#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
CFAP74	85452	hgsc.bcm.edu	37	1	1887238	1887238	+	IGR	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:1887238T>A								TMEM52 (36526 upstream) : C1orf222 (32324 downstream)																							TCAGAGAAGCTGGTGGCGGCT	0.562																																					p.S690C		Atlas-SNP	.											.	KIAA1751	92	.	0			c.A2068T						.						46.0	50.0	48.0					1																	1887238		2063	4214	6277	SO:0001628	intergenic_variant	85452	exon18			AGAAGCTGGTGGC																													chr1.hg19:g.1887238T>A		49.0	0.0		71.0	17.0	NM_001080484		Missense_Mutation	SNP		hg19		.	.	.	.	.	.	.	.	.	.	T	12.74	2.029075	0.35797	.	.	ENSG00000142609	ENST00000270720;ENST00000461752	.	.	.	3.07	1.94	0.25998	.	1.211860	0.05999	N	0.647351	T	0.58148	0.2102	M	0.62723	1.935	0.09310	N	0.999999	D;D	0.89917	1.0;0.999	D;D	0.70935	0.971;0.947	T	0.31888	-0.9927	9	0.72032	D	0.01	-6.2328	4.8553	0.13555	0.0:0.1448:0.0:0.8552	.	690;690	Q9C0B2-2;Q9C0B2	.;K1751_HUMAN	C	690;137	.	ENSP00000270720:S690C	S	-	1	0	C1orf222	1877098	0.000000	0.05858	0.011000	0.14972	0.006000	0.05464	-0.108000	0.10857	0.579000	0.29504	0.460000	0.39030	AGC	.	.	0	0.562								
THAP3	90326	hgsc.bcm.edu	37	1	6685353	6685353	+	Splice_Site	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:6685353G>T	ENST00000054650.4	+	2	232		c.e2+1		THAP3_ENST00000484676.1_Splice_Site|THAP3_ENST00000377627.3_Splice_Site|THAP3_ENST00000307896.6_Splice_Site	NM_001195753.1	NP_001182682.1	Q8WTV1	THAP3_HUMAN	THAP domain containing, apoptosis associated protein 3								DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|large_intestine(1)|prostate(1)	4	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.29e-07)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.0167)|READ - Rectum adenocarcinoma(331;0.0642)		CCTTCCACCGGTAAGAGGCGG	0.751																																					.		Atlas-SNP	.											.	THAP3	43	.	0			c.74+1G>T						.						2.0	3.0	3.0					1																	6685353		1725	3599	5324	SO:0001630	splice_region_variant	90326	exon2			CCACCGGTAAGAG	BC022081	CCDS86.1, CCDS55572.1, CCDS55573.1	1p36.1	2013-01-25			ENSG00000041988	ENSG00000041988		"""THAP (C2CH-type zinc finger) domain containing"""	20855	protein-coding gene	gene with protein product		612532				12575992	Standard	NM_138350		Approved		uc001aod.3	Q8WTV1	OTTHUMG00000001440	ENST00000054650.4:c.74+1G>T	chr1.hg19:g.6685353G>T		75.0	0.0		56.0	23.0	NM_001195753	Q569K1|Q5TH66|Q5TH67|Q8N8T6|Q9BSC7|Q9Y3H2|Q9Y3H3	Splice_Site	SNP	ENST00000054650.4	hg19	CCDS55572.1	.	.	.	.	.	.	.	.	.	.	G	13.23	2.176447	0.38413	.	.	ENSG00000041988	ENST00000054650;ENST00000307896;ENST00000377627	.	.	.	3.3	3.3	0.37823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7702	0.51953	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	THAP3	6607940	1.000000	0.71417	0.999000	0.59377	0.450000	0.32258	3.509000	0.53386	1.838000	0.53458	0.313000	0.20887	.	.	.		0.751	THAP3-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000004203.1	NM_138350	Intron
AIM1L	55057	hgsc.bcm.edu	37	1	26670848	26670848	+	5'Flank	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:26670848G>A	ENST00000308182.5	-	0	0				AIM1L_ENST00000527815.1_5'Flank			Q8N1P7	AIM1L_HUMAN	absent in melanoma 1-like								carbohydrate binding (GO:0030246)			endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|pancreas(1)|skin(2)	12		all_cancers(24;4.67e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.51e-27)|Colorectal(126;1.61e-08)|COAD - Colon adenocarcinoma(152;9.32e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000792)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|STAD - Stomach adenocarcinoma(196;0.00154)|GBM - Glioblastoma multiforme(114;0.00858)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.165)|LUSC - Lung squamous cell carcinoma(448;0.239)		GCGTATCCAGGAATATCTCCA	0.637																																					p.F767F		Atlas-SNP	.											.	AIM1L	98	.	0			c.C2301T						.																																			SO:0001631	upstream_gene_variant	55057	exon2			ATCCAGGAATATC			1p35	2010-07-14			ENSG00000176092	ENSG00000176092			17295	protein-coding gene	gene with protein product	"""beta-gamma crystallin domain containing 2"""						Standard	NM_001039775		Approved	CRYBG2, FLJ38020	uc001bmd.4	Q8N1P7	OTTHUMG00000003490		chr1.hg19:g.26670848G>A	Exception_encountered	21.0	0.0		25.0	11.0	NM_001039775	B2RNG3|Q5T137|Q5T150	Silent	SNP	ENST00000308182.5	hg19																																																																																				.	.		0.637	AIM1L-201	KNOWN	basic	protein_coding	protein_coding		NM_001039775.2	
COL16A1	1307	hgsc.bcm.edu	37	1	32163575	32163575	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:32163575G>A	ENST00000373672.3	-	6	1105	c.589C>T	c.(589-591)Cga>Tga	p.R197*	COL16A1_ENST00000271069.6_Nonsense_Mutation_p.R197*|COL16A1_ENST00000373668.3_Nonsense_Mutation_p.R197*	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	197	Laminin G-like.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		ATGGGTCGTCGGGGCCCCAGA	0.617																																					p.R197X	Colon(143;498 1786 21362 25193 36625)	Atlas-SNP	.											.	COL16A1	137	.	0			c.C589T						.						31.0	37.0	35.0					1																	32163575		2036	4195	6231	SO:0001587	stop_gained	1307	exon6			GTCGTCGGGGCCC	M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.589C>T	chr1.hg19:g.32163575G>A	ENSP00000362776:p.Arg197*	170.0	0.0		166.0	14.0	NM_001856	Q16593|Q59F89|Q71RG9	Nonsense_Mutation	SNP	ENST00000373672.3	hg19	CCDS41297.1	.	.	.	.	.	.	.	.	.	.	G	37	6.079774	0.97267	.	.	ENSG00000084636	ENST00000373672;ENST00000271069;ENST00000373668	.	.	.	5.14	-0.0938	0.13647	.	0.236988	0.33161	N	0.005206	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.3637	0.16101	0.3626:0.0:0.5129:0.1244	.	.	.	.	X	197	.	ENSP00000271069:R197X	R	-	1	2	COL16A1	31936162	0.938000	0.31826	0.891000	0.34965	0.144000	0.21451	-0.084000	0.11268	-0.182000	0.10602	-1.010000	0.02471	CGA	.	.		0.617	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000011057.2	NM_001856	
MFSD2A	84879	hgsc.bcm.edu	37	1	40431684	40431684	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:40431684A>G	ENST00000372809.5	+	6	894	c.751A>G	c.(751-753)Acg>Gcg	p.T251A	MFSD2A_ENST00000480630.1_3'UTR|MFSD2A_ENST00000420632.2_Missense_Mutation_p.T82A|MFSD2A_ENST00000372811.5_Missense_Mutation_p.T238A	NM_001136493.1	NP_001129965.1	Q8NA29	NLS1_HUMAN	major facilitator superfamily domain containing 2A	251					establishment of blood-brain barrier (GO:0060856)|fatty acid transport (GO:0015908)|lipid transport across blood brain barrier (GO:1990379)|transcytosis (GO:0045056)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phospholipid transporter activity (GO:0005548)|symporter activity (GO:0015293)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	24						ACACAGGGAAACGGTGAGGCC	0.493																																					p.T251A		Atlas-SNP	.											.	MFSD2A	53	.	0			c.A751G						.						76.0	60.0	66.0					1																	40431684		2203	4300	6503	SO:0001583	missense	84879	exon6			AGGGAAACGGTGA	AK093223	CCDS446.1, CCDS44118.1, CCDS72762.1	1p34.2	2009-09-08	2009-09-08	2009-09-08	ENSG00000168389	ENSG00000168389			25897	protein-coding gene	gene with protein product		614397	"""major facilitator superfamily domain containing 2"""	MFSD2		18694395	Standard	XM_005271285		Approved	FLJ14490	uc001cev.3	Q8NA29	OTTHUMG00000009293	ENST00000372809.5:c.751A>G	chr1.hg19:g.40431684A>G	ENSP00000361895:p.Thr251Ala	141.0	0.0		143.0	38.0	NM_001136493	A8K675|Q6UWU5|Q96F59|Q9BRC8	Missense_Mutation	SNP	ENST00000372809.5	hg19	CCDS44118.1	.	.	.	.	.	.	.	.	.	.	A	11.20	1.567694	0.28003	.	.	ENSG00000168389	ENST00000372811;ENST00000420632;ENST00000434861;ENST00000372809	.	.	.	5.94	5.94	0.96194	Major facilitator superfamily domain, general substrate transporter (1);	0.139570	0.64402	D	0.000004	T	0.45677	0.1354	N	0.25286	0.73	0.54753	D	0.999985	P;B;B	0.42735	0.788;0.237;0.346	P;B;B	0.48425	0.577;0.297;0.204	T	0.32134	-0.9918	9	0.07030	T	0.85	-15.9514	15.5763	0.76392	1.0:0.0:0.0:0.0	.	201;251;238	B4DNN7;Q8NA29;Q8NA29-2	.;MFS2A_HUMAN;.	A	238;82;236;251	.	ENSP00000361895:T251A	T	+	1	0	MFSD2A	40204271	1.000000	0.71417	0.980000	0.43619	0.502000	0.33828	5.543000	0.67225	2.272000	0.75746	0.460000	0.39030	ACG	.	.		0.493	MFSD2A-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000025756.1	NM_032793	
FOXD3	27022	hgsc.bcm.edu	37	1	63789072	63789072	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:63789072G>A	ENST00000371116.2	+	1	343	c.343G>A	c.(343-345)Gcg>Acg	p.A115T	RP4-792G4.2_ENST00000427268.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	115					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						ggagggcggcgcgagcggcgg	0.776																																					p.A115T	Pancreas(68;276 1750 11966 31252)	Atlas-SNP	.											.	FOXD3	15	.	0			c.G343A						.						3.0	5.0	4.0					1																	63789072		1389	2838	4227	SO:0001583	missense	27022	exon1			GGCGGCGCGAGCG	AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.343G>A	chr1.hg19:g.63789072G>A	ENSP00000360157:p.Ala115Thr	49.0	0.0		50.0	4.0	NM_012183	Q9BYM2|Q9UDD1	Missense_Mutation	SNP	ENST00000371116.2	hg19	CCDS624.1	.	.	.	.	.	.	.	.	.	.	G	1.327	-0.597791	0.03771	.	.	ENSG00000187140	ENST00000371116	D	0.82433	-1.61	2.69	2.69	0.31865	.	1.680140	0.03823	U	0.267807	T	0.44201	0.1282	N	0.08118	0	0.20489	N	0.999891	B	0.28636	0.218	B	0.12156	0.007	T	0.47341	-0.9125	10	0.11485	T	0.65	.	9.0375	0.36296	0.0:0.0:1.0:0.0	.	115	Q9UJU5	FOXD3_HUMAN	T	115	ENSP00000360157:A115T	ENSP00000360157:A115T	A	+	1	0	FOXD3	63561660	0.002000	0.14202	0.339000	0.25562	0.010000	0.07245	0.260000	0.18424	1.811000	0.52892	0.404000	0.27445	GCG	.	.		0.776	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000025331.1		
PTPN22	26191	hgsc.bcm.edu	37	1	114372603	114372603	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:114372603G>C	ENST00000359785.5	-	17	2237	c.2102C>G	c.(2101-2103)aCt>aGt	p.T701S	RP5-1073O3.2_ENST00000448199.1_RNA|PTPN22_ENST00000528414.1_Missense_Mutation_p.T646S|PTPN22_ENST00000538253.1_Missense_Mutation_p.T457S|PTPN22_ENST00000460620.1_Intron|PTPN22_ENST00000525799.1_Missense_Mutation_p.T574S|PTPN22_ENST00000420377.2_Missense_Mutation_p.T701S	NM_001193431.1|NM_015967.5	NP_001180360.1|NP_057051	Q9Y2R2	PTN22_HUMAN	protein tyrosine phosphatase, non-receptor type 22 (lymphoid)	701					negative regulation of T cell activation (GO:0050868)|negative regulation of T cell receptor signaling pathway (GO:0050860)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphoanandamide dephosphorylation (GO:0035644)|protein dephosphorylation (GO:0006470)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of innate immune response (GO:0045088)|regulation of natural killer cell proliferation (GO:0032817)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	kinase binding (GO:0019900)|protein tyrosine phosphatase activity (GO:0004725)|SH3 domain binding (GO:0017124)			NS(1)|breast(1)|kidney(3)|large_intestine(4)|lung(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Lung SC(450;0.184)	all_cancers(81;1.93e-08)|all_epithelial(167;4.37e-08)|all_lung(203;5.22e-06)|Lung NSC(69;8.94e-06)		Lung(183;0.0234)|Colorectal(144;0.0686)|all cancers(265;0.0792)|Epithelial(280;0.0866)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GGACTCTAGAGTTCTTTCTGG	0.338																																					p.T701S		Atlas-SNP	.											.	PTPN22	90	.	0			c.C2102G						.						65.0	68.0	67.0					1																	114372603		2202	4300	6502	SO:0001583	missense	26191	exon17			TCTAGAGTTCTTT	AF001846	CCDS863.1, CCDS864.1, CCDS864.2	1p13.2	2011-06-09	2005-02-02		ENSG00000134242	ENSG00000134242		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9652	protein-coding gene	gene with protein product		600716	"""protein tyrosine phosphatase, non-receptor type 8"""	PTPN8		10068674, 1373816	Standard	NM_015967		Approved	Lyp, Lyp1, Lyp2	uc001eds.3	Q9Y2R2	OTTHUMG00000011936	ENST00000359785.5:c.2102C>G	chr1.hg19:g.114372603G>C	ENSP00000352833:p.Thr701Ser	211.0	0.0		228.0	49.0	NM_015967	A0N0K6|B1ALC8|D4NZ71|E9PLD8|E9PPI1|O95063|O95064|Q6IPX8|Q8WVM1	Missense_Mutation	SNP	ENST00000359785.5	hg19	CCDS863.1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.594024	0.86953	.	.	ENSG00000134242	ENST00000359785;ENST00000528414;ENST00000538253;ENST00000420377;ENST00000525799	T;T;T;T;T	0.59364	2.71;2.32;0.27;3.04;2.3	6.03	6.03	0.97812	.	0.000000	0.64402	D	0.000002	T	0.74596	0.3737	M	0.80183	2.485	0.51012	D	0.999903	D;D;D;D;D	0.89917	1.0;0.999;1.0;0.999;1.0	D;D;D;D;D	0.91635	0.996;0.994;0.999;0.994;0.998	T	0.76675	-0.2872	10	0.87932	D	0	.	17.4736	0.87653	0.0:0.0:1.0:0.0	.	457;574;701;646;701	F5H2S8;E9PPI1;E9PMT0;E9PLD8;Q9Y2R2	.;.;.;.;PTN22_HUMAN	S	701;646;457;701;574	ENSP00000352833:T701S;ENSP00000435176:T646S;ENSP00000439372:T457S;ENSP00000388229:T701S;ENSP00000432674:T574S	ENSP00000352833:T701S	T	-	2	0	PTPN22	114174126	1.000000	0.71417	0.970000	0.41538	0.998000	0.95712	5.598000	0.67585	2.861000	0.98227	0.655000	0.94253	ACT	.	.		0.338	PTPN22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000033015.1	NM_015967	
IGSF3	3321	hgsc.bcm.edu	37	1	117122106	117122106	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:117122106T>A	ENST00000369486.3	-	10	4007	c.3242A>T	c.(3241-3243)cAt>cTt	p.H1081L	IGSF3_ENST00000369483.1_Missense_Mutation_p.H1101L|IGSF3_ENST00000318837.6_Missense_Mutation_p.H1101L	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1081	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		CTCCTCCACATGGCAGGAGTA	0.602																																					p.H1101L		Atlas-SNP	.											.	IGSF3	294	.	0			c.A3302T						.						51.0	54.0	53.0					1																	117122106		2203	4300	6503	SO:0001583	missense	3321	exon11			TCCACATGGCAGG	AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3242A>T	chr1.hg19:g.117122106T>A	ENSP00000358498:p.His1081Leu	103.0	0.0		92.0	24.0	NM_001542	A6NJZ6|A6NMC7	Missense_Mutation	SNP	ENST00000369486.3	hg19	CCDS30813.1	.	.	.	.	.	.	.	.	.	.	T	8.657	0.899739	0.17686	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.20463	2.07;2.07;2.07	4.67	-0.198	0.13224	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.433417	0.25878	N	0.027717	T	0.02012	0.0063	N	0.02916	-0.46	0.22240	N	0.99927	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45920	-0.9228	10	0.23891	T	0.37	-13.554	8.1574	0.31178	0.0:0.4353:0.0:0.5647	.	1081;1101	O75054;A6NJZ6	IGSF3_HUMAN;.	L	1081;1101;1101	ENSP00000358498:H1081L;ENSP00000358495:H1101L;ENSP00000321184:H1101L	ENSP00000321184:H1101L	H	-	2	0	IGSF3	116923629	0.005000	0.15991	0.186000	0.23195	0.793000	0.44817	0.019000	0.13444	-0.221000	0.09973	-0.414000	0.06135	CAT	.	.		0.602	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000059040.1	NM_001542	
SSR2	6746	hgsc.bcm.edu	37	1	155989929	155989929	+	Silent	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:155989929A>C	ENST00000295702.4	-	2	101	c.30T>G	c.(28-30)gcT>gcG	p.A10A	SSR2_ENST00000480567.1_Silent_p.A10A|SSR2_ENST00000529008.1_Silent_p.A10A|SSR2_ENST00000496742.1_Silent_p.A10A	NM_003145.3	NP_003136.1	P43308	SSRB_HUMAN	signal sequence receptor, beta (translocon-associated protein beta)	10					cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(4)|stomach(1)	10	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					CAGCAAATAGAGCCAACACCA	0.473																																					p.A10A		Atlas-SNP	.											.	SSR2	20	.	0			c.T30G						.						98.0	90.0	92.0					1																	155989929		2203	4300	6503	SO:0001819	synonymous_variant	6746	exon2			AAATAGAGCCAAC	BC000341	CCDS1126.1	1q21-q23	2008-02-05			ENSG00000163479	ENSG00000163479			11324	protein-coding gene	gene with protein product		600867				7789174	Standard	NM_003145		Approved	TLAP, TRAPB	uc001fmx.3	P43308	OTTHUMG00000017456	ENST00000295702.4:c.30T>G	chr1.hg19:g.155989929A>C		100.0	0.0		178.0	27.0	NM_003145	B2R9K9|D3DVA7|Q53HI0|Q5VY95|Q5VY96|Q6IB31|Q9BWE4	Silent	SNP	ENST00000295702.4	hg19	CCDS1126.1																																																																																			.	.		0.473	SSR2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000046172.2	NM_003145	
C1orf61	10485	hgsc.bcm.edu	37	1	156384479	156384479	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:156384479T>A	ENST00000368243.1	-	4	254	c.138A>T	c.(136-138)agA>agT	p.R46S		NM_006365.1	NP_006356.1	Q13536	CROC4_HUMAN	chromosome 1 open reading frame 61	46						nucleus (GO:0005634)				large_intestine(2)|lung(2)|skin(1)	5	Hepatocellular(266;0.158)					TGGATGTGGCTCTATCGTCCA	0.577																																					p.R46S		Atlas-SNP	.											.	C1orf61	15	.	0			c.A138T						.						37.0	36.0	36.0					1																	156384479		2203	4300	6503	SO:0001583	missense	10485	exon4			TGTGGCTCTATCG		CCDS1142.1	1q22	2014-03-17			ENSG00000125462	ENSG00000125462			30780	protein-coding gene	gene with protein product	"""contingent replication of cDNA-4"", ""transcriptional activator of the c fos promoter"""					10995546, 23012322	Standard	XM_005244832		Approved	CROC4	uc001fou.1	Q13536	OTTHUMG00000031022	ENST00000368243.1:c.138A>T	chr1.hg19:g.156384479T>A	ENSP00000357226:p.Arg46Ser	79.0	0.0		123.0	14.0	NM_006365	B1ALL5|B1ALL8	Missense_Mutation	SNP	ENST00000368243.1	hg19	CCDS1142.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.01|15.01	2.706096|2.706096	0.48412|0.48412	.|.	.|.	ENSG00000125462|ENSG00000125462	ENST00000368242|ENST00000310027;ENST00000368243;ENST00000357975	.|.	.|.	.|.	4.08|4.08	0.224|0.224	0.15297|0.15297	.|.	.|.	.|.	.|.	.|.	T|T	0.07863|0.07863	0.0197|0.0197	N|N	0.24115|0.24115	0.695|0.695	0.09310|0.09310	N|N	1|1	.|P	.|0.42908	.|0.793	.|B	.|0.42163	.|0.378	T|T	0.15378|0.15378	-1.0439|-1.0439	5|8	.|0.87932	.|D	.|0	-0.5088|-0.5088	3.23|3.23	0.06745|0.06745	0.0:0.245:0.2151:0.5399|0.0:0.245:0.2151:0.5399	.|.	.|46	.|Q13536	.|CROC4_HUMAN	V|S	78|60;46;59	.|.	.|ENSP00000310651:R60S	E|R	-|-	2|3	0|2	C1orf61|C1orf61	154651103|154651103	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.251000|0.251000	0.25915|0.25915	-0.184000|-0.184000	0.09698|0.09698	-0.054000|-0.054000	0.13266|0.13266	0.459000|0.459000	0.35465|0.35465	GAG|AGA	.	.		0.577	C1orf61-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000075988.1	NM_006365	
FCRLB	127943	hgsc.bcm.edu	37	1	161697120	161697120	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:161697120A>T	ENST00000367948.2	+	8	1164	c.949A>T	c.(949-951)Aga>Tga	p.R317*	FCRLB_ENST00000495397.1_3'UTR|FCRLB_ENST00000367944.3_3'UTR|FCRLB_ENST00000367946.3_Silent_p.S268S|FCRLB_ENST00000392158.1_Nonsense_Mutation_p.R317*|FCRLB_ENST00000367945.1_Silent_p.S261S|FCRLB_ENST00000336830.5_3'UTR			Q6BAA4	FCRLB_HUMAN	Fc receptor-like B	317					negative regulation of immune response (GO:0050777)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|skin(1)	17	all_hematologic(112;0.0359)		BRCA - Breast invasive adenocarcinoma(70;0.00634)			GCTTTCCTTCAGAAAGCCCCC	0.677																																					p.R317X		Atlas-SNP	.											.	FCRLB	35	.	0			c.A949T						.						20.0	22.0	21.0					1																	161697120		2203	4299	6502	SO:0001587	stop_gained	127943	exon6			TCCTTCAGAAAGC	AY670683	CCDS30927.1, CCDS72962.1, CCDS72963.1, CCDS72964.1, CCDS72965.1	1q23.3	2013-01-11	2006-09-26	2006-09-26	ENSG00000162746	ENSG00000162746		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	26431	protein-coding gene	gene with protein product		609251	"""Fc receptor-like and mucin-like 2"""	FCRLM2		15676285	Standard	NM_001288829		Approved	FLJ31052, FCRL2, FREB-2, FCRLY	uc001gbi.3	Q6BAA4	OTTHUMG00000133629	ENST00000367948.2:c.949A>T	chr1.hg19:g.161697120A>T	ENSP00000356925:p.Arg317*	127.0	0.0		251.0	163.0	NM_001002901	A2A3J5|A2A3J7|Q5VXA6|Q6BAA0|Q6BAA1|Q6BAA2|Q6BAA3|Q8IXZ7	Nonsense_Mutation	SNP	ENST00000367948.2	hg19	CCDS30927.1	.	.	.	.	.	.	.	.	.	.	A	31	5.084735	0.94100	.	.	ENSG00000162746	ENST00000367948;ENST00000392158	.	.	.	4.27	-3.58	0.04597	.	0.000000	0.44483	D	0.000452	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.3996	0.67034	0.2551:0.7449:0.0:0.0	.	.	.	.	X	317	.	ENSP00000356925:R317X	R	+	1	2	FCRLB	159963744	0.960000	0.32886	0.143000	0.22291	0.441000	0.31987	-0.205000	0.09411	-0.919000	0.03803	-0.548000	0.04221	AGA	.	.		0.677	FCRLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083585.1	NM_152378	
KIFAP3	22920	hgsc.bcm.edu	37	1	170001030	170001030	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:170001030G>A	ENST00000361580.2	-	8	1065	c.838C>T	c.(838-840)Cga>Tga	p.R280*	KIFAP3_ENST00000367765.1_Nonsense_Mutation_p.R240*|KIFAP3_ENST00000367767.1_Nonsense_Mutation_p.R236*|KIFAP3_ENST00000538366.1_Nonsense_Mutation_p.R202*	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3	280					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TTCATACCTCGTAATAGCTGT	0.348																																					p.R280X		Atlas-SNP	.											.	KIFAP3	102	.	0			c.C838T						.						180.0	187.0	184.0					1																	170001030		2202	4298	6500	SO:0001587	stop_gained	22920	exon8			TACCTCGTAATAG	U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.838C>T	chr1.hg19:g.170001030G>A	ENSP00000354560:p.Arg280*	93.0	0.0		180.0	113.0	NM_014970	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Nonsense_Mutation	SNP	ENST00000361580.2	hg19	CCDS1288.1	.	.	.	.	.	.	.	.	.	.	G	38	7.243945	0.98161	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000538366	.	.	.	5.59	-1.65	0.08291	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4215	0.90592	0.0:0.0:0.2762:0.7238	.	.	.	.	X	280;240;236;202	.	.	R	-	1	2	KIFAP3	168267654	0.999000	0.42202	0.770000	0.31555	0.989000	0.77384	0.455000	0.21843	-0.615000	0.05679	-0.314000	0.08810	CGA	.	.		0.348	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087568.1	NM_014970	
FMO1	2326	hgsc.bcm.edu	37	1	171236812	171236812	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:171236812T>A	ENST00000354841.4	+	2	394	c.263T>A	c.(262-264)cTg>cAg	p.L88Q	FMO1_ENST00000367750.3_Missense_Mutation_p.L88Q|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Intron	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	88					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TCTCAATTCCTGGAATATCTC	0.373																																					p.L88Q		Atlas-SNP	.											.	FMO1	79	.	0			c.T263A						.						124.0	119.0	120.0					1																	171236812		2203	4300	6503	SO:0001583	missense	2326	exon3			AATTCCTGGAATA	M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.263T>A	chr1.hg19:g.171236812T>A	ENSP00000346901:p.Leu88Gln	90.0	0.0		152.0	90.0	NM_002021	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	ENST00000354841.4	hg19	CCDS1294.1	.	.	.	.	.	.	.	.	.	.	T	15.15	2.748444	0.49257	.	.	ENSG00000010932	ENST00000367750;ENST00000433267;ENST00000354841	T;T;T	0.56275	0.47;0.47;0.47	5.68	5.68	0.88126	.	0.185488	0.46442	D	0.000286	T	0.64238	0.2580	M	0.73962	2.25	0.80722	D	1	P;D	0.89917	0.661;1.0	P;D	0.76575	0.686;0.988	T	0.64529	-0.6386	10	0.34782	T	0.22	-15.5341	14.9131	0.70773	0.0:0.0:0.0:1.0	.	88;88	B2RCG5;Q01740	.;FMO1_HUMAN	Q	88	ENSP00000356724:L88Q;ENSP00000406982:L88Q;ENSP00000346901:L88Q	ENSP00000346901:L88Q	L	+	2	0	FMO1	169503436	1.000000	0.71417	0.888000	0.34837	0.905000	0.53344	7.697000	0.84279	2.144000	0.66660	0.533000	0.62120	CTG	.	.		0.373	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086212.1	NM_002021	
CACNA1E	777	hgsc.bcm.edu	37	1	181767884	181767884	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:181767884C>T	ENST00000367573.2	+	48	6856	c.6856C>T	c.(6856-6858)Cgg>Tgg	p.R2286W	CACNA1E_ENST00000367570.1_Missense_Mutation_p.R2243W|CACNA1E_ENST00000360108.3_Missense_Mutation_p.R2267W|CACNA1E_ENST00000358338.5_Missense_Mutation_p.R2175W|CACNA1E_ENST00000526775.1_Missense_Mutation_p.R2224W|CACNA1E_ENST00000367567.4_Missense_Mutation_p.R1850W|CACNA1E_ENST00000357570.5_Missense_Mutation_p.R2237W	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	2286	Poly-Arg.				calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.R2243W(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						CTATCGGCGGCGGAGGCGCGG	0.647																																					p.R2286W		Atlas-SNP	.											CACNA1E,NS,carcinoma,0,1	CACNA1E	778	.	1	Substitution - Missense(1)	breast(1)	c.C6856T						.						13.0	16.0	15.0					1																	181767884		1950	4138	6088	SO:0001583	missense	777	exon48			CGGCGGCGGAGGC	AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6856C>T	chr1.hg19:g.181767884C>T	ENSP00000356545:p.Arg2286Trp	69.0	0.0		104.0	24.0	NM_001205293	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	ENST00000367573.2	hg19	CCDS55664.1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103731	0.76983	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.96459	-3.95;-3.95;-3.96;-3.95;-4.02;-3.97;-3.96	5.59	4.63	0.57726	.	0.379952	0.26975	N	0.021551	D	0.96510	0.8861	L	0.36672	1.1	0.52099	D	0.999942	D;D	0.89917	1.0;1.0	D;D	0.79108	0.978;0.992	D	0.96368	0.9271	10	0.62326	D	0.03	.	13.7614	0.62968	0.2537:0.7462:0.0:0.0	.	2224;2243	Q15878-2;Q15878-3	.;.	W	2243;2224;2237;2175;1850;2267;2286	ENSP00000356542:R2243W;ENSP00000434814:R2224W;ENSP00000350183:R2237W;ENSP00000351101:R2175W;ENSP00000356539:R1850W;ENSP00000353222:R2267W;ENSP00000356545:R2286W	ENSP00000350183:R2237W	R	+	1	2	CACNA1E	180034507	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	0.866000	0.27954	2.622000	0.88805	0.563000	0.77884	CGG	.	.		0.647	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	protein_coding	OTTHUMT00000090793.2	NM_000721	
PRG4	10216	hgsc.bcm.edu	37	1	186266079	186266079	+	Silent	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:186266079T>G	ENST00000445192.2	+	2	117	c.72T>G	c.(70-72)tcT>tcG	p.S24S	PRG4_ENST00000367483.4_Silent_p.S24S|PRG4_ENST00000367484.3_Silent_p.S24S|PRG4_ENST00000367486.3_Silent_p.S24S|PRG4_ENST00000367485.4_Silent_p.S24S	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	24					cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AAGTTTCATCTCAAGGTAGCT	0.343																																					p.S24S		Atlas-SNP	.											.	PRG4	259	.	0			c.T72G						.						195.0	147.0	163.0					1																	186266079		2203	4300	6503	SO:0001819	synonymous_variant	10216	exon2			TTCATCTCAAGGT	U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.72T>G	chr1.hg19:g.186266079T>G		91.0	0.0		133.0	69.0	NM_001127708	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	ENST00000445192.2	hg19	CCDS1369.1																																																																																			.	.		0.343	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000086346.1	NM_005807	
PLXNA2	5362	hgsc.bcm.edu	37	1	208212331	208212331	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:208212331T>A	ENST00000367033.3	-	25	5258		c.e25-2			NM_025179.3	NP_079455.3	O75051	PLXA2_HUMAN	plexin A2						axon guidance (GO:0007411)|centrosome localization (GO:0051642)|cerebellar granule cell precursor tangential migration (GO:0021935)|limb bud formation (GO:0060174)|neural tube development (GO:0021915)|pharyngeal system development (GO:0060037)|regulation of cell migration (GO:0030334)|semaphorin-plexin signaling pathway (GO:0071526)|somitogenesis (GO:0001756)	integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)	80				OV - Ovarian serous cystadenocarcinoma(81;0.199)		GTTCAGGATCTACAAGTAGGG	0.493																																					.		Atlas-SNP	.											.	PLXNA2	178	.	0			c.4501-2A>T						.						111.0	98.0	102.0					1																	208212331		2203	4300	6503	SO:0001630	splice_region_variant	5362	exon26			AGGATCTACAAGT	X87831	CCDS31013.1	1q32.2	2008-07-18			ENSG00000076356	ENSG00000076356		"""Plexins"""	9100	protein-coding gene	gene with protein product	"""plexin 2"", ""plexin-A2"", ""semaphorin receptor OCT"", ""transmembrane protein OCT"""	601054		PLXN2		8570614	Standard	NM_025179		Approved	OCT, FLJ11751, FLJ30634, KIAA0463	uc001hgz.3	O75051	OTTHUMG00000036564	ENST00000367033.3:c.4501-2A>T	chr1.hg19:g.208212331T>A		92.0	0.0		201.0	34.0	NM_025179	A2RTX9|B2RMX7|Q6UX61|Q96GN9|Q9BRL1|Q9UIW1	Splice_Site	SNP	ENST00000367033.3	hg19	CCDS31013.1	.	.	.	.	.	.	.	.	.	.	T	15.23	2.772714	0.49680	.	.	ENSG00000076356	ENST00000367033	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.8538	0.78960	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	PLXNA2	206278954	1.000000	0.71417	0.920000	0.36463	0.370000	0.29829	3.903000	0.56318	2.141000	0.66446	0.528000	0.53228	.	.	.		0.493	PLXNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000088932.6	NM_025179	Intron
PTPN14	5784	hgsc.bcm.edu	37	1	214538000	214538000	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:214538000T>C	ENST00000366956.5	-	18	3484	c.3290A>G	c.(3289-3291)cAg>cGg	p.Q1097R	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	1097	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		ACGGACCGACTGGATCTCCTC	0.587																																					p.Q1097R	Colon(92;557 1424 24372 34121 40073)	Atlas-SNP	.											.	PTPN14	168	.	0			c.A3290G						.						98.0	85.0	90.0					1																	214538000		2203	4300	6503	SO:0001583	missense	5784	exon18			ACCGACTGGATCT	X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.3290A>G	chr1.hg19:g.214538000T>C	ENSP00000355923:p.Gln1097Arg	92.0	0.0		189.0	83.0	NM_005401	Q5VSI0	Missense_Mutation	SNP	ENST00000366956.5	hg19	CCDS1514.1	.	.	.	.	.	.	.	.	.	.	T	18.45	3.625592	0.66901	.	.	ENSG00000152104	ENST00000366956	D	0.82344	-1.6	5.7	5.7	0.88788	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.061995	0.64402	D	0.000002	T	0.60945	0.2308	N	0.04245	-0.25	0.80722	D	1	B	0.21071	0.051	B	0.17433	0.018	T	0.59606	-0.7423	10	0.06099	T	0.92	.	10.329	0.43812	0.0:0.0731:0.0:0.9269	.	1097	Q15678	PTN14_HUMAN	R	1097	ENSP00000355923:Q1097R	ENSP00000355923:Q1097R	Q	-	2	0	PTPN14	212604623	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.203000	0.72137	2.170000	0.68504	0.533000	0.62120	CAG	.	.		0.587	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089918.2	NM_005401	
NUP133	55746	hgsc.bcm.edu	37	1	229584906	229584906	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:229584906A>G	ENST00000261396.3	-	24	3303	c.3212T>C	c.(3211-3213)cTg>cCg	p.L1071P	NUP133_ENST00000485119.1_5'UTR|NUP133_ENST00000537506.1_Missense_Mutation_p.L1055P	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	1071					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AAGGATTTCCAGTTTTAGATC	0.353																																					p.L1071P		Atlas-SNP	.											.	NUP133	111	.	0			c.T3212C						.						87.0	85.0	86.0					1																	229584906		2203	4300	6503	SO:0001583	missense	55746	exon24			ATTTCCAGTTTTA		CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.3212T>C	chr1.hg19:g.229584906A>G	ENSP00000261396:p.Leu1071Pro	55.0	0.0		96.0	45.0	NM_018230	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	ENST00000261396.3	hg19	CCDS1579.1	.	.	.	.	.	.	.	.	.	.	A	17.38	3.375993	0.61735	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.28666	1.6;1.62;1.61	6.04	6.04	0.98038	Nucleoporin, Nup133/Nup155-like, C-terminal (1);	0.118214	0.64402	D	0.000016	T	0.54334	0.1852	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.50482	-0.8823	10	0.23891	T	0.37	-0.2002	15.1596	0.72771	1.0:0.0:0.0:0.0	.	1071	Q8WUM0	NU133_HUMAN	P	1000;1071;1000;1055	ENSP00000261396:L1071P;ENSP00000355640:L1000P;ENSP00000443496:L1055P	ENSP00000261396:L1071P	L	-	2	0	NUP133	227651529	1.000000	0.71417	0.998000	0.56505	0.678000	0.39670	5.432000	0.66514	2.317000	0.78254	0.460000	0.39030	CTG	.	.		0.353	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000095224.1	NM_018230	
OR2T12	127064	hgsc.bcm.edu	37	1	248458135	248458135	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:248458135A>G	ENST00000317996.1	-	1	745	c.746T>C	c.(745-747)tTt>tCt	p.F249S		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	249						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			AGCTCCATAAAAGAGTCCCAC	0.493																																					p.F249S		Atlas-SNP	.											.	OR2T12	113	.	0			c.T746C						.						83.0	83.0	83.0					1																	248458135		2203	4298	6501	SO:0001583	missense	127064	exon1			CCATAAAAGAGTC	BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.746T>C	chr1.hg19:g.248458135A>G	ENSP00000324583:p.Phe249Ser	169.0	0.0		305.0	30.0	NM_001004692		Missense_Mutation	SNP	ENST00000317996.1	hg19	CCDS31110.1	.	.	.	.	.	.	.	.	.	.	a	15.08	2.727038	0.48833	.	.	ENSG00000177201	ENST00000317996	T	0.00297	8.23	1.55	-0.0962	0.13637	GPCR, rhodopsin-like superfamily (1);	0.000000	0.36234	U	0.002714	T	0.00496	0.0016	M	0.82056	2.57	0.09310	N	1	D	0.64830	0.994	D	0.71656	0.974	T	0.46803	-0.9165	10	0.72032	D	0.01	.	5.3308	0.15932	0.5475:0.0:0.0:0.4525	.	249	Q8NG77	O2T12_HUMAN	S	249	ENSP00000324583:F249S	ENSP00000324583:F249S	F	-	2	0	OR2T12	246524758	0.000000	0.05858	0.515000	0.27774	0.456000	0.32438	-1.448000	0.02394	0.540000	0.28808	0.147000	0.16070	TTT	.	.		0.493	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000097353.1	NM_001004692	
MYT1L	23040	hgsc.bcm.edu	37	2	1920989	1920989	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:1920989C>T	ENST00000399161.2	-	11	2353	c.1606G>A	c.(1606-1608)Gtc>Atc	p.V536I	MYT1L_ENST00000428368.2_Missense_Mutation_p.V534I	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	536					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		TCTGGAGGGACCCTATCTTTG	0.567																																					p.V534I		Atlas-SNP	.											.	MYT1L	241	.	0			c.G1600A						.						193.0	202.0	199.0					2																	1920989		2070	4186	6256	SO:0001583	missense	23040	exon11			GAGGGACCCTATC	AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1606G>A	chr2.hg19:g.1920989C>T	ENSP00000382114:p.Val536Ile	90.0	0.0		101.0	24.0	NM_015025	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	ENST00000399161.2	hg19		.	.	.	.	.	.	.	.	.	.	C	22.7	4.323937	0.81580	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.48522	0.81;0.82	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.56572	0.1994	N	0.25426	0.745	0.80722	D	1	D;P	0.65815	0.995;0.839	D;P	0.74674	0.984;0.863	T	0.46373	-0.9196	10	0.18710	T	0.47	-43.7854	19.8984	0.96975	0.0:1.0:0.0:0.0	.	536;534	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	I	536;482;534	ENSP00000382114:V536I;ENSP00000396103:V534I	ENSP00000295067:V482I	V	-	1	0	MYT1L	1899996	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.011000	0.70760	2.713000	0.92767	0.655000	0.94253	GTC	.	.		0.567	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	protein_coding	OTTHUMT00000322493.1	NM_015025	
PLEKHH2	130271	hgsc.bcm.edu	37	2	43939487	43939487	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:43939487G>A	ENST00000282406.4	+	15	2535	c.2425G>A	c.(2425-2427)Gag>Aag	p.E809K		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	809					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				CCTGCAGCCTGAGGGCAAACC	0.488																																					p.E809K		Atlas-SNP	.											.	PLEKHH2	156	.	0			c.G2425A						.						92.0	83.0	86.0					2																	43939487		2203	4300	6503	SO:0001583	missense	130271	exon15			CAGCCTGAGGGCA	AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.2425G>A	chr2.hg19:g.43939487G>A	ENSP00000282406:p.Glu809Lys	86.0	0.0		102.0	21.0	NM_172069	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	ENST00000282406.4	hg19	CCDS1812.1	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775744	0.70107	.	.	ENSG00000152527	ENST00000282406	T	0.21543	2.0	4.93	4.93	0.64822	Pleckstrin homology-type (1);	0.220226	0.44285	D	0.000462	T	0.19446	0.0467	L	0.38175	1.15	0.52099	D	0.99994	B;B	0.30361	0.016;0.277	B;B	0.23852	0.007;0.049	T	0.03077	-1.1075	10	0.49607	T	0.09	-5.5497	18.1513	0.89675	0.0:0.0:1.0:0.0	.	809;246	Q8IVE3;Q8IVE3-2	PKHH2_HUMAN;.	K	809	ENSP00000282406:E809K	ENSP00000282406:E809K	E	+	1	0	PLEKHH2	43792991	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	9.298000	0.96132	2.275000	0.75901	0.460000	0.39030	GAG	.	.		0.488	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250537.1	NM_172069	
PREPL	9581	hgsc.bcm.edu	37	2	44559599	44559599	+	Splice_Site	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:44559599T>G	ENST00000409936.1	-	9	1789	c.1352A>C	c.(1351-1353)aAg>aCg	p.K451T	PREPL_ENST00000378511.3_Splice_Site_p.K389T|PREPL_ENST00000410081.1_Splice_Site_p.K451T|PREPL_ENST00000409272.1_Splice_Site_p.K451T|PREPL_ENST00000409411.1_Splice_Site_p.K362T|PREPL_ENST00000260648.6_Splice_Site_p.K451T|PREPL_ENST00000409957.1_Splice_Site_p.K362T|PREPL_ENST00000378520.3_Intron|PREPL_ENST00000541738.1_Splice_Site_p.K362T	NM_001171606.1	NP_001165077.1	Q4J6C6	PPCEL_HUMAN	prolyl endopeptidase-like	451						cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)	serine-type endopeptidase activity (GO:0004252)|serine-type exopeptidase activity (GO:0070008)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(19)|ovary(1)|prostate(1)|skin(2)	33		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AAGACCTACCTTGCTTTTGGC	0.428																																					p.K451T		Atlas-SNP	.											.	PREPL	69	.	0			c.A1352C						.						128.0	112.0	117.0					2																	44559599		2203	4300	6503	SO:0001630	splice_region_variant	9581	exon9			CCTACCTTGCTTT	AB007896	CCDS33190.1, CCDS42675.1, CCDS42676.1, CCDS54353.1	2p22.1	2008-02-05			ENSG00000138078	ENSG00000138078			30228	protein-coding gene	gene with protein product		609557				11524703	Standard	NM_006036		Approved	KIAA0436	uc002ruk.2	Q4J6C6	OTTHUMG00000152791	ENST00000409936.1:c.1353+1A>C	chr2.hg19:g.44559599T>G		94.0	0.0		94.0	32.0	NM_001171603	A7E2X6|D6W5A3|O43163|Q4J6C3|Q4J6C4|Q4ZG39|Q6ZMW7|Q96DW7	Missense_Mutation	SNP	ENST00000409936.1	hg19	CCDS33190.1	.	.	.	.	.	.	.	.	.	.	T	21.9	4.213818	0.79352	.	.	ENSG00000138078	ENST00000541738;ENST00000409411;ENST00000409957;ENST00000409936;ENST00000260648;ENST00000409272;ENST00000410081;ENST00000378511	.	.	.	5.55	5.55	0.83447	.	0.222358	0.46442	D	0.000281	T	0.75539	0.3863	M	0.65498	2.005	0.58432	D	0.999999	D;D	0.67145	0.996;0.972	D;P	0.75484	0.986;0.786	T	0.71981	-0.4428	9	0.18276	T	0.48	-7.9121	15.6846	0.77400	0.0:0.0:0.0:1.0	.	389;451	Q4J6C6-3;Q4J6C6	.;PPCEL_HUMAN	T	362;362;362;451;451;451;451;389	.	ENSP00000260648:K451T	K	-	2	0	PREPL	44413103	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	4.441000	0.59981	2.111000	0.64477	0.454000	0.30748	AAG	.	.		0.428	PREPL-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000327900.1	NM_006036	Missense_Mutation
LHCGR	3973	hgsc.bcm.edu	37	2	48915582	48915582	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:48915582G>T	ENST00000294954.7	-	11	1375	c.1354C>A	c.(1354-1356)Ctt>Att	p.L452I	STON1-GTF2A1L_ENST00000402114.2_Intron|LHCGR_ENST00000344775.3_Missense_Mutation_p.L390I|LHCGR_ENST00000403273.1_3'UTR|LHCGR_ENST00000405626.1_Missense_Mutation_p.L425I|LHCGR_ENST00000401907.1_Intron	NM_000233.3	NP_000224.2	P22888	LSHR_HUMAN	luteinizing hormone/choriogonadotropin receptor	452					activation of adenylate cyclase activity (GO:0007190)|cellular response to gonadotropin stimulus (GO:0071371)|cognition (GO:0050890)|development of secondary male sexual characteristics (GO:0046544)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|ovarian follicle development (GO:0001541)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of inositol trisphosphate biosynthetic process (GO:0032962)|regulation of steroid hormone biosynthetic process (GO:0090030)|seminiferous tubule development (GO:0072520)|spermatogenesis (GO:0007283)|uterus development (GO:0060065)	endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	choriogonadotropin hormone binding (GO:0038106)|choriogonadotropin hormone receptor activity (GO:0035472)|luteinizing hormone receptor activity (GO:0004964)			NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(3)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	56		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.176)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Buserelin(DB06719)|Cetrorelix(DB00050)|Choriogonadotropin alfa(DB00097)|Goserelin(DB00014)|Lutropin alfa(DB00044)|Menotropins(DB00032)	TAGACAGAAAGTTCACTTGCG	0.483																																					p.L452I		Atlas-SNP	.											.	LHCGR	154	.	0			c.C1354A						.						119.0	97.0	105.0					2																	48915582		2203	4300	6503	SO:0001583	missense	3973	exon11			CAGAAAGTTCACT		CCDS1842.1	2p21	2012-08-10			ENSG00000138039	ENSG00000138039		"""GPCR / Class A : Gonadotropin and TSH receptors"""	6585	protein-coding gene	gene with protein product		152790	"""hypergonadotropic hypogonadism"""	HHG			Standard	NM_000233		Approved	LHR, LCGR, LGR2, ULG5	uc002rwu.4	P22888	OTTHUMG00000129257	ENST00000294954.7:c.1354C>A	chr2.hg19:g.48915582G>T	ENSP00000294954:p.Leu452Ile	97.0	0.0		103.0	28.0	NM_000233	Q14751|Q15996|Q9UEW9	Missense_Mutation	SNP	ENST00000294954.7	hg19	CCDS1842.1	.	.	.	.	.	.	.	.	.	.	G	20.5	3.997316	0.74818	.	.	ENSG00000138039	ENST00000344775;ENST00000294954;ENST00000405626	D;D;D	0.85629	-2.01;-2.01;-2.01	5.91	5.91	0.95273	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.94751	0.8306	M	0.93283	3.4	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.95372	0.8465	9	.	.	.	.	19.2938	0.94114	0.0:0.0:1.0:0.0	.	452	P22888	LSHR_HUMAN	I	390;452;425	ENSP00000344301:L390I;ENSP00000294954:L452I;ENSP00000386033:L425I	.	L	-	1	0	LHCGR	48769086	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.749000	0.68704	2.791000	0.96007	0.655000	0.94253	CTT	.	.		0.483	LHCGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251364.4	NM_000233.3	
EIF2AK3	9451	hgsc.bcm.edu	37	2	88887518	88887518	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:88887518T>C	ENST00000303236.3	-	8	1712	c.1411A>G	c.(1411-1413)Atc>Gtc	p.I471V	EIF2AK3_ENST00000419748.1_Missense_Mutation_p.I320V	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	471					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						TACTGCAAGATTGAAAGTGCA	0.294																																					p.I471V	GBM(138;671 1851 16235 39058 45249)	Atlas-SNP	.											.	EIF2AK3	160	.	0			c.A1411G						.						49.0	53.0	51.0					2																	88887518		2203	4288	6491	SO:0001583	missense	9451	exon8			GCAAGATTGAAAG	AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.1411A>G	chr2.hg19:g.88887518T>C	ENSP00000307235:p.Ile471Val	785.0	0.0		797.0	188.0	NM_004836	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Missense_Mutation	SNP	ENST00000303236.3	hg19	CCDS33241.1	.	.	.	.	.	.	.	.	.	.	T	1.005	-0.689850	0.03328	.	.	ENSG00000172071	ENST00000419748;ENST00000303236;ENST00000535951;ENST00000415570	T;T;T	0.46063	0.88;0.88;0.88	5.82	4.67	0.58626	.	0.208574	0.49916	N	0.000125	T	0.16642	0.0400	N	0.04724	-0.175	0.37195	D	0.904104	B	0.14012	0.009	B	0.14578	0.011	T	0.17623	-1.0363	10	0.02654	T	1	-17.5937	6.2817	0.21011	0.0:0.2905:0.0:0.7095	.	471	Q9NZJ5	E2AK3_HUMAN	V	320;471;320;350	ENSP00000408325:I320V;ENSP00000307235:I471V;ENSP00000412076:I350V	ENSP00000307235:I471V	I	-	1	0	EIF2AK3	88668633	0.981000	0.34729	0.999000	0.59377	0.977000	0.68977	2.152000	0.42272	1.042000	0.40150	0.455000	0.32223	ATC	.	.		0.294	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000338233.2	NM_004836	
RGPD4	285190	hgsc.bcm.edu	37	2	108453058	108453058	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:108453058A>C	ENST00000408999.3	+	2	150	c.73A>C	c.(73-75)Aag>Cag	p.K25Q	RGPD4_ENST00000354986.4_Splice_Site_p.K25Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	25					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TTTTTTTTAGAAGTCAACGAG	0.254																																					p.K25Q		Atlas-SNP	.											.	RGPD4	112	.	0			c.A73C						.																																			SO:0001630	splice_region_variant	285190	exon2			TTTTAGAAGTCAA	BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.73-1A>C	chr2.hg19:g.108453058A>C		288.0	0.0		300.0	85.0	NM_182588	B9A029	Missense_Mutation	SNP	ENST00000408999.3	hg19	CCDS46381.1	.	.	.	.	.	.	.	.	.	.	a	7.825	0.718676	0.15372	.	.	ENSG00000196862	ENST00000354986;ENST00000408999	T;T	0.46451	0.87;0.87	2.35	2.35	0.29111	Tetratricopeptide-like helical (1);	.	.	.	.	T	0.37652	0.1011	L	0.54323	1.7	0.32246	N	0.572059	P	0.41978	0.767	B	0.41036	0.346	T	0.48468	-0.9033	8	.	.	.	-11.4122	9.2374	0.37475	1.0:0.0:0.0:0.0	.	25	Q7Z3J3	RGPD4_HUMAN	Q	25	ENSP00000347081:K25Q;ENSP00000386810:K25Q	.	K	+	1	0	RGPD4	107819490	1.000000	0.71417	1.000000	0.80357	0.070000	0.16714	7.091000	0.76923	1.080000	0.41073	0.155000	0.16302	AAG	.	.		0.254	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000330096.2	XM_496581	Missense_Mutation
CCDC74B	91409	hgsc.bcm.edu	37	2	130897154	130897154	+	Silent	SNP	G	G	T	rs546767071		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:130897154G>T	ENST00000310463.6	-	8	1254	c.1117C>A	c.(1117-1119)Cgg>Agg	p.R373R	CCDC74B_ENST00000392984.3_Silent_p.R475R|MED15P9_ENST00000427638.1_RNA|CCDC74B_ENST00000409943.3_Silent_p.R307R	NM_207310.2	NP_997193.1	Q96LY2	CC74B_HUMAN	coiled-coil domain containing 74B	373										endometrium(2)|large_intestine(1)|lung(3)	6	Colorectal(110;0.1)					TGCAGGCGCCGTTTCTGCATT	0.602																																					p.R373R		Atlas-SNP	.											.	CCDC74B	27	.	0			c.C1117A						.						42.0	42.0	42.0					2																	130897154		2201	4300	6501	SO:0001819	synonymous_variant	91409	exon8			GGCGCCGTTTCTG		CCDS2155.1, CCDS58726.1	2q21.1	2006-11-29		2006-02-16	ENSG00000152076	ENSG00000152076			25267	protein-coding gene	gene with protein product							Standard	NM_001258307		Approved	DKFZp434E2321	uc002tqn.2	Q96LY2	OTTHUMG00000131629	ENST00000310463.6:c.1117C>A	chr2.hg19:g.130897154G>T		186.0	0.0		167.0	44.0	NM_207310	Q6NW18	Silent	SNP	ENST00000310463.6	hg19	CCDS2155.1																																																																																			.	.		0.602	CCDC74B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254522.3	NM_207310	
GALNT3	2591	hgsc.bcm.edu	37	2	166615986	166615986	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:166615986C>T	ENST00000392701.3	-	5	1708	c.933G>A	c.(931-933)ctG>ctA	p.L311L	GALNT3_ENST00000409882.1_Silent_p.L49L	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	311					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						CAAACGTGTTCAGATCTATGG	0.448																																					p.L311L		Atlas-SNP	.											.	GALNT3	65	.	0			c.G933A						.						90.0	88.0	89.0					2																	166615986		2203	4300	6503	SO:0001819	synonymous_variant	2591	exon5			CGTGTTCAGATCT		CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.933G>A	chr2.hg19:g.166615986C>T		128.0	0.0		135.0	31.0	NM_004482	Q53TG9|Q7Z476	Silent	SNP	ENST00000392701.3	hg19	CCDS2226.1																																																																																			.	.		0.448	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255205.2	NM_004482	
TTN	7273	hgsc.bcm.edu	37	2	179610419	179610419	+	Intron	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:179610419T>A	ENST00000591111.1	-	46	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.N5570Y			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATAAACAGGTTATGGAACCCT	0.438																																					p.N5570Y		Atlas-SNP	.											.	TTN	18412	.	0			c.A16708T						.						114.0	110.0	111.0					2																	179610419		2203	4299	6502	SO:0001627	intron_variant	7273	exon46			ACAGGTTATGGAA	X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-3771A>T	chr2.hg19:g.179610419T>A		123.0	0.0		108.0	31.0	NM_133379	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	ENST00000591111.1	hg19		.	.	.	.	.	.	.	.	.	.	T	15.20	2.762018	0.49468	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.67171	-0.25	6.17	6.17	0.99709	.	.	.	.	.	T	0.69895	0.3162	N	0.21373	0.66	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	T	0.72924	-0.4144	9	0.59425	D	0.04	.	12.6398	0.56702	0.0:0.0:0.1377:0.8623	.	5570	Q8WZ42-6	.	Y	5570;851	ENSP00000354117:N5570Y	ENSP00000304714:N851Y	N	-	1	0	TTN	179318664	1.000000	0.71417	0.997000	0.53966	0.646000	0.38490	4.772000	0.62324	2.371000	0.80710	0.533000	0.62120	AAC	.	.		0.438	TTN-019	PUTATIVE	basic	protein_coding	protein_coding	OTTHUMT00000460310.1	NM_133378	
ZNF804A	91752	hgsc.bcm.edu	37	2	185801445	185801445	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:185801445C>G	ENST00000302277.6	+	4	1916	c.1322C>G	c.(1321-1323)tCa>tGa	p.S441*		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	441							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						CAGTGGCCATCAGAAATGCTG	0.328																																					p.S441X		Atlas-SNP	.											.	ZNF804A	322	.	0			c.C1322G						.						112.0	117.0	115.0					2																	185801445		2203	4299	6502	SO:0001587	stop_gained	91752	exon4			GGCCATCAGAAAT	AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.1322C>G	chr2.hg19:g.185801445C>G	ENSP00000303252:p.Ser441*	323.0	0.0		308.0	85.0	NM_194250	A7E253|Q6ZN26	Nonsense_Mutation	SNP	ENST00000302277.6	hg19	CCDS2291.1	.	.	.	.	.	.	.	.	.	.	C	43	10.062489	0.99329	.	.	ENSG00000170396	ENST00000302277	.	.	.	5.6	5.6	0.85130	.	0.289408	0.25019	N	0.033770	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.9591	18.5921	0.91217	0.0:1.0:0.0:0.0	.	.	.	.	X	441	.	ENSP00000303252:S441X	S	+	2	0	ZNF804A	185509690	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.294000	0.78760	2.642000	0.89623	0.591000	0.81541	TCA	.	.		0.328	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255871.1	NM_194250	
UNC80	285175	hgsc.bcm.edu	37	2	210683819	210683819	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:210683819T>C	ENST00000439458.1	+	12	1876	c.1796T>C	c.(1795-1797)cTc>cCc	p.L599P	UNC80_ENST00000272845.6_Missense_Mutation_p.L599P	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	599					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						ATGAGGAAACTCTGCAACCAG	0.488																																					p.L599P		Atlas-SNP	.											.	UNC80	280	.	0			c.T1796C						.						124.0	101.0	108.0					2																	210683819		692	1591	2283	SO:0001583	missense	285175	exon12			GGAAACTCTGCAA	AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.1796T>C	chr2.hg19:g.210683819T>C	ENSP00000391088:p.Leu599Pro	146.0	0.0		162.0	34.0	NM_182587	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	ENST00000439458.1	hg19	CCDS46504.1	.	.	.	.	.	.	.	.	.	.	T	22.9	4.356230	0.82243	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.39056	1.1;1.1	5.81	5.81	0.92471	.	.	.	.	.	T	0.51227	0.1662	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	T	0.57069	-0.7874	9	0.72032	D	0.01	-5.8356	16.161	0.81712	0.0:0.0:0.0:1.0	.	599	Q8N2C7	UNC80_HUMAN	P	599	ENSP00000391088:L599P;ENSP00000272845:L599P	ENSP00000272845:L599P	L	+	2	0	UNC80	210392064	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	8.040000	0.89188	2.218000	0.71995	0.379000	0.24179	CTC	.	.		0.488	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding		NM_182587	
OBSL1	23363	hgsc.bcm.edu	37	2	220424039	220424039	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:220424039C>T	ENST00000404537.1	-	9	3190	c.3134G>A	c.(3133-3135)cGc>cAc	p.R1045H	OBSL1_ENST00000603926.1_Missense_Mutation_p.R1045H|OBSL1_ENST00000265318.4_Missense_Mutation_p.R1045H|OBSL1_ENST00000373876.1_Missense_Mutation_p.R1045H|OBSL1_ENST00000265317.5_Missense_Mutation_p.R36H|RP11-256I23.2_ENST00000597192.1_RNA	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	1045	Ig-like 8.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		TAGCACCAGGCGGCAGCGTGG	0.632																																					p.R1045H		Atlas-SNP	.											.	OBSL1	120	.	0			c.G3134A						.						120.0	133.0	128.0					2																	220424039		2191	4281	6472	SO:0001583	missense	23363	exon9			ACCAGGCGGCAGC	BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.3134G>A	chr2.hg19:g.220424039C>T	ENSP00000385636:p.Arg1045His	114.0	0.0		127.0	18.0	NM_001173431	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	ENST00000404537.1	hg19	CCDS46520.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.3|25.3	4.622685|4.622685	0.87460|0.87460	.|.	.|.	ENSG00000124006|ENSG00000124006	ENST00000456147|ENST00000265318;ENST00000404537;ENST00000373876;ENST00000265317	.|T;T;T;T	.|0.42513	.|3.51;3.51;3.51;0.97	4.34|4.34	4.34|4.34	0.51931|0.51931	.|Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.65565|0.65565	0.2703|0.2703	M|M	0.82823|0.82823	2.61|2.61	0.50632|0.50632	D|D	0.99988|0.99988	.|D;D;D;D	.|0.89917	.|0.976;1.0;1.0;1.0	.|P;D;D;D	.|0.97110	.|0.756;0.999;0.999;1.0	T|T	0.65059|0.65059	-0.6260|-0.6260	5|9	.|0.19147	.|T	.|0.46	.|.	17.0511|17.0511	0.86519|0.86519	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|36;1046;1045;36	.|B7Z5P5;A4KVA4;O75147;E7ER99	.|.;.;OBSL1_HUMAN;.	T|H	39|1045;1045;1045;36	.|ENSP00000265318:R1045H;ENSP00000385636:R1045H;ENSP00000362983:R1045H;ENSP00000265317:R36H	.|ENSP00000265317:R36H	A|R	-|-	1|2	0|0	OBSL1|OBSL1	220132283|220132283	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.949000|0.949000	0.60115|0.60115	3.085000|3.085000	0.50151|0.50151	2.256000|2.256000	0.74724|0.74724	0.491000|0.491000	0.48974|0.48974	GCC|CGC	.	.		0.632	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322012.1		
FAM124B	79843	hgsc.bcm.edu	37	2	225244553	225244553	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:225244553T>A	ENST00000409685.3	-	2	1370	c.1105A>T	c.(1105-1107)Atc>Ttc	p.I369F	FAM124B_ENST00000389874.3_3'UTR	NM_001122779.1	NP_001116251.1	Q9H5Z6	F124B_HUMAN	family with sequence similarity 124B	369										endometrium(2)|large_intestine(2)|lung(7)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	16		Renal(207;0.0112)|all_lung(227;0.0126)|Lung NSC(271;0.0161)|all_hematologic(139;0.138)		Epithelial(121;4.4e-10)|all cancers(144;2.02e-07)|Lung(261;0.00766)|LUSC - Lung squamous cell carcinoma(224;0.00825)		GAATTTATGATGGTCAAGCCG	0.512																																					p.I369F		Atlas-SNP	.											.	FAM124B	71	.	0			c.A1105T						.						20.0	24.0	22.0					2																	225244553		692	1591	2283	SO:0001583	missense	79843	exon2			TTATGATGGTCAA	AK075126	CCDS2461.1, CCDS46527.1	2q36.2	2008-02-05			ENSG00000124019	ENSG00000124019			26224	protein-coding gene	gene with protein product						12477932	Standard	NM_001122779		Approved	FLJ22746	uc002vnx.3	Q9H5Z6	OTTHUMG00000133168	ENST00000409685.3:c.1105A>T	chr2.hg19:g.225244553T>A	ENSP00000386895:p.Ile369Phe	127.0	0.0		129.0	44.0	NM_001122779	A6NNC7|Q8NBZ4|Q8TAV7	Missense_Mutation	SNP	ENST00000409685.3	hg19	CCDS46527.1	.	.	.	.	.	.	.	.	.	.	T	9.827	1.187474	0.21870	.	.	ENSG00000124019	ENST00000409685	T	0.36520	1.25	5.9	-3.1	0.05315	.	.	.	.	.	T	0.20820	0.0501	N	0.14661	0.345	0.09310	N	1	P	0.37276	0.589	B	0.35971	0.215	T	0.13656	-1.0501	9	0.72032	D	0.01	-0.6236	11.7601	0.51898	0.0:0.3807:0.0:0.6193	.	369	Q9H5Z6	F124B_HUMAN	F	369	ENSP00000386895:I369F	ENSP00000386895:I369F	I	-	1	0	FAM124B	224952797	0.004000	0.15560	0.000000	0.03702	0.005000	0.04900	-0.100000	0.10990	-1.073000	0.03137	-0.427000	0.05922	ATC	.	.		0.512	FAM124B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000330873.1	NM_024785	
SPHKAP	80309	hgsc.bcm.edu	37	2	228855727	228855727	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:228855727T>C	ENST00000392056.3	-	11	4994	c.4948A>G	c.(4948-4950)Aga>Gga	p.R1650G	SPHKAP_ENST00000344657.5_Missense_Mutation_p.R1621G	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1650						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		TTTTCAATTCTGTTTTCCTGA	0.458																																					p.R1650G		Atlas-SNP	.											.	SPHKAP	750	.	0			c.A4948G						.						79.0	78.0	78.0					2																	228855727		2203	4300	6503	SO:0001583	missense	80309	exon11			CAATTCTGTTTTC		CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4948A>G	chr2.hg19:g.228855727T>C	ENSP00000375909:p.Arg1650Gly	64.0	0.0		57.0	17.0	NM_001142644	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	ENST00000392056.3	hg19	CCDS46537.1	.	.	.	.	.	.	.	.	.	.	T	19.05	3.751148	0.69533	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.06528	3.29;3.29	6.17	1.0	0.19881	A-kinase anchor 110kDa, C-terminal (1);	0.237565	0.47093	D	0.000245	T	0.16041	0.0386	L	0.60455	1.87	0.36432	D	0.864966	B;D	0.65815	0.265;0.995	B;D	0.68483	0.11;0.958	T	0.02933	-1.1092	10	0.66056	D	0.02	.	8.5385	0.33377	0.0:0.0652:0.3776:0.5572	.	1650;1621	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	G	1650;1621	ENSP00000375909:R1650G;ENSP00000339886:R1621G	ENSP00000339886:R1621G	R	-	1	2	SPHKAP	228563971	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	2.434000	0.44802	0.153000	0.19213	0.533000	0.62120	AGA	.	.		0.458	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000331750.1	NM_030623	
ILKAP	80895	hgsc.bcm.edu	37	2	239079292	239079292	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr2:239079292C>G	ENST00000254654.3	-	12	1239	c.1064G>C	c.(1063-1065)gGg>gCg	p.G355A		NM_030768.2	NP_110395.1	Q9H0C8	ILKAP_HUMAN	integrin-linked kinase-associated serine/threonine phosphatase	355	PP2C-like.				protein dephosphorylation (GO:0006470)|regulation of nuclear cell cycle DNA replication (GO:0033262)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_lung(227;0.152)|all_hematologic(139;0.158)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;5.49e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.93e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.82e-08)|BRCA - Breast invasive adenocarcinoma(100;0.00012)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0163)		TGCGGACTTCCCTTCCCGGGT	0.602																																					p.G355A		Atlas-SNP	.											.	ILKAP	42	.	0			c.G1064C						.						38.0	39.0	38.0					2																	239079292		2203	4300	6503	SO:0001583	missense	80895	exon12			GACTTCCCTTCCC	AY024365	CCDS2526.1	2q37.3	2012-04-17	2010-10-25		ENSG00000132323	ENSG00000132323	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	15566	protein-coding gene	gene with protein product			"""integrin-linked kinase-associated serine/threonine phosphatase 2C"""				Standard	NM_030768		Approved	DKFZP434J2031, FLJ10181	uc002vxv.3	Q9H0C8	OTTHUMG00000133334	ENST00000254654.3:c.1064G>C	chr2.hg19:g.239079292C>G	ENSP00000254654:p.Gly355Ala	218.0	0.0		235.0	65.0	NM_030768	B3KM39	Missense_Mutation	SNP	ENST00000254654.3	hg19	CCDS2526.1	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471267	0.43942	.	.	ENSG00000132323	ENST00000254654	T	0.23552	1.9	5.69	5.69	0.88448	Protein phosphatase 2C-like (5);	0.048255	0.85682	D	0.000000	T	0.28400	0.0702	L	0.60904	1.88	0.80722	D	1	B	0.23442	0.085	B	0.27076	0.076	T	0.03157	-1.1066	10	0.24483	T	0.36	-28.543	14.8304	0.70142	0.0:0.8553:0.1447:0.0	.	355	Q9H0C8	ILKAP_HUMAN	A	355	ENSP00000254654:G355A	ENSP00000254654:G355A	G	-	2	0	ILKAP	238744031	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	2.450000	0.44943	2.688000	0.91661	0.563000	0.77884	GGG	.	.		0.602	ILKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257163.2	NM_030768	
CMTM6	54918	hgsc.bcm.edu	37	3	32544113	32544113	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:32544113T>A	ENST00000205636.3	-	1	787	c.125A>T	c.(124-126)aAg>aTg	p.K42M		NM_017801.2	NP_060271.1	Q9NX76	CKLF6_HUMAN	CKLF-like MARVEL transmembrane domain containing 6	42	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|endometrium(1)	2						CTGCAAGCCCTTGAGAACGCG	0.721																																					p.K42M		Atlas-SNP	.											.	CMTM6	5	.	0			c.A125T						.						7.0	10.0	9.0					3																	32544113		2156	4235	6391	SO:0001583	missense	54918	exon1			AAGCCCTTGAGAA	AK000403	CCDS2653.1	3p22.2	2006-08-25	2005-11-08	2005-11-08	ENSG00000091317	ENSG00000091317			19177	protein-coding gene	gene with protein product		607889	"""chemokine-like factor super family 6"", ""chemokine-like factor superfamily 6"""	CKLFSF6			Standard	NM_017801		Approved	FLJ20396	uc003cfa.1	Q9NX76	OTTHUMG00000130747	ENST00000205636.3:c.125A>T	chr3.hg19:g.32544113T>A	ENSP00000205636:p.Lys42Met	103.0	0.0		162.0	57.0	NM_017801	Q6IAC4	Missense_Mutation	SNP	ENST00000205636.3	hg19	CCDS2653.1	.	.	.	.	.	.	.	.	.	.	T	29.6	5.016499	0.93404	.	.	ENSG00000091317	ENST00000205636	T	0.32515	1.45	4.64	4.64	0.57946	Marvel (1);MARVEL-like domain (1);	0.050416	0.85682	D	0.000000	T	0.53174	0.1780	M	0.75264	2.295	0.34775	D	0.734139	D	0.89917	1.0	D	0.91635	0.999	T	0.67719	-0.5598	10	0.66056	D	0.02	.	11.0323	0.47781	0.0:0.0:0.0:1.0	.	42	Q9NX76	CKLF6_HUMAN	M	42	ENSP00000205636:K42M	ENSP00000205636:K42M	K	-	2	0	CMTM6	32519117	0.984000	0.35163	0.136000	0.22124	0.689000	0.40095	3.236000	0.51336	2.032000	0.59987	0.383000	0.25322	AAG	.	.		0.721	CMTM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253247.1		
DLEC1	9940	hgsc.bcm.edu	37	3	38157966	38157966	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:38157966C>T	ENST00000308059.6	+	28	3900	c.3879C>T	c.(3877-3879)acC>acT	p.T1293T	DLEC1_ENST00000452631.2_Silent_p.T1296T|DLEC1_ENST00000346219.3_Silent_p.T1293T					deleted in lung and esophageal cancer 1											NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(3)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	51				KIRC - Kidney renal clear cell carcinoma(284;0.0664)|Kidney(284;0.0827)		ATTGGGAGACCTATGTTCCAG	0.612																																					p.T1293T		Atlas-SNP	.											.	DLEC1	278	.	0			c.C3879T						.						39.0	40.0	40.0					3																	38157966		1963	4174	6137	SO:0001819	synonymous_variant	9940	exon28			GGAGACCTATGTT	AB020522	CCDS2672.2	3p21.3	2014-07-31			ENSG00000008226	ENSG00000008226			2899	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 81"""	604050				10213508	Standard	XM_005265630		Approved	DLC1, CFAP81	uc003chp.1	Q9Y238	OTTHUMG00000131085	ENST00000308059.6:c.3879C>T	chr3.hg19:g.38157966C>T		59.0	0.0		67.0	19.0	NM_007337		Silent	SNP	ENST00000308059.6	hg19	CCDS2672.2																																																																																			.	.		0.612	DLEC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000253745.3	NM_007337	
ULK4	54986	hgsc.bcm.edu	37	3	41977412	41977412	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:41977412T>G	ENST00000301831.4	-	4	721	c.259A>C	c.(259-261)Att>Ctt	p.I87L	ULK4_ENST00000420927.1_Missense_Mutation_p.I87L	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	87	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TCTTGAGCAATAACTGTTTTT	0.418																																					p.I87L		Atlas-SNP	.											.	ULK4	150	.	0			c.A259C						.						114.0	110.0	112.0					3																	41977412		1911	4155	6066	SO:0001583	missense	54986	exon4			GAGCAATAACTGT	AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.259A>C	chr3.hg19:g.41977412T>G	ENSP00000301831:p.Ile87Leu	70.0	0.0		90.0	27.0	NM_017886	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	ENST00000301831.4	hg19	CCDS43071.1	.	.	.	.	.	.	.	.	.	.	T	13.90	2.376492	0.42105	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.62788	0.0;0.0	5.86	5.86	0.93980	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.095687	0.64402	D	0.000001	T	0.33411	0.0862	N	0.01779	-0.725	0.80722	D	1	B;B	0.34147	0.127;0.438	B;B	0.34652	0.133;0.187	T	0.48387	-0.9040	10	0.02654	T	1	.	15.2278	0.73364	0.0:0.0:0.0:1.0	.	87;87	B4E2M4;Q96C45	.;ULK4_HUMAN	L	87	ENSP00000301831:I87L;ENSP00000412187:I87L	ENSP00000301831:I87L	I	-	1	0	ULK4	41952416	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	3.582000	0.53921	2.241000	0.73720	0.533000	0.62120	ATT	.	.		0.418	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000343490.1	XM_929989	
TGM4	7047	hgsc.bcm.edu	37	3	44938212	44938212	+	Missense_Mutation	SNP	T	T	A	rs142027211		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:44938212T>A	ENST00000296125.4	+	6	629	c.561T>A	c.(559-561)aaT>aaA	p.N187K	RP11-272D20.2_ENST00000427258.1_RNA	NM_003241.3	NP_003232.2	P49221	TGM4_HUMAN	transglutaminase 4	187					mating plug formation (GO:0042628)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			NS(1)|breast(1)|endometrium(2)|large_intestine(9)|lung(21)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	38				BRCA - Breast invasive adenocarcinoma(193;0.00963)|KIRC - Kidney renal clear cell carcinoma(197;0.0546)|Kidney(197;0.0686)	L-Glutamine(DB00130)	TTGAGAAAAATGTCCTGGACT	0.483																																					p.N187K		Atlas-SNP	.											.	TGM4	82	.	0			c.T561A						.	T	LYS/ASN	1,4405	4.2+/-10.8	0,1,2202	103.0	102.0	102.0		561	-3.3	0.0	3	dbSNP_134	102	1,8599	1.2+/-3.3	0,1,4299	no	missense	TGM4	NM_003241.3	94	0,2,6501	AA,AT,TT		0.0116,0.0227,0.0154	benign	187/685	44938212	2,13004	2203	4300	6503	SO:0001583	missense	7047	exon6			GAAAAATGTCCTG	BC007003	CCDS2723.1	3p22-p21.33	2013-05-02	2013-05-02		ENSG00000163810	ENSG00000163810	2.3.2.13	"""Transglutaminases"""	11780	protein-coding gene	gene with protein product		600585	"""transglutaminase 4 (prostate)"""			7665178, 7916568	Standard	NM_003241		Approved	TGP	uc003coc.4	P49221	OTTHUMG00000133096	ENST00000296125.4:c.561T>A	chr3.hg19:g.44938212T>A	ENSP00000296125:p.Asn187Lys	86.0	0.0		92.0	21.0	NM_003241	Q16707|Q96QN4	Missense_Mutation	SNP	ENST00000296125.4	hg19	CCDS2723.1	.	.	.	.	.	.	.	.	.	.	T	9.221	1.033352	0.19590	2.27E-4	1.16E-4	ENSG00000163810	ENST00000296125	D	0.88741	-2.42	2.43	-3.3	0.05003	.	3.097460	0.02523	U	0.092773	T	0.81302	0.4794	L	0.33624	1.015	0.09310	N	1	B	0.19073	0.033	B	0.19148	0.024	T	0.64364	-0.6425	10	0.41790	T	0.15	.	3.8373	0.08899	0.401:0.1563:0.0:0.4427	.	187	P49221	TGM4_HUMAN	K	187	ENSP00000296125:N187K	ENSP00000296125:N187K	N	+	3	2	TGM4	44913216	0.000000	0.05858	0.002000	0.10522	0.406000	0.30931	-2.574000	0.00911	-0.655000	0.05387	-0.456000	0.05471	AAT	.	T|1.000;A|0.000		0.483	TGM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256755.2	NM_003241	
RBM5	10181	hgsc.bcm.edu	37	3	50137458	50137458	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:50137458A>C	ENST00000347869.3	+	5	558	c.383A>C	c.(382-384)gAt>gCt	p.D128A	RBM5_ENST00000469838.1_Missense_Mutation_p.D128A	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	128	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CAGCCTGCGGATGTGAGGCTG	0.453																																					p.D128A		Atlas-SNP	.											.	RBM5	76	.	0			c.A383C						.						116.0	94.0	102.0					3																	50137458		2203	4300	6503	SO:0001583	missense	10181	exon5			CTGCGGATGTGAG	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.383A>C	chr3.hg19:g.50137458A>C	ENSP00000343054:p.Asp128Ala	116.0	0.0		102.0	31.0	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	hg19	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	A	20.3	3.963597	0.74016	.	.	ENSG00000003756	ENST00000347869;ENST00000469838;ENST00000441305;ENST00000543047;ENST00000539538	T;T;T	0.46063	3.04;0.88;0.88	5.86	5.86	0.93980	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.050258	0.85682	D	0.000000	T	0.55081	0.1898	L	0.37800	1.135	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.998;0.996	T	0.50939	-0.8768	9	.	.	.	-19.9812	16.2479	0.82454	1.0:0.0:0.0:0.0	.	128;128	P52756;E1CJT4	RBM5_HUMAN;.	A	128;128;128;127;127	ENSP00000343054:D128A;ENSP00000419534:D128A;ENSP00000390711:D128A	.	D	+	2	0	RBM5	50112462	1.000000	0.71417	0.929000	0.37066	0.997000	0.91878	8.923000	0.92808	2.241000	0.73720	0.533000	0.62120	GAT	.	.		0.453	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
RBM5	10181	hgsc.bcm.edu	37	3	50143082	50143082	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:50143082A>G	ENST00000347869.3	+	10	970	c.795A>G	c.(793-795)atA>atG	p.I265M		NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	265	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCCGCCTCATAAAAGACAAAC	0.463																																					p.I265M		Atlas-SNP	.											.	RBM5	76	.	0			c.A795G						.						110.0	100.0	103.0					3																	50143082		2203	4300	6503	SO:0001583	missense	10181	exon10			CCTCATAAAAGAC	U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.795A>G	chr3.hg19:g.50143082A>G	ENSP00000343054:p.Ile265Met	115.0	0.0		128.0	34.0	NM_005778	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	ENST00000347869.3	hg19	CCDS2810.1	.	.	.	.	.	.	.	.	.	.	A	22.9	4.350056	0.82132	.	.	ENSG00000003756	ENST00000347869;ENST00000543047	T	0.07908	3.15	6.16	0.562	0.17290	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (2);	0.000000	0.85682	D	0.000000	T	0.20210	0.0486	L	0.52905	1.665	0.80722	D	1	D	0.69078	0.997	D	0.83275	0.996	T	0.00191	-1.1936	10	0.41790	T	0.15	-16.7755	12.1742	0.54176	0.2604:0.6382:0.0:0.1014	.	265	P52756	RBM5_HUMAN	M	265;264	ENSP00000343054:I265M	ENSP00000343054:I265M	I	+	3	3	RBM5	50118086	0.997000	0.39634	0.999000	0.59377	0.997000	0.91878	0.759000	0.26461	0.144000	0.18951	0.528000	0.53228	ATA	.	.		0.463	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000345797.3	NM_005778	
SLMAP	7871	hgsc.bcm.edu	37	3	57882301	57882301	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:57882301G>C	ENST00000428312.1	+	14	1467	c.1373G>C	c.(1372-1374)aGc>aCc	p.S458T	SLMAP_ENST00000472546.1_3'UTR|SLMAP_ENST00000442599.2_5'UTR|SLMAP_ENST00000495364.1_5'UTR|SLMAP_ENST00000449503.2_Missense_Mutation_p.S420T|SLMAP_ENST00000383718.3_Missense_Mutation_p.S454T|SLMAP_ENST00000295952.3_Missense_Mutation_p.S441T|SLMAP_ENST00000295951.3_Missense_Mutation_p.S441T|SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000494088.1_5'UTR			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	458					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		AAGGAAAAAAGCAGTGACGAC	0.343																																					p.S441T		Atlas-SNP	.											.	SLMAP	46	.	0			c.G1322C						.						57.0	62.0	60.0					3																	57882301		2202	4300	6502	SO:0001583	missense	7871	exon13			AAAAAAGCAGTGA	AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.1373G>C	chr3.hg19:g.57882301G>C	ENSP00000398661:p.Ser458Thr	360.0	0.0		417.0	127.0	NM_007159	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	ENST00000428312.1	hg19		.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	18.57|18.57|18.57	3.652420|3.652420|3.652420	0.67472|0.67472|0.67472	.|.|.	.|.|.	ENSG00000163681|ENSG00000163681|ENSG00000163681	ENST00000417128|ENST00000416658;ENST00000438794|ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503;ENST00000537224;ENST00000465203	.|T;T|T;T;T;T;T	.|0.58060|0.55413	.|0.73;0.36|1.21;1.21;0.52;1.17;1.33	6.08|6.08|6.08	6.08|6.08|6.08	0.98989|0.98989|0.98989	.|.|.	.|.|0.000000	.|.|0.85682	.|.|D	.|.|0.000000	T|T|T	0.70500|0.70500|0.70500	0.3231|0.3231|0.3231	M|M|M	0.68952|0.68952|0.68952	2.095|2.095|2.095	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|.|D;D;D;D;D	.|.|0.76494	.|.|0.988;0.999;0.999;0.996;0.988	.|.|D;D;D;D;D	.|.|0.83275	.|.|0.992;0.996;0.991;0.99;0.992	T|T|T	0.61008|0.61008|0.61008	-0.7149|-0.7149|-0.7149	5|7|10	.|0.40728|0.10902	.|T|T	.|0.16|0.67	-6.3822|-6.3822|-6.3822	20.6721|20.6721|20.6721	0.99693|0.99693|0.99693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.|.	.|.|52;420;458;441;454	.|.|Q14BN4-4;Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.|.|.;.;SLMAP_HUMAN;.;.	P|N|T	42|65;36|441;441;454;458;420;52;165	.|ENSP00000389978:K65N;ENSP00000391886:K36N|ENSP00000295951:S441T;ENSP00000295952:S441T;ENSP00000373224:S454T;ENSP00000398661:S458T;ENSP00000412945:S420T	.|ENSP00000389978:K65N|ENSP00000295951:S441T	A|K|S	+|+|+	1|3|2	0|2|0	SLMAP|SLMAP|SLMAP	57857341|57857341|57857341	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.989000|0.989000|0.989000	0.77384|0.77384|0.77384	7.781000|7.781000|7.781000	0.85668|0.85668|0.85668	2.894000|2.894000|2.894000	0.99253|0.99253|0.99253	0.591000|0.591000|0.591000	0.81541|0.81541|0.81541	GCA|AAG|AGC	.	.		0.343	SLMAP-013	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000351584.1	NM_007159	
EPHA6	285220	hgsc.bcm.edu	37	3	96945199	96945199	+	Silent	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:96945199T>G	ENST00000389672.5	+	4	1244	c.1206T>G	c.(1204-1206)tcT>tcG	p.S402S	EPHA6_ENST00000470610.2_Silent_p.S402S	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	308	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.					integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AAGCAACTTCTGTCTGTCAGT	0.383																																					p.S402S		Atlas-SNP	.											.	EPHA6	439	.	0			c.T1206G						.						159.0	152.0	154.0					3																	96945199		1845	4088	5933	SO:0001819	synonymous_variant	285220	exon4			AACTTCTGTCTGT	AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.1206T>G	chr3.hg19:g.96945199T>G		126.0	0.0		111.0	27.0	NM_001080448	D6RAL5	Silent	SNP	ENST00000389672.5	hg19	CCDS46876.1																																																																																			.	.		0.383	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000353845.3	NM_001080448	
OR5AC2	81050	hgsc.bcm.edu	37	3	97806627	97806627	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:97806627T>C	ENST00000358642.2	+	1	611	c.611T>C	c.(610-612)tTt>tCt	p.F204S		NM_054106.1	NP_473447.1	Q9NZP5	O5AC2_HUMAN	olfactory receptor, family 5, subfamily AC, member 2	204					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|large_intestine(3)|lung(13)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	28						ATATTTATTTTTGGTGCTTTT	0.303																																					p.F204S		Atlas-SNP	.											.	OR5AC2	64	.	0			c.T611C						.						39.0	41.0	41.0					3																	97806627		2203	4299	6502	SO:0001583	missense	81050	exon1			TTATTTTTGGTGC	AF179759	CCDS33796.1	3q11.2	2013-09-23			ENSG00000196578	ENSG00000196578		"""GPCR / Class A : Olfactory receptors"""	15431	protein-coding gene	gene with protein product							Standard	NM_054106		Approved	HSA1	uc011bgs.2	Q9NZP5	OTTHUMG00000160083	ENST00000358642.2:c.611T>C	chr3.hg19:g.97806627T>C	ENSP00000351466:p.Phe204Ser	67.0	0.0		94.0	25.0	NM_054106		Missense_Mutation	SNP	ENST00000358642.2	hg19	CCDS33796.1	.	.	.	.	.	.	.	.	.	.	T	13.86	2.362749	0.41902	.	.	ENSG00000196578	ENST00000358642	T	0.00183	8.6	4.51	3.35	0.38373	GPCR, rhodopsin-like superfamily (1);	0.207171	0.23844	U	0.044008	T	0.00178	0.0005	L	0.37850	1.14	0.09310	N	1	B	0.27700	0.186	B	0.36186	0.219	T	0.25433	-1.0132	10	0.62326	D	0.03	-16.4108	8.2278	0.31579	0.0:0.0964:0.0:0.9036	.	204	Q9NZP5	O5AC2_HUMAN	S	204	ENSP00000351466:F204S	ENSP00000351466:F204S	F	+	2	0	OR5AC2	99289317	0.003000	0.15002	0.017000	0.16124	0.110000	0.19582	0.714000	0.25808	0.785000	0.33685	0.481000	0.45027	TTT	.	.		0.303	OR5AC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359116.1		
UPK1B	7348	hgsc.bcm.edu	37	3	118906777	118906777	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:118906777A>G	ENST00000264234.3	+	3	374	c.225A>G	c.(223-225)ctA>ctG	p.L75L	UPK1B_ENST00000497685.1_5'UTR|UPK1B_ENST00000460625.1_Silent_p.L75L	NM_006952.3	NP_008883.2	O75841	UPK1B_HUMAN	uroplakin 1B	75					epithelial cell differentiation (GO:0030855)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	structural molecule activity (GO:0005198)			breast(1)|endometrium(3)|large_intestine(2)|lung(6)|pancreas(1)|skin(1)	14				GBM - Glioblastoma multiforme(114;0.222)		TGTCTGTTCTAGGCATTGTAG	0.498																																					p.L75L		Atlas-SNP	.											.	UPK1B	27	.	0			c.A225G						.						137.0	122.0	127.0					3																	118906777		2203	4300	6503	SO:0001819	synonymous_variant	7348	exon3			TGTTCTAGGCATT	AF082888	CCDS2985.1	3q13.32	2013-02-14			ENSG00000114638	ENSG00000114638		"""Tetraspanins"""	12578	protein-coding gene	gene with protein product		602380		UPK1		9935153, 9846985	Standard	NM_006952		Approved	TSPAN20	uc003ecc.3	O75841	OTTHUMG00000159354	ENST00000264234.3:c.225A>G	chr3.hg19:g.118906777A>G		120.0	0.0		115.0	35.0	NM_006952	O60753|Q9UIM2|Q9UNX6	Silent	SNP	ENST00000264234.3	hg19	CCDS2985.1																																																																																			.	.		0.498	UPK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354883.2		
KALRN	8997	hgsc.bcm.edu	37	3	124207122	124207122	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:124207122A>G	ENST00000240874.3	+	29	4507	c.4350A>G	c.(4348-4350)ccA>ccG	p.P1450P	KALRN_ENST00000460856.1_Silent_p.P1441P|KALRN_ENST00000360013.3_Silent_p.P1450P	NM_003947.4	NP_003938.1	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	1450	DH 1. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TCAGTGTCCCAAAGAAAGCCA	0.512																																					p.P1450P		Atlas-SNP	.											.	KALRN	556	.	0			c.A4350G						.						136.0	105.0	116.0					3																	124207122		2203	4300	6503	SO:0001819	synonymous_variant	8997	exon29			TGTCCCAAAGAAA	U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000240874.3:c.4350A>G	chr3.hg19:g.124207122A>G		128.0	0.0		105.0	23.0	NM_003947	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Silent	SNP	ENST00000240874.3	hg19	CCDS3027.1	.	.	.	.	.	.	.	.	.	.	A	10.12	1.263994	0.23136	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.14	1.66	0.24008	.	.	.	.	.	T	0.59649	0.2209	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53486	-0.8432	4	.	.	.	.	11.1575	0.48497	0.3371:0.5892:0.0737:0.0	.	.	.	.	R	1419	.	.	Q	+	2	0	KALRN	125689812	0.192000	0.23301	1.000000	0.80357	0.998000	0.95712	-0.345000	0.07770	0.149000	0.19098	0.533000	0.62120	CAA	.	.		0.512	KALRN-005	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000258843.4	NM_003947	
CCDC37	348807	hgsc.bcm.edu	37	3	126137512	126137512	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:126137512A>T	ENST00000352312.1	+	7	644	c.545A>T	c.(544-546)gAg>gTg	p.E182V	CCDC37_ENST00000505024.1_Missense_Mutation_p.E183V|CCDC37_ENST00000393425.1_Missense_Mutation_p.E183V	NM_182628.2	NP_872434.2	Q494V2	CCD37_HUMAN	coiled-coil domain containing 37	182										NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|skin(3)	23				GBM - Glioblastoma multiforme(114;0.166)		GCGACCAAAGAGGAGGCCAGG	0.652																																					p.E182V		Atlas-SNP	.											.	CCDC37	69	.	0			c.A545T						.						33.0	36.0	35.0					3																	126137512		2197	4293	6490	SO:0001583	missense	348807	exon7			CCAAAGAGGAGGC	AK097402	CCDS3037.1	3q21.2	2014-07-31			ENSG00000163885	ENSG00000163885			26842	protein-coding gene	gene with protein product						23569216	Standard	NM_182628		Approved	FLJ40083, MIA1	uc003eiu.1	Q494V2	OTTHUMG00000162691	ENST00000352312.1:c.545A>T	chr3.hg19:g.126137512A>T	ENSP00000344749:p.Glu182Val	86.0	0.0		77.0	22.0	NM_182628	D3DNA8|Q494V1|Q494V4|Q8N838	Missense_Mutation	SNP	ENST00000352312.1	hg19	CCDS3037.1	.	.	.	.	.	.	.	.	.	.	A	16.63	3.177307	0.57692	.	.	ENSG00000163885	ENST00000352312;ENST00000393425;ENST00000505024	T;T;T	0.18338	2.22;2.22;2.22	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.44664	0.1304	M	0.85542	2.76	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.75484	0.976;0.986	T	0.48736	-0.9009	10	0.54805	T	0.06	-32.4345	12.4869	0.55879	1.0:0.0:0.0:0.0	.	183;182	Q494V2-2;Q494V2	.;CCD37_HUMAN	V	182;183;183	ENSP00000344749:E182V;ENSP00000377076:E183V;ENSP00000423046:E183V	ENSP00000344749:E182V	E	+	2	0	CCDC37	127620202	1.000000	0.71417	0.796000	0.32109	0.093000	0.18481	7.773000	0.85462	1.845000	0.53610	0.402000	0.26972	GAG	.	.		0.652	CCDC37-001	KNOWN	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000370099.4	NM_182628	
GATA2	2624	hgsc.bcm.edu	37	3	128205213	128205213	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:128205213T>A	ENST00000341105.2	-	3	561		c.e3-2		RP11-475N22.4_ENST00000473958.1_RNA|RP11-475N22.4_ENST00000464242.1_RNA|GATA2_ENST00000430265.2_Splice_Site|GATA2_ENST00000487848.1_Splice_Site|RP11-475N22.4_ENST00000468377.1_RNA	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2						blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		TCAGGCGGGCTGCGGGCAAAG	0.642			Mis		AML(CML blast transformation)																																.		Atlas-SNP	.		Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	.	GATA2	122	.	0			c.230-2A>T						.						10.0	14.0	12.0					3																	128205213		2144	4208	6352	SO:0001630	splice_region_variant	2624	exon5			GCGGGCTGCGGGC	AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.230-2A>T	chr3.hg19:g.128205213T>A		51.0	0.0		42.0	17.0	NM_001145661	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	Splice_Site	SNP	ENST00000341105.2	hg19	CCDS3049.1	.	.	.	.	.	.	.	.	.	.	T	16.90	3.249196	0.59103	.	.	ENSG00000179348	ENST00000341105;ENST00000430265;ENST00000487848;ENST00000492608	.	.	.	4.63	3.37	0.38596	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.5582	0.45129	0.0:0.0:0.1621:0.8379	.	.	.	.	.	-1	.	.	.	-	.	.	GATA2	129687903	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	3.853000	0.55941	1.702000	0.51228	0.247000	0.18012	.	.	.		0.642	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000356925.1	NM_032638	Intron
PRR23A	729627	hgsc.bcm.edu	37	3	138724450	138724450	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:138724450G>A	ENST00000383163.2	-	1	660	c.661C>T	c.(661-663)Cgc>Tgc	p.R221C	MRPS22_ENST00000495075.1_5'Flank	NM_001134659.1	NP_001128131.1	A6NEV1	PR23A_HUMAN	proline rich 23A	221	Pro-rich.									endometrium(3)|kidney(1)|lung(7)	11						TCCAGAAGGCGGAATTCCGGG	0.682																																					p.R221C		Atlas-SNP	.											.	PRR23A	35	.	0			c.C661T						.						34.0	40.0	38.0					3																	138724450		692	1591	2283	SO:0001583	missense	729627	exon1			GAAGGCGGAATTC		CCDS46923.1	3q22.3	2014-06-03				ENSG00000206260			37172	protein-coding gene	gene with protein product							Standard	NM_001134659		Approved		uc011bms.2	A6NEV1		ENST00000383163.2:c.661C>T	chr3.hg19:g.138724450G>A	ENSP00000372649:p.Arg221Cys	206.0	0.0		228.0	55.0	NM_001134659		Missense_Mutation	SNP	ENST00000383163.2	hg19	CCDS46923.1	.	.	.	.	.	.	.	.	.	.	G	13.92	2.379666	0.42207	.	.	ENSG00000206260	ENST00000383163	.	.	.	3.23	-0.918	0.10482	.	0.965081	0.08521	N	0.933459	T	0.12987	0.0315	N	0.08118	0	0.09310	N	1	P	0.40970	0.734	B	0.38921	0.285	T	0.12578	-1.0542	9	0.72032	D	0.01	.	0.6688	0.00855	0.2363:0.1892:0.3812:0.1934	.	221	A6NEV1	PR23A_HUMAN	C	221	.	ENSP00000372649:R221C	R	-	1	0	PRR23A	140207140	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	0.035000	0.13797	-0.204000	0.10235	0.591000	0.81541	CGC	.	.		0.682	PRR23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000361503.1	NM_001134659	
PIK3CA	5290	hgsc.bcm.edu	37	3	178916869	178916869	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:178916869A>T	ENST00000263967.3	+	2	413	c.256A>T	c.(256-258)Aca>Tca	p.T86S		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	86	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTTTGATGAAACAAGACGACT	0.368		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											p.T86S	Colon(199;1504 1750 3362 26421 31210 32040)	Atlas-SNP	.		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	.	PIK3CA	8460	.	0			c.A256T						.						108.0	103.0	105.0					3																	178916869		1821	4082	5903	SO:0001583	missense	5290	exon2			GATGAAACAAGAC		CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.256A>T	chr3.hg19:g.178916869A>T	ENSP00000263967:p.Thr86Ser	271.0	0.0		285.0	77.0	NM_006218	Q14CW1|Q99762	Missense_Mutation	SNP	ENST00000263967.3	hg19	CCDS43171.1	.	.	.	.	.	.	.	.	.	.	A	14.05	2.418975	0.42918	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.73152	-0.72;-0.72	5.44	5.44	0.79542	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	T	0.49795	0.1578	N	0.04880	-0.145	0.80722	D	1	B	0.10296	0.003	B	0.12837	0.008	T	0.46952	-0.9154	9	.	.	.	-9.8977	15.4956	0.75646	1.0:0.0:0.0:0.0	.	86	P42336	PK3CA_HUMAN	S	86	ENSP00000263967:T86S;ENSP00000417479:T86S	.	T	+	1	0	PIK3CA	180399563	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.800000	0.69108	2.059000	0.61396	0.454000	0.30748	ACA	.	.		0.368	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000348409.2		
JAKMIP1	152789	hgsc.bcm.edu	37	4	6027974	6027974	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:6027974G>A	ENST00000409021.3	-	21	2926	c.2477C>T	c.(2476-2478)gCa>gTa	p.A826V	JAKMIP1_ENST00000409371.3_Missense_Mutation_p.A641V	NM_001099433.1	NP_001092903.1	Q96N16	JKIP1_HUMAN	janus kinase and microtubule interacting protein 1	0					cognition (GO:0050890)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|microtubule (GO:0005874)|ribonucleoprotein complex (GO:0030529)	GABA receptor binding (GO:0050811)|RNA binding (GO:0003723)			NS(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						Cagaatgaatgctagtgagaa	0.338																																					p.A826V		Atlas-SNP	.											.	JAKMIP1	250	.	0			c.C2477T						.						50.0	48.0	48.0					4																	6027974		950	2098	3048	SO:0001583	missense	152789	exon21			ATGAATGCTAGTG	AK056126	CCDS3385.1, CCDS47005.1	4p16.1	2013-10-11	2009-08-13		ENSG00000152969	ENSG00000152969			26460	protein-coding gene	gene with protein product		611195				18941173	Standard	NM_144720		Approved	MARLIN1, JAMIP1, Gababrbp, FLJ31564	uc010idb.1	Q96N16	OTTHUMG00000125491	ENST00000409021.3:c.2477C>T	chr4.hg19:g.6027974G>A	ENSP00000386711:p.Ala826Val	560.0	1.0		550.0	152.0	NM_001099433	A6H2J2|A6H2J3|A6H2J4|A6H2J5|A8MTK6|B4DHZ8|B8ZZR7|D3DVT0|Q86Y69|Q8N7G3	Missense_Mutation	SNP	ENST00000409021.3	hg19	CCDS47005.1	.	.	.	.	.	.	.	.	.	.	G	15.50	2.852313	0.51270	.	.	ENSG00000152969	ENST00000409021;ENST00000409371;ENST00000425341	T;T	0.39592	1.51;1.07	5.07	5.07	0.68467	.	0.000000	0.51477	U	0.000098	T	0.63105	0.2483	.	.	.	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.70935	0.971;0.971	T	0.66586	-0.5886	9	0.62326	D	0.03	.	13.9656	0.64207	0.0:0.0:1.0:0.0	.	641;826	Q96N16-5;Q96N16-2	.;.	V	826;641;564	ENSP00000386711:A826V;ENSP00000387042:A641V	ENSP00000386711:A826V	A	-	2	0	JAKMIP1	6078875	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.041000	0.64196	2.364000	0.80123	0.655000	0.94253	GCA	.	.		0.338	JAKMIP1-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000329747.1	NM_144720	
PDGFRA	5156	hgsc.bcm.edu	37	4	55143655	55143655	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:55143655A>G	ENST00000257290.5	+	13	2218	c.1887A>G	c.(1885-1887)ctA>ctG	p.L629L	FIP1L1_ENST00000507166.1_Silent_p.L389L	NM_006206.4	NP_006197.1	P16234	PGFRA_HUMAN	platelet-derived growth factor receptor, alpha polypeptide	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adrenal gland development (GO:0030325)|cardiac myofibril assembly (GO:0055003)|cell activation (GO:0001775)|cell chemotaxis (GO:0060326)|cellular response to amino acid stimulus (GO:0071230)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic skeletal system morphogenesis (GO:0048704)|epidermal growth factor receptor signaling pathway (GO:0007173)|estrogen metabolic process (GO:0008210)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hematopoietic progenitor cell differentiation (GO:0002244)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|Leydig cell differentiation (GO:0033327)|lung development (GO:0030324)|luteinization (GO:0001553)|male genitalia development (GO:0030539)|metanephric glomerular capillary formation (GO:0072277)|negative regulation of platelet activation (GO:0010544)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet aggregation (GO:0070527)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-alpha signaling pathway (GO:0035790)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of DNA replication (GO:0045740)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of chemotaxis (GO:0050920)|regulation of mesenchymal stem cell differentiation (GO:2000739)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction involved in regulation of gene expression (GO:0023019)|viral process (GO:0016032)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|membrane (GO:0016020)|microvillus (GO:0005902)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet-derived growth factor alpha-receptor activity (GO:0005018)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|autonomic_ganglia(1)|bone(1)|breast(4)|central_nervous_system(17)|cervix(1)|endometrium(4)|eye(1)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(22)|kidney(6)|large_intestine(26)|liver(4)|lung(48)|ovary(4)|prostate(6)|skin(11)|small_intestine(49)|soft_tissue(727)|stomach(32)|urinary_tract(1)	967	all_cancers(7;0.000425)|all_lung(4;0.000343)|Lung NSC(11;0.000467)|all_epithelial(27;0.0131)|all_neural(26;0.0209)|Glioma(25;0.08)		GBM - Glioblastoma multiforme(1;4.18e-71)|all cancers(1;4.76e-45)|LUSC - Lung squamous cell carcinoma(32;0.00256)		Becaplermin(DB00102)|Imatinib(DB00619)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sunitinib(DB01268)	TGAAGATGCTAAAACGTAAGT	0.463			"""Mis, O, T"""	FIP1L1	"""GIST, idiopathic hypereosinophilic syndrome, paediatric GBM"""				Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Intestinal Neurofibromatosis	TSP Lung(21;0.16)																											p.L629L	Pancreas(151;208 1913 7310 23853 37092)	Atlas-SNP	.		Dom	yes		4	4q11-q13	5156	"""platelet-derived growth factor, alpha-receptor"""		"""L, M, O"""	.	PDGFRA	1583	.	0			c.A1887G						.						112.0	112.0	112.0					4																	55143655		2203	4300	6503	SO:0001819	synonymous_variant	5156	exon13	Familial Cancer Database	Sporadic Multiple GIST;Familial Intestinal Stromal Tumors, NF3B, subset of Familial GIST,	GATGCTAAAACGT	D50001	CCDS3495.1	4q12	2014-09-17			ENSG00000134853	ENSG00000134853		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	8803	protein-coding gene	gene with protein product		173490					Standard	NM_006206		Approved	CD140a, PDGFR2	uc003han.4	P16234	OTTHUMG00000128699	ENST00000257290.5:c.1887A>G	chr4.hg19:g.55143655A>G		146.0	0.0		137.0	35.0	NM_006206	B2RE69|E9PBH0|Q6P4H5|Q96KZ7|Q9UD28	Silent	SNP	ENST00000257290.5	hg19	CCDS3495.1																																																																																			.	.		0.463	PDGFRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250598.2	NM_006206	
AGPAT9	84803	hgsc.bcm.edu	37	4	84516038	84516038	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:84516038G>T	ENST00000395226.2	+	8	997	c.779G>T	c.(778-780)aGa>aTa	p.R260I	AGPAT9_ENST00000264409.4_Missense_Mutation_p.R260I	NM_001256421.1	NP_001243350.1	Q53EU6	GPAT3_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 9	260					CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|regulation of TOR signaling (GO:0032006)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)|glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(3)	13		Hepatocellular(203;0.114)				ATTATTCAGAGAGCTATGGTC	0.428																																					p.R260I		Atlas-SNP	.											.	AGPAT9	41	.	0			c.G779T						.						164.0	165.0	165.0					4																	84516038		2203	4300	6503	SO:0001583	missense	84803	exon8			TTCAGAGAGCTAT	AK055749	CCDS3606.1	4q21.23	2014-02-13	2008-01-29		ENSG00000138678	ENSG00000138678	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	28157	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, theta"""	610958	"""1-acylglycerol-3-phosphate O-acyltransferase 9 (lysophosphatidic acid acyltransferase, theta)"""			12975309	Standard	NM_001256421		Approved	MGC11324, LPAAT-theta, MAG1, HMFN0839	uc003how.4	Q53EU6	OTTHUMG00000130431	ENST00000395226.2:c.779G>T	chr4.hg19:g.84516038G>T	ENSP00000378651:p.Arg260Ile	74.0	0.0		78.0	22.0	NM_001256421	Q68CJ4|Q6GPI6|Q96NA3	Missense_Mutation	SNP	ENST00000395226.2	hg19	CCDS3606.1	.	.	.	.	.	.	.	.	.	.	G	24.9	4.577796	0.86645	.	.	ENSG00000138678	ENST00000395226;ENST00000264409	D;D	0.97505	-4.41;-4.41	5.81	4.03	0.46877	Phospholipid/glycerol acyltransferase (2);	0.041875	0.85682	D	0.000000	D	0.96990	0.9017	M	0.84433	2.695	0.80722	D	1	P	0.50710	0.938	P	0.47299	0.543	D	0.96704	0.9520	10	0.72032	D	0.01	-23.3819	11.1526	0.48469	0.0665:0.0:0.8055:0.128	.	260	Q53EU6	GPAT3_HUMAN	I	260	ENSP00000378651:R260I;ENSP00000264409:R260I	ENSP00000264409:R260I	R	+	2	0	AGPAT9	84735062	1.000000	0.71417	1.000000	0.80357	0.842000	0.47809	8.006000	0.88564	1.456000	0.47831	-0.140000	0.14226	AGA	.	.		0.428	AGPAT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252821.3	NM_032717	
EMCN	51705	hgsc.bcm.edu	37	4	101386642	101386642	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:101386642A>G	ENST00000296420.4	-	4	492	c.314T>C	c.(313-315)gTa>gCa	p.V105A	EMCN_ENST00000305864.3_Missense_Mutation_p.V105A|EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000511970.1_Missense_Mutation_p.V105A	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	105	Thr-rich.					extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		TGTTACTGTTACGTTTGAAAT	0.368																																					p.V105A		Atlas-SNP	.											.	EMCN	37	.	0			c.T314C						.						193.0	169.0	177.0					4																	101386642		2203	4300	6503	SO:0001583	missense	51705	exon4			ACTGTTACGTTTG	AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.314T>C	chr4.hg19:g.101386642A>G	ENSP00000296420:p.Val105Ala	99.0	0.0		108.0	34.0	NM_001159694	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	Missense_Mutation	SNP	ENST00000296420.4	hg19	CCDS3655.1	.	.	.	.	.	.	.	.	.	.	A	4.875	0.162698	0.09287	.	.	ENSG00000164035	ENST00000296420;ENST00000305864;ENST00000506300;ENST00000511970;ENST00000502569	.	.	.	3.93	-5.87	0.02297	.	5.984870	0.00541	N	0.000223	T	0.14787	0.0357	N	0.08118	0	0.09310	N	1	B;B;B	0.11235	0.003;0.004;0.004	B;B;B	0.09377	0.002;0.004;0.004	T	0.09100	-1.0690	9	0.19590	T	0.45	0.1434	1.6265	0.02724	0.3609:0.1092:0.3722:0.1576	.	105;105;105	Q9ULC0-2;B4E347;Q9ULC0	.;.;MUCEN_HUMAN	A	105;105;32;105;105	.	ENSP00000296420:V105A	V	-	2	0	EMCN	101605665	0.001000	0.12720	0.000000	0.03702	0.001000	0.01503	-0.616000	0.05591	-1.489000	0.01844	-0.290000	0.09829	GTA	.	.		0.368	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253699.2	NM_016242	
MAML3	55534	hgsc.bcm.edu	37	4	140640793	140640793	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:140640793A>T	ENST00000509479.2	-	5	3957	c.3101T>A	c.(3100-3102)cTc>cAc	p.L1034H	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					CTGCCCCGGGAGCGATGGCAT	0.647																																					p.L1030H		Atlas-SNP	.											.	MAML3	192	.	0			c.T3089A						.						30.0	32.0	31.0					4																	140640793		2172	4284	6456	SO:0001583	missense	55534	exon6			CCCGGGAGCGATG	AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3101T>A	chr4.hg19:g.140640793A>T	ENSP00000421180:p.Leu1034His	43.0	0.0		48.0	10.0	NM_018717		Missense_Mutation	SNP	ENST00000509479.2	hg19	CCDS54805.1	.	.	.	.	.	.	.	.	.	.	A	19.18	3.778402	0.70107	.	.	ENSG00000196782	ENST00000509479;ENST00000538400	T	0.29655	1.56	4.88	4.88	0.63580	.	0.172368	0.37955	N	0.001877	T	0.56411	0.1983	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	T	0.61623	-0.7025	10	0.59425	D	0.04	.	14.79	0.69833	1.0:0.0:0.0:0.0	.	1034;1030	E7EVW8;Q96JK9	.;MAML3_HUMAN	H	1034;341	ENSP00000421180:L1034H	ENSP00000421180:L1034H	L	-	2	0	MAML3	140860243	1.000000	0.71417	0.278000	0.24718	0.944000	0.59088	7.489000	0.81451	1.944000	0.56390	0.482000	0.46254	CTC	.	.		0.647	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000364934.2		
SCOC	60592	hgsc.bcm.edu	37	4	141294779	141294779	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:141294779G>A	ENST00000608372.1	+	1	116	c.89G>A	c.(88-90)cGg>cAg	p.R30Q	SCOC_ENST00000502535.1_5'Flank|SCOC_ENST00000394203.3_Intron|SCOC_ENST00000338517.4_Intron|RP11-425I13.3_ENST00000608178.1_RNA|SCOC_ENST00000394205.3_Intron|SCOC_ENST00000510586.1_5'Flank|RP11-425I13.3_ENST00000609616.1_RNA|RP11-425I13.3_ENST00000512692.2_RNA|SCOC_ENST00000506322.1_Intron|SCOC_ENST00000512749.1_Intron|SCOC_ENST00000394201.4_5'Flank|SCOC_ENST00000506597.1_Missense_Mutation_p.R30Q			Q9UIL1	SCOC_HUMAN	short coiled-coil protein	30				GRSG -> HEGR (in Ref. 5; AAK01707 and 6; AAP97732). {ECO:0000305}.	positive regulation of macroautophagy (GO:0016239)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)				kidney(1)|large_intestine(1)|lung(2)|skin(1)	5	all_hematologic(180;0.162)					TTCTGTGGGCGGAGTGGGCGG	0.677																																					p.R30Q		Atlas-SNP	.											.	SCOC	11	.	0			c.G89A						.						69.0	75.0	74.0					4																	141294779		692	1591	2283	SO:0001583	missense	60592	exon1			GTGGGCGGAGTGG	AK027797	CCDS3750.1, CCDS54806.1, CCDS54807.1	4q28.3	2014-05-22	2003-03-19		ENSG00000153130	ENSG00000153130			20335	protein-coding gene	gene with protein product			"""short coiled coil protein"""			11303027	Standard	NM_032547		Approved	HRIHFB2072, SCOCO	uc011che.1	Q9UIL1	OTTHUMG00000133416	ENST00000608372.1:c.89G>A	chr4.hg19:g.141294779G>A	ENSP00000477352:p.Arg30Gln	67.0	0.0		61.0	14.0	NM_001153484	B7WPH7|D3DNY7|E9PB65|Q6P5T9|Q7L2Y0|Q7Z4P2|Q96JY9|Q9BZB2	Missense_Mutation	SNP	ENST00000608372.1	hg19	CCDS54806.1	.	.	.	.	.	.	.	.	.	.	G	17.57	3.421336	0.62622	.	.	ENSG00000153130	ENST00000394201;ENST00000506597	.	.	.	4.87	2.11	0.27256	.	.	.	.	.	T	0.23210	0.0561	N	0.08118	0	0.35762	D	0.820256	B;B	0.24882	0.113;0.064	B;B	0.13407	0.009;0.004	T	0.10042	-1.0647	8	0.44086	T	0.13	-23.5909	5.7114	0.17937	0.0928:0.0:0.5614:0.3458	.	30;30	E9PB65;Q9UIL1	.;SCOC_HUMAN	Q	30	.	ENSP00000377751:R30Q	R	+	2	0	SCOC	141514229	0.105000	0.21958	0.180000	0.23079	0.766000	0.43426	0.476000	0.22180	0.172000	0.19760	0.563000	0.77884	CGG	.	.		0.677	SCOC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000257274.2		
FBXO8	26269	hgsc.bcm.edu	37	4	175162348	175162348	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:175162348T>A	ENST00000393674.2	-	4	1340	c.478A>T	c.(478-480)Aag>Tag	p.K160*	FBXO8_ENST00000503293.1_Nonsense_Mutation_p.K119*	NM_012180.2	NP_036312.2	Q9NRD0	FBX8_HUMAN	F-box protein 8	160	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell junction (GO:0030054)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(3)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|urinary_tract(1)	14		Prostate(90;0.00201)|Melanoma(52;0.012)|Renal(120;0.0183)|all_neural(102;0.0887)|all_hematologic(60;0.107)		all cancers(43;7.29e-18)|Epithelial(43;1.85e-15)|OV - Ovarian serous cystadenocarcinoma(60;5.62e-09)|GBM - Glioblastoma multiforme(59;0.00115)|STAD - Stomach adenocarcinoma(60;0.00299)|LUSC - Lung squamous cell carcinoma(193;0.1)		AGGATACCCTTGGACATAAAG	0.333																																					p.K160X		Atlas-SNP	.											.	FBXO8	34	.	0			c.A478T						.						106.0	102.0	103.0					4																	175162348		2203	4297	6500	SO:0001587	stop_gained	26269	exon4			TACCCTTGGACAT	AF174596	CCDS3820.1	4q34.1	2008-02-05	2004-06-15			ENSG00000164117		"""F-boxes /  ""other"""""	13587	protein-coding gene	gene with protein product		605649	"""F-box only protein 8"""			10531035, 10531037	Standard	NM_012180		Approved	FBX8, FBS	uc003itp.3	Q9NRD0		ENST00000393674.2:c.478A>T	chr4.hg19:g.175162348T>A	ENSP00000377280:p.Lys160*	107.0	0.0		97.0	29.0	NM_012180	B2RB40|D3DP41|G5E9Z0|Q6UWN4|Q8IWE1|Q9NRP5|Q9UKC4	Nonsense_Mutation	SNP	ENST00000393674.2	hg19	CCDS3820.1	.	.	.	.	.	.	.	.	.	.	T	43	10.123001	0.99342	.	.	ENSG00000164117	ENST00000393674;ENST00000503293;ENST00000296517;ENST00000513696	.	.	.	5.39	5.39	0.77823	.	0.103453	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.7605	0.78076	0.0:0.0:0.0:1.0	.	.	.	.	X	160;119;73;160	.	ENSP00000296517:K73X	K	-	1	0	FBXO8	175398923	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.328000	0.79160	2.171000	0.68590	0.529000	0.55759	AAG	.	.		0.333	FBXO8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000362085.2	NM_012180	
IRX4	50805	hgsc.bcm.edu	37	5	1879844	1879844	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:1879844G>A	ENST00000505790.1	-	5	966	c.510C>T	c.(508-510)ccC>ccT	p.P170P	IRX4_ENST00000231357.2_Silent_p.P170P|IRX4_ENST00000505938.1_5'UTR|IRX4_ENST00000513692.1_Silent_p.P170P	NM_001278634.1	NP_001265563.1	P78413	IRX4_HUMAN	iroquois homeobox 4	170					establishment of organ orientation (GO:0048561)|heart development (GO:0007507)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|lung(7)|ovary(1)|prostate(1)	10				GBM - Glioblastoma multiforme(108;0.242)		CGCCCTTGGTGGGGTAGGGGT	0.637																																					p.P170P		Atlas-SNP	.											.	IRX4	45	.	0			c.C510T						.						178.0	132.0	147.0					5																	1879844		2203	4300	6503	SO:0001819	synonymous_variant	50805	exon4			CTTGGTGGGGTAG	AF124733	CCDS3867.1, CCDS75225.1	5p15.33	2011-06-20	2007-07-13		ENSG00000113430	ENSG00000113430		"""Homeoboxes / TALE class"""	6129	protein-coding gene	gene with protein product		606199	"""iroquois homeobox protein 4"""			10625552	Standard	NM_016358		Approved		uc003jcz.2	P78413	OTTHUMG00000090411	ENST00000505790.1:c.510C>T	chr5.hg19:g.1879844G>A		107.0	0.0		104.0	7.0	NM_016358	B2RMW5|D3DTC5|H1AFL0|H1AFL1|Q2NL64|Q9UHR2	Silent	SNP	ENST00000505790.1	hg19	CCDS3867.1																																																																																			.	.		0.637	IRX4-004	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000365500.1	NM_016358	
ZNF622	90441	hgsc.bcm.edu	37	5	16463667	16463667	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:16463667G>A	ENST00000308683.2	-	2	936	c.810C>T	c.(808-810)caC>caT	p.H270H		NM_033414.2	NP_219482.1	Q969S3	ZN622_HUMAN	zinc finger protein 622	270					intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of kinase activity (GO:0033674)|positive regulation of MAPK cascade (GO:0043410)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|prostate(2)|urinary_tract(1)	25						CTTTGGTCATGTGAGCCACAT	0.418																																					p.H270H		Atlas-SNP	.											.	ZNF622	49	.	0			c.C810T						.						137.0	138.0	137.0					5																	16463667		2203	4300	6503	SO:0001819	synonymous_variant	90441	exon2			GGTCATGTGAGCC	AY046059	CCDS3886.1	5p15.1	2012-10-05			ENSG00000173545	ENSG00000173545			30958	protein-coding gene	gene with protein product		608694				11802789, 12645566	Standard	NM_033414		Approved	MGC2485, MGC17552, ZPR9	uc003jfq.3	Q969S3	OTTHUMG00000090567	ENST00000308683.2:c.810C>T	chr5.hg19:g.16463667G>A		146.0	0.0		166.0	48.0	NM_033414		Silent	SNP	ENST00000308683.2	hg19	CCDS3886.1																																																																																			.	.		0.418	ZNF622-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207105.1	NM_033414	
NNT	23530	hgsc.bcm.edu	37	5	43702725	43702725	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:43702725A>G	ENST00000264663.5	+	21	3219	c.2998A>G	c.(2998-3000)Act>Gct	p.T1000A	NNT_ENST00000344920.4_Missense_Mutation_p.T1000A|NNT_ENST00000512996.2_Missense_Mutation_p.T869A	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	1000					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					TTATATAGATACTGATTTGGT	0.313																																					p.T1000A		Atlas-SNP	.											.	NNT	92	.	0			c.A2998G						.						46.0	44.0	45.0					5																	43702725		2203	4300	6503	SO:0001583	missense	23530	exon21			ATAGATACTGATT	U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.2998A>G	chr5.hg19:g.43702725A>G	ENSP00000264663:p.Thr1000Ala	44.0	0.0		55.0	8.0	NM_182977	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	ENST00000264663.5	hg19	CCDS3949.1	.	.	.	.	.	.	.	.	.	.	A	23.1	4.372833	0.82573	.	.	ENSG00000112992	ENST00000542759;ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.85013	-1.93;-1.93;-1.93	5.75	5.75	0.90469	.	0.099034	0.64402	D	0.000002	D	0.90539	0.7035	M	0.67569	2.06	0.80722	D	1	P	0.51449	0.945	P	0.62435	0.902	D	0.90186	0.4246	10	0.44086	T	0.13	-24.7307	15.7357	0.77842	1.0:0.0:0.0:0.0	.	1000	Q13423	NNTM_HUMAN	A	515;1000;1000;869	ENSP00000264663:T1000A;ENSP00000343873:T1000A;ENSP00000426343:T869A	ENSP00000264663:T1000A	T	+	1	0	NNT	43738482	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	8.962000	0.93254	2.195000	0.70347	0.533000	0.62120	ACT	.	.		0.313	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000214026.1	NM_182977	
GPR98	84059	hgsc.bcm.edu	37	5	89943496	89943496	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:89943496A>G	ENST00000405460.2	+	17	3300	c.3204A>G	c.(3202-3204)agA>agG	p.R1068R		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	1068	Calx-beta 8. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTGGAAGTAGACAGCAGAGCA	0.398																																					p.R1068R		Atlas-SNP	.											.	GPR98	605	.	0			c.A3204G						.						147.0	142.0	144.0					5																	89943496		1883	4109	5992	SO:0001819	synonymous_variant	84059	exon17			AAGTAGACAGCAG	AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.3204A>G	chr5.hg19:g.89943496A>G		140.0	0.0		125.0	38.0	NM_032119	O75171|Q8TF58|Q9H0X5|Q9UL61	Silent	SNP	ENST00000405460.2	hg19	CCDS47246.1	.	.	.	.	.	.	.	.	.	.	A	5.523	0.281429	0.10458	.	.	ENSG00000164199	ENST00000504142	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	T	0.71710	0.3372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71174	-0.4670	4	.	.	.	.	15.5764	0.76392	1.0:0.0:0.0:0.0	.	.	.	.	A	657	.	.	T	+	1	0	GPR98	89979252	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	3.251000	0.51453	2.082000	0.62665	0.528000	0.53228	ACA	.	.		0.398	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000369993.2	NM_032119	
GIN1	54826	hgsc.bcm.edu	37	5	102432254	102432254	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:102432254T>A	ENST00000399004.2	-	7	1379	c.1285A>T	c.(1285-1287)Agt>Tgt	p.S429C	GIN1_ENST00000508629.1_Intron	NM_017676.2	NP_060146.2	Q9NXP7	GIN1_HUMAN	gypsy retrotransposon integrase 1	429					DNA integration (GO:0015074)		nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(142;3.23e-07)|all_epithelial(76;3.64e-10)|Prostate(80;0.00914)|Ovarian(225;0.0139)|Lung NSC(167;0.0212)|Colorectal(57;0.0249)|all_lung(232;0.0283)		Epithelial(69;3.57e-14)|COAD - Colon adenocarcinoma(37;0.00794)		CCTTGTTCACTGGATTCTCTT	0.378																																					p.S429C		Atlas-SNP	.											.	GIN1	53	.	0			c.A1285T						.						164.0	154.0	157.0					5																	102432254		1857	4095	5952	SO:0001583	missense	54826	exon7			GTTCACTGGATTC	BC015325	CCDS43349.1	5q21.1	2008-02-11	2007-06-13	2007-06-13		ENSG00000145723			25959	protein-coding gene	gene with protein product	"""gypsy integrase 1"", ""Ty3/Gypsy integrase 1"""		"""zinc finger, H2C2 domain containing"""	ZH2C2		11470852	Standard	NM_017676		Approved	FLJ20125, GIN-1, TGIN1	uc003koa.1	Q9NXP7		ENST00000399004.2:c.1285A>T	chr5.hg19:g.102432254T>A	ENSP00000381970:p.Ser429Cys	119.0	0.0		121.0	34.0	NM_017676	B2RXF7|B4DIV4|Q6AI03|Q96BR2	Missense_Mutation	SNP	ENST00000399004.2	hg19	CCDS43349.1	.	.	.	.	.	.	.	.	.	.	T	8.596	0.885773	0.17540	.	.	ENSG00000145723	ENST00000399004	T	0.19938	2.11	5.77	2.13	0.27403	.	0.528262	0.15667	U	0.250600	T	0.11707	0.0285	N	0.14661	0.345	0.09310	N	1	P	0.40660	0.726	B	0.40101	0.319	T	0.12708	-1.0537	10	0.72032	D	0.01	-16.1771	5.15	0.15005	0.0:0.283:0.1487:0.5683	.	429	Q9NXP7	GIN1_HUMAN	C	429	ENSP00000381970:S429C	ENSP00000381970:S429C	S	-	1	0	GIN1	102460153	0.073000	0.21202	0.976000	0.42696	0.259000	0.26198	0.307000	0.19296	0.462000	0.27095	-0.256000	0.11100	AGT	.	.		0.378	GIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000370478.3	NM_017676	
LVRN	206338	hgsc.bcm.edu	37	5	115336354	115336354	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:115336354T>C	ENST00000357872.4	+	9	1770	c.1646T>C	c.(1645-1647)aTg>aCg	p.M549T	AQPEP_ENST00000395528.2_Splice_Site_p.M66T	NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		549						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										CATTTTCAAATGGTAATTGTC	0.368																																					p.M549T		Atlas-SNP	.											.	.	.	.	0			c.T1646C						.						96.0	95.0	96.0					5																	115336354		2202	4300	6502	SO:0001630	splice_region_variant	0	exon9			TTCAAATGGTAAT																												ENST00000357872.4:c.1647+1T>C	chr5.hg19:g.115336354T>C		97.0	0.0		99.0	27.0	NM_173800	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	ENST00000357872.4	hg19	CCDS4124.1	.	.	.	.	.	.	.	.	.	.	T	10.94	1.493909	0.26774	.	.	ENSG00000172901	ENST00000395528;ENST00000357872;ENST00000379578	T;T	0.04275	3.66;3.66	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.07098	0.0180	L	0.28776	0.89	0.43292	D	0.995279	D	0.54207	0.965	P	0.50049	0.629	T	0.42050	-0.9474	10	0.36615	T	0.2	.	11.1922	0.48691	0.1376:0.0:0.0:0.8624	.	549	Q6Q4G3	AMPQ_HUMAN	T	66;549;538	ENSP00000378899:M66T;ENSP00000350541:M549T	ENSP00000350541:M549T	M	+	2	0	AC010282.1	115364253	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.939000	0.40213	2.371000	0.80710	0.533000	0.62120	ATG	.	.		0.368	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000250852.1		Missense_Mutation
PCDHB12	56124	hgsc.bcm.edu	37	5	140589674	140589674	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:140589674A>G	ENST00000239450.2	+	1	1384	c.1195A>G	c.(1195-1197)Aat>Gat	p.N399D	PCDHB12_ENST00000541609.1_Missense_Mutation_p.N62D	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	399	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTCGGTAAATAATTACTACAC	0.488																																					p.N399D		Atlas-SNP	.											.	PCDHB12	179	.	0			c.A1195G						.						63.0	66.0	65.0					5																	140589674		2203	4300	6503	SO:0001583	missense	56124	exon1			GTAAATAATTACT	AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.1195A>G	chr5.hg19:g.140589674A>G	ENSP00000239450:p.Asn399Asp	156.0	0.0		190.0	46.0	NM_018932	B4DDU1	Missense_Mutation	SNP	ENST00000239450.2	hg19	CCDS4254.1	.	.	.	.	.	.	.	.	.	.	A	15.09	2.729554	0.48833	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.47177	0.85;0.85	3.87	3.87	0.44632	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.66665	0.2812	M	0.91406	3.205	0.35734	D	0.818144	P	0.39551	0.678	P	0.49387	0.609	T	0.79274	-0.1871	9	0.62326	D	0.03	.	12.6328	0.56667	1.0:0.0:0.0:0.0	.	399	Q9Y5F1	PCDBC_HUMAN	D	62;399;19	ENSP00000440199:N62D;ENSP00000239450:N399D	ENSP00000239450:N399D	N	+	1	0	PCDHB12	140569858	0.102000	0.21896	0.775000	0.31657	0.174000	0.22865	1.756000	0.38390	1.518000	0.48934	0.402000	0.26972	AAT	.	.		0.488	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251815.2	NM_018932	
LARS	51520	hgsc.bcm.edu	37	5	145512586	145512586	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:145512586T>A	ENST00000394434.2	-	23	2437	c.2271A>T	c.(2269-2271)gaA>gaT	p.E757D	LARS_ENST00000510191.1_Missense_Mutation_p.E703D|LARS_ENST00000274562.9_Missense_Mutation_p.E730D|LARS_ENST00000545646.1_Missense_Mutation_p.E711D	NM_020117.9	NP_064502.9	Q9P2J5	SYLC_HUMAN	leucyl-tRNA synthetase	757					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|prostate(1)|skin(2)|stomach(8)	34			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		L-Leucine(DB00149)	CTGCCATGGCTTCCACAAAGT	0.463																																					p.E757D		Atlas-SNP	.											.	LARS	100	.	0			c.A2271T						.						99.0	89.0	92.0					5																	145512586		2203	4300	6503	SO:0001583	missense	51520	exon23			CATGGCTTCCACA	AF151026	CCDS34265.1	5q32	2012-10-02			ENSG00000133706	ENSG00000133706	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	6512	protein-coding gene	gene with protein product	"""leucine tRNA ligase 1, cytoplasmic"""	151350				6933703	Standard	NM_020117		Approved	HSPC192, FLJ10595, FLJ21788, LARS1, LEUS, RNTLS	uc003lnx.1	Q9P2J5	OTTHUMG00000163429	ENST00000394434.2:c.2271A>T	chr5.hg19:g.145512586T>A	ENSP00000377954:p.Glu757Asp	142.0	0.0		121.0	38.0	NM_020117	A2RRR4|A7E266|B4DJ10|Q2TU79|Q9NSE1	Missense_Mutation	SNP	ENST00000394434.2	hg19	CCDS34265.1	.	.	.	.	.	.	.	.	.	.	T	17.26	3.343682	0.61073	.	.	ENSG00000133706	ENST00000394434;ENST00000539715;ENST00000545646;ENST00000540713;ENST00000510191;ENST00000274562	T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.88220	0.6378	M	0.83692	2.655	0.58432	D	0.999999	B;D;B	0.67145	0.023;0.996;0.344	B;D;B	0.76071	0.024;0.987;0.099	D	0.87771	0.2605	10	0.34782	T	0.22	-25.1828	15.6849	0.77402	0.0:0.0:0.0:1.0	.	730;711;757	B4DER1;F5H698;Q9P2J5	.;.;SYLC_HUMAN	D	757;66;711;66;703;730	ENSP00000377954:E757D;ENSP00000437791:E711D;ENSP00000426005:E703D;ENSP00000274562:E730D	ENSP00000274562:E730D	E	-	3	2	LARS	145492779	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.087000	0.71362	2.103000	0.63969	0.529000	0.55759	GAA	.	.		0.463	LARS-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000373367.1	NM_020117	
WWC1	23286	hgsc.bcm.edu	37	5	167833201	167833201	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:167833201A>T	ENST00000265293.4	+	6	1092		c.e6-1		WWC1_ENST00000521089.1_Splice_Site	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1						cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		ACTGTCTCCTAGAATCGATAA	0.478																																					.		Atlas-SNP	.											.	WWC1	98	.	0			c.591-2A>T						.						123.0	111.0	115.0					5																	167833201		2203	4300	6503	SO:0001630	splice_region_variant	23286	exon6			TCTCCTAGAATCG	AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.591-1A>T	chr5.hg19:g.167833201A>T		104.0	0.0		122.0	45.0	NM_015238	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Splice_Site	SNP	ENST00000265293.4	hg19	CCDS4366.1	.	.	.	.	.	.	.	.	.	.	A	20.9	4.059775	0.76074	.	.	ENSG00000113645	ENST00000265293;ENST00000521089;ENST00000393895	.	.	.	5.45	5.45	0.79879	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.5264	0.75910	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WWC1	167765779	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.251000	0.95483	2.078000	0.62432	0.459000	0.35465	.	.	.		0.478	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000252791.2	NM_015238	Intron
PANK3	79646	hgsc.bcm.edu	37	5	167986088	167986088	+	Silent	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:167986088T>G	ENST00000239231.6	-	6	1327	c.1011A>C	c.(1009-1011)gcA>gcC	p.A337A	MIR103A1_ENST00000362165.1_RNA|PANK3_ENST00000520504.1_5'UTR	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	337					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		AGTAATCCAGTGCATATGCCA	0.308																																					p.A337A		Atlas-SNP	.											.	PANK3	39	.	0			c.A1011C						.						108.0	105.0	106.0					5																	167986088		2202	4300	6502	SO:0001819	synonymous_variant	79646	exon6			ATCCAGTGCATAT	AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.1011A>C	chr5.hg19:g.167986088T>G		115.0	0.0		108.0	28.0	NM_024594	D3DQL1|Q53FJ9|Q7RTX4	Silent	SNP	ENST00000239231.6	hg19	CCDS4368.1																																																																																			.	.		0.308	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252793.2	NM_024594	
ADAMTS2	9509	hgsc.bcm.edu	37	5	178541174	178541174	+	Silent	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr5:178541174A>T	ENST00000251582.7	-	22	3431	c.3330T>A	c.(3328-3330)ccT>ccA	p.P1110P		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1110					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		TGTGCTTCCCAGGCGGTGGCT	0.592																																					p.P1110P		Atlas-SNP	.											.	ADAMTS2	190	.	0			c.T3330A						.						179.0	135.0	150.0					5																	178541174		2203	4300	6503	SO:0001819	synonymous_variant	9509	exon22			CTTCCCAGGCGGT	AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3330T>A	chr5.hg19:g.178541174A>T		135.0	0.0		294.0	54.0	NM_014244		Silent	SNP	ENST00000251582.7	hg19	CCDS4444.1																																																																																			.	.		0.592	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253507.1	NM_014244	
STK19	8859	hgsc.bcm.edu	37	6	31940408	31940408	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:31940408C>T	ENST00000375333.2	+	3	494	c.441C>T	c.(439-441)cgC>cgT	p.R147R	DXO_ENST00000375349.3_5'Flank|DXO_ENST00000478221.1_5'Flank|DXO_ENST00000337523.5_5'Flank|DXO_ENST00000375356.3_5'Flank|STK19_ENST00000463823.1_Intron|STK19_ENST00000375331.2_Silent_p.R147R	NM_032454.1	NP_115830.1	P49842	STK19_HUMAN	serine/threonine kinase 19	147					protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			skin(5)|upper_aerodigestive_tract(2)	7						GGTCGGCGCGCGCGGCTGTCT	0.652																																					p.R147R		Atlas-SNP	.											.	STK19	33	.	0			c.C441T						.						56.0	66.0	62.0					6																	31940408		2203	4299	6502	SO:0001819	synonymous_variant	8859	exon3			GGCGCGCGCGGCT	X77474	CCDS4733.1, CCDS34417.1	6p21.33	2011-09-15			ENSG00000204344	ENSG00000204344			11398	protein-coding gene	gene with protein product		604977				8012361, 9812991	Standard	NM_032454		Approved	D6S60, G11, RP1	uc003nyv.3	P49842	OTTHUMG00000166424	ENST00000375333.2:c.441C>T	chr6.hg19:g.31940408C>T		93.0	0.0		108.0	21.0	NM_032454	A6NF95|A6NFW8|B0QZR5|Q13159|Q31617|Q5JP77|Q5ST72|Q5ST75	Silent	SNP	ENST00000375333.2	hg19	CCDS4733.1																																																																																			.	.		0.652	STK19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000076484.3		
HLA-DOB	3112	hgsc.bcm.edu	37	6	32782304	32782304	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:32782304T>A	ENST00000438763.2	-	3	532	c.436A>T	c.(436-438)Aca>Tca	p.T146S	TAP2_ENST00000452392.2_Missense_Mutation_p.T753S	NM_002120.3	NP_002111.1	P13765	DOB_HUMAN	major histocompatibility complex, class II, DO beta	146	Beta-2.|Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|immune response (GO:0006955)|negative regulation of antigen processing and presentation of peptide antigen via MHC class II (GO:0002587)|signal transduction (GO:0007165)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|MHC class II protein complex (GO:0042613)	MHC class II protein complex binding (GO:0023026)|MHC class II receptor activity (GO:0032395)			endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	9						TAGAAGCCTGTCACAGAGCAG	0.537																																					p.T146S		Atlas-SNP	.											.	HLA-DOB	17	.	0			c.A436T						.						197.0	200.0	199.0					6																	32782304		1511	2709	4220	SO:0001583	missense	3112	exon3			AGCCTGTCACAGA		CCDS4754.1	6p21.3	2013-01-11			ENSG00000241106	ENSG00000241106		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4937	protein-coding gene	gene with protein product		600629					Standard	NM_002120		Approved			P13765	OTTHUMG00000031213	ENST00000438763.2:c.436A>T	chr6.hg19:g.32782304T>A	ENSP00000390020:p.Thr146Ser	139.0	0.0		165.0	27.0	NM_002120	B0V0Y0|Q29746|Q29825|Q6FHC2	Missense_Mutation	SNP	ENST00000438763.2	hg19	CCDS4754.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	20.2|20.2	3.952157|3.952157	0.73787|0.73787	.|.	.|.	ENSG00000241106|ENSG00000241106;ENSG00000204267;ENSG00000250264	ENST00000447394|ENST00000438763;ENST00000556934;ENST00000452392	.|T;T	.|0.03004	.|4.08;4.08	3.96|3.96	3.96|3.96	0.45880|0.45880	.|Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	.|0.366720	.|0.31177	.|N	.|0.008106	T|T	0.01905|0.01905	0.0060|0.0060	L|L	0.41710|0.41710	1.295|1.295	0.31948|0.31948	N|N	0.610026|0.610026	.|D;P;B	.|0.56746	.|0.977;0.626;0.425	.|P;B;B	.|0.52424	.|0.698;0.253;0.144	T|T	0.42344|0.42344	-0.9457|-0.9457	5|10	.|0.10902	.|T	.|0.67	-52.6371|-52.6371	6.1596|6.1596	0.20356|0.20356	0.0:0.1101:0.0:0.8899|0.0:0.1101:0.0:0.8899	.|.	.|146;753;146	.|B7Z742;E7ENX8;P13765	.|.;.;DOB_HUMAN	V|S	129|146;753;753	.|ENSP00000390020:T146S;ENSP00000391806:T753S	.|ENSP00000390020:T146S	D|T	-|-	2|1	0|0	HLA-DOB|XXbac-BPG246D15.9;TAP2;HLA-DOB	32890282|32890282	0.721000|0.721000	0.28007|0.28007	0.981000|0.981000	0.43875|0.43875	0.929000|0.929000	0.56500|0.56500	1.462000|1.462000	0.35266|0.35266	2.019000|2.019000	0.59389|0.59389	0.523000|0.523000	0.50628|0.50628	GAC|ACA	.	.		0.537	HLA-DOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076439.1	NM_002120	
CMTR1	23070	hgsc.bcm.edu	37	6	37411922	37411922	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:37411922T>A	ENST00000373451.4	+	3	445	c.281T>A	c.(280-282)cTt>cAt	p.L94H		NM_015050.2	NP_055865.1	Q8N1G2	CMTR1_HUMAN	cap methyltransferase 1	94	G-patch. {ECO:0000255|PROSITE- ProRule:PRU00092}.				7-methylguanosine mRNA capping (GO:0006370)|cap1 mRNA methylation (GO:0097309)|mRNA methylation (GO:0080009)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA (nucleoside-2'-O-)-methyltransferase activity (GO:0004483)|nucleic acid binding (GO:0003676)										TCCCAGAAGCTTATGGTATGT	0.438																																					p.L94H		Atlas-SNP	.											.	FTSJD2	64	.	0			c.T281A						.						129.0	123.0	125.0					6																	37411922		2203	4300	6503	SO:0001583	missense	23070	exon3			AGAAGCTTATGGT	BC031890	CCDS4835.1	6p21.2	2013-07-23	2013-07-23	2013-07-23	ENSG00000137200	ENSG00000137200	2.1.1.57	"""G patch domain containing"""	21077	protein-coding gene	gene with protein product			"""KIAA0082"", ""FtsJ methyltransferase domain containing 2"""	KIAA0082, FTSJD2		20713356	Standard	NM_015050		Approved	MTr1, ISG95	uc003ons.3	Q8N1G2	OTTHUMG00000014624	ENST00000373451.4:c.281T>A	chr6.hg19:g.37411922T>A	ENSP00000362550:p.Leu94His	55.0	0.0		77.0	23.0	NM_015050	A8K949|Q14670|Q96FJ9	Missense_Mutation	SNP	ENST00000373451.4	hg19	CCDS4835.1	.	.	.	.	.	.	.	.	.	.	T	26.1	4.703253	0.88924	.	.	ENSG00000137200	ENST00000373451;ENST00000455891;ENST00000373427	T;T	0.38887	1.11;1.11	5.82	5.82	0.92795	D111/G-patch (3);	0.060697	0.64402	D	0.000002	T	0.60676	0.2287	M	0.85041	2.73	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.81914	0.995;0.963	T	0.66929	-0.5799	9	.	.	.	-16.8521	13.9171	0.63905	0.0:0.0:0.0:1.0	.	94;94	Q5T7F5;Q8N1G2	.;MTR1_HUMAN	H	94	ENSP00000362550:L94H;ENSP00000414233:L94H	.	L	+	2	0	FTSJD2	37519900	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	6.901000	0.75693	2.229000	0.72834	0.397000	0.26171	CTT	.	.		0.438	CMTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040408.1	NM_015050	
TTBK1	84630	hgsc.bcm.edu	37	6	43250465	43250465	+	Splice_Site	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:43250465G>A	ENST00000259750.4	+	14	2070	c.1987G>A	c.(1987-1989)Gtg>Atg	p.V663M		NM_032538.1	NP_115927.1	Q5TCY1	TTBK1_HUMAN	tau tubulin kinase 1	663					substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(10)|liver(1)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	53			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0125)|OV - Ovarian serous cystadenocarcinoma(102;0.0399)			CCCCTTGCAGGTGTTCTCCGT	0.607																																					p.V663M		Atlas-SNP	.											TTBK1,NS,carcinoma,0,1	TTBK1	124	.	0			c.G1987A						.						72.0	80.0	77.0					6																	43250465		2203	4300	6503	SO:0001630	splice_region_variant	84630	exon14			TTGCAGGTGTTCT	AB058758	CCDS34455.1	6p21.1	2008-02-05			ENSG00000146216	ENSG00000146216			19140	protein-coding gene	gene with protein product						11347906	Standard	XM_006715229		Approved	KIAA1855	uc003ouq.1	Q5TCY1	OTTHUMG00000014725	ENST00000259750.4:c.1987-1G>A	chr6.hg19:g.43250465G>A		56.0	0.0		89.0	26.0	NM_032538	A2A2U5|Q2L6C6|Q6ZNH0|Q8N444|Q96JH2	Missense_Mutation	SNP	ENST00000259750.4	hg19	CCDS34455.1	.	.	.	.	.	.	.	.	.	.	G	15.51	2.853587	0.51270	.	.	ENSG00000146216	ENST00000259750	T	0.27104	1.69	4.27	2.44	0.29823	.	0.105307	0.38217	N	0.001776	T	0.09818	0.0241	L	0.29908	0.895	0.80722	D	1	P	0.52316	0.952	P	0.45881	0.496	T	0.06752	-1.0809	9	.	.	.	.	8.612	0.33808	0.1966:0.0:0.8034:0.0	.	663	Q5TCY1	TTBK1_HUMAN	M	663	ENSP00000259750:V663M	.	V	+	1	0	TTBK1	43358443	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.562000	0.53777	0.774000	0.33427	0.555000	0.69702	GTG	.	.		0.607	TTBK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040584.3		Missense_Mutation
RUNX2	860	hgsc.bcm.edu	37	6	45390466	45390466	+	Silent	SNP	A	A	G	rs575896136	byFrequency	TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:45390466A>G	ENST00000371438.1	+	2	553	c.195A>G	c.(193-195)caA>caG	p.Q65Q	RUNX2_ENST00000576263.1_Silent_p.Q65Q|RUNX2_ENST00000371432.3_Silent_p.Q51Q|RUNX2_ENST00000465038.2_Silent_p.Q65Q|RUNX2_ENST00000352853.5_Silent_p.Q133Q|RUNX2_ENST00000359524.5_Silent_p.Q51Q|RUNX2_ENST00000541979.1_Silent_p.Q133Q|RP1-244F24.1_ENST00000606796.1_RNA|RUNX2_ENST00000371436.6_Silent_p.Q65Q	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	65	Poly-Gln.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						agcagcagcaacagcagcagc	0.731													A|||	8	0.00159744	0.0023	0.0	5008	,	,		7675	0.002		0.0	False		,,,				2504	0.0031				p.Q65Q		Atlas-SNP	.											.	RUNX2	128	.	0			c.A195G						.						10.0	15.0	14.0					6																	45390466		1452	3071	4523	SO:0001819	synonymous_variant	860	exon3			GCAGCAACAGCAG	AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.195A>G	chr6.hg19:g.45390466A>G		67.0	0.0		69.0	4.0	NM_001024630	O14614|O14615|O95181	Silent	SNP	ENST00000371438.1	hg19	CCDS43467.2																																																																																			.	.		0.731	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040755.2	NM_004348	
PKHD1	5314	hgsc.bcm.edu	37	6	51613247	51613247	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:51613247T>A	ENST00000371117.3	-	58	9442	c.9167A>T	c.(9166-9168)cAg>cTg	p.Q3056L	PKHD1_ENST00000340994.4_Missense_Mutation_p.Q3056L	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3056					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGTATAGGCCTGACCCTCTAA	0.493																																					p.Q3056L		Atlas-SNP	.											.	PKHD1	927	.	0			c.A9167T						.						106.0	95.0	99.0					6																	51613247		2203	4300	6503	SO:0001583	missense	5314	exon58			TAGGCCTGACCCT	AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.9167A>T	chr6.hg19:g.51613247T>A	ENSP00000360158:p.Gln3056Leu	57.0	0.0		64.0	20.0	NM_170724	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	ENST00000371117.3	hg19	CCDS4935.1	.	.	.	.	.	.	.	.	.	.	T	17.09	3.301049	0.60195	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	T;T	0.80738	-1.41;-1.29	5.86	5.86	0.93980	Pectin lyase fold/virulence factor (1);Pectin lyase fold (1);	0.414937	0.25156	N	0.032706	T	0.71953	0.3401	M	0.66939	2.045	0.35596	D	0.807473	P;B;P	0.39920	0.695;0.43;0.485	B;B;B	0.39339	0.297;0.142;0.297	T	0.74532	-0.3634	10	0.31617	T	0.26	.	15.448	0.75248	0.0:0.0:0.0:1.0	.	3056;3056;3056	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	L	3056	ENSP00000360158:Q3056L;ENSP00000341097:Q3056L	ENSP00000341097:Q3056L	Q	-	2	0	PKHD1	51721206	0.806000	0.28996	0.968000	0.41197	0.964000	0.63967	3.735000	0.55044	2.240000	0.73641	0.533000	0.62120	CAG	.	.		0.493	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000040893.1	NM_138694	
GOPC	57120	hgsc.bcm.edu	37	6	117884420	117884420	+	Silent	SNP	A	A	G	rs139949957	byFrequency	TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:117884420A>G	ENST00000368498.2	-	9	1461	c.1386T>C	c.(1384-1386)taT>taC	p.Y462Y	DCBLD1_ENST00000296955.8_Intron|GOPC_ENST00000535237.1_Silent_p.Y462Y|GOPC_ENST00000467125.1_Intron|GOPC_ENST00000052569.6_Silent_p.Y454Y	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	462					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		GGTCAATTTAATAAGATTTTT	0.413			O	ROS1	glioblastoma																																p.Y462Y		Atlas-SNP	.		Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	.	GOPC	29	.	0			c.T1386C						.						106.0	109.0	108.0					6																	117884420		2203	4300	6503	SO:0001819	synonymous_variant	57120	exon9			AATTTAATAAGAT	AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.1386T>C	chr6.hg19:g.117884420A>G		38.0	0.0		43.0	18.0	NM_020399	A6NM30|Q59FS4|Q969U8	Silent	SNP	ENST00000368498.2	hg19	CCDS5117.1																																																																																			.	.		0.413	GOPC-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000041988.1	NM_020399	
ADGB	79747	hgsc.bcm.edu	37	6	147122997	147122997	+	Silent	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:147122997T>C	ENST00000397944.3	+	35	4744	c.4668T>C	c.(4666-4668)gaT>gaC	p.D1556D	ADGB_ENST00000367488.1_3'UTR|KATNBL1P6_ENST00000562413.2_RNA|ADGB_ENST00000367493.3_3'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1556					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						TGCAAACAGATGAATTGAATC	0.398																																					p.D1556D		Atlas-SNP	.											.	ADGB	93	.	0			c.T4668C						.						86.0	82.0	83.0					6																	147122997		692	1591	2283	SO:0001819	synonymous_variant	79747	exon35			AACAGATGAATTG	AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4668T>C	chr6.hg19:g.147122997T>C		217.0	0.0		251.0	106.0	NM_024694	Q5T402|Q5T904|Q5T905	Silent	SNP	ENST00000397944.3	hg19																																																																																				.	.		0.398	ADGB-009	KNOWN	basic|appris_principal	protein_coding	protein_coding	OTTHUMT00000376350.2	NM_024694	
KATNA1	11104	hgsc.bcm.edu	37	6	149959640	149959640	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:149959640T>A	ENST00000335647.5	-	1	88	c.44A>T	c.(43-45)gAa>gTa	p.E15V	KATNA1_ENST00000367411.2_Missense_Mutation_p.E15V|KATNA1_ENST00000335643.8_Missense_Mutation_p.E15V					katanin p60 (ATPase containing) subunit A 1											endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	12		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;2.95e-12)|GBM - Glioblastoma multiforme(68;0.173)		CAATGCATATTCACGAGCCAA	0.358																																					p.E15V		Atlas-SNP	.											.	KATNA1	34	.	0			c.A44T						.						171.0	176.0	175.0					6																	149959640		2203	4300	6503	SO:0001583	missense	11104	exon2			GCATATTCACGAG	AF056022	CCDS5217.1, CCDS56456.1	6q24.3	2011-01-25	2011-01-25		ENSG00000186625	ENSG00000186625		"""ATPases / AAA-type"""	6216	protein-coding gene	gene with protein product		606696	"""katanin p60 (ATPase-containing) subunit A 1"""			9658175	Standard	NM_007044		Approved		uc003qms.3	O75449	OTTHUMG00000015787	ENST00000335647.5:c.44A>T	chr6.hg19:g.149959640T>A	ENSP00000335106:p.Glu15Val	104.0	0.0		140.0	57.0	NM_007044		Missense_Mutation	SNP	ENST00000335647.5	hg19	CCDS5217.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.841510	0.91197	.	.	ENSG00000186625	ENST00000335647;ENST00000335643;ENST00000367411;ENST00000444282;ENST00000420200	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	M	0.78049	2.395	0.80722	D	1	D;D;D	0.76494	0.992;0.999;0.998	D;D;D	0.80764	0.955;0.994;0.973	T	0.57039	-0.7879	9	.	.	.	.	16.1166	0.81309	0.0:0.0:0.0:1.0	.	15;15;15	A8K7S5;O75449-2;O75449	.;.;KTNA1_HUMAN	V	15	ENSP00000335106:E15V;ENSP00000335180:E15V;ENSP00000356381:E15V;ENSP00000390322:E15V;ENSP00000398993:E15V	.	E	-	2	0	KATNA1	150001333	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.692000	0.84203	2.204000	0.70986	0.529000	0.55759	GAA	.	.		0.358	KATNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042641.2	NM_007044	
POLM	27434	hgsc.bcm.edu	37	7	44119332	44119332	+	Silent	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:44119332C>G	ENST00000242248.5	-	4	581	c.480G>C	c.(478-480)ctG>ctC	p.L160L	POLM_ENST00000492971.1_5'Flank|POLM_ENST00000335195.6_Silent_p.L160L|POLM_ENST00000395831.3_Silent_p.L160L	NM_013284.2	NP_037416.1	Q9NP87	DPOLM_HUMAN	polymerase (DNA directed), mu	160					DNA recombination (GO:0006310)|DNA repair (GO:0006281)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|liver(1)|lung(6)|ovary(3)|skin(2)	22						CCAGTATCTCCAGAGCCTCCT	0.657								DNA polymerases (catalytic subunits)																													p.L160L		Atlas-SNP	.											.	POLM	50	.	0			c.G480C						.						34.0	37.0	36.0					7																	44119332		2203	4300	6503	SO:0001819	synonymous_variant	27434	exon4			TATCTCCAGAGCC	AF176097	CCDS34625.1, CCDS64635.1, CCDS64636.1	7p13	2012-05-18			ENSG00000122678	ENSG00000122678		"""DNA polymerases"""	9185	protein-coding gene	gene with protein product	"""Pol iota"""	606344				10982892	Standard	XM_005249708		Approved	Tdt-N	uc003tjt.3	Q9NP87	OTTHUMG00000155353	ENST00000242248.5:c.480G>C	chr7.hg19:g.44119332C>G		36.0	0.0		42.0	23.0	NM_013284	D3DVK4|Q6P5X8|Q86WQ9	Silent	SNP	ENST00000242248.5	hg19	CCDS34625.1																																																																																			.	.		0.657	POLM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000339594.1	NM_013284	
PTPN12	5782	hgsc.bcm.edu	37	7	77236577	77236577	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:77236577A>G	ENST00000248594.6	+	9	993	c.721A>G	c.(721-723)Att>Gtt	p.I241V	PTPN12_ENST00000415482.2_Missense_Mutation_p.I122V|PTPN12_ENST00000435495.2_Missense_Mutation_p.I111V	NM_002835.3	NP_002826.3	Q05209	PTN12_HUMAN	protein tyrosine phosphatase, non-receptor type 12	241	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				protein dephosphorylation (GO:0006470)|tissue regeneration (GO:0042246)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|podosome (GO:0002102)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|SH3 domain binding (GO:0017124)			breast(2)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(12)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	39						AACAGGTGCCATTTGTGCCAT	0.294																																					p.I241V		Atlas-SNP	.											.	PTPN12	83	.	0			c.A721G						.						110.0	115.0	113.0					7																	77236577		2203	4299	6502	SO:0001583	missense	5782	exon9			GGTGCCATTTGTG		CCDS5592.1, CCDS47619.1, CCDS47620.1	7q11.23	2011-06-09			ENSG00000127947	ENSG00000127947		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9645	protein-coding gene	gene with protein product		600079				7509295	Standard	NM_002835		Approved	PTPG1, PTP-PEST	uc003ugh.2	Q05209	OTTHUMG00000023501	ENST00000248594.6:c.721A>G	chr7.hg19:g.77236577A>G	ENSP00000248594:p.Ile241Val	163.0	0.0		195.0	41.0	NM_002835	A4D1C5|B4DKY2|E9PBR5|E9PEH9|Q16130|Q59FD6|Q75MN8|Q86XU4	Missense_Mutation	SNP	ENST00000248594.6	hg19	CCDS5592.1	.	.	.	.	.	.	.	.	.	.	A	20.4	3.986388	0.74589	.	.	ENSG00000127947	ENST00000248594;ENST00000415482;ENST00000543073;ENST00000435495	T;D;D	0.83075	2.81;-1.68;-1.68	5.68	5.68	0.88126	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.85682	D	0.000000	D	0.87589	0.6215	L	0.44542	1.39	0.53688	D	0.999979	D	0.62365	0.991	D	0.67382	0.951	D	0.88735	0.3239	10	0.72032	D	0.01	.	15.9283	0.79639	1.0:0.0:0.0:0.0	.	241	Q05209	PTN12_HUMAN	V	241;122;122;111	ENSP00000248594:I241V;ENSP00000392429:I122V;ENSP00000397991:I111V	ENSP00000248594:I241V	I	+	1	0	PTPN12	77074513	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.074000	0.76791	2.170000	0.68504	0.460000	0.39030	ATT	.	.		0.294	PTPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253183.3		
SGCE	8910	hgsc.bcm.edu	37	7	94252667	94252667	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:94252667T>A	ENST00000265735.7	-	4	543	c.433A>T	c.(433-435)Aat>Tat	p.N145Y	SGCE_ENST00000428696.2_Missense_Mutation_p.N145Y|SGCE_ENST00000445866.2_Missense_Mutation_p.N145Y|SGCE_ENST00000447873.1_Missense_Mutation_p.N145Y|SGCE_ENST00000415788.2_Missense_Mutation_p.N181Y|SGCE_ENST00000437425.2_Missense_Mutation_p.N104Y	NM_003919.2	NP_003910.1	O43556	SGCE_HUMAN	sarcoglycan, epsilon	145					cell-matrix adhesion (GO:0007160)|muscle organ development (GO:0007517)	cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|dystrophin-associated glycoprotein complex (GO:0016010)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(1)	14	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			ATTATCAAATTATGCCTTGCA	0.274																																					p.N145Y		Atlas-SNP	.											.	SGCE	68	.	0			c.A433T						.						40.0	41.0	40.0					7																	94252667		2202	4285	6487	SO:0001583	missense	8910	exon4			TCAAATTATGCCT	AF036364	CCDS5637.1, CCDS47642.1, CCDS47643.1, CCDS75634.1	7q21.3	2014-09-17			ENSG00000127990	ENSG00000127990			10808	protein-coding gene	gene with protein product		604149		DYT11		9475163, 9405466	Standard	NM_001099401		Approved		uc003unn.2	O43556	OTTHUMG00000022828	ENST00000265735.7:c.433A>T	chr7.hg19:g.94252667T>A	ENSP00000265735:p.Asn145Tyr	239.0	0.0		314.0	77.0	NM_001099401	B2R8N2|D6W5Q8|E9PF60|G5E9K6|Q6L8P0|Q75MH8|Q8NFG8|Q8WW28	Missense_Mutation	SNP	ENST00000265735.7	hg19	CCDS5637.1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.118880	0.77323	.	.	ENSG00000127990	ENST00000265735;ENST00000445866;ENST00000437425;ENST00000447873;ENST00000428696;ENST00000415788	D;D;D;D;D;D	0.97710	-4.5;-4.5;-4.5;-4.5;-4.5;-4.5	5.35	5.35	0.76521	Dystroglycan-type cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.97353	0.9134	L	0.44542	1.39	0.80722	D	1	D;D;D;D;D	0.76494	0.999;0.997;0.991;0.997;0.999	D;D;D;P;D	0.87578	0.994;0.996;0.926;0.879;0.998	D	0.95540	0.8611	10	0.02654	T	1	-26.2513	15.631	0.76908	0.0:0.0:0.0:1.0	.	181;104;145;145;145	B7Z2R4;E9PEH6;E9PF60;G5E9K6;O43556	.;.;.;.;SGCE_HUMAN	Y	145;145;104;145;145;181	ENSP00000265735:N145Y;ENSP00000398930:N145Y;ENSP00000394061:N104Y;ENSP00000388734:N145Y;ENSP00000397536:N145Y;ENSP00000405313:N181Y	ENSP00000265735:N145Y	N	-	1	0	SGCE	94090603	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.499000	0.81566	2.161000	0.67846	0.528000	0.53228	AAT	.	.		0.274	SGCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255251.2		
ACHE	43	hgsc.bcm.edu	37	7	100490380	100490380	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:100490380G>A	ENST00000412389.1	-	2	1283	c.1128C>T	c.(1126-1128)ggC>ggT	p.G376G	ACHE_ENST00000428317.1_Silent_p.G376G|ACHE_ENST00000302913.4_Silent_p.G376G|ACHE_ENST00000411582.1_Silent_p.G376G|ACHE_ENST00000419336.2_Intron|ACHE_ENST00000241069.5_Silent_p.G376G			P22303	ACES_HUMAN	acetylcholinesterase (Yt blood group)	376					acetylcholine catabolic process (GO:0006581)|acetylcholine catabolic process in synaptic cleft (GO:0001507)|amyloid precursor protein metabolic process (GO:0042982)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|choline metabolic process (GO:0019695)|DNA replication (GO:0006260)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|negative regulation of synaptic transmission, cholinergic (GO:0032223)|nervous system development (GO:0007399)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter receptor biosynthetic process (GO:0045212)|osteoblast development (GO:0002076)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of protein secretion (GO:0050714)|protein tetramerization (GO:0051262)|receptor internalization (GO:0031623)|regulation of axonogenesis (GO:0050770)|regulation of dendrite morphogenesis (GO:0048814)|regulation of receptor recycling (GO:0001919)|response to wounding (GO:0009611)|retina development in camera-type eye (GO:0060041)|small molecule metabolic process (GO:0044281)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	anchored component of membrane (GO:0031225)|axon (GO:0030424)|basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synapse (GO:0045202)	acetylcholine binding (GO:0042166)|acetylcholinesterase activity (GO:0003990)|beta-amyloid binding (GO:0001540)|cholinesterase activity (GO:0004104)|collagen binding (GO:0005518)|hydrolase activity (GO:0016787)|laminin binding (GO:0043236)|protein homodimerization activity (GO:0042803)|serine hydrolase activity (GO:0017171)			large_intestine(3)|lung(7)|skin(3)|urinary_tract(3)	16	Lung NSC(181;0.041)|all_lung(186;0.0581)				Ambenonium(DB01122)|Choline(DB00122)|Decamethonium(DB01245)|Demecarium(DB00944)|Dipivefrin(DB00449)|Donepezil(DB00843)|Edrophonium(DB01010)|Ephedrine(DB01364)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Isoflurophate(DB00677)|Mefloquine(DB00358)|Minaprine(DB00805)|Neostigmine(DB01400)|Physostigmine(DB00981)|Pralidoxime(DB00733)|Pyridostigmine(DB00545)|Rivastigmine(DB00989)|Tubocurarine(DB01199)	CTTTGCTGAAGCCTGGGGCCC	0.647																																					p.G376G		Atlas-SNP	.											.	ACHE	80	.	0			c.C1128T						.						22.0	25.0	24.0					7																	100490380		2203	4299	6502	SO:0001819	synonymous_variant	43	exon3			GCTGAAGCCTGGG		CCDS5709.1, CCDS5710.1, CCDS64736.1	7q22	2014-07-19	2014-01-02		ENSG00000087085	ENSG00000087085	3.1.1.7	"""Blood group antigens"""	108	protein-coding gene	gene with protein product	"""Yt blood group"""	100740	"""acetylcholinesterase (YT blood group)"", ""acetylcholinesterase (Yt blood group)"", ""acetylcholinesterase"""	YT		1380483	Standard	XM_005250357		Approved		uc003uxe.3	P22303	OTTHUMG00000157033	ENST00000412389.1:c.1128C>T	chr7.hg19:g.100490380G>A		70.0	0.0		67.0	24.0	NM_000665	A4D2E2|B7ZKZ0|D6W5X7|Q16169|Q29S23|Q2M324|Q504V3|Q53F46|Q86TM9|Q86YX9|Q9BXP7	Silent	SNP	ENST00000412389.1	hg19	CCDS5709.1																																																																																			.	.		0.647	ACHE-013	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000347201.1	NM_015831	
KCNH2	3757	hgsc.bcm.edu	37	7	150671846	150671846	+	Missense_Mutation	SNP	A	A	G	rs199473495		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:150671846A>G	ENST00000262186.5	-	2	661	c.260T>C	c.(259-261)cTg>cCg	p.L87P	KCNH2_ENST00000430723.3_Missense_Mutation_p.L87P	NM_000238.3	NP_000229.1	Q12809	KCNH2_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 2	87					cardiac muscle contraction (GO:0060048)|cellular response to drug (GO:0035690)|membrane depolarization during action potential (GO:0086010)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of potassium ion export (GO:1902303)|negative regulation of potassium ion transmembrane transport (GO:1901380)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of heart rate by hormone (GO:0003064)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|identical protein binding (GO:0042802)|inward rectifier potassium channel activity (GO:0005242)|phosphorelay sensor kinase activity (GO:0000155)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			NS(1)|cervix(1)|endometrium(10)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	42	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)	Alfuzosin(DB00346)|Amiodarone(DB01118)|Amsacrine(DB00276)|Astemizole(DB00637)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Cisapride(DB00604)|Dofetilide(DB00204)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Halofantrine(DB01218)|Ibutilide(DB00308)|Imipramine(DB00458)|Miconazole(DB01110)|Pimozide(DB01100)|Prazosin(DB00457)|Propafenone(DB01182)|Quinidine(DB00908)|Sertindole(DB06144)|Sotalol(DB00489)|Terazosin(DB01162)|Thioridazine(DB00679)|Verapamil(DB00661)	CTCGGCGCCCAGCAGTGCCTG	0.721																																					p.L87P	GBM(137;110 1844 13671 20123 45161)	Atlas-SNP	.											.	KCNH2	157	.	0			c.T260C	GRCh37	CM022800	KCNH2	M		.						11.0	11.0	11.0					7																	150671846		2179	4235	6414	SO:0001583	missense	3757	exon2			GCGCCCAGCAGTG	U04270	CCDS5910.1, CCDS5911.1	7q36.1	2014-09-17			ENSG00000055118	ENSG00000055118		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6251	protein-coding gene	gene with protein product		152427		LQT2		18616963, 7842012, 8159766, 16382104	Standard	NM_000238		Approved	Kv11.1, HERG, erg1	uc003wic.3	Q12809	OTTHUMG00000158341	ENST00000262186.5:c.260T>C	chr7.hg19:g.150671846A>G	ENSP00000262186:p.Leu87Pro	168.0	0.0		213.0	88.0	NM_000238	A5H1P7|C4PFH9|D3DX04|O75418|O75680|Q708S9|Q9BT72|Q9BUT7|Q9H3P0	Missense_Mutation	SNP	ENST00000262186.5	hg19	CCDS5910.1	.	.	.	.	.	.	.	.	.	.	A	20.8	4.052130	0.75960	.	.	ENSG00000055118	ENST00000262186;ENST00000430723	D;D	0.99591	-6.24;-6.24	4.44	4.44	0.53790	PAS (2);PAS fold (1);	0.478913	0.16060	N	0.231507	D	0.99585	0.9850	M	0.86420	2.815	0.80722	D	1	D;P	0.76494	0.999;0.913	D;D	0.79108	0.992;0.935	D	0.98260	1.0498	10	0.66056	D	0.02	.	11.6624	0.51354	1.0:0.0:0.0:0.0	.	87;87	G5E9I0;Q12809	.;KCNH2_HUMAN	P	87	ENSP00000262186:L87P;ENSP00000387657:L87P	ENSP00000262186:L87P	L	-	2	0	KCNH2	150302779	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	7.223000	0.78033	1.630000	0.50440	0.391000	0.25812	CTG	.	.		0.721	KCNH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350741.2	NM_000238	
VIPR2	7434	hgsc.bcm.edu	37	7	158823365	158823365	+	Missense_Mutation	SNP	T	T	A	rs184356169	byFrequency	TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr7:158823365T>A	ENST00000262178.2	-	13	1444	c.1259A>T	c.(1258-1260)cAg>cTg	p.Q420L	VIPR2_ENST00000402066.1_Missense_Mutation_p.Q561L|VIPR2_ENST00000377633.3_Missense_Mutation_p.Q404L	NM_003382.4	NP_003373.2	P41587	VIPR2_HUMAN	vasoactive intestinal peptide receptor 2	420					activation of adenylate cyclase activity (GO:0007190)|cell-cell signaling (GO:0007267)|negative regulation of smooth muscle cell proliferation (GO:0048662)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|vasoactive intestinal polypeptide receptor activity (GO:0004999)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22	Ovarian(565;0.152)	all_cancers(7;1.13e-11)|all_epithelial(9;0.000545)|all_hematologic(28;0.00603)	OV - Ovarian serous cystadenocarcinoma(82;0.00231)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)|STAD - Stomach adenocarcinoma(7;0.18)		GCGGTGGAACTGCAGGGCGCC	0.697																																					p.Q420L	Pancreas(154;1876 1931 2329 17914 20079)	Atlas-SNP	.											.	VIPR2	53	.	0			c.A1259T						.						15.0	18.0	17.0					7																	158823365		2161	4243	6404	SO:0001583	missense	7434	exon13			TGGAACTGCAGGG	CA449700, X95097	CCDS5950.1	7q36.3	2012-08-10			ENSG00000106018	ENSG00000106018		"""GPCR / Class B : VIP and PACAP (ADCYAP1) receptors"""	12695	protein-coding gene	gene with protein product	"""VIP and PACAP receptor 2"""	601970				7811244	Standard	NM_003382		Approved	VPAC2, VPAC2R	uc003woh.3	P41587	OTTHUMG00000151446	ENST00000262178.2:c.1259A>T	chr7.hg19:g.158823365T>A	ENSP00000262178:p.Gln420Leu	181.0	0.0		206.0	82.0	NM_003382	Q13053|Q15870|Q53Y09|Q6ZN22|Q9UCW0	Missense_Mutation	SNP	ENST00000262178.2	hg19	CCDS5950.1	.	.	.	.	.	.	.	.	.	.	T	23.2	4.393065	0.83011	.	.	ENSG00000106018	ENST00000262178;ENST00000377633;ENST00000402066	T;T;T	0.45668	0.96;0.92;0.89	5.01	3.84	0.44239	.	0.144241	0.31809	N	0.007036	T	0.51466	0.1676	M	0.82323	2.585	0.80722	D	1	D	0.56287	0.975	P	0.47744	0.556	T	0.56968	-0.7891	10	0.66056	D	0.02	.	10.1269	0.42654	0.0:0.0:0.1687:0.8313	.	420	P41587	VIPR2_HUMAN	L	420;404;561	ENSP00000262178:Q420L;ENSP00000366860:Q404L;ENSP00000384497:Q561L	ENSP00000262178:Q420L	Q	-	2	0	VIPR2	158516126	0.993000	0.37304	0.750000	0.31169	0.527000	0.34593	2.300000	0.43620	0.737000	0.32582	0.397000	0.26171	CAG	.	T|0.999;G|0.001		0.697	VIPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000322675.1	NM_003382	
CHRNA2	1135	hgsc.bcm.edu	37	8	27320996	27320996	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:27320996A>T	ENST00000520933.2	-	5	1117	c.964T>A	c.(964-966)Tcg>Acg	p.S322T	CHRNA2_ENST00000407991.1_Missense_Mutation_p.S322T|CHRNA2_ENST00000240132.2_Missense_Mutation_p.S307T			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	322					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	ATGACCAGCGAGGTGGACGGG	0.587																																					p.S322T		Atlas-SNP	.											.	CHRNA2	48	.	0			c.T964A						.						187.0	140.0	156.0					8																	27320996		2203	4300	6503	SO:0001583	missense	1135	exon6			CCAGCGAGGTGGA	U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.964T>A	chr8.hg19:g.27320996A>T	ENSP00000429616:p.Ser322Thr	148.0	0.0		175.0	34.0	NM_000742	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	ENST00000520933.2	hg19	CCDS6059.1	.	.	.	.	.	.	.	.	.	.	A	25.1	4.606131	0.87157	.	.	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132	D;D;D	0.93189	-3.18;-3.18;-3.18	4.88	4.88	0.63580	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.97685	0.9241	H	0.96861	3.895	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.87578	0.995;0.998	D	0.98521	1.0623	10	0.87932	D	0	.	12.4689	0.55775	1.0:0.0:0.0:0.0	.	307;322	B4DK19;Q15822	.;ACHA2_HUMAN	T	322;322;307	ENSP00000385026:S322T;ENSP00000429616:S322T;ENSP00000240132:S307T	ENSP00000240132:S307T	S	-	1	0	CHRNA2	27376913	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.139000	0.94554	2.048000	0.60808	0.459000	0.35465	TCG	.	.		0.587	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376125.4		
FGFR1	2260	hgsc.bcm.edu	37	8	38271457	38271457	+	Silent	SNP	G	G	A	rs369782405		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:38271457G>A	ENST00000447712.2	-	17	3212	c.2271C>T	c.(2269-2271)atC>atT	p.I757I	FGFR1_ENST00000335922.5_Silent_p.I747I|FGFR1_ENST00000326324.6_Silent_p.I666I|FGFR1_ENST00000397091.5_Silent_p.I755I|FGFR1_ENST00000397113.2_Silent_p.I755I|FGFR1_ENST00000397103.1_Silent_p.I668I|FGFR1_ENST00000532791.1_Silent_p.I755I|FGFR1_ENST00000356207.5_Silent_p.I668I|FGFR1_ENST00000425967.3_Silent_p.I788I|FGFR1_ENST00000341462.5_Silent_p.I757I|FGFR1_ENST00000397108.4_Silent_p.I755I	NM_001174063.1|NM_015850.3|NM_023110.2	NP_001167534.1|NP_056934.2|NP_075598.2	P11362	FGFR1_HUMAN	fibroblast growth factor receptor 1	757	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|auditory receptor cell development (GO:0060117)|axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell maturation (GO:0048469)|cell migration (GO:0016477)|chondrocyte differentiation (GO:0002062)|chordate embryonic development (GO:0043009)|embryonic limb morphogenesis (GO:0030326)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lung-associated mesenchyme development (GO:0060484)|MAPK cascade (GO:0000165)|mesenchymal cell differentiation (GO:0048762)|midbrain development (GO:0030901)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ induction (GO:0001759)|outer ear morphogenesis (GO:0042473)|paraxial mesoderm development (GO:0048339)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of phospholipase C activity (GO:0010863)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|regulation of cell differentiation (GO:0045595)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of lateral mesodermal cell fate specification (GO:0048378)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ventricular zone neuroblast division (GO:0021847)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)		FGFR1/ZNF703(2)	breast(2)|central_nervous_system(7)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(18)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	50	all_cancers(2;9.05e-47)|all_epithelial(2;2.64e-50)|all_lung(3;1.71e-23)|Lung NSC(2;3.61e-23)|Colorectal(12;0.000442)	Breast(189;1.48e-05)|all_lung(54;0.00354)|Lung NSC(58;0.0138)|Hepatocellular(245;0.065)	Epithelial(3;3.96e-34)|all cancers(3;3.06e-30)|BRCA - Breast invasive adenocarcinoma(5;2.28e-21)|COAD - Colon adenocarcinoma(9;0.24)		Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)	TCAAGGCCACGATGCGGTCCA	0.642		1	T	"""BCR, FOP, ZNF198, CEP1"""	"""MPD, NHL"""		"""Pfeiffer syndrome, Kallman syndrome"""																														p.I788I	Melanoma(146;1153 1840 21453 21841 43625)	Atlas-SNP	.		Dom	yes		8	8p11.2-p11.1	2260	fibroblast growth factor receptor 1	yes	L	Q7Z2S2_HUMAN,NS,carcinoma,0,4	FGFR1	284	.	0			c.C2364T						.						51.0	58.0	56.0					8																	38271457		2203	4300	6503	SO:0001819	synonymous_variant	2260	exon18			GGCCACGATGCGG	M34185	CCDS6107.2, CCDS43730.1, CCDS43731.1, CCDS43732.1, CCDS55221.1, CCDS55222.1, CCDS55223.1	8p11.23-p11.22	2014-04-03	2008-08-01		ENSG00000077782	ENSG00000077782	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3688	protein-coding gene	gene with protein product	"""Pfeiffer syndrome"""	136350	"""fms-related tyrosine kinase 2"""	FLT2, KAL2		2162671	Standard	NM_015850		Approved	H2, H3, H4, H5, CEK, FLG, BFGFR, N-SAM, CD331	uc011lbu.2	P11362	OTTHUMG00000147366	ENST00000447712.2:c.2271C>T	chr8.hg19:g.38271457G>A		91.0	0.0		120.0	45.0	NM_001174067	A8K6T9|A8K8V5|C1KBH8|P17049|Q02063|Q02065|Q14306|Q14307|Q53H63|Q59H40|Q5BJG2|Q8N685|Q9UD50|Q9UDF0|Q9UDF1|Q9UDF2	Silent	SNP	ENST00000447712.2	hg19	CCDS6107.2																																																																																			.	.		0.642	FGFR1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
OXR1	55074	hgsc.bcm.edu	37	8	107751706	107751706	+	Silent	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:107751706A>T	ENST00000442977.2	+	12	2160	c.2061A>T	c.(2059-2061)atA>atT	p.I687I	OXR1_ENST00000521592.1_5'UTR|OXR1_ENST00000452423.2_Intron|OXR1_ENST00000312046.6_Silent_p.I652I|OXR1_ENST00000445937.1_Silent_p.I659I|OXR1_ENST00000517566.2_Silent_p.I686I|OXR1_ENST00000531443.1_Silent_p.I659I|OXR1_ENST00000449762.2_Silent_p.I29I|OXR1_ENST00000297447.6_Silent_p.I56I	NM_001198532.1	NP_001185461.1	Q8N573	OXR1_HUMAN	oxidation resistance 1	687					adult walking behavior (GO:0007628)|cellular response to hydroperoxide (GO:0071447)|negative regulation of neuron apoptotic process (GO:0043524)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)|nucleolus (GO:0005730)	oxidoreductase activity (GO:0016491)			NS(2)|breast(2)|endometrium(2)|large_intestine(9)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	31			OV - Ovarian serous cystadenocarcinoma(57;1.81e-09)			GGGAAGACATAAATTCAAAGC	0.358																																					p.I687I		Atlas-SNP	.											.	OXR1	190	.	0			c.A2061T						.						97.0	95.0	96.0					8																	107751706		2203	4300	6503	SO:0001819	synonymous_variant	55074	exon12			AGACATAAATTCA	AF309387	CCDS6304.2, CCDS47909.1, CCDS56547.1, CCDS56548.1, CCDS56549.1, CCDS56550.1	8q23	2013-03-14			ENSG00000164830	ENSG00000164830			15822	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 3"""	605609				11114193	Standard	NM_181354		Approved	TLDC3	uc011lht.2	Q8N573	OTTHUMG00000167682	ENST00000442977.2:c.2061A>T	chr8.hg19:g.107751706A>T		95.0	0.0		151.0	26.0	NM_001198532	A6NK11|A8KA34|B3KXL1|B7Z402|B7Z8N5|D3HIS6|Q3LIB5|Q6ZVK9|Q8N8V0|Q9H266|Q9NWC7	Silent	SNP	ENST00000442977.2	hg19	CCDS56548.1																																																																																			.	.		0.358	OXR1-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_181354	
ATAD2	29028	hgsc.bcm.edu	37	8	124383232	124383232	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:124383232T>A	ENST00000287394.5	-	6	747		c.e6-2		ATAD2_ENST00000521903.1_Splice_Site|ATAD2_ENST00000534257.1_5'Flank	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2						ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AAGATTGCTCTAAAAATGTTT	0.284																																					.		Atlas-SNP	.											.	ATAD2	160	.	0			c.640-2A>T						.						100.0	91.0	94.0					8																	124383232		2203	4299	6502	SO:0001630	splice_region_variant	29028	exon7			TTGCTCTAAAAAT	BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.640-2A>T	chr8.hg19:g.124383232T>A		57.0	0.0		121.0	62.0	NM_014109	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Splice_Site	SNP	ENST00000287394.5	hg19	CCDS6343.1	.	.	.	.	.	.	.	.	.	.	T	17.49	3.403703	0.62288	.	.	ENSG00000156802	ENST00000287394	.	.	.	5.08	5.08	0.68730	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8434	0.63453	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATAD2	124452413	1.000000	0.71417	0.996000	0.52242	0.884000	0.51177	4.866000	0.63005	1.925000	0.55765	0.397000	0.26171	.	.	.		0.284	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381766.2	NM_014109	Intron
MAFA	389692	hgsc.bcm.edu	37	8	144512455	144512455	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:144512455A>T	ENST00000333480.2	-	1	121	c.122T>A	c.(121-123)tTc>tAc	p.F41Y	MAFA_ENST00000528185.1_5'Flank	NM_201589.3	NP_963883.2	Q8NHW3	MAFA_HUMAN	v-maf avian musculoaponeurotic fibrosarcoma oncogene homolog A	41					insulin secretion (GO:0030073)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|lung(1)|upper_aerodigestive_tract(2)	4	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.237)			GCGGTGGCAGAAGCGCTCGGC	0.706										HNSCC(29;0.082)																											p.F41Y		Atlas-SNP	.											.	MAFA	9	.	0			c.T122A						.						21.0	18.0	19.0					8																	144512455		2143	4226	6369	SO:0001583	missense	389692	exon1			TGGCAGAAGCGCT	AY083269	CCDS34955.1	8q24.3	2013-07-09	2013-07-09			ENSG00000182759			23145	protein-coding gene	gene with protein product		610303					Standard	NM_201589		Approved	RIPE3b1, hMafA	uc003yyc.2	Q8NHW3		ENST00000333480.2:c.122T>A	chr8.hg19:g.144512455A>T	ENSP00000328364:p.Phe41Tyr	41.0	0.0		62.0	12.0	NM_201589		Missense_Mutation	SNP	ENST00000333480.2	hg19	CCDS34955.1	.	.	.	.	.	.	.	.	.	.	a	3.511	-0.099778	0.07010	.	.	ENSG00000182759	ENST00000333480	D	0.98207	-4.79	3.27	3.27	0.37495	.	0.117810	0.35615	U	0.003094	D	0.91205	0.7229	N	0.03608	-0.345	0.23724	N	0.997011	B	0.02656	0.0	B	0.01281	0.0	T	0.79198	-0.1902	10	0.02654	T	1	.	11.6314	0.51178	1.0:0.0:0.0:0.0	.	41	Q8NHW3	MAFA_HUMAN	Y	41	ENSP00000328364:F41Y	ENSP00000328364:F41Y	F	-	2	0	MAFA	144583598	0.794000	0.28838	0.999000	0.59377	0.695000	0.40330	0.293000	0.19029	1.129000	0.42072	0.335000	0.21663	TTC	.	.		0.706	MAFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000381511.2	NM_201589	
CPSF1	29894	hgsc.bcm.edu	37	8	145623168	145623168	+	Splice_Site	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr8:145623168C>T	ENST00000349769.3	-	20	2168		c.e20+1		MIR1234_ENST00000408875.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			AGGGGGCCTACATGGTGCAGC	0.677																																					.	NSCLC(133;1088 1848 27708 34777 35269)	Atlas-SNP	.											.	CPSF1	92	.	0			c.2073+1G>A						.						50.0	53.0	52.0					8																	145623168		2202	4298	6500	SO:0001630	splice_region_variant	29894	exon21			GGCCTACATGGTG	U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2073+1G>A	chr8.hg19:g.145623168C>T		53.0	0.0		82.0	14.0	NM_013291	Q96AF0	Splice_Site	SNP	ENST00000349769.3	hg19	CCDS34966.1	.	.	.	.	.	.	.	.	.	.	C	17.01	3.280339	0.59758	.	.	ENSG00000071894	ENST00000349769	.	.	.	5.61	5.61	0.85477	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1116	0.72362	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CPSF1	145593976	1.000000	0.71417	0.994000	0.49952	0.639000	0.38242	5.948000	0.70249	2.644000	0.89710	0.491000	0.48974	.	.	.		0.677	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382422.2	NM_013291	Intron
SMARCA2	6595	hgsc.bcm.edu	37	9	2115820	2115820	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr9:2115820A>T	ENST00000382203.1	+	25	3665		c.e25-1		SMARCA2_ENST00000357248.2_Splice_Site|SMARCA2_ENST00000349721.2_Splice_Site|SMARCA2_ENST00000382194.1_Splice_Site			P51531	SMCA2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2						aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|chromatin remodeling (GO:0006338)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|RNA polymerase II transcription coactivator activity (GO:0001105)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	56		all_lung(10;2.06e-09)|Lung NSC(10;2.43e-09)		GBM - Glioblastoma multiforme(50;0.0475)		CCCCCCAAACAGGATCTGCAG	0.557																																					.		Atlas-SNP	.											.	SMARCA2	313	.	0			c.3457-2A>T						.						23.0	22.0	22.0					9																	2115820		2203	4300	6503	SO:0001630	splice_region_variant	6595	exon25			CCAAACAGGATCT	D26155	CCDS34977.1, CCDS34978.1, CCDS75807.1, CCDS75808.1	9p24.3	2008-11-11	2006-11-09		ENSG00000080503	ENSG00000080503			11098	protein-coding gene	gene with protein product		600014		SNF2L2		8012116	Standard	NM_003070		Approved	BAF190, hSNF2a, hBRM, Sth1p, SNF2LA, BRM, SNF2, SWI2	uc003zhc.3	P51531	OTTHUMG00000019445	ENST00000382203.1:c.3457-1A>T	chr9.hg19:g.2115820A>T		318.0	0.0		321.0	106.0	NM_003070	B1ALG3|B1ALG4|D3DRH4|D3DRH5	Splice_Site	SNP	ENST00000382203.1	hg19	CCDS34977.1	.	.	.	.	.	.	.	.	.	.	A	24.0	4.480929	0.84747	.	.	ENSG00000080503	ENST00000349721;ENST00000357248;ENST00000382203;ENST00000382194	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9124	0.79482	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SMARCA2	2105820	1.000000	0.71417	1.000000	0.80357	0.847000	0.48162	9.339000	0.96797	2.164000	0.68074	0.460000	0.39030	.	.	.		0.557	SMARCA2-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000051505.1	NM_003070	Intron
PTPRD	5789	hgsc.bcm.edu	37	9	8527349	8527349	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr9:8527349A>G	ENST00000381196.4	-	13	1089	c.546T>C	c.(544-546)tcT>tcC	p.S182S	PTPRD_ENST00000356435.5_Silent_p.S182S|PTPRD_ENST00000355233.5_Silent_p.S182S|PTPRD_ENST00000486161.1_Silent_p.S182S|PTPRD_ENST00000537002.1_Intron|PTPRD_ENST00000360074.4_Intron|PTPRD_ENST00000540109.1_Silent_p.S182S|PTPRD_ENST00000358503.5_Intron|PTPRD_ENST00000397617.3_Intron|PTPRD_ENST00000397606.3_Silent_p.S182S|PTPRD_ENST00000397611.3_Intron	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	182	Ig-like C2-type 2.|Interaction with IL1RAPL1. {ECO:0000250}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		ACTTACCAATAGATTCTGGAG	0.284										TSP Lung(15;0.13)																											p.S182S		Atlas-SNP	.											.	PTPRD	1348	.	0			c.T546C						.						47.0	47.0	47.0					9																	8527349		1780	4056	5836	SO:0001819	synonymous_variant	5789	exon5			ACCAATAGATTCT	X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.546T>C	chr9.hg19:g.8527349A>G		791.0	0.0		807.0	38.0	NM_130392	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Silent	SNP	ENST00000381196.4	hg19	CCDS43786.1																																																																																			.	.		0.284	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055395.3		
CCDC171	203238	hgsc.bcm.edu	37	9	15744565	15744565	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr9:15744565A>T	ENST00000380701.3	+	17	2672	c.2344A>T	c.(2344-2346)Aag>Tag	p.K782*	CCDC171_ENST00000297641.3_Nonsense_Mutation_p.K782*	NM_173550.2	NP_775821.2	Q6TFL3	CC171_HUMAN	coiled-coil domain containing 171	782																	TGTAGAGGAAAAGAAGCAAGA	0.403																																					p.K782X		Atlas-SNP	.											.	.	.	.	0			c.A2344T						.						96.0	100.0	98.0					9																	15744565		2203	4300	6503	SO:0001587	stop_gained	203238	exon17			GAGGAAAAGAAGC	AY422473	CCDS6481.1	9p22.2	2012-03-26	2012-03-26	2012-03-26	ENSG00000164989	ENSG00000164989			29828	protein-coding gene	gene with protein product	"""myosin tail domain containing protein"""		"""chromosome 9 open reading frame 93"""	C9orf93		14702039	Standard	NM_173550		Approved	FLJ39267, FLJ46740, Em:AL513423.1, bA778P13.1, bA536D16.1	uc003zmd.3	Q6TFL3	OTTHUMG00000019584	ENST00000380701.3:c.2344A>T	chr9.hg19:g.15744565A>T	ENSP00000370077:p.Lys782*	188.0	0.0		198.0	60.0	NM_173550	B7ZM22|Q5SU58|Q6P1W1|Q6ZR13|Q8N1Z4|Q8N8L3|Q8TBR2	Nonsense_Mutation	SNP	ENST00000380701.3	hg19	CCDS6481.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	45|45	11.754129|11.754129	0.99599|0.99599	.|.	.|.	ENSG00000164989|ENSG00000164989	ENST00000449575|ENST00000297641;ENST00000380689;ENST00000380701	.|.	.|.	.|.	5.46|5.46	4.32|4.32	0.51571|0.51571	.|.	0.053840|0.053840	0.64402|0.64402	D|D	0.000001|0.000001	T|.	0.32255|.	0.0823|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.16778|.	-1.0391|.	5|.	.|0.02654	.|T	.|1	-20.4428|-20.4428	11.0391|11.0391	0.47820|0.47820	0.927:0.0:0.0729:0.0|0.927:0.0:0.0729:0.0	.|.	.|.	.|.	.|.	N|X	21|782;49;782	.|.	.|ENSP00000297641:K782X	K|K	+|+	3|1	2|0	C9orf93|C9orf93	15734565|15734565	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.981000|0.981000	0.71138|0.71138	2.886000|2.886000	0.48578|0.48578	2.206000|2.206000	0.71126|0.71126	0.383000|0.383000	0.25322|0.25322	AAA|AAG	.	.		0.403	CCDC171-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051768.4	NM_173550	
RASEF	158158	hgsc.bcm.edu	37	9	85615446	85615446	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr9:85615446C>A	ENST00000376447.3	-	11	1737	c.1477G>T	c.(1477-1479)Gat>Tat	p.D493Y		NM_152573.2	NP_689786.2	Q8IZ41	RASEF_HUMAN	RAS and EF-hand domain containing	493					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(4)|liver(1)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	33						GAAGCCACATCTTCTAAACCA	0.408																																					p.D493Y		Atlas-SNP	.											.	RASEF	69	.	0			c.G1477T						.						65.0	68.0	67.0					9																	85615446		2203	4300	6503	SO:0001583	missense	158158	exon11			CCACATCTTCTAA	AK056176	CCDS6662.1	9q21.33	2014-05-09	2004-06-11	2004-06-16	ENSG00000165105	ENSG00000165105		"""EF-hand domain containing"", ""RAB, member RAS oncogene"""	26464	protein-coding gene	gene with protein product		611344	"""RAB45, member RAS oncogene family"""	RAB45		17448446	Standard	NM_152573		Approved	FLJ31614	uc004amo.2	Q8IZ41	OTTHUMG00000020100	ENST00000376447.3:c.1477G>T	chr9.hg19:g.85615446C>A	ENSP00000365630:p.Asp493Tyr	115.0	0.0		92.0	26.0	NM_152573	A6NC29|Q96N04	Missense_Mutation	SNP	ENST00000376447.3	hg19	CCDS6662.1	.	.	.	.	.	.	.	.	.	.	C	5.279	0.236901	0.10023	.	.	ENSG00000165105	ENST00000376447	T	0.61627	0.09	5.36	2.06	0.26882	.	0.971791	0.08483	N	0.939182	T	0.42494	0.1205	L	0.34521	1.04	0.09310	N	1	P	0.39624	0.681	B	0.33750	0.169	T	0.28996	-1.0026	10	0.54805	T	0.06	.	6.9155	0.24357	0.0:0.5756:0.0:0.4244	.	493	Q8IZ41	RASEF_HUMAN	Y	493	ENSP00000365630:D493Y	ENSP00000365630:D493Y	D	-	1	0	RASEF	84805266	0.001000	0.12720	0.003000	0.11579	0.139000	0.21198	1.052000	0.30429	0.638000	0.30545	0.462000	0.41574	GAT	.	.		0.408	RASEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000052825.1	NM_152573	
KCNT1	57582	hgsc.bcm.edu	37	9	138646978	138646978	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr9:138646978T>C	ENST00000263604.3	+	6	446	c.446T>C	c.(445-447)cTg>cCg	p.L149P	KCNT1_ENST00000371757.2_Missense_Mutation_p.L168P|KCNT1_ENST00000491806.2_Missense_Mutation_p.L135P|KCNT1_ENST00000490355.2_Missense_Mutation_p.L149P|KCNT1_ENST00000487664.1_Missense_Mutation_p.L120P|KCNT1_ENST00000488444.2_Missense_Mutation_p.L149P|KCNT1_ENST00000486577.2_Missense_Mutation_p.L129P|KCNT1_ENST00000298480.5_Missense_Mutation_p.L168P			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	149					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		GCTCCTATTCTGTGGGTGGAG	0.612																																					p.L168P		Atlas-SNP	.											.	KCNT1	139	.	0			c.T503C						.						113.0	90.0	98.0					9																	138646978		2203	4300	6503	SO:0001583	missense	57582	exon6			CTATTCTGTGGGT	AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.446T>C	chr9.hg19:g.138646978T>C	ENSP00000263604:p.Leu149Pro	63.0	0.0		42.0	12.0	NM_020822	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	ENST00000263604.3	hg19		.	.	.	.	.	.	.	.	.	.	.	13.90	2.374324	0.42105	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000473941;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;D;T	0.97731	1.57;1.56;1.56;-4.51;1.56	3.11	3.11	0.35812	.	0.170470	0.40064	U	0.001196	D	0.97439	0.9162	L	0.60455	1.87	0.80722	D	1	P;D	0.55385	0.951;0.971	P;P	0.58331	0.707;0.837	D	0.97079	0.9783	10	0.72032	D	0.01	-14.7654	10.4513	0.44524	0.0:0.0:0.0:1.0	.	168;120	B9EGP2;G5E9V0	.;.	P	120;168;168;115;129;135;149;149;149	ENSP00000417851:L120P;ENSP00000298480:L168P;ENSP00000360822:L168P;ENSP00000420764:L115P;ENSP00000263604:L149P	ENSP00000263604:L149P	L	+	2	0	KCNT1	137786799	1.000000	0.71417	0.984000	0.44739	0.222000	0.24845	7.288000	0.78691	1.194000	0.43101	0.260000	0.18958	CTG	.	.		0.612	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_020822	
MCM10	55388	hgsc.bcm.edu	37	10	13243528	13243528	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:13243528C>A	ENST00000484800.2	+	17	2452	c.2349C>A	c.(2347-2349)tgC>tgA	p.C783*	MCM10_ENST00000378694.1_Nonsense_Mutation_p.C782*|MCM10_ENST00000378714.3_Nonsense_Mutation_p.C782*			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	783	Zinc finger-like 2. {ECO:0000250}.				cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						TCGTGACATGCAAGACGGTGG	0.537																																					p.C783X		Atlas-SNP	.											MCM10_ENST00000361282,lower_third,carcinoma,0,1	MCM10	76	.	0			c.C2349A						.						55.0	44.0	48.0					10																	13243528		2203	4300	6503	SO:0001587	stop_gained	55388	exon17			GACATGCAAGACG	AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2349C>A	chr10.hg19:g.13243528C>A	ENSP00000418268:p.Cys783*	70.0	0.0		67.0	15.0	NM_182751	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Nonsense_Mutation	SNP	ENST00000484800.2	hg19	CCDS7096.1	.	.	.	.	.	.	.	.	.	.	C	39	7.654588	0.98415	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	.	.	.	5.27	3.43	0.39272	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.2155	8.8525	0.35208	0.0:0.7782:0.0:0.2218	.	.	.	.	X	782;783;783;782	.	ENSP00000354945:C783X	C	+	3	2	MCM10	13283534	0.959000	0.32827	1.000000	0.80357	0.841000	0.47740	0.113000	0.15499	0.629000	0.30376	0.655000	0.94253	TGC	.	.		0.537	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000356853.1	NM_182751	
COMMD3	23412	hgsc.bcm.edu	37	10	22605412	22605412	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:22605412C>T	ENST00000376836.3	+	1	510	c.66C>T	c.(64-66)tcC>tcT	p.S22S	COMMD3-BMI1_ENST00000602390.1_Silent_p.S22S|COMMD3-BMI1_ENST00000463409.2_3'UTR	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	22										kidney(2)|lung(2)|ovary(1)	5						CCTTCGACTCCAACGCCTTCA	0.647																																					p.S22S		Atlas-SNP	.											.	.	.	.	0			c.C66T						.						57.0	36.0	43.0					10																	22605412		2039	4007	6046	SO:0001819	synonymous_variant	0	exon1			CGACTCCAACGCC	AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.66C>T	chr10.hg19:g.22605412C>T		100.0	0.0		116.0	30.0	NM_001204062	D3DRU7|Q5T8Y9	Silent	SNP	ENST00000376836.3	hg19	CCDS7137.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488413	0.84854	.	.	ENSG00000148444	ENST00000456711;ENST00000444869	.	.	.	5.07	3.21	0.36854	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-13.1886	5.7432	0.18106	0.0:0.5277:0.3075:0.1648	.	.	.	.	X	23;22	.	.	Q	+	1	0	COMMD3	22645418	0.976000	0.34144	0.999000	0.59377	0.938000	0.57974	0.693000	0.25497	0.831000	0.34780	-0.150000	0.13652	CAA	.	.		0.647	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000047159.1	NM_012071	
ZEB1	6935	hgsc.bcm.edu	37	10	31816120	31816120	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:31816120A>T	ENST00000320985.10	+	9	3413	c.3303A>T	c.(3301-3303)caA>caT	p.Q1101H	ZEB1_ENST00000446923.2_Missense_Mutation_p.Q1085H|ZEB1_ENST00000560721.2_Missense_Mutation_p.Q1081H|ZEB1_ENST00000361642.5_Missense_Mutation_p.Q1102H|ZEB1_ENST00000542815.3_Missense_Mutation_p.Q1034H			P37275	ZEB1_HUMAN	zinc finger E-box binding homeobox 1	1101	Glu-rich (acidic).				cartilage development (GO:0051216)|cell proliferation (GO:0008283)|cellular response to amino acid stimulus (GO:0071230)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cochlea morphogenesis (GO:0090103)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain development (GO:0030900)|immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|pattern specification process (GO:0007389)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of mesenchymal cell proliferation (GO:0010464)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of T cell differentiation in thymus (GO:0033081)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to activity (GO:0014823)|response to nutrient levels (GO:0031667)|semicircular canal morphogenesis (GO:0048752)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|E-box binding (GO:0070888)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(38)|ovary(3)|skin(6)|upper_aerodigestive_tract(4)	77		Prostate(175;0.0156)				CTGAAAGTCAAGCAAGCAGCT	0.418																																					p.Q1102H	Ovarian(40;423 959 14296 36701 49589)	Atlas-SNP	.											.	ZEB1	173	.	0			c.A3306T						.						125.0	120.0	121.0					10																	31816120		2203	4300	6503	SO:0001583	missense	6935	exon9			AAGTCAAGCAAGC	AK091478	CCDS7169.1, CCDS44370.1, CCDS53505.1, CCDS53506.1, CCDS53507.1	10p11.22	2014-02-14	2007-02-15	2007-02-15	ENSG00000148516	ENSG00000148516		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	11642	protein-coding gene	gene with protein product		189909	"""transcription factor 8 (represses interleukin 2 expression)"", ""posterior polymorphous corneal dystrophy 3"""	TCF8, PPCD3		1427828, 1840704, 15384081, 16252232	Standard	NM_001128128		Approved	BZP, ZEB, AREB6, NIL-2-A, Zfhep, Zfhx1a, FECD6	uc001ivu.4	P37275	OTTHUMG00000017907	ENST00000320985.10:c.3303A>T	chr10.hg19:g.31816120A>T	ENSP00000319248:p.Gln1101His	53.0	0.0		66.0	17.0	NM_001174096	B4DJV0|B4DUW9|E9PCM7|F5H4I8|Q12924|Q13800|Q2KJ05|Q5T968|Q5VZ84|Q8NB68	Missense_Mutation	SNP	ENST00000320985.10	hg19	CCDS7169.1	.	.	.	.	.	.	.	.	.	.	A	13.62	2.291919	0.40594	.	.	ENSG00000148516	ENST00000542879;ENST00000361642;ENST00000546250;ENST00000542815;ENST00000320985;ENST00000437844;ENST00000541037;ENST00000543514;ENST00000446923	T;T;T;T;T	0.12672	2.97;2.67;2.71;2.66;2.71	5.27	-4.43	0.03568	.	20.999700	0.00166	N	0.000000	T	0.13884	0.0336	L	0.47716	1.5	0.09310	N	1	B;B;B;B;B	0.26935	0.164;0.102;0.102;0.102;0.102	B;B;B;B;B	0.30401	0.115;0.054;0.054;0.054;0.054	T	0.30621	-0.9972	10	0.52906	T	0.07	-0.0954	5.9924	0.19474	0.4537:0.2356:0.3106:0.0	.	1034;1085;1081;1102;1101	F5H4I8;E9PCM7;Q5VZ84;Q2KJ05;P37275	.;.;.;.;ZEB1_HUMAN	H	883;1102;1096;1034;1101;1081;620;992;1085	ENSP00000444282:Q883H;ENSP00000354487:Q1102H;ENSP00000444891:Q1034H;ENSP00000319248:Q1101H;ENSP00000391612:Q1085H	ENSP00000319248:Q1101H	Q	+	3	2	ZEB1	31856126	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.201000	0.09464	-1.180000	0.02734	-0.269000	0.10298	CAA	.	.		0.418	ZEB1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000419083.2	NM_030751	
ZNF365	22891	hgsc.bcm.edu	37	10	64148324	64148324	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:64148324A>T	ENST00000395254.3	+	3	1193	c.913A>T	c.(913-915)Agc>Tgc	p.S305C	ZNF365_ENST00000410046.3_Missense_Mutation_p.S305C|ZNF365_ENST00000395255.3_Missense_Mutation_p.S305C|ZNF365_ENST00000466727.1_3'UTR	NM_014951.2	NP_055766.2	Q70YC4	TALAN_HUMAN	zinc finger protein 365	0										breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	Prostate(12;0.0297)|all_hematologic(501;0.228)					CCGTGATCTCAGCGGGCACGT	0.562																																					p.S305C		Atlas-SNP	.											.	ZNF365	174	.	0			c.A913T						.						39.0	40.0	40.0					10																	64148324		2203	4300	6503	SO:0001583	missense	22891	exon3			GATCTCAGCGGGC	AB020651	CCDS7264.1, CCDS7265.1, CCDS31209.1, CCDS41531.1	10q21.2	2008-10-28			ENSG00000138311	ENSG00000138311		"""Zinc fingers, C2H2-type"""	18194	protein-coding gene	gene with protein product	"""Talanin"""	607818				10048485, 12740763	Standard	NM_199450		Approved	KIAA0844, UAN	uc001jmc.2	Q70YC4	OTTHUMG00000018302	ENST00000395254.3:c.913A>T	chr10.hg19:g.64148324A>T	ENSP00000378674:p.Ser305Cys	42.0	0.0		59.0	12.0	NM_014951		Missense_Mutation	SNP	ENST00000395254.3	hg19	CCDS31209.1	.	.	.	.	.	.	.	.	.	.	A	21.2	4.112581	0.77210	.	.	ENSG00000138311	ENST00000395254;ENST00000395255;ENST00000410046	T	0.48201	0.82	5.58	3.2	0.36748	.	32.444400	0.00166	N	0.000000	T	0.64549	0.2608	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.994;0.994	P;P;P;P	0.60236	0.871;0.847;0.77;0.847	T	0.37314	-0.9711	10	0.66056	D	0.02	-11.3536	7.6218	0.28189	0.7876:0.1407:0.0717:0.0	.	305;305;305;320	Q70YC5-3;Q70YC5-2;Q70YC5;Q70YC5-4	.;.;ZN365_HUMAN;.	C	305	ENSP00000378674:S305C	ENSP00000378674:S305C	S	+	1	0	ZNF365	63818330	0.601000	0.26907	0.034000	0.17996	0.200000	0.23975	2.655000	0.46707	0.463000	0.27118	0.533000	0.62120	AGC	.	.		0.562	ZNF365-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048238.2	NM_014951	
TET1	80312	hgsc.bcm.edu	37	10	70446431	70446431	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:70446431A>T	ENST00000373644.4	+	11	5580	c.5371A>T	c.(5371-5373)Aac>Tac	p.N1791Y		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1791					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						AACAACAACAAACAACAGTAA	0.453																																					p.N1791Y		Atlas-SNP	.											.	TET1	255	.	0			c.A5371T						.						82.0	75.0	77.0					10																	70446431		2203	4300	6503	SO:0001583	missense	80312	exon11			ACAACAAACAACA	AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5371A>T	chr10.hg19:g.70446431A>T	ENSP00000362748:p.Asn1791Tyr	124.0	0.0		143.0	49.0	NM_030625	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	ENST00000373644.4	hg19	CCDS7281.1	.	.	.	.	.	.	.	.	.	.	A	14.42	2.531045	0.45073	.	.	ENSG00000138336	ENST00000373644	T	0.07216	3.21	4.75	0.527	0.17084	Methylcytosine dioxygenase TET, double-stranded beta helix fold domain (1);	3.439290	0.00628	N	0.000471	T	0.12050	0.0293	L	0.40543	1.245	0.09310	N	1	P	0.41393	0.748	P	0.45037	0.467	T	0.42732	-0.9434	10	0.14252	T	0.57	.	11.652	0.51295	0.5714:0.4286:0.0:0.0	.	1791	Q8NFU7	TET1_HUMAN	Y	1791	ENSP00000362748:N1791Y	ENSP00000362748:N1791Y	N	+	1	0	TET1	70116437	0.005000	0.15991	0.001000	0.08648	0.020000	0.10135	2.083000	0.41615	0.237000	0.21200	0.372000	0.22366	AAC	.	.		0.453	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048354.1	NM_030625	
PRF1	5551	hgsc.bcm.edu	37	10	72358753	72358753	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:72358753A>T	ENST00000441259.1	-	3	884	c.724T>A	c.(724-726)Tgc>Agc	p.C242S	PRF1_ENST00000373209.2_Missense_Mutation_p.C242S	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	242	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						GCCAGCTCGCAGGTGCGCAGG	0.647			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																												p.C242S		Atlas-SNP	.	yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	.	PRF1	64	.	0			c.T724A						.						81.0	64.0	70.0					10																	72358753		2203	4300	6503	SO:0001583	missense	5551	exon3	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	GCTCGCAGGTGCG	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.724T>A	chr10.hg19:g.72358753A>T	ENSP00000398568:p.Cys242Ser	110.0	0.0		83.0	22.0	NM_001083116	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	ENST00000441259.1	hg19	CCDS7305.1	.	.	.	.	.	.	.	.	.	.	A	19.09	3.760150	0.69763	.	.	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.82526	-1.62;-1.62	5.83	5.83	0.93111	Membrane attack complex component/perforin (MACPF) domain (3);	0.000000	0.85682	D	0.000000	D	0.90597	0.7052	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.89171	0.3537	10	0.23891	T	0.37	-41.7881	14.1426	0.65329	1.0:0.0:0.0:0.0	.	242	P14222	PERF_HUMAN	S	242	ENSP00000362305:C242S;ENSP00000398568:C242S	ENSP00000316746:C242S	C	-	1	0	PRF1	72028759	1.000000	0.71417	0.996000	0.52242	0.237000	0.25408	7.989000	0.88205	2.212000	0.71576	0.533000	0.62120	TGC	.	.		0.647	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000048517.2	NM_005041	
IFIT3	3437	hgsc.bcm.edu	37	10	91099326	91099326	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:91099326A>T	ENST00000371818.4	+	2	1094	c.914A>T	c.(913-915)gAg>gTg	p.E305V	IFIT3_ENST00000371811.4_Missense_Mutation_p.E305V|LIPA_ENST00000487618.1_Intron|LIPA_ENST00000371837.1_Intron	NM_001549.4	NP_001540.2	O14879	IFIT3_HUMAN	interferon-induced protein with tetratricopeptide repeats 3	305					cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)	identical protein binding (GO:0042802)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)|urinary_tract(1)	15						GGAAATAAAGAGATGATTGAA	0.418																																					p.E305V		Atlas-SNP	.											.	IFIT3	36	.	0			c.A914T						.						81.0	73.0	76.0					10																	91099326		2203	4300	6503	SO:0001583	missense	3437	exon2			ATAAAGAGATGAT	U52513	CCDS7402.1, CCDS31241.1	10q23.31	2014-05-22	2004-07-16	2004-07-16	ENSG00000119917	ENSG00000119917		"""Tetratricopeptide (TTC) repeat domain containing"""	5411	protein-coding gene	gene with protein product		604650	"""interferon-induced protein with tetratricopeptide repeats 4"""	IFIT4		9828129, 9391139	Standard	NM_001031683		Approved	ISG60, RIG-G, CIG-49, IFI60, GARG-49, IRG2	uc001kgg.3	O14879	OTTHUMG00000018708	ENST00000371818.4:c.914A>T	chr10.hg19:g.91099326A>T	ENSP00000360883:p.Glu305Val	116.0	0.0		111.0	31.0	NM_001549	Q99634|Q9BSK7	Missense_Mutation	SNP	ENST00000371818.4	hg19	CCDS7402.1	.	.	.	.	.	.	.	.	.	.	A	16.33	3.093991	0.56075	.	.	ENSG00000119917	ENST00000371818;ENST00000371811;ENST00000543062	T;T	0.14516	2.5;2.5	4.28	4.28	0.50868	Tetratricopeptide-like helical (1);	0.650217	0.13988	N	0.349033	T	0.31606	0.0802	M	0.80746	2.51	0.09310	N	1	D	0.59767	0.986	P	0.58391	0.838	T	0.11991	-1.0565	10	0.56958	D	0.05	-2.7629	8.291	0.31958	0.9102:0.0:0.0898:0.0	.	305	O14879	IFIT3_HUMAN	V	305;305;126	ENSP00000360883:E305V;ENSP00000360876:E305V	ENSP00000360876:E305V	E	+	2	0	IFIT3	91089306	0.868000	0.29978	0.069000	0.20011	0.276000	0.26787	2.400000	0.44504	2.167000	0.68274	0.529000	0.55759	GAG	.	.		0.418	IFIT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049294.1	NM_001549	
OPALIN	93377	hgsc.bcm.edu	37	10	98111161	98111161	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:98111161A>T	ENST00000371172.3	-	3	451	c.46T>A	c.(46-48)Tct>Act	p.S16T	OPALIN_ENST00000393870.2_Intron|OPALIN_ENST00000419479.1_Missense_Mutation_p.S6T|OPALIN_ENST00000393871.1_Intron|OPALIN_ENST00000536387.1_Missense_Mutation_p.S6T	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	16						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						GTGACAGGAGAGGACGTCTGT	0.333																																					p.S16T		Atlas-SNP	.											.	OPALIN	31	.	0			c.T46A						.						82.0	85.0	84.0					10																	98111161		2203	4300	6503	SO:0001583	missense	93377	exon3			CAGGAGAGGACGT	AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.46T>A	chr10.hg19:g.98111161A>T	ENSP00000360214:p.Ser16Thr	606.0	0.0		677.0	210.0	NM_033207	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	ENST00000371172.3	hg19	CCDS7448.1	.	.	.	.	.	.	.	.	.	.	A	0.740	-0.776602	0.02951	.	.	ENSG00000197430	ENST00000371172;ENST00000419479;ENST00000536387	.	.	.	3.74	2.58	0.30949	.	0.139556	0.33691	N	0.004655	T	0.27866	0.0686	L	0.34521	1.04	0.29869	N	0.82698	B;P	0.37330	0.361;0.59	B;B	0.34652	0.187;0.187	T	0.21075	-1.0256	9	0.59425	D	0.04	-7.0333	7.209	0.25923	0.7719:0.2281:0.0:0.0	.	16;6	Q96PE5;B4DK96	OPALI_HUMAN;.	T	16;6;6	.	ENSP00000360214:S16T	S	-	1	0	OPALIN	98101151	1.000000	0.71417	0.999000	0.59377	0.097000	0.18754	0.854000	0.27791	0.776000	0.33473	-0.313000	0.08912	TCT	.	.		0.333	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049606.1	NM_033207	
C10orf12	26148	hgsc.bcm.edu	37	10	98741566	98741566	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:98741566A>T	ENST00000286067.2	+	1	526	c.419A>T	c.(418-420)aAg>aTg	p.K140M		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	140										NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		ACCTCCATCAAGACAGCTCGG	0.443																																					p.K140M		Atlas-SNP	.											.	C10orf12	94	.	0			c.A419T						.						95.0	93.0	94.0					10																	98741566		2203	4300	6503	SO:0001583	missense	26148	exon1			CCATCAAGACAGC	BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.419A>T	chr10.hg19:g.98741566A>T	ENSP00000286067:p.Lys140Met	124.0	0.0		148.0	37.0	NM_015652	Q9H945|Q9Y457	Missense_Mutation	SNP	ENST00000286067.2	hg19	CCDS7452.1	.	.	.	.	.	.	.	.	.	.	A	14.45	2.539571	0.45176	.	.	ENSG00000155640	ENST00000286067	T	0.13420	2.59	5.95	5.95	0.96441	.	0.286982	0.24456	N	0.038373	T	0.22898	0.0553	N	0.24115	0.695	0.33017	D	0.52829	D	0.89917	1.0	D	0.76575	0.988	T	0.25710	-1.0124	10	0.87932	D	0	-15.792	10.9937	0.47563	0.9224:0.0:0.0776:0.0	.	140	Q8N655	CJ012_HUMAN	M	140	ENSP00000286067:K140M	ENSP00000286067:K140M	K	+	2	0	C10orf12	98731556	1.000000	0.71417	1.000000	0.80357	0.615000	0.37417	4.297000	0.59061	2.277000	0.76020	0.533000	0.62120	AAG	.	.		0.443	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049627.1	NM_015652	
ZDHHC16	84287	hgsc.bcm.edu	37	10	99213301	99213301	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:99213301T>A	ENST00000370854.3	+	6	760	c.571T>A	c.(571-573)Tgt>Agt	p.C191S	ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000345745.5_Missense_Mutation_p.C126S|ZDHHC16_ENST00000370842.2_Missense_Mutation_p.C191S|ZDHHC16_ENST00000370846.4_Intron|ZDHHC16_ENST00000353979.3_Intron|ZDHHC16_ENST00000352634.4_Missense_Mutation_p.C191S|ZDHHC16_ENST00000393760.1_Missense_Mutation_p.C191S	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	191					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		GCTAAACAATTGTGTGGGCCA	0.483																																					p.C191S		Atlas-SNP	.											.	ZDHHC16	25	.	0			c.T571A						.						270.0	238.0	249.0					10																	99213301		2203	4300	6503	SO:0001583	missense	84287	exon7			AACAATTGTGTGG	AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.571T>A	chr10.hg19:g.99213301T>A	ENSP00000359891:p.Cys191Ser	69.0	0.0		73.0	30.0	NM_198046	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	ENST00000370854.3	hg19	CCDS7460.1	.	.	.	.	.	.	.	.	.	.	T	23.9	4.470758	0.84533	.	.	ENSG00000171307	ENST00000370854;ENST00000393760;ENST00000414567;ENST00000352634;ENST00000370842;ENST00000345745;ENST00000433086	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.95	5.95	0.96441	Zinc finger, DHHC-type, palmitoyltransferase (2);	0.000000	0.85682	D	0.000000	T	0.78368	0.4272	H	0.97940	4.11	0.80722	D	1	D;D;D;D;D;D	0.89917	0.993;1.0;0.997;1.0;1.0;1.0	D;D;D;D;D;D	0.87578	0.952;0.998;0.994;0.997;0.993;0.996	D	0.86731	0.1948	10	0.87932	D	0	-4.0762	16.397	0.83610	0.0:0.0:0.0:1.0	.	191;126;166;126;191;191	B4DNL2;E9PCL9;B1AMU1;Q969W1-4;Q969W1-2;Q969W1	.;.;.;.;.;ZDH16_HUMAN	S	191;191;191;191;191;126;126	ENSP00000359891:C191S;ENSP00000377357:C191S;ENSP00000400719:C191S;ENSP00000345383:C191S;ENSP00000359879:C191S;ENSP00000304487:C126S;ENSP00000398532:C126S	ENSP00000304487:C126S	C	+	1	0	ZDHHC16	99203291	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.040000	0.89188	2.275000	0.75901	0.459000	0.35465	TGT	.	.		0.483	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000049658.2	NM_032327	
SEC31B	25956	hgsc.bcm.edu	37	10	102250575	102250575	+	Silent	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:102250575T>A	ENST00000370345.3	-	20	2635	c.2538A>T	c.(2536-2538)gcA>gcT	p.A846A		NM_015490.3	NP_056305.1	Q9NQW1	SC31B_HUMAN	SEC31 homolog B (S. cerevisiae)	846	Pro-rich.				protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|vesicle coat (GO:0030120)				NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(3)|lung(17)|ovary(1)|urinary_tract(1)	36		Colorectal(252;0.117)		Epithelial(162;2.36e-10)|all cancers(201;2.09e-08)		GATGGGAAGGTGCCAAGGGCA	0.542																																					p.A846A		Atlas-SNP	.											.	SEC31B	84	.	0			c.A2538T						.						65.0	57.0	60.0					10																	102250575		2203	4300	6503	SO:0001819	synonymous_variant	25956	exon20			GGAAGGTGCCAAG	AF274863	CCDS7495.1	10q24.32	2013-01-10	2006-10-05	2006-09-07	ENSG00000075826	ENSG00000075826		"""WD repeat domain containing"""	23197	protein-coding gene	gene with protein product		610258	"""SEC31-like 2 (S. cerevisiae)"""	SEC31L2		16495487	Standard	NM_015490		Approved	SEC31B-1, DKFZP434M183	uc001krc.1	Q9NQW1	OTTHUMG00000019342	ENST00000370345.3:c.2538A>T	chr10.hg19:g.102250575T>A		81.0	0.0		72.0	28.0	NM_015490	B7ZM75|Q6MZS3|Q86UF0|Q9Y4Q8	Silent	SNP	ENST00000370345.3	hg19	CCDS7495.1																																																																																			.	.		0.542	SEC31B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051198.1	NM_015490	
GBF1	8729	hgsc.bcm.edu	37	10	104018779	104018779	+	Silent	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:104018779C>A	ENST00000369983.3	+	2	344	c.84C>A	c.(82-84)acC>acA	p.T28T	AL160011.1_ENST00000516180.2_RNA	NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	28					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GATGGAGCACCCATACACCAC	0.413																																					p.T28T		Atlas-SNP	.											.	GBF1	142	.	0			c.C84A						.						98.0	106.0	103.0					10																	104018779		2203	4300	6503	SO:0001819	synonymous_variant	8729	exon2			GAGCACCCATACA	D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.84C>A	chr10.hg19:g.104018779C>A		158.0	0.0		138.0	36.0	NM_001199378	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Silent	SNP	ENST00000369983.3	hg19	CCDS7533.1																																																																																			.	.		0.413	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050051.1		
Unknown	0	hgsc.bcm.edu	37	11	5989217	5989217	+	IGR	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:5989217T>G								OR56A3 (19626 upstream) : OR52L1 (17904 downstream)																							GCACAGTATCTGAGTCGAGAA	0.448																																					p.R170R		Atlas-SNP	.											.	.	.	.	0			c.A508C						.						97.0	81.0	86.0					11																	5989217		692	1591	2283	SO:0001628	intergenic_variant	390084	exon1			AGTATCTGAGTCG																													chr11.hg19:g.5989217T>G		79.0	0.0		73.0	21.0	NM_001146033		Silent	SNP		hg19																																																																																				.	.	0	0.448								
TRIM66	9866	hgsc.bcm.edu	37	11	8662353	8662353	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:8662353A>G	ENST00000299550.6	-	9	1328	c.1134T>C	c.(1132-1134)caT>caC	p.H378H	TRIM66_ENST00000402157.2_Silent_p.H376H	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	378						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						GCTTTGGTGGATGAGGGCTGC	0.667																																					p.H378H		Atlas-SNP	.											.	TRIM66	45	.	0			c.T1134C						.						14.0	16.0	15.0					11																	8662353		691	1591	2282	SO:0001819	synonymous_variant	9866	exon9			TGGTGGATGAGGG	AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.1134T>C	chr11.hg19:g.8662353A>G		65.0	0.0		73.0	16.0	NM_014818	Q9BQQ4	Silent	SNP	ENST00000299550.6	hg19																																																																																				.	.		0.667	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	protein_coding		XM_084529	
CD44	960	hgsc.bcm.edu	37	11	35219675	35219675	+	Silent	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:35219675T>A	ENST00000428726.2	+	7	927	c.804T>A	c.(802-804)tcT>tcA	p.S268S	CD44_ENST00000437706.2_Silent_p.S268S|CD44_ENST00000433892.2_Intron|CD44_ENST00000434472.2_Intron|CD44_ENST00000526669.2_Intron|CD44_ENST00000433354.2_Silent_p.S268S|CD44_ENST00000528922.1_3'UTR|CD44_ENST00000360158.4_Intron|CD44_ENST00000278386.6_Intron|CD44_ENST00000449691.2_Silent_p.S268S|CD44_ENST00000352818.4_Intron|CD44_ENST00000415148.2_Silent_p.S225S|CD44_ENST00000263398.6_Intron	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)	268	Stem.				blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	CAGGTACGTCTTCAAATACCA	0.448																																					p.S268S		Atlas-SNP	.											.	CD44	48	.	0			c.T804A						.						75.0	68.0	71.0					11																	35219675		2202	4298	6500	SO:0001819	synonymous_variant	960	exon7			TACGTCTTCAAAT	M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.804T>A	chr11.hg19:g.35219675T>A		115.0	0.0		120.0	34.0	NM_000610	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	Silent	SNP	ENST00000428726.2	hg19	CCDS7897.1	.	.	.	.	.	.	.	.	.	.	T	10.43	1.349180	0.24426	.	.	ENSG00000026508	ENST00000525685	.	.	.	5.33	2.65	0.31530	.	.	.	.	.	T	0.46521	0.1397	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35525	-0.9785	4	.	.	.	-7.8408	3.5136	0.07717	0.0:0.1456:0.2427:0.6117	.	.	.	.	H	136	.	.	L	+	2	0	CD44	35176251	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.484000	0.22308	0.948000	0.37687	0.459000	0.35465	CTT	.	.		0.448	CD44-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000388927.1	NM_000610	
NUP160	23279	hgsc.bcm.edu	37	11	47823484	47823484	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:47823484T>C	ENST00000378460.2	-	23	2822		c.e23-2		NUP160_ENST00000528071.1_Splice_Site|NUP160_ENST00000530326.1_Splice_Site|RNA5SP340_ENST00000517132.1_RNA	NM_015231.1	NP_056046.1	Q12769	NU160_HUMAN	nucleoporin 160kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|biliary_tract(2)|breast(7)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(8)|lung(15)|ovary(6)|prostate(2)|skin(2)|urinary_tract(2)	53						TTCCAGAGCCTGGAGAAATAA	0.418																																					.		Atlas-SNP	.											.	NUP160	116	.	0			c.2776-2A>G						.						55.0	51.0	52.0					11																	47823484		2201	4298	6499	SO:0001630	splice_region_variant	23279	exon24			AGAGCCTGGAGAA	D83781	CCDS31484.1	11p11.12	2008-07-21	2002-08-29		ENSG00000030066	ENSG00000030066			18017	protein-coding gene	gene with protein product		607614	"""nucleoporin 160kD"""			11684705	Standard	NM_015231		Approved	KIAA0197, FLJ22583	uc001ngm.3	Q12769	OTTHUMG00000166534	ENST00000378460.2:c.2776-2A>G	chr11.hg19:g.47823484T>C		101.0	0.0		107.0	36.0	NM_015231	B4DYE8|B4E2J9|Q08AD3|Q7Z5X6|Q96GB3|Q9H660	Splice_Site	SNP	ENST00000378460.2	hg19	CCDS31484.1	.	.	.	.	.	.	.	.	.	.	T	15.51	2.854404	0.51270	.	.	ENSG00000030066	ENST00000378460;ENST00000530326;ENST00000528071	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6385	0.62235	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NUP160	47780060	1.000000	0.71417	0.982000	0.44146	0.402000	0.30811	6.835000	0.75344	2.158000	0.67659	0.454000	0.30748	.	.	.		0.418	NUP160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390239.2	NM_015231	Intron
AHNAK	79026	hgsc.bcm.edu	37	11	62290643	62290643	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:62290643T>A	ENST00000378024.4	-	5	11520	c.11246A>T	c.(11245-11247)gAc>gTc	p.D3749V	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	3749					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TAAATCAATGTCAGGCATCGA	0.463																																					p.D3749V		Atlas-SNP	.											.	AHNAK	532	.	0			c.A11246T						.						123.0	126.0	125.0					11																	62290643		2202	4299	6501	SO:0001583	missense	79026	exon5			TCAATGTCAGGCA	M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.11246A>T	chr11.hg19:g.62290643T>A	ENSP00000367263:p.Asp3749Val	104.0	0.0		76.0	18.0	NM_001620	A1A586	Missense_Mutation	SNP	ENST00000378024.4	hg19	CCDS31584.1	.	.	.	.	.	.	.	.	.	.	-	15.67	2.901762	0.52227	.	.	ENSG00000124942	ENST00000378024	T	0.01414	4.92	5.05	5.05	0.67936	.	0.167110	0.27936	N	0.017250	T	0.15262	0.0368	H	0.97732	4.065	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.12293	-1.0553	10	0.42905	T	0.14	-12.515	14.4851	0.67611	0.0:0.0:0.0:1.0	.	3749	Q09666	AHNK_HUMAN	V	3749	ENSP00000367263:D3749V	ENSP00000367263:D3749V	D	-	2	0	AHNAK	62047219	1.000000	0.71417	0.565000	0.28409	0.191000	0.23601	7.999000	0.88496	1.905000	0.55150	0.472000	0.43445	GAC	.	.		0.463	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000395572.1	NM_024060	
MAP4K2	5871	hgsc.bcm.edu	37	11	64563810	64563810	+	Silent	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:64563810C>A	ENST00000294066.2	-	24	1777	c.1686G>T	c.(1684-1686)cgG>cgT	p.R562R	MAP4K2_ENST00000377350.3_Silent_p.R554R	NM_004579.3	NP_004570.2	Q12851	M4K2_HUMAN	mitogen-activated protein kinase kinase kinase kinase 2	562	CNH. {ECO:0000255|PROSITE- ProRule:PRU00795}.				activation of JUN kinase activity (GO:0007257)|immune response (GO:0006955)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|positive regulation of JNK cascade (GO:0046330)|protein phosphorylation (GO:0006468)|vesicle targeting (GO:0006903)	Golgi membrane (GO:0000139)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(1)|lung(3)|ovary(1)|pancreas(1)|urinary_tract(2)	8						GCTGTAGCCTCCGCTGCTCAA	0.637																																					p.R562R		Atlas-SNP	.											.	MAP4K2	83	.	0			c.G1686T						.						91.0	92.0	91.0					11																	64563810		2201	4297	6498	SO:0001819	synonymous_variant	5871	exon24			TAGCCTCCGCTGC	BC047865	CCDS8082.1	11q13.1	2011-06-09			ENSG00000168067	ENSG00000168067		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6864	protein-coding gene	gene with protein product		603166		RAB8IP		7515885	Standard	NM_004579		Approved	GCK, BL44	uc001obh.3	Q12851	OTTHUMG00000045328	ENST00000294066.2:c.1686G>T	chr11.hg19:g.64563810C>A		105.0	0.0		101.0	25.0	NM_004579	Q86VU3	Silent	SNP	ENST00000294066.2	hg19	CCDS8082.1																																																																																			.	.		0.637	MAP4K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000105239.1	NM_004579	
EHBP1L1	254102	hgsc.bcm.edu	37	11	65349553	65349553	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:65349553C>T	ENST00000309295.4	+	9	1675	c.1410C>T	c.(1408-1410)acC>acT	p.T470T		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	470						membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						GAGTCAGGACCAGGGATGAGG	0.687																																					p.T470T		Atlas-SNP	.											.	EHBP1L1	64	.	0			c.C1410T						.						25.0	30.0	28.0					11																	65349553		1919	4093	6012	SO:0001819	synonymous_variant	254102	exon9			CAGGACCAGGGAT	AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.1410C>T	chr11.hg19:g.65349553C>T		133.0	0.0		155.0	37.0	NM_001099409	Q8TB89|Q9H7M7	Silent	SNP	ENST00000309295.4	hg19	CCDS44649.1																																																																																			.	.		0.687	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000390145.1	XM_170658	
SPTBN2	6712	hgsc.bcm.edu	37	11	66466555	66466555	+	Splice_Site	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:66466555T>A	ENST00000533211.1	-	19	4108		c.e19-2		SPTBN2_ENST00000529997.1_Splice_Site|SPTBN2_ENST00000309996.2_Splice_Site			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2						actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						TTCTTGTGCCTGGAACGACAC	0.522																																					.		Atlas-SNP	.											.	SPTBN2	188	.	0			c.3777-2A>T						.						72.0	68.0	70.0					11																	66466555		2200	4295	6495	SO:0001630	splice_region_variant	6712	exon19			TGTGCCTGGAACG	AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.3777-2A>T	chr11.hg19:g.66466555T>A		107.0	0.0		96.0	28.0	NM_006946	O14872|O14873	Splice_Site	SNP	ENST00000533211.1	hg19	CCDS8150.1	.	.	.	.	.	.	.	.	.	.	T	13.73	2.325617	0.41197	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997	.	.	.	4.7	4.7	0.59300	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.3076	0.60362	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SPTBN2	66223131	1.000000	0.71417	0.974000	0.42286	0.274000	0.26718	7.753000	0.85153	1.977000	0.57605	0.533000	0.62120	.	.	.		0.522	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000393892.2	NM_006946	Intron
FGF19	9965	hgsc.bcm.edu	37	11	69518447	69518447	+	Silent	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:69518447G>T	ENST00000294312.3	-	1	963	c.198C>A	c.(196-198)ggC>ggA	p.G66G		NM_005117.2	NP_005108.1	O95750	FGF19_HUMAN	fibroblast growth factor 19	66					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of bile acid biosynthetic process (GO:0070858)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of JNK cascade (GO:0046330)	extracellular region (GO:0005576)	fibroblast growth factor receptor binding (GO:0005104)			large_intestine(2)|lung(2)|skin(2)	6	all_cancers(3;5.53e-114)|all_epithelial(3;1.34e-121)|Breast(3;9.28e-34)|all_lung(4;1.99e-21)|Lung NSC(4;4.65e-21)|Hepatocellular(3;6.15e-15)|Melanoma(5;1.89e-05)|Ovarian(3;0.0348)		Epithelial(3;3.05e-56)|all cancers(3;2.69e-50)|Lung(3;1.13e-16)|LUSC - Lung squamous cell carcinoma(11;3.74e-15)|STAD - Stomach adenocarcinoma(18;0.0278)|LUAD - Lung adenocarcinoma(13;0.0537)			AGTCCACGACGCCGTCGGCAC	0.776																																					p.G66G		Atlas-SNP	.											.	FGF19	11	.	0			c.C198A						.						3.0	6.0	5.0					11																	69518447		1478	2685	4163	SO:0001819	synonymous_variant	9965	exon1			CACGACGCCGTCG	AB018122	CCDS8193.1	11q13.1	2008-02-01			ENSG00000162344	ENSG00000162344			3675	protein-coding gene	gene with protein product		603891				9931477, 10525310	Standard	NM_005117		Approved		uc001opf.3	O95750	OTTHUMG00000167886	ENST00000294312.3:c.198C>A	chr11.hg19:g.69518447G>T		45.0	0.0		29.0	14.0	NM_005117		Silent	SNP	ENST00000294312.3	hg19	CCDS8193.1																																																																																			.	.		0.776	FGF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000396833.1	NM_005117	
PAK1	5058	hgsc.bcm.edu	37	11	77070041	77070041	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:77070041T>A	ENST00000356341.3	-	6	1030	c.499A>T	c.(499-501)Act>Tct	p.T167S	PAK1_ENST00000278568.4_Missense_Mutation_p.T167S|PAK1_ENST00000530617.1_Missense_Mutation_p.T167S|PAK1_ENST00000528203.1_Missense_Mutation_p.T69S|PAK1_ENST00000525542.1_5'Flank	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	167	Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					ACTGCAGGAGTCTCAGACACA	0.493																																					p.T167S		Atlas-SNP	.											.	PAK1	89	.	0			c.A499T						.						75.0	65.0	69.0					11																	77070041		2200	4292	6492	SO:0001583	missense	5058	exon6			CAGGAGTCTCAGA	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.499A>T	chr11.hg19:g.77070041T>A	ENSP00000348696:p.Thr167Ser	58.0	0.0		49.0	10.0	NM_001128620	O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	hg19	CCDS8250.1	.	.	.	.	.	.	.	.	.	.	T	8.747	0.920266	0.17982	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	T;T;T;T	0.70869	-0.48;-0.51;-0.51;-0.52	5.74	4.62	0.57501	.	0.283555	0.44902	D	0.000412	T	0.55847	0.1946	L	0.42245	1.32	0.39732	D	0.971621	B;B;B;B	0.22276	0.067;0.0;0.0;0.001	B;B;B;B	0.19946	0.027;0.001;0.001;0.008	T	0.46119	-0.9214	10	0.08381	T	0.77	.	7.3244	0.26547	0.0:0.0733:0.1449:0.7818	.	69;167;167;167	E9PM17;B3KNX7;Q13153;Q13153-2	.;.;PAK1_HUMAN;.	S	167;167;167;69	ENSP00000348696:T167S;ENSP00000433423:T167S;ENSP00000278568:T167S;ENSP00000433211:T69S	ENSP00000278568:T167S	T	-	1	0	PAK1	76747689	1.000000	0.71417	0.987000	0.45799	0.995000	0.86356	2.701000	0.47094	1.003000	0.39130	0.454000	0.30748	ACT	.	.		0.493	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
PAK1	5058	hgsc.bcm.edu	37	11	77070043	77070043	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:77070043T>A	ENST00000356341.3	-	6	1028	c.497A>T	c.(496-498)gAg>gTg	p.E166V	PAK1_ENST00000278568.4_Missense_Mutation_p.E166V|PAK1_ENST00000530617.1_Missense_Mutation_p.E166V|PAK1_ENST00000528203.1_Missense_Mutation_p.E68V|PAK1_ENST00000525542.1_5'Flank	NM_002576.4	NP_002567.3	Q13153	PAK1_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 1	166	Interaction with CRIPAK.				actin cytoskeleton reorganization (GO:0031532)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to insulin stimulus (GO:0032869)|dendrite development (GO:0016358)|exocytosis (GO:0006887)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|neuromuscular junction development (GO:0007528)|neuron projection morphogenesis (GO:0048812)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|receptor clustering (GO:0043113)|response to hypoxia (GO:0001666)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|wound healing (GO:0042060)	axon (GO:0030424)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|Z disc (GO:0030018)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(13)|skin(2)|stomach(1)	29	all_cancers(14;1.75e-18)					TGCAGGAGTCTCAGACACAGC	0.493																																					p.E166V		Atlas-SNP	.											.	PAK1	89	.	0			c.A497T						.						75.0	64.0	68.0					11																	77070043		2200	4292	6492	SO:0001583	missense	5058	exon6			GGAGTCTCAGACA	U51120	CCDS8250.1, CCDS44687.1	11q13-q14	2008-06-17	2008-06-17						8590	protein-coding gene	gene with protein product	"""STE20 homolog, yeast"""	602590	"""p21/Cdc42/Rac1-activated kinase 1 (yeast Ste20-related)"", ""p21/Cdc42/Rac1-activated kinase 1 (STE20 homolog, yeast)"""			8805275, 9533029	Standard	NM_002576		Approved		uc001oyg.4	Q13153		ENST00000356341.3:c.497A>T	chr11.hg19:g.77070043T>A	ENSP00000348696:p.Glu166Val	58.0	0.0		46.0	10.0	NM_001128620	O75561|Q13567|Q32M53|Q32M54|Q86W79	Missense_Mutation	SNP	ENST00000356341.3	hg19	CCDS8250.1	.	.	.	.	.	.	.	.	.	.	T	18.07	3.542063	0.65198	.	.	ENSG00000149269	ENST00000356341;ENST00000530617;ENST00000278568;ENST00000528203	T;T;T;T	0.72167	-0.59;-0.62;-0.62;-0.63	5.74	5.74	0.90152	.	0.088361	0.85682	D	0.000000	T	0.72277	0.3440	M	0.73598	2.24	0.80722	D	1	P;B;B;B	0.45348	0.856;0.001;0.004;0.272	B;B;B;B	0.41299	0.353;0.005;0.036;0.192	T	0.76176	-0.3055	10	0.51188	T	0.08	.	15.7037	0.77560	0.0:0.0:0.0:1.0	.	68;166;166;166	E9PM17;B3KNX7;Q13153;Q13153-2	.;.;PAK1_HUMAN;.	V	166;166;166;68	ENSP00000348696:E166V;ENSP00000433423:E166V;ENSP00000278568:E166V;ENSP00000433211:E68V	ENSP00000278568:E166V	E	-	2	0	PAK1	76747691	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.181000	0.77682	2.173000	0.68751	0.454000	0.30748	GAG	.	.		0.493	PAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000382083.2	NM_002576	
FAT3	120114	hgsc.bcm.edu	37	11	92600067	92600067	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:92600067G>A	ENST00000298047.6	+	21	11836	c.11819G>A	c.(11818-11820)cGg>cAg	p.R3940Q	FAT3_ENST00000525166.1_Missense_Mutation_p.R3790Q|FAT3_ENST00000409404.2_Missense_Mutation_p.R3940Q|FAT3_ENST00000533797.1_Missense_Mutation_p.R275Q			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	3940	Laminin G-like. {ECO:0000255|PROSITE- ProRule:PRU00122}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TACGTGGAGCGGCGCCGGGCG	0.622										TCGA Ovarian(4;0.039)																											p.R3940Q		Atlas-SNP	.											.	FAT3	1822	.	0			c.G11819A						.						31.0	35.0	34.0					11																	92600067		1941	4120	6061	SO:0001583	missense	120114	exon21			TGGAGCGGCGCCG	AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.11819G>A	chr11.hg19:g.92600067G>A	ENSP00000298047:p.Arg3940Gln	72.0	0.0		62.0	22.0	NM_001008781	B5MDB0|Q96AU6	Missense_Mutation	SNP	ENST00000298047.6	hg19		.	.	.	.	.	.	.	.	.	.	G	29.4	5.001270	0.93227	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166;ENST00000533797	T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14	5.74	5.74	0.90152	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	D	0.82365	0.5021	L	0.31752	0.955	0.80722	D	1	D;B	0.89917	1.0;0.175	D;B	0.70227	0.968;0.053	T	0.79885	-0.1614	9	0.32370	T	0.25	.	19.9226	0.97093	0.0:0.0:1.0:0.0	.	3940;3940	Q8TDW7-3;Q8TDW7	.;FAT3_HUMAN	Q	3940;3940;3790;275	ENSP00000298047:R3940Q;ENSP00000387040:R3940Q;ENSP00000432586:R3790Q;ENSP00000436399:R275Q	ENSP00000298047:R3940Q	R	+	2	0	FAT3	92239715	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.190000	0.77755	2.720000	0.93068	0.561000	0.74099	CGG	.	.		0.622	FAT3-201	KNOWN	basic	protein_coding	protein_coding		NM_001008781	
MMP20	9313	hgsc.bcm.edu	37	11	102495988	102495988	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:102495988A>G	ENST00000260228.2	-	1	75	c.63T>C	c.(61-63)acT>acC	p.T21T	RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	0					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	AGGGGGCTGCAGTGGAAAACT	0.537																																					p.T21T		Atlas-SNP	.											.	MMP20	52	.	0			c.T63C						.						117.0	96.0	103.0					11																	102495988		2203	4299	6502	SO:0001819	synonymous_variant	9313	exon1			GGCTGCAGTGGAA	Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.63T>C	chr11.hg19:g.102495988A>G		104.0	0.0		75.0	24.0	NM_004771	D3DUA8|Q9H3Q0	Silent	SNP	ENST00000260228.2	hg19	CCDS8318.1																																																																																			.	.		0.537	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398012.1		
LAYN	143903	hgsc.bcm.edu	37	11	111430883	111430883	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr11:111430883G>T	ENST00000375615.3	+	8	1034	c.849G>T	c.(847-849)caG>caT	p.Q283H	LAYN_ENST00000533265.1_3'UTR|LAYN_ENST00000375614.2_Missense_Mutation_p.Q275H|LAYN_ENST00000525126.1_3'UTR|LAYN_ENST00000436913.2_Missense_Mutation_p.Q130H	NM_001258390.1	NP_001245319.1	Q6UX15	LAYN_HUMAN	layilin	283						cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|ruffle (GO:0001726)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|skin(1)	14		all_cancers(61;9.06e-10)|all_epithelial(67;1.34e-05)|Melanoma(852;1.74e-05)|all_hematologic(158;0.000885)|Acute lymphoblastic leukemia(157;0.000966)|Medulloblastoma(222;0.0523)|all_neural(223;0.0663)|Breast(348;0.086)		Epithelial(105;1.5e-06)|BRCA - Breast invasive adenocarcinoma(274;1.63e-06)|all cancers(92;2.45e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0476)	Hyaluronan(DB08818)	CTCCTCACCAGGGAAACAGCC	0.498																																					p.Q283H	Ovarian(17;551 586 12136 22082 22900)	Atlas-SNP	.											.	LAYN	35	.	0			c.G849T						.						70.0	73.0	72.0					11																	111430883		2201	4297	6498	SO:0001583	missense	143903	exon8			TCACCAGGGAAAC		CCDS31676.1, CCDS58178.1, CCDS58179.1	11q23.1	2006-02-09			ENSG00000204381	ENSG00000204381			29471	protein-coding gene	gene with protein product						15913605	Standard	NM_001258390		Approved	FLJ30977, FLJ31092	uc001plr.2	Q6UX15	OTTHUMG00000166721	ENST00000375615.3:c.849G>T	chr11.hg19:g.111430883G>T	ENSP00000364765:p.Gln283His	163.0	0.0		146.0	42.0	NM_001258390	A6NJB0|B4DJU0|Q8TAY8|Q96NC5|Q96NF3	Missense_Mutation	SNP	ENST00000375615.3	hg19	CCDS58178.1	.	.	.	.	.	.	.	.	.	.	G	8.107	0.777981	0.16120	.	.	ENSG00000204381	ENST00000375614;ENST00000375615;ENST00000436913;ENST00000541011	T;T	0.05580	3.83;3.42	5.5	-8.81	0.00813	.	0.974275	0.08406	N	0.950621	T	0.03871	0.0109	N	0.22421	0.69	0.09310	N	1	B;B;B	0.11235	0.003;0.003;0.004	B;B;B	0.12156	0.004;0.002;0.007	T	0.41770	-0.9490	10	0.36615	T	0.2	0.7953	10.0405	0.42155	0.2507:0.5082:0.2412:0.0	.	130;283;275	B4DJU0;Q6UX15;Q6UX15-2	.;LAYN_HUMAN;.	H	275;283;130;238	ENSP00000364764:Q275H;ENSP00000364765:Q283H	ENSP00000364764:Q275H	Q	+	3	2	LAYN	110936093	0.000000	0.05858	0.000000	0.03702	0.305000	0.27757	-0.865000	0.04250	-1.876000	0.01131	-0.294000	0.09567	CAG	.	.		0.498	LAYN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000391187.1	NM_178834	
ERC1	23085	hgsc.bcm.edu	37	12	1137264	1137264	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:1137264C>T	ENST00000397203.2	+	2	601	c.195C>T	c.(193-195)gcC>gcT	p.A65A	ERC1_ENST00000360905.4_Silent_p.A65A|ERC1_ENST00000355446.5_Silent_p.A65A|ERC1_ENST00000546231.2_Silent_p.A65A|ERC1_ENST00000543086.3_Silent_p.A65A|ERC1_ENST00000589028.1_Silent_p.A65A			Q8IUD2	RB6I2_HUMAN	ELKS/RAB6-interacting/CAST family member 1	65					I-kappaB phosphorylation (GO:0007252)|multicellular organismal development (GO:0007275)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|IkappaB kinase complex (GO:0008385)|presynaptic membrane (GO:0042734)	leucine zipper domain binding (GO:0043522)			NS(1)|breast(2)|cervix(2)|endometrium(2)|large_intestine(8)|lung(15)|ovary(3)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	38	all_epithelial(11;0.0698)|Ovarian(42;0.107)		OV - Ovarian serous cystadenocarcinoma(31;0.00239)|BRCA - Breast invasive adenocarcinoma(9;0.0567)			TAAATGCTGCCTATGCCACCT	0.493																																					p.A65A		Atlas-SNP	.											.	ERC1	95	.	0			c.C195T						.						90.0	92.0	91.0					12																	1137264		2203	4300	6503	SO:0001819	synonymous_variant	23085	exon2			TGCTGCCTATGCC	AB015617	CCDS8508.1, CCDS53732.1	12p13.3	2008-02-05	2006-08-14	2006-08-14	ENSG00000082805	ENSG00000082805			17072	protein-coding gene	gene with protein product		607127	"""RAB6 interacting protein 2"""	RAB6IP2		10697956, 11929610	Standard	NM_178040		Approved	ELKS, KIAA1081, CAST2, MGC12974	uc001qjb.2	Q8IUD2	OTTHUMG00000130138	ENST00000397203.2:c.195C>T	chr12.hg19:g.1137264C>T		70.0	0.0		82.0	26.0	NM_178039	A2RU77|A7E295|D3DUP7|D3DUP8|Q6NVK2|Q8IUD3|Q8IUD4|Q8IUD5|Q8NAS1|Q9NXN5|Q9UIK7|Q9UPS1	Silent	SNP	ENST00000397203.2	hg19	CCDS8508.1																																																																																			.	.		0.493	ERC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000398380.2	NM_015064	
DBX2	440097	hgsc.bcm.edu	37	12	45417596	45417596	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:45417596G>A	ENST00000332700.6	-	3	752	c.581C>T	c.(580-582)tCt>tTt	p.S194F		NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	194					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		CTGGTCCTCAGAAAAGACAGC	0.443																																					p.S194F		Atlas-SNP	.											.	DBX2	45	.	0			c.C581T						.						109.0	111.0	110.0					12																	45417596		2203	4300	6503	SO:0001583	missense	440097	exon3			TCCTCAGAAAAGA		CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.581C>T	chr12.hg19:g.45417596G>A	ENSP00000331470:p.Ser194Phe	80.0	0.0		70.0	18.0	NM_001004329		Missense_Mutation	SNP	ENST00000332700.6	hg19	CCDS31781.1	.	.	.	.	.	.	.	.	.	.	G	29.1	4.979819	0.92982	.	.	ENSG00000185610	ENST00000332700	D	0.96802	-4.13	5.49	5.49	0.81192	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.64402	D	0.000013	D	0.98645	0.9546	M	0.92923	3.36	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99517	1.0957	10	0.87932	D	0	-16.9304	19.3677	0.94471	0.0:0.0:1.0:0.0	.	194	Q6ZNG2	DBX2_HUMAN	F	194	ENSP00000331470:S194F	ENSP00000331470:S194F	S	-	2	0	DBX2	43703863	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.807000	0.99171	2.582000	0.87167	0.655000	0.94253	TCT	.	.		0.443	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000404810.1	NM_001004329	
TENC1	23371	hgsc.bcm.edu	37	12	53454679	53454679	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:53454679G>T	ENST00000314250.6	+	20	3279	c.2989G>T	c.(2989-2991)Gat>Tat	p.D997Y	TENC1_ENST00000314276.3_Missense_Mutation_p.D1007Y|TENC1_ENST00000546602.1_Missense_Mutation_p.D900Y|TENC1_ENST00000549700.1_Missense_Mutation_p.D932Y|TENC1_ENST00000552570.1_Missense_Mutation_p.D997Y|TENC1_ENST00000451358.1_Missense_Mutation_p.D987Y|TENC1_ENST00000379902.3_Missense_Mutation_p.D873Y	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	997	Pro-rich.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						GGGCCACTCAGATGGCGCCAG	0.697																																					p.D1007Y		Atlas-SNP	.											.	TENC1	148	.	0			c.G3019T						.						18.0	20.0	19.0					12																	53454679		2198	4298	6496	SO:0001583	missense	23371	exon20			CACTCAGATGGCG	AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.2989G>T	chr12.hg19:g.53454679G>T	ENSP00000319684:p.Asp997Tyr	89.0	0.0		105.0	29.0	NM_015319	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	ENST00000314250.6	hg19	CCDS8843.1	.	.	.	.	.	.	.	.	.	.	G	7.511	0.654653	0.14580	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000546602;ENST00000552570;ENST00000549700	D;D;D;D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42;-3.39;-3.42;-3.41	4.45	3.54	0.40534	.	0.825543	0.10800	N	0.632769	D	0.88043	0.6331	N	0.14661	0.345	0.25593	N	0.986679	P;P;P;P	0.37276	0.589;0.589;0.454;0.589	B;B;B;B	0.37888	0.192;0.192;0.133;0.26	T	0.80564	-0.1326	10	0.44086	T	0.13	-2.1879	7.6828	0.28524	0.1184:0.0:0.8816:0.0	.	997;900;997;1007	Q63HR2-6;Q63HR2-2;Q63HR2;Q63HR2-4	.;.;TENC1_HUMAN;.	Y	873;1007;997;987;900;997;932	ENSP00000369232:D873Y;ENSP00000319756:D1007Y;ENSP00000319684:D997Y;ENSP00000393362:D987Y;ENSP00000449363:D900Y;ENSP00000447021:D997Y;ENSP00000449361:D932Y	ENSP00000319684:D997Y	D	+	1	0	TENC1	51740946	0.021000	0.18746	0.312000	0.25196	0.082000	0.17680	2.016000	0.40971	1.206000	0.43276	0.561000	0.74099	GAT	.	.		0.697	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000405779.1	NM_170754	
SPRYD3	84926	hgsc.bcm.edu	37	12	53460128	53460128	+	Silent	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:53460128T>A	ENST00000301463.4	-	10	1250	c.1164A>T	c.(1162-1164)atA>atT	p.I388I	SPRYD3_ENST00000547837.1_Silent_p.I425I	NM_032840.2	NP_116229.1	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	388	Glu-rich.									central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						GCTCCGGCTCTATctcttccc	0.582											OREG0021856	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.I388I		Atlas-SNP	.											.	SPRYD3	29	.	0			c.A1164T						.						306.0	237.0	261.0					12																	53460128		2203	4300	6503	SO:0001819	synonymous_variant	84926	exon10			CGGCTCTATCTCT	AK074694	CCDS8845.1	12q13.13	2006-11-29		2006-02-02		ENSG00000167778			25920	protein-coding gene	gene with protein product						14702039	Standard	NM_032840		Approved	FLJ14800	uc001sbt.2	Q8NCJ5	OTTHUMG00000170101	ENST00000301463.4:c.1164A>T	chr12.hg19:g.53460128T>A		82.0	0.0	992	94.0	28.0	NM_032840	B9EG99|Q96SK5	Silent	SNP	ENST00000301463.4	hg19	CCDS8845.1																																																																																			.	.		0.582	SPRYD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000407264.1	NM_032840	
RARG	5916	hgsc.bcm.edu	37	12	53608001	53608001	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:53608001G>A	ENST00000425354.2	-	7	1142	c.655C>T	c.(655-657)Cgc>Tgc	p.R219C	RARG_ENST00000327550.3_Missense_Mutation_p.R147C|RARG_ENST00000394426.1_Missense_Mutation_p.R219C|RARG_ENST00000543726.1_Missense_Mutation_p.R197C|RARG_ENST00000338561.5_Missense_Mutation_p.R208C|RARG_ENST00000543762.1_5'UTR	NM_000966.5	NP_000957.1	P13631	RARG_HUMAN	retinoic acid receptor, gamma	219	Ligand-binding.				anterior/posterior pattern specification (GO:0009952)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|embryonic camera-type eye development (GO:0031076)|embryonic eye morphogenesis (GO:0048048)|embryonic hindlimb morphogenesis (GO:0035116)|face development (GO:0060324)|gene expression (GO:0010467)|glandular epithelial cell development (GO:0002068)|growth plate cartilage chondrocyte growth (GO:0003430)|Harderian gland development (GO:0070384)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cartilage development (GO:0061037)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of programmed cell death (GO:0043068)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell size (GO:0008361)|regulation of myelination (GO:0031641)|response to retinoic acid (GO:0032526)|retinal pigment epithelium development (GO:0003406)|retinoic acid receptor signaling pathway (GO:0048384)|trachea cartilage development (GO:0060534)|transcription initiation from RNA polymerase II promoter (GO:0006367)	integral component of membrane (GO:0016021)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|retinoic acid receptor activity (GO:0003708)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)	p.R219C(1)		breast(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20					Acitretin(DB00459)|Adapalene(DB00210)|Alitretinoin(DB00523)|Tazarotene(DB00799)|Tretinoin(DB00755)	AGCTGCACGCGGTGGTCTGCA	0.567																																					p.R219C		Atlas-SNP	.											RARG,colon,carcinoma,0,1	RARG	53	.	1	Substitution - Missense(1)	large_intestine(1)	c.C655T						.						77.0	67.0	70.0					12																	53608001		2203	4300	6503	SO:0001583	missense	5916	exon7			GCACGCGGTGGTC	M57707	CCDS8850.1, CCDS41790.1, CCDS58236.1, CCDS58237.1	12q13	2013-01-16			ENSG00000172819	ENSG00000172819		"""Nuclear hormone receptors"""	9866	protein-coding gene	gene with protein product		180190				1849262	Standard	NM_001042728		Approved	RARC, NR1B3	uc001scf.3	P13631	OTTHUMG00000048077	ENST00000425354.2:c.655C>T	chr12.hg19:g.53608001G>A	ENSP00000388510:p.Arg219Cys	93.0	0.0		83.0	17.0	NM_000966	B7Z492|B7Z4F1|B7ZAE4|J3KNP6|P22932|Q15281|Q52LZ8|Q9BYX8|Q9H1I3|Q9UJ38	Missense_Mutation	SNP	ENST00000425354.2	hg19	CCDS8850.1	.	.	.	.	.	.	.	.	.	.	G	17.74	3.464891	0.63513	.	.	ENSG00000172819	ENST00000425354;ENST00000394426;ENST00000327550;ENST00000338561;ENST00000543726;ENST00000550265	T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23	5.37	5.37	0.77165	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	T	0.61110	0.2321	M	0.83603	2.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;P	0.81914	0.986;0.985;0.995;0.817	T	0.64398	-0.6417	10	0.59425	D	0.04	.	11.8888	0.52618	0.0:0.0:0.7219:0.2781	.	256;197;219;208	F8VR45;B7Z4F1;P13631;F1D8P1	.;.;RARG_HUMAN;.	C	219;219;147;208;197;256	ENSP00000388510:R219C;ENSP00000377947:R219C;ENSP00000332695:R147C;ENSP00000343698:R208C;ENSP00000444335:R197C	ENSP00000332695:R147C	R	-	1	0	RARG	51894268	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	2.445000	0.44899	2.688000	0.91661	0.563000	0.77884	CGC	.	.		0.567	RARG-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000109404.2	NM_000966	
CALCOCO1	57658	hgsc.bcm.edu	37	12	54105826	54105826	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:54105826T>A	ENST00000550804.1	-	15	2038	c.1978A>T	c.(1978-1980)Aag>Tag	p.K660*	CALCOCO1_ENST00000262059.4_Nonsense_Mutation_p.K659*|CALCOCO1_ENST00000548263.1_3'UTR|CALCOCO1_ENST00000430117.2_Nonsense_Mutation_p.K575*			Q9P1Z2	CACO1_HUMAN	calcium binding and coiled-coil domain 1	660	C-terminal AD (CTNNB1 binding site). {ECO:0000250}.			K -> E (in Ref. 7; CAG38598). {ECO:0000305}.	intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	28						AAGCGCTCCTTACAGATAGGA	0.547																																					p.K660X		Atlas-SNP	.											.	CALCOCO1	50	.	0			c.A1978T						.						145.0	127.0	133.0					12																	54105826		2203	4300	6503	SO:0001587	stop_gained	57658	exon15			GCTCCTTACAGAT	AL136895	CCDS8864.1, CCDS44908.1	12q13.13	2014-01-02			ENSG00000012822	ENSG00000012822			29306	protein-coding gene	gene with protein product	"""coiled-coil leucine zipper coactivator 1"", ""inorganic pyrophosphatase activator"""					10819331, 11230166	Standard	NM_020898		Approved	KIAA1536, calphoglin, Cocoa	uc001sef.3	Q9P1Z2	OTTHUMG00000170095	ENST00000550804.1:c.1978A>T	chr12.hg19:g.54105826T>A	ENSP00000449960:p.Lys660*	170.0	0.0		160.0	45.0	NM_020898	B3KVA8|Q6FI59|Q71RC3|Q86WF8|Q96JU3|Q9H090	Nonsense_Mutation	SNP	ENST00000550804.1	hg19	CCDS8864.1	.	.	.	.	.	.	.	.	.	.	t	37	6.342693	0.97489	.	.	ENSG00000012822	ENST00000342760;ENST00000430117;ENST00000262059;ENST00000413257;ENST00000550804	.	.	.	4.26	4.26	0.50523	.	0.207171	0.24431	N	0.038596	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-23.0702	8.0675	0.30669	0.0:0.0:0.2057:0.7943	.	.	.	.	X	361;575;659;598;660	.	ENSP00000262059:K659X	K	-	1	0	CALCOCO1	52392093	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.821000	0.39041	1.933000	0.56026	0.375000	0.23000	AAG	.	.		0.547	CALCOCO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000407233.2	NM_020898	
LRP1	4035	hgsc.bcm.edu	37	12	57589063	57589063	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:57589063C>T	ENST00000243077.3	+	52	8784	c.8318C>T	c.(8317-8319)aCg>aTg	p.T2773M	MIR1228_ENST00000408438.1_RNA	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	2773	LDL-receptor class A 17. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	GAAGGCAAGACGTGCGGCCCC	0.627																																					p.T2773M		Atlas-SNP	.											.	LRP1	428	.	0			c.C8318T						.						117.0	123.0	121.0					12																	57589063		2203	4300	6503	SO:0001583	missense	4035	exon52			GCAAGACGTGCGG	X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.8318C>T	chr12.hg19:g.57589063C>T	ENSP00000243077:p.Thr2773Met	53.0	0.0		51.0	15.0	NM_002332	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	ENST00000243077.3	hg19	CCDS8932.1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.966717	0.74131	.	.	ENSG00000123384	ENST00000243077	D	0.96073	-3.9	4.82	4.82	0.62117	.	0.000000	0.64402	D	0.000001	D	0.97411	0.9153	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97764	1.0222	10	0.59425	D	0.04	.	16.8286	0.85938	0.0:1.0:0.0:0.0	.	2773	Q07954	LRP1_HUMAN	M	2773	ENSP00000243077:T2773M	ENSP00000243077:T2773M	T	+	2	0	LRP1	55875330	1.000000	0.71417	0.992000	0.48379	0.939000	0.58152	4.736000	0.62059	2.493000	0.84123	0.462000	0.41574	ACG	.	.		0.627	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412772.2	NM_002332	
NOS1	4842	hgsc.bcm.edu	37	12	117657990	117657990	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr12:117657990A>T	ENST00000338101.4	-	27	4166	c.4162T>A	c.(4162-4164)Tgt>Agt	p.C1388S	NOS1_ENST00000344089.3_3'UTR|NOS1_ENST00000317775.6_Missense_Mutation_p.C1354S			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		ACGTCCCCACAGACGTATATG	0.597																																					p.C1388S	Esophageal Squamous(162;1748 2599 51982 52956)	Atlas-SNP	.											.	NOS1	240	.	0			c.T4162A						.						142.0	153.0	150.0					12																	117657990		2199	4299	6498	SO:0001583	missense	4842	exon28			CCCCACAGACGTA		CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.4162T>A	chr12.hg19:g.117657990A>T	ENSP00000337459:p.Cys1388Ser	50.0	0.0		42.0	16.0	NM_001204218		Missense_Mutation	SNP	ENST00000338101.4	hg19	CCDS55890.1	.	.	.	.	.	.	.	.	.	.	A	23.3	4.399238	0.83120	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000338101	D;D	0.91295	-2.82;-2.82	4.44	3.27	0.37495	Oxidoreductase FAD/NAD(P)-binding (1);Flavoprotein pyridine nucleotide cytochrome reductase (1);	0.000000	0.85682	D	0.000000	D	0.93805	0.8019	M	0.87328	2.875	0.80722	D	1	P	0.43938	0.822	P	0.52793	0.709	D	0.93514	0.6855	10	0.87932	D	0	-17.9165	11.2674	0.49118	0.8471:0.1528:0.0:0.0	.	1354	P29475	NOS1_HUMAN	S	1249;1354;1388	ENSP00000320758:C1354S;ENSP00000337459:C1388S	ENSP00000320758:C1354S	C	-	1	0	NOS1	116142373	1.000000	0.71417	0.627000	0.29227	0.926000	0.56050	7.282000	0.78630	0.712000	0.32039	0.459000	0.35465	TGT	.	.		0.597	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000268053.1		
SACS	26278	hgsc.bcm.edu	37	13	23929324	23929324	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr13:23929324C>T	ENST00000382292.3	-	7	1700	c.1427G>A	c.(1426-1428)aGc>aAc	p.S476N	SACS_ENST00000476776.1_5'Flank|SACS_ENST00000402364.1_5'UTR|SACS_ENST00000382298.3_Missense_Mutation_p.S476N			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	476					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		CCATTTTATGCTCCTGCGGTT	0.483																																					p.S476N		Atlas-SNP	.											.	SACS	871	.	0			c.G1427A						.						58.0	57.0	58.0					13																	23929324		2203	4300	6503	SO:0001583	missense	26278	exon8			TTTATGCTCCTGC	AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1427G>A	chr13.hg19:g.23929324C>T	ENSP00000371729:p.Ser476Asn	64.0	0.0		53.0	17.0	NM_014363	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	ENST00000382292.3	hg19	CCDS9300.2	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962941	0.92791	.	.	ENSG00000151835	ENST00000382292;ENST00000382298;ENST00000423156	T;T;T	0.18657	2.2;2.2;2.2	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.38746	0.1052	L	0.36672	1.1	0.54753	D	0.999987	D;P;P	0.76494	0.999;0.729;0.638	D;B;P	0.71414	0.973;0.413;0.613	T	0.02365	-1.1170	10	0.44086	T	0.13	.	19.9404	0.97159	0.0:1.0:0.0:0.0	.	375;263;476	B2REB1;E9PAL4;Q9NZJ4	.;.;SACS_HUMAN	N	476;476;100	ENSP00000371729:S476N;ENSP00000371735:S476N;ENSP00000390925:S100N	ENSP00000371729:S476N	S	-	2	0	SACS	22827324	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	7.764000	0.85297	2.788000	0.95919	0.555000	0.69702	AGC	.	.		0.483	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044148.3	NM_014363	
PDS5B	23047	hgsc.bcm.edu	37	13	33333788	33333788	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr13:33333788A>G	ENST00000315596.10	+	29	3518	c.3332A>G	c.(3331-3333)tAt>tGt	p.Y1111C		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	1111					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		ACCAAAAATTATCTGCCTCCT	0.313																																					p.Y1111C		Atlas-SNP	.											.	PDS5B	141	.	0			c.A3332G						.						75.0	70.0	71.0					13																	33333788		1801	4058	5859	SO:0001583	missense	23047	exon29			AAAATTATCTGCC	AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.3332A>G	chr13.hg19:g.33333788A>G	ENSP00000313851:p.Tyr1111Cys	102.0	0.0		103.0	28.0	NM_015032	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	ENST00000315596.10	hg19	CCDS41878.1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.312817	0.81358	.	.	ENSG00000083642	ENST00000315596;ENST00000421084;ENST00000447833	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.77831	0.4189	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	T	0.78450	-0.2199	9	0.46703	T	0.11	-21.814	15.5627	0.76262	1.0:0.0:0.0:0.0	.	1111	Q9NTI5	PDS5B_HUMAN	C	1111;1111;65	.	ENSP00000313851:Y1111C	Y	+	2	0	PDS5B	32231788	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.887000	0.92456	2.153000	0.67306	0.528000	0.53228	TAT	.	.		0.313	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044428.3	NM_015032	
MYCBP2	23077	hgsc.bcm.edu	37	13	77672195	77672195	+	Nonsense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr13:77672195T>A	ENST00000544440.2	-	56	8997	c.8980A>T	c.(8980-8982)Aga>Tga	p.R2994*	MYCBP2_ENST00000482517.1_5'Flank|MYCBP2_ENST00000357337.6_Nonsense_Mutation_p.R2994*|MYCBP2_ENST00000407578.2_Nonsense_Mutation_p.R3032*|MYCBP2-AS1_ENST00000593933.1_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		AACACAGCTCTGGCACATTCG	0.443																																					p.R3032X		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.A9094T						.						78.0	75.0	76.0					13																	77672195		2203	4300	6503	SO:0001587	stop_gained	23077	exon56			CAGCTCTGGCACA	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.8980A>T	chr13.hg19:g.77672195T>A	ENSP00000444596:p.Arg2994*	64.0	0.0		115.0	30.0	NM_015057		Nonsense_Mutation	SNP	ENST00000544440.2	hg19		.	.	.	.	.	.	.	.	.	.	T	48	14.860176	0.99813	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	.	.	.	5.57	-1.86	0.07760	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	21.0492	0.99944	0.0:0.0:0.7593:0.2407	.	.	.	.	X	2994;3032;2994	.	ENSP00000349892:R2994X	R	-	1	2	MYCBP2	76570196	1.000000	0.71417	0.986000	0.45419	0.947000	0.59692	1.020000	0.30027	-0.540000	0.06265	0.482000	0.46254	AGA	.	.		0.443	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
DAOA	267012	hgsc.bcm.edu	37	13	106119492	106119492	+	Splice_Site	SNP	T	T	C	rs148297571	byFrequency	TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr13:106119492T>C	ENST00000375936.3	+	2	179		c.e2+2		DAOA-AS1_ENST00000448407.1_RNA|DAOA_ENST00000329625.5_Splice_Site	NM_001161812.1|NM_172370.3	NP_001155284.1|NP_758958.3	P59103	DAOA_HUMAN	D-amino acid oxidase activator						negative regulation of D-amino-acid oxidase activity (GO:1900758)|positive regulation of catalytic activity (GO:0043085)	Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)	enzyme activator activity (GO:0008047)|enzyme binding (GO:0019899)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(5)|skin(1)	13	Lung NSC(43;0.01)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					ACTCTATTGGTATGTTACTCT	0.289																																					.		Atlas-SNP	.											.	DAOA	26	.	0			c.133+2T>C						.						69.0	66.0	67.0					13																	106119492		1790	4063	5853	SO:0001630	splice_region_variant	267012	exon2			TATTGGTATGTTA	AY138547	CCDS41905.1, CCDS53880.1, CCDS59242.1	13q33.2	2011-08-01			ENSG00000182346	ENSG00000182346			21191	protein-coding gene	gene with protein product	"""G72 transcript"""	607408				12364586, 15057823	Standard	NM_001161814		Approved	G72	uc010tjg.2	P59103	OTTHUMG00000041333	ENST00000375936.3:c.133+2T>C	chr13.hg19:g.106119492T>C		62.0	0.0		78.0	10.0	NM_172370	A6NKG7|Q0VAE6|Q5VX59|Q86Y17|Q8IWM4	Splice_Site	SNP	ENST00000375936.3	hg19	CCDS41905.1	.	.	.	.	.	.	.	.	.	.	T	1.982	-0.433970	0.04669	.	.	ENSG00000182346	ENST00000375936	.	.	.	3.19	0.607	0.17564	.	.	.	.	.	.	.	.	.	.	.	0.18873	N	0.999986	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.3622	0.04310	0.2417:0.1378:0.0:0.6205	.	.	.	.	.	-1	.	.	.	+	.	.	DAOA	104917493	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	0.961000	0.29267	0.122000	0.18314	0.455000	0.32223	.	.	T|0.994;A|0.006		0.289	DAOA-005	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000099040.2	NM_172370	Intron
FANCM	57697	hgsc.bcm.edu	37	14	45645056	45645056	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:45645056A>G	ENST00000267430.5	+	14	3184	c.3099A>G	c.(3097-3099)aaA>aaG	p.K1033K	FANCM_ENST00000542564.2_Silent_p.K1007K	NM_020937.2	NP_065988.1	Q8IYD8	FANCM_HUMAN	Fanconi anemia, complementation group M	1033					DNA repair (GO:0006281)|replication fork processing (GO:0031297)|resolution of meiotic recombination intermediates (GO:0000712)	FANCM-MHF complex (GO:0071821)|Fanconi anaemia nuclear complex (GO:0043240)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|nuclease activity (GO:0004518)			breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(31)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	85						GAAGTGATAAATGCACCTGTT	0.363								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																												p.K1033K		Atlas-SNP	.											.	FANCM	225	.	0			c.A3099G						.						39.0	34.0	36.0					14																	45645056		2203	4298	6501	SO:0001819	synonymous_variant	57697	exon14	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	TGATAAATGCACC	AK001672	CCDS32070.1	14q21.3	2014-09-17	2005-09-01	2005-09-01		ENSG00000187790		"""Fanconi anemia, complementation groups"""	23168	protein-coding gene	gene with protein product		609644	"""KIAA1596"""	KIAA1596		10997877, 16116422	Standard	NM_020937		Approved	FAAP250	uc001wwd.4	Q8IYD8		ENST00000267430.5:c.3099A>G	chr14.hg19:g.45645056A>G		156.0	0.0		151.0	48.0	NM_020937	B2RTQ9|Q3YFH9|Q8N9X6|Q9HCH6	Silent	SNP	ENST00000267430.5	hg19	CCDS32070.1																																																																																			.	.		0.363	FANCM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000410474.1	XM_048128	
COQ6	51004	hgsc.bcm.edu	37	14	74417192	74417192	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:74417192G>A	ENST00000334571.2	+	1	197	c.157G>A	c.(157-159)Gcc>Acc	p.A53T	FAM161B_ENST00000286544.3_5'Flank|COQ6_ENST00000555552.1_3'UTR|COQ6_ENST00000394026.4_Intron|COQ6_ENST00000554920.1_Missense_Mutation_p.A53T|FAM161B_ENST00000534936.1_5'Flank|COQ6_ENST00000238709.4_Intron	NM_182476.2	NP_872282.1	Q9Y2Z9	COQ6_HUMAN	coenzyme Q6 monooxygenase	53					small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16				BRCA - Breast invasive adenocarcinoma(234;0.00337)		CATGGCCTGTGCCTTGGGTAA	0.657																																					p.A53T		Atlas-SNP	.											.	COQ6	27	.	0			c.G157A						.						32.0	27.0	29.0					14																	74417192		2202	4297	6499	SO:0001583	missense	51004	exon1			GCCTGTGCCTTGG	AF132944	CCDS9823.1, CCDS9824.1, CCDS9824.2	14q24.1	2013-05-01	2013-05-01		ENSG00000119723	ENSG00000119723			20233	protein-coding gene	gene with protein product		614647	"""coenzyme Q6 homolog (yeast)"", ""coenzyme Q6 homolog, monooxygenase (yeast)"", ""coenzyme Q6 homolog, monooxygenase (S. cerevisiae)"""			21540551	Standard	NM_182476		Approved	CGI-10	uc001xph.3	Q9Y2Z9	OTTHUMG00000171260	ENST00000334571.2:c.157G>A	chr14.hg19:g.74417192G>A	ENSP00000333946:p.Ala53Thr	79.0	0.0		95.0	26.0	NM_182476	B7Z3K8|Q53GG6|Q86U30|Q96CA1|Q96CK2	Missense_Mutation	SNP	ENST00000334571.2	hg19	CCDS9823.1	.	.	.	.	.	.	.	.	.	.	G	32	5.184132	0.94885	.	.	ENSG00000119723	ENST00000334571;ENST00000556300;ENST00000554920;ENST00000545052	T	0.48201	0.82	5.01	5.01	0.66863	Aromatic-ring hydroxylase-like (1);	0.052943	0.85682	D	0.000000	T	0.67316	0.2880	M	0.65498	2.005	0.80722	D	1	D;P	0.65815	0.995;0.952	D;P	0.66847	0.947;0.703	T	0.70234	-0.4928	10	0.72032	D	0.01	-2.6135	18.5698	0.91130	0.0:0.0:1.0:0.0	.	53;53	B7Z357;Q9Y2Z9	.;COQ6_HUMAN	T	53	ENSP00000333946:A53T	ENSP00000333946:A53T	A	+	1	0	COQ6	73486945	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.548000	0.67255	2.615000	0.88500	0.650000	0.86243	GCC	.	.		0.657	COQ6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000412616.1		
PROX2	283571	hgsc.bcm.edu	37	14	75329266	75329266	+	Silent	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:75329266A>T	ENST00000445876.1	-	1	1271	c.1272T>A	c.(1270-1272)gcT>gcA	p.A424A	PROX2_ENST00000556084.2_Intron|PROX2_ENST00000556489.2_Silent_p.A424A			Q3B8N5	PROX2_HUMAN	prospero homeobox 2	424					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|lung(3)	6			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00652)		CCTCCATGACAGCATGCAGGC	0.512																																					p.A424A		Atlas-SNP	.											.	PROX2	44	.	0			c.T1272A						.						92.0	93.0	93.0					14																	75329266		2014	4176	6190	SO:0001819	synonymous_variant	283571	exon1			CATGACAGCATGC		CCDS45136.1, CCDS45136.2, CCDS73663.1	14q24.3	2012-10-02			ENSG00000119608	ENSG00000119608		"""Homeoboxes / PROS class"""	26715	protein-coding gene	gene with protein product		615094					Standard	NM_001080408		Approved	FLJ36749	uc031qpi.1	Q3B8N5	OTTHUMG00000171481	ENST00000445876.1:c.1272T>A	chr14.hg19:g.75329266A>T		49.0	0.0		61.0	20.0	NM_001243007	C9J5W1|Q8N9Q3	Silent	SNP	ENST00000445876.1	hg19	CCDS45136.2																																																																																			.	.		0.512	PROX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding			
RPS6KA5	9252	hgsc.bcm.edu	37	14	91340125	91340125	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:91340125C>A	ENST00000261991.3	-	16	2184	c.2011G>T	c.(2011-2013)Gat>Tat	p.D671Y	RPS6KA5_ENST00000536315.2_Missense_Mutation_p.D592Y	NM_004755.2	NP_004746.2	O75582	KS6A5_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 5	671	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|histone H2A-S1 phosphorylation (GO:0043990)|histone H3-S10 phosphorylation (GO:0043987)|histone H3-S28 phosphorylation (GO:0043988)|histone phosphorylation (GO:0016572)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cytokine production (GO:0001818)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone phosphorylation (GO:0033129)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0148)|Melanoma(154;0.099)|all_epithelial(191;0.146)		Epithelial(152;0.182)|BRCA - Breast invasive adenocarcinoma(234;0.201)		TTGTTTGGATCTACTGTGAGA	0.353																																					p.D671Y		Atlas-SNP	.											.	RPS6KA5	135	.	0			c.G2011T						.						219.0	216.0	217.0					14																	91340125		2203	4300	6503	SO:0001583	missense	9252	exon16			TTGGATCTACTGT	AF074393	CCDS9893.1, CCDS45149.1	14q31-q32.1	2011-04-05	2002-08-29			ENSG00000100784			10434	protein-coding gene	gene with protein product		603607	"""ribosomal protein S6 kinase, 90kD, polypeptide 5"""			9687510, 10702687	Standard	NM_004755		Approved	MSK1, RLPK	uc001xys.2	O75582		ENST00000261991.3:c.2011G>T	chr14.hg19:g.91340125C>A	ENSP00000261991:p.Asp671Tyr	38.0	0.0		59.0	15.0	NM_004755	O95316|Q96AF7	Missense_Mutation	SNP	ENST00000261991.3	hg19	CCDS9893.1	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488128	0.84854	.	.	ENSG00000100784	ENST00000261991;ENST00000536315	T;T	0.58506	0.33;0.33	5.44	5.44	0.79542	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.82476	0.5045	M	0.92122	3.275	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.86682	0.1917	10	0.87932	D	0	.	19.2862	0.94072	0.0:1.0:0.0:0.0	.	671	O75582	KS6A5_HUMAN	Y	671;592	ENSP00000261991:D671Y;ENSP00000442803:D592Y	ENSP00000261991:D671Y	D	-	1	0	RPS6KA5	90409878	1.000000	0.71417	0.992000	0.48379	0.954000	0.61252	7.794000	0.85869	2.553000	0.86117	0.650000	0.86243	GAT	.	.		0.353	RPS6KA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000411442.2	NM_004755	
DICER1	23405	hgsc.bcm.edu	37	14	95590842	95590842	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:95590842T>A	ENST00000526495.1	-	10	1358	c.1067A>T	c.(1066-1068)cAt>cTt	p.H356L	DICER1_ENST00000527414.1_Missense_Mutation_p.H356L|DICER1_ENST00000343455.3_Missense_Mutation_p.H356L|DICER1_ENST00000541352.1_Missense_Mutation_p.H356L|DICER1_ENST00000393063.1_Missense_Mutation_p.H356L			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	356	Required for interaction with PRKRA and TARBP2.				angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		ACATAGTGCATGTATTTTCCT	0.373			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																												p.H356L		Atlas-SNP	.	yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	.	DICER1	181	.	0			c.A1067T						.						136.0	137.0	136.0					14																	95590842		2203	4300	6503	SO:0001583	missense	23405	exon9	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AGTGCATGTATTT	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.1067A>T	chr14.hg19:g.95590842T>A	ENSP00000437256:p.His356Leu	146.0	0.0		145.0	42.0	NM_030621	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	ENST00000526495.1	hg19	CCDS9931.1	.	.	.	.	.	.	.	.	.	.	T	23.8	4.457908	0.84317	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.49847	0.1581	L	0.56769	1.78	0.80722	D	1	D	0.56035	0.974	P	0.51742	0.678	T	0.41787	-0.9489	10	0.20046	T	0.44	-27.1109	15.6811	0.77371	0.0:0.0:0.0:1.0	.	356	Q9UPY3	DICER_HUMAN	L	356	ENSP00000343745:H356L;ENSP00000437256:H356L;ENSP00000376783:H356L;ENSP00000435681:H356L;ENSP00000444719:H356L	ENSP00000343745:H356L	H	-	2	0	DICER1	94660595	1.000000	0.71417	0.761000	0.31378	0.997000	0.91878	7.471000	0.80985	2.106000	0.64143	0.477000	0.44152	CAT	.	.		0.373	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000387997.1		
TECPR2	9895	hgsc.bcm.edu	37	14	102898383	102898383	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr14:102898383C>T	ENST00000359520.7	+	8	1561	c.1335C>T	c.(1333-1335)aaC>aaT	p.N445N	TECPR2_ENST00000558678.1_Silent_p.N445N	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	445					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						AGAGATTCAACGCCATCAGCT	0.592																																					p.N445N		Atlas-SNP	.											.	TECPR2	114	.	0			c.C1335T						.						17.0	18.0	17.0					14																	102898383		2082	4102	6184	SO:0001819	synonymous_variant	9895	exon8			ATTCAACGCCATC	AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1335C>T	chr14.hg19:g.102898383C>T		93.0	0.0		80.0	21.0	NM_001172631	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Silent	SNP	ENST00000359520.7	hg19	CCDS32162.1																																																																																			.	.		0.592	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000415056.2	NM_014844	
NPAP1	23742	hgsc.bcm.edu	37	15	24921184	24921184	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:24921184G>A	ENST00000329468.2	+	1	644	c.170G>A	c.(169-171)cGc>cAc	p.R57H		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	57					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											AACGCCCGTCGCAGGCCTTCA	0.746																																					p.R57H		Atlas-SNP	.											C15orf2,caecum,carcinoma,0,2	.	.	.	0			c.G170A						.						15.0	19.0	17.0					15																	24921184		2167	4254	6421	SO:0001583	missense	23742	exon1			CCCGTCGCAGGCC	AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.170G>A	chr15.hg19:g.24921184G>A	ENSP00000333735:p.Arg57His	136.0	0.0		134.0	39.0	NM_018958		Missense_Mutation	SNP	ENST00000329468.2	hg19	CCDS10015.1	.	.	.	.	.	.	.	.	.	.	.	15.11	2.735211	0.48939	.	.	ENSG00000185823	ENST00000329468	T	0.07216	3.21	2.17	1.23	0.21249	.	.	.	.	.	T	0.09113	0.0225	L	0.34521	1.04	0.09310	N	1	D	0.69078	0.997	P	0.53518	0.728	T	0.28586	-1.0039	9	0.17369	T	0.5	.	4.5859	0.12282	0.1955:0.0:0.8045:0.0	.	57	Q9NZP6	CO002_HUMAN	H	57	ENSP00000333735:R57H	ENSP00000333735:R57H	R	+	2	0	C15orf2	22472277	0.001000	0.12720	0.000000	0.03702	0.006000	0.05464	0.074000	0.14662	0.465000	0.27167	0.484000	0.47621	CGC	.	.		0.746	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251253.1	NM_018958	
NUTM1	256646	hgsc.bcm.edu	37	15	34646775	34646775	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:34646775A>T	ENST00000333756.4	+	5	1275	c.1120A>T	c.(1120-1122)Atc>Ttc	p.I374F	NUTM1_ENST00000537011.1_Missense_Mutation_p.I402F|NUTM1_ENST00000438749.3_Missense_Mutation_p.I392F	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	374						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GTATGTTGACATCATGGAATG	0.587																																					p.I374F		Atlas-SNP	.											.	C15orf55	110	.	0			c.A1120T						.						122.0	119.0	120.0					15																	34646775		2201	4298	6499	SO:0001583	missense	256646	exon5			GTTGACATCATGG	AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.1120A>T	chr15.hg19:g.34646775A>T	ENSP00000329448:p.Ile374Phe	146.0	0.0		179.0	58.0	NM_175741	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	ENST00000333756.4	hg19	CCDS32190.1	.	.	.	.	.	.	.	.	.	.	A	17.62	3.434087	0.62955	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.16073	2.37;2.38;2.38	5.32	4.19	0.49359	Nuclear Testis protein, C-terminal (1);	0.000000	0.56097	D	0.000039	T	0.41166	0.1147	M	0.83483	2.645	0.39550	D	0.968951	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.85130	0.995;0.992;0.997	T	0.43426	-0.9392	10	0.87932	D	0	.	8.5691	0.33558	0.9111:0.0:0.0889:0.0	.	392;402;374	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	F	402;392;243;374	ENSP00000444896:I402F;ENSP00000407031:I392F;ENSP00000329448:I374F	ENSP00000329448:I374F	I	+	1	0	C15orf55	32434067	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	4.911000	0.63328	2.133000	0.65898	0.482000	0.46254	ATC	.	.		0.587	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000418026.1	NM_175741	
LTK	4058	hgsc.bcm.edu	37	15	41804112	41804112	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:41804112T>A	ENST00000263800.6	-	5	656	c.560A>T	c.(559-561)gAa>gTa	p.E187V	LTK_ENST00000453182.2_Missense_Mutation_p.E187V|LTK_ENST00000561619.1_Intron|LTK_ENST00000355166.5_Missense_Mutation_p.E187V	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	187					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CGCGTGCTCTTCAACGGCTCG	0.746										TSP Lung(18;0.14)																											p.E187V		Atlas-SNP	.											.	LTK	117	.	0			c.A560T						.						3.0	4.0	4.0					15																	41804112		1796	3749	5545	SO:0001583	missense	4058	exon5			TGCTCTTCAACGG	D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.560A>T	chr15.hg19:g.41804112T>A	ENSP00000263800:p.Glu187Val	76.0	0.0		81.0	24.0	NM_001135685	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	ENST00000263800.6	hg19	CCDS10077.1	.	.	.	.	.	.	.	.	.	.	T	19.07	3.755498	0.69648	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.47177	0.85;0.85;0.85	3.38	2.24	0.28232	.	0.481200	0.15183	U	0.275992	T	0.60327	0.2260	M	0.67397	2.05	0.26839	N	0.968425	D;D;P	0.63046	0.992;0.989;0.553	D;P;B	0.65443	0.935;0.893;0.259	T	0.49661	-0.8916	10	0.56958	D	0.05	.	7.4895	0.27454	0.0:0.1091:0.0:0.8909	.	187;187;187	E9PFX4;P29376-4;P29376	.;.;LTK_HUMAN	V	187	ENSP00000347293:E187V;ENSP00000263800:E187V;ENSP00000392196:E187V	ENSP00000263800:E187V	E	-	2	0	LTK	39591404	0.291000	0.24352	0.260000	0.24451	0.044000	0.14063	0.249000	0.18216	0.385000	0.24970	-0.441000	0.05720	GAA	.	.		0.746	LTK-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000252690.2		
DUOX1	53905	hgsc.bcm.edu	37	15	45426494	45426494	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:45426494G>A	ENST00000321429.4	+	5	701	c.294G>A	c.(292-294)ttG>ttA	p.L98L	DUOX1_ENST00000389037.3_Silent_p.L98L	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	98	Peroxidase-like; mediates peroxidase activity.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GCACAGTGTTGGGGGTCTTCT	0.602																																					p.L98L		Atlas-SNP	.											.	DUOX1	125	.	0			c.G294A						.						38.0	43.0	42.0					15																	45426494		2198	4298	6496	SO:0001819	synonymous_variant	53905	exon5			AGTGTTGGGGGTC	AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.294G>A	chr15.hg19:g.45426494G>A		139.0	0.0		136.0	48.0	NM_017434	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Silent	SNP	ENST00000321429.4	hg19	CCDS32221.1																																																																																			.	.		0.602	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000416251.1	NM_017434	
SHF	90525	hgsc.bcm.edu	37	15	45464477	45464477	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:45464477C>G	ENST00000290894.8	-	6	1327	c.833G>C	c.(832-834)gGc>gCc	p.G278A	SHF_ENST00000318390.6_Missense_Mutation_p.G288A|SHF_ENST00000560734.1_Intron|SHF_ENST00000458022.2_Missense_Mutation_p.G94A|SHF_ENST00000560540.1_Missense_Mutation_p.G296A|SHF_ENST00000561091.1_5'Flank|RP11-519G16.2_ENST00000560034.1_RNA|SHF_ENST00000560471.1_Missense_Mutation_p.G343A	NM_138356.2	NP_612365			Src homology 2 domain containing F											endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(2)	12		all_cancers(109;8.13e-11)|all_epithelial(112;6.29e-09)|Lung NSC(122;3.57e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;4.1e-16)|GBM - Glioblastoma multiforme(94;5.98e-06)		CTCCTCCCGGCCAGGTGACAG	0.607																																					p.G278A		Atlas-SNP	.											.	SHF	27	.	0			c.G833C						.						35.0	41.0	39.0					15																	45464477		2198	4298	6496	SO:0001583	missense	90525	exon6			TCCCGGCCAGGTG	BC007586	CCDS10120.2, CCDS73721.1	15q21.1	2013-02-14			ENSG00000138606	ENSG00000138606		"""SH2 domain containing"""	25116	protein-coding gene	gene with protein product						11095946	Standard	NM_138356		Approved		uc001zuy.3	Q7M4L6	OTTHUMG00000131353	ENST00000290894.8:c.833G>C	chr15.hg19:g.45464477C>G	ENSP00000290894:p.Gly278Ala	60.0	0.0		53.0	17.0	NM_138356		Missense_Mutation	SNP	ENST00000290894.8	hg19	CCDS10120.2	.	.	.	.	.	.	.	.	.	.	C	10.03	1.240036	0.22711	.	.	ENSG00000138606	ENST00000290894;ENST00000361989;ENST00000318390;ENST00000458022;ENST00000413198	T;T;T	0.32023	1.47;1.47;1.47	3.91	3.91	0.45181	.	0.760658	0.13439	N	0.387802	T	0.26738	0.0654	L	0.31926	0.97	0.32589	N	0.527461	P;B;B;B	0.47677	0.899;0.0;0.014;0.001	P;B;B;B	0.47528	0.549;0.002;0.032;0.004	T	0.05131	-1.0904	10	0.12766	T	0.61	-13.252	9.9553	0.41663	0.0:0.792:0.208:0.0	.	141;221;288;278	Q8N9I8;E7EWB7;F8W6K9;Q7M4L6	.;.;.;SHF_HUMAN	A	278;278;288;94;221	ENSP00000290894:G278A;ENSP00000315978:G288A;ENSP00000411530:G94A	ENSP00000290894:G278A	G	-	2	0	SHF	43251769	0.990000	0.36364	1.000000	0.80357	0.996000	0.88848	2.265000	0.43311	1.904000	0.55121	0.563000	0.77884	GGC	.	.		0.607	SHF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000254141.2	NM_138356	
TLN2	83660	hgsc.bcm.edu	37	15	63089561	63089561	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:63089561T>A	ENST00000561311.1	+	47	6424	c.6194T>A	c.(6193-6195)cTg>cAg	p.L2065Q	TLN2_ENST00000306829.6_Missense_Mutation_p.L2065Q			Q9Y4G6	TLN2_HUMAN	talin 2	2065					cell adhesion (GO:0007155)|cell-cell junction assembly (GO:0007043)|cytoskeletal anchoring at plasma membrane (GO:0007016)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	actin binding (GO:0003779)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(3)|breast(6)|central_nervous_system(3)|endometrium(8)|kidney(8)|large_intestine(20)|lung(34)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)	99						GTGGTCAAGCTGGGGGCAGCC	0.662																																					p.L2065Q		Atlas-SNP	.											.	TLN2	253	.	0			c.T6194A						.						32.0	35.0	34.0					15																	63089561		2202	4300	6502	SO:0001583	missense	83660	exon45			TCAAGCTGGGGGC	AB002318	CCDS32261.1	15q15-q21	2008-07-03			ENSG00000171914	ENSG00000171914			15447	protein-coding gene	gene with protein product		607349				9205841, 11527381	Standard	NM_015059		Approved	KIAA0320, ILWEQ	uc002alb.4	Q9Y4G6	OTTHUMG00000133679	ENST00000561311.1:c.6194T>A	chr15.hg19:g.63089561T>A	ENSP00000453508:p.Leu2065Gln	108.0	0.0		124.0	39.0	NM_015059	A6NLB8	Missense_Mutation	SNP	ENST00000561311.1	hg19	CCDS32261.1	.	.	.	.	.	.	.	.	.	.	T	24.5	4.535519	0.85812	.	.	ENSG00000171914	ENST00000306829	T	0.13307	2.6	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.29288	0.0729	L	0.57536	1.79	0.58432	D	0.999997	D	0.71674	0.998	P	0.62089	0.898	T	0.03852	-1.0998	10	0.13853	T	0.58	-13.024	16.3483	0.83171	0.0:0.0:0.0:1.0	.	2065	Q9Y4G6	TLN2_HUMAN	Q	2065	ENSP00000303476:L2065Q	ENSP00000303476:L2065Q	L	+	2	0	TLN2	60876614	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.997000	0.88414	2.254000	0.74563	0.533000	0.62120	CTG	.	.		0.662	TLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257878.2		
PIF1	80119	hgsc.bcm.edu	37	15	65113605	65113605	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:65113605A>T	ENST00000268043.4	-	5	1026	c.932T>A	c.(931-933)gTg>gAg	p.V311E	PIF1_ENST00000333425.6_Missense_Mutation_p.V311E|PIF1_ENST00000559239.1_Missense_Mutation_p.V311E					PIF1 5'-to-3' DNA helicase											kidney(1)|lung(1)	2						GTCTGCCTCCACCATTGAGAT	0.612																																					p.V311E		Atlas-SNP	.											.	PIF1	43	.	0			c.T932A						.						96.0	94.0	95.0					15																	65113605		2202	4299	6501	SO:0001583	missense	80119	exon5			GCCTCCACCATTG	AK026345	CCDS10195.2, CCDS66797.1	15q22.1	2013-05-13	2013-05-13	2006-11-24	ENSG00000140451	ENSG00000140451	3.6.4.12		26220	protein-coding gene	gene with protein product		610953	"""chromosome 15 open reading frame 20"", ""PIF1 5'-to-3' DNA helicase homolog (S. cerevisiae)"""	C15orf20		10926538, 16522649	Standard	NM_025049		Approved	FLJ22692	uc002ant.2	Q9H611	OTTHUMG00000132974	ENST00000268043.4:c.932T>A	chr15.hg19:g.65113605A>T	ENSP00000268043:p.Val311Glu	195.0	0.0		171.0	40.0	NM_025049		Missense_Mutation	SNP	ENST00000268043.4	hg19	CCDS10195.2	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557026	0.86231	.	.	ENSG00000140451	ENST00000268043;ENST00000333425	T;T	0.57273	0.41;0.41	5.97	4.82	0.62117	.	0.053557	0.64402	D	0.000001	T	0.79890	0.4524	H	0.96460	3.825	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.84310	0.0510	10	0.87932	D	0	-26.6362	11.4094	0.49917	0.8485:0.1515:0.0:0.0	.	311	Q9H611	PIF1_HUMAN	E	311	ENSP00000268043:V311E;ENSP00000328174:V311E	ENSP00000268043:V311E	V	-	2	0	PIF1	62900658	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.920000	0.75799	1.035000	0.39972	0.533000	0.62120	GTG	.	.		0.612	PIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256533.1	NM_025049	
CSPG4	1464	hgsc.bcm.edu	37	15	75968374	75968374	+	Silent	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:75968374A>C	ENST00000308508.5	-	10	6578	c.6486T>G	c.(6484-6486)acT>acG	p.T2162T	AC105020.1_ENST00000435356.1_5'Flank|CTD-2026K11.1_ENST00000569467.1_RNA	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2162	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						TGTAAGGCTCAGTGGCAAAGT	0.701																																					p.T2162T		Atlas-SNP	.											.	CSPG4	175	.	0			c.T6486G						.						16.0	15.0	16.0					15																	75968374		2185	4277	6462	SO:0001819	synonymous_variant	1464	exon10			AGGCTCAGTGGCA	X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6486T>G	chr15.hg19:g.75968374A>C		18.0	0.0		27.0	9.0	NM_001897	D3DW77|Q92675	Silent	SNP	ENST00000308508.5	hg19	CCDS10284.1																																																																																			.	.		0.701	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000286472.1	NM_001897	
ABHD2	11057	hgsc.bcm.edu	37	15	89659582	89659582	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr15:89659582C>T	ENST00000352732.5	+	3	544	c.24C>T	c.(22-24)ccC>ccT	p.P8P	ABHD2_ENST00000355100.3_Silent_p.P8P|ABHD2_ENST00000565973.1_Silent_p.P8P	NM_152924.4	NP_690888.1	P08910	ABHD2_HUMAN	abhydrolase domain containing 2	8					negative regulation of cell migration (GO:0030336)|response to wounding (GO:0009611)	integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)	p.P8P(1)		NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|soft_tissue(1)	23	Lung NSC(78;0.0472)|all_lung(78;0.089)					TGGAGACTCCCGAACTCCCAG	0.577																																					p.P8P	Colon(11;252 417 24570 33239 41878)	Atlas-SNP	.											.	ABHD2	55	.	1	Substitution - coding silent(1)	lung(1)	c.C24T						.						107.0	94.0	98.0					15																	89659582		2200	4299	6499	SO:0001819	synonymous_variant	11057	exon7			GACTCCCGAACTC	X12433	CCDS10348.1	15q26.1	2006-10-06			ENSG00000140526	ENSG00000140526		"""Abhydrolase domain containing"""	18717	protein-coding gene	gene with protein product		612196					Standard	NM_152924		Approved	LABH2	uc002bnk.2	P08910	OTTHUMG00000148684	ENST00000352732.5:c.24C>T	chr15.hg19:g.89659582C>T		93.0	0.0		109.0	25.0	NM_007011	Q53G48|Q53GU0|Q5FVD9|Q8TC79	Silent	SNP	ENST00000352732.5	hg19	CCDS10348.1																																																																																			.	.		0.577	ABHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309074.2		
CASKIN1	57524	hgsc.bcm.edu	37	16	2235014	2235014	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:2235014T>A	ENST00000343516.6	-	13	1354	c.1262A>T	c.(1261-1263)cAg>cTg	p.Q421L	CASKIN1_ENST00000564289.1_5'UTR	NM_020764.3	NP_065815.1	Q8WXD9	CSKI1_HUMAN	CASK interacting protein 1	421	CASK-binding. {ECO:0000250}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|liver(1)|lung(7)|ovary(4)|prostate(5)|skin(3)	28						GACGGACTTCTGGGAAAGCAC	0.667																																					p.Q421L		Atlas-SNP	.											.	CASKIN1	130	.	0			c.A1262T						.						41.0	55.0	51.0					16																	2235014		1942	4135	6077	SO:0001583	missense	57524	exon13			GACTTCTGGGAAA	AF451977	CCDS42103.1	16p13.3	2013-01-10				ENSG00000167971		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	20879	protein-coding gene	gene with protein product		612184				12040031	Standard	NM_020764		Approved	KIAA1306, ANKS5A	uc010bsg.1	Q8WXD9		ENST00000343516.6:c.1262A>T	chr16.hg19:g.2235014T>A	ENSP00000345436:p.Gln421Leu	94.0	0.0		113.0	52.0	NM_020764	Q9P2P0	Missense_Mutation	SNP	ENST00000343516.6	hg19	CCDS42103.1	.	.	.	.	.	.	.	.	.	.	T	9.285	1.049204	0.19827	.	.	ENSG00000167971	ENST00000343516;ENST00000382453	T	0.68765	-0.35	4.91	3.82	0.43975	.	.	.	.	.	T	0.57533	0.2060	L	0.58101	1.795	0.54753	D	0.999984	B	0.24258	0.1	B	0.14023	0.01	T	0.55121	-0.8190	9	0.30078	T	0.28	-26.4998	8.3321	0.32193	0.0:0.1583:0.0:0.8417	.	421	Q8WXD9	CSKI1_HUMAN	L	421;250	ENSP00000345436:Q421L	ENSP00000345436:Q421L	Q	-	2	0	CASKIN1	2175015	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	0.727000	0.25999	1.829000	0.53265	0.454000	0.30748	CAG	.	.		0.667	CASKIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000435055.1	NM_020764	
NOMO3	408050	hgsc.bcm.edu	37	16	16356983	16356983	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:16356983C>T	ENST00000399336.4	+	13	1620	c.1448C>T	c.(1447-1449)aCa>aTa	p.T483I	NOMO3_ENST00000263012.6_Missense_Mutation_p.T483I|NOMO3_ENST00000538468.1_Missense_Mutation_p.T316I	NM_001004067.3	NP_001004067.1	P69849	NOMO3_HUMAN	NODAL modulator 3	483						integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	8				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)		AAACCCCAGACATTTCCTCTT	0.502																																					p.T483I		Atlas-SNP	.											.	NOMO3	23	.	0			c.C1448T						.						117.0	149.0	138.0					16																	16356983		2061	4295	6356	SO:0001583	missense	408050	exon13			CCCAGACATTTCC	AK125530	CCDS42123.1	16p13	2004-11-24				ENSG00000103226			25242	protein-coding gene	gene with protein product		609159				15257293	Standard	NM_001004067		Approved		uc002deq.3	P69849	OTTHUMG00000170525	ENST00000399336.4:c.1448C>T	chr16.hg19:g.16356983C>T	ENSP00000382274:p.Thr483Ile	137.0	0.0		159.0	65.0	NM_001004067		Missense_Mutation	SNP	ENST00000399336.4	hg19	CCDS42123.1	.	.	.	.	.	.	.	.	.	.	.	8.973	0.973374	0.18736	.	.	ENSG00000103226	ENST00000263012;ENST00000399336;ENST00000538468	T;T;T	0.14516	2.5;2.5;2.5	4.31	-5.12	0.02893	.	1.094200	0.06932	N	0.811328	T	0.09905	0.0243	L	0.27053	0.805	0.09310	N	1	B;B;B	0.15141	0.012;0.009;0.007	B;B;B	0.18561	0.022;0.009;0.013	T	0.39165	-0.9627	10	0.40728	T	0.16	0.1932	12.0743	0.53634	0.0:0.3491:0.0:0.6509	.	316;483;483	F5H826;P69849;Q5JPE7-2	.;NOMO3_HUMAN;.	I	483;483;316	ENSP00000263012:T483I;ENSP00000382274:T483I;ENSP00000443768:T316I	ENSP00000263012:T483I	T	+	2	0	NOMO3	16264484	0.000000	0.05858	0.000000	0.03702	0.909000	0.53808	-0.491000	0.06474	-0.832000	0.04251	-0.720000	0.03607	ACA	.	.		0.502	NOMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409528.13	NM_001004067	
PRKCB	5579	hgsc.bcm.edu	37	16	24105573	24105573	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:24105573T>C	ENST00000321728.7	+	7	951	c.776T>C	c.(775-777)tTg>tCg	p.L259S	PRKCB_ENST00000303531.7_Missense_Mutation_p.L259S|PRKCB_ENST00000482000.1_3'UTR	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	259	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	ATGGGATCTTTGTCCTTTGGG	0.448																																					p.L259S		Atlas-SNP	.											.	PRKCB	383	.	0			c.T776C						.						164.0	148.0	153.0					16																	24105573		2197	4300	6497	SO:0001583	missense	5579	exon7			GATCTTTGTCCTT	M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.776T>C	chr16.hg19:g.24105573T>C	ENSP00000318315:p.Leu259Ser	159.0	0.0		201.0	92.0	NM_212535	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Missense_Mutation	SNP	ENST00000321728.7	hg19	CCDS10618.1	.	.	.	.	.	.	.	.	.	.	T	18.46	3.628472	0.67015	.	.	ENSG00000166501	ENST00000321728;ENST00000303531	T;T	0.70164	-0.46;-0.46	5.52	5.52	0.82312	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.079948	0.52532	D	0.000073	T	0.65770	0.2723	L	0.43923	1.385	0.80722	D	1	B;B	0.31318	0.272;0.319	B;B	0.39935	0.209;0.314	T	0.66976	-0.5787	10	0.54805	T	0.06	.	14.8443	0.70249	0.0:0.0:0.0:1.0	.	259;259	P05771-2;P05771	.;KPCB_HUMAN	S	259	ENSP00000318315:L259S;ENSP00000305355:L259S	ENSP00000305355:L259S	L	+	2	0	PRKCB	24013074	1.000000	0.71417	0.965000	0.40720	0.934000	0.57294	7.692000	0.84203	2.088000	0.63022	0.533000	0.62120	TTG	.	.		0.448	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254504.2	NM_212535	
ITGAM	3684	hgsc.bcm.edu	37	16	31336309	31336309	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:31336309A>T	ENST00000287497.8	+	19	2395	c.2320A>T	c.(2320-2322)Aac>Tac	p.N774Y	ITGAM_ENST00000544665.3_Missense_Mutation_p.N775Y			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	774					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						TGGCAATGACAACATCTGCCA	0.393																																					p.N775Y		Atlas-SNP	.											.	ITGAM	137	.	0			c.A2323T						.						77.0	71.0	73.0					16																	31336309		1904	4127	6031	SO:0001583	missense	3684	exon19			AATGACAACATCT	J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.2320A>T	chr16.hg19:g.31336309A>T	ENSP00000287497:p.Asn774Tyr	46.0	0.0		70.0	28.0	NM_001145808	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	ENST00000287497.8	hg19	CCDS45470.1	.	.	.	.	.	.	.	.	.	.	A	11.34	1.609792	0.28623	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.57273	0.41;0.41	4.94	2.67	0.31697	Integrin alpha-2 (1);	.	.	.	.	T	0.41558	0.1164	L	0.34521	1.04	0.21184	N	0.999763	B;B;B	0.27013	0.166;0.166;0.166	B;B;B	0.35182	0.197;0.197;0.197	T	0.41980	-0.9478	9	0.54805	T	0.06	.	3.8459	0.08934	0.5652:0.18:0.2548:0.0	.	180;774;774	B3KXM6;Q4VAK1;P11215	.;.;ITAM_HUMAN	Y	775;774	ENSP00000441691:N775Y;ENSP00000287497:N774Y	ENSP00000287497:N774Y	N	+	1	0	ITGAM	31243810	0.049000	0.20398	0.319000	0.25293	0.913000	0.54294	0.785000	0.26830	0.367000	0.24454	0.533000	0.62120	AAC	.	.		0.393	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000432816.1	NM_000632	
NOD2	64127	hgsc.bcm.edu	37	16	50746089	50746089	+	Missense_Mutation	SNP	G	G	T	rs375713299		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:50746089G>T	ENST00000300589.2	+	4	2372	c.2267G>T	c.(2266-2268)cGg>cTg	p.R756L	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	756					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CGGCTGGCTCGGAAGGCTGCA	0.632																																					p.R756L		Atlas-SNP	.											NOD2,caecum,carcinoma,0,1	NOD2	118	.	0			c.G2267T						.						78.0	56.0	63.0					16																	50746089		2198	4300	6498	SO:0001583	missense	64127	exon4			TGGCTCGGAAGGC	AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2267G>T	chr16.hg19:g.50746089G>T	ENSP00000300589:p.Arg756Leu	57.0	0.0		98.0	20.0	NM_022162	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Missense_Mutation	SNP	ENST00000300589.2	hg19	CCDS10746.1	.	.	.	.	.	.	.	.	.	.	G	6.635	0.485603	0.12641	.	.	ENSG00000167207	ENST00000526417;ENST00000300589	T	0.70399	-0.48	5.47	-0.00388	0.14024	.	0.576361	0.16535	N	0.210192	T	0.68137	0.2968	M	0.77103	2.36	0.09310	N	1	P;P;P	0.42973	0.796;0.795;0.796	B;B;B	0.40982	0.264;0.345;0.252	T	0.61720	-0.7005	10	0.72032	D	0.01	.	8.972	0.35912	0.4753:0.0:0.5247:0.0	.	540;729;756	D6CHF9;Q9HC29-2;Q9HC29	.;.;NOD2_HUMAN	L	729;756	ENSP00000300589:R756L	ENSP00000300589:R756L	R	+	2	0	NOD2	49303590	0.279000	0.24239	0.007000	0.13788	0.015000	0.08874	0.639000	0.24690	-0.201000	0.10284	0.561000	0.74099	CGG	.	.		0.632	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256876.2	NM_022162	
SALL1	6299	hgsc.bcm.edu	37	16	51175130	51175130	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:51175130T>A	ENST00000251020.4	-	2	1036	c.1003A>T	c.(1003-1005)Agc>Tgc	p.S335C	SALL1_ENST00000440970.1_Missense_Mutation_p.S238C|SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000541611.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	335					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GAAGAGCCGCTGTTGGATGGA	0.547																																					p.S335C	GBM(103;1352 1446 1855 4775 8890)	Atlas-SNP	.											.	SALL1	301	.	0			c.A1003T						.						110.0	114.0	113.0					16																	51175130		2198	4300	6498	SO:0001583	missense	6299	exon2			AGCCGCTGTTGGA	X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1003A>T	chr16.hg19:g.51175130T>A	ENSP00000251020:p.Ser335Cys	59.0	0.0		82.0	27.0	NM_002968	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	ENST00000251020.4	hg19	CCDS10747.1	.	.	.	.	.	.	.	.	.	.	T	10.40	1.338625	0.24253	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.08458	3.09;3.11	4.39	2.06	0.26882	.	0.132053	0.64402	D	0.000001	T	0.05318	0.0141	N	0.19112	0.55	0.42144	D	0.991525	P	0.39131	0.661	B	0.36186	0.219	T	0.44862	-0.9300	10	0.56958	D	0.05	-4.4151	8.703	0.34338	0.0:0.1601:0.0:0.8399	.	335	Q9NSC2	SALL1_HUMAN	C	335;238;299	ENSP00000251020:S335C;ENSP00000407914:S238C	ENSP00000251020:S335C	S	-	1	0	SALL1	49732631	1.000000	0.71417	0.555000	0.28281	0.967000	0.64934	3.179000	0.50887	0.206000	0.20587	0.260000	0.18958	AGC	.	.		0.547	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256883.2	NM_002968	
BBS2	583	hgsc.bcm.edu	37	16	56545111	56545111	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:56545111A>T	ENST00000245157.5	-	3	851	c.431T>A	c.(430-432)cTg>cAg	p.L144Q	BBS2_ENST00000561951.1_5'UTR|BBS2_ENST00000568104.1_Missense_Mutation_p.L144Q	NM_031885.3	NP_114091	Q9BXC9	BBS2_HUMAN	Bardet-Biedl syndrome 2	144					adult behavior (GO:0030534)|artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|cilium morphogenesis (GO:0060271)|fat cell differentiation (GO:0045444)|Golgi to plasma membrane protein transport (GO:0043001)|hippocampus development (GO:0021766)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of gene expression (GO:0010629)|negative regulation of multicellular organism growth (GO:0040015)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|positive regulation of multicellular organism growth (GO:0040018)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sperm axoneme assembly (GO:0007288)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	BBSome (GO:0034464)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	RNA polymerase II repressing transcription factor binding (GO:0001103)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|skin(3)	26						GAAACCTTGCAGAGCACAATT	0.388									Bardet-Biedl syndrome																												p.L144Q		Atlas-SNP	.											.	BBS2	67	.	0			c.T431A						.						125.0	109.0	115.0					16																	56545111		2198	4300	6498	SO:0001583	missense	583	exon3	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome	CCTTGCAGAGCAC	AF342736	CCDS32451.1	16q21	2013-01-08				ENSG00000125124			967	protein-coding gene	gene with protein product		606151		BBS		11285252	Standard	NM_031885		Approved		uc002ejd.2	Q9BXC9		ENST00000245157.5:c.431T>A	chr16.hg19:g.56545111A>T	ENSP00000245157:p.Leu144Gln	51.0	0.0		77.0	37.0	NM_031885	Q96CM0|Q96SN9	Missense_Mutation	SNP	ENST00000245157.5	hg19	CCDS32451.1	.	.	.	.	.	.	.	.	.	.	A	26.9	4.785484	0.90282	.	.	ENSG00000125124	ENST00000245157	D	0.84589	-1.87	5.9	5.9	0.94986	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.91862	0.7424	M	0.76002	2.32	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.70935	0.971;0.971	D	0.92605	0.6094	10	0.72032	D	0.01	-10.1552	16.3294	0.83004	1.0:0.0:0.0:0.0	.	144;144	A8K0N9;Q9BXC9	.;BBS2_HUMAN	Q	144	ENSP00000245157:L144Q	ENSP00000245157:L144Q	L	-	2	0	BBS2	55102612	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	9.186000	0.94906	2.259000	0.74868	0.523000	0.50628	CTG	.	.		0.388	BBS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000434386.2	NM_031885	
KATNB1	10300	hgsc.bcm.edu	37	16	57785926	57785926	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:57785926T>G	ENST00000379661.3	+	8	983	c.591T>G	c.(589-591)ttT>ttG	p.F197L		NM_005886.2	NP_005877.2			katanin p80 (WD repeat containing) subunit B 1											cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_neural(199;0.223)				TGGTCGAGTTTCACCCCAACG	0.617																																					p.F197L		Atlas-SNP	.											.	KATNB1	35	.	0			c.T591G						.						95.0	60.0	72.0					16																	57785926		2198	4300	6498	SO:0001583	missense	10300	exon8			CGAGTTTCACCCC	AF052432	CCDS10788.1	16q12.2	2013-01-09	2003-03-13		ENSG00000140854	ENSG00000140854		"""WD repeat domain containing"""	6217	protein-coding gene	gene with protein product		602703	"""katanin p80 (WD40-containing) subunit B 1"""			9568719	Standard	XM_006721121		Approved		uc002eml.1	Q9BVA0	OTTHUMG00000133467	ENST00000379661.3:c.591T>G	chr16.hg19:g.57785926T>G	ENSP00000368982:p.Phe197Leu	69.0	0.0		105.0	46.0	NM_005886		Missense_Mutation	SNP	ENST00000379661.3	hg19	CCDS10788.1	.	.	.	.	.	.	.	.	.	.	T	18.10	3.548718	0.65311	.	.	ENSG00000140854	ENST00000379661	T	0.67171	-0.25	5.34	0.197	0.15164	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.048698	0.85682	N	0.000000	T	0.52256	0.1723	L	0.45137	1.4	0.58432	D	0.999995	B	0.06786	0.001	B	0.12156	0.007	T	0.42965	-0.9420	10	0.87932	D	0	9.2791	5.9544	0.19265	0.0:0.335:0.1345:0.5305	.	197	Q9BVA0	KTNB1_HUMAN	L	197	ENSP00000368982:F197L	ENSP00000368982:F197L	F	+	3	2	KATNB1	56343427	0.986000	0.35501	0.998000	0.56505	0.985000	0.73830	0.167000	0.16602	0.018000	0.15052	0.459000	0.35465	TTT	.	.		0.617	KATNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257343.3		
ZC3H18	124245	hgsc.bcm.edu	37	16	88643896	88643896	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr16:88643896A>T	ENST00000301011.5	+	2	565	c.365A>T	c.(364-366)gAg>gTg	p.E122V	ZC3H18_ENST00000452588.2_Missense_Mutation_p.E122V	NM_144604.3	NP_653205.3	Q86VM9	ZCH18_HUMAN	zinc finger CCCH-type containing 18	122						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(9)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	42				BRCA - Breast invasive adenocarcinoma(80;0.0542)		GTCACCAGGGAGCTGGATGAG	0.647																																					p.E122V	Ovarian(121;375 2276 20373 38669)	Atlas-SNP	.											.	ZC3H18	90	.	0			c.A365T						.						42.0	40.0	41.0					16																	88643896		2195	4299	6494	SO:0001583	missense	124245	exon2			CCAGGGAGCTGGA	BC001584	CCDS10967.1, CCDS73924.1	16q24.2-q24.3	2012-07-05			ENSG00000158545	ENSG00000158545		"""Zinc fingers, CCCH-type domain containing"""	25091	protein-coding gene	gene with protein product						17579712	Standard	NM_144604		Approved	NHN1	uc002fky.3	Q86VM9	OTTHUMG00000137679	ENST00000301011.5:c.365A>T	chr16.hg19:g.88643896A>T	ENSP00000301011:p.Glu122Val	58.0	0.0		82.0	21.0	NM_144604	Q96DG4|Q96MP7	Missense_Mutation	SNP	ENST00000301011.5	hg19	CCDS10967.1	.	.	.	.	.	.	.	.	.	.	A	15.20	2.761772	0.49468	.	.	ENSG00000158545	ENST00000301011;ENST00000289509;ENST00000452588	T;T	0.35789	1.3;1.29	5.43	5.43	0.79202	.	0.161156	0.53938	D	0.000041	T	0.46946	0.1419	L	0.54323	1.7	0.54753	D	0.99998	P;P	0.48589	0.912;0.912	P;P	0.51742	0.678;0.678	T	0.40664	-0.9551	10	0.45353	T	0.12	-20.4026	15.4961	0.75653	1.0:0.0:0.0:0.0	.	122;122	E7ERS3;Q86VM9	.;ZCH18_HUMAN	V	122	ENSP00000301011:E122V;ENSP00000416951:E122V	ENSP00000289509:E122V	E	+	2	0	ZC3H18	87171397	1.000000	0.71417	0.996000	0.52242	0.232000	0.25224	8.576000	0.90770	2.072000	0.62099	0.459000	0.35465	GAG	.	.		0.647	ZC3H18-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000269168.1	NM_144604	
SMYD4	114826	hgsc.bcm.edu	37	17	1703349	1703349	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:1703349C>A	ENST00000305513.7	-	5	1506	c.1339G>T	c.(1339-1341)Gtt>Ttt	p.V447F		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	447	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						AGTGCAGAAACACAGAGAGCA	0.448																																					p.V447F		Atlas-SNP	.											.	SMYD4	50	.	0			c.G1339T						.						91.0	82.0	85.0					17																	1703349		2203	4300	6503	SO:0001583	missense	114826	exon5			CAGAAACACAGAG	AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1339G>T	chr17.hg19:g.1703349C>A	ENSP00000304360:p.Val447Phe	95.0	0.0		80.0	25.0	NM_052928	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	ENST00000305513.7	hg19	CCDS11013.1	.	.	.	.	.	.	.	.	.	.	C	18.30	3.593960	0.66219	.	.	ENSG00000186532	ENST00000305513	T	0.13657	2.57	6.03	0.692	0.18050	SET domain (2);	0.547815	0.21608	N	0.071838	T	0.31544	0.0800	M	0.78049	2.395	0.21355	N	0.999711	D	0.60575	0.988	D	0.63113	0.911	T	0.08472	-1.0720	10	0.56958	D	0.05	-4.9941	11.2161	0.48827	0.0:0.6409:0.0:0.3591	.	447	Q8IYR2	SMYD4_HUMAN	F	447	ENSP00000304360:V447F	ENSP00000304360:V447F	V	-	1	0	SMYD4	1650099	0.452000	0.25713	0.627000	0.29227	0.931000	0.56810	0.144000	0.16135	0.161000	0.19458	0.655000	0.94253	GTT	.	.		0.448	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207108.4	XM_056082	
DNAH2	146754	hgsc.bcm.edu	37	17	7681450	7681450	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:7681450A>T	ENST00000572933.1	+	34	6763	c.5303A>T	c.(5302-5304)gAg>gTg	p.E1768V	DNAH2_ENST00000389173.2_Missense_Mutation_p.E1768V			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	1768	AAA 1. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				TATAATTATGAGTACTTGGGT	0.552																																					p.E1768V		Atlas-SNP	.											.	DNAH2	498	.	0			c.A5303T						.						90.0	86.0	87.0					17																	7681450		2203	4300	6503	SO:0001583	missense	146754	exon33			ATTATGAGTACTT	U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.5303A>T	chr17.hg19:g.7681450A>T	ENSP00000458355:p.Glu1768Val	72.0	0.0		80.0	18.0	NM_020877	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	ENST00000572933.1	hg19	CCDS32551.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.762857	0.89932	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	T	0.14516	2.5	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.55417	0.1919	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.73733	-0.3890	10	0.87932	D	0	.	14.7836	0.69784	1.0:0.0:0.0:0.0	.	1768	Q9P225	DYH2_HUMAN	V	1768	ENSP00000373825:E1768V	ENSP00000353818:E1768V	E	+	2	0	DNAH2	7622175	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	8.968000	0.93407	2.322000	0.78497	0.528000	0.53228	GAG	.	.		0.552	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000440241.1	NM_020877	
MYH8	4626	hgsc.bcm.edu	37	17	10314242	10314242	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:10314242C>A	ENST00000403437.2	-	15	1533	c.1439G>T	c.(1438-1440)tGc>tTc	p.C480F	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	480	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GAAGTTGATGCACAGCTGCTC	0.378									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																												p.C480F		Atlas-SNP	.											.	MYH8	346	.	0			c.G1439T						.						138.0	120.0	126.0					17																	10314242		2203	4300	6503	SO:0001583	missense	4626	exon15	Familial Cancer Database	Carney Complex Variant	TTGATGCACAGCT		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1439G>T	chr17.hg19:g.10314242C>A	ENSP00000384330:p.Cys480Phe	96.0	0.0		112.0	31.0	NM_002472	Q14910	Missense_Mutation	SNP	ENST00000403437.2	hg19	CCDS11153.1	.	.	.	.	.	.	.	.	.	.	C	23.8	4.453777	0.84209	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.75154	-0.91	5.02	5.02	0.67125	Myosin head, motor domain (3);	0.000000	0.45867	U	0.000323	D	0.89818	0.6825	M	0.93939	3.475	0.80722	D	1	D	0.69078	0.997	D	0.73380	0.98	D	0.92335	0.5877	10	0.87932	D	0	.	18.5246	0.90967	0.0:1.0:0.0:0.0	.	480	P13535	MYH8_HUMAN	F	480	ENSP00000384330:C480F	ENSP00000252173:C480F	C	-	2	0	MYH8	10254967	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.609000	0.82925	2.621000	0.88768	0.655000	0.94253	TGC	.	.		0.378	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252724.2	NM_002472	
GPR179	440435	hgsc.bcm.edu	37	17	36485868	36485868	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:36485868G>A	ENST00000342292.4	-	11	3604	c.3584C>T	c.(3583-3585)gCa>gTa	p.A1195V	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1195					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				TGTTTTACCTGCTCTCTCAGC	0.542																																					p.A1195V		Atlas-SNP	.											.	GPR179	170	.	0			c.C3584T						.						225.0	229.0	228.0					17																	36485868		2085	4208	6293	SO:0001583	missense	440435	exon11			TTACCTGCTCTCT		CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.3584C>T	chr17.hg19:g.36485868G>A	ENSP00000345060:p.Ala1195Val	93.0	0.0		95.0	29.0	NM_001004334		Missense_Mutation	SNP	ENST00000342292.4	hg19	CCDS42308.1	.	.	.	.	.	.	.	.	.	.	G	8.953	0.968733	0.18659	.	.	ENSG00000188888	ENST00000342292	T	0.52983	0.64	5.03	-0.498	0.12019	.	0.966593	0.08512	N	0.934781	T	0.27900	0.0687	N	0.17082	0.46	0.09310	N	1	B	0.18461	0.028	B	0.16722	0.016	T	0.22836	-1.0205	10	0.49607	T	0.09	-0.0154	3.936	0.09305	0.2327:0.0:0.4839:0.2834	.	1195	Q6PRD1	GP179_HUMAN	V	1195	ENSP00000345060:A1195V	ENSP00000345060:A1195V	A	-	2	0	GPR179	33739394	0.000000	0.05858	0.000000	0.03702	0.417000	0.31264	0.010000	0.13242	-0.175000	0.10725	0.462000	0.41574	GCA	.	.		0.542	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255329.2		
MED24	9862	hgsc.bcm.edu	37	17	38183205	38183205	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:38183205T>A	ENST00000394128.2	-	17	1694	c.1613A>T	c.(1612-1614)aAg>aTg	p.K538M	MED24_ENST00000501516.3_Missense_Mutation_p.K557M|MED24_ENST00000356271.3_Missense_Mutation_p.K525M|MED24_ENST00000394126.1_Missense_Mutation_p.K563M|MED24_ENST00000394127.2_Missense_Mutation_p.K525M|SNORD124_ENST00000459577.1_RNA	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	538					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					GTTCAGGATCTTGCCCTCCTC	0.607											OREG0024386	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									p.K538M		Atlas-SNP	.											.	MED24	89	.	0			c.A1613T						.						55.0	51.0	53.0					17																	38183205		2203	4300	6503	SO:0001583	missense	9862	exon17			AGGATCTTGCCCT	AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.1613A>T	chr17.hg19:g.38183205T>A	ENSP00000377686:p.Lys538Met	124.0	0.0	876	138.0	43.0	NM_014815	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	ENST00000394128.2	hg19	CCDS11359.1	.	.	.	.	.	.	.	.	.	.	T	12.40	1.926399	0.34002	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000431269	T;T;T	0.57436	0.4;0.4;0.4	4.5	3.41	0.39046	Mediator complex, subunit Med24, N-terminal (1);	0.047359	0.85682	D	0.000000	T	0.61850	0.2380	M	0.63843	1.955	0.58432	D	0.999999	D;D;D;D;D;D	0.69078	0.997;0.995;0.995;0.995;0.996;0.995	D;P;P;P;P;P	0.63113	0.911;0.847;0.847;0.847;0.905;0.847	T	0.61695	-0.7010	10	0.72032	D	0.01	-15.9486	6.0967	0.20025	0.0:0.0822:0.1654:0.7524	.	479;488;448;525;538;480	B4DSQ6;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;MED24_HUMAN;.	M	538;538;538;488;525;480;448	ENSP00000377686:K538M;ENSP00000443344:K488M;ENSP00000377685:K525M	ENSP00000348610:K538M	K	-	2	0	MED24	35436731	1.000000	0.71417	0.996000	0.52242	0.926000	0.56050	6.092000	0.71414	0.738000	0.32606	-0.313000	0.08912	AAG	.	.		0.607	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257147.2	NM_014815	
TOP2A	7153	hgsc.bcm.edu	37	17	38557137	38557137	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:38557137T>A	ENST00000423485.1	-	21	2787	c.2629A>T	c.(2629-2631)Agg>Tgg	p.R877W		NM_001067.3	NP_001058.2	P11388	TOP2A_HUMAN	topoisomerase (DNA) II alpha 170kDa	877					apoptotic chromosome condensation (GO:0030263)|ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromosome segregation (GO:0007059)|DNA ligation (GO:0006266)|DNA topological change (GO:0006265)|DNA unwinding involved in DNA replication (GO:0006268)|embryonic cleavage (GO:0040016)|hematopoietic progenitor cell differentiation (GO:0002244)|mitotic cell cycle (GO:0000278)|mitotic DNA integrity checkpoint (GO:0044774)|mitotic recombination (GO:0006312)|positive regulation of apoptotic process (GO:0043065)|positive regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral genome replication (GO:0045070)|resolution of meiotic recombination intermediates (GO:0000712)|sister chromatid segregation (GO:0000819)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA topoisomerase complex (ATP-hydrolyzing) (GO:0009330)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA topoisomerase type II (ATP-hydrolyzing) activity (GO:0003918)|DNA-dependent ATPase activity (GO:0008094)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|magnesium ion binding (GO:0000287)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|ubiquitin binding (GO:0043130)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(9)|ovary(5)|pancreas(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)	39		Breast(137;0.00328)	STAD - Stomach adenocarcinoma(5;0.00183)		Amsacrine(DB00276)|Ciprofloxacin(DB00537)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Dexrazoxane(DB00380)|Doxorubicin(DB00997)|Enoxacin(DB00467)|Epirubicin(DB00445)|Etoposide(DB00773)|Fleroxacin(DB04576)|Idarubicin(DB01177)|Levofloxacin(DB01137)|Lomefloxacin(DB00978)|Lucanthone(DB04967)|Mitoxantrone(DB01204)|Moxifloxacin(DB00218)|Norfloxacin(DB01059)|Ofloxacin(DB01165)|Pefloxacin(DB00487)|Podofilox(DB01179)|Sparfloxacin(DB01208)|Teniposide(DB00444)|Trovafloxacin(DB00685)|Valrubicin(DB00385)	ATCAAACGCCTGATGTTATTT	0.408																																					p.R877W		Atlas-SNP	.											.	TOP2A	124	.	0			c.A2629T						.						258.0	248.0	251.0					17																	38557137		1909	4126	6035	SO:0001583	missense	7153	exon21			AACGCCTGATGTT		CCDS45672.1	17q21-q22	2008-08-06	2002-08-29		ENSG00000131747	ENSG00000131747	5.99.1.2		11989	protein-coding gene	gene with protein product		126430	"""topoisomerase (DNA) II alpha (170kD)"""	TOP2			Standard	NM_001067		Approved		uc002huq.3	P11388	OTTHUMG00000155008	ENST00000423485.1:c.2629A>T	chr17.hg19:g.38557137T>A	ENSP00000411532:p.Arg877Trp	109.0	0.0		96.0	16.0	NM_001067	B2RTS1|Q71UN1|Q71UQ5|Q9HB24|Q9HB25|Q9HB26|Q9UP44|Q9UQP9	Missense_Mutation	SNP	ENST00000423485.1	hg19	CCDS45672.1	.	.	.	.	.	.	.	.	.	.	T	17.15	3.314874	0.60524	.	.	ENSG00000131747	ENST00000423485;ENST00000269577;ENST00000348049;ENST00000357601	T	0.25912	1.77	5.21	4.1	0.47936	DNA topoisomerase, type IIA, subunit A/C-terminal (2);DNA topoisomerase, type IIA, subunit A/ C-terminal, alpha-beta (1);DNA topoisomerase, type IIA, central (1);	0.097636	0.64402	D	0.000003	T	0.46870	0.1415	M	0.82923	2.615	0.48632	D	0.999684	D	0.56035	0.974	P	0.61874	0.895	T	0.46345	-0.9198	10	0.87932	D	0	.	7.0162	0.24889	0.0:0.0811:0.3787:0.5402	.	877	P11388	TOP2A_HUMAN	W	877;957;900;913	ENSP00000411532:R877W	ENSP00000269577:R957W	R	-	1	2	TOP2A	35810663	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	2.168000	0.42424	0.887000	0.36136	0.383000	0.25322	AGG	.	.		0.408	TOP2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000338035.1		
STAT3	6774	hgsc.bcm.edu	37	17	40474482	40474482	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:40474482T>A	ENST00000264657.5	-	21	2231	c.1919A>T	c.(1918-1920)tAc>tTc	p.Y640F	STAT3_ENST00000404395.3_Missense_Mutation_p.Y640F|STAT3_ENST00000389272.3_Missense_Mutation_p.Y542F|STAT3_ENST00000588969.1_Missense_Mutation_p.Y640F|STAT3_ENST00000585517.1_Missense_Mutation_p.Y640F	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	640	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		CTGCTTTGTGTATGGTTCCAC	0.463									Hyperimmunoglobulin E Recurrent Infection Syndrome																												p.Y640F		Atlas-SNP	.											STAT3,NS,lymphoid_neoplasm,0,46	STAT3	268	.	0			c.A1919T						.						243.0	213.0	223.0					17																	40474482		2203	4300	6503	SO:0001583	missense	6774	exon21	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	TTTGTGTATGGTT	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.1919A>T	chr17.hg19:g.40474482T>A	ENSP00000264657:p.Tyr640Phe	136.0	0.0		134.0	37.0	NM_003150	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	ENST00000264657.5	hg19	CCDS32656.1	.	.	.	.	.	.	.	.	.	.	T	19.36	3.813449	0.70912	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.89196	-2.48;-2.48;-2.48	4.64	4.64	0.57946	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.87120	0.6098	N	0.16016	0.355	0.80722	D	1	D;D;D	0.59357	0.982;0.985;0.985	D;D;D	0.78314	0.984;0.991;0.991	T	0.82589	-0.0382	10	0.06891	T	0.86	-37.3581	14.2314	0.65895	0.0:0.0:0.0:1.0	.	640;640;640	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	F	640;542;640	ENSP00000264657:Y640F;ENSP00000373923:Y542F;ENSP00000384943:Y640F	ENSP00000264657:Y640F	Y	-	2	0	STAT3	37728008	1.000000	0.71417	0.964000	0.40570	0.715000	0.41141	7.868000	0.87116	1.953000	0.56701	0.460000	0.39030	TAC	.	.		0.463	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000319353.3	NM_139276, NM_003150	
COL1A1	1277	hgsc.bcm.edu	37	17	48276663	48276663	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:48276663T>A	ENST00000225964.5	-	5	513	c.395A>T	c.(394-396)gAt>gTt	p.D132V		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	132					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	AGGGATGCCATCTCGGCCAGG	0.741			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																														p.D132V		Atlas-SNP	.		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	.	COL1A1	158	.	0			c.A395T						.						2.0	3.0	3.0					17																	48276663		1658	3560	5218	SO:0001583	missense	1277	exon5			ATGCCATCTCGGC	Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.395A>T	chr17.hg19:g.48276663T>A	ENSP00000225964:p.Asp132Val	174.0	0.0		178.0	34.0	NM_000088	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	ENST00000225964.5	hg19	CCDS11561.1	.	.	.	.	.	.	.	.	.	.	T	23.5	4.429419	0.83776	.	.	ENSG00000108821	ENST00000225964	D	0.93307	-3.2	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.95370	0.8497	L	0.54908	1.71	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.94999	0.8141	10	0.44086	T	0.13	.	14.3852	0.66940	0.0:0.0:0.0:1.0	.	132	P02452	CO1A1_HUMAN	V	132	ENSP00000225964:D132V	ENSP00000225964:D132V	D	-	2	0	COL1A1	45631662	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.266000	0.78452	2.037000	0.60232	0.459000	0.35465	GAT	.	.		0.741	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000309036.2		
TEX2	55852	hgsc.bcm.edu	37	17	62290645	62290645	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:62290645T>A	ENST00000583097.1	-	2	1105	c.933A>T	c.(931-933)gaA>gaT	p.E311D	TEX2_ENST00000258991.3_Missense_Mutation_p.E311D|TEX2_ENST00000584379.1_Missense_Mutation_p.E311D			Q8IWB9	TEX2_HUMAN	testis expressed 2	311					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)				breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		TGCCACTTTCTTCCCCTATAA	0.423																																					p.E311D		Atlas-SNP	.											.	TEX2	89	.	0			c.A933T						.						45.0	48.0	47.0					17																	62290645		2203	4300	6503	SO:0001583	missense	55852	exon2			ACTTTCTTCCCCT	AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.933A>T	chr17.hg19:g.62290645T>A	ENSP00000462665:p.Glu311Asp	73.0	0.0		75.0	14.0	NM_018469	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	ENST00000583097.1	hg19		.	.	.	.	.	.	.	.	.	.	T	8.850	0.944323	0.18356	.	.	ENSG00000136478	ENST00000258991	T	0.44881	0.91	6.03	-3.07	0.05363	.	0.112860	0.64402	D	0.000004	T	0.19127	0.0459	N	0.14661	0.345	0.29597	N	0.847959	B;B	0.19445	0.036;0.021	B;B	0.24541	0.054;0.024	T	0.07404	-1.0774	10	0.30854	T	0.27	-22.5236	5.6553	0.17639	0.139:0.5082:0.1037:0.2491	.	311;311	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	D	311	ENSP00000258991:E311D	ENSP00000258991:E311D	E	-	3	2	TEX2	59644377	0.043000	0.20138	0.911000	0.35937	0.901000	0.52897	-0.683000	0.05179	-0.536000	0.06298	-0.250000	0.11733	GAA	.	.		0.423	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000443745.1	NM_018469	
ABCA9	10350	hgsc.bcm.edu	37	17	66988376	66988376	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:66988376A>C	ENST00000340001.4	-	28	3867	c.3656T>G	c.(3655-3657)aTt>aGt	p.I1219S	ABCA9_ENST00000370732.2_Missense_Mutation_p.I1219S|ABCA9_ENST00000453985.2_Missense_Mutation_p.I1181S	NM_080283.3	NP_525022.2	Q8IUA7	ABCA9_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 9	1219					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(8)|kidney(3)|large_intestine(21)|lung(35)|ovary(4)|prostate(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	91	Breast(10;1.47e-12)					GCATCGCAGAATGAAAAGAAA	0.318																																					p.I1219S		Atlas-SNP	.											.	ABCA9	192	.	0			c.T3656G						.						57.0	51.0	53.0					17																	66988376		2203	4299	6502	SO:0001583	missense	10350	exon28			CGCAGAATGAAAA	AF423307	CCDS11681.1	17q24	2012-03-14			ENSG00000154258	ENSG00000154258		"""ATP binding cassette transporters / subfamily A"""	39	protein-coding gene	gene with protein product		612507					Standard	XM_005256934		Approved	EST640918	uc002jhu.3	Q8IUA7	OTTHUMG00000140371	ENST00000340001.4:c.3656T>G	chr17.hg19:g.66988376A>C	ENSP00000342216:p.Ile1219Ser	190.0	0.0		217.0	53.0	NM_080283	Q6P655|Q8N2S4|Q8WWZ5|Q96MD8	Missense_Mutation	SNP	ENST00000340001.4	hg19	CCDS11681.1	.	.	.	.	.	.	.	.	.	.	A	10.64	1.406150	0.25378	.	.	ENSG00000154258	ENST00000340001;ENST00000453985;ENST00000370732	D;D	0.89050	-2.46;-2.46	5.26	3.0	0.34707	.	1.196280	0.06335	N	0.706852	D	0.90324	0.6973	L	0.57536	1.79	0.09310	N	1	P;B	0.40909	0.732;0.161	P;B	0.48677	0.586;0.314	T	0.78420	-0.2211	10	0.54805	T	0.06	.	8.6598	0.34086	0.8416:0.0:0.1584:0.0	.	1219;1219	Q8IUA7-3;Q8IUA7	.;ABCA9_HUMAN	S	1219;1164;1219	ENSP00000342216:I1219S;ENSP00000359767:I1219S	ENSP00000342216:I1219S	I	-	2	0	ABCA9	64499971	0.022000	0.18835	0.589000	0.28718	0.230000	0.25150	2.971000	0.49248	0.814000	0.34374	0.482000	0.46254	ATT	.	.		0.318	ABCA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277072.2	NM_172386	
COG1	9382	hgsc.bcm.edu	37	17	71197661	71197661	+	Silent	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:71197661C>G	ENST00000299886.4	+	7	1775	c.1695C>G	c.(1693-1695)acC>acG	p.T565T		NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	565					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			ATGCGGGGACCGTGCAGGAGA	0.577																																					p.T565T		Atlas-SNP	.											.	COG1	46	.	0			c.C1695G						.						95.0	82.0	86.0					17																	71197661		2203	4300	6503	SO:0001819	synonymous_variant	9382	exon7			GGGGACCGTGCAG		CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.1695C>G	chr17.hg19:g.71197661C>G		80.0	0.0		81.0	25.0	NM_018714	Q9NPV9|Q9P2G6	Silent	SNP	ENST00000299886.4	hg19	CCDS11692.1																																																																																			.	.		0.577	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441638.1		
C17orf99	100141515	hgsc.bcm.edu	37	17	76160372	76160372	+	Silent	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:76160372A>G	ENST00000340363.5	+	4	622	c.567A>G	c.(565-567)acA>acG	p.T189T	C17orf99_ENST00000451352.3_3'UTR	NM_001163075.1	NP_001156547.1	Q6UX52	CQ099_HUMAN	chromosome 17 open reading frame 99	189						extracellular region (GO:0005576)											CGAGCCAGACATCGGACTGGT	0.612																																					p.T189T		Atlas-SNP	.											.	.	.	.	0			c.A567G						.						41.0	46.0	45.0					17																	76160372		692	1591	2283	SO:0001819	synonymous_variant	100141515	exon4			CCAGACATCGGAC	AY358510	CCDS54171.1	17q25.3	2012-10-23			ENSG00000187997	ENSG00000187997			34490	protein-coding gene	gene with protein product							Standard	NM_001163075		Approved	GLPG464, UNQ464	uc002jus.4	Q6UX52	OTTHUMG00000153871	ENST00000340363.5:c.567A>G	chr17.hg19:g.76160372A>G		176.0	0.0		166.0	48.0	NM_001163075		Silent	SNP	ENST00000340363.5	hg19	CCDS54171.1																																																																																			.	.		0.612	C17orf99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000332775.1	NM_001163075	
MYOM1	8736	hgsc.bcm.edu	37	18	3215130	3215130	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr18:3215130C>T	ENST00000356443.4	-	2	425	c.92G>A	c.(91-93)cGg>cAg	p.R31Q	MYOM1_ENST00000261606.7_Missense_Mutation_p.R31Q|MYOM1_ENST00000400569.3_Missense_Mutation_p.R31Q|RP13-270P17.2_ENST00000580139.1_RNA	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	31					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)	p.R31L(1)		NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTTCTTCTCCCGCTGGTAGTG	0.642																																					p.R31Q		Atlas-SNP	.											MYOM1,NS,carcinoma,0,1	MYOM1	192	.	1	Substitution - Missense(1)	ovary(1)	c.G92A						.						53.0	58.0	56.0					18																	3215130		2089	4235	6324	SO:0001583	missense	8736	exon2			TTCTCCCGCTGGT	AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.92G>A	chr18.hg19:g.3215130C>T	ENSP00000348821:p.Arg31Gln	80.0	0.0		74.0	25.0	NM_003803	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	ENST00000356443.4	hg19	CCDS45824.1	.	.	.	.	.	.	.	.	.	.	C	0.978	-0.697845	0.03279	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.39997	1.17;1.18;1.05	5.67	4.52	0.55395	.	0.516121	0.20942	N	0.082914	T	0.15089	0.0364	N	0.01874	-0.695	0.21897	N	0.999483	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.24584	-1.0156	10	0.02654	T	1	.	10.6635	0.45717	0.0:0.0763:0.0:0.9237	.	31;31	P52179-2;P52179	.;MYOM1_HUMAN	Q	31	ENSP00000348821:R31Q;ENSP00000383413:R31Q;ENSP00000261606:R31Q	ENSP00000261606:R31Q	R	-	2	0	MYOM1	3205130	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	4.038000	0.57318	0.989000	0.38761	-0.238000	0.12139	CGG	.	.		0.642	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000441037.2	NM_003803	
PTPRM	5797	hgsc.bcm.edu	37	18	7926575	7926575	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr18:7926575C>T	ENST00000332175.8	+	5	1594	c.557C>T	c.(556-558)cCt>cTt	p.P186L	PTPRM_ENST00000400053.4_Missense_Mutation_p.P124L|PTPRM_ENST00000400060.4_Missense_Mutation_p.P186L|PTPRM_ENST00000580170.1_Missense_Mutation_p.P186L	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	186	Ig-like C2-type.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				GCCAGGACTCCTCACTTCCTG	0.433																																					p.P186L		Atlas-SNP	.											.	PTPRM	185	.	0			c.C557T						.						80.0	73.0	75.0					18																	7926575		2203	4300	6503	SO:0001583	missense	5797	exon5			GGACTCCTCACTT	X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.557C>T	chr18.hg19:g.7926575C>T	ENSP00000331418:p.Pro186Leu	74.0	0.0		64.0	16.0	NM_001105244	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	ENST00000332175.8	hg19	CCDS11840.1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.527336	0.85706	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053	T;T;T	0.54279	0.75;0.7;0.58	5.72	5.72	0.89469	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	T	0.73118	0.3546	M	0.68317	2.08	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.74478	-0.3652	10	0.87932	D	0	.	19.8788	0.96888	0.0:1.0:0.0:0.0	.	186;186	A7MBN1;P28827	.;PTPRM_HUMAN	L	186;186;124	ENSP00000331418:P186L;ENSP00000382933:P186L;ENSP00000382927:P124L	ENSP00000331418:P186L	P	+	2	0	PTPRM	7916575	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	6.709000	0.74665	2.704000	0.92352	0.563000	0.77884	CCT	.	.		0.433	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000254456.1		
ANKRD30B	374860	hgsc.bcm.edu	37	18	14842894	14842894	+	Splice_Site	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr18:14842894A>G	ENST00000358984.4	+	32	2902		c.e32-1			NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B											breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						TTTGCTTTTTAGAGTCTCCTG	0.299																																					.		Atlas-SNP	.											.	ANKRD30B	237	.	0			c.2723-2A>G						.						165.0	126.0	138.0					18																	14842894		692	1590	2282	SO:0001630	splice_region_variant	374860	exon32			CTTTTTAGAGTCT	BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2723-1A>G	chr18.hg19:g.14842894A>G		454.0	0.0		482.0	85.0	NM_001145029	B4DGP1|F8WAG3|Q4G175	Splice_Site	SNP	ENST00000358984.4	hg19	CCDS54182.1	.	.	.	.	.	.	.	.	.	.	a	1.119	-0.655948	0.03480	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	.	.	.	2.27	2.27	0.28462	.	.	.	.	.	.	.	.	.	.	.	0.49299	D	0.999771	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.4285	0.21784	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKRD30B	14832894	1.000000	0.71417	0.240000	0.24138	0.021000	0.10359	3.104000	0.50306	1.064000	0.40671	0.367000	0.22151	.	.	.		0.299	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000443557.1	NM_001145029	Intron
GATA6	2627	hgsc.bcm.edu	37	18	19751506	19751506	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr18:19751506C>G	ENST00000269216.3	+	2	678	c.401C>G	c.(400-402)gCc>gGc	p.A134G	GATA6_ENST00000581694.1_Missense_Mutation_p.A134G|GATA6-AS1_ENST00000583490.1_lincRNA	NM_005257.4	NP_005248.2	Q92908	GATA6_HUMAN	GATA binding protein 6	134					blood coagulation (GO:0007596)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac vascular smooth muscle cell differentiation (GO:0060947)|cellular response to BMP stimulus (GO:0071773)|cellular response to gonadotropin stimulus (GO:0071371)|cellular response to hypoxia (GO:0071456)|Clara cell differentiation (GO:0060486)|endodermal cell fate determination (GO:0007493)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|liver development (GO:0001889)|lung saccule development (GO:0060430)|male gonad development (GO:0008584)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta1 production (GO:0032911)|negative regulation of transforming growth factor beta2 production (GO:0032912)|organ formation (GO:0048645)|outflow tract septum morphogenesis (GO:0003148)|pancreatic A cell differentiation (GO:0003310)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to growth factor (GO:0070848)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)|tube morphogenesis (GO:0035239)|type B pancreatic cell differentiation (GO:0003309)|Type II pneumocyte differentiation (GO:0060510)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)	18	all_cancers(21;0.00271)|all_epithelial(16;7.31e-05)|Ovarian(2;0.116)|Lung NSC(20;0.123)|all_lung(20;0.246)		STAD - Stomach adenocarcinoma(5;0.106)			AGCCGCGGCGCCAAGCTGAGC	0.716																																					p.A134G	Colon(8;48 282 46199 46856)|Melanoma(177;170 2725 12489 26999)	Atlas-SNP	.											.	GATA6	35	.	0			c.C401G						.						14.0	19.0	17.0					18																	19751506		2142	4222	6364	SO:0001583	missense	2627	exon2			GCGGCGCCAAGCT	U66075	CCDS11872.1	18q11-q12	2013-01-25	2001-11-28		ENSG00000141448	ENSG00000141448		"""GATA zinc finger domain containing"""	4174	protein-coding gene	gene with protein product		601656	"""GATA-binding protein 6"""			8975704	Standard	XM_005258248		Approved		uc002ktt.2	Q92908	OTTHUMG00000131767	ENST00000269216.3:c.401C>G	chr18.hg19:g.19751506C>G	ENSP00000269216:p.Ala134Gly	1248.0	0.0		1043.0	281.0	NM_005257	B0YJ17|P78327	Missense_Mutation	SNP	ENST00000269216.3	hg19	CCDS11872.1	.	.	.	.	.	.	.	.	.	.	c	17.38	3.374194	0.61735	.	.	ENSG00000141448	ENST00000269216	D	0.98135	-4.74	3.3	3.3	0.37823	.	1.034180	0.07690	N	0.938563	D	0.93926	0.8056	N	0.19112	0.55	0.36202	D	0.850782	P	0.37525	0.598	B	0.31751	0.135	D	0.89800	0.3974	10	0.30854	T	0.27	-17.452	14.3936	0.66996	0.0:1.0:0.0:0.0	.	134	Q92908	GATA6_HUMAN	G	134	ENSP00000269216:A134G	ENSP00000269216:A134G	A	+	2	0	GATA6	18005504	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.665000	0.46791	1.667000	0.50832	0.450000	0.29827	GCC	.	.		0.716	GATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254696.1	NM_005257	
PIAS2	9063	hgsc.bcm.edu	37	18	44400939	44400939	+	Silent	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr18:44400939T>C	ENST00000585916.1	-	12	1604	c.1605A>G	c.(1603-1605)ccA>ccG	p.P535P	PIAS2_ENST00000545673.1_Silent_p.P245P|PIAS2_ENST00000324794.7_Silent_p.P535P	NM_004671.3	NP_004662.2	O75928	PIAS2_HUMAN	protein inhibitor of activated STAT, 2	535					androgen receptor signaling pathway (GO:0030521)|negative regulation of androgen receptor signaling pathway (GO:0060766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein sumoylation (GO:0016925)|regulation of osteoblast differentiation (GO:0045667)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|SUMO ligase activity (GO:0019789)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	22						TATGGTGGAATGGTACTGAGT	0.398																																					p.P535P		Atlas-SNP	.											.	PIAS2	85	.	0			c.A1605G						.						217.0	188.0	198.0					18																	44400939		2203	4300	6503	SO:0001819	synonymous_variant	9063	exon12			GTGGAATGGTACT	AF077953	CCDS32824.1, CCDS32825.1	18q12.1-q12.3	2011-10-11				ENSG00000078043		"""Zinc fingers, MIZ-type"""	17311	protein-coding gene	gene with protein product	"""zinc finger, MIZ-type containing 4"""	603567				9724754, 9256341	Standard	NM_004671		Approved	PIASX-BETA, miz, PIASX-ALPHA, ZMIZ4	uc002lck.3	O75928		ENST00000585916.1:c.1605A>G	chr18.hg19:g.44400939T>C		146.0	0.0		115.0	31.0	NM_173206	O75927|Q96BT5|Q96KE3	Silent	SNP	ENST00000585916.1	hg19	CCDS32824.1																																																																																			.	.		0.398	PIAS2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445656.2	NM_004671	
S1PR4	8698	hgsc.bcm.edu	37	19	3179175	3179175	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:3179175C>T	ENST00000246115.3	+	1	440	c.385C>T	c.(385-387)Ctg>Ttg	p.L129L	S1PR4_ENST00000591346.1_Intron	NM_003775.3	NP_003766.1	O95977	S1PR4_HUMAN	sphingosine-1-phosphate receptor 4	129					activation of phospholipase C activity (GO:0007202)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|positive regulation of cytosolic calcium ion concentration (GO:0007204)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)|sphingosine-1-phosphate receptor activity (GO:0038036)			breast(1)|kidney(2)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	13						CTTCACCGCCCTGGCCGCCTC	0.721																																					p.L129L	GBM(82;318 1638 33279 49708)	Atlas-SNP	.											.	S1PR4	31	.	0			c.C385T						.						33.0	35.0	35.0					19																	3179175		2178	4257	6435	SO:0001819	synonymous_variant	8698	exon1			ACCGCCCTGGCCG	AJ000479	CCDS12105.1	19p13.3	2012-08-08	2008-04-30	2008-04-30		ENSG00000125910		"""GPCR / Class A : Lysophospholipid receptors : Sphingosine 1-phosphate"""	3170	protein-coding gene	gene with protein product		603751	"""endothelial differentiation, G-protein-coupled receptor 6"", ""endothelial differentiation, lysophosphatidic acid G-protein-coupled receptor, 6"""	EDG6		9790765	Standard	NM_003775		Approved		uc002lxg.3	O95977		ENST00000246115.3:c.385C>T	chr19.hg19:g.3179175C>T		125.0	0.0		157.0	29.0	NM_003775	D6W612	Silent	SNP	ENST00000246115.3	hg19	CCDS12105.1																																																																																			.	.		0.721	S1PR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000452517.1	NM_003775	
PTPRS	5802	hgsc.bcm.edu	37	19	5244417	5244417	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:5244417G>A	ENST00000587303.1	-	10	1164	c.1065C>T	c.(1063-1065)ggC>ggT	p.G355G	PTPRS_ENST00000262963.6_Silent_p.G351G|PTPRS_ENST00000372412.4_Silent_p.G356G|PTPRS_ENST00000588012.1_Silent_p.G342G|PTPRS_ENST00000592099.1_Silent_p.G342G|PTPRS_ENST00000348075.2_Silent_p.G342G|PTPRS_ENST00000353284.2_Silent_p.G342G|PTPRS_ENST00000357368.4_Silent_p.G355G|PTPRS_ENST00000588552.1_5'UTR			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	355	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GATCTGGGTTGCCCGAGTCCC	0.547																																					p.G355G		Atlas-SNP	.											.	PTPRS	169	.	0			c.C1065T						.						127.0	115.0	119.0					19																	5244417		2203	4300	6503	SO:0001819	synonymous_variant	5802	exon11			TGGGTTGCCCGAG	U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.1065C>T	chr19.hg19:g.5244417G>A		113.0	0.0		131.0	54.0	NM_002850	O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	ENST00000587303.1	hg19	CCDS45930.1																																																																																			.	.		0.547	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000450762.2		
MUC16	94025	hgsc.bcm.edu	37	19	9068492	9068492	+	Silent	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:9068492A>T	ENST00000397910.4	-	3	19157	c.18954T>A	c.(18952-18954)acT>acA	p.T6318T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	6320	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CAGGTGAGACAGTAAAATAGA	0.463																																					p.T6318T		Atlas-SNP	.											.	MUC16	4315	.	0			c.T18954A						.						177.0	167.0	170.0					19																	9068492		1992	4176	6168	SO:0001819	synonymous_variant	94025	exon3			TGAGACAGTAAAA	AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.18954T>A	chr19.hg19:g.9068492A>T		88.0	0.0		134.0	53.0	NM_024690	Q6ZQW5|Q96RK2	Silent	SNP	ENST00000397910.4	hg19	CCDS54212.1																																																																																			.	.		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402806.1	NM_024690	
OR1M1	125963	hgsc.bcm.edu	37	19	9204033	9204033	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:9204033T>A	ENST00000429566.3	+	1	179	c.113T>A	c.(112-114)aTg>aAg	p.M38K		NM_001004456.1	NP_001004456.1	Q8NGA1	OR1M1_HUMAN	olfactory receptor, family 1, subfamily M, member 1	38						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(3)|lung(17)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						TACCTGGTCATGGTCGTGGGG	0.527																																					p.M38K		Atlas-SNP	.											.	OR1M1	52	.	0			c.T113A						.						130.0	105.0	113.0					19																	9204033		2203	4300	6503	SO:0001583	missense	125963	exon1			TGGTCATGGTCGT		CCDS32896.1	19p13.2	2013-09-20			ENSG00000170929	ENSG00000170929		"""GPCR / Class A : Olfactory receptors"""	8220	protein-coding gene	gene with protein product							Standard	NM_001004456		Approved	OR19-6	uc010xkj.2	Q8NGA1	OTTHUMG00000179930	ENST00000429566.3:c.113T>A	chr19.hg19:g.9204033T>A	ENSP00000401966:p.Met38Lys	73.0	0.0		94.0	15.0	NM_001004456	B9EHA6|Q6IFJ3|Q96R91	Missense_Mutation	SNP	ENST00000429566.3	hg19	CCDS32896.1	.	.	.	.	.	.	.	.	.	.	c	10.98	1.503730	0.26949	.	.	ENSG00000170929	ENST00000305465;ENST00000429566	T	0.00509	6.91	3.49	2.43	0.29744	.	0.718575	0.12863	N	0.432985	T	0.00384	0.0012	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46925	-0.9156	10	0.87932	D	0	.	8.6652	0.34116	0.0:0.8024:0.0:0.1976	.	38	Q8NGA1	OR1M1_HUMAN	K	41;38	ENSP00000401966:M38K	ENSP00000303195:M41K	M	+	2	0	OR1M1	9065033	0.715000	0.27946	0.002000	0.10522	0.000000	0.00434	2.370000	0.44240	0.295000	0.22570	-0.511000	0.04467	ATG	.	.		0.527	OR1M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000448993.1		
PODNL1	79883	hgsc.bcm.edu	37	19	14047181	14047181	+	Splice_Site	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:14047181T>C	ENST00000339560.5	-	3	612	c.339A>G	c.(337-339)gaA>gaG	p.E113E	PODNL1_ENST00000254320.3_Splice_Site_p.K53R|PODNL1_ENST00000538517.2_Splice_Site_p.E111E|PODNL1_ENST00000538371.2_Splice_Site_p.E111E	NM_024825.3	NP_079101.3	Q6PEZ8	PONL1_HUMAN	podocan-like 1	113	Leu-rich.					proteinaceous extracellular matrix (GO:0005578)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8			OV - Ovarian serous cystadenocarcinoma(19;5.26e-23)			CCCCCTCACCTTCGGAGGAGA	0.647																																					p.E113E		Atlas-SNP	.											.	PODNL1	27	.	0			c.A339G						.						154.0	135.0	141.0					19																	14047181		2203	4300	6503	SO:0001630	splice_region_variant	79883	exon3			CTCACCTTCGGAG	AK027100	CCDS12300.1, CCDS54225.1, CCDS54226.1	19p13.12	2008-02-05							26275	protein-coding gene	gene with protein product						12477932	Standard	NM_024825		Approved	FLJ23447, SLRR5B	uc010xnj.2	Q6PEZ8		ENST00000339560.5:c.340+1A>G	chr19.hg19:g.14047181T>C		66.0	0.0		71.0	23.0	NM_024825	B7Z564|Q9H5G9	Silent	SNP	ENST00000339560.5	hg19	CCDS12300.1	.	.	.	.	.	.	.	.	.	.	t	11.33	1.607520	0.28623	.	.	ENSG00000132000	ENST00000545071;ENST00000254320	T	0.38401	1.14	4.64	2.49	0.30216	.	.	.	.	.	T	0.21841	0.0526	.	.	.	0.80722	D	1	B	0.12013	0.005	B	0.15052	0.012	T	0.04991	-1.0913	8	0.22706	T	0.39	.	7.2974	0.26401	0.0:0.7819:0.0:0.2181	.	53	B7Z3M0	.	R	53	ENSP00000254320:K53R	ENSP00000254320:K53R	K	-	2	0	PODNL1	13908181	0.597000	0.26874	0.995000	0.50966	0.404000	0.30871	-0.136000	0.10405	0.930000	0.37217	-0.433000	0.05886	AAG	.	.		0.647	PODNL1-003	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000457967.1	NM_024825	Silent
JAK3	3718	hgsc.bcm.edu	37	19	17954263	17954263	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:17954263G>T	ENST00000527670.1	-	3	375	c.346C>A	c.(346-348)Cac>Aac	p.H116N	JAK3_ENST00000458235.1_Missense_Mutation_p.H116N|JAK3_ENST00000526008.1_5'UTR|JAK3_ENST00000534444.1_Missense_Mutation_p.H116N			P52333	JAK3_HUMAN	Janus kinase 3	116	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with cytokine/interferon/growth hormone receptors. {ECO:0000250}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	CCGAAGCGGTGGCACTTCTCC	0.562		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																p.H116N		Atlas-SNP	.		Dom	yes		19	19p13.1	3718	Janus kinase 3		L	.	JAK3	341	.	0			c.C346A						.						25.0	22.0	23.0					19																	17954263		2201	4297	6498	SO:0001583	missense	3718	exon4			AGCGGTGGCACTT	U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.346C>A	chr19.hg19:g.17954263G>T	ENSP00000432511:p.His116Asn	170.0	0.0		227.0	49.0	NM_000215	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	ENST00000527670.1	hg19	CCDS12366.1	.	.	.	.	.	.	.	.	.	.	G	14.28	2.486848	0.44249	.	.	ENSG00000105639	ENST00000458235;ENST00000428406;ENST00000527670;ENST00000534444	T;T;T	0.70869	-0.52;-0.52;-0.52	4.78	3.51	0.40186	Band 4.1 domain (1);FERM domain (1);	0.204238	0.45126	D	0.000400	T	0.59074	0.2167	L	0.47716	1.5	0.29632	N	0.845346	P;P;B	0.51933	0.949;0.696;0.432	B;B;B	0.43301	0.415;0.32;0.093	T	0.60551	-0.7241	10	0.42905	T	0.14	-42.9992	4.9412	0.13967	0.2664:0.0:0.7336:0.0	.	116;116;116	B4DK43;P52333-2;P52333	.;.;JAK3_HUMAN	N	116	ENSP00000391676:H116N;ENSP00000432511:H116N;ENSP00000436421:H116N	ENSP00000413248:H116N	H	-	1	0	JAK3	17815263	0.999000	0.42202	0.952000	0.39060	0.732000	0.41865	3.433000	0.52834	2.386000	0.81285	0.485000	0.47835	CAC	.	.		0.562	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000385549.1	NM_000215	
KIRREL2	84063	hgsc.bcm.edu	37	19	36351548	36351548	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:36351548A>C	ENST00000360202.5	+	7	1105	c.907A>C	c.(907-909)Agt>Cgt	p.S303R	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Missense_Mutation_p.S303R|KIRREL2_ENST00000347900.6_Missense_Mutation_p.S253R|KIRREL2_ENST00000262625.7_Missense_Mutation_p.S303R	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	303	Ig-like C2-type 3.				cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CGCCAACCGCAGTACTGCGCT	0.682																																					p.S303R		Atlas-SNP	.											.	KIRREL2	170	.	0			c.A907C						.						61.0	68.0	66.0					19																	36351548		2203	4300	6503	SO:0001583	missense	84063	exon7			AACCGCAGTACTG	AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.907A>C	chr19.hg19:g.36351548A>C	ENSP00000353331:p.Ser303Arg	61.0	0.0		71.0	31.0	NM_199180	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	ENST00000360202.5	hg19	CCDS12481.1	.	.	.	.	.	.	.	.	.	.	a	24.6	4.548749	0.86127	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658	T;T;T	0.18016	2.24;2.24;2.24	3.99	3.99	0.46301	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.49916	D	0.000126	T	0.39172	0.1068	M	0.84683	2.71	0.48830	D	0.999711	P;P;P;D;P	0.53462	0.942;0.928;0.901;0.96;0.928	P;P;P;P;P	0.60012	0.867;0.79;0.743;0.626;0.626	T	0.37197	-0.9716	10	0.87932	D	0	-20.8176	9.5376	0.39231	1.0:0.0:0.0:0.0	.	303;283;303;253;303	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	R	303;253;303;283	ENSP00000262625:S303R;ENSP00000345067:S253R;ENSP00000353331:S303R	ENSP00000262625:S303R	S	+	1	0	KIRREL2	41043388	1.000000	0.71417	1.000000	0.80357	0.764000	0.43329	8.067000	0.89488	1.831000	0.53308	0.365000	0.22127	AGT	.	.		0.682	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000452561.1	NM_032123	
SPTBN4	57731	hgsc.bcm.edu	37	19	41025770	41025770	+	Silent	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:41025770A>T	ENST00000352632.3	+	16	3452	c.3366A>T	c.(3364-3366)ctA>ctT	p.L1122L	SPTBN4_ENST00000344104.3_Silent_p.L1122L|SPTBN4_ENST00000598249.1_Silent_p.L1122L|SPTBN4_ENST00000595535.1_Silent_p.L1122L|SPTBN4_ENST00000338932.3_Silent_p.L1122L			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1122					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			CCAACAGCCTAGAAGAGGCGG	0.711																																					p.L1122L		Atlas-SNP	.											.	SPTBN4	213	.	0			c.A3366T						.						3.0	3.0	3.0					19																	41025770		1591	3203	4794	SO:0001819	synonymous_variant	57731	exon16			CAGCCTAGAAGAG	AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.3366A>T	chr19.hg19:g.41025770A>T		28.0	0.0		38.0	9.0	NM_020971	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Silent	SNP	ENST00000352632.3	hg19	CCDS12559.1																																																																																			.	.		0.711	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462559.2		
HNRNPUL1	11100	hgsc.bcm.edu	37	19	41808816	41808816	+	Missense_Mutation	SNP	G	G	A	rs147281768		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:41808816G>A	ENST00000392006.3	+	12	2107	c.1934G>A	c.(1933-1935)cGa>cAa	p.R645Q	HNRNPUL1_ENST00000378215.4_Missense_Mutation_p.R531Q|HNRNPUL1_ENST00000352456.3_Missense_Mutation_p.R545Q|HNRNPUL1_ENST00000602130.1_Missense_Mutation_p.R645Q|HNRNPUL1_ENST00000595018.1_Missense_Mutation_p.R545Q|HNRNPUL1_ENST00000263367.3_Missense_Mutation_p.R556Q|HNRNPUL1_ENST00000593587.1_Missense_Mutation_p.R545Q	NM_007040.3	NP_008971.2	Q9BUJ2	HNRL1_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 1	645	5 X 3 AA repeats of R-G-G.|Gly-rich.|Necessary for interaction with TP53.|Necessary for transcription repression.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	29						TTCCAGAACCGAGGGGGAGGC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		14965	0.0		0.001	False		,,,				2504	0.0				p.R645Q		Atlas-SNP	.											.	HNRNPUL1	73	.	0			c.G1934A						.	G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	35.0	41.0	39.0		1934,1634	5.3	1.0	19	dbSNP_134	39	2,8596	2.2+/-6.3	0,2,4297	no	missense,missense	HNRNPUL1	NM_007040.3,NM_144732.2	43,43	0,2,6500	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging,probably-damaging	645/857,545/757	41808816	2,13002	2203	4299	6502	SO:0001583	missense	11100	exon12			AGAACCGAGGGGG	AJ007509	CCDS12576.1, CCDS12577.1	19q13.2	2013-06-12		2008-04-18	ENSG00000105323	ENSG00000105323			17011	protein-coding gene	gene with protein product	"""E1B 55kDa associated protein 5"""	605800		HNRPUL1		9733834, 12489984	Standard	XM_005258459		Approved	E1B-AP5, E1BAP5, FLJ12944	uc002oqb.4	Q9BUJ2	OTTHUMG00000182740	ENST00000392006.3:c.1934G>A	chr19.hg19:g.41808816G>A	ENSP00000375863:p.Arg645Gln	185.0	0.0		247.0	44.0	NM_007040	B3KMW7|O76022|Q6ZSZ0|Q7L8P4|Q8N6Z4|Q96G37|Q9HAL3|Q9UG75	Missense_Mutation	SNP	ENST00000392006.3	hg19	CCDS12576.1	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492286	0.84962	0.0	2.33E-4	ENSG00000105323	ENST00000352456;ENST00000392006;ENST00000378215;ENST00000263367	D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.85639	0.5743	N	0.24115	0.695	0.47547	D	0.99945	D;D;D;D;D;D;D	0.89917	0.98;0.993;0.996;1.0;0.996;0.993;0.996	P;P;P;D;P;P;P	0.76575	0.449;0.546;0.806;0.988;0.806;0.644;0.734	D	0.85884	0.1424	10	0.44086	T	0.13	-7.3539	18.1981	0.89829	0.0:0.0:1.0:0.0	.	556;545;645;169;531;645;545	B7Z4B8;A8K3W4;Q9BUJ2-2;Q9BUJ2-5;Q9BUJ2-3;Q9BUJ2;Q9BUJ2-4	.;.;.;.;.;HNRL1_HUMAN;.	Q	545;645;531;556	ENSP00000340857:R545Q;ENSP00000375863:R645Q;ENSP00000367460:R531Q;ENSP00000263367:R556Q	ENSP00000263367:R556Q	R	+	2	0	HNRNPUL1	46500656	1.000000	0.71417	0.997000	0.53966	0.940000	0.58332	8.522000	0.90573	2.659000	0.90383	0.655000	0.94253	CGA	.	G|1.000;A|0.000		0.647	HNRNPUL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463406.1	NM_144732, NM_007040	
IRGQ	126298	hgsc.bcm.edu	37	19	44096203	44096203	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:44096203A>T	ENST00000602269.1	-	2	2032	c.1847T>A	c.(1846-1848)cTg>cAg	p.L616Q	IRGQ_ENST00000601520.1_Intron|IRGQ_ENST00000422989.1_Missense_Mutation_p.L616Q|L34079.2_ENST00000594374.1_Intron			Q8WZA9	IRGQ_HUMAN	immunity-related GTPase family, Q	616	Ala-rich.									endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(3)	18		Prostate(69;0.0199)				AGGGGGTGCCAGCACAGCCTC	0.667																																					p.L616Q		Atlas-SNP	.											.	IRGQ	40	.	0			c.T1847A						.						74.0	85.0	82.0					19																	44096203		2201	4294	6495	SO:0001583	missense	126298	exon3			GGTGCCAGCACAG	AF322648	CCDS33040.1	19q13.31	2013-07-03	2005-10-31	2005-10-31		ENSG00000167378			24868	protein-coding gene	gene with protein product			"""immunity-related GTPase family, Q1"""	IRGQ1		16277747	Standard	NM_001007561		Approved	FKSG27	uc010eiv.2	Q8WZA9		ENST00000602269.1:c.1847T>A	chr19.hg19:g.44096203A>T	ENSP00000472250:p.Leu616Gln	116.0	0.0		166.0	34.0	NM_001007561	B2RNP3	Missense_Mutation	SNP	ENST00000602269.1	hg19	CCDS33040.1	.	.	.	.	.	.	.	.	.	.	A	15.27	2.782907	0.49891	.	.	ENSG00000167378	ENST00000422989	T	0.59224	0.28	4.9	4.9	0.64082	.	0.101452	0.39544	N	0.001324	T	0.69602	0.3129	L	0.53249	1.67	0.34845	D	0.741081	D	0.89917	1.0	D	0.91635	0.999	T	0.78753	-0.2081	10	0.87932	D	0	-11.5777	11.1101	0.48228	1.0:0.0:0.0:0.0	.	616	Q8WZA9	IRGQ_HUMAN	Q	616	ENSP00000387535:L616Q	ENSP00000387535:L616Q	L	-	2	0	IRGQ	48788043	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	4.277000	0.58939	2.185000	0.69588	0.533000	0.62120	CTG	.	.		0.667	IRGQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000463205.1	NM_001007561	
TPRX1	284355	hgsc.bcm.edu	37	19	48305829	48305829	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:48305829C>T	ENST00000322175.3	-	2	594	c.439G>A	c.(439-441)Ggc>Agc	p.G147S	TPRX1_ENST00000535759.1_Missense_Mutation_p.G244S|TPRX1_ENST00000543508.1_Missense_Mutation_p.G147S	NM_198479.2	NP_940881.2	Q8N7U7	TPRX1_HUMAN	tetra-peptide repeat homeobox 1	147	Gly-rich.					nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)|skin(1)	18		all_cancers(25;3.02e-09)|all_epithelial(76;7e-07)|all_lung(116;2.48e-06)|Lung NSC(112;5.15e-06)|Ovarian(192;0.0139)|all_neural(266;0.0146)|Breast(70;0.133)		OV - Ovarian serous cystadenocarcinoma(262;0.000241)|all cancers(93;0.00036)|Epithelial(262;0.0127)|GBM - Glioblastoma multiforme(486;0.048)		cggaatgggcctgggatctgg	0.642																																					p.G147S	Esophageal Squamous(123;175 2281 3051 32395)	Atlas-SNP	.											.	TPRX1	46	.	0			c.G439A						.						21.0	18.0	19.0					19																	48305829		1961	3844	5805	SO:0001583	missense	284355	exon2			ATGGGCCTGGGAT		CCDS33066.1	19q13.33	2011-07-08			ENSG00000178928	ENSG00000178928		"""Homeoboxes / PRD class"""	32174	protein-coding gene	gene with protein product		611166					Standard	XM_005258788		Approved	FLJ40321	uc002php.2	Q8N7U7		ENST00000322175.3:c.439G>A	chr19.hg19:g.48305829C>T	ENSP00000323455:p.Gly147Ser	146.0	0.0		198.0	36.0	NM_198479	A5D8Y3|B2RPL5	Missense_Mutation	SNP	ENST00000322175.3	hg19	CCDS33066.1	.	.	.	.	.	.	.	.	.	.	c	2.004	-0.428714	0.04701	.	.	ENSG00000178928	ENST00000322175;ENST00000535759;ENST00000543508	T;T;T	0.40225	1.04;1.04;1.04	0.383	0.383	0.16239	.	.	.	.	.	T	0.17238	0.0414	N	0.03608	-0.345	0.09310	N	1	P	0.43314	0.803	B	0.41946	0.371	T	0.11817	-1.0572	8	0.09590	T	0.72	.	.	.	.	.	147	Q8N7U7	TPRX1_HUMAN	S	147;244;147	ENSP00000323455:G147S;ENSP00000438832:G244S;ENSP00000438712:G147S	ENSP00000323455:G147S	G	-	1	0	TPRX1	52997641	0.000000	0.05858	0.028000	0.17463	0.028000	0.11728	-0.232000	0.09055	0.423000	0.26033	0.423000	0.28283	GGC	.	.		0.642	TPRX1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409868.1	NM_198479	
ZNF615	284370	hgsc.bcm.edu	37	19	52496688	52496688	+	Silent	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:52496688T>C	ENST00000602063.1	-	6	1990	c.1641A>G	c.(1639-1641)aaA>aaG	p.K547K	ZNF615_ENST00000376716.5_Silent_p.K547K|ZNF615_ENST00000391795.3_Silent_p.K552K|ZNF615_ENST00000594083.1_Silent_p.K558K|ZNF615_ENST00000598071.1_Silent_p.K558K			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	547					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CAGTGAAGCCTTTTCCACACT	0.448																																					p.K558K		Atlas-SNP	.											.	ZNF615	111	.	0			c.A1674G						.						117.0	103.0	108.0					19																	52496688		2203	4300	6503	SO:0001819	synonymous_variant	284370	exon7			GAAGCCTTTTCCA	AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1641A>G	chr19.hg19:g.52496688T>C		80.0	0.0		97.0	4.0	NM_001199324	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	ENST00000602063.1	hg19	CCDS12846.1																																																																																			.	.		0.448	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000462391.1	NM_198480	
ZNF808	388558	hgsc.bcm.edu	37	19	53050791	53050791	+	Silent	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:53050791T>C	ENST00000359798.4	+	4	270	c.90T>C	c.(88-90)gcT>gcC	p.A30A		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		GGGATGTGGCTATAGAATTCT	0.438																																					p.A30A		Atlas-SNP	.											.	ZNF808	81	.	0			c.T90C						.						122.0	129.0	127.0					19																	53050791		2203	4300	6503	SO:0001819	synonymous_variant	388558	exon4			TGTGGCTATAGAA	CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.90T>C	chr19.hg19:g.53050791T>C		83.0	0.0		118.0	22.0	NM_001039886	Q68CN7	Silent	SNP	ENST00000359798.4	hg19	CCDS46167.1																																																																																			.	.		0.438	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000350447.3	NM_001039886	
VN1R2	317701	hgsc.bcm.edu	37	19	53762581	53762581	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr19:53762581T>A	ENST00000341702.3	+	1	1037	c.953T>A	c.(952-954)cTt>cAt	p.L318H	VN1R2_ENST00000598458.1_3'UTR	NM_173856.2	NP_776255.2	Q8NFZ6	VN1R2_HUMAN	vomeronasal 1 receptor 2	318					response to pheromone (GO:0019236)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	pheromone receptor activity (GO:0016503)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(134;0.00301)		CAAAGCATCCTTGCATTGGTG	0.453																																					p.L318H		Atlas-SNP	.											.	VN1R2	71	.	0			c.T953A						.						231.0	202.0	212.0					19																	53762581		2203	4300	6503	SO:0001583	missense	317701	exon1			GCATCCTTGCATT	AF370359	CCDS12862.1	19q13.42	2012-08-22			ENSG00000196131	ENSG00000196131		"""Vomeronasal receptors / Type 1"", ""GPCR / Unclassified : Vomeronasal receptors, type 1"""	19872	protein-coding gene	gene with protein product						12123587	Standard	NM_173856		Approved	V1RL2	uc002qbi.2	Q8NFZ6		ENST00000341702.3:c.953T>A	chr19.hg19:g.53762581T>A	ENSP00000351244:p.Leu318His	161.0	0.0		133.0	51.0	NM_173856	A1L411|Q8TDU4	Missense_Mutation	SNP	ENST00000341702.3	hg19	CCDS12862.1	.	.	.	.	.	.	.	.	.	.	T	16.45	3.126336	0.56721	.	.	ENSG00000196131	ENST00000341702	T	0.14640	2.49	2.93	2.93	0.34026	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.45994	0.1370	H	0.94658	3.565	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.32322	-0.9911	9	0.87932	D	0	.	9.7491	0.40464	0.0:0.0:0.0:1.0	.	318	Q8NFZ6	VN1R2_HUMAN	H	318	ENSP00000351244:L318H	ENSP00000351244:L318H	L	+	2	0	VN1R2	58454393	0.018000	0.18449	0.080000	0.20451	0.436000	0.31835	2.713000	0.47194	1.615000	0.50252	0.481000	0.45027	CTT	.	.		0.453	VN1R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000464285.1	NM_173856	
SIRPB1	10326	hgsc.bcm.edu	37	20	1551730	1551730	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:1551730T>C	ENST00000381605.4	-	4	869	c.805A>G	c.(805-807)Aac>Gac	p.N269D	SIRPB1_ENST00000262929.5_Intron|SIRPB1_ENST00000381603.3_Intron|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	269	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						CAGGTGACGTTTGCCTGGTTC	0.542																																					p.N269D		Atlas-SNP	.											.	SIRPB1	83	.	0			c.A805G						.						95.0	88.0	90.0					20																	1551730		2203	4300	6503	SO:0001583	missense	10326	exon4			TGACGTTTGCCTG	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.805A>G	chr20.hg19:g.1551730T>C	ENSP00000371018:p.Asn269Asp	146.0	0.0		195.0	80.0	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Missense_Mutation	SNP	ENST00000381605.4	hg19	CCDS13019.1	.	.	.	.	.	.	.	.	.	.	.	14.56	2.573313	0.45902	.	.	ENSG00000101307	ENST00000381605	T	0.00612	6.22	2.39	2.39	0.29439	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.455016	0.21297	N	0.076865	T	0.02230	0.0069	M	0.80422	2.495	0.19775	N	0.999959	D	0.57571	0.98	P	0.60789	0.879	T	0.31530	-0.9940	10	0.52906	T	0.07	.	6.5862	0.22622	0.0:0.0:0.0:1.0	.	269	O00241	SIRB1_HUMAN	D	269	ENSP00000371018:N269D	ENSP00000371018:N269D	N	-	1	0	SIRPB1	1499730	0.013000	0.17824	0.082000	0.20525	0.027000	0.11550	1.809000	0.38922	1.095000	0.41419	0.260000	0.18958	AAC	.	.		0.542	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
CEP250	11190	hgsc.bcm.edu	37	20	34092199	34092199	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:34092199T>A	ENST00000397527.1	+	30	6722	c.6002T>A	c.(6001-6003)cTg>cAg	p.L2001Q	CEP250_ENST00000342580.4_Missense_Mutation_p.L1945Q	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	2001	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			ACTGCAACCCTGCAAGCCTCC	0.612																																					p.L2001Q		Atlas-SNP	.											.	CEP250	141	.	0			c.T6002A						.						18.0	20.0	19.0					20																	34092199		2198	4298	6496	SO:0001583	missense	11190	exon30			CAACCCTGCAAGC	AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.6002T>A	chr20.hg19:g.34092199T>A	ENSP00000380661:p.Leu2001Gln	77.0	0.0		89.0	39.0	NM_007186	E1P5Q3|O14812|O60588|Q9H450	Missense_Mutation	SNP	ENST00000397527.1	hg19	CCDS13255.1	.	.	.	.	.	.	.	.	.	.	T	12.59	1.984543	0.35036	.	.	ENSG00000126001	ENST00000397527;ENST00000342580;ENST00000422671	T;T;T	0.50001	2.76;2.74;0.76	5.08	5.08	0.68730	.	0.261790	0.25487	N	0.030338	T	0.62696	0.2449	L	0.49126	1.545	0.37119	D	0.900729	D	0.89917	1.0	D	0.91635	0.999	T	0.67562	-0.5639	10	0.46703	T	0.11	.	14.6713	0.68945	0.0:0.0:0.0:1.0	.	2001	Q9BV73	CP250_HUMAN	Q	2001;1945;489	ENSP00000380661:L2001Q;ENSP00000341541:L1945Q;ENSP00000395992:L489Q	ENSP00000341541:L1945Q	L	+	2	0	CEP250	33555613	0.994000	0.37717	0.870000	0.34147	0.064000	0.16182	2.321000	0.43805	2.127000	0.65507	0.533000	0.62120	CTG	.	.		0.612	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000078877.7	NM_007186	
TTI1	9675	hgsc.bcm.edu	37	20	36642114	36642114	+	Silent	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:36642114T>A	ENST00000373448.2	-	3	343	c.105A>T	c.(103-105)acA>acT	p.T35T	TTI1_ENST00000487362.1_5'UTR|TTI1_ENST00000373447.3_Silent_p.T35T|TTI1_ENST00000449821.1_Silent_p.T35T	NM_014657.1	NP_055472.1	O43156	TTI1_HUMAN	TELO2 interacting protein 1	35					regulation of TOR signaling (GO:0032006)	cytoplasm (GO:0005737)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)				breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|pancreas(1)|prostate(3)|skin(3)	47						CTTGTAGTCGTGTCTGCAGAT	0.512																																					p.T35T		Atlas-SNP	.											.	TTI1	104	.	0			c.A105T						.						141.0	117.0	125.0					20																	36642114		2203	4300	6503	SO:0001819	synonymous_variant	9675	exon3			TAGTCGTGTCTGC	BC013121	CCDS13300.1	20q11.23	2011-11-10	2011-11-10	2010-06-22	ENSG00000101407	ENSG00000101407			29029	protein-coding gene	gene with protein product	"""smg-10 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	614425	"""KIAA0406"", ""Tel2 interacting protein 1 homolog (S. pombe)"""	KIAA0406		9455477, 20427287, 20371770	Standard	NM_014657		Approved	smg-10	uc002xhl.3	O43156	OTTHUMG00000032433	ENST00000373448.2:c.105A>T	chr20.hg19:g.36642114T>A		85.0	0.0		117.0	57.0	NM_014657	D6W4K3|Q5JX67|Q96A38|Q9BR47|Q9H4K0	Silent	SNP	ENST00000373448.2	hg19	CCDS13300.1																																																																																			.	.		0.512	TTI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079138.2	NM_014657	
SYS1	90196	hgsc.bcm.edu	37	20	43995718	43995718	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:43995718A>T	ENST00000243918.5	+	4	725	c.434A>T	c.(433-435)gAg>gTg	p.E145V	SYS1_ENST00000414310.1_Missense_Mutation_p.E124V|SYS1_ENST00000372727.1_Missense_Mutation_p.E145V|SYS1_ENST00000479779.1_3'UTR|SYS1-DBNDD2_ENST00000452133.1_Intron|SYS1-DBNDD2_ENST00000475242.1_Intron|SYS1_ENST00000426004.1_Intron	NM_033542.3	NP_291020.1	Q8N2H4	SYS1_HUMAN	Sys1 golgi trafficking protein	145					protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|large_intestine(2)|prostate(1)|skin(1)	7		Myeloproliferative disorder(115;0.0122)				GAGCTCAAGGAGATACCCCTC	0.582																																					p.E145V		Atlas-SNP	.											.	SYS1	15	.	0			c.A434T						.						116.0	112.0	113.0					20																	43995718		2203	4300	6503	SO:0001583	missense	90196	exon5			TCAAGGAGATACC	AL021578	CCDS13351.1, CCDS56192.1	20q13.12	2014-05-07	2014-05-07	2006-11-06	ENSG00000204070	ENSG00000204070			16162	protein-coding gene	gene with protein product		612979	"""chromosome 20 open reading frame 169"", ""SYS1 Golgi-localized integral membrane protein homolog (S. cerevisiae)"""	C20orf169		15077113	Standard	NM_001197129		Approved	dJ453C12.4	uc002xnv.3	Q8N2H4	OTTHUMG00000032579	ENST00000243918.5:c.434A>T	chr20.hg19:g.43995718A>T	ENSP00000243918:p.Glu145Val	117.0	0.0		136.0	52.0	NM_001197129	C9JFB3|E1P620|Q5QPU7|Q96SD8|Q9BQZ2|Q9BQZ4|Q9H1F7	Missense_Mutation	SNP	ENST00000243918.5	hg19	CCDS13351.1	.	.	.	.	.	.	.	.	.	.	A	25.5	4.644275	0.87859	.	.	ENSG00000204070	ENST00000372727;ENST00000414310;ENST00000243918	.	.	.	6.17	6.17	0.99709	.	0.054549	0.64402	D	0.000001	T	0.67401	0.2889	M	0.76170	2.325	0.58432	D	0.999996	P	0.34864	0.473	B	0.38106	0.265	T	0.70077	-0.4971	9	0.66056	D	0.02	-0.1171	16.0034	0.80327	1.0:0.0:0.0:0.0	.	145	Q8N2H4	SYS1_HUMAN	V	145;124;145	.	ENSP00000243918:E145V	E	+	2	0	SYS1	43429132	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.080000	0.71299	2.371000	0.80710	0.533000	0.62120	GAG	.	.		0.582	SYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079453.2	NM_033542	
SLC12A5	57468	hgsc.bcm.edu	37	20	44665420	44665420	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:44665420A>G	ENST00000454036.2	+	5	585	c.536A>G	c.(535-537)aAt>aGt	p.N179S	SLC12A5_ENST00000243964.3_Missense_Mutation_p.N156S|SLC12A5_ENST00000608944.1_Missense_Mutation_p.N105S|SLC12A5_ENST00000372315.1_Missense_Mutation_p.N156S	NM_001134771.1	NP_001128243.1	Q9H2X9	S12A5_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 5	179					cellular ion homeostasis (GO:0006873)|chloride transmembrane transport (GO:1902476)|ion transport (GO:0006811)|learning (GO:0007612)|multicellular organism growth (GO:0035264)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)|thermosensory behavior (GO:0040040)|transmembrane transport (GO:0055085)|transport (GO:0006810)	dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(1)|lung(38)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)	80		Myeloproliferative disorder(115;0.0122)			Bumetanide(DB00887)|Potassium Chloride(DB00761)	ATTGCAACGAATGGTGTTGTG	0.607																																					p.N179S		Atlas-SNP	.											.	SLC12A5	181	.	0			c.A536G						.						156.0	116.0	130.0					20																	44665420		2203	4300	6503	SO:0001583	missense	57468	exon5			CAACGAATGGTGT	AB033002	CCDS13391.1, CCDS46610.1	20q13.12	2013-05-22	2010-04-20		ENSG00000124140	ENSG00000124140		"""Solute carriers"""	13818	protein-coding gene	gene with protein product		606726					Standard	NM_020708		Approved	KIAA1176, KCC2	uc010zxl.1	Q9H2X9	OTTHUMG00000032638	ENST00000454036.2:c.536A>G	chr20.hg19:g.44665420A>G	ENSP00000387694:p.Asn179Ser	96.0	0.0		143.0	22.0	NM_001134771	A2RTX2|Q5VZ41|Q9H4Z0|Q9ULP4	Missense_Mutation	SNP	ENST00000454036.2	hg19	CCDS46610.1	.	.	.	.	.	.	.	.	.	.	A	15.19	2.761230	0.49468	.	.	ENSG00000124140	ENST00000454036;ENST00000372315;ENST00000539566;ENST00000243964	D;D;D;D	0.98849	-5.18;-5.18;-5.18;-5.18	4.65	4.65	0.58169	Amino acid permease domain (1);	0.000000	0.85682	D	0.000000	D	0.99245	0.9737	M	0.92219	3.285	0.80722	D	1	D;D;D	0.89917	0.997;0.999;1.0	D;D;D	0.81914	0.98;0.991;0.995	D	0.99063	1.0831	10	0.87932	D	0	.	13.416	0.60968	1.0:0.0:0.0:0.0	.	179;156;156	Q9H2X9;Q9H2X9-2;A8K143	S12A5_HUMAN;.;.	S	179;156;156;156	ENSP00000387694:N179S;ENSP00000361389:N156S;ENSP00000446091:N156S;ENSP00000243964:N156S	ENSP00000243964:N156S	N	+	2	0	SLC12A5	44098827	1.000000	0.71417	0.996000	0.52242	0.040000	0.13550	9.006000	0.93592	1.953000	0.56701	0.460000	0.39030	AAT	.	.		0.607	SLC12A5-003	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000471538.1		
SYCP2	10388	hgsc.bcm.edu	37	20	58441392	58441392	+	Nonsense_Mutation	SNP	C	C	A	rs377589640		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:58441392C>A	ENST00000357552.3	-	41	4501	c.4276G>T	c.(4276-4278)Gaa>Taa	p.E1426*	SYCP2_ENST00000371001.2_Nonsense_Mutation_p.E1426*			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	1426					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)	p.E1426K(1)		NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			GAATCTTTTTCAAAATTCTCC	0.234																																					p.E1426X		Atlas-SNP	.											SYCP2,NS,carcinoma,0,1	SYCP2	204	.	1	Substitution - Missense(1)	lung(1)	c.G4276T						.						30.0	35.0	33.0					20																	58441392		2120	4219	6339	SO:0001587	stop_gained	10388	exon40			CTTTTTCAAAATT	Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.4276G>T	chr20.hg19:g.58441392C>A	ENSP00000350162:p.Glu1426*	310.0	1.0		464.0	96.0	NM_014258	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Nonsense_Mutation	SNP	ENST00000357552.3	hg19	CCDS13482.1	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221123	0.79464	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000412613	.	.	.	5.5	5.5	0.81552	.	0.000000	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-17.1811	14.3627	0.66785	0.0:0.8522:0.1478:0.0	.	.	.	.	X	1426;1426;112	.	ENSP00000350162:E1426X	E	-	1	0	SYCP2	57874787	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	3.360000	0.52299	2.735000	0.93741	0.557000	0.71058	GAA	.	.		0.234	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000079930.3	NM_014258	
ZNF512B	57473	hgsc.bcm.edu	37	20	62595237	62595237	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr20:62595237T>C	ENST00000450537.1	-	9	1570	c.1510A>G	c.(1510-1512)Atc>Gtc	p.I504V	ZNF512B_ENST00000217130.3_Missense_Mutation_p.I504V|ZNF512B_ENST00000369888.1_Missense_Mutation_p.I504V			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	504					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CGCTCATGGATGGCCCTCTGC	0.637																																					p.I504V		Atlas-SNP	.											.	ZNF512B	72	.	0			c.A1510G						.						52.0	53.0	53.0					20																	62595237		2202	4298	6500	SO:0001583	missense	57473	exon9			CATGGATGGCCCT	AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1510A>G	chr20.hg19:g.62595237T>C	ENSP00000393795:p.Ile504Val	40.0	0.0		54.0	13.0	NM_020713	Q08AK9|Q9ULM4	Missense_Mutation	SNP	ENST00000450537.1	hg19	CCDS13548.1	.	.	.	.	.	.	.	.	.	.	T	8.421	0.846335	0.16963	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.30448	1.53;1.53;1.53	4.62	1.95	0.26073	.	0.060400	0.64402	D	0.000004	T	0.44891	0.1315	M	0.64404	1.975	0.37675	D	0.923278	P	0.51240	0.943	D	0.66716	0.946	T	0.42531	-0.9446	10	0.45353	T	0.12	-13.3647	6.9432	0.24504	0.0:0.0902:0.2862:0.6236	.	504	Q96KM6	Z512B_HUMAN	V	504	ENSP00000358904:I504V;ENSP00000393795:I504V;ENSP00000217130:I504V	ENSP00000217130:I504V	I	-	1	0	ZNF512B	62065681	1.000000	0.71417	0.996000	0.52242	0.055000	0.15305	2.884000	0.48562	0.581000	0.29539	0.383000	0.25322	ATC	.	.		0.637	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080246.1	NM_020713	
TPTE	7179	hgsc.bcm.edu	37	21	10921957	10921957	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr21:10921957A>G	ENST00000361285.4	-	18	1395	c.1066T>C	c.(1066-1068)Tct>Cct	p.S356P	TPTE_ENST00000415664.2_5'UTR|TPTE_ENST00000298232.7_Missense_Mutation_p.S338P|TPTE_ENST00000342420.5_Missense_Mutation_p.S318P	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	356	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		CATATTTCAGAGGCAATAAGG	0.343																																					p.S356P		Atlas-SNP	.											.	TPTE	513	.	0			c.T1066C						.						142.0	121.0	128.0					21																	10921957		2203	4299	6502	SO:0001583	missense	7179	exon18			TTTCAGAGGCAAT	AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1066T>C	chr21.hg19:g.10921957A>G	ENSP00000355208:p.Ser356Pro	570.0	0.0		577.0	63.0	NM_199261	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	ENST00000361285.4	hg19	CCDS13560.2	.	.	.	.	.	.	.	.	.	.	.	11.74	1.730269	0.30684	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.86297	-2.1;-2.1;-2.1	2.26	-0.715	0.11215	Phosphatase tensin type (1);Dual specificity phosphatase, catalytic domain (1);	0.279979	0.44483	D	0.000445	D	0.91851	0.7421	M	0.93375	3.41	0.18873	N	0.999983	D;D;D	0.58970	0.984;0.964;0.97	P;P;P	0.59761	0.847;0.786;0.863	D	0.84323	0.0517	10	0.66056	D	0.02	-5.384	4.9133	0.13833	0.5101:0.0:0.0:0.4899	.	318;338;356	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	P	338;356;318	ENSP00000298232:S338P;ENSP00000355208:S356P;ENSP00000344441:S318P	ENSP00000298232:S338P	S	-	1	0	TPTE	9943828	0.017000	0.18338	0.015000	0.15790	0.010000	0.07245	-0.469000	0.06648	-0.275000	0.09219	0.102000	0.15555	TCT	.	.		0.343	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000157413.1		
KRTAP13-4	284827	hgsc.bcm.edu	37	21	31802679	31802679	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr21:31802679T>A	ENST00000334068.2	+	1	108	c.86T>A	c.(85-87)cTg>cAg	p.L29Q		NM_181600.1	NP_853631.1	Q3LI77	KR134_HUMAN	keratin associated protein 13-4	29						intermediate filament (GO:0005882)				NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	15						CCCAGCAGCCTGGTCTACAGC	0.602																																					p.L29Q	NSCLC(196;2401 3038 18004 35753)	Atlas-SNP	.											.	KRTAP13-4	46	.	0			c.T86A						.						87.0	88.0	88.0					21																	31802679		2203	4300	6503	SO:0001583	missense	284827	exon1			GCAGCCTGGTCTA	AP001708	CCDS13592.1	21q22.1	2006-03-13			ENSG00000186971	ENSG00000186971		"""Keratin associated proteins"""	18926	protein-coding gene	gene with protein product						12359730	Standard	NM_181600		Approved	KAP13.4	uc011acw.2	Q3LI77	OTTHUMG00000057770	ENST00000334068.2:c.86T>A	chr21.hg19:g.31802679T>A	ENSP00000334834:p.Leu29Gln	114.0	0.0		118.0	40.0	NM_181600	A2RRL3	Missense_Mutation	SNP	ENST00000334068.2	hg19	CCDS13592.1	.	.	.	.	.	.	.	.	.	.	-	10.73	1.433548	0.25813	.	.	ENSG00000186971	ENST00000334068	T	0.04083	3.71	4.64	3.48	0.39840	.	0.000000	0.36234	N	0.002717	T	0.12220	0.0297	M	0.83223	2.63	0.23936	N	0.996413	P	0.52061	0.95	P	0.49502	0.613	T	0.07927	-1.0747	10	0.56958	D	0.05	.	8.2291	0.31587	0.1777:0.0:0.0:0.8223	.	29	Q3LI77	KR134_HUMAN	Q	29	ENSP00000334834:L29Q	ENSP00000334834:L29Q	L	+	2	0	KRTAP13-4	30724550	0.987000	0.35691	0.987000	0.45799	0.173000	0.22820	1.149000	0.31626	0.900000	0.36469	-0.280000	0.10049	CTG	.	.		0.602	KRTAP13-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000128222.1		
TMPRSS2	7113	hgsc.bcm.edu	37	21	42845270	42845270	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr21:42845270G>A	ENST00000332149.5	-	9	1015	c.881C>T	c.(880-882)gCc>gTc	p.A294V	TMPRSS2_ENST00000398585.3_Missense_Mutation_p.A331V|TMPRSS2_ENST00000458356.1_Missense_Mutation_p.A294V	NM_005656.3	NP_005647.3	O15393	TMPS2_HUMAN	transmembrane protease, serine 2	294	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of viral entry into host cell (GO:0046598)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)		TMPRSS2/ETV1(34)|TMPRSS2/ETV5_ENST00000306376(5)|TMPRSS2/ERG(3582)|TMPRSS2/ETV4(13)	central_nervous_system(1)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	4		Prostate(19;4.48e-07)|all_epithelial(19;0.031)				GCAGTGGGCGGCTGTCACGAT	0.692			T	"""ERG, ETV1, ETV4, ETV5"""	prostate																																p.A331V		Atlas-SNP	.		Dom	yes		21	21q22.3	7113	"""transmembrane protease, serine 2"""		E	.	TMPRSS2	148	.	0			c.C992T						.						17.0	16.0	16.0					21																	42845270		2177	4277	6454	SO:0001583	missense	7113	exon9			TGGGCGGCTGTCA	U75329	CCDS33564.1, CCDS54486.1	21q22.3	2010-04-13			ENSG00000184012	ENSG00000184012		"""Serine peptidases / Transmembrane"""	11876	protein-coding gene	gene with protein product		602060				9325052	Standard	NM_005656		Approved	PRSS10	uc010gor.3	O15393	OTTHUMG00000086762	ENST00000332149.5:c.881C>T	chr21.hg19:g.42845270G>A	ENSP00000330330:p.Ala294Val	108.0	0.0		115.0	36.0	NM_001135099	A8K6Z8|B2R8E5|B7Z459|D3DSJ2|F8WES1|Q6GTK7|Q9BXX1	Missense_Mutation	SNP	ENST00000332149.5	hg19	CCDS33564.1	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436731	0.62955	.	.	ENSG00000184012	ENST00000332149;ENST00000398585;ENST00000458356;ENST00000454499	D;D;D;D	0.95238	-3.65;-3.65;-3.65;-3.65	5.31	5.31	0.75309	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.64402	D	0.000002	D	0.97445	0.9164	M	0.86953	2.85	0.51482	D	0.999928	D;D	0.76494	0.999;0.997	D;D	0.79108	0.992;0.992	D	0.97805	1.0247	10	0.56958	D	0.05	.	16.4733	0.84124	0.0:0.0:1.0:0.0	.	331;294	F8WES1;O15393	.;TMPS2_HUMAN	V	294;331;294;294	ENSP00000330330:A294V;ENSP00000381588:A331V;ENSP00000391216:A294V;ENSP00000389006:A294V	ENSP00000330330:A294V	A	-	2	0	TMPRSS2	41767140	1.000000	0.71417	0.296000	0.24974	0.126000	0.20510	7.106000	0.77039	2.476000	0.83614	0.650000	0.86243	GCC	.	.		0.692	TMPRSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000195189.1		
COL6A2	1292	hgsc.bcm.edu	37	21	47535813	47535813	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr21:47535813G>A	ENST00000300527.4	+	6	933	c.829G>A	c.(829-831)Gga>Aga	p.G277R	COL6A2_ENST00000397763.1_Missense_Mutation_p.G277R|COL6A2_ENST00000310645.5_Missense_Mutation_p.G277R|COL6A2_ENST00000357838.4_Missense_Mutation_p.G277R|COL6A2_ENST00000409416.1_Missense_Mutation_p.G277R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	277	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGTGAGCCGGGAGAGCCTGG	0.657																																					p.G277R		Atlas-SNP	.											.	COL6A2	351	.	0			c.G829A						.						63.0	56.0	59.0					21																	47535813		2201	4299	6500	SO:0001583	missense	1292	exon6			GAGCCGGGAGAGC	M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.829G>A	chr21.hg19:g.47535813G>A	ENSP00000300527:p.Gly277Arg	68.0	0.0		79.0	20.0	NM_058175	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	ENST00000300527.4	hg19	CCDS13728.1	.	.	.	.	.	.	.	.	.	.	G	16.22	3.062627	0.55432	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.99353	-5.77;-5.77;-5.77;-5.77;-5.77	3.98	3.98	0.46160	.	0.060364	0.64402	D	0.000003	D	0.99603	0.9856	H	0.96048	3.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.995;0.998;0.967	D	0.97535	1.0082	10	0.87932	D	0	-1.4171	16.5135	0.84293	0.0:0.0:1.0:0.0	.	277;277;277	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	R	277	ENSP00000300527:G277R;ENSP00000350497:G277R;ENSP00000312529:G277R;ENSP00000387115:G277R;ENSP00000380870:G277R	ENSP00000300527:G277R	G	+	1	0	COL6A2	46360241	1.000000	0.71417	0.956000	0.39512	0.758000	0.43043	5.682000	0.68182	1.956000	0.56807	0.555000	0.69702	GGA	.	.		0.657	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206971.1		
SPECC1L	23384	hgsc.bcm.edu	37	22	24807640	24807640	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr22:24807640A>T	ENST00000314328.9	+	15	3457	c.3172A>T	c.(3172-3174)Att>Ttt	p.I1058F	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|SPECC1L_ENST00000437398.1_Missense_Mutation_p.I1058F|SPECC1L_ENST00000541492.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	1058	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.				actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CCCTGCCCACATTCCATATCA	0.532																																					p.I1058F		Atlas-SNP	.											.	SPECC1L	85	.	0			c.A3172T						.						115.0	98.0	103.0					22																	24807640		2203	4300	6503	SO:0001583	missense	23384	exon14			GCCCACATTCCAT	AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.3172A>T	chr22.hg19:g.24807640A>T	ENSP00000325785:p.Ile1058Phe	66.0	0.0		60.0	19.0	NM_001145468	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	ENST00000314328.9	hg19	CCDS33619.1	.	.	.	.	.	.	.	.	.	.	A	25.3	4.629030	0.87560	.	.	ENSG00000100014	ENST00000437398;ENST00000314328	D;D	0.95656	-3.77;-3.77	5.84	5.84	0.93424	Calponin homology domain (5);	0.000000	0.85682	D	0.000000	D	0.96346	0.8808	L	0.42008	1.315	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95740	0.8782	10	0.35671	T	0.21	-22.215	15.3856	0.74699	1.0:0.0:0.0:0.0	.	1058	Q69YQ0	CYTSA_HUMAN	F	1058	ENSP00000393363:I1058F;ENSP00000325785:I1058F	ENSP00000325785:I1058F	I	+	1	0	SPECC1L	23137640	1.000000	0.71417	0.998000	0.56505	0.760000	0.43138	8.631000	0.90991	2.234000	0.73211	0.459000	0.35465	ATT	.	.		0.532	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000319986.2	NM_015330	
ADRBK2	157	hgsc.bcm.edu	37	22	26083502	26083502	+	Splice_Site	SNP	A	A	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr22:26083502A>C	ENST00000324198.6	+	11	1018		c.e11-1			NM_005160.3	NP_005151.2	P35626	ARBK2_HUMAN	adrenergic, beta, receptor kinase 2						receptor internalization (GO:0031623)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)		ATP binding (GO:0005524)|beta-adrenergic receptor kinase activity (GO:0047696)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|skin(3)|stomach(2)	32					Adenosine triphosphate(DB00171)	ATCTGATTCCAGGGGGCGATT	0.403																																					.		Atlas-SNP	.											.	ADRBK2	78	.	0			c.827-2A>C						.						106.0	89.0	95.0					22																	26083502		2203	4300	6503	SO:0001630	splice_region_variant	157	exon11			GATTCCAGGGGGC	X69117	CCDS13832.1	22q11	2013-01-10			ENSG00000100077	ENSG00000100077		"""Pleckstrin homology (PH) domain containing"""	290	protein-coding gene	gene with protein product		109636				7695743	Standard	NM_005160		Approved	GRK3, BARK2	uc003abx.4	P35626	OTTHUMG00000150280	ENST00000324198.6:c.827-1A>C	chr22.hg19:g.26083502A>C		68.0	0.0		75.0	22.0	NM_005160	Q9UGW9	Splice_Site	SNP	ENST00000324198.6	hg19	CCDS13832.1	.	.	.	.	.	.	.	.	.	.	A	11.68	1.710931	0.30322	.	.	ENSG00000100077	ENST00000324198;ENST00000545323	.	.	.	4.71	4.71	0.59529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8081	0.63246	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ADRBK2	24413502	1.000000	0.71417	0.999000	0.59377	0.110000	0.19582	8.100000	0.89544	2.105000	0.64084	0.528000	0.53228	.	.	.		0.403	ADRBK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317296.4	NM_005160	Intron
RPGR	6103	hgsc.bcm.edu	37	X	38182690	38182690	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:38182690T>C	ENST00000339363.3	-	2	283	c.116A>G	c.(115-117)cAt>cGt	p.H39R	RPGR_ENST00000318842.7_Missense_Mutation_p.H39R|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Missense_Mutation_p.H39R|RPGR_ENST00000338898.3_Missense_Mutation_p.H39R|RPGR_ENST00000378505.2_Missense_Mutation_p.H39R|RPGR_ENST00000342811.3_Missense_Mutation_p.H39R			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	39					cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ACATGAAAGATGTACAGGGAC	0.323																																					p.H39R		Atlas-SNP	.											.	RPGR	175	.	0			c.A116G						.						52.0	46.0	48.0					X																	38182690		2201	4298	6499	SO:0001583	missense	6103	exon2			GAAAGATGTACAG	U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.116A>G	chrX.hg19:g.38182690T>C	ENSP00000343671:p.His39Arg	769.0	0.0		551.0	245.0	NM_001034853	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	ENST00000339363.3	hg19		.	.	.	.	.	.	.	.	.	.	T	3.418	-0.118851	0.06838	.	.	ENSG00000156313	ENST00000339363;ENST00000309513;ENST00000338898;ENST00000318842;ENST00000342811;ENST00000378505	T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	5.6	-6.54	0.01860	.	1.355820	0.04617	U	0.401283	T	0.59404	0.2191	N	0.17872	0.535	0.09310	N	1	B;B	0.16603	0.018;0.01	B;B	0.19148	0.024;0.018	T	0.45071	-0.9286	10	0.23302	T	0.38	.	0.8369	0.01142	0.2216:0.305:0.2236:0.2498	.	39;39	E9PE28;Q92834-2	.;.	R	39	ENSP00000343671:H39R;ENSP00000308783:H39R;ENSP00000340208:H39R;ENSP00000322219:H39R;ENSP00000339531:H39R;ENSP00000367766:H39R	ENSP00000308783:H39R	H	-	2	0	RPGR	38067634	0.000000	0.05858	0.000000	0.03702	0.214000	0.24535	-0.145000	0.10265	-1.885000	0.01118	0.417000	0.27973	CAT	.	.		0.323	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	protein_coding		NM_000328	
KCND1	3750	hgsc.bcm.edu	37	X	48826085	48826085	+	Silent	SNP	C	C	T			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:48826085C>T	ENST00000218176.3	-	1	1891	c.594G>A	c.(592-594)gtG>gtA	p.V198V	KCND1_ENST00000376477.1_5'Flank	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	198					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	CGATGACCGACACGGCGATGA	0.632																																					p.V198V		Atlas-SNP	.											.	KCND1	63	.	0			c.G594A						.						18.0	16.0	17.0					X																	48826085		2199	4298	6497	SO:0001819	synonymous_variant	3750	exon1			GACCGACACGGCG	AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.594G>A	chrX.hg19:g.48826085C>T		127.0	0.0		107.0	41.0	NM_004979	A6NEF1|B2RCG0|O75671	Silent	SNP	ENST00000218176.3	hg19	CCDS14314.1																																																																																			.	.		0.632	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000060774.1	NM_004979	
ARHGEF9	23229	hgsc.bcm.edu	37	X	62926291	62926291	+	Silent	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:62926291G>A	ENST00000253401.6	-	3	1028	c.228C>T	c.(226-228)ccC>ccT	p.P76P	ARHGEF9_ENST00000374872.1_Silent_p.P55P|ARHGEF9_ENST00000437457.2_Silent_p.P23P|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374878.1_Silent_p.P74P|ARHGEF9_ENST00000374870.4_5'UTR	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	76					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						GCACATCGCTGGGCCCCTCCT	0.557																																					p.P76P		Atlas-SNP	.											.	ARHGEF9	117	.	0			c.C228T						.						69.0	51.0	57.0					X																	62926291		2203	4300	6503	SO:0001819	synonymous_variant	23229	exon3			ATCGCTGGGCCCC	AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.228C>T	chrX.hg19:g.62926291G>A		65.0	0.0		39.0	14.0	NM_015185	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Silent	SNP	ENST00000253401.6	hg19	CCDS35315.1																																																																																			.	.		0.557	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000056937.1		
AWAT2	158835	hgsc.bcm.edu	37	X	69269752	69269752	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:69269752T>A	ENST00000276101.3	-	1	36	c.31A>T	c.(31-33)Act>Tct	p.T11S		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	11					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						TCCAGGGCAGTCTTGAGGTCC	0.552																																					p.T11S	NSCLC(80;1334 1436 9350 24214 26427)	Atlas-SNP	.											.	AWAT2	36	.	0			c.A31T						.						146.0	103.0	118.0					X																	69269752		2203	4300	6503	SO:0001583	missense	158835	exon1			GGGCAGTCTTGAG	BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.31A>T	chrX.hg19:g.69269752T>A	ENSP00000421172:p.Thr11Ser	405.0	0.0		358.0	130.0	NM_001002254	Q6IEE3|Q6P437	Missense_Mutation	SNP	ENST00000276101.3	hg19	CCDS35320.1	.	.	.	.	.	.	.	.	.	.	T	0.065	-1.214724	0.01555	.	.	ENSG00000147160	ENST00000276101	T	0.11277	2.79	4.0	1.6	0.23607	.	0.752361	0.11823	N	0.525975	T	0.05135	0.0137	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.09377	0.004	T	0.38134	-0.9675	10	0.51188	T	0.08	.	4.9677	0.14098	0.0:0.2646:0.0:0.7354	.	11	Q6E213	AWAT2_HUMAN	S	11	ENSP00000421172:T11S	ENSP00000421172:T11S	T	-	1	0	AWAT2	69186477	0.175000	0.23083	0.023000	0.16930	0.094000	0.18550	0.110000	0.15437	0.128000	0.18479	0.356000	0.21956	ACT	.	.		0.552	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000358738.1	NM_001002254	
ZMAT1	84460	hgsc.bcm.edu	37	X	101139286	101139286	+	Silent	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:101139286T>A	ENST00000372782.3	-	7	1160	c.1113A>T	c.(1111-1113)tcA>tcT	p.S371S	ZMAT1_ENST00000458570.1_Silent_p.S200S|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000540921.1_Silent_p.S371S	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	371						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						TTTCCACTGGTGAAATATGGT	0.423																																					p.S371S		Atlas-SNP	.											.	ZMAT1	143	.	0			c.A1113T						.						178.0	160.0	166.0					X																	101139286		2203	4300	6503	SO:0001819	synonymous_variant	84460	exon7			CACTGGTGAAATA	Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.1113A>T	chrX.hg19:g.101139286T>A		176.0	0.0		145.0	52.0	NM_001011657	Q8NDS3|Q96JN6	Silent	SNP	ENST00000372782.3	hg19	CCDS35348.1																																																																																			.	.		0.423	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000057598.1		
COL4A5	1287	hgsc.bcm.edu	37	X	107867495	107867495	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:107867495T>A	ENST00000361603.2	+	34	3191	c.2947T>A	c.(2947-2949)Tat>Aat	p.Y983N	COL4A5_ENST00000328300.6_Missense_Mutation_p.Y983N	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	983	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						GCCAAAAGGTTATCAGGGTTT	0.458									Alport syndrome with Diffuse Leiomyomatosis																												p.Y983N		Atlas-SNP	.											.	COL4A5	262	.	0			c.T2947A						.						104.0	82.0	89.0					X																	107867495		2203	4300	6503	SO:0001583	missense	1287	exon34	Familial Cancer Database		AAAGGTTATCAGG	M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.2947T>A	chrX.hg19:g.107867495T>A	ENSP00000354505:p.Tyr983Asn	156.0	0.0		110.0	34.0	NM_000495	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	ENST00000361603.2	hg19	CCDS14543.1	.	.	.	.	.	.	.	.	.	.	T	11.62	1.692822	0.30052	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.89810	-2.57;-2.57	5.5	1.71	0.24356	.	0.657110	0.15722	N	0.247857	T	0.70692	0.3253	N	0.02916	-0.46	0.09310	N	1	B;B;B	0.24043	0.095;0.096;0.095	B;B;B	0.28465	0.062;0.09;0.062	T	0.59606	-0.7423	10	0.20519	T	0.43	.	5.2906	0.15725	0.0:0.1513:0.2744:0.5744	.	983;591;983	E7EVY4;Q49AM6;P29400	.;.;CO4A5_HUMAN	N	983	ENSP00000331902:Y983N;ENSP00000354505:Y983N	ENSP00000331902:Y983N	Y	+	1	0	COL4A5	107754151	0.960000	0.32886	0.833000	0.33012	0.488000	0.33401	1.027000	0.30115	0.227000	0.20999	-0.496000	0.04628	TAT	.	.		0.458	COL4A5-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000057880.2		
AIFM1	9131	hgsc.bcm.edu	37	X	129289157	129289157	+	Intron	SNP	T	T	C			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrX:129289157T>C	ENST00000287295.3	-	2	480				AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Missense_Mutation_p.T71A|AIFM1_ENST00000535724.1_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	CCAGTGACTGTTGCTCCTACA	0.443																																					p.T71A		Atlas-SNP	.											.	AIFM1	75	.	0			c.A211G						.						154.0	143.0	147.0					X																	129289157		2203	4300	6503	SO:0001627	intron_variant	9131	exon2			TGACTGTTGCTCC	AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.249+1277A>G	chrX.hg19:g.129289157T>C		317.0	0.0		268.0	13.0	NM_145812	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	ENST00000287295.3	hg19	CCDS14618.1	.	.	.	.	.	.	.	.	.	.	T	6.223	0.409231	0.11812	.	.	ENSG00000156709	ENST00000319908	T	0.40225	1.04	4.42	2.03	0.26663	.	.	.	.	.	T	0.21347	0.0514	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07751	-1.0756	8	0.09338	T	0.73	.	7.9019	0.29740	0.0:0.2317:0.0:0.7683	.	71	O95831-3	.	A	71	ENSP00000315122:T71A	ENSP00000315122:T71A	T	-	1	0	AIFM1	129116838	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	0.523000	0.22925	0.204000	0.20548	0.417000	0.27973	ACA	.	.		0.443	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000058247.2		
MT-ND5	4540	hgsc.bcm.edu	37	M	13177	13177	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chrM:13177G>A	ENST00000361567.2	+	1	841	c.841G>A	c.(841-843)Ggc>Agc	p.G281S	MT-TH_ENST00000387441.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-TP_ENST00000387461.2_RNA|MT-TR_ENST00000387439.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	281					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CACTATGCTTAGGCGCTATCA	0.448																																					p.G281S		Atlas-SNP	.											.	.	.	.	0			c.G841A						.																																			SO:0001583	missense	0	exon1			TGCTTAGGCGCTA			mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.841G>A	chrM.hg19:g.13177G>A	ENSP00000354813:p.Gly281Ser	10.0	0.0		50.0	47.0	ENST00000361567	Q34773|Q8WCY3	Missense_Mutation	SNP	ENST00000361567.2	hg19																																																																																				.	.		0.448	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		YP_003024036	
SYTL3	94120	hgsc.bcm.edu	37	6	159139125	159139125	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr6:159139125delC	ENST00000297239.9	+	9	796	c.602delC	c.(601-603)tccfs	p.S201fs	SYTL3_ENST00000360448.3_Intron|SYTL3_ENST00000367081.3_Intron			Q4VX76	SYTL3_HUMAN	synaptotagmin-like 3	201					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	calcium-dependent phospholipid binding (GO:0005544)			endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|urinary_tract(1)	20		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.54e-17)|BRCA - Breast invasive adenocarcinoma(81;8.24e-06)		TTAGAGCTCTCCAAATCCCAG	0.542																																					p.S201fs		Atlas-INDEL	.											.	SYTL3	49	.	0			c.601delT						.																																			SO:0001589	frameshift_variant	94120	exon11			.	AK055750	CCDS34563.1, CCDS56458.1	6q25.3	2008-07-04			ENSG00000164674	ENSG00000164674			15587	protein-coding gene	gene with protein product						11773082	Standard	NM_001242384		Approved	SLP3, exophilin-6	uc003qrp.3	Q4VX76	OTTHUMG00000015916	ENST00000297239.9:c.602delC	chr6.hg19:g.159139125delC	ENSP00000297239:p.Ser201fs	62.0	0.0		89.0	19.0	NM_001242384	Q496J4|Q496J6|Q5U3B9	Frame_Shift_Del	DEL	ENST00000297239.9	hg19	CCDS56458.1																																																																																			.	.		0.542	SYTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042876.1		
BTAF1	9044	hgsc.bcm.edu	37	10	93699802	93699802	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:93699802delC	ENST00000265990.6	+	3	540	c.232delC	c.(232-234)ccafs	p.P78fs		NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	78					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				TGAGTGGAATCCAGTGCCGAG	0.353																																					p.N77fs		Atlas-INDEL	.											.	BTAF1	148	.	0			c.231delT						.						64.0	65.0	65.0					10																	93699802		2203	4300	6503	SO:0001589	frameshift_variant	9044	exon3			.	AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.232delC	chr10.hg19:g.93699802delC	ENSP00000265990:p.Pro78fs	162.0	0.0		202.0	57.0	NM_003972	B4E0W6|O43578	Frame_Shift_Del	DEL	ENST00000265990.6	hg19	CCDS7419.1																																																																																			.	.		0.353	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000049380.4	NM_003972	
FFAR4	338557	hgsc.bcm.edu	37	10	95338925	95338931	+	Frame_Shift_Del	DEL	CACCTCC	CACCTCC	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	CACCTCC	CACCTCC	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr10:95338925_95338931delCACCTCC	ENST00000371483.4	+	3	762_768	c.706_712delCACCTCC	c.(706-714)cacctcctgfs	p.HLL236fs	FFAR4_ENST00000371481.4_Intron|FFAR4_ENST00000604414.1_Intron	NM_181745.3	NP_859529.2	Q5NUL3	FFAR4_HUMAN	free fatty acid receptor 4	236					hormone secretion (GO:0046879)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of inflammatory response (GO:0050728)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of glucose transport (GO:0010827)	endocytic vesicle (GO:0030139)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	fatty acid binding (GO:0005504)|taste receptor activity (GO:0008527)										GACCTCGGAACACCTCCTGGATGCAAG	0.483																																					p.235_237del		Atlas-INDEL	.											.	.	.	.	0			c.705_711del						.																																			SO:0001589	frameshift_variant	338557	exon3			.		CCDS31248.1, CCDS55720.1	10q23.33	2012-11-16	2012-11-16	2012-11-16	ENSG00000186188	ENSG00000186188		"""GPCR / Class A : Fatty acid receptors"""	19061	protein-coding gene	gene with protein product		609044	"""G protein-coupled receptor 129"", ""G protein-coupled receptor 120"", ""omega-3 fatty acid receptor 1"""	GPR129, GPR120, O3FAR1		20471368, 19723586, 15619630, 20813258	Standard	NM_181745		Approved	PGR4	uc010qnt.2	Q5NUL3	OTTHUMG00000034409	ENST00000371483.4:c.706_712delCACCTCC	chr10.hg19:g.95338925_95338931delCACCTCC	ENSP00000360538:p.His236fs	76.0	0.0		79.0	16.0	NM_181745	Q495H1|Q5VY25|Q5VY26|Q7Z605|Q86SM7	Frame_Shift_Del	DEL	ENST00000371483.4	hg19	CCDS31248.1																																																																																			.	.		0.483	FFAR4-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000083179.1	NM_181745	
KIAA2018	205717	hgsc.bcm.edu	37	3	113379342	113379342	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:113379342delT	ENST00000478658.1	-	5	1204	c.1187delA	c.(1186-1188)aatfs	p.N396fs	KIAA2018_ENST00000316407.4_Frame_Shift_Del_p.N396fs|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	396						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AGTCCAACCATTGTCCAAAGG	0.443																																					p.N396fs		Atlas-INDEL	.											.	KIAA2018	180	.	0			c.1188delT						.						90.0	84.0	86.0					3																	113379342		1925	4116	6041	SO:0001589	frameshift_variant	205717	exon7			.	AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.1187delA	chr3.hg19:g.113379342delT	ENSP00000420721:p.Asn396fs	55.0	0.0		61.0	19.0	NM_001009899	Q7Z3L9|Q8IVF3|Q9H8T4	Frame_Shift_Del	DEL	ENST00000478658.1	hg19	CCDS43133.1																																																																																			.	.		0.443	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000354591.1	NM_001009899	
CC2D2A	57545	hgsc.bcm.edu	37	4	15529075	15529075	+	Frame_Shift_Del	DEL	A	A	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr4:15529075delA	ENST00000503292.1	+	13	1335	c.1155delA	c.(1153-1155)gtafs	p.V385fs	CC2D2A_ENST00000389652.5_Frame_Shift_Del_p.V336fs|CC2D2A_ENST00000424120.1_Frame_Shift_Del_p.V385fs|CC2D2A_ENST00000513811.1_3'UTR|CC2D2A_ENST00000413206.1_Frame_Shift_Del_p.V385fs	NM_001080522.2	NP_001073991.2	Q9P2K1	C2D2A_HUMAN	coiled-coil and C2 domain containing 2A	385					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	ciliary transition zone (GO:0035869)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|TCTN-B9D complex (GO:0036038)				NS(1)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|urinary_tract(2)	32						GGCAGGCTGTAAAATACGTTC	0.408																																					p.V385fs		Atlas-INDEL	.											.	CC2D2A	158	.	0			c.1154delT						.						73.0	71.0	72.0					4																	15529075		1892	4117	6009	SO:0001589	frameshift_variant	57545	exon13			.	AB037766, EU450799	CCDS47026.1, CCDS47027.1, CCDS47027.2, CCDS54744.1	4p15.33	2014-09-17	2007-10-19		ENSG00000048342	ENSG00000048342			29253	protein-coding gene	gene with protein product	"""Meckel syndrome, type 6"""	612013				10718198, 18513680	Standard	NM_001080522		Approved	KIAA1345, MKS6, JBTS9	uc010idv.2	Q9P2K1	OTTHUMG00000160255	ENST00000503292.1:c.1155delA	chr4.hg19:g.15529075delA	ENSP00000421809:p.Val385fs	50.0	0.0		58.0	11.0	NM_001080522	A6ND97|B3FW08|D6RB72|E7EP21|E9PEV5|Q3SYP3|Q9H8A7	Frame_Shift_Del	DEL	ENST00000503292.1	hg19	CCDS47026.1																																																																																			.	.		0.408	CC2D2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359906.2	NM_001080522	
ROBO1	6091	hgsc.bcm.edu	37	3	78649366	78649366	+	Frame_Shift_Del	DEL	C	C	-			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:78649366delC	ENST00000464233.1	-	30	4951	c.4838delG	c.(4837-4839)ggafs	p.G1613fs	ROBO1_ENST00000436010.2_Frame_Shift_Del_p.G1574fs|ROBO1_ENST00000466906.1_5'UTR|ROBO1_ENST00000467549.1_Frame_Shift_Del_p.G1513fs|ROBO1_ENST00000495273.1_Frame_Shift_Del_p.G1568fs	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1613					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTGTCTGCTTCCTGATCCTCT	0.378																																					p.G1613fs		Atlas-INDEL	.											.	ROBO1	833	.	0			c.4839delA						.						176.0	162.0	166.0					3																	78649366		1888	4105	5993	SO:0001589	frameshift_variant	6091	exon30			.	AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4838delG	chr3.hg19:g.78649366delC	ENSP00000420321:p.Gly1613fs	188.0	0.0		228.0	56.0	NM_002941	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Frame_Shift_Del	DEL	ENST00000464233.1	hg19	CCDS54611.1																																																																																			.	.		0.378	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000352610.1	NM_002941	
KRTAP4-5	85289	hgsc.bcm.edu	37	17	39305778	39305779	+	In_Frame_Ins	INS	-	-	AGCAGCTGGGGCGGC			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr17:39305778_39305779insAGCAGCTGGGGCGGC	ENST00000343246.4	-	1	275_276	c.241_242insGCCGCCCCAGCTGCT	c.(241-243)tgc>tGCCGCCCCAGCTGCTgc	p.81_81C>CRPSCC		NM_033188.3	NP_149445.3	Q9BYR2	KRA45_HUMAN	keratin associated protein 4-5	81	26 X 5 AA repeats of C-C-[GRQVCHIEK]- [SPTR]-[VSTQYC].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(4)	6		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			ggtggtctggcagcagcagggg	0.653																																					p.C81delinsCRPSCC		Atlas-INDEL	.											.	KRTAP4-5	34	.	0			c.242_243insGCCGCCCCAGCTGCT						.																																			SO:0001652	inframe_insertion	85289	exon1			.	AJ406937	CCDS32650.1	17q21.2	2013-06-25			ENSG00000198271	ENSG00000198271		"""Keratin associated proteins"""	18899	protein-coding gene	gene with protein product						11279113	Standard	NM_033188		Approved	KAP4.5	uc002hwb.3	Q9BYR2	OTTHUMG00000133638	ENST00000343246.4:c.241_242insGCCGCCCCAGCTGCT	chr17.hg19:g.39305778_39305779insAGCAGCTGGGGCGGC	Exception_encountered	45.0	0.0		61.0	37.0	NM_033188		In_Frame_Ins	INS	ENST00000343246.4	hg19	CCDS32650.1																																																																																			.	.		0.653	KRTAP4-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000257783.1		
CENPF	1063	hgsc.bcm.edu	37	1	214815369	214815370	+	Frame_Shift_Del	DEL	GA	GA	-	rs199690817		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	GA	GA	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:214815369_214815370delGA	ENST00000366955.3	+	12	3856_3857	c.3688_3689delGA	c.(3688-3690)gagfs	p.E1230fs		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AAGTGAGAAGGAGAAGGAGTGC	0.371																																					p.1229_1230del	Colon(80;575 1284 11000 14801 43496)	Atlas-INDEL	.											.	CENPF	321	.	0			c.3687_3688del						.																																			SO:0001589	frameshift_variant	1063	exon12			.	U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3688_3689delGA	chr1.hg19:g.214815371_214815372delGA	ENSP00000355922:p.Glu1230fs	372.0	0.0		797.0	369.0	NM_016343	Q13171|Q13246|Q5VVM7	Frame_Shift_Del	DEL	ENST00000366955.3	hg19	CCDS31023.1																																																																																			.	.		0.371	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000089749.1	NM_016343	
NME6	10201	hgsc.bcm.edu	37	3	48336594	48336595	+	Frame_Shift_Del	DEL	GT	GT	-	rs368964694		TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	GT	GT	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr3:48336594_48336595delGT	ENST00000452211.1	-	6	601_602	c.364_365delAC	c.(364-366)actfs	p.T122fs	NME6_ENST00000435684.1_Frame_Shift_Del_p.L109fs|NME6_ENST00000450160.1_Frame_Shift_Del_p.L109fs|NME6_ENST00000415644.1_Intron|NME6_ENST00000442597.1_Frame_Shift_Del_p.T122fs|NME6_ENST00000421967.1_Frame_Shift_Del_p.T130fs|NME6_ENST00000447314.1_Frame_Shift_Del_p.T77fs|ZNF589_ENST00000412564.1_Intron|NME6_ENST00000426689.2_Frame_Shift_Del_p.T122fs|NME6_ENST00000444069.1_5'UTR|NME6_ENST00000415053.1_Frame_Shift_Del_p.T122fs|NME6_ENST00000451657.1_Frame_Shift_Del_p.L109fs|NME6_ENST00000426723.1_Intron			O75414	NDK6_HUMAN	NME/NM23 nucleoside diphosphate kinase 6	122					apoptotic process (GO:0006915)|CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|negative regulation of cell growth (GO:0030308)|negative regulation of mitosis (GO:0045839)|UTP biosynthetic process (GO:0006228)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			breast(1)|large_intestine(5)	6				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(197;0.00544)|Kidney(197;0.00609)		GCGGGTGTCAGTGAGGCCGAAA	0.589																																					p.130_130del		Atlas-INDEL	.											.	NME6	14	.	0			c.389_390del						.																																			SO:0001589	frameshift_variant	10201	exon5			.	AF051941	CCDS2763.1	3p21.31	2012-05-18	2012-05-18		ENSG00000172113	ENSG00000172113			20567	protein-coding gene	gene with protein product		608294	"""non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)"""			10453732, 19852809	Standard	NM_005793		Approved	NM23-H6, IPIA-ALPHA	uc003cso.3	O75414	OTTHUMG00000133531	ENST00000452211.1:c.364_365delAC	chr3.hg19:g.48336594_48336595delGT	ENSP00000392352:p.Thr122fs	114.0	0.0		107.0	35.0	NM_005793	B4DGW7|B4DM99|Q53HM5|Q96E73|Q9BQ63	Frame_Shift_Del	DEL	ENST00000452211.1	hg19																																																																																				.	.		0.589	NME6-005	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_candidate	protein_coding	protein_coding	OTTHUMT00000346107.1	NM_005793	
FMO3	2328	hgsc.bcm.edu	37	1	171061808	171061809	+	Frame_Shift_Ins	INS	-	-	A			TCGA-DD-AACT-01A-11D-A40R-10	TCGA-DD-AACT-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	9f7c9ce7-623f-4bd3-be0d-2c55d8e86fcf	52619546-0765-495f-b30e-c05fc98e8c92	g.chr1:171061808_171061809insA	ENST00000367755.4	+	2	120_121	c.9_10insA	c.(10-12)aaafs	p.K4fs	FMO3_ENST00000392085.2_Frame_Shift_Ins_p.K4fs|FMO3_ENST00000542847.1_5'UTR|FMO3_ENST00000534514.1_3'UTR|FMO3_ENST00000538429.1_Frame_Shift_Ins_p.K4fs	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	4					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CCATGGGGAAGAAAGTGGCCAT	0.455																																					p.K3fs		Atlas-INDEL	.											.	FMO3	73	.	0			c.9_10insA						.																																			SO:0001589	frameshift_variant	2328	exon2			.	BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.12dupA	chr1.hg19:g.171061811_171061811dupA	ENSP00000356729:p.Lys4fs	124.0	0.0		231.0	17.0	NM_001002294	B2R816|Q14854|Q8N5N5	Frame_Shift_Ins	INS	ENST00000367755.4	hg19	CCDS1292.1																																																																																			.	.		0.455	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000086219.1	NM_006894	
