP00000302811:A328D	ENSP00000302811:A328D	A	-	2	0	MTNR1A	187691907	0.608000	0.26966	0.005000	0.12908	0.016000	0.09150	0.581000	0.23819	0.097000	0.17492	0.655000	0.94253	GCC	.	.		0.463	MTNR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000360189.1		
BASP1	10409	hgsc.bcm.edu	37	5	17275577	17275577	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr5:17275577G>A	ENST00000322611.3	+	2	512	c.252G>A	c.(250-252)aaG>aaA	p.K84K		NM_001271606.1|NM_006317.3	NP_001258535.1|NP_006308.3	P80723	BASP1_HUMAN	brain abundant, membrane attached signal protein 1	84					diaphragm development (GO:0060539)|glomerular visceral epithelial cell differentiation (GO:0072112)|gonad development (GO:0008406)|mesenchymal to epithelial transition (GO:0060231)|metanephric mesenchyme development (GO:0072075)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of heart growth (GO:0060421)|positive regulation of metanephric ureteric bud development (GO:2001076)|substantia nigra development (GO:0021762)|thorax and anterior abdomen determination (GO:0007356)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|lung(8)	9						AGGCCCCGAAGGCGGAGCCCG	0.756																																					p.K84K		Atlas-SNP	.											.	BASP1	29	.	0			c.G252A						.						11.0	16.0	15.0					5																	17275577		2007	3903	5910	SO:0001819	synonymous_variant	10409	exon2			CCCGAAGGCGGAG	AF039656	CCDS3888.1	5p15.1	2010-12-03			ENSG00000176788	ENSG00000176788			957	protein-coding gene	gene with protein product		605940				9310187, 9749536	Standard	NM_001271606		Approved	NAP-22, NAP22, CAP23, CAP-23	uc031siz.1	P80723	OTTHUMG00000131061	ENST00000322611.3:c.252G>A	chr5.hg19:g.17275577G>A		101.0	0.0		107.0	38.0	NM_006317	B4DJA8|D3DTD5|O43596|Q5U0S0|Q9BWA5	Silent	SNP	ENST00000322611.3	hg19	CCDS3888.1																																																																																			.	.		0.756	BASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253716.2		
ADAMTS19	171019	hgsc.bcm.edu	37	5	128994333	128994333	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr5:128994333A>C	ENST00000274487.4	+	15	2455	c.2310A>C	c.(2308-2310)ttA>ttC	p.L770F	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	770	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		ATGGTTTATTAGGGTCTCTTG	0.378																																					p.L770F		Atlas-SNP	.											.	ADAMTS19	216	.	0			c.A2310C						.						176.0	173.0	174.0					5																	128994333		2203	4300	6503	SO:0001583	missense	171019	exon15			TTTATTAGGGTCT	AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2310A>C	chr5.hg19:g.128994333A>C	ENSP00000274487:p.Leu770Phe	77.0	0.0		75.0	23.0	NM_133638		Missense_Mutation	SNP	ENST00000274487.4	hg19	CCDS4146.1	.	.	.	.	.	.	.	.	.	.	A	16.14	3.038989	0.55003	.	.	ENSG00000145808	ENST00000274487	T	0.69306	-0.39	3.89	0.284	0.15701	.	0.114263	0.33327	N	0.005030	T	0.64692	0.2621	L	0.58510	1.815	0.41536	D	0.988481	D	0.56968	0.978	P	0.50754	0.649	T	0.61431	-0.7064	9	.	.	.	.	8.3034	0.32027	0.6485:0.0:0.3515:0.0	.	770	Q8TE59	ATS19_HUMAN	F	770	ENSP00000274487:L770F	.	L	+	3	2	ADAMTS19	129022232	0.988000	0.35896	0.998000	0.56505	0.987000	0.75469	0.277000	0.18734	0.046000	0.15833	-0.263000	0.10527	TTA	.	.		0.378	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250979.2	NM_133638	
SH3TC2	79628	hgsc.bcm.edu	37	5	148406144	148406144	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr5:148406144T>C	ENST00000515425.1	-	12	3145	c.3044A>G	c.(3043-3045)aAt>aGt	p.N1015S	SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000394358.2_3'UTR|SH3TC2_ENST00000538184.1_Missense_Mutation_p.N562S|SH3TC2_ENST00000512049.1_Missense_Mutation_p.N1008S	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1015					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTGGCGGTATTTAGGTTCCG	0.547																																					p.N1015S		Atlas-SNP	.											.	SH3TC2	178	.	0			c.A3044G						.						83.0	89.0	87.0					5																	148406144		2203	4300	6503	SO:0001583	missense	79628	exon12			GCGGTATTTAGGT	AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3044A>G	chr5.hg19:g.148406144T>C	ENSP00000423660:p.Asn1015Ser	124.0	0.0		109.0	33.0	NM_024577	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Missense_Mutation	SNP	ENST00000515425.1	hg19	CCDS4293.1	.	.	.	.	.	.	.	.	.	.	T	9.446	1.089388	0.20390	.	.	ENSG00000169247	ENST00000538184;ENST00000515425;ENST00000512049	T;T;T	0.80566	-1.39;-0.97;-0.97	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.67031	0.2850	L	0.40543	1.245	0.80722	D	1	P;P;P	0.41188	0.495;0.741;0.495	B;B;B	0.29598	0.104;0.104;0.104	T	0.67906	-0.5549	10	0.33141	T	0.24	-22.2996	10.2038	0.43101	0.0:0.083:0.0:0.917	.	1008;1015;1015	Q14CC0;E9PDF1;Q8TF17	.;.;S3TC2_HUMAN	S	562;1015;1008	ENSP00000441427:N562S;ENSP00000423660:N1015S;ENSP00000421860:N1008S	ENSP00000425627:N1015S	N	-	2	0	SH3TC2	148386337	1.000000	0.71417	0.948000	0.38648	0.006000	0.05464	3.440000	0.52886	2.254000	0.74563	0.482000	0.46254	AAT	.	.		0.547	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252186.2	NM_024577	
PNPLA1	285848	hgsc.bcm.edu	37	6	36269664	36269664	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:36269664A>T	ENST00000394571.2	+	6	802	c.802A>T	c.(802-804)Aag>Tag	p.K268*	PNPLA1_ENST00000388715.3_Nonsense_Mutation_p.K173*|PNPLA1_ENST00000312917.5_Nonsense_Mutation_p.K182*	NM_001145717.1	NP_001139189.2	Q8N8W4	PLPL1_HUMAN	patatin-like phospholipase domain containing 1	268					lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)	hydrolase activity (GO:0016787)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)	22						TTCTTCCTCCAAGAGAGTGAT	0.498											OREG0017382	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K268X		Atlas-SNP	.											.	PNPLA1	92	.	0			c.A802T						.						82.0	85.0	84.0					6																	36269664		2203	4300	6503	SO:0001587	stop_gained	285848	exon6			TCCTCCAAGAGAG		CCDS34438.1, CCDS47416.1, CCDS54997.1	6p21.31	2009-01-12			ENSG00000180316	ENSG00000180316		"""Patatin-like phospholipase domain containing"""	21246	protein-coding gene	gene with protein product		612121				16799181, 19029121	Standard	NM_001145717		Approved	FLJ38755, dJ50J22.1	uc010jwf.2	Q8N8W4	OTTHUMG00000014590	ENST00000394571.2:c.802A>T	chr6.hg19:g.36269664A>T	ENSP00000378072:p.Lys268*	76.0	0.0	861	80.0	22.0	NM_001145717	A3RMU3|J3JS20|Q2A6N1|Q3SY95|Q3SY96|Q5R3L2	Nonsense_Mutation	SNP	ENST00000394571.2	hg19	CCDS54997.1	.	.	.	.	.	.	.	.	.	.	A	36	5.767684	0.96914	.	.	ENSG00000180316	ENST00000388715;ENST00000312917;ENST00000457797;ENST00000394571	.	.	.	5.61	5.61	0.85477	.	0.000000	0.52532	D	0.000075	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.2608	12.1977	0.54307	1.0:0.0:0.0:0.0	.	.	.	.	X	173;182;269;268	.	ENSP00000321116:K182X	K	+	1	0	PNPLA1	36377642	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	4.247000	0.58750	2.136000	0.66102	0.459000	0.35465	AAG	.	.		0.498	PNPLA1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding		NM_173676	
FAM135A	57579	hgsc.bcm.edu	37	6	71185406	71185406	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:71185406T>A	ENST00000418814.2	+	7	952	c.338T>A	c.(337-339)tTg>tAg	p.L113*	FAM135A_ENST00000457062.2_Nonsense_Mutation_p.L70*|FAM135A_ENST00000370479.3_Nonsense_Mutation_p.L70*|FAM135A_ENST00000505769.1_Nonsense_Mutation_p.L113*|FAM135A_ENST00000505868.1_Nonsense_Mutation_p.L113*|FAM135A_ENST00000361499.3_Nonsense_Mutation_p.L113*	NM_001105531.2|NM_001162529.1	NP_001099001.1|NP_001156001.1	Q9P2D6	F135A_HUMAN	family with sequence similarity 135, member A	113										breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38						CTATTATCCTTGGATCTACAC	0.284																																					p.L113X		Atlas-SNP	.											.	FAM135A	181	.	0			c.T338A						.						60.0	65.0	63.0					6																	71185406		2201	4292	6493	SO:0001587	stop_gained	57579	exon5			TATCCTTGGATCT	AK000183	CCDS34481.1, CCDS47448.1, CCDS55028.1	6q13	2008-10-30	2007-05-11	2007-05-11	ENSG00000082269	ENSG00000082269			21084	protein-coding gene	gene with protein product			"""KIAA1411"""	KIAA1411		10718198	Standard	NM_001105531		Approved	FLJ20176	uc003pfj.3	Q9P2D6	OTTHUMG00000014991	ENST00000418814.2:c.338T>A	chr6.hg19:g.71185406T>A	ENSP00000410768:p.Leu113*	130.0	0.0		105.0	41.0	NM_001162529	A2RRQ5|Q3C0H3|Q5JXK0|Q5JXK1|Q68DW0|Q6P081|Q9H0F2|Q9NU48|Q9NUQ5|Q9NXL5	Nonsense_Mutation	SNP	ENST00000418814.2	hg19	CCDS55028.1	.	.	.	.	.	.	.	.	.	.	T	38	7.185762	0.98121	.	.	ENSG00000082269	ENST00000418814;ENST00000370479;ENST00000505769;ENST00000515323;ENST00000457062;ENST00000361499;ENST00000505868	.	.	.	5.67	5.67	0.87782	.	0.077054	0.56097	D	0.000031	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.2002	0.82067	0.0:0.0:0.0:1.0	.	.	.	.	X	113;70;113;113;70;113;113	.	ENSP00000194672:L113X	L	+	2	0	FAM135A	71242127	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.595000	0.82710	2.285000	0.76669	0.528000	0.53228	TTG	.	.		0.284	FAM135A-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041137.2	NM_020819	
EEF1A1	1915	hgsc.bcm.edu	37	6	74228303	74228303	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:74228303T>A	ENST00000316292.9	-	5	1794	c.803A>T	c.(802-804)gAg>gTg	p.E268V	EEF1A1_ENST00000309268.6_Missense_Mutation_p.E268V|EEF1A1_ENST00000491404.1_Intron|EEF1A1_ENST00000331523.2_Missense_Mutation_p.E268V	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	268					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AACACCAGTCTCCACTCGGCC	0.413											OREG0003895	type=REGULATORY REGION|Gene=D16891|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																									p.E268V		Atlas-SNP	.											.	EEF1A1	56	.	0			c.A803T						.						71.0	72.0	72.0					6																	74228303		2133	4269	6402	SO:0001583	missense	1915	exon6			CCAGTCTCCACTC	BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.803A>T	chr6.hg19:g.74228303T>A	ENSP00000339063:p.Glu268Val	280.0	0.0	1151	317.0	98.0	NM_001402	P04719|P04720|Q6IQ15	Missense_Mutation	SNP	ENST00000316292.9	hg19	CCDS4980.1	.	.	.	.	.	.	.	.	.	.	T	22.5	4.296290	0.81025	.	.	ENSG00000156508	ENST00000316292;ENST00000309268;ENST00000331523;ENST00000391977	T;T;T	0.64803	-0.12;-0.12;-0.12	4.71	4.71	0.59529	Translation elongation factor EFTu/EF1A, domain 2 (2);Translation elongation/initiation factor/Ribosomal, beta-barrel (2);	0.126928	0.50627	U	0.000107	D	0.86793	0.6018	H	0.99650	4.68	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.92591	0.6083	10	0.87932	D	0	.	14.5361	0.67960	0.0:0.0:0.0:1.0	.	268;268;268;268	P68104;Q53HR5;Q6IPS9;Q5VTE0	EF1A1_HUMAN;.;.;EF1A3_HUMAN	V	268;268;268;247	ENSP00000339063:E268V;ENSP00000339053:E268V;ENSP00000330054:E268V	ENSP00000339053:E268V	E	-	2	0	EEF1A1	74285024	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.654000	0.83653	1.883000	0.54544	0.454000	0.30748	GAG	.	.		0.413	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041210.2	NM_001402	
PHIP	55023	hgsc.bcm.edu	37	6	79679863	79679863	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:79679863T>C	ENST00000275034.4	-	26	3192	c.3025A>G	c.(3025-3027)Ata>Gta	p.I1009V	PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1009	Mediates interaction with IRS1. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		TCATACTTTATGCCAACTATT	0.363																																					p.I1009V		Atlas-SNP	.											.	PHIP	177	.	0			c.A3025G						.						118.0	119.0	118.0					6																	79679863		2203	4300	6503	SO:0001583	missense	55023	exon26			ACTTTATGCCAAC	AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3025A>G	chr6.hg19:g.79679863T>C	ENSP00000275034:p.Ile1009Val	74.0	0.0		62.0	22.0	NM_017934	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	ENST00000275034.4	hg19	CCDS4987.1	.	.	.	.	.	.	.	.	.	.	T	22.3	4.269135	0.80469	.	.	ENSG00000146247	ENST00000275034	T	0.39406	1.08	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.49474	0.1559	M	0.62209	1.925	0.80722	D	1	P;P	0.48640	0.913;0.913	P;P	0.61592	0.891;0.891	T	0.47262	-0.9131	9	.	.	.	-20.8541	14.7826	0.69776	0.0:0.0:0.0:1.0	.	1009;1009	A7J992;Q8WWQ0	.;PHIP_HUMAN	V	1009	ENSP00000275034:I1009V	.	I	-	1	0	PHIP	79736582	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.698000	0.84413	2.094000	0.63399	0.455000	0.32223	ATA	.	.		0.363	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041297.2		
FBXL4	26235	hgsc.bcm.edu	37	6	99353398	99353398	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:99353398G>A	ENST00000369244.2	-	6	1435	c.1007C>T	c.(1006-1008)tCt>tTt	p.S336F	FBXL4_ENST00000229971.1_Missense_Mutation_p.S336F	NM_001278716.1	NP_001265645.1	Q9UKA2	FBXL4_HUMAN	F-box and leucine-rich repeat protein 4	336					ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)				central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(2)	18		all_cancers(76;1.56e-06)|Acute lymphoblastic leukemia(125;4.93e-10)|all_hematologic(75;3.55e-07)|all_epithelial(107;0.00893)|Colorectal(196;0.069)|Lung NSC(302;0.197)		BRCA - Breast invasive adenocarcinoma(108;0.0413)		AAATTCCAGAGAAGTGTCATC	0.448																																					p.S336F		Atlas-SNP	.											.	FBXL4	54	.	0			c.C1007T						.						190.0	174.0	179.0					6																	99353398		2203	4300	6503	SO:0001583	missense	26235	exon5			TCCAGAGAAGTGT	AF176699	CCDS5041.1	6q16.1-q16.3	2011-06-09			ENSG00000112234	ENSG00000112234		"""F-boxes / Leucine-rich repeats"""	13601	protein-coding gene	gene with protein product		605654				10531035	Standard	NM_012160		Approved	FBL4, FBL5	uc003ppf.1	Q9UKA2	OTTHUMG00000015259	ENST00000369244.2:c.1007C>T	chr6.hg19:g.99353398G>A	ENSP00000358247:p.Ser336Phe	133.0	0.0		107.0	31.0	NM_012160	B2R7Q5|E1P530|O95919|Q5BJH0|Q9UJU0	Missense_Mutation	SNP	ENST00000369244.2	hg19	CCDS5041.1	.	.	.	.	.	.	.	.	.	.	G	15.24	2.773871	0.49786	.	.	ENSG00000112234	ENST00000369244;ENST00000229971	T;T	0.18338	2.22;2.22	5.43	5.43	0.79202	.	0.102077	0.64402	D	0.000001	T	0.16642	0.0400	M	0.71036	2.16	0.80722	D	1	P	0.45348	0.856	P	0.44477	0.451	T	0.01767	-1.1278	10	0.30078	T	0.28	.	17.412	0.87488	0.0:0.0:1.0:0.0	.	336	Q9UKA2	FBXL4_HUMAN	F	336	ENSP00000358247:S336F;ENSP00000229971:S336F	ENSP00000229971:S336F	S	-	2	0	FBXL4	99460119	1.000000	0.71417	0.136000	0.22124	0.428000	0.31595	9.476000	0.97823	2.543000	0.85770	0.591000	0.81541	TCT	.	.		0.448	FBXL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000041587.2		
LAMA2	3908	hgsc.bcm.edu	37	6	129813106	129813106	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr6:129813106G>A	ENST00000421865.2	+	57	8008	c.7959G>A	c.(7957-7959)caG>caA	p.Q2653Q	LAMA2_ENST00000498257.1_3'UTR	NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2653	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		CAGTTGAACAGCCTATCGAAG	0.373																																					p.Q2653Q		Atlas-SNP	.											.	LAMA2	481	.	0			c.G7959A						.						65.0	67.0	67.0					6																	129813106		2203	4300	6503	SO:0001819	synonymous_variant	3908	exon57			TGAACAGCCTATC	Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.7959G>A	chr6.hg19:g.129813106G>A		111.0	0.0		112.0	41.0	NM_000426	Q14736|Q5VUM2|Q93022	Silent	SNP	ENST00000421865.2	hg19	CCDS5138.1																																																																																			.	.		0.373	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042180.1		
SNX8	29886	hgsc.bcm.edu	37	7	2309216	2309216	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:2309216C>T	ENST00000222990.3	-	5	641	c.599G>A	c.(598-600)tGt>tAt	p.C200Y		NM_013321.2	NP_037453.1	Q9Y5X2	SNX8_HUMAN	sorting nexin 8	200					early endosome to Golgi transport (GO:0034498)|intracellular protein transport (GO:0006886)	early endosome membrane (GO:0031901)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			breast(2)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|prostate(2)|skin(3)	26		Ovarian(82;0.11)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0853)|OV - Ovarian serous cystadenocarcinoma(56;3.79e-14)		AGCCAGCTTACAGTTCAGGAA	0.388																																					p.C200Y		Atlas-SNP	.											.	SNX8	46	.	0			c.G599A						.						79.0	69.0	72.0					7																	2309216		2203	4300	6503	SO:0001583	missense	29886	exon5			AGCTTACAGTTCA	AF121858	CCDS5331.1	7p22.3	2010-08-05			ENSG00000106266	ENSG00000106266		"""Sorting nexins"""	14972	protein-coding gene	gene with protein product		614905					Standard	NM_013321		Approved	Mvp1	uc003slw.3	Q9Y5X2	OTTHUMG00000151512	ENST00000222990.3:c.599G>A	chr7.hg19:g.2309216C>T	ENSP00000222990:p.Cys200Tyr	39.0	0.0		40.0	16.0	NM_013321	A4D207|Q96I67	Missense_Mutation	SNP	ENST00000222990.3	hg19	CCDS5331.1	.	.	.	.	.	.	.	.	.	.	C	9.033	0.987765	0.18966	.	.	ENSG00000106266	ENST00000222990;ENST00000435060;ENST00000457286;ENST00000435336	.	.	.	3.64	3.64	0.41730	.	0.130437	0.53938	D	0.000051	T	0.42291	0.1196	L	0.36672	1.1	0.45621	D	0.998559	B	0.15473	0.013	B	0.10450	0.005	T	0.32929	-0.9888	9	0.02654	T	1	.	13.8704	0.63615	0.0:1.0:0.0:0.0	.	200	Q9Y5X2	SNX8_HUMAN	Y	200;186;147;147	.	ENSP00000222990:C200Y	C	-	2	0	SNX8	2275742	1.000000	0.71417	0.973000	0.42090	0.703000	0.40648	4.827000	0.62723	1.735000	0.51646	0.462000	0.41574	TGT	.	.		0.388	SNX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322949.2		
TNRC18	84629	hgsc.bcm.edu	37	7	5385411	5385411	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:5385411T>A	ENST00000430969.1	-	18	5849	c.5501A>T	c.(5500-5502)gAg>gTg	p.E1834V	TNRC18_ENST00000399537.4_Missense_Mutation_p.E1834V	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1834	Poly-Glu.						chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		ctcgagctcctcctcctcgtc	0.706																																					p.E1834V		Atlas-SNP	.											.	TNRC18	311	.	0			c.A5501T						.						4.0	4.0	4.0					7																	5385411		1410	3314	4724	SO:0001583	missense	84629	exon18			AGCTCCTCCTCCT	U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.5501A>T	chr7.hg19:g.5385411T>A	ENSP00000395538:p.Glu1834Val	56.0	0.0		59.0	28.0	NM_001080495	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	ENST00000430969.1	hg19	CCDS47534.1	.	.	.	.	.	.	.	.	.	.	.	11.84	1.759032	0.31137	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544	T;T	0.12774	2.65;2.65	5.17	3.7	0.42460	.	1.029360	0.07800	N	0.956285	T	0.12518	0.0304	L	0.36672	1.1	0.21719	N	0.999571	B	0.24186	0.099	B	0.19391	0.025	T	0.36601	-0.9741	10	0.32370	T	0.25	.	8.8881	0.35416	0.2489:0.0:0.0:0.7511	.	1834	O15417	TNC18_HUMAN	V	1834;1834;889	ENSP00000382452:E1834V;ENSP00000395538:E1834V	ENSP00000382452:E1834V	E	-	2	0	TNRC18	5351937	0.696000	0.27757	0.334000	0.25495	0.938000	0.57974	2.898000	0.48672	0.514000	0.28300	0.523000	0.50628	GAG	.	.		0.706	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
CCT6A	908	hgsc.bcm.edu	37	7	56125786	56125786	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:56125786T>C	ENST00000275603.4	+	6	934	c.715T>C	c.(715-717)Tat>Cat	p.Y239H	CCT6A_ENST00000335503.3_Missense_Mutation_p.Y194H|SNORA15_ENST00000384439.1_RNA|SNORA22_ENST00000383876.1_RNA|CCT6A_ENST00000540286.1_Missense_Mutation_p.Y208H	NM_001762.3	NP_001753.1	P40227	TCPZ_HUMAN	chaperonin containing TCP1, subunit 6A (zeta 1)	239					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			breast(1)|cervix(2)|endometrium(1)|large_intestine(4)|lung(5)|stomach(1)|upper_aerodigestive_tract(1)	15	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			GTCATTAGAGTATGAGAAAAC	0.418																																					p.Y239H		Atlas-SNP	.											.	CCT6A	44	.	0			c.T715C						.						67.0	59.0	62.0					7																	56125786		2203	4300	6503	SO:0001583	missense	908	exon6			TTAGAGTATGAGA	M94083	CCDS5523.1, CCDS34640.1	7p11.2	2011-09-02			ENSG00000146731	ENSG00000146731		"""Heat Shock Proteins / Chaperonins"""	1620	protein-coding gene	gene with protein product		104613		CCT6		1352881, 8034610	Standard	NM_001762		Approved	TTCP20, TCPZ, Cctz, HTR3, TCP20	uc003trl.1	P40227	OTTHUMG00000022842	ENST00000275603.4:c.715T>C	chr7.hg19:g.56125786T>C	ENSP00000275603:p.Tyr239His	69.0	0.0		82.0	33.0	NM_001762	A6NCD2|Q3KP28|Q75LP4|Q96S46	Missense_Mutation	SNP	ENST00000275603.4	hg19	CCDS5523.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.511151	0.64522	.	.	ENSG00000146731	ENST00000275603;ENST00000335503;ENST00000540286;ENST00000539340	T;T;T	0.68903	-0.36;-0.36;-0.36	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	D	0.86802	0.6020	H	0.95328	3.655	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.997	D;D;D	0.75484	0.986;0.981;0.947	D	0.90640	0.4574	10	0.87932	D	0	-14.8046	14.7035	0.69171	0.0:0.0:0.0:1.0	.	208;194;239	B4DPJ8;A6NCD2;P40227	.;.;TCPZ_HUMAN	H	239;194;208;97	ENSP00000275603:Y239H;ENSP00000352019:Y194H;ENSP00000438488:Y208H	ENSP00000275603:Y239H	Y	+	1	0	CCT6A	56093280	1.000000	0.71417	0.991000	0.47740	0.281000	0.26958	7.243000	0.78219	2.151000	0.67156	0.397000	0.26171	TAT	.	.		0.418	CCT6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251526.2	NM_001762	
WBSCR17	64409	hgsc.bcm.edu	37	7	71130560	71130560	+	Silent	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:71130560A>T	ENST00000333538.5	+	7	1879	c.1245A>T	c.(1243-1245)atA>atT	p.I415I	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	415					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				ATGTGTACATAGCGTGGAACC	0.458																																					p.I415I		Atlas-SNP	.											.	WBSCR17	208	.	0			c.A1245T						.						91.0	74.0	80.0					7																	71130560		2203	4300	6503	SO:0001819	synonymous_variant	64409	exon7			GTACATAGCGTGG	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1245A>T	chr7.hg19:g.71130560A>T		78.0	0.0		66.0	26.0	NM_022479	Q8NFV9|Q9NTA8	Silent	SNP	ENST00000333538.5	hg19	CCDS5540.1																																																																																			.	.		0.458	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
AKR1D1	6718	hgsc.bcm.edu	37	7	137761312	137761312	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:137761312C>A	ENST00000242375.3	+	1	90	c.48C>A	c.(46-48)aaC>aaA	p.N16K	AKR1D1_ENST00000411726.2_Missense_Mutation_p.N16K|AKR1D1_ENST00000468877.2_Intron|AKR1D1_ENST00000432161.1_Missense_Mutation_p.N16K	NM_005989.3	NP_005980.1	P51857	AK1D1_HUMAN	aldo-keto reductase family 1, member D1	16					androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|C21-steroid hormone metabolic process (GO:0008207)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	delta4-3-oxosteroid 5beta-reductase activity (GO:0047787)|steroid binding (GO:0005496)			endometrium(1)|kidney(2)|large_intestine(1)|lung(14)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	23					Azelaic Acid(DB00548)|Finasteride(DB01216)	GTGATGGAAACAGCATTCCCA	0.423																																					p.N16K		Atlas-SNP	.											.	AKR1D1	52	.	0			c.C48A						.						235.0	184.0	201.0					7																	137761312		2203	4300	6503	SO:0001583	missense	6718	exon1			TGGAAACAGCATT	Z28339	CCDS5846.1, CCDS55169.1, CCDS55170.1	7q32-q33	2012-12-04	2012-12-04		ENSG00000122787	ENSG00000122787	1.3.99.6	"""Aldo-keto reductases"""	388	protein-coding gene	gene with protein product	"""delta 4-3-ketosteroid-5-beta-reductase"""	604741	"""aldo-keto reductase family 1, member D1 (delta 4-3-ketosteroid-5-beta-reductase)"""	SRD5B1		7508385, 10343119	Standard	NM_005989		Approved		uc003vtz.3	P51857	OTTHUMG00000155787	ENST00000242375.3:c.48C>A	chr7.hg19:g.137761312C>A	ENSP00000242375:p.Asn16Lys	86.0	0.0		91.0	33.0	NM_001190907	A1L4P6|A8K060|B4DPN3|B4DPN8	Missense_Mutation	SNP	ENST00000242375.3	hg19	CCDS5846.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.278729	0.59758	.	.	ENSG00000122787	ENST00000432161;ENST00000411726;ENST00000242375;ENST00000438242	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	4.92	1.16	0.20824	NADP-dependent oxidoreductase domain (2);	0.102971	0.64402	D	0.000005	T	0.34687	0.0906	L	0.38649	1.16	0.42479	D	0.99285	P;P;B	0.50272	0.862;0.933;0.17	B;B;B	0.43478	0.421;0.319;0.061	T	0.10894	-1.0610	10	0.56958	D	0.05	.	6.4969	0.22148	0.0:0.6097:0.0:0.3903	.	16;16;16	B4DPN8;B4DPN3;P51857	.;.;AK1D1_HUMAN	K	16	ENSP00000389197:N16K;ENSP00000402374:N16K;ENSP00000242375:N16K;ENSP00000397042:N16K	ENSP00000242375:N16K	N	+	3	2	AKR1D1	137411852	0.996000	0.38824	0.998000	0.56505	0.992000	0.81027	0.036000	0.13819	0.380000	0.24823	-0.145000	0.13849	AAC	.	.		0.423	AKR1D1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000341637.1	NM_005989	
SSPO	23145	hgsc.bcm.edu	37	7	149493829	149493829	+	RNA	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr7:149493829T>A	ENST00000378016.2	+	0	6825							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CTGAGGGCACTGGCAGGTATA	0.657																																					p.T2275T		Atlas-SNP	.											.	.	.	.	0			c.T6825A						.						94.0	96.0	95.0					7																	149493829		2142	4234	6376			23145	exon45			GGGCACTGGCAGG	AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		chr7.hg19:g.149493829T>A		78.0	0.0		71.0	33.0	NM_198455	Q76B61	Silent	SNP	ENST00000378016.2	hg19																																																																																				.	.		0.657	SSPO-202	KNOWN	basic	processed_transcript	processed_transcript			
BAG4	9530	hgsc.bcm.edu	37	8	38065143	38065143	+	Silent	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr8:38065143T>C	ENST00000287322.4	+	3	763	c.492T>C	c.(490-492)agT>agC	p.S164S	BAG4_ENST00000432471.2_Silent_p.S128S|BAG4_ENST00000521282.1_3'UTR	NM_004874.3	NP_004865.1	O95429	BAG4_HUMAN	BCL2-associated athanogene 4	164					cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to tumor necrosis factor (GO:0071356)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of mRNA modification (GO:0090367)|negative regulation of phosphatidylinositol-3,4,5-trisphosphate 5-phosphatase activity (GO:2001145)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein localization to plasma membrane (GO:0072659)|ruffle assembly (GO:0097178)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|urinary_tract(1)	11	Colorectal(12;0.000442)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)				CTCAGACCAGTTACTCCACAG	0.507																																					p.S164S		Atlas-SNP	.											.	BAG4	32	.	0			c.T492C						.						97.0	90.0	92.0					8																	38065143		2203	4300	6503	SO:0001819	synonymous_variant	9530	exon3			GACCAGTTACTCC	AF095194	CCDS6104.1, CCDS56533.1	8p11.23	2008-08-07			ENSG00000156735	ENSG00000156735			940	protein-coding gene	gene with protein product	"""silencer of death domains"""	603884				9873016, 9915703	Standard	NM_004874		Approved	SODD	uc003xky.2	O95429	OTTHUMG00000164064	ENST00000287322.4:c.492T>C	chr8.hg19:g.38065143T>C		109.0	0.0		89.0	43.0	NM_004874	B4E217|O95818	Silent	SNP	ENST00000287322.4	hg19	CCDS6104.1																																																																																			.	.		0.507	BAG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377038.2	NM_004874	
PXDNL	137902	hgsc.bcm.edu	37	8	52323892	52323892	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr8:52323892T>G	ENST00000356297.4	-	16	2080	c.1980A>C	c.(1978-1980)agA>agC	p.R660S	PXDNL_ENST00000543296.1_Missense_Mutation_p.R660S	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	660					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TCTCCCCTGCTCTTGCCATTT	0.507																																					p.R660S		Atlas-SNP	.											.	PXDNL	414	.	0			c.A1980C						.						60.0	60.0	60.0					8																	52323892		1964	4163	6127	SO:0001583	missense	137902	exon16			CCCTGCTCTTGCC		CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1980A>C	chr8.hg19:g.52323892T>G	ENSP00000348645:p.Arg660Ser	115.0	0.0		116.0	55.0	NM_144651	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	ENST00000356297.4	hg19	CCDS47855.1	.	.	.	.	.	.	.	.	.	.	T	12.13	1.846314	0.32606	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.69306	-0.39;-0.35	4.46	4.46	0.54185	.	.	.	.	.	D	0.82332	0.5014	M	0.85630	2.765	0.26127	N	0.980466	D	0.89917	1.0	D	0.79784	0.993	T	0.74191	-0.3745	9	0.87932	D	0	.	11.6895	0.51508	0.0:0.0:0.0:1.0	.	660	A1KZ92	PXDNL_HUMAN	S	660	ENSP00000348645:R660S;ENSP00000444865:R660S	ENSP00000348645:R660S	R	-	3	2	PXDNL	52486445	0.054000	0.20591	0.008000	0.14137	0.005000	0.04900	-0.659000	0.05323	1.645000	0.50612	0.533000	0.62120	AGA	.	.		0.507	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000377905.1	NM_144651	
VLDLR	7436	hgsc.bcm.edu	37	9	2643403	2643403	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:2643403G>A	ENST00000382100.3	+	5	1048	c.692G>A	c.(691-693)cGt>cAt	p.R231H	VLDLR_ENST00000382099.2_Missense_Mutation_p.R231H|RP11-125B21.2_ENST00000599229.1_RNA	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	231	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		CAGTGTGGCCGTCAGCCAGTC	0.582																																					p.R231H		Atlas-SNP	.											VLDLR,NS,carcinoma,0,2	VLDLR	68	.	0			c.G692A						.						47.0	41.0	43.0					9																	2643403		2203	4300	6503	SO:0001583	missense	7436	exon5			GTGGCCGTCAGCC		CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.692G>A	chr9.hg19:g.2643403G>A	ENSP00000371532:p.Arg231His	86.0	0.0		82.0	31.0	NM_003383	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	ENST00000382100.3	hg19	CCDS6446.1	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349753	0.61183	.	.	ENSG00000147852	ENST00000382100;ENST00000382099;ENST00000382092	D;D	0.90844	-2.74;-2.74	5.5	4.6	0.57074	.	0.117180	0.39274	N	0.001411	D	0.85305	0.5666	L	0.35542	1.07	0.58432	D	0.999999	B;B;B	0.13594	0.008;0.005;0.003	B;B;B	0.08055	0.003;0.002;0.002	T	0.80968	-0.1145	10	0.36615	T	0.2	.	14.3127	0.66426	0.0707:0.0:0.9292:0.0	.	231;231;231	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	H	231;231;110	ENSP00000371532:R231H;ENSP00000371531:R231H	ENSP00000371524:R110H	R	+	2	0	VLDLR	2633403	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.265000	0.65519	1.547000	0.49401	0.655000	0.94253	CGT	.	.		0.582	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000051519.2	NM_003383	
CDKN2A	1029	hgsc.bcm.edu	37	9	21971035	21971035	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:21971035T>C	ENST00000304494.5	-	2	593	c.323A>G	c.(322-324)gAt>gGt	p.D108G	CDKN2A_ENST00000579122.1_Missense_Mutation_p.D108G|CDKN2A_ENST00000578845.2_Missense_Mutation_p.D57G|CDKN2A_ENST00000494262.1_Missense_Mutation_p.D57G|CDKN2A_ENST00000497750.1_Missense_Mutation_p.D57G|CDKN2A_ENST00000530628.2_Silent_p.R122R|CDKN2A_ENST00000579755.1_Silent_p.R122R|CDKN2A_ENST00000361570.3_Silent_p.R163R|CDKN2A_ENST00000498628.2_Missense_Mutation_p.D57G|CDKN2A_ENST00000498124.1_Missense_Mutation_p.D108G|CDKN2A_ENST00000479692.2_Missense_Mutation_p.D57G|CDKN2A_ENST00000446177.1_Missense_Mutation_p.D108G|RP11-145E5.5_ENST00000404796.2_Intron	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	108			D -> H (in a bladder tumor).|D -> Y (in a head and neck tumor).		cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.D108G(2)|p.H83fs*2(2)|p.D105fs*8(1)|p.0(1)|p.A68fs*3(1)|p.R163R(1)|p.R107fs*33(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		GCCCCAGGCATCGCGCACGTC	0.741		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																											p.D108G		Atlas-SNP	.											CDKN2A_ENST00000498124,bladder,carcinoma,-1,5	CDKN2A	4810	.	1368	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(5)|Substitution - Missense(2)|Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(167)|lung(148)|urinary_tract(91)|bone(74)|soft_tissue(57)|pleura(51)|oesophagus(51)|upper_aerodigestive_tract(49)|ovary(36)|kidney(32)|pancreas(32)|breast(32)|thyroid(13)|NS(12)|biliary_tract(12)|stomach(12)|autonomic_ganglia(9)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)	c.A323G						.						17.0	19.0	18.0					9																	21971035		2198	4292	6490	SO:0001583	missense	1029	exon2			CAGGCATCGCGCA	L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.323A>G	chr9.hg19:g.21971035T>C	ENSP00000307101:p.Asp108Gly	127.0	0.0		123.0	41.0	NM_000077	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Missense_Mutation	SNP	ENST00000304494.5	hg19	CCDS6510.1	.	.	.	.	.	.	.	.	.	.	T	26.2	4.715925	0.89112	.	.	ENSG00000147889	ENST00000304494;ENST00000446177	D;D	0.93953	-3.32;-3.32	5.93	5.93	0.95920	Ankyrin repeat-containing domain (4);	.	.	.	.	D	0.96775	0.8947	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.97240	0.9890	8	0.72032	D	0.01	-14.8146	15.3697	0.74554	0.0:0.0:0.0:1.0	.	108	P42771	CD2A1_HUMAN	G	108	ENSP00000307101:D108G;ENSP00000394932:D108G	ENSP00000307101:D108G	D	-	2	0	CDKN2A	21961035	1.000000	0.71417	0.974000	0.42286	0.662000	0.39071	7.037000	0.76531	2.265000	0.75225	0.533000	0.62120	GAT	.	.		0.741	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000051915.1	NM_000077	
GBA2	57704	hgsc.bcm.edu	37	9	35736083	35736083	+	IGR	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:35736083T>C	ENST00000378103.3	-	0	3611				CREB3_ENST00000486056.1_3'UTR|CREB3_ENST00000353704.2_Missense_Mutation_p.V217A|GBA2_ENST00000467252.1_5'Flank	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CAGGCCATGGTGATTGAGATA	0.517											OREG0019176	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.V217A		Atlas-SNP	.											.	CREB3	24	.	0			c.T650C						.						154.0	136.0	142.0					9																	35736083		2203	4300	6503	SO:0001628	intergenic_variant	10488	exon7			CCATGGTGATTGA	AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024		chr9.hg19:g.35736083T>C		81.0	0.0	857	79.0	30.0	NM_006368	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	Missense_Mutation	SNP	ENST00000378103.3	hg19	CCDS6589.1	.	.	.	.	.	.	.	.	.	.	T	9.581	1.123676	0.20959	.	.	ENSG00000107175	ENST00000353704	T	0.70631	-0.5	5.41	3.02	0.34903	.	0.264850	0.36268	N	0.002690	T	0.71978	0.3404	M	0.85630	2.765	0.40994	D	0.984871	P;B	0.38617	0.64;0.176	B;B	0.40602	0.334;0.054	T	0.71337	-0.4623	10	0.87932	D	0	.	7.045	0.25040	0.1324:0.0729:0.0:0.7947	.	241;217	O43889;O43889-2	CREB3_HUMAN;.	A	217	ENSP00000342136:V217A	ENSP00000342136:V217A	V	+	2	0	CREB3	35726083	1.000000	0.71417	0.650000	0.29550	0.012000	0.07955	3.606000	0.54095	0.351000	0.24027	-0.410000	0.06199	GTG	.	.		0.517	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000055456.1	NM_020944	
PRUNE2	158471	hgsc.bcm.edu	37	9	79325451	79325451	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:79325451T>A	ENST00000376718.3	-	8	1862	c.1739A>T	c.(1738-1740)aAc>aTc	p.N580I	PRUNE2_ENST00000428286.1_Missense_Mutation_p.N221I	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	580					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCTTTCAGAGTTATCTCTGGG	0.443																																					p.N580I		Atlas-SNP	.											.	PRUNE2	331	.	0			c.A1739T						.						57.0	51.0	53.0					9																	79325451		1568	3582	5150	SO:0001583	missense	158471	exon8			TCAGAGTTATCTC	BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.1739A>T	chr9.hg19:g.79325451T>A	ENSP00000365908:p.Asn580Ile	103.0	0.0		72.0	26.0	NM_015225	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	ENST00000376718.3	hg19	CCDS47982.1	.	.	.	.	.	.	.	.	.	.	T	7.208	0.594751	0.13875	.	.	ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033	T;T	0.42513	0.97;0.98	5.71	3.12	0.35913	.	0.495429	0.18752	N	0.132156	T	0.29783	0.0744	L	0.51422	1.61	0.09310	N	0.999994	P	0.35077	0.483	B	0.30251	0.113	T	0.10753	-1.0616	10	0.24483	T	0.36	-12.4268	6.0619	0.19842	0.251:0.0865:0.0:0.6625	.	580	Q8WUY3	PRUN2_HUMAN	I	580;221;579	ENSP00000365908:N580I;ENSP00000397425:N221I	ENSP00000365908:N580I	N	-	2	0	PRUNE2	78515271	0.008000	0.16893	0.852000	0.33557	0.799000	0.45148	1.057000	0.30492	1.010000	0.39314	0.533000	0.62120	AAC	.	.		0.443	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052730.2	NM_138818	
RAD23B	5887	hgsc.bcm.edu	37	9	110081131	110081131	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:110081131C>G	ENST00000358015.3	+	6	1003	c.652C>G	c.(652-654)Cct>Gct	p.P218A	RAD23B_ENST00000416373.2_Missense_Mutation_p.P146A	NM_001244713.1|NM_002874.4	NP_001231642.1|NP_002865.1	P54727	RD23B_HUMAN	RAD23 homolog B (S. cerevisiae)	218	UBA 1. {ECO:0000255|PROSITE- ProRule:PRU00212}.				DNA repair (GO:0006281)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage recognition (GO:0000715)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|XPC complex (GO:0071942)	damaged DNA binding (GO:0003684)|polyubiquitin binding (GO:0031593)|single-stranded DNA binding (GO:0003697)			breast(3)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14						TTTCAACAACCCTGACAGAGC	0.383								Direct reversal of damage;Nucleotide excision repair (NER)																													p.P218A		Atlas-SNP	.											.	RAD23B	31	.	0			c.C652G						.						117.0	111.0	113.0					9																	110081131		2203	4300	6503	SO:0001583	missense	5887	exon6			AACAACCCTGACA		CCDS6769.1, CCDS59138.1	9q31.2	2008-07-21	2001-11-28		ENSG00000119318	ENSG00000119318			9813	protein-coding gene	gene with protein product	"""XP-C repair complementing protein"", ""XP-C repair complementing complex 58 kDa"""	600062	"""RAD23 (S. cerevisiae) homolog B"""			7851894, 8168482	Standard	NM_002874		Approved	HHR23B, P58, HR23B	uc004bde.3	P54727	OTTHUMG00000020446	ENST00000358015.3:c.652C>G	chr9.hg19:g.110081131C>G	ENSP00000350708:p.Pro218Ala	80.0	0.0		97.0	25.0	NM_002874	B3KWK8|G5E9P0|Q7Z5K8|Q8WUB0	Missense_Mutation	SNP	ENST00000358015.3	hg19	CCDS6769.1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.648312	0.87958	.	.	ENSG00000119318	ENST00000358015;ENST00000374678;ENST00000416373	T;T	0.23950	1.88;1.88	4.9	4.9	0.64082	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (2);Ubiquitin-associated/translation elongation factor EF1B, N-terminal (1);UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.55577	0.1929	M	0.80616	2.505	0.80722	D	1	D;D;D	0.89917	0.999;0.987;1.0	D;D;D	0.87578	0.998;0.951;0.998	T	0.62450	-0.6852	10	0.87932	D	0	-20.0749	18.4398	0.90662	0.0:1.0:0.0:0.0	.	197;218;218	B7Z4W4;B4DEA3;P54727	.;.;RD23B_HUMAN	A	218;146;146	ENSP00000350708:P218A;ENSP00000405623:P146A	ENSP00000350708:P218A	P	+	1	0	RAD23B	109120952	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.459000	0.80802	2.417000	0.82017	0.561000	0.74099	CCT	.	.		0.383	RAD23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053548.1	NM_002874	
ENTPD2	954	hgsc.bcm.edu	37	9	139943427	139943427	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr9:139943427T>A	ENST00000355097.2	-	8	1297	c.1250A>T	c.(1249-1251)gAg>gTg	p.E417V	ENTPD2_ENST00000312665.5_Missense_Mutation_p.E394V|NPDC1_ENST00000488145.1_5'Flank|NPDC1_ENST00000371601.4_5'Flank|ENTPD2_ENST00000460614.1_5'UTR	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	417					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GAAGGCGCGCTCGTCGAAGCC	0.736																																					p.E417V		Atlas-SNP	.											.	ENTPD2	30	.	0			c.A1250T						.						2.0	2.0	2.0					9																	139943427		1517	3185	4702	SO:0001583	missense	954	exon8			GCGCGCTCGTCGA	U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.1250A>T	chr9.hg19:g.139943427T>A	ENSP00000347213:p.Glu417Val	98.0	0.0		92.0	20.0	NM_203468	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	ENST00000355097.2	hg19	CCDS7026.1	.	.	.	.	.	.	.	.	.	.	T	15.14	2.746056	0.49151	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.13089	2.8;2.62	3.65	3.65	0.41850	.	0.411454	0.27891	N	0.017424	T	0.32496	0.0831	M	0.77406	2.37	0.41415	D	0.987767	D;D;D	0.71674	0.998;0.996;0.996	D;D;D	0.67231	0.95;0.941;0.941	T	0.06716	-1.0811	10	0.56958	D	0.05	-41.9107	8.4598	0.32921	0.0:0.1008:0.0:0.8992	.	394;417;417	Q9Y5L3-2;Q9Y5L3;Q5SPY7	.;ENTP2_HUMAN;.	V	417;394	ENSP00000347213:E417V;ENSP00000312494:E394V	ENSP00000312494:E394V	E	-	2	0	ENTPD2	139063248	0.005000	0.15991	0.809000	0.32408	0.012000	0.07955	1.606000	0.36826	1.644000	0.50603	0.368000	0.22195	GAG	.	.		0.736	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055169.1	NM_203468	
GATA3	2625	hgsc.bcm.edu	37	10	8097825	8097825	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr10:8097825G>A	ENST00000346208.3	+	2	662	c.207G>A	c.(205-207)agG>agA	p.R69R	GATA3-AS1_ENST00000355358.1_lincRNA|RP11-379F12.3_ENST00000458727.1_lincRNA|RP11-379F12.4_ENST00000418270.1_lincRNA|GATA3_ENST00000379328.3_Silent_p.R69R			P23771	GATA3_HUMAN	GATA binding protein 3	69					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						ACTCGGTCAGGGCCACGGTGC	0.697			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																														p.R69R		Atlas-SNP	.		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	.	GATA3	182	.	0			c.G207A						.						30.0	26.0	27.0					10																	8097825		2196	4290	6486	SO:0001819	synonymous_variant	2625	exon2			GGTCAGGGCCACG	X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.207G>A	chr10.hg19:g.8097825G>A		248.0	0.0		227.0	92.0	NM_002051	Q5VWG7|Q5VWG8|Q96J16	Silent	SNP	ENST00000346208.3	hg19	CCDS7083.1																																																																																			.	.		0.697	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000046719.1	NM_001002295	
SLC39A12	221074	hgsc.bcm.edu	37	10	18270244	18270244	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr10:18270244T>A	ENST00000377369.2	+	6	1201	c.928T>A	c.(928-930)Tgc>Agc	p.C310S	SLC39A12_ENST00000539911.1_Missense_Mutation_p.C176S|SLC39A12_ENST00000377374.4_Missense_Mutation_p.C310S|SLC39A12_ENST00000377371.3_Missense_Mutation_p.C310S	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	310					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						CACACAGACCTGCTTCTCTGC	0.423																																					p.C310S		Atlas-SNP	.											.	SLC39A12	181	.	0			c.T928A						.						90.0	88.0	89.0					10																	18270244		2203	4300	6503	SO:0001583	missense	221074	exon6			CAGACCTGCTTCT		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.928T>A	chr10.hg19:g.18270244T>A	ENSP00000366586:p.Cys310Ser	113.0	0.0		116.0	41.0	NM_152725	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	ENST00000377369.2	hg19	CCDS44362.1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.328580	0.81690	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	D;D;D;D	0.95690	-3.47;-3.78;-3.42;-3.15	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.97739	0.9258	M	0.82517	2.595	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.98588	1.0653	10	0.87932	D	0	-13.5218	15.8497	0.78921	0.0:0.0:0.0:1.0	.	310;310;310	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	S	310;310;310;176;230	ENSP00000366586:C310S;ENSP00000366591:C310S;ENSP00000366588:C310S;ENSP00000440445:C176S	ENSP00000366586:C310S	C	+	1	0	SLC39A12	18310250	1.000000	0.71417	0.998000	0.56505	0.796000	0.44982	7.303000	0.78871	2.155000	0.67459	0.533000	0.62120	TGC	.	.		0.423	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
MPP7	143098	hgsc.bcm.edu	37	10	28491163	28491163	+	Silent	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr10:28491163C>A	ENST00000375732.1	-	3	334	c.75G>T	c.(73-75)ctG>ctT	p.L25L	MPP7_ENST00000540098.1_Silent_p.L25L|MPP7_ENST00000445954.2_Intron|MPP7_ENST00000375719.3_Silent_p.L25L|MPP7_ENST00000481244.1_5'UTR|MPP7_ENST00000337532.5_Silent_p.L25L			Q5T2T1	MPP7_HUMAN	membrane protein, palmitoylated 7 (MAGUK p55 subfamily member 7)	25	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				establishment of cell polarity (GO:0030010)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of signal transduction (GO:0009967)|protein localization to adherens junction (GO:0071896)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cell junction (GO:0030054)|mitochondrion (GO:0005739)|MPP7-DLG1-LIN7 complex (GO:0097025)|tight junction (GO:0005923)	protein complex scaffold (GO:0032947)|protein domain specific binding (GO:0019904)|protein heterodimerization activity (GO:0046982)|signaling adaptor activity (GO:0035591)			autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	22						CATGTGGCTGCAGCTGGGCTG	0.433																																					p.L25L		Atlas-SNP	.											.	MPP7	60	.	0			c.G75T						.						62.0	58.0	60.0					10																	28491163		2203	4300	6503	SO:0001819	synonymous_variant	143098	exon5			TGGCTGCAGCTGG	BC038105	CCDS7158.1	10p12.1	2004-01-15			ENSG00000150054	ENSG00000150054			26542	protein-coding gene	gene with protein product		610973				14719143	Standard	NM_173496		Approved	FLJ32798	uc001iua.1	Q5T2T1	OTTHUMG00000017868	ENST00000375732.1:c.75G>T	chr10.hg19:g.28491163C>A		119.0	0.0		140.0	47.0	NM_173496	B2RCC9|B4DWL9|B5MDZ3|D3DRW3|Q5T2T0|Q8IY28	Silent	SNP	ENST00000375732.1	hg19	CCDS7158.1																																																																																			.	.		0.433	MPP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047345.1	NM_173496	
CSTF2T	23283	hgsc.bcm.edu	37	10	53457589	53457589	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr10:53457589T>A	ENST00000331173.4	-	1	1766	c.1721A>T	c.(1720-1722)cAg>cTg	p.Q574L	PRKG1_ENST00000401604.2_Intron|PRKG1_ENST00000373985.1_Intron|PRKG1_ENST00000373980.4_Intron	NM_015235.2	NP_056050.1	Q9H0L4	CSTFT_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa, tau variant	574					mRNA processing (GO:0006397)	intracellular (GO:0005622)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	30				COAD - Colon adenocarcinoma(2;0.00736)|Colorectal(2;0.00898)|all cancers(4;0.0188)|GBM - Glioblastoma multiforme(4;0.0778)|Epithelial(53;0.122)		TGCCTTCTCCTGATCCTGTGG	0.517																																					p.Q574L		Atlas-SNP	.											.	CSTF2T	64	.	0			c.A1721T						.						124.0	102.0	110.0					10																	53457589		2203	4300	6503	SO:0001583	missense	23283	exon1			TTCTCCTGATCCT	AB014589	CCDS7245.1	10q11	2013-02-12			ENSG00000177613	ENSG00000177613		"""RNA binding motif (RRM) containing"""	17086	protein-coding gene	gene with protein product		611968				12408968, 11113135	Standard	NM_015235		Approved	DKFZp434C1013, KIAA0689, CstF-64T	uc001jjp.3	Q9H0L4	OTTHUMG00000018246	ENST00000331173.4:c.1721A>T	chr10.hg19:g.53457589T>A	ENSP00000332444:p.Gln574Leu	101.0	0.0		103.0	37.0	NM_015235	B2RAR9|O75174|Q53HK6|Q7LGE8|Q8N6T1	Missense_Mutation	SNP	ENST00000331173.4	hg19	CCDS7245.1	.	.	.	.	.	.	.	.	.	.	T	11.96	1.795326	0.31777	.	.	ENSG00000177613	ENST00000331173	T	0.23754	1.89	4.65	3.53	0.40419	.	0.227106	0.44097	D	0.000496	T	0.24509	0.0594	L	0.59436	1.845	0.39225	D	0.963573	B	0.14438	0.01	B	0.17433	0.018	T	0.19418	-1.0306	10	0.87932	D	0	-9.4223	8.2905	0.31954	0.0:0.096:0.0:0.904	.	574	Q9H0L4	CSTFT_HUMAN	L	574	ENSP00000332444:Q574L	ENSP00000332444:Q574L	Q	-	2	0	CSTF2T	53127595	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.110000	0.64622	2.102000	0.63906	0.533000	0.62120	CAG	.	.		0.517	CSTF2T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048097.1	NM_015235	
CFAP46	54777	hgsc.bcm.edu	37	10	134738360	134738360	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr10:134738360C>A	ENST00000368586.5	-	11	1196	c.1096G>T	c.(1096-1098)Gtc>Ttc	p.V366F	TTC40_ENST00000368582.2_Missense_Mutation_p.V366F	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						TGCAGCGCGACGTCTAGCCTC	0.682																																					p.V366F		Atlas-SNP	.											.	TTC40	100	.	0			c.G1096T						.																																			SO:0001583	missense	54777	exon11			GCGCGACGTCTAG																												ENST00000368586.5:c.1096G>T	chr10.hg19:g.134738360C>A	ENSP00000357575:p.Val366Phe	163.0	0.0		142.0	49.0	NM_001200049		Missense_Mutation	SNP	ENST00000368586.5	hg19	CCDS58101.1	.	.	.	.	.	.	.	.	.	.	C	9.831	1.188488	0.21954	.	.	ENSG00000171811	ENST00000368586;ENST00000368582	T;T	0.55413	0.52;0.52	3.29	-6.58	0.01836	.	.	.	.	.	T	0.36908	0.0984	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.38672	-0.9650	6	0.40728	T	0.16	.	4.0398	0.09746	0.1132:0.1562:0.1128:0.6178	.	.	.	.	F	366	ENSP00000357575:V366F;ENSP00000357571:V366F	ENSP00000357571:V366F	V	-	1	0	C10orf93	134588350	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.056000	0.03489	-1.553000	0.01702	-0.149000	0.13747	GTC	.	.		0.682	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051095.3		
CNGA4	1262	hgsc.bcm.edu	37	11	6261883	6261883	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:6261883A>T	ENST00000379936.2	+	4	974	c.859A>T	c.(859-861)Aag>Tag	p.K287*	CNGA4_ENST00000533426.1_Nonsense_Mutation_p.K56*	NM_001037329.3	NP_001032406.1	Q8IV77	CNGA4_HUMAN	cyclic nucleotide gated channel alpha 4	287					phototransduction, visible light (GO:0007603)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sensory perception of smell (GO:0007608)	integral component of plasma membrane (GO:0005887)	cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|intracellular cAMP activated cation channel activity (GO:0005222)|intracellular cGMP activated cation channel activity (GO:0005223)|voltage-gated potassium channel activity (GO:0005249)			endometrium(2)|kidney(1)|large_intestine(9)|lung(24)|prostate(3)|skin(1)	40		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;2.04e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGCACTGGTGAAGAAGTACAT	0.547																																					p.K287X		Atlas-SNP	.											.	CNGA4	96	.	0			c.A859T						.						99.0	88.0	92.0					11																	6261883		2201	4296	6497	SO:0001587	stop_gained	1262	exon4			CTGGTGAAGAAGT	AK122736	CCDS31408.1	11p15.4	2011-07-05		2002-01-18		ENSG00000132259		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	2152	protein-coding gene	gene with protein product		609472	"""cyclic nucleotide gated channel beta 2"""	CNCA2, CNGB2		11764791, 16382102	Standard	NM_001037329		Approved	OCNC2, OCNCb, CNG5	uc001mco.3	Q8IV77		ENST00000379936.2:c.859A>T	chr11.hg19:g.6261883A>T	ENSP00000369268:p.Lys287*	129.0	0.0		141.0	50.0	NM_001037329		Nonsense_Mutation	SNP	ENST00000379936.2	hg19	CCDS31408.1	.	.	.	.	.	.	.	.	.	.	A	37	6.296064	0.97449	.	.	ENSG00000132259	ENST00000533426;ENST00000379936	.	.	.	5.3	5.3	0.74995	.	0.090520	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.1129	0.48243	0.8455:0.1545:0.0:0.0	.	.	.	.	X	56;287	.	ENSP00000369268:K287X	K	+	1	0	CNGA4	6218459	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	4.028000	0.57246	2.133000	0.65898	0.459000	0.35465	AAG	.	.		0.547	CNGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000383765.2	NM_001037329	
OR4A15	81328	hgsc.bcm.edu	37	11	55135453	55135453	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:55135453A>T	ENST00000314706.3	+	1	94	c.94A>T	c.(94-96)Aaa>Taa	p.K32*		NM_001005275.1	NP_001005275.1	Q8NGL6	O4A15_HUMAN	olfactory receptor, family 4, subfamily A, member 15	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(2)|endometrium(2)|kidney(2)|large_intestine(7)|lung(48)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	71						AGAACACATGAAAAATAAGAA	0.388																																					p.K32X		Atlas-SNP	.											.	OR4A15	161	.	0			c.A94T						.						64.0	60.0	62.0					11																	55135453		2201	4296	6497	SO:0001587	stop_gained	81328	exon1			CACATGAAAAATA	AB065776	CCDS31500.1	11q11	2012-08-09			ENSG00000181958	ENSG00000181958		"""GPCR / Class A : Olfactory receptors"""	15152	protein-coding gene	gene with protein product							Standard	NM_001005275		Approved		uc010rif.2	Q8NGL6	OTTHUMG00000166711	ENST00000314706.3:c.94A>T	chr11.hg19:g.55135453A>T	ENSP00000325065:p.Lys32*	114.0	0.0		109.0	44.0	NM_001005275	Q6IFL4|Q96R65	Nonsense_Mutation	SNP	ENST00000314706.3	hg19	CCDS31500.1	.	.	.	.	.	.	.	.	.	.	a	13.55	2.270661	0.40194	.	.	ENSG00000181958	ENST00000314706	.	.	.	3.48	2.54	0.30619	.	1.993750	0.03854	U	0.272736	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	6.6947	0.23193	0.1355:0.0:0.8645:0.0	.	.	.	.	X	32	.	ENSP00000325065:K32X	K	+	1	0	OR4A15	54892029	0.712000	0.27916	0.122000	0.21767	0.015000	0.08874	0.762000	0.26503	0.677000	0.31305	-0.342000	0.07992	AAA	.	.		0.388	OR4A15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391161.1	NM_001005275	
SYT7	9066	hgsc.bcm.edu	37	11	61295635	61295635	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:61295635T>C	ENST00000263846.4	-	5	701	c.374A>G	c.(373-375)gAt>gGt	p.D125G	SYT7_ENST00000539008.1_Missense_Mutation_p.D408G|SYT7_ENST00000535826.1_Missense_Mutation_p.D244G|SYT7_ENST00000542836.1_Missense_Mutation_p.D169G|SYT7_ENST00000542670.1_Missense_Mutation_p.D333G|SYT7_ENST00000540677.1_Missense_Mutation_p.D200G|SYT7_ENST00000540831.1_5'UTR	NM_004200.3	NP_004191.2	O43581	SYT7_HUMAN	synaptotagmin VII	125					exocytosis (GO:0006887)|plasma membrane repair (GO:0001778)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of insulin secretion (GO:0050796)	cell junction (GO:0030054)|dense core granule (GO:0031045)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			kidney(2)|large_intestine(3)|lung(4)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GTGGGCCTCATCCTCCTCGGA	0.642																																					p.D200G		Atlas-SNP	.											.	SYT7	39	.	0			c.A599G						.						41.0	48.0	46.0					11																	61295635		2201	4299	6500	SO:0001583	missense	9066	exon6			GCCTCATCCTCCT	AF038535	CCDS31577.1, CCDS58139.1, CCDS73298.1	11q12-q13.1	2013-01-21			ENSG00000011347	ENSG00000011347		"""Synaptotagmins"""	11514	protein-coding gene	gene with protein product		604146	"""prostate cancer associated protein 7"""	PCANAP7		9615227	Standard	NM_001252065		Approved	IPCA-7, SYT-VII, MGC150517	uc009ynr.3	O43581	OTTHUMG00000168199	ENST00000263846.4:c.374A>G	chr11.hg19:g.61295635T>C	ENSP00000263846:p.Asp125Gly	51.0	0.0		36.0	14.0	NM_001252065	F5GZU9|Q08AH6	Missense_Mutation	SNP	ENST00000263846.4	hg19	CCDS31577.1	.	.	.	.	.	.	.	.	.	.	T	23.1	4.373484	0.82573	.	.	ENSG00000011347	ENST00000263846;ENST00000540677;ENST00000539008;ENST00000542836;ENST00000542670;ENST00000535826;ENST00000545053	T;T;T;T;T;T;T	0.56444	0.46;0.48;0.61;0.5;0.49;0.49;1.84	4.42	4.42	0.53409	.	0.090510	0.85682	D	0.000000	T	0.41627	0.1167	L	0.34521	1.04	0.80722	D	1	B;B	0.25955	0.138;0.067	B;B	0.21151	0.033;0.013	T	0.34079	-0.9843	10	0.40728	T	0.16	.	14.047	0.64710	0.0:0.0:0.0:1.0	.	200;125	F5GZU9;O43581	.;SYT7_HUMAN	G	125;200;408;169;333;244;125	ENSP00000263846:D125G;ENSP00000444201:D200G;ENSP00000439694:D408G;ENSP00000444568:D169G;ENSP00000444019:D333G;ENSP00000437720:D244G;ENSP00000443576:D125G	ENSP00000263846:D125G	D	-	2	0	SYT7	61052211	1.000000	0.71417	0.999000	0.59377	0.894000	0.52154	5.893000	0.69798	1.951000	0.56629	0.533000	0.62120	GAT	.	.		0.642	SYT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398733.1	NM_004200	
SLC22A8	9376	hgsc.bcm.edu	37	11	62763192	62763192	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:62763192A>T	ENST00000336232.2	-	7	1120	c.985T>A	c.(985-987)Tgt>Agt	p.C329S	SLC22A8_ENST00000542795.1_5'Flank|SLC22A8_ENST00000535878.1_Missense_Mutation_p.C206S|SLC22A8_ENST00000430500.2_Missense_Mutation_p.C329S|SLC22A8_ENST00000545207.1_Missense_Mutation_p.C238S|SLC22A8_ENST00000311438.8_Missense_Mutation_p.C329S	NM_001184732.1|NM_001184736.1|NM_004254.3	NP_001171661.1|NP_001171665.1|NP_004245.2	Q8TCC7	S22A8_HUMAN	solute carrier family 22 (organic anion transporter), member 8	329					glutathione transport (GO:0034635)|response to methotrexate (GO:0031427)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|organic anion transmembrane transporter activity (GO:0008514)|quaternary ammonium group transmembrane transporter activity (GO:0015651)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	28					Aciclovir(DB00787)|Adefovir Dipivoxil(DB00718)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Aspartame(DB00168)|Baclofen(DB00181)|Benzylpenicillin(DB01053)|Bumetanide(DB00887)|Cefacetrile(DB01414)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefazolin(DB01327)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Ceftriaxone(DB01212)|Cephalexin(DB00567)|Cilastatin(DB01597)|Cimetidine(DB00501)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Diclofenac(DB00586)|Digoxin(DB00390)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Doxycycline(DB00254)|Enalapril(DB00584)|Estradiol(DB00783)|Famotidine(DB00927)|Furosemide(DB00695)|Ganciclovir(DB01004)|Guanidine(DB00536)|Ibuprofen(DB01050)|Indomethacin(DB00328)|Ketoprofen(DB01009)|L-Carnitine(DB00583)|Liothyronine(DB00279)|Liotrix(DB01583)|Melatonin(DB01065)|Mercaptopurine(DB01033)|Methotrexate(DB00563)|Methyltestosterone(DB06710)|Minocycline(DB01017)|Novobiocin(DB01051)|Oseltamivir(DB00198)|Ouabain(DB01092)|Oxytetracycline(DB00595)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Ranitidine(DB00863)|Salicylic acid(DB00936)|Saxagliptin(DB06335)|Succinic acid(DB00139)|Tenofovir(DB00300)|Tenoxicam(DB00469)|Testosterone(DB00624)|Tetracycline(DB00759)|Valaciclovir(DB00577)|Valproic Acid(DB00313)|Zidovudine(DB00495)	AGGGAAAGACAGAAGGTCATG	0.587																																					p.C329S		Atlas-SNP	.											.	SLC22A8	60	.	0			c.T985A						.						144.0	130.0	134.0					11																	62763192		2201	4298	6499	SO:0001583	missense	9376	exon7			AAAGACAGAAGGT	AF097491, BC022387	CCDS8042.1, CCDS53643.1, CCDS53644.1	11q12.3	2013-05-22			ENSG00000149452	ENSG00000149452		"""Solute carriers"""	10972	protein-coding gene	gene with protein product		607581				10049739	Standard	NM_004254		Approved	OAT3	uc001nwo.3	Q8TCC7	OTTHUMG00000167768	ENST00000336232.2:c.985T>A	chr11.hg19:g.62763192A>T	ENSP00000337335:p.Cys329Ser	85.0	0.0		77.0	44.0	NM_001184732	B4DPH7|F5GWA8|F5H5J1|O95820|Q59EW9|Q96TC1	Missense_Mutation	SNP	ENST00000336232.2	hg19	CCDS8042.1	.	.	.	.	.	.	.	.	.	.	A	22.3	4.269079	0.80469	.	.	ENSG00000149452	ENST00000336232;ENST00000540631;ENST00000545207;ENST00000535878;ENST00000311438;ENST00000430500	T;T;T;T;T	0.73258	-0.73;-0.73;-0.73;-0.73;-0.73	5.34	5.34	0.76211	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.120557	0.64402	D	0.000010	T	0.79197	0.4405	M	0.66378	2.025	0.47511	D	0.999443	P;P	0.50272	0.918;0.933	P;P	0.58391	0.749;0.838	T	0.80944	-0.1156	10	0.62326	D	0.03	.	11.7357	0.51763	1.0:0.0:0.0:0.0	.	329;329	Q8TCC7-2;Q8TCC7	.;S22A8_HUMAN	S	329;315;238;206;329;329	ENSP00000337335:C329S;ENSP00000441658:C238S;ENSP00000443368:C206S;ENSP00000311463:C329S;ENSP00000398548:C329S	ENSP00000311463:C329S	C	-	1	0	SLC22A8	62519768	1.000000	0.71417	0.985000	0.45067	0.969000	0.65631	5.477000	0.66799	2.023000	0.59567	0.454000	0.30748	TGT	.	.		0.587	SLC22A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396191.1	NM_004254	
INTS4	92105	hgsc.bcm.edu	37	11	77632432	77632432	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:77632432T>A	ENST00000534064.1	-	14	1752	c.1718A>T	c.(1717-1719)tAt>tTt	p.Y573F	INTS4_ENST00000525931.1_5'Flank	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	573					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			GAGGTAGGCATAGTGCCTGAA	0.413																																					p.Y573F		Atlas-SNP	.											.	INTS4	89	.	0			c.A1718T						.						145.0	125.0	132.0					11																	77632432		2200	4292	6492	SO:0001583	missense	92105	exon14			TAGGCATAGTGCC	BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1718A>T	chr11.hg19:g.77632432T>A	ENSP00000434466:p.Tyr573Phe	334.0	0.0		334.0	119.0	NM_033547	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Missense_Mutation	SNP	ENST00000534064.1	hg19	CCDS31644.1	.	.	.	.	.	.	.	.	.	.	T	26.7	4.764159	0.89932	.	.	ENSG00000149262	ENST00000534064;ENST00000354849	D	0.86097	-2.07	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	D	0.91372	0.7278	M	0.79475	2.455	0.80722	D	1	D	0.63880	0.993	D	0.68192	0.956	D	0.91927	0.5552	10	0.52906	T	0.07	-14.6043	14.1606	0.65443	0.0:0.0:0.0:1.0	.	573	Q96HW7	INT4_HUMAN	F	573;424	ENSP00000434466:Y573F	ENSP00000346913:Y424F	Y	-	2	0	INTS4	77310080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.195000	0.77798	1.926000	0.55796	0.477000	0.44152	TAT	.	.		0.413	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390927.1	NM_033547	
FLI1	2313	hgsc.bcm.edu	37	11	128680398	128680398	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr11:128680398T>A	ENST00000527786.2	+	9	1363	c.874T>A	c.(874-876)Tcc>Acc	p.S292T	FLI1_ENST00000344954.6_Missense_Mutation_p.S259T|FLI1_ENST00000534087.2_Missense_Mutation_p.S259T|FLI1_ENST00000281428.8_Missense_Mutation_p.S226T|FLI1_ENST00000525560.1_Missense_Mutation_p.S99T	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	292					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		GGAGCTGCTCTCCGACAGCGC	0.632			T	EWSR1	Ewing sarcoma																																p.S292T		Atlas-SNP	.		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	.	FLI1	72	.	0			c.T874A						.						17.0	19.0	18.0					11																	128680398		2175	4293	6468	SO:0001583	missense	2313	exon9			CTGCTCTCCGACA	M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.874T>A	chr11.hg19:g.128680398T>A	ENSP00000433488:p.Ser292Thr	76.0	0.0		84.0	24.0	NM_002017	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	ENST00000527786.2	hg19	CCDS44768.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117864	0.77323	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T;T	0.21543	2.0;2.0;2.0;2.0;2.0	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.106359	0.64402	D	0.000003	T	0.31702	0.0805	N	0.21324	0.655	0.80722	D	1	P;P;P	0.50943	0.887;0.927;0.94	P;P;D	0.63597	0.874;0.842;0.916	T	0.05115	-1.0905	10	0.46703	T	0.11	.	15.8302	0.78743	0.0:0.0:0.0:1.0	.	292;99;226	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	T	99;259;292;259;226	ENSP00000437124:S99T;ENSP00000339627:S259T;ENSP00000399985:S292T;ENSP00000432950:S259T;ENSP00000281428:S226T	ENSP00000281428:S226T	S	+	1	0	FLI1	128185608	1.000000	0.71417	0.997000	0.53966	0.996000	0.88848	8.040000	0.89188	2.145000	0.66743	0.477000	0.44152	TCC	.	.		0.632	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000386226.2	NM_002017	
NCAPD2	9918	hgsc.bcm.edu	37	12	6640135	6640135	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:6640135T>C	ENST00000315579.5	+	31	4812	c.4013T>C	c.(4012-4014)gTc>gCc	p.V1338A	RP5-940J5.3_ENST00000537921.1_RNA|NCAPD2_ENST00000545962.1_Missense_Mutation_p.V1293A|GAPDH_ENST00000229239.5_5'Flank	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2	1338					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						AATGACTTTGTCACACCAGAG	0.473																																					p.V1338A		Atlas-SNP	.											.	NCAPD2	99	.	0			c.T4013C						.						67.0	78.0	74.0					12																	6640135		2203	4300	6503	SO:0001583	missense	9918	exon31			ACTTTGTCACACC	D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.4013T>C	chr12.hg19:g.6640135T>C	ENSP00000325017:p.Val1338Ala	101.0	0.0		109.0	43.0	NM_014865	D3DUR4|Q8N6U3	Missense_Mutation	SNP	ENST00000315579.5	hg19	CCDS8548.1	.	.	.	.	.	.	.	.	.	.	T	13.39	2.223363	0.39300	.	.	ENSG00000010292	ENST00000315579;ENST00000545962	T;T	0.17370	2.55;2.28	5.1	1.41	0.22369	.	0.140303	0.47852	N	0.000215	T	0.06645	0.0170	N	0.08118	0	0.40423	D	0.979862	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.35549	-0.9784	10	0.10902	T	0.67	-12.2539	7.699	0.28611	0.0:0.2425:0.0:0.7575	.	1293;1338	F5GZJ1;Q15021	.;CND1_HUMAN	A	1338;1293	ENSP00000325017:V1338A;ENSP00000444417:V1293A	ENSP00000325017:V1338A	V	+	2	0	NCAPD2	6510396	0.995000	0.38212	0.153000	0.22517	0.417000	0.31264	1.921000	0.40035	0.074000	0.16767	-0.411000	0.06167	GTC	.	.		0.473	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399964.1	NM_014865	
CLEC1A	51267	hgsc.bcm.edu	37	12	10224016	10224016	+	Silent	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:10224016C>T	ENST00000315330.4	-	6	821	c.759G>A	c.(757-759)aaG>aaA	p.K253K	CLEC1A_ENST00000457018.2_Silent_p.K220K|CLEC1A_ENST00000420265.2_Silent_p.K161K	NM_016511.2	NP_057595.2	Q8NC01	CLC1A_HUMAN	C-type lectin domain family 1, member A	253	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	23						AGACACAACGCTTCAATTCTT	0.483																																					p.K253K		Atlas-SNP	.											.	CLEC1A	48	.	0			c.G759A						.						202.0	180.0	187.0					12																	10224016		2203	4300	6503	SO:0001819	synonymous_variant	51267	exon6			ACAACGCTTCAAT	AY358587	CCDS8612.1, CCDS73443.1	12p13.31	2005-02-09				ENSG00000150048		"""C-type lectin domain containing"""	24355	protein-coding gene	gene with protein product		606782				10671229, 11745369	Standard	XM_005253383		Approved	CLEC1, MGC34328	uc001qxb.3	Q8NC01		ENST00000315330.4:c.759G>A	chr12.hg19:g.10224016C>T		89.0	0.0		84.0	6.0	NM_016511	Q8IUW7|Q9NZH3	Silent	SNP	ENST00000315330.4	hg19	CCDS8612.1																																																																																			.	.		0.483	CLEC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000399924.1	NM_016511	
PRICKLE1	144165	hgsc.bcm.edu	37	12	42860019	42860019	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:42860019C>G	ENST00000455697.1	-	6	1037	c.752G>C	c.(751-753)tGt>tCt	p.C251S	PRICKLE1_ENST00000552240.1_Missense_Mutation_p.C251S|PRICKLE1_ENST00000345127.3_Missense_Mutation_p.C251S|RP11-328C8.4_ENST00000547824.1_RNA|PRICKLE1_ENST00000548696.1_Missense_Mutation_p.C251S|PRICKLE1_ENST00000445766.2_Missense_Mutation_p.C251S	NM_001144882.1|NM_001144883.1	NP_001138354.1|NP_001138355.1	Q96MT3	PRIC1_HUMAN	prickle homolog 1 (Drosophila)	251	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle cell myoblast differentiation (GO:2000691)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(13)|ovary(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	47	all_cancers(12;4.25e-05)|Breast(8;0.176)			GBM - Glioblastoma multiforme(48;0.2)		ACAGGTTTCACAGTACTCCGC	0.502																																					p.C251S		Atlas-SNP	.											.	PRICKLE1	105	.	0			c.G752C						.						75.0	75.0	75.0					12																	42860019		2203	4300	6503	SO:0001583	missense	144165	exon6			GTTTCACAGTACT	AK056499	CCDS8742.1	12p11-q12	2010-08-13	2006-09-12			ENSG00000139174			17019	protein-coding gene	gene with protein product		608500	"""prickle-like 1 (Drosophila)"""			12525887, 18976727	Standard	NM_153026		Approved	FLJ31937, EPM1B	uc010skv.2	Q96MT3		ENST00000455697.1:c.752G>C	chr12.hg19:g.42860019C>G	ENSP00000401060:p.Cys251Ser	124.0	0.0		131.0	44.0	NM_001144882	Q14C83|Q71QF8|Q96N00	Missense_Mutation	SNP	ENST00000455697.1	hg19	CCDS8742.1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.873294	0.91664	.	.	ENSG00000139174	ENST00000455697;ENST00000445766;ENST00000548696;ENST00000345127;ENST00000552240	D;D;D;D;D	0.99311	-5.73;-5.73;-5.73;-5.73;-5.73	4.98	4.98	0.66077	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.99750	0.9900	H	0.99555	4.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96840	0.9617	10	0.66056	D	0.02	-3.4384	18.6235	0.91330	0.0:1.0:0.0:0.0	.	251	Q96MT3	PRIC1_HUMAN	S	251	ENSP00000401060:C251S;ENSP00000398947:C251S;ENSP00000448359:C251S;ENSP00000345064:C251S;ENSP00000449819:C251S	ENSP00000345064:C251S	C	-	2	0	PRICKLE1	41146286	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	7.776000	0.85560	2.484000	0.83849	0.561000	0.74099	TGT	.	.		0.502	PRICKLE1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404069.1		
COL2A1	1280	hgsc.bcm.edu	37	12	48393717	48393717	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:48393717G>A	ENST00000380518.3	-	2	441	c.277C>T	c.(277-279)Ctc>Ttc	p.L93F	COL2A1_ENST00000337299.6_Intron	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	93					axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	GCAGTGGCGAGGTCAGTTGGG	0.493																																					p.L93F		Atlas-SNP	.											.	COL2A1	368	.	0			c.C277T						.						72.0	79.0	76.0					12																	48393717		2063	4206	6269	SO:0001583	missense	1280	exon2			TGGCGAGGTCAGT	X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.277C>T	chr12.hg19:g.48393717G>A	ENSP00000369889:p.Leu93Phe	150.0	0.0		114.0	34.0	NM_001844	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	ENST00000380518.3	hg19	CCDS41778.1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.257381	0.39896	.	.	ENSG00000139219	ENST00000380518	D	0.89939	-2.59	4.66	4.66	0.58398	.	0.485117	0.19947	N	0.102515	D	0.82637	0.5080	N	0.25957	0.775	0.80722	D	1	B	0.19583	0.037	B	0.17433	0.018	T	0.77043	-0.2734	10	0.23891	T	0.37	.	16.8676	0.86033	0.0:0.0:1.0:0.0	.	93	P02458	CO2A1_HUMAN	F	93	ENSP00000369889:L93F	ENSP00000369889:L93F	L	-	1	0	COL2A1	46679984	0.972000	0.33761	1.000000	0.80357	0.996000	0.88848	2.122000	0.41987	2.584000	0.87258	0.563000	0.77884	CTC	.	.		0.493	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313810.2	NM_001844	
SMARCD1	6602	hgsc.bcm.edu	37	12	50492775	50492775	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:50492775A>G	ENST00000394963.4	+	13	1938	c.1540A>G	c.(1540-1542)Aat>Gat	p.N514D	SMARCD1_ENST00000548573.1_Missense_Mutation_p.N312D|SMARCD1_ENST00000381513.4_Missense_Mutation_p.N473D	NM_003076.4	NP_003067.3			SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 1											NS(1)|breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	18						GGGAATCCGGAATACATAGGG	0.507																																					p.N514D		Atlas-SNP	.											.	SMARCD1	37	.	0			c.A1540G						.						107.0	104.0	105.0					12																	50492775		2203	4300	6503	SO:0001583	missense	6602	exon13			ATCCGGAATACAT	U66617	CCDS8797.2, CCDS8798.2	12q13-q14	2008-08-05			ENSG00000066117	ENSG00000066117			11106	protein-coding gene	gene with protein product		601735				8804307, 9693044, 12917342	Standard	NM_003076		Approved	BAF60A, Rsc6p, CRACD1	uc001rvx.4	Q96GM5	OTTHUMG00000150194	ENST00000394963.4:c.1540A>G	chr12.hg19:g.50492775A>G	ENSP00000378414:p.Asn514Asp	66.0	0.0		58.0	22.0	NM_003076		Missense_Mutation	SNP	ENST00000394963.4	hg19	CCDS8797.2	.	.	.	.	.	.	.	.	.	.	A	18.50	3.637649	0.67130	.	.	ENSG00000066117	ENST00000394963;ENST00000381513;ENST00000542914;ENST00000548573	T;T	0.48836	0.8;0.9	5.65	4.48	0.54585	.	0.050225	0.85682	D	0.000000	T	0.56949	0.2020	M	0.83692	2.655	0.80722	D	1	P;P;P	0.48640	0.712;0.913;0.743	P;P;B	0.47044	0.535;0.535;0.334	T	0.59637	-0.7417	10	0.33940	T	0.23	-10.5949	12.9701	0.58508	0.8648:0.1352:0.0:0.0	.	312;473;514	F8VRQ4;Q96GM5-2;Q96GM5	.;.;SMRD1_HUMAN	D	514;473;290;312	ENSP00000378414:N514D;ENSP00000370924:N473D	ENSP00000370924:N473D	N	+	1	0	SMARCD1	48779042	1.000000	0.71417	0.991000	0.47740	0.977000	0.68977	7.485000	0.81204	1.050000	0.40346	0.482000	0.46254	AAT	.	.		0.507	SMARCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316759.2	NM_003076	
IRAK3	11213	hgsc.bcm.edu	37	12	66638917	66638917	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:66638917G>A	ENST00000261233.4	+	11	1610	c.1189G>A	c.(1189-1191)Gat>Aat	p.D397N	IRAK3_ENST00000457197.2_Missense_Mutation_p.D336N	NM_007199.2	NP_009130.2			interleukin-1 receptor-associated kinase 3											breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(28;0.0203)		GAGAGGCCTGGATTCATGTCT	0.478																																					p.D397N		Atlas-SNP	.											.	IRAK3	75	.	0			c.G1189A						.						93.0	95.0	95.0					12																	66638917		2203	4300	6503	SO:0001583	missense	11213	exon11			GGCCTGGATTCAT	AF113136	CCDS8975.1, CCDS44937.1	12q13.13	2008-05-02			ENSG00000090376	ENSG00000090376			17020	protein-coding gene	gene with protein product		604459				10383454	Standard	NM_001142523		Approved	IRAK-M	uc001sth.3	Q9Y616	OTTHUMG00000169002	ENST00000261233.4:c.1189G>A	chr12.hg19:g.66638917G>A	ENSP00000261233:p.Asp397Asn	110.0	0.0		136.0	69.0	NM_007199		Missense_Mutation	SNP	ENST00000261233.4	hg19	CCDS8975.1	.	.	.	.	.	.	.	.	.	.	G	15.20	2.764261	0.49574	.	.	ENSG00000090376	ENST00000261233;ENST00000457197	T;T	0.66815	-0.23;-0.23	5.89	4.06	0.47325	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.312643	0.31566	N	0.007435	T	0.56645	0.1999	L	0.49640	1.575	0.25990	N	0.982258	B;B	0.20671	0.047;0.028	B;B	0.20955	0.032;0.027	T	0.45891	-0.9230	9	.	.	.	-5.7203	8.4694	0.32975	0.0817:0.1535:0.7647:0.0	.	336;397	Q9Y616-2;Q9Y616	.;IRAK3_HUMAN	N	397;336	ENSP00000261233:D397N;ENSP00000409852:D336N	.	D	+	1	0	IRAK3	64925184	0.986000	0.35501	0.140000	0.22221	0.173000	0.22820	1.350000	0.34010	0.822000	0.34565	-0.305000	0.09177	GAT	.	.		0.478	IRAK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000401908.1		
ATXN2	6311	hgsc.bcm.edu	37	12	111902504	111902504	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:111902504G>T	ENST00000377617.3	-	21	3493	c.3332C>A	c.(3331-3333)cCa>cAa	p.P1111Q	ATXN2_ENST00000542287.2_Missense_Mutation_p.P846Q|ATXN2_ENST00000550104.1_3'UTR|ATXN2_ENST00000535949.1_Intron|ATXN2_ENST00000608853.1_Missense_Mutation_p.P951Q|ATXN2_ENST00000389153.4_Missense_Mutation_p.P848Q	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	1111					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						CTTGTTGTATGGTAATTTGGG	0.323																																					p.P1111Q		Atlas-SNP	.											.	ATXN2	99	.	0			c.C3332A						.						141.0	146.0	144.0					12																	111902504		2203	4300	6503	SO:0001583	missense	6311	exon21			TTGTATGGTAATT	U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.3332C>A	chr12.hg19:g.111902504G>T	ENSP00000366843:p.Pro1111Gln	70.0	0.0		91.0	4.0	NM_002973	A6NLD4|Q6ZQZ7|Q99493	Missense_Mutation	SNP	ENST00000377617.3	hg19	CCDS31902.1	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148222	0.78001	.	.	ENSG00000204842	ENST00000389154;ENST00000389153;ENST00000377617;ENST00000542287;ENST00000550844	T	0.69685	-0.42	5.74	5.74	0.90152	.	0.152147	0.46442	D	0.000300	T	0.75657	0.3879	L	0.36672	1.1	0.80722	D	1	D;D;D	0.89917	1.0;0.995;0.999	D;P;D	0.85130	0.997;0.836;0.994	T	0.72697	-0.4215	10	0.38643	T	0.18	-8.7208	18.4783	0.90800	0.0:0.0:1.0:0.0	.	1111;846;848	Q99700;F8VQP2;F8WB06	ATX2_HUMAN;.;.	Q	166;848;1111;846;36	ENSP00000366843:P1111Q	ENSP00000366843:P1111Q	P	-	2	0	ATXN2	110386887	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.013000	0.70776	2.873000	0.98535	0.563000	0.77884	CCA	.	.		0.323	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257351.3	NM_002973	
TCTN2	79867	hgsc.bcm.edu	37	12	124192255	124192255	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr12:124192255A>T	ENST00000303372.5	+	18	2217	c.2089A>T	c.(2089-2091)Agt>Tgt	p.S697C	RP11-338K17.8_ENST00000538837.1_lincRNA|TCTN2_ENST00000426174.2_Missense_Mutation_p.S696C	NM_001143850.2|NM_024809.4	NP_001137322.1|NP_079085.2	Q96GX1	TECT2_HUMAN	tectonic family member 2	697					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|TCTN-B9D complex (GO:0036038)				breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000163)|Epithelial(86;0.000502)|all cancers(50;0.00451)		CAAAGCCTATAGTTAGACAAC	0.483																																					p.S697C		Atlas-SNP	.											.	TCTN2	50	.	0			c.A2089T						.						143.0	124.0	131.0					12																	124192255		2203	4300	6503	SO:0001583	missense	79867	exon18			GCCTATAGTTAGA	AK056924	CCDS9253.1, CCDS45007.1	12q24.31	2011-04-12	2007-08-20	2007-08-20	ENSG00000168778	ENSG00000168778		"""Tectonic proteins"""	25774	protein-coding gene	gene with protein product	"""Meckel syndrome, type 8"""	613846	"""chromosome 12 open reading frame 38"""	C12orf38		21462283	Standard	NM_024809		Approved	FLJ12975, TECT2, MKS8	uc001ufp.3	Q96GX1	OTTHUMG00000168700	ENST00000303372.5:c.2089A>T	chr12.hg19:g.124192255A>T	ENSP00000304941:p.Ser697Cys	74.0	0.0		82.0	39.0	NM_024809	A8K7Y8|B3KPW5|Q9H966	Missense_Mutation	SNP	ENST00000303372.5	hg19	CCDS9253.1	.	.	.	.	.	.	.	.	.	.	A	14.26	2.483430	0.44147	.	.	ENSG00000168778	ENST00000426174;ENST00000303372	D;D	0.84298	-1.83;-1.83	4.46	-1.11	0.09840	.	0.461184	0.16889	U	0.195373	T	0.71846	0.3388	L	0.40543	1.245	0.09310	N	1	D;D	0.54047	0.964;0.964	B;B	0.40702	0.338;0.338	T	0.66168	-0.5991	10	0.66056	D	0.02	.	0.9967	0.01469	0.5084:0.1591:0.1793:0.1533	.	696;697	A8K7Y8;Q96GX1	.;TECT2_HUMAN	C	696;697	ENSP00000395171:S696C;ENSP00000304941:S697C	ENSP00000304941:S697C	S	+	1	0	TCTN2	122758208	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.138000	0.16016	-0.403000	0.07622	-0.361000	0.07541	AGT	.	.		0.483	TCTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000400652.1	NM_024809	
LINC00283	100874057	hgsc.bcm.edu	37	13	103396437	103396437	+	RNA	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr13:103396437C>A	ENST00000430111.1	+	0	810									long intergenic non-protein coding RNA 283																		CTGAGTAATGCCTCTCCTATA	0.358																																					p.A2204S		Atlas-SNP	.											.	.	.	.	0			c.G6610T						.						395.0	301.0	330.0					13																	103396437		692	1591	2283			643677	exon4			GTAATGCCTCTCC			13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		chr13.hg19:g.103396437C>A		54.0	0.0		90.0	35.0	NM_001146197		Missense_Mutation	SNP	ENST00000430111.1	hg19																																																																																				.	.		0.358	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	antisense	OTTHUMT00000045714.1		
ARHGEF7	8874	hgsc.bcm.edu	37	13	111926288	111926288	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr13:111926288A>T	ENST00000375741.2	+	11	1514	c.1264A>T	c.(1264-1266)Aga>Tga	p.R422*	ARHGEF7_ENST00000370623.3_Nonsense_Mutation_p.R329*|ARHGEF7_ENST00000375736.4_Nonsense_Mutation_p.R244*|ARHGEF7_ENST00000426073.2_Nonsense_Mutation_p.R244*|ARHGEF7_ENST00000478679.1_Nonsense_Mutation_p.R166*|ARHGEF7_ENST00000375723.1_Nonsense_Mutation_p.R244*|ARHGEF7_ENST00000483189.1_3'UTR|ARHGEF7_ENST00000218789.5_Nonsense_Mutation_p.R244*|ARHGEF7_ENST00000375737.5_Nonsense_Mutation_p.R319*|ARHGEF7_ENST00000544132.1_Intron|ARHGEF7_ENST00000317133.5_Nonsense_Mutation_p.R401*|ARHGEF7_ENST00000375739.2_Nonsense_Mutation_p.R372*	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	422	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			AGAGCTCGAGAGACACATGGA	0.498																																					p.R422X		Atlas-SNP	.											.	ARHGEF7	157	.	0			c.A1264T						.						69.0	60.0	63.0					13																	111926288		2203	4300	6503	SO:0001587	stop_gained	8874	exon11			CTCGAGAGACACA	D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.1264A>T	chr13.hg19:g.111926288A>T	ENSP00000364893:p.Arg422*	79.0	0.0		77.0	19.0	NM_001113511	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Nonsense_Mutation	SNP	ENST00000375741.2	hg19	CCDS45068.1	.	.	.	.	.	.	.	.	.	.	A	38	6.921280	0.97936	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000466143;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	.	.	.	4.87	2.18	0.27775	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.3829	0.49768	0.5561:0.4439:0.0:0.0	.	.	.	.	X	401;422;372;329;399;244;244;244;244;319;244;166	.	ENSP00000218789:R244X	R	+	1	2	ARHGEF7	110724289	1.000000	0.71417	0.986000	0.45419	0.958000	0.62258	2.243000	0.43115	0.669000	0.31146	0.477000	0.44152	AGA	.	.		0.498	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_001113511	
MYH7	4625	hgsc.bcm.edu	37	14	23900980	23900980	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:23900980C>T	ENST00000355349.3	-	7	791	c.629G>A	c.(628-630)aGc>aAc	p.S210N		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	210	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		CTTGCCCGGGCTCTGGTCCTT	0.597																																					p.S210N		Atlas-SNP	.											.	MYH7	349	.	0			c.G629A						.						103.0	94.0	97.0					14																	23900980		2203	4300	6503	SO:0001583	missense	4625	exon7			CCCGGGCTCTGGT	M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.629G>A	chr14.hg19:g.23900980C>T	ENSP00000347507:p.Ser210Asn	60.0	0.0		69.0	24.0	NM_000257	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	ENST00000355349.3	hg19	CCDS9601.1	.	.	.	.	.	.	.	.	.	.	C	0.017	-1.504108	0.00992	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95137	-3.62	3.12	-1.69	0.08186	Myosin head, motor domain (2);	.	.	.	.	D	0.88647	0.6493	L	0.33753	1.03	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.75563	-0.3274	9	0.35671	T	0.21	.	8.6915	0.34269	0.0:0.2308:0.2876:0.4815	.	210	P12883	MYH7_HUMAN	N	210	ENSP00000347507:S210N	ENSP00000347507:S210N	S	-	2	0	MYH7	22970820	0.001000	0.12720	0.038000	0.18304	0.057000	0.15508	0.000000	0.12993	-0.488000	0.06726	-0.786000	0.03341	AGC	.	.		0.597	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000071798.3	NM_000257	
INSM2	84684	hgsc.bcm.edu	37	14	36003923	36003923	+	Silent	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:36003923A>T	ENST00000307169.3	+	1	676	c.465A>T	c.(463-465)gcA>gcT	p.A155A		NM_032594.3	NP_115983.3	Q96T92	INSM2_HUMAN	insulinoma-associated 2	155					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|urinary_tract(1)	10	Breast(36;0.122)|Hepatocellular(127;0.158)		LUAD - Lung adenocarcinoma(9;2.16e-07)|Lung(238;2.63e-07)|Epithelial(34;0.00145)|all cancers(34;0.00452)	GBM - Glioblastoma multiforme(112;0.0223)		TGGCGCCAGCAGCCGCACCGA	0.756																																					p.A155A		Atlas-SNP	.											.	INSM2	39	.	0			c.A465T						.						2.0	2.0	2.0					14																	36003923		1229	2805	4034	SO:0001819	synonymous_variant	84684	exon1			GCCAGCAGCCGCA	AF260323	CCDS9657.1	14q13.1	2013-01-08			ENSG00000168348	ENSG00000168348		"""Zinc fingers, C2H2-type"""	17539	protein-coding gene	gene with protein product	"""mlt 1"""	614027					Standard	NM_032594		Approved	IA-6	uc001wth.1	Q96T92	OTTHUMG00000140223	ENST00000307169.3:c.465A>T	chr14.hg19:g.36003923A>T		30.0	0.0		29.0	8.0	NM_032594	A1L432|J9Y024|Q8N8K7|Q96Q84	Silent	SNP	ENST00000307169.3	hg19	CCDS9657.1																																																																																			.	.		0.756	INSM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276686.1		
PELI2	57161	hgsc.bcm.edu	37	14	56757106	56757106	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:56757106G>A	ENST00000267460.4	+	5	914	c.628G>A	c.(628-630)Gag>Aag	p.E210K		NM_021255.2	NP_067078.1	Q9HAT8	PELI2_HUMAN	pellino E3 ubiquitin protein ligase family member 2	210					innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein phosphorylation (GO:0001934)|protein ubiquitination (GO:0016567)|Toll signaling pathway (GO:0008063)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytosol (GO:0005829)	ligase activity (GO:0016874)			kidney(6)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	22						GGTCTGGCGCGAGATCTCTGT	0.587																																					p.E210K		Atlas-SNP	.											PELI2,NS,carcinoma,-2,1	PELI2	55	.	0			c.G628A						.						105.0	109.0	107.0					14																	56757106		2203	4300	6503	SO:0001583	missense	57161	exon5			TGGCGCGAGATCT	AF302502	CCDS9726.1	14q21	2012-02-23	2012-02-23		ENSG00000139946	ENSG00000139946		"""Pellino homologs"""	8828	protein-coding gene	gene with protein product		614798	"""pellino (Drosophila) homolog 2"", ""pellino homolog 2 (Drosophila)"""			11306823, 12860405	Standard	XM_006720211		Approved		uc001xch.3	Q9HAT8	OTTHUMG00000152336	ENST00000267460.4:c.628G>A	chr14.hg19:g.56757106G>A	ENSP00000267460:p.Glu210Lys	81.0	1.0		75.0	27.0	NM_021255	B2RDY5	Missense_Mutation	SNP	ENST00000267460.4	hg19	CCDS9726.1	.	.	.	.	.	.	.	.	.	.	G	37	6.315957	0.97467	.	.	ENSG00000139946	ENST00000267460	T	0.59772	0.24	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.81880	0.4916	M	0.89601	3.045	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	D	0.84626	0.0687	10	0.87932	D	0	-34.1072	20.1634	0.98142	0.0:0.0:1.0:0.0	.	210	Q9HAT8	PELI2_HUMAN	K	210	ENSP00000267460:E210K	ENSP00000267460:E210K	E	+	1	0	PELI2	55826859	1.000000	0.71417	0.972000	0.41901	0.991000	0.79684	9.869000	0.99810	2.773000	0.95371	0.655000	0.94253	GAG	.	.		0.587	PELI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000276925.1		
AREL1	9870	hgsc.bcm.edu	37	14	75139861	75139861	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:75139861T>A	ENST00000356357.4	-	10	1734	c.1219A>T	c.(1219-1221)Att>Ttt	p.I407F	AREL1_ENST00000557401.1_5'UTR	NM_001039479.1	NP_001034568.1	O15033	AREL1_HUMAN	apoptosis resistant E3 ubiquitin protein ligase 1	407					apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGAGGTTGAATGCCATCATCC	0.448																																					p.I407F		Atlas-SNP	.											.	KIAA0317	68	.	0			c.A1219T						.						107.0	106.0	107.0					14																	75139861		1943	4135	6078	SO:0001583	missense	9870	exon10			GTTGAATGCCATC	AB002315	CCDS41971.1	14q24.2	2013-04-15	2013-04-15	2013-04-15	ENSG00000119682	ENSG00000119682			20363	protein-coding gene	gene with protein product		615380	"""KIAA0317"""	KIAA0317		9205841, 23479728	Standard	XM_006720344		Approved		uc001xqb.3	O15033	OTTHUMG00000154499	ENST00000356357.4:c.1219A>T	chr14.hg19:g.75139861T>A	ENSP00000348714:p.Ile407Phe	103.0	0.0		98.0	39.0	NM_001039479	B4E2C7|Q7LDY1|Q8IYY9	Missense_Mutation	SNP	ENST00000356357.4	hg19	CCDS41971.1	.	.	.	.	.	.	.	.	.	.	T	13.74	2.326482	0.41197	.	.	ENSG00000119682	ENST00000356357;ENST00000543377;ENST00000556202	T;T	0.50277	0.75;0.75	6.17	6.17	0.99709	.	0.045801	0.85682	D	0.000000	T	0.40398	0.1115	L	0.29908	0.895	0.80722	D	1	P;B	0.46512	0.879;0.01	P;B	0.47864	0.559;0.004	T	0.19289	-1.0310	10	0.08599	T	0.76	.	12.6398	0.56702	0.0:0.0:0.1377:0.8623	.	407;407	O15033-2;O15033	.;K0317_HUMAN	F	407;246;246	ENSP00000348714:I407F;ENSP00000452101:I246F	ENSP00000348714:I407F	I	-	1	0	KIAA0317	74209614	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.873000	0.69644	2.371000	0.80710	0.533000	0.62120	ATT	.	.		0.448	AREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000335517.2	NM_014821	
NRXN3	9369	hgsc.bcm.edu	37	14	79432393	79432393	+	Silent	SNP	T	T	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:79432393T>G	ENST00000554719.1	+	9	1793	c.1302T>G	c.(1300-1302)cgT>cgG	p.R434R	NRXN3_ENST00000335750.5_Silent_p.R434R	NM_004796.4	NP_004787.2	Q9HDB5	NRX3B_HUMAN	neurexin 3	203					adult behavior (GO:0030534)|angiogenesis (GO:0001525)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(23)|lung(40)|ovary(3)|pancreas(2)|prostate(5)|skin(7)|upper_aerodigestive_tract(9)|urinary_tract(1)	104		Renal(4;0.00876)		BRCA - Breast invasive adenocarcinoma(234;0.00544)|Kidney(3;0.029)|KIRC - Kidney renal clear cell carcinoma(182;0.223)		ACCATACCCGTTTGGAGTTCC	0.423																																					p.R434R		Atlas-SNP	.											.	NRXN3	342	.	0			c.T1302G						.						97.0	90.0	92.0					14																	79432393		2203	4300	6503	SO:0001819	synonymous_variant	9369	exon9			TACCCGTTTGGAG	AB018286	CCDS9870.1, CCDS9871.1, CCDS45145.1, CCDS61515.1	14q31	2010-01-19				ENSG00000021645			8010	protein-coding gene	gene with protein product		600567	"""chromosome 14 open reading frame 60"""	C14orf60		11944992, 12379233	Standard	NM_004796		Approved	KIAA0743	uc001xun.4	Q9HDB5		ENST00000554719.1:c.1302T>G	chr14.hg19:g.79432393T>G		66.0	0.0		68.0	22.0	NM_004796	A5PKW8|A8MPU5|B3KPM7|Q6NUR0|Q8IUD8	Silent	SNP	ENST00000554719.1	hg19	CCDS9870.1																																																																																			.	.		0.423	NRXN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000413787.1	NM_001105250	
GPR68	8111	hgsc.bcm.edu	37	14	91701172	91701172	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr14:91701172G>T	ENST00000531499.2	-	2	562	c.223C>A	c.(223-225)Ccc>Acc	p.P75T	GPR68_ENST00000238699.3_Missense_Mutation_p.P85T|GPR68_ENST00000529300.1_5'Flank|GPR68_ENST00000535815.1_Missense_Mutation_p.P75T			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	75					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		AGCCAGAAGGGCAGCGAGCAG	0.602																																					p.P75T		Atlas-SNP	.											.	GPR68	32	.	0			c.C223A						.						60.0	56.0	57.0					14																	91701172		2203	4300	6503	SO:0001583	missense	8111	exon2			AGAAGGGCAGCGA	U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.223C>A	chr14.hg19:g.91701172G>T	ENSP00000434045:p.Pro75Thr	87.0	0.0		87.0	38.0	NM_001177676	Q13334|Q4VBB4|Q6IX34	Missense_Mutation	SNP	ENST00000531499.2	hg19	CCDS9894.2	.	.	.	.	.	.	.	.	.	.	G	23.8	4.461116	0.84317	.	.	ENSG00000119714	ENST00000531499;ENST00000238699;ENST00000535815;ENST00000529102	T;T;T;T	0.73047	-0.71;-0.71;-0.71;-0.71	5.56	5.56	0.83823	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.88555	0.6468	M	0.92604	3.325	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90847	0.4728	10	0.87932	D	0	.	19.5343	0.95242	0.0:0.0:1.0:0.0	.	75;75	Q6NWR5;Q15743	.;OGR1_HUMAN	T	75;85;75;75	ENSP00000434045:P75T;ENSP00000238699:P85T;ENSP00000440797:P75T;ENSP00000432740:P75T	ENSP00000238699:P85T	P	-	1	0	GPR68	90770925	1.000000	0.71417	0.978000	0.43139	0.776000	0.43924	9.869000	0.99810	2.601000	0.87937	0.655000	0.94253	CCC	.	.		0.602	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000395245.2		
ARHGAP11A	9824	hgsc.bcm.edu	37	15	32928129	32928129	+	Intron	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr15:32928129A>G	ENST00000361627.3	+	11	2205				ARHGAP11A_ENST00000567348.1_Missense_Mutation_p.Y499C|ARHGAP11A_ENST00000563864.1_Missense_Mutation_p.Y471C|ARHGAP11A_ENST00000543522.1_Intron|ARHGAP11A_ENST00000565905.1_Intron	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		ACATTTACATACTACTGTTAG	0.274																																					p.Y499C	Colon(45;757 1134 30003 36652)	Atlas-SNP	.											.	ARHGAP11A	84	.	0			c.A1496G						.						60.0	60.0	60.0					15																	32928129		2201	4299	6500	SO:0001627	intron_variant	9824	exon11			TTACATACTACTG	D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.1483+13A>G	chr15.hg19:g.32928129A>G		165.0	0.0		191.0	58.0	NM_199357	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	ENST00000361627.3	hg19	CCDS10028.1																																																																																			.	.		0.274	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251417.1	NM_014783	
UACA	55075	hgsc.bcm.edu	37	15	70959550	70959550	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr15:70959550T>G	ENST00000322954.6	-	16	3658	c.3473A>C	c.(3472-3474)aAt>aCt	p.N1158T	UACA_ENST00000560441.1_Missense_Mutation_p.N1143T|UACA_ENST00000539319.1_Missense_Mutation_p.N1049T|UACA_ENST00000379983.2_Missense_Mutation_p.N1145T	NM_018003.2	NP_060473.2	Q9BZF9	UACA_HUMAN	uveal autoantigen with coiled-coil domains and ankyrin repeats	1158					intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of protein import into nucleus (GO:0042307)|response to UV (GO:0009411)	apoptosome (GO:0043293)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)				breast(2)|endometrium(7)|kidney(4)|large_intestine(13)|lung(17)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	50						GTTCTTTTGATTCTCCAACAA	0.393																																					p.N1158T		Atlas-SNP	.											.	UACA	235	.	0			c.A3473C						.						169.0	169.0	169.0					15																	70959550		2199	4298	6497	SO:0001583	missense	55075	exon16			TTTTGATTCTCCA	AF322916	CCDS10235.1, CCDS32280.1	15q22-q24	2013-01-10			ENSG00000137831	ENSG00000137831		"""Ankyrin repeat domain containing"""	15947	protein-coding gene	gene with protein product		612516				11162650, 10997877	Standard	NM_001008224		Approved	FLJ10128, KIAA1561	uc002asr.3	Q9BZF9	OTTHUMG00000133363	ENST00000322954.6:c.3473A>C	chr15.hg19:g.70959550T>G	ENSP00000314556:p.Asn1158Thr	81.0	0.0		58.0	25.0	NM_018003	G3XAG2|Q14DD3|Q8N3B8|Q96NH6|Q9HCL1|Q9NWC6	Missense_Mutation	SNP	ENST00000322954.6	hg19	CCDS10235.1	.	.	.	.	.	.	.	.	.	.	T	7.643	0.681369	0.14907	.	.	ENSG00000137831	ENST00000322954;ENST00000379983;ENST00000539319	T;T;T	0.33865	1.39;1.41;1.88	5.66	5.66	0.87406	.	0.357899	0.27100	N	0.020934	T	0.37348	0.1000	L	0.55103	1.725	0.09310	N	1	P;B;P;P	0.40398	0.529;0.394;0.536;0.716	B;B;B;B	0.39840	0.228;0.114;0.114;0.311	T	0.31052	-0.9957	10	0.32370	T	0.25	-21.1466	15.9023	0.79387	0.0:0.0:0.0:1.0	.	1049;1158;1158;1145	F5H2B9;B7ZKM6;Q9BZF9;G3XAG2	.;.;UACA_HUMAN;.	T	1158;1145;1049	ENSP00000314556:N1158T;ENSP00000369319:N1145T;ENSP00000438667:N1049T	ENSP00000314556:N1158T	N	-	2	0	UACA	68746604	0.000000	0.05858	0.964000	0.40570	0.036000	0.12997	0.072000	0.14617	2.153000	0.67306	0.533000	0.62120	AAT	.	.		0.393	UACA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257199.2		
ZNF646	9726	hgsc.bcm.edu	37	16	31090546	31090546	+	Silent	SNP	C	C	T	rs140492151		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr16:31090546C>T	ENST00000394979.2	+	1	3324	c.2901C>T	c.(2899-2901)taC>taT	p.Y967Y	ZNF646_ENST00000300850.5_Silent_p.Y967Y			O15015	ZN646_HUMAN	zinc finger protein 646	967					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						GTCAGACCTACGATGACCTGG	0.607																																					p.Y967Y		Atlas-SNP	.											.	ZNF646	133	.	0			c.C2901T						.	C		0,4394		0,0,2197	86.0	75.0	79.0		2901	-4.4	1.0	16	dbSNP_134	79	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	ZNF646	NM_014699.3		0,1,6496	TT,TC,CC		0.0116,0.0,0.0077		967/1833	31090546	1,12993	2197	4300	6497	SO:0001819	synonymous_variant	9726	exon2			GACCTACGATGAC	AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.2901C>T	chr16.hg19:g.31090546C>T		103.0	0.0		63.0	22.0	NM_014699	Q8IVD8	Silent	SNP	ENST00000394979.2	hg19																																																																																				.	C|1.000;T|0.000		0.607	ZNF646-003	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000108510.2	NM_014699	
DNAH2	146754	hgsc.bcm.edu	37	17	7637534	7637534	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:7637534T>A	ENST00000572933.1	+	6	2122	c.662T>A	c.(661-663)cTc>cAc	p.L221H	DNAH2_ENST00000082259.3_Missense_Mutation_p.L221H|DNAH2_ENST00000389173.2_Missense_Mutation_p.L221H|DNAH2_ENST00000570791.1_Missense_Mutation_p.L221H			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	221	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				CACACGGTCCTCTACATCCCT	0.532																																					p.L221H		Atlas-SNP	.											.	DNAH2	498	.	0			c.T662A						.						92.0	77.0	82.0					17																	7637534		2203	4300	6503	SO:0001583	missense	146754	exon5			CGGTCCTCTACAT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.662T>A	chr17.hg19:g.7637534T>A	ENSP00000458355:p.Leu221His	142.0	0.0		156.0	56.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.418614	0.83559	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.38560	1.13;1.19	5.24	5.24	0.73138	.	0.955765	0.08632	N	0.916895	T	0.69922	0.3165	M	0.84326	2.69	0.47511	D	0.999445	D;D	0.89917	0.999;1.0	D;D	0.91635	0.921;0.999	T	0.64554	-0.6380	10	0.87932	D	0	.	14.1209	0.65186	0.0:0.0:0.0:1.0	.	221;221	Q9P225;Q9P225-3	DYH2_HUMAN;.	H	221	ENSP00000373825:L221H;ENSP00000082259:L221H	ENSP00000082259:L221H	L	+	2	0	DNAH2	7578259	1.000000	0.71417	0.999000	0.59377	0.959000	0.62525	6.690000	0.74567	2.004000	0.58718	0.374000	0.22700	CTC	.	.		0.532	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
TAF15	8148	hgsc.bcm.edu	37	17	34171663	34171663	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:34171663G>A	ENST00000588240.1	+	15	1475	c.1360G>A	c.(1360-1362)Ggc>Agc	p.G454S	TAF15_ENST00000592237.1_Intron|TAF15_ENST00000311979.3_Missense_Mutation_p.G451S	NM_003487.3|NM_139215.2	NP_003478.1|NP_631961.1	Q16514	TAF12_HUMAN	TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa	0					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of RNA biosynthetic process (GO:2001141)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)		TAF15/NR4A3(33)	lung(1)|ovary(1)|skin(2)|stomach(1)	5		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0193)		aagtgggggtggctatggtgg	0.622			T	"""TEC, CHN1, ZNF384"""	"""extraskeletal myxoid chondrosarcomas, ALL"""																																p.G454S		Atlas-SNP	.		Dom	yes		17	17q11.1-q11.2	8148	"""TAF15 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 68kDa"""		"""L, M"""	.	TAF15	46	.	0			c.G1360A						.						20.0	21.0	20.0					17																	34171663		2200	4297	6497	SO:0001583	missense	8148	exon15			GGGGGTGGCTATG	U51334	CCDS32623.1, CCDS59279.1	17q11.1-q11.2	2013-02-12	2002-08-29	2001-12-07		ENSG00000270647		"""RNA binding motif (RRM) containing"""	11547	protein-coding gene	gene with protein product		601574	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, N, 68kD (RNA-binding protein 56)"""	TAF2N		8954779, 9795213	Standard	NM_003487		Approved	hTAFII68, RBP56, Npl3	uc002hkd.4	Q92804		ENST00000588240.1:c.1360G>A	chr17.hg19:g.34171663G>A	ENSP00000466950:p.Gly454Ser	89.0	0.0		72.0	23.0	NM_139215	D3DPM5|Q15775|Q5T077	Missense_Mutation	SNP	ENST00000588240.1	hg19	CCDS32623.1	.	.	.	.	.	.	.	.	.	.	G	15.62	2.887249	0.52014	.	.	ENSG00000172660	ENST00000311979;ENST00000536077	D	0.94280	-3.39	5.06	4.09	0.47781	.	.	.	.	.	D	0.87334	0.6151	N	0.22421	0.69	0.27235	N	0.95928	B;B	0.09022	0.001;0.002	B;B	0.10450	0.002;0.005	T	0.80086	-0.1529	9	0.87932	D	0	-0.2947	7.8671	0.29543	0.1881:0.0:0.8119:0.0	.	454;451	Q92804;Q92804-2	RBP56_HUMAN;.	S	454;257	ENSP00000309558:G454S	ENSP00000309558:G454S	G	+	1	0	TAF15	31195776	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.402000	0.73260	1.152000	0.42452	0.585000	0.79938	GGC	.	.		0.622	TAF15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000449134.1	NM_139215	
KRT10	3858	hgsc.bcm.edu	37	17	38975889	38975889	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:38975889A>T	ENST00000269576.5	-	6	1262	c.1253T>A	c.(1252-1254)tTg>tAg	p.L418*	TMEM99_ENST00000301665.3_Intron|TMEM99_ENST00000496847.1_Intron	NM_000421.3	NP_000412	P13645	K1C10_HUMAN	keratin 10	418	Coil 2.|Gly-rich.|Rod.				cellular response to calcium ion (GO:0071277)|keratinocyte differentiation (GO:0030216)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of epidermis (GO:0030280)			NS(2)|kidney(1)|large_intestine(3)|lung(4)|prostate(1)	11		Breast(137;0.000301)				AATCTGTTGCAACTGTTCTTC	0.483																																					p.L418X		Atlas-SNP	.											.	KRT10	56	.	0			c.T1253A						.						128.0	123.0	124.0					17																	38975889		2203	4300	6503	SO:0001587	stop_gained	3858	exon6			TGTTGCAACTGTT	J04029	CCDS11377.1	17q21.2	2013-06-20	2008-08-01		ENSG00000186395	ENSG00000186395		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6413	protein-coding gene	gene with protein product	"""cytokeratin 10"", ""epidermolytic hyperkeratosis"""	148080	"""keratosis palmaris et plantaris"""	KPP		2461420, 16831889	Standard	NM_000421		Approved	K10, CK10	uc002hvi.3	P13645	OTTHUMG00000133368	ENST00000269576.5:c.1253T>A	chr17.hg19:g.38975889A>T	ENSP00000269576:p.Leu418*	152.0	0.0		136.0	59.0	NM_000421	Q14664|Q8N175	Nonsense_Mutation	SNP	ENST00000269576.5	hg19	CCDS11377.1	.	.	.	.	.	.	.	.	.	.	A	38	6.680169	0.97755	.	.	ENSG00000186395	ENST00000269576	.	.	.	5.6	5.6	0.85130	.	0.000000	0.29080	N	0.013219	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7953	0.78404	1.0:0.0:0.0:0.0	.	.	.	.	X	418	.	ENSP00000269576:L418X	L	-	2	0	KRT10	36229415	0.992000	0.36948	0.999000	0.59377	0.888000	0.51559	8.907000	0.92634	2.151000	0.67156	0.533000	0.62120	TTG	.	.		0.483	KRT10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257875.1	NM_000421	
KIF2B	84643	hgsc.bcm.edu	37	17	51901119	51901119	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:51901119A>T	ENST00000268919.4	+	1	881	c.725A>T	c.(724-726)aAt>aTt	p.N242I		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	242	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CCCTCGGACAATGTGGTTATG	0.547																																					p.N242I		Atlas-SNP	.											.	KIF2B	254	.	0			c.A725T						.						124.0	102.0	109.0					17																	51901119		2203	4300	6503	SO:0001583	missense	84643	exon1			CGGACAATGTGGT	AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.725A>T	chr17.hg19:g.51901119A>T	ENSP00000268919:p.Asn242Ile	146.0	0.0		104.0	32.0	NM_032559	Q96MA2|Q9BXG6	Missense_Mutation	SNP	ENST00000268919.4	hg19	CCDS32685.1	.	.	.	.	.	.	.	.	.	.	A	16.48	3.136156	0.56936	.	.	ENSG00000141200	ENST00000268919	T	0.18960	2.18	5.63	4.56	0.56223	Kinesin, motor domain (4);	0.285603	0.26485	N	0.024105	T	0.26231	0.0640	M	0.74647	2.275	0.20764	N	0.999851	B	0.18461	0.028	B	0.25759	0.063	T	0.19484	-1.0304	10	0.46703	T	0.11	.	9.6414	0.39842	0.8542:0.0:0.1458:0.0	.	242	Q8N4N8	KIF2B_HUMAN	I	242	ENSP00000268919:N242I	ENSP00000268919:N242I	N	+	2	0	KIF2B	49256118	0.489000	0.26004	0.022000	0.16811	0.955000	0.61496	2.078000	0.41567	1.072000	0.40860	0.533000	0.62120	AAT	.	.		0.547	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000438854.1	NM_032559	
CARD14	79092	hgsc.bcm.edu	37	17	78176201	78176201	+	Missense_Mutation	SNP	C	C	G	rs371296759		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:78176201C>G	ENST00000573882.1	+	17	2737	c.2201C>G	c.(2200-2202)aCc>aGc	p.T734S	RP11-334C17.5_ENST00000572730.1_RNA|RP11-334C17.5_ENST00000573935.1_RNA|CARD14_ENST00000570421.1_Missense_Mutation_p.T734S|RP11-334C17.5_ENST00000570309.1_RNA|RP11-334C17.5_ENST00000576824.1_RNA|RP11-334C17.5_ENST00000573346.1_RNA|CARD14_ENST00000392434.2_3'UTR|CARD14_ENST00000344227.2_Missense_Mutation_p.T734S			Q9BXL6	CAR14_HUMAN	caspase recruitment domain family, member 14	734					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)			NS(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(5)|prostate(1)|skin(1)	23	all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.017)|BRCA - Breast invasive adenocarcinoma(99;0.0908)			GCGCACGGCACCATCCCCAAC	0.647																																					p.T734S		Atlas-SNP	.											.	CARD14	98	.	0			c.C2201G						.						47.0	37.0	40.0					17																	78176201		2203	4300	6503	SO:0001583	missense	79092	exon15			ACGGCACCATCCC	AF322642	CCDS11768.1, CCDS58605.1	17q25.3	2014-09-04			ENSG00000141527	ENSG00000141527			16446	protein-coding gene	gene with protein product		607211	"""psoriasis susceptibility 2"""	PSORS2		11278692, 11356195, 22521418	Standard	NM_052819		Approved	CARMA2, BIMP2	uc031res.1	Q9BXL6	OTTHUMG00000177549	ENST00000573882.1:c.2201C>G	chr17.hg19:g.78176201C>G	ENSP00000458715:p.Thr734Ser	63.0	0.0		59.0	12.0	NM_024110	B8QQJ3|Q9BVB5	Missense_Mutation	SNP	ENST00000573882.1	hg19	CCDS11768.1	.	.	.	.	.	.	.	.	.	.	C	10.25	1.298728	0.23650	.	.	ENSG00000141527	ENST00000344227	T	0.04706	3.57	4.64	3.66	0.41972	.	0.368348	0.29830	N	0.011087	T	0.07052	0.0179	M	0.71581	2.175	0.80722	D	1	B	0.30406	0.278	B	0.27887	0.084	T	0.09707	-1.0662	10	0.62326	D	0.03	-21.8755	7.6124	0.28137	0.0:0.7401:0.1685:0.0914	.	734	Q9BXL6	CAR14_HUMAN	S	734	ENSP00000344549:T734S	ENSP00000344549:T734S	T	+	2	0	CARD14	75790796	0.997000	0.39634	0.981000	0.43875	0.263000	0.26337	1.851000	0.39338	0.920000	0.36970	0.462000	0.41574	ACC	.	.		0.647	CARD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000437507.1		
C17orf70	80233	hgsc.bcm.edu	37	17	79514592	79514592	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr17:79514592T>C	ENST00000327787.8	-	5	1562	c.1516A>G	c.(1516-1518)Atc>Gtc	p.I506V	C17orf70_ENST00000425898.2_Missense_Mutation_p.I155V|C17orf70_ENST00000537152.1_Missense_Mutation_p.I355V			Q0VG06	FP100_HUMAN	chromosome 17 open reading frame 70	506					DNA repair (GO:0006281)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|intermediate filament cytoskeleton (GO:0045111)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	19	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GTGCAGGAGATGGGTCTGGGG	0.612																																					p.I506V		Atlas-SNP	.											.	C17orf70	79	.	0			c.A1516G						.						99.0	89.0	92.0					17																	79514592		2203	4300	6503	SO:0001583	missense	80233	exon5			AGGAGATGGGTCT	BC008883	CCDS32765.1, CCDS32765.2	17q25.3	2012-05-30			ENSG00000185504	ENSG00000185504			26171	protein-coding gene	gene with protein product	"""Fanconi anemia-associated protein, 100kDa"""	611301				17396147	Standard	NM_025161		Approved	FLJ22175, FAAP100	uc002kaq.3	Q0VG06	OTTHUMG00000167764	ENST00000327787.8:c.1516A>G	chr17.hg19:g.79514592T>C	ENSP00000333283:p.Ile506Val	57.0	0.0		54.0	14.0	NM_025161	A6NNM1|Q8N3F7|Q9BV13|Q9H6K7|Q9H7E8	Missense_Mutation	SNP	ENST00000327787.8	hg19	CCDS32765.2	.	.	.	.	.	.	.	.	.	.	T	7.517	0.655955	0.14580	.	.	ENSG00000185504	ENST00000327787;ENST00000425898;ENST00000537152	T;T;T	0.34859	1.34;1.34;1.34	4.24	0.824	0.18818	.	0.161496	0.41712	N	0.000827	T	0.27629	0.0679	L	0.49640	1.575	0.36352	D	0.860178	B;B	0.27316	0.006;0.175	B;B	0.26969	0.028;0.075	T	0.11991	-1.0565	10	0.33940	T	0.23	.	7.4203	0.27067	0.0:0.3853:0.0:0.6147	.	506;155	Q0VG06;E7EVV8	FP100_HUMAN;.	V	506;155;355	ENSP00000333283:I506V;ENSP00000399674:I155V;ENSP00000440151:I355V	ENSP00000333283:I506V	I	-	1	0	C17orf70	77125045	0.998000	0.40836	0.319000	0.25293	0.483000	0.33249	0.478000	0.22212	-0.046000	0.13446	0.379000	0.24179	ATC	.	.		0.612	C17orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396170.1	NM_025161	
MOCOS	55034	hgsc.bcm.edu	37	18	33779681	33779681	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr18:33779681A>T	ENST00000261326.5	+	4	356	c.335A>T	c.(334-336)tAc>tTc	p.Y112F		NM_017947.2	NP_060417.2			molybdenum cofactor sulfurase											breast(2)|endometrium(5)|kidney(1)|large_intestine(10)|liver(1)|lung(15)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						GCAGAAGACTACACTGTGATC	0.602																																					p.Y112F		Atlas-SNP	.											.	MOCOS	84	.	0			c.A335T						.						76.0	73.0	74.0					18																	33779681		2203	4300	6503	SO:0001583	missense	55034	exon4			AAGACTACACTGT	AK000740	CCDS11919.1	18q12	2003-12-18			ENSG00000075643	ENSG00000075643			18234	protein-coding gene	gene with protein product		613274				11302742	Standard	NM_017947		Approved	HMCS, FLJ20733, MOS	uc002kzq.4	Q96EN8	OTTHUMG00000132590	ENST00000261326.5:c.335A>T	chr18.hg19:g.33779681A>T	ENSP00000261326:p.Tyr112Phe	90.0	0.0		79.0	31.0	NM_017947		Missense_Mutation	SNP	ENST00000261326.5	hg19	CCDS11919.1	.	.	.	.	.	.	.	.	.	.	A	18.88	3.718169	0.68844	.	.	ENSG00000075643	ENST00000261326	D	0.87029	-2.2	5.38	5.38	0.77491	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);Aminotransferase, class V/Cysteine desulfurase (1);	0.000000	0.85682	D	0.000000	D	0.91043	0.7182	L	0.58925	1.835	0.49582	D	0.999803	D	0.76494	0.999	D	0.70935	0.971	D	0.89846	0.4006	10	0.33940	T	0.23	-21.3111	13.6318	0.62200	1.0:0.0:0.0:0.0	.	112	Q96EN8	MOCOS_HUMAN	F	112	ENSP00000261326:Y112F	ENSP00000261326:Y112F	Y	+	2	0	MOCOS	32033679	1.000000	0.71417	0.993000	0.49108	0.215000	0.24574	9.142000	0.94618	2.176000	0.68965	0.383000	0.25322	TAC	.	.		0.602	MOCOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255801.1		
MC4R	4160	hgsc.bcm.edu	37	18	58038792	58038792	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr18:58038792T>A	ENST00000299766.3	-	1	1209	c.791A>T	c.(790-792)cAc>cTc	p.H264L		NM_005912.2	NP_005903.2	P32245	MC4R_HUMAN	melanocortin 4 receptor	264					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|diet induced thermogenesis (GO:0002024)|energy reserve metabolic process (GO:0006112)|feeding behavior (GO:0007631)|insulin secretion (GO:0030073)|negative regulation of feeding behavior (GO:2000252)|positive regulation of bone resorption (GO:0045780)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of grooming behavior (GO:2000821)|response to insulin (GO:0032868)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	17		Colorectal(73;0.0946)				GAATATTAAGTGGAGGAAGAA	0.448																																					p.H264L		Atlas-SNP	.											.	MC4R	49	.	0			c.A791T						.						100.0	90.0	94.0					18																	58038792		2203	4300	6503	SO:0001583	missense	4160	exon1			ATTAAGTGGAGGA	AY236539	CCDS11976.1	18q22	2012-08-10			ENSG00000166603	ENSG00000166603		"""GPCR / Class A : Melanocortin receptors"""	6932	protein-coding gene	gene with protein product		155541				7949735, 9763669	Standard	NM_005912		Approved		uc002lie.1	P32245	OTTHUMG00000132766	ENST00000299766.3:c.791A>T	chr18.hg19:g.58038792T>A	ENSP00000299766:p.His264Leu	132.0	0.0		167.0	69.0	NM_005912	B2RAC3|Q16317|Q3MIJ6	Missense_Mutation	SNP	ENST00000299766.3	hg19	CCDS11976.1	.	.	.	.	.	.	.	.	.	.	T	22.1	4.245346	0.80024	.	.	ENSG00000166603	ENST00000299766	T	0.69175	-0.38	5.85	5.85	0.93711	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.78941	0.4363	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80854	-0.1196	10	0.87932	D	0	.	14.1876	0.65617	0.0:0.0:0.0:1.0	.	264	P32245	MC4R_HUMAN	L	264	ENSP00000299766:H264L	ENSP00000299766:H264L	H	-	2	0	MC4R	56189772	1.000000	0.71417	0.911000	0.35937	0.957000	0.61999	8.040000	0.89188	2.238000	0.73509	0.533000	0.62120	CAC	.	.		0.448	MC4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256139.1	NM_005912	
MED16	10025	hgsc.bcm.edu	37	19	868161	868161	+	Silent	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:868161T>A	ENST00000589119.1	-	15	2573	c.2574A>T	c.(2572-2574)acA>acT	p.T858T	MED16_ENST00000395808.3_3'UTR|MED16_ENST00000269814.4_3'UTR|MED16_ENST00000325464.1_Silent_p.T858T|MED16_ENST00000312090.6_3'UTR			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	858					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GAGAGTGGTGTGTGGACTGCG	0.687																																					p.T858T		Atlas-SNP	.											.	MED16	61	.	0			c.A2574T						.						40.0	38.0	39.0					19																	868161		2196	4297	6493	SO:0001819	synonymous_variant	10025	exon16			GTGGTGTGTGGAC	AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.2574A>T	chr19.hg19:g.868161T>A		61.0	0.0		39.0	14.0	NM_005481	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Silent	SNP	ENST00000589119.1	hg19	CCDS12047.1																																																																																			.	.		0.687	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457902.3	NM_005481	
MUC16	94025	hgsc.bcm.edu	37	19	9049962	9049962	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:9049962T>A	ENST00000397910.4	-	5	31872	c.31669A>T	c.(31669-31671)Acc>Tcc	p.T10557S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10559	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACAGATGGGGTTGTCCTGGGA	0.488																																					p.T10557S		Atlas-SNP	.											.	MUC16	4315	.	0			c.A31669T						.						223.0	204.0	210.0					19																	9049962		1933	4131	6064	SO:0001583	missense	94025	exon5			ATGGGGTTGTCCT	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31669A>T	chr19.hg19:g.9049962T>A	ENSP00000381008:p.Thr10557Ser	170.0	0.0		199.0	78.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	t	8.565	0.878694	0.17395	.	.	ENSG00000181143	ENST00000397910	T	0.02369	4.32	3.08	2.03	0.26663	.	.	.	.	.	T	0.02888	0.0086	L	0.52573	1.65	.	.	.	P	0.36282	0.546	B	0.28784	0.094	T	0.26430	-1.0103	8	0.87932	D	0	.	5.285	0.15696	0.0:0.1368:0.0:0.8632	.	10557	B5ME49	.	S	10557	ENSP00000381008:T10557S	ENSP00000381008:T10557S	T	-	1	0	MUC16	8910962	0.021000	0.18746	0.018000	0.16275	0.073000	0.16967	0.387000	0.20718	0.537000	0.28751	0.248000	0.18094	ACC	.	.		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
MUC16	94025	hgsc.bcm.edu	37	19	9049967	9049967	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:9049967C>A	ENST00000397910.4	-	5	31867	c.31664G>T	c.(31663-31665)aGg>aTg	p.R10555M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10557	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGGGGTTGTCCTGGGAAGAGC	0.483																																					p.R10555M		Atlas-SNP	.											.	MUC16	4315	.	0			c.G31664T						.						230.0	210.0	216.0					19																	9049967		1932	4135	6067	SO:0001583	missense	94025	exon5			GTTGTCCTGGGAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.31664G>T	chr19.hg19:g.9049967C>A	ENSP00000381008:p.Arg10555Met	174.0	0.0		197.0	74.0	NM_024690	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	ENST00000397910.4	hg19	CCDS54212.1	.	.	.	.	.	.	.	.	.	.	c	6.633	0.485205	0.12641	.	.	ENSG00000181143	ENST00000397910	T	0.02974	4.09	3.08	-1.69	0.08186	.	.	.	.	.	T	0.02083	0.0065	L	0.27053	0.805	.	.	.	P	0.37573	0.6	B	0.36885	0.235	T	0.42207	-0.9465	8	0.87932	D	0	.	2.75	0.05277	0.2197:0.3987:0.0:0.3816	.	10555	B5ME49	.	M	10555	ENSP00000381008:R10555M	ENSP00000381008:R10555M	R	-	2	0	MUC16	8910967	0.000000	0.05858	0.012000	0.15200	0.062000	0.15995	-0.334000	0.07883	-0.257000	0.09459	0.298000	0.19748	AGG	.	.		0.483	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
ICAM1	3383	hgsc.bcm.edu	37	19	10395559	10395559	+	Silent	SNP	C	C	T	rs556280231		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:10395559C>T	ENST00000264832.3	+	6	1606	c.1281C>T	c.(1279-1281)ccC>ccT	p.P427P	ICAM4_ENST00000393717.2_5'Flank|CTD-2369P2.8_ENST00000589379.1_RNA|ICAM1_ENST00000423829.2_Silent_p.P205P|CTD-2369P2.5_ENST00000592893.1_RNA|ICAM4_ENST00000380770.3_5'Flank|ICAM4_ENST00000340992.4_5'Flank	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	427	Ig-like C2-type 5.				adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	ACCCATTGCCCGAGCTCAAGT	0.582													C|||	1	0.000199681	0.0008	0.0	5008	,	,		18051	0.0		0.0	False		,,,				2504	0.0				p.P427P		Atlas-SNP	.											.	ICAM1	32	.	0			c.C1281T						.						52.0	53.0	53.0					19																	10395559		2203	4300	6503	SO:0001819	synonymous_variant	3383	exon6			ATTGCCCGAGCTC		CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.1281C>T	chr19.hg19:g.10395559C>T		107.0	0.0		90.0	25.0	NM_000201	B2R6M3|Q5NKV7|Q96B50	Silent	SNP	ENST00000264832.3	hg19	CCDS12231.1																																																																																			.	.		0.582	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000451207.1		
ZNF681	148213	hgsc.bcm.edu	37	19	23927688	23927688	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:23927688C>A	ENST00000402377.3	-	4	805	c.664G>T	c.(664-666)Gga>Tga	p.G222*	ZNF681_ENST00000395385.3_Nonsense_Mutation_p.G153*	NM_138286.2	NP_612143.2	Q96N22	ZN681_HUMAN	zinc finger protein 681	222					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(10)|prostate(1)|skin(1)|urinary_tract(3)	21		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				GATTTCTCTCCAATATGAATT	0.308																																					p.G222X		Atlas-SNP	.											.	ZNF681	76	.	0			c.G664T						.						43.0	43.0	43.0					19																	23927688		2203	4299	6502	SO:0001587	stop_gained	148213	exon4			TCTCTCCAATATG	AK056088	CCDS12414.2	19p12	2013-01-08			ENSG00000196172	ENSG00000196172		"""Zinc fingers, C2H2-type"", ""-"""	26457	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31526"""						Standard	NM_138286		Approved	FLJ31526	uc002nrk.4	Q96N22	OTTHUMG00000150831	ENST00000402377.3:c.664G>T	chr19.hg19:g.23927688C>A	ENSP00000384000:p.Gly222*	64.0	0.0		61.0	20.0	NM_138286	B3KVF7	Nonsense_Mutation	SNP	ENST00000402377.3	hg19	CCDS12414.2	.	.	.	.	.	.	.	.	.	.	.	9.979	1.227542	0.22542	.	.	ENSG00000196172	ENST00000402377;ENST00000395385	.	.	.	1.62	1.62	0.23740	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.7414	0.34560	0.0:1.0:0.0:0.0	.	.	.	.	X	222;153	.	ENSP00000378783:G153X	G	-	1	0	ZNF681	23719528	0.007000	0.16637	0.004000	0.12327	0.003000	0.03518	2.402000	0.44521	0.870000	0.35726	0.453000	0.30009	GGA	.	.		0.308	ZNF681-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000320248.2	NM_138286	
DMKN	93099	hgsc.bcm.edu	37	19	35993746	35993746	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:35993746T>A	ENST00000339686.3	-	10	1353	c.1177A>T	c.(1177-1179)Agc>Tgc	p.S393C	DMKN_ENST00000408915.2_5'Flank|DMKN_ENST00000472252.2_Missense_Mutation_p.S40C|DMKN_ENST00000602781.1_Missense_Mutation_p.S106C|DMKN_ENST00000429837.1_Missense_Mutation_p.S352C|DMKN_ENST00000467637.1_Missense_Mutation_p.S118C|DMKN_ENST00000443640.1_Missense_Mutation_p.S156C|DMKN_ENST00000492341.2_Missense_Mutation_p.S40C|DMKN_ENST00000480502.1_Intron|DMKN_ENST00000436012.1_Missense_Mutation_p.S89C|DMKN_ENST00000462126.1_5'UTR|DMKN_ENST00000419602.1_Missense_Mutation_p.S382C|DMKN_ENST00000402589.2_Missense_Mutation_p.S106C|DMKN_ENST00000414866.2_Missense_Mutation_p.S106C	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	393						extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CAGAGTCGGCTGAAGTAGAGG	0.637																																					p.S393C		Atlas-SNP	.											.	DMKN	116	.	0			c.A1177T						.						33.0	37.0	36.0					19																	35993746		2203	4300	6503	SO:0001583	missense	93099	exon10			GTCGGCTGAAGTA	BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.1177A>T	chr19.hg19:g.35993746T>A	ENSP00000342012:p.Ser393Cys	143.0	0.0		140.0	44.0	NM_033317	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	ENST00000339686.3	hg19	CCDS12463.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	16.94|16.94	3.259441|3.259441	0.59321|0.59321	.|.	.|.	ENSG00000161249|ENSG00000161249	ENST00000434389|ENST00000402589;ENST00000339686;ENST00000436012;ENST00000414866;ENST00000429837;ENST00000419602;ENST00000443640	.|T;T;T;T;T;T;T	.|0.34859	.|1.34;1.34;1.34;1.34;1.34;1.34;1.34	5.85|5.85	1.1|1.1	0.20463|0.20463	.|.	.|0.869080	.|0.09885	.|N	.|0.743095	T|T	0.52175|0.52175	0.1718|0.1718	L|L	0.59436|0.59436	1.845|1.845	0.80722|0.80722	D|D	1|1	.|B;B;D;B;B;B;D;D;B;B;B	.|0.76494	.|0.063;0.023;0.997;0.006;0.01;0.01;0.999;0.999;0.063;0.01;0.023	.|B;B;P;B;B;B;D;D;B;B;B	.|0.72075	.|0.026;0.015;0.847;0.007;0.01;0.01;0.912;0.976;0.026;0.01;0.015	T|T	0.47761|0.47761	-0.9092|-0.9092	5|10	.|0.62326	.|D	.|0.03	-0.3348|-0.3348	8.3368|8.3368	0.32219|0.32219	0.1139:0.0:0.55:0.3361|0.1139:0.0:0.55:0.3361	.|.	.|89;40;49;49;69;87;382;352;393;106;156	.|B4E3D1;B7ZB10;Q6E0U4-12;Q6E0U4-11;Q6E0U4-10;Q6E0U4-9;C9J4P6;Q6E0U4-4;Q6E0U4;Q6E0U4-8;C9IYI1	.|.;.;.;.;.;.;.;.;DMKN_HUMAN;.;.	L|C	103|106;393;89;106;352;382;156	.|ENSP00000384509:S106C;ENSP00000342012:S393C;ENSP00000412075:S89C;ENSP00000392222:S106C;ENSP00000405503:S352C;ENSP00000391036:S382C;ENSP00000406864:S156C	.|ENSP00000342012:S393C	Q|S	-|-	2|1	0|0	DMKN|DMKN	40685586|40685586	0.941000|0.941000	0.31946|0.31946	0.803000|0.803000	0.32268|0.32268	0.870000|0.870000	0.49936|0.49936	0.633000|0.633000	0.24598|0.24598	0.184000|0.184000	0.20083|0.20083	-0.619000|-0.619000	0.04042|0.04042	CAG|AGC	.	.		0.637	DMKN-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000109461.2	NM_033317	
B9D2	80776	hgsc.bcm.edu	37	19	41860749	41860749	+	Silent	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:41860749C>A	ENST00000243578.3	-	4	603	c.384G>T	c.(382-384)gtG>gtT	p.V128V	TGFB1_ENST00000221930.5_5'Flank|TMEM91_ENST00000604123.1_Intron|TMEM91_ENST00000539627.1_Intron|CTC-435M10.3_ENST00000604424.1_Intron	NM_030578.3	NP_085055.2	Q9BPU9	B9D2_HUMAN	B9 protein domain 2	128					cilium assembly (GO:0042384)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|TCTN-B9D complex (GO:0036038)	gamma-tubulin binding (GO:0043015)			large_intestine(1)|ovary(1)	2						GCCCACCACCCACGAAAGCCC	0.672																																					p.V128V		Atlas-SNP	.											.	B9D2	9	.	0			c.G384T						.						61.0	55.0	57.0					19																	41860749		2203	4299	6502	SO:0001819	synonymous_variant	80776	exon4			ACCACCCACGAAA	BC004157	CCDS12579.1	19q13.2	2014-01-28				ENSG00000123810			28636	protein-coding gene	gene with protein product		611951				21763481	Standard	NM_030578		Approved	MGC4093, MKS10	uc002oqj.2	Q9BPU9		ENST00000243578.3:c.384G>T	chr19.hg19:g.41860749C>A		100.0	0.0		99.0	30.0	NM_030578		Silent	SNP	ENST00000243578.3	hg19	CCDS12579.1																																																																																			.	.		0.672	B9D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463489.1	NM_030578	
IL4I1	259307	hgsc.bcm.edu	37	19	50393835	50393835	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:50393835A>T	ENST00000391826.2	-	8	938	c.796T>A	c.(796-798)Tgg>Agg	p.W266R	MIR4750_ENST00000584564.1_RNA|IL4I1_ENST00000341114.3_Missense_Mutation_p.W288R|IL4I1_ENST00000595948.1_Missense_Mutation_p.W288R	NM_152899.1	NP_690863.1	Q96RQ9	OXLA_HUMAN	interleukin 4 induced 1	266						extracellular region (GO:0005576)|lysosome (GO:0005764)	L-amino-acid oxidase activity (GO:0001716)			endometrium(3)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	16		all_lung(116;1.47e-05)|all_neural(266;0.0459)|Ovarian(192;0.0481)		GBM - Glioblastoma multiforme(134;0.00245)|OV - Ovarian serous cystadenocarcinoma(262;0.0169)	Flavin adenine dinucleotide(DB03147)	AGCAGGTCCCAGCCACCCACG	0.736																																					p.W288R		Atlas-SNP	.											.	IL4I1	50	.	0			c.T862A						.						7.0	8.0	8.0					19																	50393835		2171	4242	6413	SO:0001583	missense	259307	exon10			GGTCCCAGCCACC	AF293462	CCDS12786.1, CCDS12787.1	19q13.3-q13.4	2014-06-26				ENSG00000104951			19094	protein-coding gene	gene with protein product		609742				12031486	Standard	NM_152899		Approved	FIG1	uc002pqt.1	Q96RQ9		ENST00000391826.2:c.796T>A	chr19.hg19:g.50393835A>T	ENSP00000375702:p.Trp266Arg	35.0	0.0		30.0	11.0	NM_172374	Q1WMJ3|Q4GZN1|Q4GZN2|Q6P2Q3|Q8TEM5|Q96RQ8	Missense_Mutation	SNP	ENST00000391826.2	hg19	CCDS12787.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.107392	0.77096	.	.	ENSG00000104951	ENST00000341114;ENST00000391826	T;T	0.09255	3.0;3.0	4.24	4.24	0.50183	Amine oxidase (1);	0.543501	0.19465	N	0.113611	T	0.19525	0.0469	L	0.57536	1.79	0.33508	D	0.590823	D;D;D	0.55172	0.962;0.97;0.97	P;P;P	0.53450	0.605;0.726;0.726	T	0.20207	-1.0282	10	0.51188	T	0.08	-12.6054	9.634	0.39795	1.0:0.0:0.0:0.0	.	288;288;266	Q96RQ9-2;Q1WMJ3;Q96RQ9	.;.;OXLA_HUMAN	R	288;266	ENSP00000342557:W288R;ENSP00000375702:W266R	ENSP00000342557:W288R	W	-	1	0	IL4I1	55085647	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.360000	0.34125	1.787000	0.52448	0.358000	0.22013	TGG	.	.		0.736	IL4I1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466413.1		
PRKCG	5582	hgsc.bcm.edu	37	19	54409615	54409615	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:54409615T>A	ENST00000263431.3	+	17	2091	c.1809T>A	c.(1807-1809)gaT>gaA	p.D603E	PRKCG_ENST00000542049.1_Missense_Mutation_p.D454E|PRKCG_ENST00000540413.1_Missense_Mutation_p.D603E|CACNG7_ENST00000391767.1_5'Flank	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	603	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	CAGGGCCTGATGGGGAACCTA	0.592																																					p.D603E		Atlas-SNP	.											.	PRKCG	246	.	0			c.T1809A						.						50.0	38.0	42.0					19																	54409615		2182	4251	6433	SO:0001583	missense	5582	exon17			GCCTGATGGGGAA	M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1809T>A	chr19.hg19:g.54409615T>A	ENSP00000263431:p.Asp603Glu	79.0	0.0		76.0	26.0	NM_002739	B7Z8Q0	Missense_Mutation	SNP	ENST00000263431.3	hg19	CCDS12867.1	.	.	.	.	.	.	.	.	.	.	T	6.192	0.403597	0.11754	.	.	ENSG00000126583	ENST00000540413;ENST00000263431;ENST00000542049	T;T;T	0.52983	0.64;0.64;1.87	3.89	-1.34	0.09143	Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.21227	0.0511	N	0.12746	0.255	0.36304	D	0.857192	B;B;B	0.12630	0.006;0.0;0.0	B;B;B	0.15870	0.014;0.0;0.0	T	0.41998	-0.9477	9	0.02654	T	1	.	8.5494	0.33442	0.0:0.475:0.0:0.525	.	454;603;603	B7Z8Q0;F5H5C4;P05129	.;.;KPCG_HUMAN	E	603;603;454	ENSP00000443493:D603E;ENSP00000263431:D603E;ENSP00000438090:D454E	ENSP00000263431:D603E	D	+	3	2	PRKCG	59101427	0.000000	0.05858	0.963000	0.40424	0.986000	0.74619	-4.656000	0.00202	-0.469000	0.06911	0.454000	0.30748	GAT	.	.		0.592	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139233.3	NM_002739	
ZNF416	55659	hgsc.bcm.edu	37	19	58084830	58084830	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr19:58084830G>C	ENST00000196489.3	-	4	664	c.442C>G	c.(442-444)Ccc>Gcc	p.P148A		NM_017879.1	NP_060349.1	Q9BWM5	ZN416_HUMAN	zinc finger protein 416	148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|large_intestine(5)|lung(12)|prostate(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0259)		CTTTCCAAGGGTTTCTCTGCA	0.517																																					p.P148A		Atlas-SNP	.											.	ZNF416	50	.	0			c.C442G						.						103.0	87.0	92.0					19																	58084830		2203	4300	6503	SO:0001583	missense	55659	exon4			CCAAGGGTTTCTC	BC000130	CCDS12954.1	19q13.4	2013-01-08				ENSG00000083817		"""Zinc fingers, C2H2-type"", ""-"""	20645	protein-coding gene	gene with protein product							Standard	NM_017879		Approved	FLJ20557	uc002qpf.3	Q9BWM5		ENST00000196489.3:c.442C>G	chr19.hg19:g.58084830G>C	ENSP00000196489:p.Pro148Ala	113.0	0.0		114.0	44.0	NM_017879	Q9NWW8	Missense_Mutation	SNP	ENST00000196489.3	hg19	CCDS12954.1	.	.	.	.	.	.	.	.	.	.	G	0.052	-1.248520	0.01469	.	.	ENSG00000083817	ENST00000196489;ENST00000359489;ENST00000428052	T	0.07216	3.21	1.85	-3.69	0.04450	.	.	.	.	.	T	0.09069	0.0224	M	0.76938	2.355	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.37502	-0.9703	9	0.38643	T	0.18	.	2.7052	0.05160	0.4665:0.0:0.3164:0.2172	.	148	Q9BWM5	ZN416_HUMAN	A	148;134;128	ENSP00000196489:P148A	ENSP00000196489:P148A	P	-	1	0	ZNF416	62776642	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	0.272000	0.18644	-0.932000	0.03742	-1.087000	0.02190	CCC	.	.		0.517	ZNF416-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000466787.1	NM_017879	
ARFGEF2	10564	hgsc.bcm.edu	37	20	47602054	47602054	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr20:47602054G>C	ENST00000371917.4	+	16	2180	c.2180G>C	c.(2179-2181)cGg>cCg	p.R727P		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	727	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			TCAGCCCTGCGGACATTCCTA	0.473																																					p.R727P	Esophageal Squamous(176;1738 1974 26285 33069 35354)	Atlas-SNP	.											.	ARFGEF2	160	.	0			c.G2180C						.						115.0	100.0	105.0					20																	47602054		2203	4300	6503	SO:0001583	missense	10564	exon16			CCCTGCGGACATT	AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.2180G>C	chr20.hg19:g.47602054G>C	ENSP00000360985:p.Arg727Pro	198.0	0.0		178.0	71.0	NM_006420	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	ENST00000371917.4	hg19	CCDS13411.1	.	.	.	.	.	.	.	.	.	.	G	34	5.392717	0.96009	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.71817	-0.6	6.03	6.03	0.97812	SEC7-like, alpha orthogonal bundle (1);Armadillo-type fold (1);SEC7-like (4);	0.000000	0.85682	D	0.000000	D	0.92417	0.7593	H	0.99689	4.705	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95106	0.8234	10	0.87932	D	0	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	727	Q9Y6D5	BIG2_HUMAN	P	727	ENSP00000360985:R727P	ENSP00000360985:R727P	R	+	2	0	ARFGEF2	47035461	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.869000	0.99810	2.861000	0.98227	0.655000	0.94253	CGG	.	.		0.473	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079627.1	NM_006420	
CDH4	1002	hgsc.bcm.edu	37	20	60485571	60485571	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr20:60485571G>A	ENST00000360469.5	+	9	1370	c.1282G>A	c.(1282-1284)Gcc>Acc	p.A428T	CDH4_ENST00000543233.1_Missense_Mutation_p.A354T	NM_001794.3	NP_001785.2	P55283	CADH4_HUMAN	cadherin 4, type 1, R-cadherin (retinal)	428	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|liver(2)|lung(25)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74			BRCA - Breast invasive adenocarcinoma(19;2.36e-08)			AAACTGGAATGCCGTTTACCG	0.597																																					p.A428T		Atlas-SNP	.											.	CDH4	172	.	0			c.G1282A						.						128.0	96.0	107.0					20																	60485571		2203	4300	6503	SO:0001583	missense	1002	exon9			TGGAATGCCGTTT	L34059	CCDS13488.1, CCDS58784.1	20q13.3	2010-01-26			ENSG00000179242	ENSG00000179242		"""Cadherins / Major cadherins"""	1763	protein-coding gene	gene with protein product	"""R-Cadherin"""	603006				10191097, 10516427	Standard	NM_001794		Approved		uc002ybn.2	P55283	OTTHUMG00000032890	ENST00000360469.5:c.1282G>A	chr20.hg19:g.60485571G>A	ENSP00000353656:p.Ala428Thr	132.0	0.0		138.0	51.0	NM_001794	B3KWB8|G3V1P8|Q2M208|Q5VZ44|Q9BZ05	Missense_Mutation	SNP	ENST00000360469.5	hg19	CCDS13488.1	.	.	.	.	.	.	.	.	.	.	g	19.16	3.773754	0.69992	.	.	ENSG00000179242	ENST00000360469;ENST00000536643;ENST00000543233	T;T	0.54279	0.58;0.58	4.66	4.66	0.58398	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.72334	0.3447	M	0.73753	2.245	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.74390	-0.3681	9	.	.	.	.	17.1368	0.86742	0.0:0.0:1.0:0.0	.	428	P55283	CADH4_HUMAN	T	428;336;354	ENSP00000353656:A428T;ENSP00000443301:A354T	.	A	+	1	0	CDH4	59918966	1.000000	0.71417	0.442000	0.26870	0.153000	0.21895	9.189000	0.94928	2.145000	0.66743	0.556000	0.70494	GCC	.	.		0.597	CDH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079965.2	NM_001794	
OLIG2	10215	hgsc.bcm.edu	37	21	34400111	34400111	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr21:34400111G>T	ENST00000333337.3	+	1	1869	c.941G>T	c.(940-942)aGc>aTc	p.S314I	OLIG2_ENST00000382357.3_Missense_Mutation_p.S314I|AP000282.2_ENST00000420356.1_RNA|AP000282.2_ENST00000454622.1_RNA			Q13516	OLIG2_HUMAN	oligodendrocyte lineage transcription factor 2	314					myelination (GO:0042552)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|positive regulation of oligodendrocyte differentiation (GO:0048714)|spinal cord motor neuron differentiation (GO:0021522)|spinal cord oligodendrocyte cell fate specification (GO:0021530)|thalamus development (GO:0021794)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|central_nervous_system(2)	3						GGCGCCGGCAGCCTGCCGCGC	0.756			T	TRA@	T-ALL																																p.S314I		Atlas-SNP	.		Dom	yes		21	21q22.11	10215	oligodendrocyte lineage transcription factor 2 (BHLHB1)		L	.	OLIG2	22	.	0			c.G941T						.						1.0	1.0	1.0					21																	34400111		561	1185	1746	SO:0001583	missense	10215	exon2			CCGGCAGCCTGCC	U48250	CCDS13620.1	21q22.11	2013-05-21	2001-12-04	2001-12-07	ENSG00000205927	ENSG00000205927		"""Basic helix-loop-helix proteins"""	9398	protein-coding gene	gene with protein product	"""oligodendrocyte-specific bHLH transcription factor 2"", ""protein kinase C binding protein 2"", ""human protein kinase C-binding protein RACK17"", ""basic domain, helix-loop-helix protein, class B, 1"""	606386	"""protein kinase C binding protein 2"""	PRKCBP2, BHLHB1		11526205	Standard	NM_005806		Approved	RACK17, OLIGO2, bHLHe19	uc002yqx.2	Q13516	OTTHUMG00000065032	ENST00000333337.3:c.941G>T	chr21.hg19:g.34400111G>T	ENSP00000331040:p.Ser314Ile	16.0	0.0		22.0	6.0	NM_005806	B3KRF3|Q05BP9|Q49AL3|Q86X04|Q9NZ14	Missense_Mutation	SNP	ENST00000333337.3	hg19	CCDS13620.1	.	.	.	.	.	.	.	.	.	.	G	15.12	2.740437	0.49045	.	.	ENSG00000205927	ENST00000382357;ENST00000333337	T;T	0.70749	-0.51;-0.51	3.75	0.682	0.17992	.	0.301943	0.28778	U	0.014164	T	0.49304	0.1549	N	0.22421	0.69	0.30335	N	0.786272	B	0.15141	0.012	B	0.11329	0.006	T	0.41016	-0.9532	10	0.72032	D	0.01	.	3.1794	0.06579	0.1003:0.3381:0.4003:0.1613	.	314	Q13516	OLIG2_HUMAN	I	314	ENSP00000371794:S314I;ENSP00000331040:S314I	ENSP00000331040:S314I	S	+	2	0	OLIG2	33321981	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	0.600000	0.24104	-0.069000	0.12931	0.455000	0.32223	AGC	.	.		0.756	OLIG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139663.1	NM_005806	
IL10RB	3588	hgsc.bcm.edu	37	21	34655403	34655403	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr21:34655403A>G	ENST00000290200.2	+	5	611	c.503A>G	c.(502-504)cAa>cGa	p.Q168R	AP000295.9_ENST00000433395.2_Missense_Mutation_p.K296E	NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	168	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						TACTAGTTTCAAATTACTCCC	0.398																																					p.Q168R	Melanoma(67;315 1275 21667 21943 44564)	Atlas-SNP	.											.	IL10RB	37	.	0			c.A503G						.						115.0	105.0	108.0					21																	34655403		2203	4300	6503	SO:0001583	missense	3588	exon5			AGTTTCAAATTAC	U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.503A>G	chr21.hg19:g.34655403A>G	ENSP00000290200:p.Gln168Arg	95.0	0.0		89.0	38.0	NM_000628	Q9BUU4	Missense_Mutation	SNP	ENST00000290200.2	hg19	CCDS13623.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.91|10.91	1.484773|1.484773	0.26598|0.26598	.|.	.|.	ENSG00000249624|ENSG00000243646	ENST00000433395|ENST00000290200;ENST00000539894	.|T	.|0.28666	.|1.6	5.27|5.27	4.18|4.18	0.49190|0.49190	.|Fibronectin, type III (2);Interferon alpha/beta receptor, beta chain (1);Immunoglobulin-like fold (1);	.|0.626286	.|0.16259	.|N	.|0.222354	T|T	0.27900|0.27900	0.0687|0.0687	L|L	0.51422|0.51422	1.61|1.61	0.09310|0.09310	N|N	1|1	.|B;B;B;B	.|0.22746	.|0.074;0.035;0.035;0.035	.|B;B;B;B	.|0.27076	.|0.076;0.038;0.055;0.046	T|T	0.20706|0.20706	-1.0267|-1.0267	5|10	.|0.27082	.|T	.|0.32	-0.6922|-0.6922	8.8031|8.8031	0.34920|0.34920	0.7553:0.2447:0.0:0.0|0.7553:0.2447:0.0:0.0	.|.	.|170;168;168;168	.|Q6ZVU9;Q08334;B4DSX5;F5H766	.|.;I10R2_HUMAN;.;.	E|R	296|168	.|ENSP00000290200:Q168R	.|ENSP00000290200:Q168R	K|Q	+|+	1|2	0|0	AP000295.9|IL10RB	33577273|33577273	0.000000|0.000000	0.05858|0.05858	0.007000|0.007000	0.13788|0.13788	0.100000|0.100000	0.18952|0.18952	0.280000|0.280000	0.18790|0.18790	0.942000|0.942000	0.37525|0.37525	0.459000|0.459000	0.35465|0.35465	AAA|CAA	.	.		0.398	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000139831.3		
DYRK1A	1859	hgsc.bcm.edu	37	21	38877655	38877655	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr21:38877655C>T	ENST00000398960.2	+	9	1384	c.1309C>T	c.(1309-1311)Cga>Tga	p.R437*	DYRK1A_ENST00000455387.2_Nonsense_Mutation_p.R209*|DYRK1A_ENST00000451934.1_Nonsense_Mutation_p.R437*|DYRK1A_ENST00000398956.2_Nonsense_Mutation_p.R437*|DYRK1A_ENST00000321219.8_Nonsense_Mutation_p.R437*|DYRK1A_ENST00000338785.3_Nonsense_Mutation_p.R437*|DYRK1A_ENST00000339659.4_Nonsense_Mutation_p.R428*	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	437	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						ACCTGGTGGGCGACGTGCTGG	0.463																																					p.R437X	Melanoma(114;464 1602 31203 43785 45765)	Atlas-SNP	.											DYRK1A,caecum,carcinoma,0,1	DYRK1A	85	.	0			c.C1309T						.						87.0	83.0	84.0					21																	38877655		2203	4300	6503	SO:0001587	stop_gained	1859	exon9			GGTGGGCGACGTG	U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.1309C>T	chr21.hg19:g.38877655C>T	ENSP00000381932:p.Arg437*	135.0	0.0		85.0	34.0	NM_001396	O60769|Q92582|Q92810|Q9UNM5	Nonsense_Mutation	SNP	ENST00000398960.2	hg19	CCDS42925.1	.	.	.	.	.	.	.	.	.	.	C	50	17.038654	0.99878	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956;ENST00000455387	.	.	.	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	20.115	0.97926	0.0:1.0:0.0:0.0	.	.	.	.	X	437;428;437;437;437;437;209	.	ENSP00000319032:R437X	R	+	1	2	DYRK1A	37799525	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	7.757000	0.85209	2.761000	0.94854	0.650000	0.86243	CGA	.	.		0.463	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194804.1	NM_001396	
ITGB2	3689	hgsc.bcm.edu	37	21	46311901	46311901	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr21:46311901T>A	ENST00000397850.2	-	12	1687	c.1235A>T	c.(1234-1236)cAg>cTg	p.Q412L	ITGB2_ENST00000397854.3_Missense_Mutation_p.Q355L|ITGB2_ENST00000397852.1_Missense_Mutation_p.Q412L|ITGB2_ENST00000302347.5_Missense_Mutation_p.Q412L|ITGB2_ENST00000355153.4_Missense_Mutation_p.Q412L|ITGB2_ENST00000397857.1_Missense_Mutation_p.Q412L			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	412					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GACCTTCACCTGGAAGGTGAT	0.647																																					p.Q412L		Atlas-SNP	.											.	ITGB2	107	.	0			c.A1235T						.						66.0	50.0	55.0					21																	46311901		2200	4300	6500	SO:0001583	missense	3689	exon11			TTCACCTGGAAGG	AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1235A>T	chr21.hg19:g.46311901T>A	ENSP00000380948:p.Gln412Leu	37.0	0.0		44.0	21.0	NM_000211	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	ENST00000397850.2	hg19	CCDS13716.1	.	.	.	.	.	.	.	.	.	.	T	11.35	1.613725	0.28712	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347;ENST00000545414	T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.54	3.17	0.36434	Integrin beta subunit, N-terminal (2);	.	.	.	.	T	0.57007	0.2024	L	0.58583	1.82	0.30247	N	0.79444	B;B	0.19445	0.036;0.007	B;B	0.10450	0.005;0.002	T	0.53143	-0.8480	9	0.46703	T	0.11	.	10.6348	0.45558	0.0:0.1485:0.0:0.8515	.	355;412	A8MYE6;P05107	.;ITB2_HUMAN	L	412;412;355;412;412;412;355	ENSP00000380950:Q412L;ENSP00000380955:Q412L;ENSP00000380952:Q355L;ENSP00000347279:Q412L;ENSP00000380948:Q412L;ENSP00000303242:Q412L	ENSP00000303242:Q412L	Q	-	2	0	ITGB2	45136329	0.956000	0.32656	1.000000	0.80357	0.849000	0.48306	0.085000	0.14912	0.077000	0.16863	-1.139000	0.01908	CAG	.	.		0.647	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206566.2	NM_000211	
RASD2	23551	hgsc.bcm.edu	37	22	35948024	35948024	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr22:35948024C>A	ENST00000216127.4	+	3	1388	c.746C>A	c.(745-747)gCc>gAc	p.A249D		NM_014310.3	NP_055125.2	Q96D21	RHES_HUMAN	RASD family, member 2	249					locomotory behavior (GO:0007626)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein sumoylation (GO:0033235)|regulation of cAMP-mediated signaling (GO:0043949)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission, dopaminergic (GO:0001963)	plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	13						TACATCAAGGCCAAGGTCCTT	0.647																																					p.A249D		Atlas-SNP	.											.	RASD2	34	.	0			c.C746A						.						56.0	54.0	55.0					22																	35948024		2203	4300	6503	SO:0001583	missense	23551	exon3			TCAAGGCCAAGGT	AF279143	CCDS13916.1	22q13.1	2014-05-09			ENSG00000100302	ENSG00000100302			18229	protein-coding gene	gene with protein product	"""tumor endothelial marker 2"", ""Ras homolog enriched in striatum"""	612842				10947988, 10467249, 14724584	Standard	NM_014310		Approved	TEM2, Rhes, MGC:4834	uc003anx.3	Q96D21	OTTHUMG00000150607	ENST00000216127.4:c.746C>A	chr22.hg19:g.35948024C>A	ENSP00000216127:p.Ala249Asp	21.0	0.0		21.0	8.0	NM_014310	O95520|Q5THY8	Missense_Mutation	SNP	ENST00000216127.4	hg19	CCDS13916.1	.	.	.	.	.	.	.	.	.	.	C	14.63	2.592338	0.46214	.	.	ENSG00000100302	ENST00000216127	T	0.70986	-0.53	5.68	5.68	0.88126	.	0.158364	0.56097	D	0.000032	T	0.61350	0.2340	N	0.24115	0.695	0.40944	D	0.984498	B	0.19935	0.04	B	0.23150	0.044	T	0.55095	-0.8194	10	0.30078	T	0.28	.	19.8575	0.96767	0.0:1.0:0.0:0.0	.	249	Q96D21	RHES_HUMAN	D	249	ENSP00000216127:A249D	ENSP00000216127:A249D	A	+	2	0	RASD2	34277970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.887000	0.69751	2.705000	0.92388	0.556000	0.70494	GCC	.	.		0.647	RASD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319063.1	NM_014310	
CACNA1I	8911	hgsc.bcm.edu	37	22	40069972	40069972	+	Silent	SNP	G	G	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr22:40069972G>T	ENST00000402142.3	+	29	4788	c.4788G>T	c.(4786-4788)ctG>ctT	p.L1596L	CACNA1I_ENST00000400164.3_Silent_p.L1561L|CACNA1I_ENST00000404898.1_Silent_p.L1561L|CACNA1I_ENST00000407673.1_Silent_p.L1561L|CACNA1I_ENST00000336649.4_Silent_p.L1602L|CACNA1I_ENST00000401624.1_Silent_p.L1596L	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	1596					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	CCGCAGTGCTGAAGCTGTTGA	0.622																																					p.L1596L		Atlas-SNP	.											.	CACNA1I	264	.	0			c.G4788T						.						49.0	54.0	53.0					22																	40069972		2108	4217	6325	SO:0001819	synonymous_variant	8911	exon29			AGTGCTGAAGCTG	AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.4788G>T	chr22.hg19:g.40069972G>T		50.0	0.0		39.0	10.0	NM_021096	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	ENST00000402142.3	hg19	CCDS46710.1																																																																																			.	.		0.622	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000321290.1	NM_001003406	
PRR5	55615	hgsc.bcm.edu	37	22	45132780	45132780	+	Missense_Mutation	SNP	G	G	T	rs376477477		TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr22:45132780G>T	ENST00000336985.6	+	8	1097	c.820G>T	c.(820-822)Ggc>Tgc	p.G274C	PRR5_ENST00000006251.7_Missense_Mutation_p.G265C|ARHGAP8_ENST00000389773.5_Intron|PRR5_ENST00000477331.1_3'UTR|PRR5-ARHGAP8_ENST00000352766.7_Intron|PRR5_ENST00000403581.1_Missense_Mutation_p.G297C|PRR5-ARHGAP8_ENST00000361473.5_Intron|ARHGAP8_ENST00000517296.3_Intron	NM_181333.3	NP_851850.1	P85299	PRR5_HUMAN	proline rich 5 (renal)	274					cell cycle (GO:0007049)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)	TORC2 complex (GO:0031932)				central_nervous_system(1)|endometrium(2)|lung(6)|prostate(1)|skin(1)	11		all_neural(38;0.00409)|Ovarian(80;0.024)|Glioma(61;0.0647)		UCEC - Uterine corpus endometrioid carcinoma (28;0.168)		CGCGGCGGCCGGCGGTACCAG	0.706																																					p.G297C		Atlas-SNP	.											.	PRR5	75	.	0			c.G889T						.						17.0	21.0	20.0					22																	45132780		2177	4263	6440	SO:0001583	missense	55615	exon10			GCGGCCGGCGGTA	AF177331	CCDS14058.1, CCDS14059.1, CCDS56232.1, CCDS74875.1	22q13.3	2011-02-10			ENSG00000186654	ENSG00000186654			31682	protein-coding gene	gene with protein product	"""protein observed with Rictor-1"""	609406				15718101, 17599906	Standard	NM_001017528		Approved	PP610, FLJ20185k, Protor-1		P85299	OTTHUMG00000150460	ENST00000336985.6:c.820G>T	chr22.hg19:g.45132780G>T	ENSP00000337464:p.Gly274Cys	113.0	0.0		86.0	23.0	NM_001198721	B1AHF6|B1AHG5|B3KP73|O75983|O95695|Q5BIW2|Q5EAJ8|Q5EAJ9|Q5XKJ6|Q96RW1|Q96RW2|Q9HA49|Q9HC46|Q9NSG0|Q9NVX8|Q9NXL1|Q9UH20	Missense_Mutation	SNP	ENST00000336985.6	hg19	CCDS14058.1	.	.	.	.	.	.	.	.	.	.	G	14.59	2.582069	0.46006	.	.	ENSG00000186654	ENST00000432186;ENST00000006251;ENST00000404016;ENST00000403581;ENST00000336985	T;T;T;T	0.32753	1.44;1.47;1.45;1.47	5.41	-0.997	0.10215	.	.	.	.	.	T	0.42177	0.1191	L	0.53249	1.67	0.09310	N	1	D;D;D;D;D	0.76494	0.975;0.999;0.998;0.983;0.983	P;P;P;P;P	0.61800	0.648;0.894;0.841;0.775;0.775	T	0.32851	-0.9891	9	0.59425	D	0.04	.	9.048	0.36358	0.568:0.0:0.432:0.0	.	238;297;173;274;274	B1AHF5;B1AHF6;P85299-2;P85299;A8K699	.;.;.;PRR5_HUMAN;.	C	265;265;238;297;274	ENSP00000400925:G265C;ENSP00000006251:G265C;ENSP00000384848:G297C;ENSP00000337464:G274C	ENSP00000006251:G265C	G	+	1	0	PRR5	43511444	0.933000	0.31639	0.001000	0.08648	0.177000	0.22998	2.330000	0.43885	0.015000	0.14971	0.313000	0.20887	GGC	.	.		0.706	PRR5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000318200.2	NM_001017528	
MAPK11	5600	hgsc.bcm.edu	37	22	50706332	50706332	+	Silent	SNP	G	G	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr22:50706332G>A	ENST00000330651.6	-	2	263	c.163C>T	c.(163-165)Ctg>Ttg	p.L55L	MAPK11_ENST00000495277.1_5'UTR|MAPK11_ENST00000449719.2_5'UTR	NM_002751.5	NP_002742.3	Q15759	MK11_HUMAN	mitogen-activated protein kinase 11	55	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|gene expression (GO:0010467)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mRNA metabolic process (GO:0016071)|muscle cell differentiation (GO:0042692)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of muscle cell differentiation (GO:0051149)|Ras protein signal transduction (GO:0007265)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|lung(4)	6		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)	Regorafenib(DB08896)	GGGCGCGACAGCTTCTTCACC	0.716																																					p.L55L	GBM(9;634 739 50668)	Atlas-SNP	.											.	MAPK11	23	.	0			c.C163T						.						11.0	11.0	11.0					22																	50706332		2175	4276	6451	SO:0001819	synonymous_variant	5600	exon2			GCGACAGCTTCTT	Y14440	CCDS14090.1	22q13.33	2011-06-09			ENSG00000185386	ENSG00000185386	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6873	protein-coding gene	gene with protein product		602898		PRKM11		9218798	Standard	NM_002751		Approved	p38-2, p38Beta, SAPK2	uc003bkr.3	Q15759	OTTHUMG00000150226	ENST00000330651.6:c.163C>T	chr22.hg19:g.50706332G>A		126.0	0.0		123.0	46.0	NM_002751	A8K730|B0LPG1|B7Z630|E7ETQ1|L7RT27|O00284|O15472|Q2XNF2	Silent	SNP	ENST00000330651.6	hg19	CCDS14090.1																																																																																			.	.		0.716	MAPK11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000316900.1		
HUWE1	10075	hgsc.bcm.edu	37	X	53561499	53561499	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chrX:53561499T>A	ENST00000342160.3	-	81	13266	c.12809A>T	c.(12808-12810)aAg>aTg	p.K4270M	HUWE1_ENST00000262854.6_Missense_Mutation_p.K4270M			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4270	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GGACTGGTACTTGTGGTATTC	0.473																																					p.K4270M		Atlas-SNP	.											.	HUWE1	724	.	0			c.A12809T						.						235.0	169.0	191.0					X																	53561499		2203	4300	6503	SO:0001583	missense	10075	exon82			TGGTACTTGTGGT	AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12809A>T	chrX.hg19:g.53561499T>A	ENSP00000340648:p.Lys4270Met	75.0	0.0		79.0	55.0	NM_031407	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	ENST00000342160.3	hg19	CCDS35301.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.34|12.34	1.908266|1.908266	0.33721|0.33721	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000342160;ENST00000262854|ENST00000427052;ENST00000426907	T;T|.	0.44482|.	0.92;0.92|.	5.36|5.36	5.36|5.36	0.76844|0.76844	HECT (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.76941|0.76941	0.4058|0.4058	M|M	0.83953|0.83953	2.67|2.67	0.80722|0.80722	D|D	1|1	D;D|.	0.61080|.	0.989;0.986|.	D;D|.	0.77557|.	0.99;0.983|.	T|T	0.79249|0.79249	-0.1881|-0.1881	10|5	0.87932|.	D|.	0|.	.|.	13.5296|13.5296	0.61615|0.61615	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	4270;4254|.	Q7Z6Z7;Q7Z6Z7-2|.	HUWE1_HUMAN;.|.	M|H	4270|3303;1092	ENSP00000340648:K4270M;ENSP00000262854:K4270M|.	ENSP00000262854:K4270M|.	K|Q	-|-	2|3	0|2	HUWE1|HUWE1	53578224|53578224	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.410000|7.410000	0.80065|0.80065	1.907000|1.907000	0.55213|0.55213	0.486000|0.486000	0.48141|0.48141	AAG|CAA	.	.		0.473	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056766.1	XM_497119	
RAB33A	9363	hgsc.bcm.edu	37	X	129318331	129318331	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chrX:129318331C>A	ENST00000257017.4	+	2	745	c.331C>A	c.(331-333)Cat>Aat	p.H111N		NM_004794.2	NP_004785.1	Q14088	RB33A_HUMAN	RAB33A, member RAS oncogene family	111					antigen processing and presentation (GO:0019882)|GTP catabolic process (GO:0006184)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(5)	11						CCGCAACGTACATGCCGTGGT	0.498																																					p.H111N		Atlas-SNP	.											.	RAB33A	24	.	0			c.C331A						.						163.0	124.0	137.0					X																	129318331		2203	4300	6503	SO:0001583	missense	9363	exon2			AACGTACATGCCG	D14889	CCDS14621.1	Xq26	2008-02-05			ENSG00000134594	ENSG00000134594		"""RAB, member RAS oncogene"""	9773	protein-coding gene	gene with protein product		300333				7688322, 9512502	Standard	NM_004794		Approved	RabS10	uc004evl.3	Q14088	OTTHUMG00000022391	ENST00000257017.4:c.331C>A	chrX.hg19:g.129318331C>A	ENSP00000257017:p.His111Asn	88.0	0.0		59.0	48.0	NM_004794	Q5JUZ6|Q92465	Missense_Mutation	SNP	ENST00000257017.4	hg19	CCDS14621.1	.	.	.	.	.	.	.	.	.	.	C	18.44	3.623769	0.66901	.	.	ENSG00000134594	ENST00000257017	T	0.79845	-1.31	4.71	4.71	0.59529	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	T	0.79793	0.4507	N	0.21282	0.65	0.80722	D	1	P	0.36789	0.57	P	0.48921	0.595	T	0.82723	-0.0316	10	0.72032	D	0.01	-10.8948	17.2062	0.86918	0.0:1.0:0.0:0.0	.	111	Q14088	RB33A_HUMAN	N	111	ENSP00000257017:H111N	ENSP00000257017:H111N	H	+	1	0	RAB33A	129146012	1.000000	0.71417	0.999000	0.59377	0.920000	0.55202	7.776000	0.85560	2.072000	0.62099	0.429000	0.28392	CAT	.	.		0.498	RAB33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058246.1	NM_004794	
FRMD7	90167	hgsc.bcm.edu	37	X	131212800	131212800	+	Silent	SNP	A	A	G			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chrX:131212800A>G	ENST00000298542.4	-	12	1420	c.1245T>C	c.(1243-1245)ccT>ccC	p.P415P	FRMD7_ENST00000370879.1_Silent_p.P295P|FRMD7_ENST00000464296.1_Silent_p.P400P	NM_194277.2	NP_919253.1	Q6ZUT3	FRMD7_HUMAN	FERM domain containing 7	415					regulation of neuron projection development (GO:0010975)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(12)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24	Acute lymphoblastic leukemia(192;0.000127)					TATAAATAAAAGGGAAAGAGG	0.453																																					p.P415P		Atlas-SNP	.											.	FRMD7	69	.	0			c.T1245C						.						151.0	141.0	144.0					X																	131212800		2203	4300	6503	SO:0001819	synonymous_variant	90167	exon12			AATAAAAGGGAAA	AL161984	CCDS35397.1	Xq26.2	2014-09-17	2006-09-01	2006-09-01	ENSG00000165694	ENSG00000165694			8079	protein-coding gene	gene with protein product		300628	"""nystagmus 1, congenital"""	NYS, NYS1		2063919, 17013395	Standard	NM_194277		Approved	FLJ43346	uc004ewn.3	Q6ZUT3	OTTHUMG00000022421	ENST00000298542.4:c.1245T>C	chrX.hg19:g.131212800A>G		106.0	0.0		95.0	4.0	NM_194277	C0LLJ3|Q5JX99	Silent	SNP	ENST00000298542.4	hg19	CCDS35397.1																																																																																			.	.		0.453	FRMD7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000355031.1	NM_194277	
PCDH11Y	83259	hgsc.bcm.edu	37	Y	4924912	4924912	+	Silent	SNP	T	T	A			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chrY:4924912T>A	ENST00000362095.5	+	1	782	c.48T>A	c.(46-48)tcT>tcA	p.S16S	PCDH11Y_ENST00000215473.6_Silent_p.S16S|PCDH11Y_ENST00000333703.4_Intron	NM_032972.2	NP_116754.1	Q9BZA8	PC11Y_HUMAN	protocadherin 11 Y-linked	16					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|kidney(2)|large_intestine(7)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						CTTCTCTCTCTCCTCTTCTTT	0.388																																					p.S16S		Atlas-SNP	.											.	PCDH11Y	163	.	0			c.T48A						.																																			SO:0001819	synonymous_variant	83259	exon1			TCTCTCTCCTCTT	AF332217	CCDS14776.1, CCDS14777.1, CCDS76066.1	Yp11.2	2010-01-26	2002-05-22	2002-05-24	ENSG00000099715	ENSG00000099715		"""Cadherins / Protocadherins : Non-clustered"""	15813	protein-coding gene	gene with protein product		400022	"""protocadherin 22"""	PCDH22		10644456, 11003707	Standard	NM_032971		Approved	PCDHY	uc004fqo.3	Q9BZA8	OTTHUMG00000035105	ENST00000362095.5:c.48T>A	chrY.hg19:g.4924912T>A		155.0	0.0		174.0	112.0	NM_032972	Q70LR6|Q70LR8|Q70LS0|Q70LS1|Q70LS2|Q70LS3|Q70LS4|Q70LS5|Q8WY34|Q9BZA9|Q9H4E1	Silent	SNP	ENST00000362095.5	hg19	CCDS14777.1																																																																																			.	.		0.388	PCDH11Y-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000084980.1	NM_032973	
GJB1	2705	hgsc.bcm.edu	37	X	70443636	70443637	+	In_Frame_Ins	INS	-	-	TCATCT			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chrX:70443636_70443637insTCATCT	ENST00000374022.3	+	2	174_175	c.79_80insTCATCT	c.(79-81)gtc>gTCATCTtc	p.31_32insIF	GJB1_ENST00000361726.6_In_Frame_Ins_p.31_32insIF|GJB1_ENST00000374029.1_In_Frame_Ins_p.31_32insIF	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	31					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					ATGGCTCTCGGTCATCTTCATC	0.53																																					p.V27delinsVIF		Atlas-INDEL	.											.	GJB1	21	.	0			c.79_80insTCATCT						.																																			SO:0001652	inframe_insertion	2705	exon2			.	X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.86_91dupTCATCT	chrX.hg19:g.70443637_70443642dupTCATCT	ENSP00000363134:p.Ile30_Phe31dup	50.0	0.0		45.0	20.0	NM_001097642	B2R8R2|D3DVV2|Q5U0S4	In_Frame_Ins	INS	ENST00000374022.3	hg19	CCDS14408.1																																																																																			.	.		0.530	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057133.1	NM_000166	
SUCLA2	8803	hgsc.bcm.edu	37	13	48517535	48517540	+	In_Frame_Del	DEL	CATGTG	CATGTG	-			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	CATGTG	CATGTG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr13:48517535_48517540delCATGTG	ENST00000378654.3	-	11	1414_1419	c.1358_1363delCACATG	c.(1357-1365)gcacatgtg>gtg	p.AH453del	SUCLA2_ENST00000543413.1_In_Frame_Del_p.AH395del|SUCLA2_ENST00000534875.1_In_Frame_Del_p.AH395del|SUCLA2_ENST00000544100.1_In_Frame_Del_p.AH319del	NM_003850.2	NP_003841.1	Q9P2R7	SUCB1_HUMAN	succinate-CoA ligase, ADP-forming, beta subunit	453					cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|succinyl-CoA metabolic process (GO:0006104)|succinyl-CoA pathway (GO:0006781)|tricarboxylic acid cycle (GO:0006099)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(3)|skin(4)	15		all_cancers(8;1.13e-24)|all_epithelial(8;1.78e-13)|all_lung(13;2.85e-06)|Breast(56;0.000141)|Lung NSC(96;0.000226)|all_hematologic(8;0.000885)|Prostate(109;0.00132)|Acute lymphoblastic leukemia(8;0.0167)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;2.1e-06)	Succinic acid(DB00139)	TTCACATCCACATGTGCTTGCTTCGC	0.369																																					p.453_455del		Atlas-INDEL	.											.	SUCLA2	40	.	0			c.1359_1364del						.																																			SO:0001651	inframe_deletion	8803	exon11			.	AF058953	CCDS9406.1	13q12.2-q13.3	2010-04-16			ENSG00000136143	ENSG00000136143	6.2.1.5		11448	protein-coding gene	gene with protein product		603921				9765291	Standard	NM_003850		Approved		uc001vbs.3	Q9P2R7	OTTHUMG00000016889	ENST00000378654.3:c.1358_1363delCACATG	chr13.hg19:g.48517535_48517540delCATGTG	ENSP00000367923:p.Ala453_His454del	188.0	0.0		158.0	35.0	NM_003850	B2RDE7|O95194|Q5T9Q4|Q5T9Q6|Q9NV21|Q9NVP7	In_Frame_Del	DEL	ENST00000378654.3	hg19	CCDS9406.1																																																																																			.	.		0.369	SUCLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044852.1		
HDAC4	9759	hgsc.bcm.edu	37	2	239975278	239975278	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:239975278delC	ENST00000345617.3	-	26	3884	c.3093delG	c.(3091-3093)ctgfs	p.L1031fs	HDAC4_ENST00000543185.1_Frame_Shift_Del_p.L615fs	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	1031	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		TTGTGCGCTGCAGGCAGCGCC	0.632																																					p.Q1032fs		Atlas-INDEL	.											.	HDAC4	127	.	0			c.3094delC						.						30.0	35.0	33.0					2																	239975278		2203	4299	6502	SO:0001589	frameshift_variant	9759	exon26			.	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.3093delG	chr2.hg19:g.239975278delC	ENSP00000264606:p.Leu1031fs	80.0	0.0		84.0	21.0	NM_006037	Q9UND6	Frame_Shift_Del	DEL	ENST00000345617.3	hg19	CCDS2529.1																																																																																			.	.		0.632	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
HCN1	348980	hgsc.bcm.edu	37	5	45303784	45303785	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr5:45303784_45303785insT	ENST00000303230.4	-	6	1591_1592	c.1534_1535insA	c.(1534-1536)atgfs	p.M512fs		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	512					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)	p.M512fs*17(1)		NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						AATGAAATACATTTTTTTACCC	0.401																																					p.M512fs		Atlas-INDEL	.											.,1	HCN1	298	.	1	Insertion - Frameshift(1)	large_intestine(1)	c.1535_1536insA						.																																			SO:0001589	frameshift_variant	348980	exon6			.	AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.1535dupA	chr5.hg19:g.45303791_45303791dupT	ENSP00000307342:p.Met512fs	115.0	0.0		129.0	39.0	NM_021072		Frame_Shift_Ins	INS	ENST00000303230.4	hg19	CCDS3952.1																																																																																			.	.		0.401	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253847.1	NM_021072	
NGRN	51335	hgsc.bcm.edu	37	15	90808975	90808984	+	Frame_Shift_Del	DEL	GGGCGCGTTT	GGGCGCGTTT	-			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	GGGCGCGTTT	GGGCGCGTTT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr15:90808975_90808984delGGGCGCGTTT	ENST00000379095.3	+	1	39_48	c.31_40delGGGCGCGTTT	c.(31-42)gggcgcgtttgcfs	p.GRVC11fs	RP11-697E2.6_ENST00000561573.1_Intron|NGRN_ENST00000331497.3_3'UTR	NM_001033088.1	NP_001028260.2	Q9NPE2	NGRN_HUMAN	neugrin, neurite outgrowth associated	11					neuron differentiation (GO:0030182)	extracellular region (GO:0005576)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	11	Melanoma(11;0.00551)|Lung NSC(78;0.0178)|all_lung(78;0.0378)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|BRCA - Breast invasive adenocarcinoma(143;0.0323)|Kidney(142;0.0514)			CTTGCTGGGCGGGCGCGTTTGCGCCGCCGT	0.676																																					p.10_13del		Atlas-INDEL	.											.	NGRN	27	.	0			c.30_39del						.																																			SO:0001589	frameshift_variant	51335	exon1			.	AB029315	CCDS32329.1	15q26.1	2008-02-05			ENSG00000182768	ENSG00000182768			18077	protein-coding gene	gene with protein product						11118320	Standard	NR_028052		Approved	DSC92	uc002bpf.1	Q9NPE2	OTTHUMG00000149807	ENST00000379095.3:c.31_40delGGGCGCGTTT	chr15.hg19:g.90808975_90808984delGGGCGCGTTT	ENSP00000368389:p.Gly11fs	49.0	0.0		54.0	11.0	NM_001033088	B2R6M8|Q4V9L7|Q9HBL4	Frame_Shift_Del	DEL	ENST00000379095.3	hg19	CCDS32329.1																																																																																			.	.		0.676	NGRN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000313418.1		
HDAC4	9759	hgsc.bcm.edu	37	2	239975280	239975281	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	GG	GG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr2:239975280_239975281delGG	ENST00000345617.3	-	26	3881_3882	c.3090_3091delCC	c.(3088-3093)tgcctgfs	p.L1031fs	HDAC4_ENST00000543185.1_Frame_Shift_Del_p.L615fs	NM_006037.3	NP_006028.2	P56524	HDAC4_HUMAN	histone deacetylase 4	1031	Histone deacetylase.				B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cardiac muscle hypertrophy in response to stress (GO:0014898)|chromatin remodeling (GO:0006338)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|osteoblast development (GO:0002076)|peptidyl-lysine deacetylation (GO:0034983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein sumoylation (GO:0033235)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression, epigenetic (GO:0040029)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to drug (GO:0042493)|response to interleukin-1 (GO:0070555)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	A band (GO:0031672)|actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)|Z disc (GO:0030018)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|potassium ion binding (GO:0030955)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(5)	62		all_epithelial(40;1.45e-17)|Breast(86;1.53e-05)|Renal(207;0.000355)|all_lung(227;0.0121)|Ovarian(221;0.0183)|Lung NSC(271;0.0413)|Melanoma(123;0.0749)|all_hematologic(139;0.159)		Epithelial(121;6.38e-25)|OV - Ovarian serous cystadenocarcinoma(60;2.48e-12)|Kidney(56;6.04e-08)|KIRC - Kidney renal clear cell carcinoma(57;1.18e-06)|BRCA - Breast invasive adenocarcinoma(100;3.99e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.04)		GTGCGCTGCAGGCAGCGCCAGT	0.629																																					p.1031_1031del		Atlas-INDEL	.											.	HDAC4	127	.	0			c.3091_3092del						.																																			SO:0001589	frameshift_variant	9759	exon26			.	AB006626	CCDS2529.1	2q37.3	2014-02-12			ENSG00000068024	ENSG00000068024			14063	protein-coding gene	gene with protein product		605314	"""brachydactyly-mental retardation syndrome"""	BDMR		10206986, 10220385, 20691407	Standard	NM_006037		Approved	KIAA0288, HDAC-A, HDACA, HD4, HA6116, HDAC-4	uc002vyk.4	P56524	OTTHUMG00000133344	ENST00000345617.3:c.3090_3091delCC	chr2.hg19:g.239975280_239975281delGG	ENSP00000264606:p.Leu1031fs	79.0	0.0		84.0	21.0	NM_006037	Q9UND6	Frame_Shift_Del	DEL	ENST00000345617.3	hg19	CCDS2529.1																																																																																			.	.		0.629	HDAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257174.2	NM_006037	
CDK18	5129	hgsc.bcm.edu	37	1	205497176	205497219	+	Splice_Site	DEL	GACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	GACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	-	rs201373119|rs150420895	byFrequency	TCGA-DD-AACK-01A-11D-A40R-10	TCGA-DD-AACK-10A-01D-A40U-10	GACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	GACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	1606e906-2e7b-4b31-a047-f6669a5f5db0	20530127-b977-4fd9-bd3e-d983efbe98cd	g.chr1:205497176_205497219delGACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	ENST00000360066.2	+	10	1155_1198	c.854_897delGACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT	c.(853-897)ggactggccagggccaagtcagtgcccacaaagacttactccaat>g	p.GLARAKSVPTKTYSN285fs	CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000506784.1_Splice_Site_p.GLARAKSVPTKTYSN315fs|CDK18_ENST00000429964.2_Splice_Site_p.GLARAKSVPTKTYSN285fs	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	283	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CTGCCCCCAGGACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAATGAGGTGGTGA	0.611																																					p.315_329del	Pancreas(180;489 2072 28461 40831 44265)	Atlas-INDEL	.											.	CDK18	75	.	0			c.944_986del						.																																			SO:0001630	splice_region_variant	5129	exon10			.	X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.854-1GACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT>-	chr1.hg19:g.205497176_205497219delGACTGGCCAGGGCCAAGTCAGTGCCCACAAAGACTTACTCCAAT		160.0	0.0		137.0	12.0	NM_212503	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Frame_Shift_Del	DEL	ENST00000360066.2	hg19	CCDS44300.1																																																																																			.	.		0.611	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000090407.2	NM_002596	Frame_Shift_Del
