#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_AAChange	i_ACHILLES_Lineage_Results_Top_Genes	i_Algorithm	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_Codon	i_COSMIC_Gene	i_COSMIC_Gene_Freq	i_COSMIC_Site_Freq	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ChromChange	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_Drug_Target	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Exon	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_Genome_Plus_Minus_10_Bp	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_NTotCov	i_NVarCov	i_ORegAnno_bin	i_TTotCov	i_TVarCov	i_Transcript_Id	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_annotation_transcript	i_build	i_ccds_id	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_dbSNPPopFreq	i_dbSNP_AF	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_type	i_havana_transcript	i_refseq_mrna_id	i_secondary_variant_classification
VPS13D	55187	hgsc.bcm.edu	37	1	12368658	12368658	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:12368658C>T	ENST00000358136.3	+	27	6740	c.6610C>T	c.(6610-6612)Cct>Tct	p.P2204S	VPS13D_ENST00000356315.4_Missense_Mutation_p.P2204S	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		CTTAACCGAGCCTTGTAGGCT	0.468																																					p.P2204S		Atlas-SNP	.											.	VPS13D	316	.	0			c.C6610T						.						143.0	140.0	141.0					1																	12368658		2203	4300	6503	SO:0001583	missense	55187	exon27			ACCGAGCCTTGTA	AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.6610C>T	chr1.hg19:g.12368658C>T	ENSP00000350854:p.Pro2204Ser	134.0	0.0		218.0	107.0	NM_015378		Missense_Mutation	SNP	ENST00000358136.3	hg19	CCDS30588.1	.	.	.	.	.	.	.	.	.	.	C	15.86	2.958659	0.53400	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.38887	1.11;1.11	5.61	5.61	0.85477	.	0.114530	0.56097	D	0.000040	T	0.28034	0.0691	N	0.16368	0.405	0.80722	D	1	B;B	0.15719	0.014;0.008	B;B	0.17433	0.018;0.008	T	0.08391	-1.0724	9	.	.	.	.	14.4763	0.67548	0.147:0.853:0.0:0.0	.	2204;2204	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	S	2204	ENSP00000348666:P2204S;ENSP00000350854:P2204S	.	P	+	1	0	VPS13D	12291245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.298000	0.51818	2.636000	0.89361	0.650000	0.86243	CCT	.	.		0.468	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000036897.2	NM_015378	
SLC9A1	6548	hgsc.bcm.edu	37	1	27434282	27434282	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:27434282T>C	ENST00000263980.3	-	4	1714	c.1139A>G	c.(1138-1140)aAa>aGa	p.K380R	SLC9A1_ENST00000374086.3_Missense_Mutation_p.K380R|SLC9A1_ENST00000545949.1_Missense_Mutation_p.K41R	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	380					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CAGGAAGTATTTGATGGTGGT	0.592																																					p.K380R		Atlas-SNP	.											.	SLC9A1	68	.	0			c.A1139G						.						94.0	74.0	81.0					1																	27434282		2202	4294	6496	SO:0001583	missense	6548	exon4			AAGTATTTGATGG	M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.1139A>G	chr1.hg19:g.27434282T>C	ENSP00000263980:p.Lys380Arg	78.0	0.0		103.0	53.0	NM_003047	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	ENST00000263980.3	hg19	CCDS295.1	.	.	.	.	.	.	.	.	.	.	T	20.8	4.045429	0.75846	.	.	ENSG00000090020	ENST00000263980;ENST00000545949;ENST00000374086	T;T;T	0.16196	2.36;2.36;2.36	5.6	5.6	0.85130	Cation/H+ exchanger (1);	0.042369	0.85682	D	0.000000	T	0.19327	0.0464	L	0.42245	1.32	0.80722	D	1	P;B	0.48089	0.905;0.136	B;B	0.43728	0.429;0.214	T	0.01432	-1.1356	10	0.31617	T	0.26	.	15.773	0.78187	0.0:0.0:0.0:1.0	.	380;380	P19634-2;P19634	.;SL9A1_HUMAN	R	380;41;380	ENSP00000263980:K380R;ENSP00000445520:K41R;ENSP00000363199:K380R	ENSP00000263980:K380R	K	-	2	0	SLC9A1	27306869	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	8.040000	0.89188	2.131000	0.65755	0.374000	0.22700	AAA	.	.		0.592	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000012336.2	NM_003047	
NTNG1	22854	hgsc.bcm.edu	37	1	107937924	107937924	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:107937924A>G	ENST00000370068.1	+	4	1882	c.1036A>G	c.(1036-1038)Atc>Gtc	p.I346V	NTNG1_ENST00000542803.1_Missense_Mutation_p.I346V|NTNG1_ENST00000370074.4_Missense_Mutation_p.I346V|NTNG1_ENST00000370067.1_Missense_Mutation_p.I346V|NTNG1_ENST00000370073.2_Missense_Mutation_p.I346V|NTNG1_ENST00000370070.2_Missense_Mutation_p.I346V|NTNG1_ENST00000370066.1_Missense_Mutation_p.I346V|NTNG1_ENST00000370071.2_Missense_Mutation_p.I346V|NTNG1_ENST00000370061.3_Missense_Mutation_p.I346V|NTNG1_ENST00000370072.3_Missense_Mutation_p.I346V|NTNG1_ENST00000370065.1_Missense_Mutation_p.I346V			Q9Y2I2	NTNG1_HUMAN	netrin G1	346	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CTATCTCCCCATCCCCAAAGG	0.463																																					p.I346V		Atlas-SNP	.											.	NTNG1	274	.	0			c.A1036G						.						154.0	153.0	154.0					1																	107937924		2203	4300	6503	SO:0001583	missense	22854	exon4			CTCCCCATCCCCA	AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1036A>G	chr1.hg19:g.107937924A>G	ENSP00000359085:p.Ile346Val	101.0	0.0		156.0	68.0	NM_014917	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	ENST00000370068.1	hg19	CCDS44180.1	.	.	.	.	.	.	.	.	.	.	A	14.65	2.598787	0.46318	.	.	ENSG00000162631	ENST00000370076;ENST00000370073;ENST00000370071;ENST00000542803;ENST00000370061;ENST00000370072;ENST00000370070;ENST00000535584;ENST00000370064;ENST00000370062;ENST00000370074;ENST00000370068;ENST00000294649;ENST00000370067;ENST00000370066;ENST00000370065	T;T;T;T;T;T;T;T;T;T;T	0.73047	0.88;-0.32;0.81;0.21;0.16;-0.45;-0.71;0.88;-0.47;-0.32;0.26	5.8	4.67	0.58626	EGF-like, laminin (2);	0.000000	0.64402	D	0.000008	T	0.49457	0.1558	M	0.63428	1.95	0.58432	D	0.999991	B;B;B;B;B	0.32031	0.352;0.212;0.04;0.039;0.044	B;B;B;B;B	0.32090	0.14;0.125;0.124;0.031;0.029	T	0.50931	-0.8769	10	0.13108	T	0.6	.	13.1587	0.59533	0.8665:0.1335:0.0:0.0	.	346;346;346;346;346	B4DKF0;Q9Y2I2;Q9Y2I2-4;Q9Y2I2-2;Q9Y2I2-1	.;NTNG1_HUMAN;.;.;.	V	346;346;346;346;346;346;346;346;107;107;346;346;346;346;346;346	ENSP00000359090:I346V;ENSP00000359088:I346V;ENSP00000440561:I346V;ENSP00000359078:I346V;ENSP00000359089:I346V;ENSP00000359087:I346V;ENSP00000359091:I346V;ENSP00000359085:I346V;ENSP00000359084:I346V;ENSP00000359083:I346V;ENSP00000359082:I346V	ENSP00000294649:I346V	I	+	1	0	NTNG1	107739447	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.070000	0.64376	1.014000	0.39417	0.528000	0.53228	ATC	.	.		0.463	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000030340.1	NM_014917	
TARS2	80222	hgsc.bcm.edu	37	1	150471453	150471453	+	Silent	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:150471453G>A	ENST00000369064.3	+	12	1516	c.1482G>A	c.(1480-1482)ctG>ctA	p.L494L	TARS2_ENST00000369054.2_Silent_p.L364L|TARS2_ENST00000438568.2_3'UTR|TARS2_ENST00000606933.1_Silent_p.L412L|TARS2_ENST00000463555.1_3'UTR	NM_025150.3	NP_079426.2	Q9BW92	SYTM_HUMAN	threonyl-tRNA synthetase 2, mitochondrial (putative)	494					gene expression (GO:0010467)|mitochondrial threonyl-tRNA aminoacylation (GO:0070159)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			cervix(1)|endometrium(4)|large_intestine(7)|lung(19)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	35	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.51e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)		L-Threonine(DB00156)	GCCTGGCACTGTCCACCCGGC	0.557																																					p.L494L		Atlas-SNP	.											.	TARS2	91	.	0			c.G1482A						.						116.0	102.0	106.0					1																	150471453		2203	4300	6503	SO:0001819	synonymous_variant	80222	exon12			GGCACTGTCCACC	BC007824	CCDS952.1, CCDS60251.1, CCDS60252.1	1q21.2	2012-10-26	2007-02-23	2007-02-23	ENSG00000143374	ENSG00000143374	6.1.1.3	"""Aminoacyl tRNA synthetases / Class II"""	30740	protein-coding gene	gene with protein product	"""threonine tRNA ligase 2, mitochondrial"""	612805	"""threonyl-tRNA synthetase-like 1"""	TARSL1			Standard	NM_001271895		Approved	FLJ12528	uc001euq.4	Q9BW92	OTTHUMG00000012809	ENST00000369064.3:c.1482G>A	chr1.hg19:g.150471453G>A		66.0	0.0		108.0	49.0	NM_025150	Q53GW7|Q96I50|Q9H9V2	Silent	SNP	ENST00000369064.3	hg19	CCDS952.1																																																																																			.	.		0.557	TARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000035847.1	NM_025150	
IL6R	3570	hgsc.bcm.edu	37	1	154422417	154422417	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:154422417A>G	ENST00000368485.3	+	8	1464	c.1027A>G	c.(1027-1029)Att>Gtt	p.I343V	IL6R_ENST00000344086.4_Missense_Mutation_p.I343V|IL6R_ENST00000507256.1_3'UTR	NM_000565.3	NP_000556.1	P08887	IL6RA_HUMAN	interleukin 6 receptor	343					acute-phase response (GO:0006953)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|endocrine pancreas development (GO:0031018)|extrinsic apoptotic signaling pathway (GO:0097191)|hepatic immune response (GO:0002384)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of interleukin-8 production (GO:0032717)|neutrophil mediated immunity (GO:0002446)|positive regulation of activation of Janus kinase activity (GO:0010536)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|response to cytokine (GO:0034097)	apical plasma membrane (GO:0016324)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)|plasma membrane (GO:0005886)	ciliary neurotrophic factor binding (GO:0070119)|cytokine receptor activity (GO:0004896)|enzyme binding (GO:0019899)|interleukin-6 binding (GO:0019981)|protein homodimerization activity (GO:0042803)		IL6R/ATP8B2(2)	breast(2)|large_intestine(1)|ovary(3)	6	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)		Tocilizumab(DB06273)	CGATGATAATATTCTCTTCAG	0.443																																					p.I343V		Atlas-SNP	.											.	IL6R	47	.	0			c.A1027G						.						128.0	128.0	128.0					1																	154422417		2203	4300	6503	SO:0001583	missense	3570	exon8			GATAATATTCTCT	X12830	CCDS1067.1, CCDS1068.1, CCDS72927.1	1q21	2013-01-11			ENSG00000160712	ENSG00000160712		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6019	protein-coding gene	gene with protein product		147880					Standard	NM_000565		Approved	CD126	uc001fez.2	P08887	OTTHUMG00000036073	ENST00000368485.3:c.1027A>G	chr1.hg19:g.154422417A>G	ENSP00000357470:p.Ile343Val	63.0	0.0		147.0	72.0	NM_000565	A8KAE8|B2R6V4|Q16202|Q53EQ7|Q5FWG2|Q5VZ23	Missense_Mutation	SNP	ENST00000368485.3	hg19	CCDS1067.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.722|6.722	0.501848|0.501848	0.12822|0.12822	.|.	.|.	ENSG00000160712|ENSG00000160712	ENST00000476006;ENST00000515190|ENST00000368485;ENST00000344086	.|T;T	.|0.18174	.|2.24;2.23	4.09|4.09	-0.854|-0.854	0.10705|0.10705	.|.	3.454680|3.454680	0.00817|0.00817	N|N	0.001545|0.001545	T|T	0.03959|0.03959	0.0111|0.0111	L|L	0.28274|0.28274	0.84|0.84	0.09310|0.09310	N|N	1|1	.|B;B	.|0.16166	.|0.016;0.013	.|B;B	.|0.16722	.|0.016;0.01	T|T	0.35500|0.35500	-0.9786|-0.9786	6|10	.|0.29301	.|T	.|0.29	3.4193|3.4193	7.3906|7.3906	0.26907|0.26907	0.4673:0.0:0.5327:0.0|0.4673:0.0:0.5327:0.0	.|.	.|343;343	.|P08887-2;P08887	.|.;IL6RA_HUMAN	M|V	281;145|343	.|ENSP00000357470:I343V;ENSP00000340589:I343V	.|ENSP00000340589:I343V	I|I	+|+	3|1	3|0	IL6R|IL6R	152689041|152689041	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.004000|0.004000	0.04260|0.04260	-0.568000|-0.568000	0.05909|0.05909	-0.150000|-0.150000	0.11195|0.11195	-0.371000|-0.371000	0.07208|0.07208	ATA|ATT	.	.		0.443	IL6R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000087911.1	NM_000565	
OR10Z1	128368	hgsc.bcm.edu	37	1	158576368	158576368	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:158576368T>C	ENST00000361284.1	+	1	140	c.140T>C	c.(139-141)aTa>aCa	p.I47T		NM_001004478.1	NP_001004478.1	Q8NGY1	O10Z1_HUMAN	olfactory receptor, family 10, subfamily Z, member 1	47						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(6)|lung(21)|pancreas(1)|prostate(3)|skin(4)	37	all_hematologic(112;0.0378)					TTCATTATCATAGCCATCAGG	0.498																																					p.I47T		Atlas-SNP	.											.	OR10Z1	99	.	0			c.T140C						.						244.0	232.0	236.0					1																	158576368		2203	4300	6503	SO:0001583	missense	128368	exon1			TTATCATAGCCAT	AB065635	CCDS30901.1	1q23.1	2012-08-23			ENSG00000198967	ENSG00000198967		"""GPCR / Class A : Olfactory receptors"""	14996	protein-coding gene	gene with protein product							Standard	NM_001004478		Approved		uc010pio.2	Q8NGY1	OTTHUMG00000019637	ENST00000361284.1:c.140T>C	chr1.hg19:g.158576368T>C	ENSP00000354707:p.Ile47Thr	97.0	0.0		163.0	66.0	NM_001004478	Q5VYL0|Q6IFR7	Missense_Mutation	SNP	ENST00000361284.1	hg19	CCDS30901.1	.	.	.	.	.	.	.	.	.	.	T	0.001	-3.139622	0.00030	.	.	ENSG00000198967	ENST00000361284	T	0.01139	5.28	5.36	3.05	0.35203	GPCR, rhodopsin-like superfamily (1);	0.662303	0.12484	N	0.464829	T	0.00144	0.0004	N	0.00808	-1.17	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.19516	-1.0303	10	0.07030	T	0.85	.	7.9631	0.30083	0.0:0.2381:0.0:0.7619	.	47	Q8NGY1	O10Z1_HUMAN	T	47	ENSP00000354707:I47T	ENSP00000354707:I47T	I	+	2	0	OR10Z1	156842992	0.000000	0.05858	0.001000	0.08648	0.047000	0.14425	0.153000	0.16323	0.485000	0.27652	0.533000	0.62120	ATA	.	.		0.498	OR10Z1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000051853.1	NM_001004478	
RGS4	5999	hgsc.bcm.edu	37	1	163044190	163044190	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:163044190A>G	ENST00000367909.6	+	5	798	c.458A>G	c.(457-459)cAg>cGg	p.Q153R	RGS4_ENST00000367906.3_Missense_Mutation_p.Q135R|RGS4_ENST00000527809.1_Missense_Mutation_p.Q135R|RGS4_ENST00000367908.4_3'UTR|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000421743.2_Missense_Mutation_p.Q250R|RGS4_ENST00000531057.1_Intron	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	153	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						GATGAGGCCCAGAAGAAGATT	0.517																																					p.Q250R	Ovarian(76;1257 1738 3039 6086)	Atlas-SNP	.											.	RGS4	97	.	0			c.A749G						.						254.0	264.0	261.0					1																	163044190		2203	4300	6503	SO:0001583	missense	5999	exon6			AGGCCCAGAAGAA	BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.458A>G	chr1.hg19:g.163044190A>G	ENSP00000356885:p.Gln153Arg	101.0	0.0		183.0	95.0	NM_001102445	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	ENST00000367909.6	hg19	CCDS1243.1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472758	0.84640	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000527809;ENST00000367906;ENST00000528938	T;T;T;T;T	0.02863	4.13;4.13;4.13;4.13;4.13	4.93	4.93	0.64822	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.15132	0.0365	H	0.95745	3.715	0.43421	D	0.995572	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	T	0.11690	-1.0577	9	0.87932	D	0	.	12.5856	0.56416	1.0:0.0:0.0:0.0	.	153;250	P49798;A7XA59	RGS4_HUMAN;.	R	250;153;135;135;135	ENSP00000397181:Q250R;ENSP00000356885:Q153R;ENSP00000433261:Q135R;ENSP00000356882:Q135R;ENSP00000432194:Q135R	ENSP00000356882:Q135R	Q	+	2	0	RGS4	161310814	1.000000	0.71417	0.997000	0.53966	0.872000	0.50106	8.930000	0.92872	2.062000	0.61559	0.533000	0.62120	CAG	.	.		0.517	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083197.2	NM_005613	
DUSP27	92235	hgsc.bcm.edu	37	1	167064149	167064149	+	Missense_Mutation	SNP	C	C	A	rs372564326		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:167064149C>A	ENST00000361200.2	+	2	229	c.63C>A	c.(61-63)aaC>aaA	p.N21K	DUSP27_ENST00000271385.5_Missense_Mutation_p.N21K|DUSP27_ENST00000443333.1_Missense_Mutation_p.N21K			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	21					protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						ACGAAGCCAACGTGAGGGCGG	0.602																																					p.N21K		Atlas-SNP	.											.	DUSP27	235	.	0			c.C63A						.	C	LYS/ASN	1,4405	2.1+/-5.4	0,1,2202	71.0	57.0	62.0		63	-3.7	0.0	1		62	0,8598		0,0,4299	no	missense	DUSP27	NM_001080426.1	94	0,1,6501	AA,AC,CC		0.0,0.0227,0.0077	benign	21/1159	167064149	1,13003	2203	4299	6502	SO:0001583	missense	92235	exon1			AGCCAACGTGAGG	AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.63C>A	chr1.hg19:g.167064149C>A	ENSP00000354483:p.Asn21Lys	230.0	0.0		361.0	169.0	NM_001080426	A0AUM4|Q9C074	Missense_Mutation	SNP	ENST00000361200.2	hg19	CCDS30932.1	.	.	.	.	.	.	.	.	.	.	C	8.912	0.958968	0.18507	2.27E-4	0.0	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03035	4.07;4.07;4.07	5.27	-3.69	0.04450	.	0.797469	0.11523	N	0.555457	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B	0.28350	0.208	B	0.20384	0.029	T	0.47071	-0.9145	10	0.87932	D	0	-5.4915	8.1317	0.31031	0.0:0.4512:0.1059:0.4429	.	21	Q5VZP5	DUS27_HUMAN	K	21	ENSP00000354483:N21K;ENSP00000271385:N21K;ENSP00000404874:N21K	ENSP00000271385:N21K	N	+	3	2	DUSP27	165330773	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-2.459000	0.01000	-0.594000	0.05836	0.655000	0.94253	AAC	.	.		0.602	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000083244.1	NM_001080426	
MIA3	375056	hgsc.bcm.edu	37	1	222801064	222801064	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:222801064A>T	ENST00000344922.5	+	4	527	c.502A>T	c.(502-504)Aac>Tac	p.N168Y	MIA3_ENST00000344441.6_Missense_Mutation_p.N168Y|MIA3_ENST00000344507.1_Missense_Mutation_p.N168Y|MIA3_ENST00000470521.1_3'UTR	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	168					chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TATGGAAAAAAACCCTGAATT	0.368																																					p.N168Y		Atlas-SNP	.											.	MIA3	167	.	0			c.A502T						.						55.0	53.0	53.0					1																	222801064		1816	4073	5889	SO:0001583	missense	375056	exon4			GAAAAAAACCCTG		CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.502A>T	chr1.hg19:g.222801064A>T	ENSP00000340900:p.Asn168Tyr	216.0	0.0		363.0	173.0	NM_198551	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	ENST00000344922.5	hg19	CCDS41470.1	.	.	.	.	.	.	.	.	.	.	A	9.707	1.156019	0.21454	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000344507	T;T;T	0.47528	0.84;0.84;0.84	5.05	0.372	0.16173	.	.	.	.	.	T	0.22513	0.0543	N	0.14661	0.345	0.09310	N	1	B;B	0.33883	0.031;0.43	B;B	0.25759	0.037;0.063	T	0.13683	-1.0500	9	0.56958	D	0.05	.	2.1012	0.03680	0.1404:0.4683:0.1467:0.2447	.	168;168	Q5JRA6-2;Q5JRA6	.;MIA3_HUMAN	Y	168	ENSP00000340900:N168Y;ENSP00000340587:N168Y;ENSP00000341348:N168Y	ENSP00000325973:N168Y	N	+	1	0	MIA3	220867687	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.530000	0.06179	-0.146000	0.11274	-0.672000	0.03802	AAC	.	.		0.368	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000091489.4	NM_198551	
DNAH14	127602	hgsc.bcm.edu	37	1	225533932	225533932	+	Silent	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr1:225533932A>G	ENST00000445597.2	+	48	8259	c.8259A>G	c.(8257-8259)caA>caG	p.Q2753Q	DNAH14_ENST00000430092.1_Silent_p.Q3556Q|DNAH14_ENST00000439375.2_Silent_p.Q3556Q			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	2753					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						GCAAAGAACAAGAACATAGTT	0.348																																					p.Q3556Q		Atlas-SNP	.											.	DNAH14	300	.	0			c.A10668G						.						56.0	47.0	49.0					1																	225533932		692	1591	2283	SO:0001819	synonymous_variant	127602	exon68			AGAACAAGAACAT	U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.8259A>G	chr1.hg19:g.225533932A>G		182.0	0.0		204.0	97.0	NM_001373	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Silent	SNP	ENST00000445597.2	hg19																																																																																				.	.		0.348	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	protein_coding	OTTHUMT00000331217.3	XM_059166	
COLEC11	78989	hgsc.bcm.edu	37	2	3691387	3691387	+	Silent	SNP	C	C	T	rs545129835		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr2:3691387C>T	ENST00000349077.4	+	7	598	c.495C>T	c.(493-495)gaC>gaT	p.D165D	COLEC11_ENST00000418971.2_Silent_p.D179D|COLEC11_ENST00000236693.7_Silent_p.D162D|COLEC11_ENST00000402794.1_Silent_p.D115D|COLEC11_ENST00000404205.1_Silent_p.D91D|COLEC11_ENST00000487365.1_3'UTR|COLEC11_ENST00000403096.3_Silent_p.D139D|COLEC11_ENST00000382062.2_Silent_p.D141D|COLEC11_ENST00000402922.1_Silent_p.D115D	NM_024027.4	NP_076932.1	Q9BWP8	COL11_HUMAN	collectin sub-family member 11	165	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				developmental process (GO:0032502)|multicellular organismal development (GO:0007275)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|soft_tissue(1)	22	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.127)		GCTACGCGGACGCCCAGCTGT	0.662																																					p.D179D		Atlas-SNP	.											.	COLEC11	93	.	0			c.C537T						.						38.0	40.0	39.0					2																	3691387		2203	4298	6501	SO:0001819	synonymous_variant	78989	exon8			CGCGGACGCCCAG	BC000078	CCDS1649.1, CCDS1650.1, CCDS58689.1, CCDS58690.1, CCDS58691.1, CCDS58692.1, CCDS58693.1, CCDS58694.1	2p25.3	2014-09-17			ENSG00000118004	ENSG00000118004		"""Collectins"""	17213	protein-coding gene	gene with protein product	"""Collectin K1"""	612502					Standard	NM_024027		Approved	MGC3279, CL-K1	uc031rnn.1	Q9BWP8	OTTHUMG00000090304	ENST00000349077.4:c.495C>T	chr2.hg19:g.3691387C>T		129.0	0.0		162.0	76.0	NM_001255985	A1IGE4|A1IGE5|A1IGE6|A7VJJ2|A7VJJ3|A7VJJ4|A7VJJ5|B2R9M5|B4E1G0|J3KQY9|Q5CZ85|Q7Z6N1	Silent	SNP	ENST00000349077.4	hg19	CCDS1649.1																																																																																			.	.		0.662	COLEC11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000206666.1	NM_024027	
WDR92	116143	hgsc.bcm.edu	37	2	68384452	68384452	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr2:68384452C>T	ENST00000295121.6	-	1	240	c.124G>A	c.(124-126)Ggc>Agc	p.G42S	WDR92_ENST00000409164.1_Missense_Mutation_p.G42S|RP11-474G23.1_ENST00000406334.3_3'UTR|PNO1_ENST00000263657.2_5'Flank|WDR92_ENST00000406245.2_Intron|WDR92_ENST00000492039.2_Intron	NM_138458.3	NP_612467.1	Q96MX6	WDR92_HUMAN	WD repeat domain 92	42					apoptotic process (GO:0006915)|histone lysine methylation (GO:0034968)		methylated histone binding (GO:0035064)			endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|stomach(1)	12						ACGCCGGTGCCCCGTGCGAAG	0.607																																					p.G42S		Atlas-SNP	.											.	WDR92	21	.	0			c.G124A						.						73.0	70.0	71.0					2																	68384452		2203	4300	6503	SO:0001583	missense	116143	exon1			CGGTGCCCCGTGC	AK056303	CCDS1884.1, CCDS58712.1	2p14	2013-01-09			ENSG00000243667	ENSG00000243667		"""WD repeat domain containing"""	25176	protein-coding gene	gene with protein product		610729				16487927	Standard	NM_138458		Approved	FLJ31741, Monad	uc002see.2	Q96MX6	OTTHUMG00000152561	ENST00000295121.6:c.124G>A	chr2.hg19:g.68384452C>T	ENSP00000295121:p.Gly42Ser	87.0	0.0		99.0	48.0	NM_001256476	Q96CR6	Missense_Mutation	SNP	ENST00000295121.6	hg19	CCDS1884.1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372769	0.82573	.	.	ENSG00000243667	ENST00000295121;ENST00000409164	T;T	0.74209	1.72;-0.82	5.66	5.66	0.87406	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000002	T	0.70718	0.3256	L	0.60845	1.875	0.80722	D	1	P	0.43431	0.807	B	0.35510	0.204	T	0.72114	-0.4388	10	0.36615	T	0.2	.	19.76	0.96311	0.0:1.0:0.0:0.0	.	42	Q96MX6	WDR92_HUMAN	S	42	ENSP00000295121:G42S;ENSP00000386746:G42S	ENSP00000295121:G42S	G	-	1	0	WDR92	68237956	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.944000	0.75940	2.666000	0.90696	0.655000	0.94253	GGC	.	.		0.607	WDR92-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000251754.2	NM_138458	
ALMS1	7840	hgsc.bcm.edu	37	2	73613036	73613037	+	Missense_Mutation	DNP	GA	GA	CT	rs61156725|rs72319667|rs3074417	byFrequency	TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G|A	G|A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr2:73613036_73613037GA>CT	ENST00000264448.6	+	1	151_152	c.40_41GA>CT	c.(40-42)GAg>CTg	p.E14L	ALMS1_ENST00000377715.1_Missense_Mutation_p.E14L|ALMS1_ENST00000409009.1_Missense_Mutation_p.E14L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	14	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.E27_E28delEE(1)		breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGAGCTggaggaggaggaggag	0.693																																					p.E14Q|p.E14V		Atlas-SNP	.											.	ALMS1	384	.	1	Deletion - In frame(1)	ovary(1)	c.G40C|c.A41T						.																																			SO:0001583	missense	7840	exon1			CTGGAGGAGGAGG|TGGAGGAGGAGGA	AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	Exception_encountered	chr2.hg19:g.73613036_73613037delinsCT	ENSP00000264448:p.Glu14Leu	129.0|130.0	0.0		266.0|268.0	20.0|23.0	NM_015120	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	ENST00000264448.6	hg19	CCDS42697.1																																																																																			.	.		0.693	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000327776.1	NM_015120	
SPEG	10290	hgsc.bcm.edu	37	2	220326770	220326770	+	Silent	SNP	C	C	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr2:220326770C>A	ENST00000312358.7	+	7	2739	c.2607C>A	c.(2605-2607)ccC>ccA	p.P869P	SPEG_ENST00000396689.2_Silent_p.P20P|SPEG_ENST00000396698.1_Silent_p.P765P|SPEG_ENST00000396695.2_Silent_p.P77P|SPEG_ENST00000485813.1_3'UTR|SPEG_ENST00000396688.1_Silent_p.P20P|SPEG_ENST00000396686.1_Silent_p.P20P	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	869	Ig-like 3.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		AGGCACCCCCCACCTTCAAGG	0.642																																					p.P869P		Atlas-SNP	.											.	SPEG	272	.	0			c.C2607A						.						31.0	35.0	33.0					2																	220326770		1892	4111	6003	SO:0001819	synonymous_variant	10290	exon7			ACCCCCCACCTTC	BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.2607C>A	chr2.hg19:g.220326770C>A		85.0	0.0		97.0	51.0	NM_005876	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Silent	SNP	ENST00000312358.7	hg19	CCDS42824.1																																																																																			.	.		0.642	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000130252.2	NM_005876	
VPRBP	9730	hgsc.bcm.edu	37	3	51505011	51505011	+	Missense_Mutation	SNP	A	A	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:51505011A>T	ENST00000335891.5	-	2	130	c.121T>A	c.(121-123)Ttg>Atg	p.L41M				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	41					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TTTTCAATCAATTGAGACATC	0.403																																					p.L41M		Atlas-SNP	.											.	VPRBP	107	.	0			c.T121A						.						98.0	88.0	91.0					3																	51505011		1857	4106	5963	SO:0001583	missense	9730	exon4			CAATCAATTGAGA	AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.121T>A	chr3.hg19:g.51505011A>T	ENSP00000338857:p.Leu41Met	64.0	0.0		112.0	54.0	NM_014703	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Missense_Mutation	SNP	ENST00000335891.5	hg19		.	.	.	.	.	.	.	.	.	.	A	16.50	3.140130	0.56936	.	.	ENSG00000145041	ENST00000335891;ENST00000504652	T;T	0.60797	0.16;0.55	4.93	2.47	0.30058	.	0.156624	0.42420	D	0.000718	T	0.68997	0.3062	M	0.65975	2.015	0.21386	N	0.999708	D	0.62365	0.991	D	0.75484	0.986	T	0.57723	-0.7762	10	0.66056	D	0.02	-0.471	7.8207	0.29286	0.7509:0.0:0.249:0.0	.	41	Q9Y4B6	VPRBP_HUMAN	M	41	ENSP00000338857:L41M;ENSP00000421724:L41M	ENSP00000338857:L41M	L	-	1	2	VPRBP	51480051	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	1.243000	0.32767	0.726000	0.32339	-0.587000	0.04127	TTG	.	.		0.403	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	protein_coding		NM_014703	
CADPS	8618	hgsc.bcm.edu	37	3	62467427	62467427	+	Silent	SNP	C	C	T	rs368961255		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:62467427C>T	ENST00000383710.4	-	22	3493	c.3144G>A	c.(3142-3144)ccG>ccA	p.P1048P	CADPS_ENST00000283269.9_Intron|CADPS_ENST00000357948.3_Intron	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	1048	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		CCATCCATGACGGTGCCGAAA	0.398																																					p.P1048P		Atlas-SNP	.											.	CADPS	387	.	0			c.G3144A						.	C	,,	1,3805		0,1,1902	202.0	188.0	193.0		3144,,	4.7	1.0	3		193	0,8254		0,0,4127	no	coding-synonymous,intron,intron	CADPS	NM_003716.3,NM_183393.2,NM_183394.2	,,	0,1,6029	TT,TC,CC		0.0,0.0263,0.0083	,,	1048/1354,,	62467427	1,12059	1903	4127	6030	SO:0001819	synonymous_variant	8618	exon22			CCATGACGGTGCC	U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.3144G>A	chr3.hg19:g.62467427C>T		161.0	0.0		186.0	72.0	NM_003716	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Silent	SNP	ENST00000383710.4	hg19	CCDS46858.1	.	.	.	.	.	.	.	.	.	.	C	7.200	0.593233	0.13875	2.63E-4	0.0	ENSG00000163618	ENST00000473635	.	.	.	5.52	4.65	0.58169	.	.	.	.	.	T	0.72732	0.3497	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.72896	-0.4153	4	.	.	.	.	16.8253	0.85929	0.0:0.8714:0.1285:0.0	.	.	.	.	H	35	.	.	R	-	2	0	CADPS	62442467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.995000	0.49441	1.460000	0.47911	0.563000	0.77884	CGT	.	.		0.398	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000351951.5	NM_003716, NM_183393, NM_183394	
MORC1	27136	hgsc.bcm.edu	37	3	108698449	108698449	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:108698449C>T	ENST00000483760.1	-	23	2370	c.2327G>A	c.(2326-2328)aGt>aAt	p.S776N	MORC1_ENST00000232603.5_Missense_Mutation_p.S797N					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						ACAACTGCCACTCACAGAAAC	0.403																																					p.S797N		Atlas-SNP	.											.	MORC1	211	.	0			c.G2390A						.						118.0	112.0	114.0					3																	108698449		2203	4300	6503	SO:0001583	missense	27136	exon24			CTGCCACTCACAG	AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.2327G>A	chr3.hg19:g.108698449C>T	ENSP00000417282:p.Ser776Asn	98.0	0.0		134.0	57.0	NM_014429		Missense_Mutation	SNP	ENST00000483760.1	hg19		.	.	.	.	.	.	.	.	.	.	C	10.49	1.363480	0.24684	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	T;T	0.06528	3.32;3.29	5.25	-3.69	0.04450	.	1.666880	0.03032	N	0.152287	T	0.03827	0.0108	N	0.19112	0.55	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.38735	-0.9647	10	0.23891	T	0.37	-0.0757	2.2679	0.04083	0.1345:0.225:0.1329:0.5077	.	776;797	E7ERX1;Q86VD1	.;MORC1_HUMAN	N	797;776	ENSP00000232603:S797N;ENSP00000417282:S776N	ENSP00000232603:S797N	S	-	2	0	MORC1	110181139	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-1.337000	0.02657	-0.864000	0.04078	-0.165000	0.13383	AGT	.	.		0.403	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	protein_coding	OTTHUMT00000353844.1		
CD200R1	131450	hgsc.bcm.edu	37	3	112647737	112647737	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:112647737T>A	ENST00000471858.1	-	4	858	c.626A>T	c.(625-627)cAc>cTc	p.H209L	CD200R1_ENST00000308611.3_Missense_Mutation_p.H232L|CD200R1_ENST00000295863.4_Missense_Mutation_p.H187L	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	209	Ig-like C2-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						AGACACATTGTGGACCTCCCA	0.473																																					p.H232L		Atlas-SNP	.											.	CD200R1	91	.	0			c.A695T						.						115.0	95.0	102.0					3																	112647737		2203	4300	6503	SO:0001583	missense	131450	exon5			ACATTGTGGACCT	AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.626A>T	chr3.hg19:g.112647737T>A	ENSP00000418928:p.His209Leu	104.0	0.0		149.0	82.0	NM_138806	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	ENST00000471858.1	hg19	CCDS2970.1	.	.	.	.	.	.	.	.	.	.	T	10.82	1.458517	0.26248	.	.	ENSG00000163606	ENST00000471858;ENST00000308611;ENST00000295863	T;T;T	0.76186	-1.0;-1.0;-1.0	5.24	-10.5	0.00291	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);	2.147030	0.01987	N	0.045222	T	0.60235	0.2253	L	0.57536	1.79	0.09310	N	1	B;B;B	0.18166	0.026;0.001;0.001	B;B;B	0.20184	0.028;0.009;0.005	T	0.42882	-0.9425	10	0.11182	T	0.66	.	4.175	0.10348	0.1555:0.5168:0.2084:0.1193	.	187;209;232	B4E2U2;Q8TD46;Q8TD46-4	.;MO2R1_HUMAN;.	L	209;232;187	ENSP00000418928:H209L;ENSP00000311035:H232L;ENSP00000295863:H187L	ENSP00000295863:H187L	H	-	2	0	CD200R1	114130427	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-4.038000	0.00308	-1.592000	0.01619	-1.137000	0.01932	CAC	.	.		0.473	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354467.1	NM_138806	
STXBP5L	9515	hgsc.bcm.edu	37	3	120998775	120998775	+	Silent	SNP	T	T	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:120998775T>A	ENST00000273666.6	+	19	2353	c.2082T>A	c.(2080-2082)tcT>tcA	p.S694S	STXBP5L_ENST00000492541.1_Silent_p.S694S|STXBP5L_ENST00000497029.1_Silent_p.S694S|STXBP5L_ENST00000472879.1_Silent_p.S694S|STXBP5L_ENST00000471454.1_Silent_p.S694S	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	694					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		AACCACGGTCTCCTCGAAAAA	0.388																																					p.S694S		Atlas-SNP	.											.	STXBP5L	159	.	0			c.T2082A						.						105.0	97.0	100.0					3																	120998775		1883	4115	5998	SO:0001819	synonymous_variant	9515	exon19			ACGGTCTCCTCGA	AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.2082T>A	chr3.hg19:g.120998775T>A		115.0	0.0		151.0	77.0	NM_014980	Q4G1B4|Q6PIC3	Silent	SNP	ENST00000273666.6	hg19	CCDS43137.1																																																																																			.	.		0.388	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355256.3		
STAG1	10274	hgsc.bcm.edu	37	3	136060292	136060292	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:136060292C>G	ENST00000383202.2	-	31	3804	c.3548G>C	c.(3547-3549)aGg>aCg	p.R1183T	STAG1_ENST00000434713.2_Missense_Mutation_p.R923T|STAG1_ENST00000236698.5_Intron|STAG1_ENST00000536929.1_Missense_Mutation_p.R767T	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	1183					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						CACAGCATGCCTCACTCCAGT	0.418																																					p.R1183T		Atlas-SNP	.											.	STAG1	135	.	0			c.G3548C						.						270.0	202.0	225.0					3																	136060292		2203	4300	6503	SO:0001583	missense	10274	exon31			GCATGCCTCACTC	Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.3548G>C	chr3.hg19:g.136060292C>G	ENSP00000372689:p.Arg1183Thr	47.0	0.0		74.0	36.0	NM_005862	O00539|Q6P275	Missense_Mutation	SNP	ENST00000383202.2	hg19	CCDS3090.1	.	.	.	.	.	.	.	.	.	.	C	16.71	3.198309	0.58126	.	.	ENSG00000118007	ENST00000383202;ENST00000434713;ENST00000536929	T;T;T	0.33438	1.8;1.78;1.41	5.72	5.72	0.89469	.	0.136113	0.52532	D	0.000071	T	0.31199	0.0789	L	0.41236	1.265	0.58432	D	0.999992	P	0.36683	0.565	B	0.35312	0.2	T	0.08848	-1.0702	10	0.72032	D	0.01	.	19.8868	0.96915	0.0:1.0:0.0:0.0	.	1183	Q8WVM7	STAG1_HUMAN	T	1183;923;767	ENSP00000372689:R1183T;ENSP00000404396:R923T;ENSP00000445787:R767T	ENSP00000372689:R1183T	R	-	2	0	STAG1	137542982	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	4.581000	0.60949	2.689000	0.91719	0.650000	0.86243	AGG	.	.		0.418	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357366.1	NM_005862	
ZBTB38	253461	hgsc.bcm.edu	37	3	141161744	141161744	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:141161744G>A	ENST00000514251.1	+	4	793	c.514G>A	c.(514-516)Gaa>Aaa	p.E172K	ZBTB38_ENST00000321464.5_Missense_Mutation_p.E173K|ZBTB38_ENST00000441582.2_Missense_Mutation_p.E172K					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						TTCCATCATCGAAACAGAAAA	0.418																																					p.E172K		Atlas-SNP	.											.	ZBTB38	92	.	0			c.G514A						.						92.0	86.0	88.0					3																	141161744		1918	4135	6053	SO:0001583	missense	253461	exon8			ATCATCGAAACAG	BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.514G>A	chr3.hg19:g.141161744G>A	ENSP00000426387:p.Glu172Lys	103.0	0.0		144.0	74.0	NM_001080412		Missense_Mutation	SNP	ENST00000514251.1	hg19	CCDS43157.1	.	.	.	.	.	.	.	.	.	.	G	28.7	4.942240	0.92526	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464;ENST00000510726	T;T;T;T;D	0.83914	3.17;2.64;2.64;2.64;-1.78	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	D	0.87168	0.6110	L	0.34521	1.04	0.53688	D	0.999979	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.85338	0.1094	9	.	.	.	-10.0734	19.5786	0.95455	0.0:0.0:1.0:0.0	.	173;172	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	K	172;172;172;173;172	ENSP00000424254:E172K;ENSP00000426387:E172K;ENSP00000406955:E172K;ENSP00000372635:E173K;ENSP00000422081:E172K	.	E	+	1	0	ZBTB38	142644434	1.000000	0.71417	0.905000	0.35620	0.993000	0.82548	9.041000	0.93788	2.699000	0.92147	0.591000	0.81541	GAA	.	.		0.418	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359329.2		
AGTR1	185	hgsc.bcm.edu	37	3	148459155	148459155	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:148459155C>G	ENST00000497524.1	+	2	724	c.333C>G	c.(331-333)aaC>aaG	p.N111K	AGTR1_ENST00000418473.2_Missense_Mutation_p.N111K|AGTR1_ENST00000475347.1_Missense_Mutation_p.N111K|AGTR1_ENST00000402260.1_Missense_Mutation_p.N111K|AGTR1_ENST00000404754.2_Missense_Mutation_p.N111K|AGTR1_ENST00000542281.1_Missense_Mutation_p.N111K|AGTR1_ENST00000474935.1_Missense_Mutation_p.N111K|AGTR1_ENST00000349243.3_Missense_Mutation_p.N111K|AGTR1_ENST00000461609.1_Missense_Mutation_p.N111K	NM_009585.3	NP_033611.1	P30556	AGTR1_HUMAN	angiotensin II receptor, type 1	111					angiotensin-activated signaling pathway (GO:0038166)|calcium-mediated signaling (GO:0019722)|cell chemotaxis (GO:0060326)|G-protein coupled receptor signaling pathway (GO:0007186)|kidney development (GO:0001822)|low-density lipoprotein particle remodeling (GO:0034374)|phospholipase C-activating angiotensin-activated signaling pathway (GO:0086097)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol esterification (GO:0010873)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of NAD(P)H oxidase activity (GO:0033864)|positive regulation of phospholipase A2 activity (GO:0032430)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|regulation of blood vessel size by renin-angiotensin (GO:0002034)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of inflammatory response (GO:0050727)|regulation of renal sodium excretion (GO:0035813)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)|renin-angiotensin regulation of aldosterone production (GO:0002018)|Rho protein signal transduction (GO:0007266)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin type I receptor activity (GO:0001596)|angiotensin type II receptor activity (GO:0004945)|bradykinin receptor binding (GO:0031711)|protein heterodimerization activity (GO:0046982)			breast(4)|endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30			LUSC - Lung squamous cell carcinoma(72;0.127)|Lung(72;0.152)		Azilsartan medoxomil(DB08822)|Candesartan(DB00796)|Eprosartan(DB00876)|Forasartan(DB01342)|Irbesartan(DB01029)|Losartan(DB00678)|Olmesartan(DB00275)|Saprisartan(DB01347)|Tasosartan(DB01349)|Telmisartan(DB00966)|Valsartan(DB00177)	TCAGTTTCAACCTGTACGCTA	0.483																																					p.N146K		Atlas-SNP	.											.	AGTR1	63	.	0			c.C438G						.						104.0	101.0	102.0					3																	148459155		2203	4300	6503	SO:0001583	missense	185	exon4			TTTCAACCTGTAC	M87290	CCDS3137.1	3q24	2012-08-08	2002-02-20		ENSG00000144891	ENSG00000144891		"""GPCR / Class A : Angiotensin receptors"""	336	protein-coding gene	gene with protein product		106165	"""angiotensin receptor 1B"""	AGTR1B		1550596	Standard	NM_009585		Approved	AT1, AT2R1, AGTR1A, AT2R1A, HAT1R, AG2S, AT2R1B, AT1B	uc003ewh.4	P30556	OTTHUMG00000159503	ENST00000497524.1:c.333C>G	chr3.hg19:g.148459155C>G	ENSP00000419422:p.Asn111Lys	52.0	0.0		64.0	28.0	NM_031850	Q13725|Q8TBK4	Missense_Mutation	SNP	ENST00000497524.1	hg19	CCDS3137.1	.	.	.	.	.	.	.	.	.	.	C	15.74	2.922193	0.52653	.	.	ENSG00000144891	ENST00000497524;ENST00000349243;ENST00000542281;ENST00000418473;ENST00000404754;ENST00000475347;ENST00000474935;ENST00000461609;ENST00000402260	T;T;T;T;T;T;T;T;T	0.38722	1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12;1.12	5.48	3.64	0.41730	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.75635	0.3876	H	0.98818	4.34	0.58432	D	0.999993	D	0.89917	1.0	D	0.87578	0.998	T	0.81232	-0.1026	10	0.56958	D	0.05	-20.8487	9.673	0.40023	0.0:0.6769:0.0:0.3231	.	111	P30556	AGTR1_HUMAN	K	111	ENSP00000419422:N111K;ENSP00000273430:N111K;ENSP00000443186:N111K;ENSP00000398832:N111K;ENSP00000385612:N111K;ENSP00000419783:N111K;ENSP00000418084:N111K;ENSP00000418851:N111K;ENSP00000385641:N111K	ENSP00000273430:N111K	N	+	3	2	AGTR1	149941845	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	1.169000	0.31871	1.275000	0.44379	0.655000	0.94253	AAC	.	.		0.483	AGTR1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000355807.1		
CP	1356	hgsc.bcm.edu	37	3	148905856	148905856	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:148905856T>C	ENST00000264613.6	-	10	2109	c.1847A>G	c.(1846-1848)gAa>gGa	p.E616G	CP_ENST00000462336.1_5'UTR	NM_000096.3	NP_000087	P00450	CERU_HUMAN	ceruloplasmin (ferroxidase)	616	F5/8 type A 2.|Plastocyanin-like 4.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|transmembrane transport (GO:0055085)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)	chaperone binding (GO:0051087)|copper ion binding (GO:0005507)|ferroxidase activity (GO:0004322)			breast(6)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		Prostate(884;0.00217)|Hepatocellular(537;0.00826)|Myeloproliferative disorder(1037;0.0122)|all_neural(597;0.0189)|Melanoma(1037;0.152)	LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)		Drotrecogin alfa(DB00055)	TTTATTAGATTCCTGAAAGTC	0.338																																					p.E616G		Atlas-SNP	.											.	CP	112	.	0			c.A1847G						.						138.0	137.0	138.0					3																	148905856		2203	4297	6500	SO:0001583	missense	1356	exon10			TTAGATTCCTGAA	M13536	CCDS3141.1	3q23-q25	2010-07-01			ENSG00000047457	ENSG00000047457	1.16.3.1		2295	protein-coding gene	gene with protein product		117700					Standard	NM_000096		Approved		uc003ewy.4	P00450	OTTHUMG00000159563	ENST00000264613.6:c.1847A>G	chr3.hg19:g.148905856T>C	ENSP00000264613:p.Glu616Gly	73.0	0.0		80.0	36.0	NM_000096	Q14063|Q2PP18|Q9UKS4	Missense_Mutation	SNP	ENST00000264613.6	hg19	CCDS3141.1	.	.	.	.	.	.	.	.	.	.	T	27.5	4.840754	0.91197	.	.	ENSG00000047457	ENST00000264613;ENST00000494544	D;D	0.98792	-5.14;-5.14	6.16	6.16	0.99307	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.98748	0.9579	H	0.94423	3.535	0.80722	D	1	D;P;D;P	0.54047	0.964;0.927;0.964;0.927	B;B;B;B	0.43867	0.434;0.434;0.434;0.284	D	0.99533	1.0961	10	0.62326	D	0.03	-41.9819	16.8061	0.85666	0.0:0.0:0.0:1.0	.	616;616;616;616	A5PL27;A8K5A4;P00450;Q1L857	.;.;CERU_HUMAN;.	G	616;399	ENSP00000264613:E616G;ENSP00000420545:E399G	ENSP00000264613:E616G	E	-	2	0	CP	150388546	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	5.459000	0.66685	2.367000	0.80283	0.528000	0.53228	GAA	.	.		0.338	CP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000317498.1	NM_000096	
IGSF10	285313	hgsc.bcm.edu	37	3	151171320	151171320	+	Silent	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:151171320G>A	ENST00000282466.3	-	3	566	c.567C>T	c.(565-567)ttC>ttT	p.F189F		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	189					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			ACAAGTATAGGAACTTAATGA	0.453																																					p.F189F		Atlas-SNP	.											.	IGSF10	279	.	0			c.C567T						.						116.0	122.0	120.0					3																	151171320		2203	4300	6503	SO:0001819	synonymous_variant	285313	exon3			GTATAGGAACTTA	AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.567C>T	chr3.hg19:g.151171320G>A		163.0	0.0		225.0	90.0	NM_178822	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	ENST00000282466.3	hg19	CCDS3160.1																																																																																			.	.		0.453	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000357782.1	NM_178822	
ABCF3	55324	hgsc.bcm.edu	37	3	183907511	183907511	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:183907511A>G	ENST00000429586.2	+	13	1465	c.1280A>G	c.(1279-1281)tAt>tGt	p.Y427C	ABCF3_ENST00000292808.5_Missense_Mutation_p.Y421C|EIF2B5_ENST00000444495.1_Intron	NM_018358.2	NP_060828.2	Q9NUQ8	ABCF3_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 3	427					defense response to virus (GO:0051607)	membrane (GO:0016020)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(20)|ovary(3)|prostate(5)|upper_aerodigestive_tract(1)	39	all_cancers(143;1.12e-10)|Ovarian(172;0.0339)		Epithelial(37;2.35e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CAGCGTGAATATGAGGCGCAG	0.602																																					p.Y427C		Atlas-SNP	.											.	ABCF3	72	.	0			c.A1280G						.						35.0	33.0	33.0					3																	183907511		2203	4300	6503	SO:0001583	missense	55324	exon13			GTGAATATGAGGC	U66685	CCDS3254.1	3q27.1	2012-05-16			ENSG00000161204	ENSG00000161204		"""ATP binding cassette transporters / subfamily F"""	72	protein-coding gene	gene with protein product						8894702	Standard	NM_018358		Approved	EST201864	uc003fmz.2	Q9NUQ8	OTTHUMG00000156824	ENST00000429586.2:c.1280A>G	chr3.hg19:g.183907511A>G	ENSP00000411471:p.Tyr427Cys	44.0	0.0		91.0	61.0	NM_018358	A8K241|Q86UA2|Q8NAN1|Q96GS8|Q9H7A8	Missense_Mutation	SNP	ENST00000429586.2	hg19	CCDS3254.1	.	.	.	.	.	.	.	.	.	.	A	12.76	2.035655	0.35893	.	.	ENSG00000161204	ENST00000429586;ENST00000292808	D;D	0.92911	-3.13;-3.13	4.05	4.05	0.47172	.	0.000000	0.85682	D	0.000000	D	0.97031	0.9030	H	0.95982	3.75	0.80722	D	1	D;P	0.89917	1.0;0.585	D;B	0.79108	0.992;0.277	D	0.97737	1.0206	10	0.87932	D	0	-8.1136	12.3482	0.55132	1.0:0.0:0.0:0.0	.	421;427	Q9NUQ8-2;Q9NUQ8	.;ABCF3_HUMAN	C	427;421	ENSP00000411471:Y427C;ENSP00000292808:Y421C	ENSP00000292808:Y421C	Y	+	2	0	ABCF3	185390205	1.000000	0.71417	0.975000	0.42487	0.417000	0.31264	8.477000	0.90424	1.710000	0.51325	0.460000	0.39030	TAT	.	.		0.602	ABCF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000346047.1	NM_018358	
PDLIM5	10611	hgsc.bcm.edu	37	4	95539284	95539284	+	Silent	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr4:95539284G>A	ENST00000317968.4	+	8	1186	c.1050G>A	c.(1048-1050)aaG>aaA	p.K350K	PDLIM5_ENST00000437932.1_Silent_p.K241K|PDLIM5_ENST00000542407.1_Silent_p.K228K|PDLIM5_ENST00000514743.1_Silent_p.K379K|PDLIM5_ENST00000380176.3_3'UTR	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	350					regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		CTGCCTTCAAGCCTGTAGGAT	0.572																																					p.K379K		Atlas-SNP	.											.	PDLIM5	76	.	0			c.G1137A						.						53.0	46.0	48.0					4																	95539284		2203	4300	6503	SO:0001819	synonymous_variant	10611	exon12			CTTCAAGCCTGTA	AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.1050G>A	chr4.hg19:g.95539284G>A		180.0	0.0		118.0	110.0	NM_001256426	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Silent	SNP	ENST00000317968.4	hg19	CCDS3641.1																																																																																			.	.		0.572	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000253586.1		
CDH9	1007	hgsc.bcm.edu	37	5	26988368	26988368	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr5:26988368G>A	ENST00000231021.4	-	2	245	c.73C>T	c.(73-75)Caa>Taa	p.Q25*		NM_016279.3	NP_057363.3	Q9ULB4	CADH9_HUMAN	cadherin 9, type 2 (T1-cadherin)	25					adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(25)|lung(80)|ovary(5)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	137						GGTTTTTCTTGTAATAGGATG	0.393																																					p.Q25X	Melanoma(8;187 585 15745 40864 52829)	Atlas-SNP	.											.	CDH9	305	.	0			c.C73T						.						143.0	144.0	144.0					5																	26988368		2203	4300	6503	SO:0001587	stop_gained	1007	exon2			TTTCTTGTAATAG	AB035302	CCDS3893.1	5p14	2010-01-26			ENSG00000113100	ENSG00000113100		"""Cadherins / Major cadherins"""	1768	protein-coding gene	gene with protein product		609974				2059658	Standard	NM_016279		Approved		uc003jgs.1	Q9ULB4	OTTHUMG00000090671	ENST00000231021.4:c.73C>T	chr5.hg19:g.26988368G>A	ENSP00000231021:p.Gln25*	113.0	0.0		230.0	50.0	NM_016279	Q3B7I5	Nonsense_Mutation	SNP	ENST00000231021.4	hg19	CCDS3893.1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.034492	0.75617	.	.	ENSG00000113100	ENST00000231021;ENST00000513289;ENST00000511822	.	.	.	5.64	4.75	0.60458	.	1.038480	0.07520	N	0.910439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6722	0.62432	0.0:0.2959:0.7041:0.0	.	.	.	.	X	25	.	.	Q	-	1	0	CDH9	27024125	0.994000	0.37717	0.265000	0.24526	0.114000	0.19823	2.481000	0.45215	1.338000	0.45544	0.591000	0.81541	CAA	.	.		0.393	CDH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000207352.1	NM_016279	
OR2J3	442186	hgsc.bcm.edu	37	6	29079833	29079833	+	Missense_Mutation	SNP	T	T	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:29079833T>G	ENST00000377169.1	+	1	166	c.166T>G	c.(166-168)Tcc>Gcc	p.S56A		NM_001005216.2	NP_001005216.2	O76001	OR2J3_HUMAN	olfactory receptor, family 2, subfamily J, member 3	56						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|large_intestine(5)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	24						ATACCTGGACTCCCATCTGCA	0.448																																					p.S56A		Atlas-SNP	.											.	OR2J3	53	.	0			c.T166G						.						289.0	303.0	299.0					6																	29079833		1360	2644	4004	SO:0001583	missense	442186	exon1			CTGGACTCCCATC		CCDS43433.1	6p22.2-p21.31	2012-08-09			ENSG00000204701	ENSG00000204701		"""GPCR / Class A : Olfactory receptors"""	8261	protein-coding gene	gene with protein product		615016					Standard	NM_001005216		Approved	OR6-6	uc011dll.2	O76001	OTTHUMG00000031092	ENST00000377169.1:c.166T>G	chr6.hg19:g.29079833T>G	ENSP00000366374:p.Ser56Ala	122.0	0.0		158.0	85.0	NM_001005216	B0UY52|B9EH11|Q5SUJ7|Q6IF25|Q96R15|Q9GZK5|Q9GZL4|Q9GZL5	Missense_Mutation	SNP	ENST00000377169.1	hg19	CCDS43433.1	.	.	.	.	.	.	.	.	.	.	T	0.341	-0.950452	0.02285	.	.	ENSG00000204701	ENST00000377169	T	0.00424	7.45	2.78	0.256	0.15567	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00073	0.0002	L	0.28740	0.885	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.18745	-1.0327	9	0.39692	T	0.17	.	4.4705	0.11710	0.0:0.184:0.1869:0.6291	.	56	O76001	OR2J3_HUMAN	A	56	ENSP00000366374:S56A	ENSP00000366374:S56A	S	+	1	0	OR2J3	29187812	0.000000	0.05858	0.930000	0.37139	0.050000	0.14768	-0.715000	0.04997	0.264000	0.21851	0.358000	0.22013	TCC	.	.		0.448	OR2J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000076132.2		
TFEB	7942	hgsc.bcm.edu	37	6	41652806	41652806	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:41652806A>G	ENST00000230323.4	-	10	1263	c.962T>C	c.(961-963)aTg>aCg	p.M321T	TFEB_ENST00000403298.4_Missense_Mutation_p.M321T|TFEB_ENST00000373033.1_Missense_Mutation_p.M321T|TFEB_ENST00000420312.1_Missense_Mutation_p.M236T|TFEB_ENST00000358871.2_Missense_Mutation_p.M335T|AL035588.1_ENST00000597468.1_5'Flank	NM_001271945.1|NM_007162.2	NP_001258874.1|NP_009093.1	P19484	TFEB_HUMAN	transcription factor EB	321					autophagy (GO:0006914)|embryonic placenta development (GO:0001892)|humoral immune response (GO:0006959)|lysosome organization (GO:0007040)|positive regulation of autophagy (GO:0010508)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	11	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;7.61e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00507)			TCGAGCCTGCATCTCCAGCTC	0.647			T	ALPHA	renal (childhood epithelioid)																																p.M335T		Atlas-SNP	.		Dom	yes		6	6p21	7942	transcription factor EB		"""E,M"""	.	TFEB	37	.	0			c.T1004C						.						13.0	13.0	13.0					6																	41652806		2174	4267	6441	SO:0001583	missense	7942	exon9			GCCTGCATCTCCA	M33782	CCDS4858.1, CCDS64424.1, CCDS64425.1	6p21	2013-05-21			ENSG00000112561	ENSG00000112561		"""Basic helix-loop-helix proteins"""	11753	protein-coding gene	gene with protein product		600744				2115126	Standard	NM_007162		Approved	TCFEB, bHLHe35	uc003oqu.2	P19484	OTTHUMG00000014684	ENST00000230323.4:c.962T>C	chr6.hg19:g.41652806A>G	ENSP00000230323:p.Met321Thr	120.0	0.0		149.0	77.0	NM_001167827	Q709B3|Q7Z6P9|Q9BRJ5|Q9UJD8	Missense_Mutation	SNP	ENST00000230323.4	hg19	CCDS4858.1	.	.	.	.	.	.	.	.	.	.	A	17.44	3.389569	0.61956	.	.	ENSG00000112561	ENST00000406563;ENST00000343317;ENST00000230323;ENST00000358871;ENST00000403298;ENST00000420312;ENST00000373033	T;T;T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24;-0.24;-0.24	4.99	4.99	0.66335	.	0.079783	0.85682	D	0.000000	T	0.69557	0.3124	M	0.81802	2.56	0.54753	D	0.999982	D;D;D	0.59357	0.985;0.985;0.981	P;P;P	0.54499	0.754;0.754;0.64	T	0.76307	-0.3007	10	0.87932	D	0	-23.8157	10.5225	0.44927	0.8376:0.1624:0.0:0.0	.	335;321;236	B0QYS6;P19484;P19484-2	.;TFEB_HUMAN;.	T	179;407;321;335;321;236;321	ENSP00000383998:M179T;ENSP00000343948:M407T;ENSP00000230323:M321T;ENSP00000351742:M335T;ENSP00000384203:M321T;ENSP00000412551:M236T;ENSP00000362124:M321T	ENSP00000230323:M321T	M	-	2	0	TFEB	41760784	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.989000	0.63870	1.880000	0.54463	0.459000	0.35465	ATG	.	.		0.647	TFEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000040522.3		
GRIK2	2898	hgsc.bcm.edu	37	6	102503262	102503262	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:102503262A>C	ENST00000421544.1	+	15	2859	c.2369A>C	c.(2368-2370)aAa>aCa	p.K790T	GRIK2_ENST00000369138.1_Missense_Mutation_p.K790T|GRIK2_ENST00000369134.4_Missense_Mutation_p.K741T|GRIK2_ENST00000369137.3_Missense_Mutation_p.K714T|GRIK2_ENST00000318991.6_Missense_Mutation_p.K790T|GRIK2_ENST00000413795.1_Missense_Mutation_p.K790T	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	790					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GAGGAAGGCAAACTGCATATG	0.458																																					p.K790T		Atlas-SNP	.											.	GRIK2	487	.	0			c.A2369C						.						91.0	92.0	91.0					6																	102503262		2203	4300	6503	SO:0001583	missense	2898	exon15			AAGGCAAACTGCA		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2369A>C	chr6.hg19:g.102503262A>C	ENSP00000397026:p.Lys790Thr	97.0	0.0		149.0	62.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	hg19	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	A	16.08	3.020954	0.54576	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.09817	2.94;2.94;2.94;2.94;2.94;2.94	5.68	5.68	0.88126	Ionotropic glutamate receptor (2);	0.099481	0.64402	D	0.000002	T	0.04815	0.0130	N	0.12182	0.205	0.45066	D	0.998089	B;P;B	0.42757	0.262;0.789;0.262	B;P;B	0.47430	0.223;0.547;0.146	T	0.38607	-0.9653	10	0.51188	T	0.08	.	11.1174	0.48268	0.8622:0.0:0.0:0.1378	.	790;790;790	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	T	790;790;790;714;790;741;565	ENSP00000397026:K790T;ENSP00000405596:K790T;ENSP00000358134:K790T;ENSP00000358133:K714T;ENSP00000313276:K790T;ENSP00000358130:K741T	ENSP00000313276:K790T	K	+	2	0	GRIK2	102609955	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.338000	0.79269	2.176000	0.68965	0.477000	0.44152	AAA	.	.		0.458	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
GRIK2	2898	hgsc.bcm.edu	37	6	102503268	102503268	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:102503268A>G	ENST00000421544.1	+	15	2865	c.2375A>G	c.(2374-2376)cAt>cGt	p.H792R	GRIK2_ENST00000369138.1_Missense_Mutation_p.H792R|GRIK2_ENST00000369134.4_Missense_Mutation_p.H743R|GRIK2_ENST00000369137.3_Missense_Mutation_p.H716R|GRIK2_ENST00000318991.6_Missense_Mutation_p.H792R|GRIK2_ENST00000413795.1_Missense_Mutation_p.H792R	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	792					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	GGCAAACTGCATATGATGAAG	0.448																																					p.H792R		Atlas-SNP	.											.	GRIK2	487	.	0			c.A2375G						.						93.0	94.0	94.0					6																	102503268		2203	4300	6503	SO:0001583	missense	2898	exon15			AACTGCATATGAT		CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2375A>G	chr6.hg19:g.102503268A>G	ENSP00000397026:p.His792Arg	95.0	0.0		151.0	62.0	NM_021956	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	ENST00000421544.1	hg19	CCDS5048.1	.	.	.	.	.	.	.	.	.	.	A	25.4	4.634718	0.87660	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86	5.68	5.68	0.88126	Ionotropic glutamate receptor (2);	0.046749	0.85682	D	0.000000	T	0.15003	0.0362	L	0.38838	1.175	0.58432	D	0.999993	D;D;D	0.56287	0.968;0.975;0.968	P;D;P	0.64321	0.875;0.924;0.832	T	0.01195	-1.1422	10	0.72032	D	0.01	.	15.9826	0.80125	1.0:0.0:0.0:0.0	.	792;792;792	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	R	792;792;792;716;792;743;567	ENSP00000397026:H792R;ENSP00000405596:H792R;ENSP00000358134:H792R;ENSP00000358133:H716R;ENSP00000313276:H792R;ENSP00000358130:H743R	ENSP00000313276:H792R	H	+	2	0	GRIK2	102609961	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.339000	0.96797	2.176000	0.68965	0.477000	0.44152	CAT	.	.		0.448	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000043718.1		
ADAT2	134637	hgsc.bcm.edu	37	6	143759816	143759816	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:143759816C>T	ENST00000237283.8	-	2	126	c.112G>A	c.(112-114)Gaa>Aaa	p.E38K	ADAT2_ENST00000606514.1_5'UTR|AL031320.1_ENST00000595616.1_Intron	NM_182503.2	NP_872309.2	Q7Z6V5	ADAT2_HUMAN	adenosine deaminase, tRNA-specific 2	38					tRNA wobble adenosine to inosine editing (GO:0002100)		tRNA-specific adenosine deaminase activity (GO:0008251)|zinc ion binding (GO:0008270)	p.E38K(1)		endometrium(2)|large_intestine(3)|lung(3)	8				OV - Ovarian serous cystadenocarcinoma(155;5.61e-06)|GBM - Glioblastoma multiforme(68;0.0115)		TCAGTATTTTCGAGGGCTTCT	0.393																																					p.E38K		Atlas-SNP	.											ADAT2,rectum,carcinoma,0,1	ADAT2	18	.	1	Substitution - Missense(1)	large_intestine(1)	c.G112A						.						153.0	136.0	141.0					6																	143759816		1864	4095	5959	SO:0001583	missense	134637	exon2			TATTTTCGAGGGC	BC037955	CCDS43511.1, CCDS69219.1	6q24.2	2014-01-28	2011-05-19	2007-08-16	ENSG00000189007	ENSG00000189007			21172	protein-coding gene	gene with protein product	tRNA-specific adenosine deaminase 2 homolog (S. cerevisiae)	615388	"""deaminase domain containing 1"", ""adenosine deaminase, tRNA-specific 2, TAD2 homolog (S. cerevisiae)"""	DEADC1		12457566	Standard	NM_182503		Approved	dJ20N2.1, TAD2	uc003qjj.3	Q7Z6V5	OTTHUMG00000015725	ENST00000237283.8:c.112G>A	chr6.hg19:g.143759816C>T	ENSP00000237283:p.Glu38Lys	58.0	0.0		94.0	36.0	NM_182503	A6NL12|B3KWY3|Q7Z327|Q8IY39	Missense_Mutation	SNP	ENST00000237283.8	hg19	CCDS43511.1	.	.	.	.	.	.	.	.	.	.	C	11.23	1.577853	0.28180	.	.	ENSG00000189007	ENST00000237283	T	0.39592	1.07	5.89	5.03	0.67393	Cytidine deaminase-like (1);CMP/dCMP deaminase, zinc-binding (1);	0.269079	0.42682	N	0.000677	T	0.07324	0.0185	N	0.04245	-0.25	0.80722	D	1	B	0.18166	0.026	B	0.14578	0.011	T	0.19289	-1.0310	10	0.07644	T	0.81	-10.9942	10.9233	0.47178	0.0:0.8581:0.0:0.1419	.	38	Q7Z6V5	ADAT2_HUMAN	K	38	ENSP00000237283:E38K	ENSP00000237283:E38K	E	-	1	0	ADAT2	143801509	0.996000	0.38824	0.517000	0.27799	0.677000	0.39632	2.248000	0.43160	1.507000	0.48752	0.563000	0.77884	GAA	.	.		0.393	ADAT2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000042517.1	XM_059727	
STXBP5	134957	hgsc.bcm.edu	37	6	147694876	147694876	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr6:147694876G>A	ENST00000321680.6	+	26	3091	c.3091G>A	c.(3091-3093)Ggt>Agt	p.G1031S	STXBP5_ENST00000367480.3_Missense_Mutation_p.G978S|STXBP5_ENST00000367481.3_Missense_Mutation_p.G995S|STXBP5_ENST00000179882.6_Missense_Mutation_p.G686S	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	1031					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		GGAAATGTTGGGTGAACTCTT	0.363																																					p.G1031S		Atlas-SNP	.											STXBP5_ENST00000321680,NS,carcinoma,0,2	STXBP5	163	.	0			c.G3091A						.						116.0	114.0	115.0					6																	147694876		2203	4300	6503	SO:0001583	missense	134957	exon26			ATGTTGGGTGAAC	AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.3091G>A	chr6.hg19:g.147694876G>A	ENSP00000321826:p.Gly1031Ser	104.0	0.0		119.0	45.0	NM_001127715	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Missense_Mutation	SNP	ENST00000321680.6	hg19	CCDS47499.1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779105	0.90195	.	.	ENSG00000164506	ENST00000367481;ENST00000321680;ENST00000367480;ENST00000179882	T;T;T;T	0.26518	1.87;1.73;2.01;2.51	5.71	5.71	0.89125	.	0.099686	0.64402	D	0.000002	T	0.23727	0.0574	L	0.58302	1.8	0.80722	D	1	B;P;P	0.38300	0.312;0.626;0.626	B;B;B	0.41619	0.103;0.361;0.361	T	0.01393	-1.1366	10	0.40728	T	0.16	.	19.8494	0.96733	0.0:0.0:1.0:0.0	.	995;1031;686	Q5T5C0-2;Q5T5C0;B3KXX0	.;STXB5_HUMAN;.	S	995;1031;978;686	ENSP00000356451:G995S;ENSP00000321826:G1031S;ENSP00000356450:G978S;ENSP00000179882:G686S	ENSP00000179882:G686S	G	+	1	0	STXBP5	147736569	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.312000	0.59154	2.705000	0.92388	0.585000	0.79938	GGT	.	.		0.363	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000042606.1		
DGKB	1607	hgsc.bcm.edu	37	7	14733789	14733789	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:14733789A>G	ENST00000403951.2	-	9	1041	c.622T>C	c.(622-624)Tat>Cat	p.Y208H	DGKB_ENST00000406247.3_Missense_Mutation_p.Y208H|DGKB_ENST00000402815.1_Missense_Mutation_p.Y208H|DGKB_ENST00000403963.1_5'UTR|DGKB_ENST00000407950.1_Missense_Mutation_p.Y201H|DGKB_ENST00000399322.3_Missense_Mutation_p.Y208H|DGKB_ENST00000444700.2_Missense_Mutation_p.Y201H|DGKB_ENST00000258767.5_Missense_Mutation_p.Y208H			Q9Y6T7	DGKB_HUMAN	diacylglycerol kinase, beta 90kDa	208	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|liver(1)|lung(34)|ovary(4)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	72						TCATGATCATAGTCAATTTCT	0.398																																					p.Y208H		Atlas-SNP	.											.	DGKB	166	.	0			c.T622C						.						69.0	65.0	66.0					7																	14733789		1900	4136	6036	SO:0001583	missense	1607	exon8			GATCATAGTCAAT	AB018261	CCDS47547.1, CCDS47548.1	7p21.2	2013-01-10	2002-08-29		ENSG00000136267	ENSG00000136267	2.7.1.107	"""EF-hand domain containing"""	2850	protein-coding gene	gene with protein product		604070	"""diacylglycerol kinase, beta (90kD)"""	DAGK2		7689223	Standard	NM_004080		Approved	KIAA0718, DGK, DGK-BETA	uc003ssz.3	Q9Y6T7	OTTHUMG00000152477	ENST00000403951.2:c.622T>C	chr7.hg19:g.14733789A>G	ENSP00000385780:p.Tyr208His	68.0	0.0		108.0	53.0	NM_145695	A4D116|A4D117|A8MXU2|O75241|Q2M377|Q75MF9|Q75MU7|Q86UI5|Q86UM9|Q9UQ29	Missense_Mutation	SNP	ENST00000403951.2	hg19	CCDS47547.1	.	.	.	.	.	.	.	.	.	.	A	26.7	4.763706	0.89932	.	.	ENSG00000136267	ENST00000403951;ENST00000399322;ENST00000258767;ENST00000402815;ENST00000407950;ENST00000444700;ENST00000406247	T;T;T;T;T;T;T	0.70631	-0.5;-0.5;-0.5;-0.5;-0.5;-0.5;-0.5	5.72	5.72	0.89469	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79505	0.4457	L	0.43923	1.385	0.80722	D	1	D;D;D;D	0.89917	1.0;0.98;0.98;1.0	D;D;D;D	0.80764	0.994;0.929;0.929;0.987	T	0.80587	-0.1316	10	0.56958	D	0.05	.	15.9926	0.80217	1.0:0.0:0.0:0.0	.	208;201;208;208	B7ZL83;C9JTC0;Q9Y6T7-2;Q9Y6T7	.;.;.;DGKB_HUMAN	H	208;208;208;208;201;201;208	ENSP00000385780:Y208H;ENSP00000382260:Y208H;ENSP00000258767:Y208H;ENSP00000384909:Y208H;ENSP00000385031:Y201H;ENSP00000388451:Y201H;ENSP00000386066:Y208H	ENSP00000258767:Y208H	Y	-	1	0	DGKB	14700314	1.000000	0.71417	1.000000	0.80357	0.857000	0.48899	9.339000	0.96797	2.179000	0.69175	0.482000	0.46254	TAT	.	.		0.398	DGKB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000326356.2	NM_004080	
WBSCR17	64409	hgsc.bcm.edu	37	7	71130456	71130456	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:71130456C>T	ENST00000333538.5	+	7	1775	c.1141C>T	c.(1141-1143)Cgg>Tgg	p.R381W	WBSCR17_ENST00000498380.2_3'UTR	NM_022479.1	NP_071924.1	Q6IS24	GLTL3_HUMAN	Williams-Beuren syndrome chromosome region 17	381	Catalytic subdomain B.				protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(5)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(7)|large_intestine(22)|lung(45)|ovary(2)|pancreas(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	100		all_cancers(73;0.2)|Lung NSC(55;0.094)|all_lung(88;0.125)				CCACATTGAGCGGAAGAAGAA	0.488																																					p.R381W		Atlas-SNP	.											.	WBSCR17	208	.	0			c.C1141T						.						106.0	100.0	102.0					7																	71130456		2203	4300	6503	SO:0001583	missense	64409	exon7			ATTGAGCGGAAGA	AF410457	CCDS5540.1	7q11.23	2014-03-13			ENSG00000185274	ENSG00000185274		"""Glycosyltransferase family 2 domain containing"""	16347	protein-coding gene	gene with protein product	"""polypeptide N-acetylgalactosaminyltransferase-like 3"", ""polypeptide GalNAc transferase 3"""	615137				12073013, 15744064, 22787146	Standard	NM_022479		Approved	GALNTL3, GalNAc-T5L	uc003tvy.4	Q6IS24	OTTHUMG00000129783	ENST00000333538.5:c.1141C>T	chr7.hg19:g.71130456C>T	ENSP00000329654:p.Arg381Trp	88.0	0.0		121.0	52.0	NM_022479	Q8NFV9|Q9NTA8	Missense_Mutation	SNP	ENST00000333538.5	hg19	CCDS5540.1	.	.	.	.	.	.	.	.	.	.	C	20.7	4.033947	0.75504	.	.	ENSG00000185274	ENST00000333538	T	0.69175	-0.38	5.85	1.83	0.25207	.	0.000000	0.85682	D	0.000000	D	0.88526	0.6460	H	0.98936	4.375	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.92381	0.5913	10	0.87932	D	0	.	15.3575	0.74440	0.6063:0.3937:0.0:0.0	.	381	Q6IS24	GLTL3_HUMAN	W	381	ENSP00000329654:R381W	ENSP00000329654:R381W	R	+	1	2	WBSCR17	70768392	0.877000	0.30153	1.000000	0.80357	0.987000	0.75469	1.218000	0.32467	0.362000	0.24319	-0.261000	0.10672	CGG	.	.		0.488	WBSCR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252006.1	NM_022479	
PCLO	27445	hgsc.bcm.edu	37	7	82584355	82584355	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:82584355T>C	ENST00000333891.9	-	5	6251	c.5914A>G	c.(5914-5916)Agt>Ggt	p.S1972G	PCLO_ENST00000423517.2_Missense_Mutation_p.S1972G	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTTAGCAGACTGCCATCTACC	0.368																																					p.S1972G		Atlas-SNP	.											.	PCLO	1506	.	0			c.A5914G						.						111.0	113.0	112.0					7																	82584355		1874	4099	5973	SO:0001583	missense	27445	exon5			GCAGACTGCCATC	AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.5914A>G	chr7.hg19:g.82584355T>C	ENSP00000334319:p.Ser1972Gly	82.0	0.0		109.0	51.0	NM_014510		Missense_Mutation	SNP	ENST00000333891.9	hg19	CCDS47630.1	.	.	.	.	.	.	.	.	.	.	T	0.423	-0.907069	0.02434	.	.	ENSG00000186472	ENST00000431819;ENST00000333891;ENST00000423517	T;T	0.16897	2.31;2.31	5.57	1.97	0.26223	.	.	.	.	.	T	0.08133	0.0203	N	0.03115	-0.41	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.006	T	0.32214	-0.9915	9	0.87932	D	0	.	8.8639	0.35274	0.0:0.2137:0.0:0.7863	.	1972;1972	Q9Y6V0-5;Q9Y6V0-6	.;.	G	1903;1972;1972	ENSP00000334319:S1972G;ENSP00000388393:S1972G	ENSP00000334319:S1972G	S	-	1	0	PCLO	82422291	0.094000	0.21725	0.039000	0.18376	0.313000	0.28021	0.211000	0.17474	0.408000	0.25621	0.533000	0.62120	AGT	.	.		0.368	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000337368.5	NM_014510	
KMT2E	55904	hgsc.bcm.edu	37	7	104749510	104749510	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:104749510A>C	ENST00000311117.3	+	23	4135	c.3590A>C	c.(3589-3591)gAt>gCt	p.D1197A	KMT2E_ENST00000334877.4_Missense_Mutation_p.D1197A|KMT2E_ENST00000334914.7_Missense_Mutation_p.D252A|KMT2E_ENST00000257745.4_Missense_Mutation_p.D1197A|SRPK2_ENST00000493638.1_5'Flank	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1197					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AACAATGGTGATGGCTGTGCC	0.468																																					p.D1197A		Atlas-SNP	.											.	MLL5	173	.	0			c.A3590C						.						109.0	94.0	99.0					7																	104749510		2203	4300	6503	SO:0001583	missense	55904	exon22			ATGGTGATGGCTG	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.3590A>C	chr7.hg19:g.104749510A>C	ENSP00000312379:p.Asp1197Ala	126.0	0.0		148.0	69.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.03|10.03	1.238644|1.238644	0.22711|0.22711	.|.	.|.	ENSG00000005483|ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914|ENST00000473063	D;D;D;T|.	0.91686|.	-2.89;-2.53;-2.89;0.83|.	5.65|5.65	4.51|4.51	0.55191|0.55191	.|.	0.189244|.	0.37053|.	N|.	0.002273|.	T|.	0.44393|.	0.1291|.	L|L	0.27053|0.27053	0.805|0.805	0.39578|0.39578	D|D	0.969391|0.969391	B|.	0.34103|.	0.437|.	B|.	0.27608|.	0.081|.	T|.	0.36383|.	-0.9750|.	10|.	0.44086|.	T|.	0.13|.	.|.	9.7341|9.7341	0.40377|0.40377	0.9225:0.0:0.0775:0.0|0.9225:0.0:0.0775:0.0	.|.	1197|.	Q8IZD2|.	MLL5_HUMAN|.	A|C	1197;1197;1197;1117;1197;252|8	ENSP00000312379:D1197A;ENSP00000335599:D1197A;ENSP00000257745:D1197A;ENSP00000333986:D252A|.	ENSP00000257745:D1197A|.	D|X	+|+	2|3	0|0	MLL5|MLL5	104536746|104536746	0.997000|0.997000	0.39634|0.39634	0.114000|0.114000	0.21550|0.21550	0.478000|0.478000	0.33099|0.33099	2.948000|2.948000	0.49066|0.49066	2.150000|2.150000	0.67090|0.67090	0.383000|0.383000	0.25322|0.25322	GAT|TGA	.	.		0.468	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
KMT2E	55904	hgsc.bcm.edu	37	7	104751284	104751284	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:104751284A>G	ENST00000311117.3	+	26	4582	c.4037A>G	c.(4036-4038)aAt>aGt	p.N1346S	KMT2E_ENST00000334877.4_Missense_Mutation_p.N1304S|KMT2E_ENST00000334914.7_Missense_Mutation_p.N401S|KMT2E_ENST00000257745.4_Missense_Mutation_p.N1346S|SRPK2_ENST00000493638.1_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1346					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										ACTTCTCAAAATACTTGTAAA	0.378																																					p.N1346S		Atlas-SNP	.											.	MLL5	173	.	0			c.A4037G						.						99.0	102.0	101.0					7																	104751284		2203	4300	6503	SO:0001583	missense	55904	exon25			CTCAAAATACTTG	AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4037A>G	chr7.hg19:g.104751284A>G	ENSP00000312379:p.Asn1346Ser	169.0	0.0		202.0	90.0	NM_018682	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	ENST00000311117.3	hg19	CCDS34723.1	.	.	.	.	.	.	.	.	.	.	A	11.08	1.534681	0.27475	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.91180	-2.8;-2.49;-2.8;0.96	4.48	-1.54	0.08584	.	0.703396	0.12818	N	0.436654	T	0.73087	0.3542	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.56673	-0.7940	10	0.09084	T	0.74	.	4.3451	0.11129	0.5002:0.0:0.1448:0.355	.	1266;1346	F8W6H1;Q8IZD2	.;MLL5_HUMAN	S	1346;1346;1304;1266;1346;401	ENSP00000312379:N1346S;ENSP00000335599:N1304S;ENSP00000257745:N1346S;ENSP00000333986:N401S	ENSP00000257745:N1346S	N	+	2	0	MLL5	104538520	1.000000	0.71417	0.483000	0.27378	0.888000	0.51559	1.336000	0.33850	-0.483000	0.06772	-0.669000	0.03829	AAT	.	.		0.378	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348697.1		
PODXL	5420	hgsc.bcm.edu	37	7	131241029	131241029	+	Silent	SNP	G	G	C	rs11277659|rs547816245|rs532078953|rs79759078|rs571821675	byFrequency	TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:131241029G>C	ENST00000378555.3	-	1	337	c.90C>G	c.(88-90)ccC>ccG	p.P30P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Silent_p.P30P|PODXL_ENST00000322985.9_Silent_p.P30P|PODXL_ENST00000541194.1_Silent_p.P30P			O00592	PODXL_HUMAN	podocalyxin-like	30					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					CATTCTGGGAGggcgacggcg	0.751																																					p.P30P		Atlas-SNP	.											.	PODXL	53	.	0			c.C90G						.						5.0	7.0	6.0					7																	131241029		1981	3946	5927	SO:0001819	synonymous_variant	5420	exon1			CTGGGAGGGCGAC		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.90C>G	chr7.hg19:g.131241029G>C		89.0	0.0		88.0	8.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Silent	SNP	ENST00000378555.3	hg19	CCDS34755.1																																																																																			.	.		0.751	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
PODXL	5420	hgsc.bcm.edu	37	7	131241055	131241055	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:131241055A>G	ENST00000378555.3	-	1	311	c.64T>C	c.(64-66)Tcg>Ccg	p.S22P	PODXL_ENST00000465001.1_Intron|PODXL_ENST00000537928.1_Missense_Mutation_p.S22P|PODXL_ENST00000322985.9_Missense_Mutation_p.S22P|PODXL_ENST00000541194.1_Missense_Mutation_p.S22P			O00592	PODXL_HUMAN	podocalyxin-like	22					cell adhesion (GO:0007155)|cell migration (GO:0016477)|epithelial tube formation (GO:0072175)|glomerular visceral epithelial cell development (GO:0072015)|leukocyte migration (GO:0050900)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-cell adhesion (GO:0022408)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|regulation of microvillus assembly (GO:0032534)	apical plasma membrane (GO:0016324)|cell body (GO:0044297)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|slit diaphragm (GO:0036057)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Melanoma(18;0.162)					gacggcgacgacggcagcagc	0.741																																					p.S22P		Atlas-SNP	.											.	PODXL	53	.	0			c.T64C						.						5.0	8.0	7.0					7																	131241055		1914	3836	5750	SO:0001583	missense	5420	exon1			GCGACGACGGCAG		CCDS34755.1, CCDS47714.1	7q32-q33	2008-07-18			ENSG00000128567	ENSG00000128567			9171	protein-coding gene	gene with protein product		602632					Standard	NM_001018111		Approved	PCLP, Gp200, PC	uc003vqx.4	O00592	OTTHUMG00000154918	ENST00000378555.3:c.64T>C	chr7.hg19:g.131241055A>G	ENSP00000367817:p.Ser22Pro	94.0	0.0		98.0	7.0	NM_001018111	A6NHX8|Q52LZ7|Q53ER6	Missense_Mutation	SNP	ENST00000378555.3	hg19	CCDS34755.1	.	.	.	.	.	.	.	.	.	.	A	10.93	1.488975	0.26686	.	.	ENSG00000128567	ENST00000541194;ENST00000537928;ENST00000378555;ENST00000322985	T;T;T;T	0.12774	2.82;2.65;2.82;2.85	.	.	.	.	7739.210000	0.00166	U	0.000000	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	0.999994	.	.	.	.	.	.	T	0.24728	-1.0152	6	0.29301	T	0.29	.	.	.	.	.	22;22	O00592-2;O00592	.;PODXL_HUMAN	P	22	ENSP00000440518:S22P;ENSP00000442655:S22P;ENSP00000367817:S22P;ENSP00000319782:S22P	ENSP00000319782:S22P	S	-	1	0	PODXL	130891595	0.001000	0.12720	0.027000	0.17364	0.027000	0.11550	0.743000	0.26231	0.056000	0.16144	0.055000	0.15244	TCG	.	.		0.741	PODXL-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000337627.2	NM_001018111	
PRKAG2	51422	hgsc.bcm.edu	37	7	151573596	151573596	+	Missense_Mutation	SNP	A	A	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr7:151573596A>C	ENST00000287878.4	-	1	614	c.110T>G	c.(109-111)aTt>aGt	p.I37S	PRKAG2-AS1_ENST00000464464.1_RNA|PRKAG2-AS1_ENST00000467458.1_RNA	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit	37					ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	ACTCACCGGAATGTGCACGCG	0.662																																					p.I37S		Atlas-SNP	.											.	PRKAG2	86	.	0			c.T110G						.						86.0	86.0	86.0					7																	151573596		2203	4300	6503	SO:0001583	missense	51422	exon1			ACCGGAATGTGCA	AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.110T>G	chr7.hg19:g.151573596A>C	ENSP00000287878:p.Ile37Ser	51.0	0.0		61.0	20.0	NM_016203	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	Missense_Mutation	SNP	ENST00000287878.4	hg19	CCDS5928.1	.	.	.	.	.	.	.	.	.	.	A	16.88	3.244216	0.59103	.	.	ENSG00000106617	ENST00000287878	D	0.86097	-2.07	4.01	4.01	0.46588	.	0.062584	0.64402	D	0.000006	D	0.82788	0.5113	N	0.24115	0.695	0.80722	D	1	D;P	0.69078	0.997;0.808	P;B	0.62184	0.899;0.161	T	0.78952	-0.2001	10	0.22706	T	0.39	.	9.3009	0.37845	1.0:0.0:0.0:0.0	.	37;37	Q8NCK6;Q9UGJ0	.;AAKG2_HUMAN	S	37	ENSP00000287878:I37S	ENSP00000287878:I37S	I	-	2	0	PRKAG2	151204529	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.271000	0.58902	1.692000	0.51112	0.369000	0.22263	ATT	.	.		0.662	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000348440.2	NM_016203	
ADAM7	8756	hgsc.bcm.edu	37	8	24346811	24346811	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr8:24346811G>T	ENST00000175238.6	+	12	1314	c.1231G>T	c.(1231-1233)Gat>Tat	p.D411Y	RP11-624C23.1_ENST00000519689.1_RNA|ADAM7_ENST00000520720.1_Missense_Mutation_p.D183Y|RP11-561E1.1_ENST00000519364.1_RNA|ADAM7_ENST00000380789.1_Missense_Mutation_p.D411Y|RP11-624C23.1_ENST00000523578.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	411	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CAAGAAGTTGGATGAGGGTGA	0.388																																					p.D411Y		Atlas-SNP	.											.	ADAM7	165	.	0			c.G1231T						.						100.0	87.0	92.0					8																	24346811		2203	4300	6503	SO:0001583	missense	8756	exon12			AAGTTGGATGAGG	AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.1231G>T	chr8.hg19:g.24346811G>T	ENSP00000175238:p.Asp411Tyr	106.0	0.0		109.0	55.0	NM_003817	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	ENST00000175238.6	hg19	CCDS6045.1	.	.	.	.	.	.	.	.	.	.	G	19.24	3.790132	0.70337	.	.	ENSG00000069206	ENST00000175238;ENST00000380789;ENST00000520720;ENST00000335595	T;T;T	0.13307	2.6;2.6;2.6	5.74	5.74	0.90152	Blood coagulation inhibitor, Disintegrin (4);Metallopeptidase, catalytic domain (1);	0.220934	0.31709	N	0.007181	T	0.44644	0.1303	M	0.87097	2.86	0.46521	D	0.999081	D;D	0.89917	0.999;1.0	D;D	0.72338	0.964;0.977	T	0.48151	-0.9060	10	0.87932	D	0	.	17.4289	0.87534	0.0:0.0:1.0:0.0	.	183;411	E5RK87;Q9H2U9	.;ADAM7_HUMAN	Y	411;411;183;226	ENSP00000175238:D411Y;ENSP00000370166:D411Y;ENSP00000430400:D183Y	ENSP00000175238:D411Y	D	+	1	0	ADAM7	24402701	1.000000	0.71417	1.000000	0.80357	0.691000	0.40173	6.778000	0.75043	2.703000	0.92315	0.655000	0.94253	GAT	.	.		0.388	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000215150.1	NM_003817	
MBOAT4	619373	hgsc.bcm.edu	37	8	29996075	29996075	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr8:29996075T>C	ENST00000320542.3	-	2	401	c.317A>G	c.(316-318)tAt>tGt	p.Y106C		NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4	106					cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						ATGCAGATAATACTCAGTGTA	0.537																																					p.Y106C		Atlas-SNP	.											.	MBOAT4	31	.	0			c.A317G						.						37.0	38.0	37.0					8																	29996075		692	1591	2283	SO:0001583	missense	619373	exon2			AGATAATACTCAG	AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.317A>G	chr8.hg19:g.29996075T>C	ENSP00000314196:p.Tyr106Cys	218.0	0.0		309.0	127.0	NM_001100916	B1Q003	Missense_Mutation	SNP	ENST00000320542.3	hg19	CCDS47835.1	.	.	.	.	.	.	.	.	.	.	T	17.23	3.336980	0.60963	.	.	ENSG00000177669	ENST00000320542	T	0.25250	1.81	5.44	5.44	0.79542	.	.	.	.	.	T	0.39091	0.1065	L	0.47716	1.5	0.80722	D	1	D	0.64830	0.994	P	0.60345	0.873	T	0.05869	-1.0859	8	.	.	.	.	13.5122	0.61519	0.0:0.0:0.0:1.0	.	106	Q96T53	MBOA4_HUMAN	C	106	ENSP00000314196:Y106C	.	Y	-	2	0	MBOAT4	30115617	0.998000	0.40836	1.000000	0.80357	0.753000	0.42808	2.962000	0.49176	2.284000	0.76573	0.523000	0.50628	TAT	.	.		0.537	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000375795.1		
TTI2	80185	hgsc.bcm.edu	37	8	33360999	33360999	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr8:33360999T>C	ENST00000431156.2	-	6	1825	c.1207A>G	c.(1207-1209)Aga>Gga	p.R403G	TTI2_ENST00000360742.5_Missense_Mutation_p.R403G|TTI2_ENST00000520636.1_Missense_Mutation_p.R372G|TTI2_ENST00000519356.1_5'UTR	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	403																	ATCTTCAGTCTAGCTTCCTCC	0.448																																					p.R403G		Atlas-SNP	.											.	.	.	.	0			c.A1207G						.						169.0	169.0	169.0					8																	33360999		2203	4300	6503	SO:0001583	missense	80185	exon6			TCAGTCTAGCTTC	AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.1207A>G	chr8.hg19:g.33360999T>C	ENSP00000411169:p.Arg403Gly	85.0	0.0		112.0	44.0	NM_001265581	D3DSV7|Q96IM2|Q9H5N4	Missense_Mutation	SNP	ENST00000431156.2	hg19	CCDS6090.1	.	.	.	.	.	.	.	.	.	.	T	17.94	3.510758	0.64522	.	.	ENSG00000129696	ENST00000360742;ENST00000431156;ENST00000522668;ENST00000520636	T;T;T	0.72505	-0.66;-0.66;-0.65	6.17	3.62	0.41486	.	0.000000	0.85682	D	0.000000	T	0.81777	0.4894	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	T	0.83330	-0.0013	10	0.72032	D	0.01	-20.8393	12.5136	0.56019	0.0:0.0:0.2627:0.7373	.	403;372	Q6NXR4;E5RIH5	TTI2_HUMAN;.	G	403;403;392;372	ENSP00000353971:R403G;ENSP00000411169:R403G;ENSP00000428401:R372G	ENSP00000353971:R403G	R	-	1	2	C8orf41	33480541	0.695000	0.27747	0.145000	0.22337	0.807000	0.45602	0.981000	0.29526	1.104000	0.41587	0.533000	0.62120	AGA	.	.		0.448	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000376555.1	NM_025115	
KIAA1429	25962	hgsc.bcm.edu	37	8	95531278	95531278	+	Silent	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr8:95531278A>G	ENST00000297591.5	-	9	2523	c.2448T>C	c.(2446-2448)ttT>ttC	p.F816F	KIAA1429_ENST00000421249.2_Silent_p.F816F|KIAA1429_ENST00000437199.1_Silent_p.F816F	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	816					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			TCTCCAGACTAAAAACATGGC	0.373																																					p.F816F		Atlas-SNP	.											.	KIAA1429	176	.	0			c.T2448C						.						57.0	62.0	60.0					8																	95531278		2203	4300	6503	SO:0001819	synonymous_variant	25962	exon9			CAGACTAAAAACA	AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.2448T>C	chr8.hg19:g.95531278A>G		62.0	0.0		77.0	36.0	NM_015496	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Silent	SNP	ENST00000297591.5	hg19	CCDS34923.1																																																																																			.	.		0.373	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000378720.2	NM_015496	
GRIN3A	116443	hgsc.bcm.edu	37	9	104500017	104500017	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr9:104500017T>C	ENST00000361820.3	-	1	845	c.245A>G	c.(244-246)gAg>gGg	p.E82G		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	82					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGTCCCTGGCTCCGGCTCATC	0.781																																					p.E82G		Atlas-SNP	.											.	GRIN3A	186	.	0			c.A245G						.						2.0	2.0	2.0					9																	104500017		1438	3039	4477	SO:0001583	missense	116443	exon1			CCTGGCTCCGGCT		CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.245A>G	chr9.hg19:g.104500017T>C	ENSP00000355155:p.Glu82Gly	10.0	0.0		27.0	12.0	NM_133445	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	ENST00000361820.3	hg19	CCDS6758.1	.	.	.	.	.	.	.	.	.	.	T	7.830	0.719635	0.15372	.	.	ENSG00000198785	ENST00000361820	T	0.10382	2.88	5.31	0.763	0.18459	.	1.535890	0.03332	N	0.193615	T	0.06005	0.0156	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34004	-0.9846	10	0.30854	T	0.27	.	4.7153	0.12893	0.0:0.2541:0.1614:0.5845	.	82	Q8TCU5	NMD3A_HUMAN	G	82	ENSP00000355155:E82G	ENSP00000355155:E82G	E	-	2	0	GRIN3A	103539838	0.023000	0.18921	0.129000	0.21949	0.850000	0.48378	0.664000	0.25068	0.291000	0.22468	0.533000	0.62120	GAG	.	.		0.781	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053453.1		
C5	727	hgsc.bcm.edu	37	9	123716025	123716025	+	Silent	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr9:123716025T>C	ENST00000223642.1	-	40	4913	c.4884A>G	c.(4882-4884)aaA>aaG	p.K1628K		NM_001735.2	NP_001726.2	P01031	CO5_HUMAN	complement component 5	1628	NTR. {ECO:0000255|PROSITE- ProRule:PRU00295}.				activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cell surface receptor signaling pathway (GO:0007166)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|in utero embryonic development (GO:0001701)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukocyte migration involved in inflammatory response (GO:0002523)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of macrophage chemotaxis (GO:0010760)|negative regulation of norepinephrine secretion (GO:0010700)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of chemotaxis (GO:0050921)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of complement activation (GO:0030449)|response to stress (GO:0006950)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	chemokine activity (GO:0008009)|endopeptidase inhibitor activity (GO:0004866)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(14)|lung(5)|ovary(2)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	46				OV - Ovarian serous cystadenocarcinoma(323;4.98e-53)|GBM - Glioblastoma multiforme(294;0.0242)	Eculizumab(DB01257)|Intravenous Immunoglobulin(DB00028)	TGAAATTGTATTTTATCTGGA	0.343																																					p.K1628K		Atlas-SNP	.											.	C5	124	.	0			c.A4884G						.						112.0	112.0	112.0					9																	123716025		2203	4300	6503	SO:0001819	synonymous_variant	727	exon40			ATTGTATTTTATC	M57729	CCDS6826.1	9q33-q34	2014-09-17			ENSG00000106804	ENSG00000106804		"""Complement system"", ""Endogenous ligands"""	1331	protein-coding gene	gene with protein product	"""prepro-C5"", ""C5a anaphylatoxin"""	120900					Standard	NM_001735		Approved	CPAMD4, C5a, C5b	uc004bkv.3	P01031	OTTHUMG00000020579	ENST00000223642.1:c.4884A>G	chr9.hg19:g.123716025T>C		104.0	0.0		159.0	72.0	NM_001735	Q14CJ0|Q27I61	Silent	SNP	ENST00000223642.1	hg19	CCDS6826.1																																																																																			.	.		0.343	C5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000053844.1	NM_001735	
ASS1	445	hgsc.bcm.edu	37	9	133355124	133355124	+	Missense_Mutation	SNP	A	A	G	rs565520844		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr9:133355124A>G	ENST00000372394.1	+	11	1191	c.710A>G	c.(709-711)aAc>aGc	p.N237S	ASS1_ENST00000372393.3_Missense_Mutation_p.N237S|ASS1_ENST00000493984.2_Intron|ASS1_ENST00000352480.5_Missense_Mutation_p.N237S			P00966	ASSY_HUMAN	argininosuccinate synthase 1	237					acute-phase response (GO:0006953)|aging (GO:0007568)|arginine biosynthetic process (GO:0006526)|argininosuccinate metabolic process (GO:0000053)|aspartate metabolic process (GO:0006531)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to amine stimulus (GO:0071418)|cellular response to amino acid stimulus (GO:0071230)|cellular response to ammonium ion (GO:0071242)|cellular response to cAMP (GO:0071320)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to glucagon stimulus (GO:0071377)|cellular response to interferon-gamma (GO:0071346)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to oleic acid (GO:0071400)|cellular response to tumor necrosis factor (GO:0071356)|citrulline metabolic process (GO:0000052)|diaphragm development (GO:0060539)|kidney development (GO:0001822)|liver development (GO:0001889)|midgut development (GO:0007494)|negative regulation of leukocyte cell-cell adhesion (GO:1903038)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to growth hormone (GO:0060416)|response to mycotoxin (GO:0010046)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|perikaryon (GO:0043204)	amino acid binding (GO:0016597)|argininosuccinate synthase activity (GO:0004055)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|toxic substance binding (GO:0015643)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(145;0.000514)	Adenosine triphosphate(DB00171)|L-Arginine(DB00125)|L-Aspartic Acid(DB00128)|L-Citrulline(DB00155)	AAGGTGACCAACGTCAAGGAT	0.647													A|||	1	0.000199681	0.0	0.0014	5008	,	,		15958	0.0		0.0	False		,,,				2504	0.0				p.N237S		Atlas-SNP	.											.	ASS1	37	.	0			c.A710G						.						75.0	69.0	71.0					9																	133355124		2203	4300	6503	SO:0001583	missense	445	exon10			TGACCAACGTCAA	X01630	CCDS6933.1	9q34.1	2012-10-02	2010-04-20	2006-08-24	ENSG00000130707	ENSG00000130707	6.3.4.5		758	protein-coding gene	gene with protein product		603470	"""argininosuccinate synthetase"""	ASS		3513483, 852520	Standard	NM_054012		Approved	CTLN1	uc004bzm.3	P00966	OTTHUMG00000020806	ENST00000372394.1:c.710A>G	chr9.hg19:g.133355124A>G	ENSP00000361471:p.Asn237Ser	62.0	0.0		69.0	40.0	NM_054012	Q6LDL2|Q86UZ0|Q96GT4	Missense_Mutation	SNP	ENST00000372394.1	hg19	CCDS6933.1	.	.	.	.	.	.	.	.	.	.	A	10.37	1.331893	0.24167	.	.	ENSG00000130707	ENST00000334909;ENST00000352480;ENST00000372394;ENST00000372393	D;D;D	0.99070	-5.39;-5.39;-5.39	4.91	3.77	0.43336	Argininosuccinate synthetase, catalytic/multimerisation domain body (1);	0.108900	0.64402	U	0.000014	D	0.97099	0.9052	L	0.54965	1.715	0.42711	D	0.993645	B;B;B;B;B	0.27559	0.003;0.181;0.181;0.003;0.003	B;B;B;B;B	0.19148	0.01;0.024;0.024;0.01;0.01	D	0.95080	0.8212	10	0.72032	D	0.01	.	9.5703	0.39425	0.9164:0.0:0.0836:0.0	.	237;120;120;237;237	A8KAP9;B4E395;E9PDT0;Q5T6L4;P00966	.;.;.;.;ASSY_HUMAN	S	237	ENSP00000253004:N237S;ENSP00000361471:N237S;ENSP00000361469:N237S	ENSP00000361470:N237S	N	+	2	0	ASS1	132344945	1.000000	0.71417	0.997000	0.53966	0.947000	0.59692	6.347000	0.73004	0.729000	0.32403	0.383000	0.25322	AAC	.	.		0.647	ASS1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000054652.1	NM_000050	
ANAPC2	29882	hgsc.bcm.edu	37	9	140077677	140077677	+	Missense_Mutation	SNP	T	T	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr9:140077677T>A	ENST00000323927.2	-	6	1190	c.1186A>T	c.(1186-1188)Atc>Ttc	p.I396F		NM_013366.3	NP_037498.1	Q9UJX6	ANC2_HUMAN	anaphase promoting complex subunit 2	396					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				breast(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	15	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.37e-05)|Epithelial(140;0.000858)		AGGGTGATGATGTCACACGTG	0.622																																					p.I396F		Atlas-SNP	.											.	ANAPC2	57	.	0			c.A1186T						.						141.0	137.0	138.0					9																	140077677		2203	4300	6503	SO:0001583	missense	29882	exon6			TGATGATGTCACA	AB037827	CCDS7033.1	9q34.3	2011-06-15			ENSG00000176248	ENSG00000176248		"""Anaphase promoting complex subunits"""	19989	protein-coding gene	gene with protein product		606946				11739784	Standard	NM_013366		Approved	APC2, KIAA1406	uc004clr.1	Q9UJX6	OTTHUMG00000020983	ENST00000323927.2:c.1186A>T	chr9.hg19:g.140077677T>A	ENSP00000314004:p.Ile396Phe	84.0	0.0		115.0	51.0	NM_013366	Q5VSG1|Q96DG5|Q96GG4|Q9P2E1	Missense_Mutation	SNP	ENST00000323927.2	hg19	CCDS7033.1	.	.	.	.	.	.	.	.	.	.	T	25.0	4.590530	0.86851	.	.	ENSG00000176248	ENST00000323927	T	0.03524	3.9	4.83	4.83	0.62350	.	0.071723	0.64402	D	0.000001	T	0.22627	0.0546	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.984	T	0.02844	-1.1103	10	0.87932	D	0	-30.9235	12.3771	0.55285	0.0:0.0:0.0:1.0	.	396;393	Q9UJX6;Q9UJX6-2	ANC2_HUMAN;.	F	396	ENSP00000314004:I396F	ENSP00000314004:I396F	I	-	1	0	ANAPC2	139197498	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.346000	0.79347	2.034000	0.60081	0.459000	0.35465	ATC	.	.		0.622	ANAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055315.1	NM_013366	
CACNA1B	774	hgsc.bcm.edu	37	9	141014753	141014753	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr9:141014753G>A	ENST00000371372.1	+	45	6312	c.6167G>A	c.(6166-6168)tGc>tAc	p.C2056Y	CACNA1B_ENST00000371357.1_Missense_Mutation_p.C2055Y|CACNA1B_ENST00000371363.1_Missense_Mutation_p.C2054Y|CACNA1B_ENST00000277551.2_Missense_Mutation_p.C2056Y|CACNA1B_ENST00000371355.4_Missense_Mutation_p.C2057Y|CACNA1B_ENST00000277549.5_Missense_Mutation_p.C1250Y	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	2056					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CACCACCGCTGCCACCGCCGC	0.711																																					p.C2056Y		Atlas-SNP	.											.	CACNA1B	266	.	0			c.G6167A						.						8.0	12.0	11.0					9																	141014753		2085	4168	6253	SO:0001583	missense	774	exon44			ACCGCTGCCACCG	AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.6167G>A	chr9.hg19:g.141014753G>A	ENSP00000360423:p.Cys2056Tyr	58.0	0.0		37.0	21.0	NM_001243812	B1AQK5	Missense_Mutation	SNP	ENST00000371372.1	hg19	CCDS59522.1	.	.	.	.	.	.	.	.	.	.	G	12.12	1.843331	0.32606	.	.	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.96967	-3.94;-3.99;-4.19;-3.94;-3.93;-3.93	4.44	4.44	0.53790	.	2.332040	0.01458	N	0.015755	D	0.96883	0.8982	L	0.36672	1.1	0.80722	D	1	D;D	0.76494	0.992;0.999	P;D	0.68621	0.901;0.959	D	0.86923	0.2068	10	0.02654	T	1	.	17.0694	0.86569	0.0:0.0:1.0:0.0	.	2055;2054	B1AQK7;B1AQK6	.;.	Y	2056;2056;1250;2054;2055;2057	ENSP00000360423:C2056Y;ENSP00000277551:C2056Y;ENSP00000277549:C1250Y;ENSP00000360414:C2054Y;ENSP00000360408:C2055Y;ENSP00000360406:C2057Y	ENSP00000277549:C1250Y	C	+	2	0	CACNA1B	140134574	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	8.703000	0.91344	2.027000	0.59764	0.313000	0.20887	TGC	.	.		0.711	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000055380.1	NM_000718	
SLC39A12	221074	hgsc.bcm.edu	37	10	18242319	18242319	+	Silent	SNP	G	G	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr10:18242319G>C	ENST00000377369.2	+	2	387	c.114G>C	c.(112-114)ggG>ggC	p.G38G	SLC39A12_ENST00000377374.4_Silent_p.G38G|SLC39A12_ENST00000377371.3_Silent_p.G38G|SLC39A12_ENST00000539911.1_Intron	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	38					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						GAAGCCGTGGGAGTTCAGGCC	0.512																																					p.G38G		Atlas-SNP	.											.	SLC39A12	181	.	0			c.G114C						.						94.0	91.0	92.0					10																	18242319		2203	4300	6503	SO:0001819	synonymous_variant	221074	exon2			CCGTGGGAGTTCA		CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.114G>C	chr10.hg19:g.18242319G>C		143.0	0.0		205.0	101.0	NM_152725	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Silent	SNP	ENST00000377369.2	hg19	CCDS44362.1																																																																																			.	.		0.512	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding		NM_152725	
DCLRE1A	9937	hgsc.bcm.edu	37	10	115612648	115612648	+	Silent	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr10:115612648T>C	ENST00000361384.2	-	1	1211	c.294A>G	c.(292-294)ccA>ccG	p.P98P	DCLRE1A_ENST00000476112.1_5'Flank|NHLRC2_ENST00000369301.3_5'Flank|DCLRE1A_ENST00000369305.1_Silent_p.P98P	NM_014881.3	NP_055696.3	Q6PJP8	DCR1A_HUMAN	DNA cross-link repair 1A	98	Nuclear localization region.				mitotic nuclear division (GO:0007067)|nucleotide-excision repair (GO:0006289)	nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(1)|skin(2)|urinary_tract(1)	31				Epithelial(162;0.0157)|all cancers(201;0.0171)		AGAGTTTTCCTGGAGTAGTTT	0.438								Other identified genes with known or suspected DNA repair function																													p.P98P		Atlas-SNP	.											.	DCLRE1A	80	.	0			c.A294G						.						273.0	262.0	266.0					10																	115612648		2203	4300	6503	SO:0001819	synonymous_variant	9937	exon1			TTTTCCTGGAGTA		CCDS7584.1	10q25.1	2010-06-24	2010-06-24		ENSG00000198924	ENSG00000198924			17660	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	609682	"""DNA cross-link repair 1A (PSO2 homolog, S. cerevisiae)"""			9806498, 17804464	Standard	NM_014881		Approved	SNM1, PSO2, KIAA0086, hSNM1	uc031pxf.1	Q6PJP8	OTTHUMG00000019077	ENST00000361384.2:c.294A>G	chr10.hg19:g.115612648T>C		124.0	0.0		72.0	67.0	NM_014881	D3DRC1|Q14701|Q6P5Y3|Q6PKL4	Silent	SNP	ENST00000361384.2	hg19	CCDS7584.1																																																																																			.	.		0.438	DCLRE1A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000050444.1	NM_014881	
GPR123	84435	hgsc.bcm.edu	37	10	134942314	134942314	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr10:134942314C>T	ENST00000392607.3	+	7	1418	c.982C>T	c.(982-984)Cac>Tac	p.H328Y	GPR123_ENST00000392606.2_Missense_Mutation_p.H231Y|GPR123_ENST00000607359.1_Missense_Mutation_p.H1047Y	NM_001083909.1	NP_001077378.1	Q86SQ6	GP123_HUMAN	G protein-coupled receptor 123	328					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(3)	14		all_cancers(35;1.8e-10)|all_epithelial(44;8.95e-09)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Colorectal(31;0.0585)|Melanoma(40;0.123)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;9.16e-06)|Epithelial(32;1.21e-05)|all cancers(32;1.63e-05)		CAAGGACGCCCACCCCGCACT	0.741																																					p.H328Y		Atlas-SNP	.											.	GPR123	118	.	0			c.C982T						.						19.0	18.0	18.0					10																	134942314		2154	4229	6383	SO:0001583	missense	84435	exon7			GACGCCCACCCCG	AB058731	CCDS41580.1	10q26	2014-08-08			ENSG00000197177	ENSG00000197177		"""-"", ""GPCR / Class B : Orphans"""	13838	protein-coding gene	gene with protein product		612302				12565841	Standard	XM_005252695		Approved	KIAA1828	uc001llw.3	Q86SQ6	OTTHUMG00000019304	ENST00000392607.3:c.982C>T	chr10.hg19:g.134942314C>T	ENSP00000376384:p.His328Tyr	74.0	0.0		62.0	58.0	NM_001083909	A5HL16|A6NG50|Q5T234|Q86SN7|Q96JJ9	Missense_Mutation	SNP	ENST00000392607.3	hg19	CCDS41580.1	.	.	.	.	.	.	.	.	.	.	.	0.007	-1.971817	0.00457	.	.	ENSG00000197177	ENST00000368577;ENST00000392607;ENST00000392606	T	0.03982	3.74	4.14	1.1	0.20463	.	0.933617	0.08910	N	0.875932	T	0.05181	0.0138	L	0.36672	1.1	0.09310	N	1	B;B	0.25351	0.0;0.124	B;B	0.26517	0.0;0.07	T	0.42531	-0.9446	10	0.49607	T	0.09	.	7.5999	0.28069	0.0:0.5681:0.3374:0.0945	.	328;1047	Q86SQ6;Q86SQ6-1	GP123_HUMAN;.	Y	1047;328;232	ENSP00000376384:H328Y	ENSP00000357566:H1047Y	H	+	1	0	GPR123	134792304	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-1.616000	0.02053	0.129000	0.18514	0.561000	0.74099	CAC	.	.		0.741	GPR123-003	NOVEL	basic|appris_candidate|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000051113.2		
INS	3630	hgsc.bcm.edu	37	11	2181222	2181222	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr11:2181222G>T	ENST00000397262.1	-	2	425	c.193C>A	c.(193-195)Cag>Aag	p.Q65K	INS-IGF2_ENST00000481781.1_5'Flank|INS_ENST00000250971.3_Missense_Mutation_p.Q65K|INS-IGF2_ENST00000397270.1_Intron|INS_ENST00000381330.4_Missense_Mutation_p.Q65K|INS_ENST00000512523.1_Intron	NM_001185098.1	NP_001172027.1	P01308	INS_HUMAN	insulin	65					activation of protein kinase B activity (GO:0032148)|acute-phase response (GO:0006953)|alpha-beta T cell activation (GO:0046631)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|fatty acid homeostasis (GO:0055089)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of fatty acid metabolic process (GO:0045922)|negative regulation of feeding behavior (GO:2000252)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of glycogen catabolic process (GO:0045818)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of protein secretion (GO:0050709)|negative regulation of proteolysis (GO:0045861)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|negative regulation of vasodilation (GO:0045908)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of respiratory burst (GO:0060267)|positive regulation of vasodilation (GO:0045909)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of insulin secretion (GO:0050796)|regulation of protein localization (GO:0032880)|regulation of protein secretion (GO:0050708)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transmembrane transporter activity (GO:0022898)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	endoplasmic reticulum lumen (GO:0005788)|endosome lumen (GO:0031904)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)|identical protein binding (GO:0042802)|insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|protease binding (GO:0002020)			haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)	5		Lung NSC(207;8.94e-06)|all_epithelial(84;3.17e-05)|all_lung(207;3.67e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)	Colorectal(5;0.00245)|COAD - Colon adenocarcinoma(6;0.0239)	BRCA - Breast invasive adenocarcinoma(625;0.0025)|LUSC - Lung squamous cell carcinoma(625;0.082)|Lung(200;0.14)		AGCTCCACCTGCCCCACTGCC	0.682																																					p.Q65K		Atlas-SNP	.											.	INS	10	.	0			c.C193A						.						19.0	19.0	19.0					11																	2181222		2170	4273	6443	SO:0001583	missense	3630	exon3			CCACCTGCCCCAC	X70508	CCDS7729.1	11p15.5	2014-02-03			ENSG00000254647	ENSG00000254647			6081	protein-coding gene	gene with protein product		176730	"""insulin-dependent diabetes mellitus 2"""	IDDM2, IDDM1		6243748, 7773291	Standard	NM_000207		Approved			P01308	OTTHUMG00000009558	ENST00000397262.1:c.193C>A	chr11.hg19:g.2181222G>T	ENSP00000380432:p.Gln65Lys	42.0	0.0		39.0	22.0	NM_001185097	Q5EEX2	Missense_Mutation	SNP	ENST00000397262.1	hg19	CCDS7729.1	.	.	.	.	.	.	.	.	.	.	G	2.388	-0.340403	0.05243	.	.	ENSG00000254647	ENST00000397262;ENST00000250971;ENST00000381330	D;D;D	0.88509	-2.39;-2.39;-2.39	3.5	1.44	0.22558	Insulin-like (4);	.	.	.	.	D	0.87633	0.6226	M	0.80028	2.48	0.09310	N	0.999998	B	0.31351	0.32	B	0.34991	0.193	T	0.72500	-0.4274	9	0.10111	T	0.7	.	11.4432	0.50109	0.0:0.3187:0.6813:0.0	.	65	P01308	INS_HUMAN	K	65	ENSP00000380432:Q65K;ENSP00000250971:Q65K;ENSP00000370731:Q65K	ENSP00000250971:Q65K	Q	-	1	0	INS	2137798	0.000000	0.05858	0.004000	0.12327	0.194000	0.23727	0.033000	0.13754	0.256000	0.21614	0.462000	0.41574	CAG	.	.		0.682	INS-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000026395.3	NM_000207	
KIF18A	81930	hgsc.bcm.edu	37	11	28090820	28090820	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr11:28090820C>T	ENST00000263181.6	-	11	1866	c.1576G>A	c.(1576-1578)Ggt>Agt	p.G526S		NM_031217.3	NP_112494.3	Q8NI77	KI18A_HUMAN	kinesin family member 18A	526					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)|protein transport (GO:0015031)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore microtubule (GO:0005828)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|ruffle (GO:0001726)	actin binding (GO:0003779)|ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|plus-end-directed microtubule motor activity (GO:0008574)|tubulin-dependent ATPase activity (GO:0070463)|ubiquitin binding (GO:0043130)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(1)|urinary_tract(2)	36						GGAATATGACCGTTTTGACTT	0.358																																					p.G526S		Atlas-SNP	.											.	KIF18A	92	.	0			c.G1576A						.						97.0	95.0	95.0					11																	28090820		2202	4299	6501	SO:0001583	missense	81930	exon11			TATGACCGTTTTG	AL136819	CCDS7867.1	11p14.1	2014-06-12			ENSG00000121621	ENSG00000121621		"""Kinesins"""	29441	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 99"""	611271				11230166	Standard	NM_031217		Approved	DKFZP434G2226, PPP1R99	uc001msc.2	Q8NI77	OTTHUMG00000166195	ENST00000263181.6:c.1576G>A	chr11.hg19:g.28090820C>T	ENSP00000263181:p.Gly526Ser	70.0	0.0		127.0	9.0	NM_031217	Q4VPE3|Q86VS5|Q9H0F3	Missense_Mutation	SNP	ENST00000263181.6	hg19	CCDS7867.1	.	.	.	.	.	.	.	.	.	.	C	18.80	3.701040	0.68501	.	.	ENSG00000121621	ENST00000263181	T	0.72282	-0.64	5.39	5.39	0.77823	.	0.100798	0.64402	D	0.000002	T	0.80341	0.4605	M	0.66939	2.045	0.53005	D	0.999967	D	0.89917	1.0	D	0.65140	0.932	T	0.74945	-0.3491	10	0.09338	T	0.73	.	18.7497	0.91809	0.0:1.0:0.0:0.0	.	526	Q8NI77	KI18A_HUMAN	S	526	ENSP00000263181:G526S	ENSP00000263181:G526S	G	-	1	0	KIF18A	28047396	1.000000	0.71417	1.000000	0.80357	0.562000	0.35680	5.407000	0.66363	2.537000	0.85549	0.655000	0.94253	GGT	.	.		0.358	KIF18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000388328.3	NM_031217	
OR5M9	390162	hgsc.bcm.edu	37	11	56230823	56230823	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr11:56230823G>A	ENST00000279791.1	-	1	54	c.55C>T	c.(55-57)Cag>Tag	p.Q19*		NM_001004743.1	NP_001004743.1	Q8NGP3	OR5M9_HUMAN	olfactory receptor, family 5, subfamily M, member 9	19						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(4)|urinary_tract(2)	36	Esophageal squamous(21;0.00448)					TGTAGCTCCTGACGACAGGTC	0.428																																					p.Q19X		Atlas-SNP	.											.	OR5M9	75	.	0			c.C55T						.						36.0	36.0	36.0					11																	56230823		2201	4296	6497	SO:0001587	stop_gained	390162	exon1			GCTCCTGACGACA	AB065747	CCDS31531.1	11q11	2012-08-09			ENSG00000150269	ENSG00000150269		"""GPCR / Class A : Olfactory receptors"""	15294	protein-coding gene	gene with protein product							Standard	NM_001004743		Approved		uc010rjj.2	Q8NGP3	OTTHUMG00000166874	ENST00000279791.1:c.55C>T	chr11.hg19:g.56230823G>A	ENSP00000279791:p.Gln19*	200.0	1.0		122.0	107.0	NM_001004743	Q6IEW5|Q96RB9	Nonsense_Mutation	SNP	ENST00000279791.1	hg19	CCDS31531.1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.802983	0.31869	.	.	ENSG00000150269	ENST00000279791	.	.	.	4.79	3.81	0.43845	.	0.000000	0.41396	D	0.000894	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-9.9619	9.7681	0.40574	0.0:0.0:0.7943:0.2057	.	.	.	.	X	19	.	ENSP00000279791:Q19X	Q	-	1	0	OR5M9	55987399	0.000000	0.05858	0.110000	0.21437	0.424000	0.31475	0.325000	0.19628	2.349000	0.79799	0.549000	0.68633	CAG	.	.		0.428	OR5M9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000391638.1	NM_001004743	
ROBO4	54538	hgsc.bcm.edu	37	11	124756386	124756386	+	Missense_Mutation	SNP	G	G	A	rs377645881	byFrequency	TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr11:124756386G>A	ENST00000306534.3	-	16	3253	c.2768C>T	c.(2767-2769)cCc>cTc	p.P923L	RP11-664I21.5_ENST00000524453.1_RNA|ROBO4_ENST00000533054.1_Missense_Mutation_p.P778L	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	923					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TGCCTCCCTGGGCTCTAGACC	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		17877	0.0		0.0	False		,,,				2504	0.002				p.P923L		Atlas-SNP	.											.	ROBO4	130	.	0			c.C2768T						.						53.0	57.0	56.0					11																	124756386		2201	4299	6500	SO:0001583	missense	54538	exon16			TCCCTGGGCTCTA	AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2768C>T	chr11.hg19:g.124756386G>A	ENSP00000304945:p.Pro923Leu	132.0	0.0		75.0	67.0	NM_019055	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	ENST00000306534.3	hg19	CCDS8455.1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941748	0.73557	.	.	ENSG00000154133	ENST00000306534;ENST00000533054	T;T	0.63417	-0.04;0.33	4.7	4.7	0.59300	.	0.000000	0.36034	N	0.002840	T	0.54919	0.1888	M	0.65975	2.015	0.35346	D	0.786902	B;B	0.30584	0.112;0.286	B;B	0.25140	0.049;0.058	T	0.66838	-0.5822	10	0.66056	D	0.02	.	6.7067	0.23254	0.0908:0.0:0.6805:0.2287	.	923;923	Q8WZ75-2;Q8WZ75	.;ROBO4_HUMAN	L	923;778	ENSP00000304945:P923L;ENSP00000437129:P778L	ENSP00000304945:P923L	P	-	2	0	ROBO4	124261596	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.284000	0.43478	2.319000	0.78375	0.655000	0.94253	CCC	.	.		0.547	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000387111.1	NM_019055	
GYS2	2998	hgsc.bcm.edu	37	12	21757510	21757510	+	Missense_Mutation	SNP	G	G	C	rs141614479		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr12:21757510G>C	ENST00000261195.2	-	1	271	c.17C>G	c.(16-18)tCc>tGc	p.S6C		NM_021957.3	NP_068776.2	P54840	GYS2_HUMAN	glycogen synthase 2 (liver)	6					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cell cortex (GO:0005938)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|ectoplasm (GO:0043265)	glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein homodimerization activity (GO:0042803)			NS(1)|breast(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(14)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	48						TACAGAGAGGGATCGGCCTCG	0.478																																					p.S6C	Colon(149;9 1820 3690 10544 50424)	Atlas-SNP	.											.	GYS2	110	.	0			c.C17G						.	G	CYS/SER	0,4406		0,0,2203	89.0	86.0	87.0		17	5.3	0.4	12	dbSNP_134	87	1,8597	1.2+/-3.3	0,1,4298	no	missense	GYS2	NM_021957.3	112	0,1,6501	CC,CG,GG		0.0116,0.0,0.0077	probably-damaging	6/704	21757510	1,13003	2203	4299	6502	SO:0001583	missense	2998	exon1			GAGAGGGATCGGC		CCDS8690.1	12p12.2-p11.2	2013-02-22			ENSG00000111713	ENSG00000111713	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4707	protein-coding gene	gene with protein product		138571					Standard	NM_021957		Approved		uc001rfb.3	P54840	OTTHUMG00000169135	ENST00000261195.2:c.17C>G	chr12.hg19:g.21757510G>C	ENSP00000261195:p.Ser6Cys	156.0	0.0		201.0	86.0	NM_021957	A0AVD8	Missense_Mutation	SNP	ENST00000261195.2	hg19	CCDS8690.1	.	.	.	.	.	.	.	.	.	.	G	19.20	3.781198	0.70222	0.0	1.16E-4	ENSG00000111713	ENST00000261195	T	0.67345	-0.26	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.68393	0.2996	N	0.19112	0.55	0.54753	D	0.999985	D	0.71674	0.998	P	0.61201	0.885	T	0.71873	-0.4461	10	0.62326	D	0.03	-25.3852	15.9549	0.79880	0.0:0.0:1.0:0.0	.	6	P54840	GYS2_HUMAN	C	6	ENSP00000261195:S6C	ENSP00000261195:S6C	S	-	2	0	GYS2	21648777	1.000000	0.71417	0.396000	0.26296	0.761000	0.43186	7.158000	0.77470	2.756000	0.94617	0.655000	0.94253	TCC	.	G|1.000;C|0.000		0.478	GYS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000402396.1	NM_021957	
LRRK2	120892	hgsc.bcm.edu	37	12	40689286	40689286	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr12:40689286C>T	ENST00000298910.7	+	23	2994	c.2936C>T	c.(2935-2937)tCt>tTt	p.S979F	LRRK2_ENST00000343742.2_Missense_Mutation_p.S979F	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	979					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				TCTCTGGCTTCTGAGAGAGAA	0.353																																					p.S979F		Atlas-SNP	.											.	LRRK2	763	.	0			c.C2936T						.						71.0	72.0	72.0					12																	40689286		2203	4300	6503	SO:0001583	missense	120892	exon23			TGGCTTCTGAGAG	AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2936C>T	chr12.hg19:g.40689286C>T	ENSP00000298910:p.Ser979Phe	56.0	0.0		87.0	44.0	NM_198578	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	ENST00000298910.7	hg19	CCDS31774.1	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557009	0.65425	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.25085	2.18;1.82	5.71	1.58	0.23477	.	0.599767	0.17694	N	0.165143	T	0.15089	0.0364	L	0.27053	0.805	0.35598	D	0.807625	P;P	0.46706	0.883;0.788	B;B	0.39876	0.312;0.126	T	0.23261	-1.0193	10	0.19147	T	0.46	.	9.8616	0.41118	0.0:0.5249:0.4029:0.0722	.	979;979	E9PC85;Q5S007	.;LRRK2_HUMAN	F	979	ENSP00000341930:S979F;ENSP00000298910:S979F	ENSP00000298910:S979F	S	+	2	0	LRRK2	38975553	0.024000	0.19004	0.973000	0.42090	0.994000	0.84299	0.329000	0.19698	0.271000	0.22005	0.591000	0.81541	TCT	.	.		0.353	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000277179.1	XM_058513	
TIMELESS	8914	hgsc.bcm.edu	37	12	56811967	56811967	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr12:56811967C>A	ENST00000553532.1	-	27	3555	c.3405G>T	c.(3403-3405)agG>agT	p.R1135S	TIMELESS_ENST00000554616.1_Missense_Mutation_p.R632S|TIMELESS_ENST00000229201.4_Missense_Mutation_p.R1134S					timeless circadian clock											NS(1)|breast(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(8)|lung(14)|ovary(7)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	49						GCAAGAGGGCCCTCAGGGCTT	0.557																																					p.R1135S		Atlas-SNP	.											.	TIMELESS	107	.	0			c.G3405T						.						169.0	178.0	175.0					12																	56811967		2203	4300	6503	SO:0001583	missense	8914	exon27			GAGGGCCCTCAGG	AF098162	CCDS8918.1	12q13.3	2012-12-14	2012-12-14		ENSG00000111602	ENSG00000111602			11813	protein-coding gene	gene with protein product	"""Tof1 homolog (S. cerevisiae)"", ""timeless circadian clock 1"""	603887	"""timeless (Drosophila) homolog"", ""timeless homolog (Drosophila)"""			9856465	Standard	NM_003920		Approved	hTIM, TIM, TIM1	uc001slf.2	Q9UNS1	OTTHUMG00000170600	ENST00000553532.1:c.3405G>T	chr12.hg19:g.56811967C>A	ENSP00000450607:p.Arg1135Ser	62.0	0.0		87.0	42.0	NM_003920		Missense_Mutation	SNP	ENST00000553532.1	hg19	CCDS8918.1	.	.	.	.	.	.	.	.	.	.	C	12.13	1.845766	0.32606	.	.	ENSG00000111602	ENST00000229201;ENST00000553532;ENST00000554616	T;T;T	0.12255	2.7;2.7;2.7	5.27	0.953	0.19590	Timeless C-terminal (1);	0.727010	0.13293	N	0.398821	T	0.13372	0.0324	M	0.66939	2.045	0.09310	N	1	B	0.27910	0.193	B	0.28385	0.089	T	0.28964	-1.0027	10	0.49607	T	0.09	-1.4219	2.794	0.05396	0.3315:0.3384:0.0:0.3301	.	1135	Q9UNS1	TIM_HUMAN	S	1134;1135;632	ENSP00000229201:R1134S;ENSP00000450607:R1135S;ENSP00000450848:R632S	ENSP00000229201:R1135S	R	-	3	2	TIMELESS	55098234	0.000000	0.05858	0.003000	0.11579	0.002000	0.02628	-0.663000	0.05299	-0.035000	0.13691	-0.137000	0.14449	AGG	.	.		0.557	TIMELESS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000409771.1	NM_003920	
OTOGL	283310	hgsc.bcm.edu	37	12	80712338	80712338	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr12:80712338G>T	ENST00000547103.1	+	32	3626	c.3620G>T	c.(3619-3621)gGa>gTa	p.G1207V	OTOGL_ENST00000458043.2_Missense_Mutation_p.G1207V			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1207					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						CTTGGAGAAGGACCATATATG	0.363																																					p.G1207V		Atlas-SNP	.											.	OTOGL	235	.	0			c.G3620T						.						43.0	40.0	41.0					12																	80712338		1545	3453	4998	SO:0001583	missense	283310	exon32			GAGAAGGACCATA	AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3620G>T	chr12.hg19:g.80712338G>T	ENSP00000447211:p.Gly1207Val	67.0	0.0		77.0	39.0	NM_173591	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	ENST00000547103.1	hg19		.	.	.	.	.	.	.	.	.	.	G	23.5	4.429089	0.83667	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.19806	2.12;2.13	5.43	5.43	0.79202	.	.	.	.	.	T	0.44685	0.1305	M	0.73962	2.25	0.80722	D	1	.	.	.	.	.	.	T	0.20773	-1.0265	7	0.39692	T	0.17	.	19.2361	0.93861	0.0:0.0:1.0:0.0	.	.	.	.	V	1207	ENSP00000447211:G1207V;ENSP00000400895:G1207V	ENSP00000400895:G1207V	G	+	2	0	OTOGL	79236469	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.939000	0.92951	2.528000	0.85240	0.655000	0.94253	GGA	.	.		0.363	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	protein_coding	OTTHUMT00000407438.1	NM_173591	
MIPEP	4285	hgsc.bcm.edu	37	13	24411689	24411689	+	Splice_Site	SNP	A	A	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:24411689A>T	ENST00000382172.3	-	13	1642		c.e13+1			NM_005932.3	NP_005923	Q99797	MIPEP_HUMAN	mitochondrial intermediate peptidase						protein processing involved in protein targeting to mitochondrion (GO:0006627)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(5)|liver(1)|lung(12)|prostate(2)|skin(1)	27		all_cancers(29;1.83e-22)|all_epithelial(30;8.75e-19)|all_lung(29;9.17e-18)|Lung SC(185;0.0225)|Breast(139;0.14)		all cancers(112;0.00389)|Epithelial(112;0.0266)|OV - Ovarian serous cystadenocarcinoma(117;0.0717)|Lung(94;0.207)|GBM - Glioblastoma multiforme(144;0.232)		CTCATGGCTCACCAGTGACGT	0.388																																					.		Atlas-SNP	.											.	MIPEP	53	.	0			c.1543+2T>A						.						132.0	127.0	129.0					13																	24411689		2203	4300	6503	SO:0001630	splice_region_variant	4285	exon14			TGGCTCACCAGTG		CCDS9303.1	13q12	2011-01-17			ENSG00000027001	ENSG00000027001	3.4.24.59		7104	protein-coding gene	gene with protein product		602241				9073519	Standard	NM_005932		Approved	MIP	uc001uox.4	Q99797	OTTHUMG00000016573	ENST00000382172.3:c.1543+1T>A	chr13.hg19:g.24411689A>T		98.0	0.0		140.0	69.0	NM_005932	Q5JV15|Q5T9Q9|Q96G65	Splice_Site	SNP	ENST00000382172.3	hg19	CCDS9303.1	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681955	0.88542	.	.	ENSG00000027001	ENST00000382172	.	.	.	5.82	5.82	0.92795	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1864	0.81955	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	MIPEP	23309689	1.000000	0.71417	1.000000	0.80357	0.927000	0.56198	8.973000	0.93428	2.227000	0.72691	0.454000	0.30748	.	.	.		0.388	MIPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000044169.1		Intron
AMER2	219287	hgsc.bcm.edu	37	13	25744258	25744258	+	Silent	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:25744258G>T	ENST00000515384.1	-	1	2167	c.1500C>A	c.(1498-1500)ccC>ccA	p.P500P	AMER2_ENST00000357816.2_Silent_p.P381P|AMER2_ENST00000381853.3_Silent_p.P381P|AMER2-AS1_ENST00000413501.1_lincRNA			Q8N7J2	AMER2_HUMAN	APC membrane recruitment protein 2	500					ectoderm development (GO:0007398)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Wnt signaling pathway (GO:0016055)	plasma membrane (GO:0005886)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)										CCTTAGGATGGGGCTCGATGG	0.657																																					p.P500P		Atlas-SNP	.											.	.	.	.	0			c.C1500A						.						51.0	49.0	50.0					13																	25744258		2203	4300	6503	SO:0001819	synonymous_variant	219287	exon1			AGGATGGGGCTCG	AK055049	CCDS9312.1, CCDS53859.1	13q12.13	2013-10-11	2012-12-03	2012-12-03	ENSG00000165566	ENSG00000165566		"""-"""	26360	protein-coding gene	gene with protein product		614659	"""family with sequence similarity 123A"""	FAM123A		20843316	Standard	XM_005266279		Approved	FLJ25477	uc001uqb.3	Q8N7J2	OTTHUMG00000016602	ENST00000515384.1:c.1500C>A	chr13.hg19:g.25744258G>T		60.0	0.0		70.0	32.0	NM_152704	Q5RL80|Q5VX56|Q8N593|Q96NN5	Silent	SNP	ENST00000515384.1	hg19	CCDS53859.1																																																																																			.	.		0.657	AMER2-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000370229.1	NM_152704	
PCDH20	64881	hgsc.bcm.edu	37	13	61985638	61985638	+	Missense_Mutation	SNP	A	A	G	rs375289034		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:61985638A>G	ENST00000409186.1	-	5	4699	c.2594T>C	c.(2593-2595)aTa>aCa	p.I865T	PCDH20_ENST00000409204.4_Missense_Mutation_p.I865T			Q8N6Y1	PCD20_HUMAN	protocadherin 20	865					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(14)|liver(1)|lung(23)|ovary(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	58		Breast(118;0.195)|Prostate(109;0.229)		GBM - Glioblastoma multiforme(99;0.000118)		TTTCTCCTCTATATTAATCTC	0.398																																					p.I865T		Atlas-SNP	.											.	PCDH20	265	.	0			c.T2594C						.	A	THR/ILE	2,4404	4.2+/-10.8	0,2,2201	73.0	69.0	70.0		2594	6.1	1.0	13		70	0,8600		0,0,4300	no	missense	PCDH20	NM_022843.3	89	0,2,6501	GG,GA,AA		0.0,0.0454,0.0154	benign	865/952	61985638	2,13004	2203	4300	6503	SO:0001583	missense	64881	exon2			TCCTCTATATTAA	AF169693	CCDS9442.2	13q21	2010-01-26			ENSG00000197991	ENSG00000197991		"""Cadherins / Protocadherins : Non-clustered"""	14257	protein-coding gene	gene with protein product		614449					Standard	NM_022843		Approved	PCDH13, FLJ22218	uc001vid.4	Q8N6Y1	OTTHUMG00000017012	ENST00000409186.1:c.2594T>C	chr13.hg19:g.61985638A>G	ENSP00000386653:p.Ile865Thr	103.0	0.0		68.0	62.0	NM_022843	A8K1K9|B1AQU2|Q8NDN4|Q9NRT9	Missense_Mutation	SNP	ENST00000409186.1	hg19	CCDS9442.2	.	.	.	.	.	.	.	.	.	.	A	11.33	1.608035	0.28623	4.54E-4	0.0	ENSG00000197991	ENST00000409204;ENST00000409186;ENST00000358674	T;T	0.55234	0.53;0.53	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.40595	0.1123	L	0.29908	0.895	0.51012	D	0.999902	P	0.43094	0.799	B	0.33339	0.162	T	0.46219	-0.9207	10	0.72032	D	0.01	.	16.6406	0.85098	1.0:0.0:0.0:0.0	.	865	A8K1K9	.	T	865;865;611	ENSP00000387250:I865T;ENSP00000386653:I865T	ENSP00000351500:I611T	I	-	2	0	PCDH20	60883639	1.000000	0.71417	0.996000	0.52242	0.787000	0.44495	8.610000	0.90902	2.326000	0.78906	0.533000	0.62120	ATA	.	.		0.398	PCDH20-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000333054.2	NM_022843	
MYCBP2	23077	hgsc.bcm.edu	37	13	77661633	77661633	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:77661633C>T	ENST00000544440.2	-	62	10764	c.10747G>A	c.(10747-10749)Gaa>Aaa	p.E3583K	MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.E3583K|MYCBP2_ENST00000407578.2_Missense_Mutation_p.E3621K|MYCBP2-AS1_ENST00000450627.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		TCTGAATTTTCTTTGCTTGTT	0.343																																					p.E3621K		Atlas-SNP	.											.	MYCBP2	1029	.	0			c.G10861A						.						99.0	81.0	87.0					13																	77661633		2202	4300	6502	SO:0001583	missense	23077	exon62			AATTTTCTTTGCT	AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10747G>A	chr13.hg19:g.77661633C>T	ENSP00000444596:p.Glu3583Lys	167.0	0.0		107.0	14.0	NM_015057		Missense_Mutation	SNP	ENST00000544440.2	hg19		.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.71|15.71	2.913267|2.913267	0.52439|0.52439	.|.	.|.	ENSG00000005810|ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440|ENST00000429715	T;T;T|.	0.27402|.	1.67;1.67;1.67|.	5.15|5.15	5.15|5.15	0.70609|0.70609	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.33059|0.33059	0.0850|0.0850	N|N	0.02011|0.02011	-0.69|-0.69	0.80722|0.80722	D|D	1|1	P|.	0.37781|.	0.608|.	B|.	0.32211|.	0.142|.	T|T	0.33137|0.33137	-0.9880|-0.9880	10|5	0.32370|.	T|.	0.25|.	.|.	18.6231|18.6231	0.91328|0.91328	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	3583|.	O75592|.	MYCB2_HUMAN|.	K|K	3583;3621;3583|6	ENSP00000349892:E3583K;ENSP00000384288:E3621K;ENSP00000444596:E3583K|.	ENSP00000349892:E3583K|.	E|R	-|-	1|2	0|0	MYCBP2|MYCBP2	76559634|76559634	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.104000|0.104000	0.19210|0.19210	7.809000|7.809000	0.86057|0.86057	2.379000|2.379000	0.81126|0.81126	0.563000|0.563000	0.77884|0.77884	GAA|AGA	.	.		0.343	MYCBP2-001	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000045326.1	NM_015057	
POTEM	641455	hgsc.bcm.edu	37	14	20019996	20019996	+	Silent	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:20019996G>A	ENST00000551509.1	-	1	276	c.225C>T	c.(223-225)agC>agT	p.S75S		NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M	75								p.S75S(2)		endometrium(4)|kidney(1)|lung(4)	9						TGCTCTTGCCGCTCCCCCTGC	0.587																																					p.S75S		Atlas-SNP	.											POTEM_ENST00000551509,NS,carcinoma,-2,3	POTEM	51	.	2	Substitution - coding silent(2)	endometrium(2)	c.C225T						.						12.0	21.0	19.0					14																	20019996		316	1139	1455	SO:0001819	synonymous_variant	641455	exon1			CTTGCCGCTCCCC		CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.225C>T	chr14.hg19:g.20019996G>A		519.0	1.0		964.0	62.0	NM_001145442		Silent	SNP	ENST00000551509.1	hg19	CCDS45076.1																																																																																			.	.		0.587	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000409490.3	NM_001145442	
RALGAPA1	253959	hgsc.bcm.edu	37	14	36155747	36155747	+	Splice_Site	SNP	C	C	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:36155747C>A	ENST00000389698.3	-	18	2950		c.e18+1		RALGAPA1_ENST00000382366.3_Splice_Site|RALGAPA1_ENST00000307138.6_Splice_Site|RALGAPA1_ENST00000258840.6_Splice_Site	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)						activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						ATAAAACTTACCGAGGCATTA	0.343																																					.		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.2559+1G>T						.						27.0	27.0	27.0					14																	36155747		2203	4300	6503	SO:0001630	splice_region_variant	253959	exon19			AACTTACCGAGGC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.2559+1G>T	chr14.hg19:g.36155747C>A		335.0	0.0		167.0	153.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Splice_Site	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	C	14.46	2.543222	0.45280	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.452	0.99131	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RALGAPA1	35225498	1.000000	0.71417	1.000000	0.80357	0.384000	0.30261	6.829000	0.75314	2.838000	0.97847	0.591000	0.81541	.	.	.		0.343	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	Intron
RALGAPA1	253959	hgsc.bcm.edu	37	14	36155768	36155768	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:36155768G>C	ENST00000389698.3	-	18	2929	c.2539C>G	c.(2539-2541)Ctt>Gtt	p.L847V	RALGAPA1_ENST00000382366.3_Missense_Mutation_p.L860V|RALGAPA1_ENST00000307138.6_Missense_Mutation_p.L847V|RALGAPA1_ENST00000258840.6_Missense_Mutation_p.L894V	NM_014990.1	NP_055805.1	Q6GYQ0	RGPA1_HUMAN	Ral GTPase activating protein, alpha subunit 1 (catalytic)	847					activation of Ral GTPase activity (GO:0032859)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(7)|large_intestine(14)|lung(21)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCACTTCGAAGTCGTTCTGCT	0.368																																					p.L847V		Atlas-SNP	.											.	RALGAPA1	289	.	0			c.C2539G						.						47.0	43.0	44.0					14																	36155768		2203	4300	6503	SO:0001583	missense	253959	exon18			TTCGAAGTCGTTC	AK126975	CCDS32064.1, CCDS32065.1, CCDS61439.1	14q13.2	2012-01-26	2009-09-09	2009-09-09	ENSG00000174373	ENSG00000174373			17770	protein-coding gene	gene with protein product	"""tuberin-like protein 1"", ""GAP-related interacting protein to E12"""	608884	"""GTPase activating RANGAP domain-like 1"", ""GTPase activating Rap/RanGAP domain-like 1"""	GARNL1		19520869	Standard	NM_014990		Approved	GRIPE, DKFZp667F074, KIAA0884, Tulip1, RalGAPalpha1	uc001wtj.3	Q6GYQ0	OTTHUMG00000170619	ENST00000389698.3:c.2539C>G	chr14.hg19:g.36155768G>C	ENSP00000374348:p.Leu847Val	355.0	0.0		175.0	163.0	NM_194301	A6NMA4|B9EK38|C5NU19|O94960|Q6GYP9|Q6ZT23|Q86YF3|Q86YF5|Q8ND69	Missense_Mutation	SNP	ENST00000389698.3	hg19	CCDS32065.1	.	.	.	.	.	.	.	.	.	.	G	14.29	2.490314	0.44249	.	.	ENSG00000174373	ENST00000389698;ENST00000307138;ENST00000335518;ENST00000258840;ENST00000382366;ENST00000553892	D;D;D;D;D	0.94966	-3.45;-3.46;-3.54;-3.57;-3.54	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	D	0.94548	0.8244	L	0.32530	0.975	0.45035	D	0.998052	D;D;P;D;P	0.71674	0.991;0.959;0.916;0.998;0.74	P;P;P;D;B	0.77557	0.861;0.556;0.527;0.99;0.313	D	0.91338	0.5095	10	0.13108	T	0.6	-19.1447	14.5704	0.68208	0.0695:0.0:0.9305:0.0	.	894;860;894;847;847	Q6GYQ0-6;B9EK38;Q6GYQ0-3;Q6GYQ0-2;Q6GYQ0	.;.;.;.;RGPA1_HUMAN	V	847;847;847;894;860;894	ENSP00000374348:L847V;ENSP00000302647:L847V;ENSP00000258840:L894V;ENSP00000371803:L860V;ENSP00000451877:L894V	ENSP00000258840:L894V	L	-	1	0	RALGAPA1	35225519	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.618000	0.83043	2.833000	0.97629	0.585000	0.79938	CTT	.	.		0.368	RALGAPA1-002	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000409829.1	XM_210022	
IRF2BPL	64207	hgsc.bcm.edu	37	14	77493105	77493105	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:77493105A>G	ENST00000238647.3	-	1	1929	c.1031T>C	c.(1030-1032)tTg>tCg	p.L344S		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	344					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						CTTCTCCTTCAACTCGCGCTC	0.682																																					p.L344S		Atlas-SNP	.											.	IRF2BPL	40	.	0			c.T1031C						.						29.0	30.0	30.0					14																	77493105		2203	4300	6503	SO:0001583	missense	64207	exon1			TCCTTCAACTCGC	AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.1031T>C	chr14.hg19:g.77493105A>G	ENSP00000238647:p.Leu344Ser	83.0	0.0		115.0	42.0	NM_024496	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	ENST00000238647.3	hg19	CCDS9854.1	.	.	.	.	.	.	.	.	.	.	A	21.3	4.122702	0.77436	.	.	ENSG00000119669	ENST00000238647	T	0.65549	-0.16	3.73	3.73	0.42828	.	0.000000	0.49916	U	0.000129	T	0.52500	0.1738	L	0.29908	0.895	0.39300	D	0.964899	D	0.54601	0.967	P	0.50314	0.637	T	0.50808	-0.8784	10	0.07644	T	0.81	26.8	11.6991	0.51560	1.0:0.0:0.0:0.0	.	344	Q9H1B7	I2BPL_HUMAN	S	344	ENSP00000238647:L344S	ENSP00000238647:L344S	L	-	2	0	IRF2BPL	76562858	0.999000	0.42202	1.000000	0.80357	0.952000	0.60782	4.284000	0.58983	1.696000	0.51158	0.379000	0.24179	TTG	.	.		0.682	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414298.1	NM_024496	
UNC79	57578	hgsc.bcm.edu	37	14	94004493	94004493	+	Silent	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:94004493C>T	ENST00000393151.2	+	12	1281	c.1281C>T	c.(1279-1281)acC>acT	p.T427T	UNC79_ENST00000256339.4_Silent_p.T250T|UNC79_ENST00000553484.1_Silent_p.T427T|UNC79_ENST00000555664.1_Silent_p.T427T			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	427					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TCTATCAGACCTCTCCTCCGC	0.582																																					p.T250T		Atlas-SNP	.											.	UNC79	366	.	0			c.C750T						.						47.0	46.0	46.0					14																	94004493		2203	4300	6503	SO:0001819	synonymous_variant	57578	exon12			TCAGACCTCTCCT	AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.1281C>T	chr14.hg19:g.94004493C>T		115.0	0.0		153.0	75.0	NM_020818	B5MDL6|Q6ZUT7	Silent	SNP	ENST00000393151.2	hg19																																																																																				.	.		0.582	UNC79-006	KNOWN	basic	protein_coding	protein_coding	OTTHUMT00000412766.1	XM_028395	
ATG2B	55102	hgsc.bcm.edu	37	14	96775858	96775858	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:96775858A>G	ENST00000359933.4	-	29	5128	c.4235T>C	c.(4234-4236)cTg>cCg	p.L1412P	ATG2B_ENST00000261834.5_5'UTR	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	1412					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ATCACTCATCAGATCTCGTAA	0.448																																					p.L1412P		Atlas-SNP	.											.	ATG2B	169	.	0			c.T4235C						.						203.0	158.0	173.0					14																	96775858		2203	4300	6503	SO:0001583	missense	55102	exon29			CTCATCAGATCTC	AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.4235T>C	chr14.hg19:g.96775858A>G	ENSP00000353010:p.Leu1412Pro	101.0	0.0		154.0	65.0	NM_018036	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	ENST00000359933.4	hg19	CCDS9944.2	.	.	.	.	.	.	.	.	.	.	A	24.6	4.548517	0.86127	.	.	ENSG00000066739	ENST00000359933	T	0.64438	-0.1	5.58	5.58	0.84498	.	0.245457	0.35235	N	0.003356	T	0.79787	0.4506	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82184	-0.0583	10	0.66056	D	0.02	.	16.0556	0.80801	1.0:0.0:0.0:0.0	.	1412	Q96BY7	ATG2B_HUMAN	P	1412	ENSP00000353010:L1412P	ENSP00000261834:L56P	L	-	2	0	ATG2B	95845611	1.000000	0.71417	0.946000	0.38457	0.934000	0.57294	8.517000	0.90555	2.239000	0.73571	0.533000	0.62120	CTG	.	.		0.448	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000314037.1	NM_018036	
HSP90AA1	3320	hgsc.bcm.edu	37	14	102548068	102548068	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr14:102548068C>T	ENST00000216281.8	-	11	2385	c.2180G>A	c.(2179-2181)cGc>cAc	p.R727H	HSP90AA1_ENST00000334701.7_Missense_Mutation_p.R849H	NM_005348.3	NP_005339.3	P07900	HS90A_HUMAN	heat shock protein 90kDa alpha (cytosolic), class A member 1	727	Required for homodimerization.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone-mediated protein complex assembly (GO:0051131)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|G2/M transition of mitotic cell cycle (GO:0000086)|innate immune response (GO:0045087)|mitochondrial transport (GO:0006839)|mitotic cell cycle (GO:0000278)|nitric oxide metabolic process (GO:0046209)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|protein import into mitochondrial outer membrane (GO:0045040)|protein refolding (GO:0042026)|regulation of nitric-oxide synthase activity (GO:0050999)|response to unfolded protein (GO:0006986)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|identical protein binding (GO:0042802)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(6)|large_intestine(3)|liver(1)|lung(10)|ovary(2)|prostate(1)	28					Nedocromil(DB00716)|Rifabutin(DB00615)	TTCTTCCATGCGTGATGTGTC	0.408																																					p.R849H		Atlas-SNP	.											.	HSP90AA1	65	.	0			c.G2546A						.						167.0	140.0	149.0					14																	102548068		2203	4300	6503	SO:0001583	missense	3320	exon12			TCCATGCGTGATG	M27024	CCDS9967.1, CCDS32160.1	14q32.33	2011-09-02	2006-02-24	2006-02-24	ENSG00000080824	ENSG00000080824		"""Heat shock proteins / HSPC"""	5253	protein-coding gene	gene with protein product		140571	"""heat shock 90kD protein 1, alpha"", ""heat shock 90kDa protein 1, alpha"""	HSPC1, HSPCA		2527334, 16269234	Standard	NM_001017963		Approved	Hsp89, Hsp90, FLJ31884, HSP90N	uc001ykv.4	P07900		ENST00000216281.8:c.2180G>A	chr14.hg19:g.102548068C>T	ENSP00000216281:p.Arg727His	66.0	0.0		85.0	38.0	NM_001017963	A8K500|B3KPJ9|Q2PP14|Q5CAQ6|Q5CAQ7|Q9BVQ5	Missense_Mutation	SNP	ENST00000216281.8	hg19	CCDS9967.1	.	.	.	.	.	.	.	.	.	.	c	17.11	3.305699	0.60305	.	.	ENSG00000080824	ENST00000216281;ENST00000334701	T;T	0.09723	2.95;2.95	4.21	4.21	0.49690	.	0.000000	0.85682	U	0.000000	T	0.14485	0.0350	L	0.60957	1.885	0.80722	D	1	P;P	0.44478	0.836;0.581	B;B	0.39971	0.211;0.315	T	0.06058	-1.0848	10	0.44086	T	0.13	-15.4851	16.9302	0.86188	0.0:1.0:0.0:0.0	.	849;727	P07900-2;P07900	.;HS90A_HUMAN	H	727;849	ENSP00000216281:R727H;ENSP00000335153:R849H	ENSP00000216281:R727H	R	-	2	0	HSP90AA1	101617821	1.000000	0.71417	0.998000	0.56505	0.707000	0.40811	5.810000	0.69179	2.070000	0.61991	0.305000	0.20034	CGC	.	.		0.408	HSP90AA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000414952.2	NM_005348	
CHRNA7	1139	hgsc.bcm.edu	37	15	32455506	32455506	+	Silent	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr15:32455506C>T	ENST00000306901.3	+	9	1057	c.960C>T	c.(958-960)caC>caT	p.H320H	CHRNA7_ENST00000454250.3_Silent_p.H349H|CHRNA7_ENST00000455693.2_Silent_p.H139H	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	320					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)	p.H230H(1)|p.H320H(1)		endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	ACCACCACCACGACCCCGACG	0.597																																					p.H349H	Esophageal Squamous(193;529 2900 40232 43193)	Atlas-SNP	.											CHRNA7,NS,carcinoma,0,1	CHRNA7	57	.	2	Substitution - coding silent(2)	endometrium(2)	c.C1047T						.						25.0	24.0	24.0					15																	32455506		1245	2201	3446	SO:0001819	synonymous_variant	1139	exon9			CCACCACGACCCC	Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.960C>T	chr15.hg19:g.32455506C>T		355.0	0.0		524.0	255.0	NM_001190455	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	ENST00000306901.3	hg19	CCDS10027.1																																																																																			.	.		0.597	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000251410.2		
SPATA5L1	79029	hgsc.bcm.edu	37	15	45707864	45707864	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr15:45707864C>G	ENST00000305560.6	+	5	1823	c.1724C>G	c.(1723-1725)gCc>gGc	p.A575G	SPATA5L1_ENST00000559860.1_Missense_Mutation_p.A575G	NM_024063.2	NP_076968.2	Q9BVQ7	SPA5L_HUMAN	spermatogenesis associated 5-like 1	575						cytoplasm (GO:0005737)	ATP binding (GO:0005524)			kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14		Lung NSC(122;8.3e-05)|all_lung(180;0.000547)|Melanoma(134;0.0417)		all cancers(107;7.31e-17)|GBM - Glioblastoma multiforme(94;6.28e-07)		GCTCGCTCAGCCAGCAAGACA	0.378																																					p.A575G		Atlas-SNP	.											.	SPATA5L1	40	.	0			c.C1724G						.						70.0	66.0	68.0					15																	45707864		2198	4298	6496	SO:0001583	missense	79029	exon5			GCTCAGCCAGCAA	AK023232	CCDS10123.1	15q15.1	2010-04-21			ENSG00000171763	ENSG00000171763		"""ATPases / AAA-type"""	28762	protein-coding gene	gene with protein product						12477932	Standard	NM_024063		Approved	MGC5347, FLJ12286	uc001zve.3	Q9BVQ7	OTTHUMG00000131425	ENST00000305560.6:c.1724C>G	chr15.hg19:g.45707864C>G	ENSP00000305494:p.Ala575Gly	63.0	0.0		112.0	53.0	NM_024063	C9JHR5|Q9H8W7|Q9HA41	Missense_Mutation	SNP	ENST00000305560.6	hg19	CCDS10123.1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.669|7.669	0.686509|0.686509	0.14973|0.14973	.|.	.|.	ENSG00000171763|ENSG00000171763	ENST00000305560|ENST00000531624	D|.	0.94723|.	-3.5|.	5.54|5.54	1.82|1.82	0.25136|0.25136	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);|.	1.437660|.	0.04074|.	N|.	0.308552|.	T|T	0.09379|0.09379	0.0231|0.0231	N|N	0.03016|0.03016	-0.435|-0.435	0.09310|0.09310	N|N	1|1	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.27020|0.27020	-1.0086|-1.0086	10|5	0.21014|.	T|.	0.42|.	-33.411|-33.411	1.2862|1.2862	0.02051|0.02051	0.1432:0.1723:0.1485:0.5361|0.1432:0.1723:0.1485:0.5361	.|.	575|.	Q9BVQ7|.	SPA5L_HUMAN|.	G|A	575|80	ENSP00000305494:A575G|.	ENSP00000305494:A575G|.	A|P	+|+	2|1	0|0	SPATA5L1|SPATA5L1	43495156|43495156	0.001000|0.001000	0.12720|0.12720	0.011000|0.011000	0.14972|0.14972	0.855000|0.855000	0.48748|0.48748	0.031000|0.031000	0.13710|0.13710	0.104000|0.104000	0.17725|0.17725	-0.302000|-0.302000	0.09304|0.09304	GCC|CCA	.	.		0.378	SPATA5L1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	protein_coding	OTTHUMT00000254218.1	NM_024063	
PYGO1	26108	hgsc.bcm.edu	37	15	55838901	55838901	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr15:55838901G>T	ENST00000302000.6	-	3	674	c.580C>A	c.(580-582)Caa>Aaa	p.Q194K	PYGO1_ENST00000563719.1_Missense_Mutation_p.Q194K	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	194	Asn-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		TTAGAAACTTGGCTAGCATTC	0.338																																					p.Q194K		Atlas-SNP	.											.	PYGO1	56	.	0			c.C580A						.						74.0	78.0	77.0					15																	55838901		2193	4292	6485	SO:0001583	missense	26108	exon3			AAACTTGGCTAGC	AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.580C>A	chr15.hg19:g.55838901G>T	ENSP00000302327:p.Gln194Lys	148.0	0.0		237.0	107.0	NM_015617	A7Y2D6	Missense_Mutation	SNP	ENST00000302000.6	hg19	CCDS10155.1	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660473	0.67586	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.47869	0.83	4.99	4.99	0.66335	.	0.163511	0.42053	D	0.000779	T	0.56615	0.1997	L	0.32530	0.975	0.50632	D	0.99988	D;D	0.57899	0.981;0.981	D;P	0.65010	0.931;0.899	T	0.52223	-0.8604	10	0.32370	T	0.25	-10.5213	17.6483	0.88154	0.0:0.0:1.0:0.0	.	194;194	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	K	194	ENSP00000302327:Q194K	ENSP00000302327:Q194K	Q	-	1	0	PYGO1	53626193	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	7.287000	0.78681	2.484000	0.83849	0.585000	0.79938	CAA	.	.		0.338	PYGO1-001	KNOWN	basic|CCDS	protein_coding	protein_coding	OTTHUMT00000254977.2	NM_015617	
DNAJA4	55466	hgsc.bcm.edu	37	15	78566662	78566662	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr15:78566662G>T	ENST00000394852.3	+	4	732	c.542G>T	c.(541-543)tGc>tTc	p.C181F	DNAJA4_ENST00000343789.3_Missense_Mutation_p.C181F|DNAJA4_ENST00000394855.3_Missense_Mutation_p.C210F|DNAJA4_ENST00000446172.2_Missense_Mutation_p.C154F	NM_001130182.1	NP_001123654.1	Q8WW22	DNJA4_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 4	181					negative regulation of inclusion body assembly (GO:0090084)|protein refolding (GO:0042026)|response to heat (GO:0009408)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|unfolded protein binding (GO:0051082)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	8						TGCATCGAGTGCAAGGGCCAG	0.607																																					p.C210F		Atlas-SNP	.											.	DNAJA4	63	.	0			c.G629T						.						78.0	65.0	70.0					15																	78566662		2196	4293	6489	SO:0001583	missense	55466	exon5			TCGAGTGCAAGGG	AF116663	CCDS10299.2, CCDS45316.1, CCDS45317.1	15q24.1	2011-09-02			ENSG00000140403	ENSG00000140403		"""Heat shock proteins / DNAJ (HSP40)"""	14885	protein-coding gene	gene with protein product						11147971	Standard	NM_018602		Approved	PRO1472	uc002bdi.3	Q8WW22	OTTHUMG00000143733	ENST00000394852.3:c.542G>T	chr15.hg19:g.78566662G>T	ENSP00000378321:p.Cys181Phe	144.0	0.0		139.0	42.0	NM_018602	E9PDM9|Q6AW87|Q8N5Z4|Q8N7P2	Missense_Mutation	SNP	ENST00000394852.3	hg19	CCDS45316.1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475998	0.84640	.	.	ENSG00000140403	ENST00000394855;ENST00000343789;ENST00000394852;ENST00000446172	T;T;T;D	0.81659	-1.06;-0.87;-0.87;-1.52	5.63	4.72	0.59763	HSP40/DnaJ peptide-binding (1);Heat shock protein DnaJ, cysteine-rich domain (4);	0.000000	0.85682	D	0.000000	D	0.93654	0.7973	H	0.99650	4.68	0.80722	D	1	P;P;P;P	0.51933	0.83;0.949;0.866;0.749	P;P;P;P	0.60415	0.546;0.874;0.798;0.627	D	0.95595	0.8658	10	0.66056	D	0.02	-7.5969	13.7548	0.62930	0.0733:0.0:0.9267:0.0	.	96;154;181;210	Q9P1H1;E9PDM9;Q8WW22;Q8WW22-2	.;.;DNJA4_HUMAN;.	F	210;181;181;154	ENSP00000378324:C210F;ENSP00000339581:C181F;ENSP00000378321:C181F;ENSP00000413499:C154F	ENSP00000339581:C181F	C	+	2	0	DNAJA4	76353717	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.658000	0.98594	1.384000	0.46424	0.655000	0.94253	TGC	.	.		0.607	DNAJA4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000289801.1	NM_018602	
CAPN15	6650	hgsc.bcm.edu	37	16	597393	597394	+	Nonsense_Mutation	DNP	GG	GG	AT			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr16:597393_597394GG>AT	ENST00000219611.2	+	4	918_919	c.555_556GG>AT	c.(553-558)ccGGaa>ccATaa	p.E186*	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	186					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TGGTGGTCCCGGAAGTGGTGGC	0.748																																					p.P185P|p.E186X		Atlas-SNP	.											.	SOLH	47	.	0			c.G555A|c.G556T						.																																			SO:0001587	stop_gained	6650	exon4			GGTCCCGGAAGTG|GTCCCGGAAGTGG	U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	Exception_encountered	chr16.hg19:g.597393_597394delinsAT	ENSP00000219611:p.Glu186*	64.0|65.0	0.0		71.0	34.0	NM_005632	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Silent|Nonsense_Mutation	SNP	ENST00000219611.2	hg19	CCDS10410.1																																																																																			.	.		0.748	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000239271.1	NM_005632	
ACSM5	54988	hgsc.bcm.edu	37	16	20451162	20451162	+	Missense_Mutation	SNP	C	C	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr16:20451162C>G	ENST00000331849.4	+	13	1724	c.1577C>G	c.(1576-1578)tCt>tGt	p.S526C	CTD-2194A8.2_ENST00000574654.1_RNA|CTD-2194A8.2_ENST00000575772.1_RNA	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	526					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						GCCTACTCCTCTCATGACCCA	0.468																																					p.S526C		Atlas-SNP	.											.	ACSM5	101	.	0			c.C1577G						.						112.0	104.0	106.0					16																	20451162		2203	4299	6502	SO:0001583	missense	54988	exon13			ACTCCTCTCATGA		CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.1577C>G	chr16.hg19:g.20451162C>G	ENSP00000327916:p.Ser526Cys	140.0	0.0		169.0	47.0	NM_017888	Q96AV1|Q96CX8|Q9NWV3	Missense_Mutation	SNP	ENST00000331849.4	hg19	CCDS10585.1	.	.	.	.	.	.	.	.	.	.	C	13.08	2.130367	0.37630	.	.	ENSG00000183549	ENST00000331849	T	0.50277	0.75	5.01	4.0	0.46444	.	0.241704	0.29307	N	0.012540	T	0.40932	0.1137	L	0.55481	1.735	0.09310	N	1	B	0.28208	0.203	B	0.23419	0.046	T	0.42224	-0.9464	10	0.62326	D	0.03	-10.8708	10.2397	0.43305	0.148:0.7079:0.1441:0.0	.	526	Q6NUN0	ACSM5_HUMAN	C	526	ENSP00000327916:S526C	ENSP00000327916:S526C	S	+	2	0	ACSM5	20358663	0.801000	0.28930	0.017000	0.16124	0.365000	0.29674	2.703000	0.47110	2.487000	0.83934	0.655000	0.94253	TCT	.	.		0.468	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000254413.1	NM_017888	
SLC12A4	6560	hgsc.bcm.edu	37	16	67995510	67995510	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr16:67995510T>C	ENST00000316341.3	-	3	450	c.310A>G	c.(310-312)Agt>Ggt	p.S104G	SLC12A4_ENST00000572037.1_Missense_Mutation_p.S56G|SLC12A4_ENST00000576616.1_Missense_Mutation_p.S104G|SLC12A4_ENST00000541864.2_Missense_Mutation_p.S73G|SLC12A4_ENST00000572010.1_5'UTR|SLC12A4_ENST00000338335.3_Missense_Mutation_p.S104G|SLC12A4_ENST00000422611.2_Missense_Mutation_p.S106G|SLC12A4_ENST00000537830.2_Missense_Mutation_p.S98G	NM_001145961.1|NM_005072.4	NP_001139433.1|NP_005063.1	Q9UP95	S12A4_HUMAN	solute carrier family 12 (potassium/chloride transporter), member 4	104					cell volume homeostasis (GO:0006884)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|potassium ion transport (GO:0006813)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	potassium:chloride symporter activity (GO:0015379)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|prostate(4)|skin(2)|urinary_tract(3)	29		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)	Bumetanide(DB00887)|Potassium Chloride(DB00761)	CCCTCCCCACTCTCGGCCTCC	0.627																																					p.S106G		Atlas-SNP	.											.	SLC12A4	81	.	0			c.A316G						.						68.0	67.0	68.0					16																	67995510		2198	4300	6498	SO:0001583	missense	6560	exon2			CCCCACTCTCGGC		CCDS10855.1, CCDS54030.1, CCDS54031.1, CCDS54032.1	16q22.1	2013-07-18	2013-07-18		ENSG00000124067	ENSG00000124067		"""Solute carriers"""	10913	protein-coding gene	gene with protein product		604119				8663127	Standard	NM_005072		Approved	KCC1	uc010ceu.2	Q9UP95	OTTHUMG00000137535	ENST00000316341.3:c.310A>G	chr16.hg19:g.67995510T>C	ENSP00000318557:p.Ser104Gly	75.0	0.0		59.0	57.0	NM_001145962	B4DF69|B4DR04|B4DZ82|B7ZAV0|F5H066|F5H0S9|F5H3C0|O60632|O75893|Q13953|Q96LD5	Missense_Mutation	SNP	ENST00000316341.3	hg19	CCDS10855.1	.	.	.	.	.	.	.	.	.	.	T	18.73	3.685424	0.68157	.	.	ENSG00000124067	ENST00000422611;ENST00000541864;ENST00000537830;ENST00000338335;ENST00000316341	D;D;D;D;D	0.88741	-1.92;-1.91;-1.91;-2.42;-1.91	5.81	4.7	0.59300	.	0.137331	0.64402	D	0.000001	T	0.81856	0.4911	N	0.19112	0.55	0.58432	D	0.999993	B;B;B;B;B;B	0.25390	0.035;0.038;0.125;0.017;0.039;0.001	B;B;B;B;B;B	0.31946	0.062;0.044;0.138;0.039;0.039;0.002	T	0.75966	-0.3131	10	0.37606	T	0.19	.	10.9902	0.47545	0.1392:0.0:0.0:0.8608	.	106;104;73;98;104;104	F5H3C0;B4DF30;F5H066;F5H0S9;Q9UP95-2;Q9UP95	.;.;.;.;.;S12A4_HUMAN	G	106;73;98;104;104	ENSP00000395983:S106G;ENSP00000438334:S73G;ENSP00000445962:S98G;ENSP00000343374:S104G;ENSP00000318557:S104G	ENSP00000318557:S104G	S	-	1	0	SLC12A4	66553011	0.658000	0.27402	1.000000	0.80357	0.977000	0.68977	3.860000	0.55995	1.005000	0.39183	0.379000	0.24179	AGT	.	.		0.627	SLC12A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000268864.4	NM_005072	
TP53	7157	hgsc.bcm.edu	37	17	7578500	7578500	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:7578500G>A	ENST00000269305.4	-	5	619	c.430C>T	c.(430-432)Cag>Tag	p.Q144*	TP53_ENST00000359597.4_Nonsense_Mutation_p.Q144*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000420246.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q144*|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q144*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	144	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in sporadic cancers; somatic mutation).|Q -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q144*(36)|p.0?(8)|p.Q144fs*25(3)|p.Q144K(2)|p.Q12*(2)|p.Q144fs*26(2)|p.Q51*(2)|p.Q144_G154del11(1)|p.L137_W146del10(1)|p.Q51fs*25(1)|p.Q144del(1)|p.Q144fs*32(1)|p.Q144fs*16(1)|p.P142_Q144delPVQ(1)|p.Q144fs*4(1)|p.Q12fs*25(1)|p.V143_S149del(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ACCCACAGCTGCACAGGGCAG	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											p.Q144X	Pancreas(47;798 1329 9957 10801)	Atlas-SNP	.	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	TP53_ENST00000545858,bladder,carcinoma,0,3	TP53	33396	.	65	Substitution - Nonsense(40)|Deletion - Frameshift(10)|Whole gene deletion(8)|Deletion - In frame(5)|Substitution - Missense(2)	lung(11)|upper_aerodigestive_tract(10)|oesophagus(8)|breast(8)|endometrium(6)|ovary(5)|bone(4)|large_intestine(3)|stomach(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|soft_tissue(1)|liver(1)|skin(1)|prostate(1)	c.C430T						.						57.0	56.0	57.0					17																	7578500		2203	4300	6503	SO:0001587	stop_gained	7157	exon5	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	ACAGCTGCACAGG	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.430C>T	chr17.hg19:g.7578500G>A	ENSP00000269305:p.Gln144*	83.0	0.0		81.0	74.0	NM_000546	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	ENST00000269305.4	hg19	CCDS11118.1	.	.	.	.	.	.	.	.	.	.	G	16.25	3.071217	0.55646	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315;ENST00000508793	.	.	.	5.48	5.48	0.80851	.	0.121732	0.56097	D	0.000038	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-30.9139	17.2272	0.86973	0.0:0.0:1.0:0.0	.	.	.	.	X	144;144;144;144;144;144;133;51;12;51;12;144	.	ENSP00000269305:Q144X	Q	-	1	0	TP53	7519225	1.000000	0.71417	0.908000	0.35775	0.017000	0.09413	7.953000	0.87836	2.733000	0.93635	0.655000	0.94253	CAG	.	.		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000367397.1	NM_000546	
MYH1	4619	hgsc.bcm.edu	37	17	10408279	10408279	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:10408279C>A	ENST00000226207.5	-	22	2633	c.2539G>T	c.(2539-2541)Gca>Tca	p.A847S	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	847					muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTGTCTCTGCACTTTTGAGG	0.458																																					p.A847S		Atlas-SNP	.											.	MYH1	403	.	0			c.G2539T						.						136.0	127.0	130.0					17																	10408279		2203	4300	6503	SO:0001583	missense	4619	exon22			TCTCTGCACTTTT		CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2539G>T	chr17.hg19:g.10408279C>A	ENSP00000226207:p.Ala847Ser	106.0	0.0		67.0	64.0	NM_005963	Q14CA4|Q9Y622	Missense_Mutation	SNP	ENST00000226207.5	hg19	CCDS11155.1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.427227	0.83667	.	.	ENSG00000109061	ENST00000226207	D	0.82893	-1.66	5.48	5.48	0.80851	.	0.000000	0.42821	U	0.000642	D	0.86598	0.5971	M	0.75085	2.285	0.58432	D	0.999999	P	0.43973	0.823	P	0.46049	0.502	D	0.86322	0.1693	10	0.44086	T	0.13	.	19.7157	0.96119	0.0:1.0:0.0:0.0	.	847	P12882	MYH1_HUMAN	S	847	ENSP00000226207:A847S	ENSP00000226207:A847S	A	-	1	0	MYH1	10349004	1.000000	0.71417	1.000000	0.80357	0.698000	0.40448	7.692000	0.84203	2.749000	0.94314	0.655000	0.94253	GCA	.	.		0.458	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000252725.1	NM_005963	
NOS2	4843	hgsc.bcm.edu	37	17	26089884	26089884	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:26089884G>A	ENST00000313735.6	-	22	2973	c.2740C>T	c.(2740-2742)Cgg>Tgg	p.R914W		NM_000625.4	NP_000616.3	P35228	NOS2_HUMAN	nitric oxide synthase 2, inducible	914	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				arginine catabolic process (GO:0006527)|blood coagulation (GO:0007596)|cellular response to interferon-gamma (GO:0071346)|cellular response to lipopolysaccharide (GO:0071222)|circadian rhythm (GO:0007623)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|inflammatory response (GO:0006954)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|negative regulation of protein catabolic process (GO:0042177)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide mediated signal transduction (GO:0007263)|peptidyl-cysteine S-nitrosylation (GO:0018119)|phagosome maturation (GO:0090382)|positive regulation of guanylate cyclase activity (GO:0031284)|positive regulation of killing of cells of other organism (GO:0051712)|positive regulation of leukocyte mediated cytotoxicity (GO:0001912)|positive regulation of vasodilation (GO:0045909)|regulation of cell proliferation (GO:0042127)|regulation of cellular respiration (GO:0043457)|regulation of insulin secretion (GO:0050796)|response to bacterium (GO:0009617)|response to hypoxia (GO:0001666)|superoxide metabolic process (GO:0006801)	cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)	arginine binding (GO:0034618)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric-oxide synthase activity (GO:0004517)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|tetrahydrobiopterin binding (GO:0034617)			autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(28)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	56					Dexamethasone(DB01234)|Doxorubicin(DB00997)|L-Arginine(DB00125)|L-Citrulline(DB00155)|Miconazole(DB01110)|Triflusal(DB08814)	GTGTGATCCCGGGAGGAGCTG	0.642																																					p.R914W		Atlas-SNP	.											.	NOS2	113	.	0			c.C2740T						.						24.0	21.0	22.0					17																	26089884		2195	4294	6489	SO:0001583	missense	4843	exon22			GATCCCGGGAGGA	U20141	CCDS11223.1	17q11.2	2014-06-12	2008-09-16	2008-09-16	ENSG00000007171	ENSG00000007171	1.14.13.39		7873	protein-coding gene	gene with protein product		163730	"""nitric oxide synthase 2A (inducible, hepatocytes)"""	NOS2A		7682706	Standard	NM_000625		Approved	iNOS, NOS, HEP-NOS	uc002gzu.3	P35228	OTTHUMG00000132445	ENST00000313735.6:c.2740C>T	chr17.hg19:g.26089884G>A	ENSP00000327251:p.Arg914Trp	67.0	0.0		90.0	7.0	NM_000625	A1L3U5|B7ZLY2|O60757|O94994|Q16263|Q16692|Q4TTS5|Q9UD42	Missense_Mutation	SNP	ENST00000313735.6	hg19	CCDS11223.1	.	.	.	.	.	.	.	.	.	.	G	10.79	1.449700	0.26074	.	.	ENSG00000007171	ENST00000313735;ENST00000379105	T	0.67171	-0.25	4.9	1.71	0.24356	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.860574	0.10294	N	0.691949	T	0.51075	0.1653	L	0.38838	1.175	0.25703	N	0.985562	B	0.11235	0.004	B	0.04013	0.001	T	0.46707	-0.9172	10	0.66056	D	0.02	.	1.8657	0.03198	0.1979:0.1233:0.4809:0.1978	.	914	P35228	NOS2_HUMAN	W	914;875	ENSP00000327251:R914W	ENSP00000327251:R914W	R	-	1	2	NOS2	23114011	0.985000	0.35326	0.367000	0.25926	0.287000	0.27160	2.186000	0.42593	0.072000	0.16694	-0.467000	0.05162	CGG	.	.		0.642	NOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255597.1	NM_000625	
DHRS11	79154	hgsc.bcm.edu	37	17	34958498	34958498	+	IGR	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:34958498G>T	ENST00000251312.5	+	0	1598				MRM1_ENST00000585770.1_5'UTR|MRM1_ENST00000250156.7_Nonsense_Mutation_p.E87*	NM_024308.3	NP_077284.2	Q6UWP2	DHR11_HUMAN	dehydrogenase/reductase (SDR family) member 11							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(4)	5						GAAGCGGGCCGAGCTGCTCCG	0.687																																					p.E87X		Atlas-SNP	.											.	MRM1	19	.	0			c.G259T						.						24.0	29.0	28.0					17																	34958498		2196	4284	6480	SO:0001628	intergenic_variant	79922	exon1			CGGGCCGAGCTGC		CCDS11315.2	17q12	2014-05-06			ENSG00000108272	ENSG00000278535		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	28639	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 24C, member 1"""					12975309, 19027726	Standard	NM_024308		Approved	MGC4172, SDR24C1	uc002hnd.3	Q6UWP2	OTTHUMG00000188442		chr17.hg19:g.34958498G>T		52.0	0.0		66.0	38.0	NM_024864	B2RDZ3|Q9BUC7|Q9H674	Nonsense_Mutation	SNP	ENST00000251312.5	hg19	CCDS11315.2	.	.	.	.	.	.	.	.	.	.	G	36	5.676260	0.96764	.	.	ENSG00000129282	ENST00000250156	.	.	.	4.9	3.86	0.44501	.	0.248378	0.41194	D	0.000926	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	-17.0011	12.0634	0.53574	0.0:0.1738:0.8262:0.0	.	.	.	.	X	87	.	ENSP00000250156:E87X	E	+	1	0	MRM1	32032611	0.999000	0.42202	1.000000	0.80357	0.314000	0.28054	3.234000	0.51320	2.423000	0.82170	0.555000	0.69702	GAG	.	.		0.687	DHRS11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000256681.2	NM_024308	
MSI2	124540	hgsc.bcm.edu	37	17	55752442	55752442	+	Silent	SNP	T	T	C	rs376818853		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:55752442T>C	ENST00000284073.2	+	12	1109	c.900T>C	c.(898-900)agT>agC	p.S300S	MSI2_ENST00000416426.2_Silent_p.S296S|MSI2_ENST00000442934.2_Silent_p.S239S	NM_138962.2	NP_620412.1	Q96DH6	MSI2H_HUMAN	musashi RNA-binding protein 2	300						cytoplasm (GO:0005737)|polysome (GO:0005844)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	7	Breast(9;1.78e-08)			GBM - Glioblastoma multiforme(1;0.0025)		ATTACATAAGTGCGGCCAGCC	0.682			T	HOXA9	CML																																p.S300S		Atlas-SNP	.		Dom	yes		17	17q23.2	124540	musashi homolog 2 (Drosophila)		L	.	MSI2	52	.	0			c.T900C						.	T		0,4406		0,0,2203	54.0	61.0	59.0		900	-6.2	1.0	17		59	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	MSI2	NM_138962.2		0,1,6501	CC,CT,TT		0.0116,0.0,0.0077		300/329	55752442	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	124540	exon12			CATAAGTGCGGCC	BC001526	CCDS11596.1, CCDS11597.1	17q23.2	2013-07-16	2012-12-13					"""RNA binding motif (RRM) containing"""	18585	protein-coding gene	gene with protein product		607897	"""musashi homolog 2 (Drosophila)"""			11588182	Standard	NM_138962		Approved		uc002iuz.1	Q96DH6		ENST00000284073.2:c.900T>C	chr17.hg19:g.55752442T>C		202.0	0.0		293.0	108.0	NM_138962	Q7Z6M7|Q8N9T4	Silent	SNP	ENST00000284073.2	hg19	CCDS11596.1																																																																																			.	.		0.682	MSI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000441813.1		
SMG8	55181	hgsc.bcm.edu	37	17	57290544	57290544	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:57290544G>A	ENST00000543872.2	+	4	2624	c.2360G>A	c.(2359-2361)gGc>gAc	p.G787D	SMG8_ENST00000300917.5_Missense_Mutation_p.G787D|CTD-2510F5.6_ENST00000577660.1_Intron			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	787					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						GACCAACAGGGCTTTATTCCA	0.438																																					p.G787D		Atlas-SNP	.											.	SMG8	79	.	0			c.G2360A						.						110.0	113.0	112.0					17																	57290544		2203	4300	6503	SO:0001583	missense	55181	exon3			AACAGGGCTTTAT	AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2360G>A	chr17.hg19:g.57290544G>A	ENSP00000438748:p.Gly787Asp	94.0	0.0		142.0	74.0	NM_018149	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	ENST00000543872.2	hg19	CCDS11615.1	.	.	.	.	.	.	.	.	.	.	G	22.8	4.337042	0.81801	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.51574	0.7;0.7	6.07	6.07	0.98685	.	0.042937	0.85682	D	0.000000	T	0.69387	0.3105	M	0.75085	2.285	0.80722	D	1	D	0.64830	0.994	D	0.63703	0.917	T	0.70378	-0.4888	10	0.87932	D	0	-16.1888	19.6475	0.95784	0.0:0.0:1.0:0.0	.	787	Q8ND04	SMG8_HUMAN	D	787	ENSP00000300917:G787D;ENSP00000438748:G787D	ENSP00000300917:G787D	G	+	2	0	SMG8	54645326	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.885000	0.99019	0.655000	0.94253	GGC	.	.		0.438	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000445960.2	NM_018149	
KIAA0195	9772	hgsc.bcm.edu	37	17	73487458	73487458	+	Missense_Mutation	SNP	C	C	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr17:73487458C>A	ENST00000314256.7	+	13	1702	c.1308C>A	c.(1306-1308)agC>agA	p.S436R	KIAA0195_ENST00000579208.1_Missense_Mutation_p.S87R|KIAA0195_ENST00000375248.5_Missense_Mutation_p.S446R	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	436						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			TGTTCTTCAGCGGGAAGGTGG	0.587																																					p.S436R		Atlas-SNP	.											.	KIAA0195	102	.	0			c.C1308A						.						103.0	90.0	94.0					17																	73487458		2203	4300	6503	SO:0001583	missense	9772	exon13			CTTCAGCGGGAAG		CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.1308C>A	chr17.hg19:g.73487458C>A	ENSP00000313885:p.Ser436Arg	91.0	0.0		131.0	55.0	NM_014738	O75536|Q86XF1	Missense_Mutation	SNP	ENST00000314256.7	hg19	CCDS32732.1	.	.	.	.	.	.	.	.	.	.	C	12.53	1.966397	0.34659	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.42900	0.96;0.96	5.84	-9.99	0.00435	.	0.000000	0.85682	D	0.000000	T	0.44371	0.1290	N	0.25789	0.76	0.49299	D	0.99977	D;P;D	0.89917	0.999;0.882;1.0	D;P;D	0.85130	0.995;0.639;0.997	T	0.73411	-0.3991	10	0.31617	T	0.26	-12.4154	20.9608	0.99942	0.0:0.6813:0.0:0.3187	.	446;446;436	B4DGC6;C9JL75;Q12767	.;.;K0195_HUMAN	R	436;446	ENSP00000313885:S436R;ENSP00000364397:S446R	ENSP00000313885:S436R	S	+	3	2	KIAA0195	70999053	0.013000	0.17824	0.466000	0.27168	0.915000	0.54546	-0.941000	0.03925	-2.176000	0.00770	-0.948000	0.02665	AGC	.	.		0.587	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000447303.1	NM_014738	
CTIF	9811	hgsc.bcm.edu	37	18	46287893	46287893	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr18:46287893A>G	ENST00000256413.3	+	9	1499	c.1204A>G	c.(1204-1206)Aac>Gac	p.N402D	CTIF_ENST00000382998.4_Missense_Mutation_p.N404D	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	402	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGAGGCCCAGAACTCCACCAA	0.582																																					p.N404D		Atlas-SNP	.											.	CTIF	102	.	0			c.A1210G						.						165.0	97.0	120.0					18																	46287893		2203	4300	6503	SO:0001583	missense	9811	exon10			GCCCAGAACTCCA	AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1204A>G	chr18.hg19:g.46287893A>G	ENSP00000256413:p.Asn402Asp	98.0	0.0		65.0	59.0	NM_001142397	B3KTR8|Q8IVD5	Missense_Mutation	SNP	ENST00000256413.3	hg19	CCDS11935.1	.	.	.	.	.	.	.	.	.	.	A	21.5	4.163539	0.78226	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.21191	2.02;2.02	5.75	5.75	0.90469	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.138974	0.64402	D	0.000003	T	0.29288	0.0729	L	0.47716	1.5	0.47441	D	0.999426	P;P	0.50528	0.839;0.936	P;P	0.50082	0.497;0.63	T	0.01051	-1.1468	10	0.33141	T	0.24	-22.7557	15.7442	0.77926	1.0:0.0:0.0:0.0	.	404;402	O43310-2;O43310	.;CTIF_HUMAN	D	402;404;354	ENSP00000256413:N402D;ENSP00000372459:N404D	ENSP00000256413:N402D	N	+	1	0	CTIF	44541891	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.909000	0.56363	2.194000	0.70268	0.533000	0.62120	AAC	.	.		0.582	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000255907.1	NM_014772	
SERPINB2	5055	hgsc.bcm.edu	37	18	61562581	61562581	+	Silent	SNP	G	G	A	rs149564761	byFrequency	TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr18:61562581G>A	ENST00000299502.4	+	3	332	c.252G>A	c.(250-252)caG>caA	p.Q84Q	SERPINB2_ENST00000457692.1_Silent_p.Q84Q|SERPINB2_ENST00000482254.1_3'UTR	NM_002575.2	NP_002566.1	P05120	PAI2_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 2	84					blood coagulation (GO:0007596)|fibrinolysis (GO:0042730)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|liver(1)|lung(12)|prostate(2)|skin(2)|stomach(1)	32		Esophageal squamous(42;0.131)			Tenecteplase(DB00031)|Urokinase(DB00013)	TCATGCAGCAGATCCAGAAGG	0.428																																					p.Q84Q		Atlas-SNP	.											.	SERPINB2	63	.	0			c.G252A						.						191.0	186.0	188.0					18																	61562581		2203	4300	6503	SO:0001819	synonymous_variant	5055	exon3			GCAGCAGATCCAG	Y00630	CCDS11989.1	18q21.3	2014-02-18	2005-08-18		ENSG00000197632	ENSG00000197632		"""Serine (or cysteine) peptidase inhibitors"""	8584	protein-coding gene	gene with protein product		173390	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 2"""	PLANH2, PAI2		24172014	Standard	NM_002575		Approved	HsT1201	uc002ljo.3	P05120	OTTHUMG00000060592	ENST00000299502.4:c.252G>A	chr18.hg19:g.61562581G>A		81.0	0.0		77.0	71.0	NM_002575	Q96E96	Silent	SNP	ENST00000299502.4	hg19	CCDS11989.1																																																																																			.	G|0.999;C|0.001		0.428	SERPINB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000134009.1	NM_002575	
ZNF91	7644	hgsc.bcm.edu	37	19	23543926	23543926	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr19:23543926T>C	ENST00000300619.7	-	4	2060	c.1855A>G	c.(1855-1857)Aga>Gga	p.R619G	ZNF91_ENST00000397082.2_Missense_Mutation_p.R587G|ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000596528.1_5'Flank	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	619					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CTCTTATGTCTTCTTAGGGTT	0.388																																					p.R619G		Atlas-SNP	.											.	ZNF91	349	.	0			c.A1855G						.						62.0	65.0	64.0					19																	23543926		2178	4284	6462	SO:0001583	missense	7644	exon4			TATGTCTTCTTAG	M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1855A>G	chr19.hg19:g.23543926T>C	ENSP00000300619:p.Arg619Gly	104.0	0.0		128.0	59.0	NM_003430	A8K5E1|B7Z6G6	Missense_Mutation	SNP	ENST00000300619.7	hg19	CCDS42541.1	.	.	.	.	.	.	.	.	.	.	T	2.108	-0.404500	0.04832	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.07216	3.21;3.21	1.78	-3.55	0.04639	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.12944	0.0314	M	0.70903	2.155	0.09310	N	1	P;D	0.55172	0.721;0.97	B;P	0.56648	0.342;0.803	T	0.13150	-1.0520	9	0.22706	T	0.39	.	0.3269	0.00312	0.3421:0.1352:0.1724:0.3503	.	587;619	Q05481-2;Q05481	.;ZNF91_HUMAN	G	619;587	ENSP00000300619:R619G;ENSP00000380272:R587G	ENSP00000300619:R619G	R	-	1	2	ZNF91	23335766	0.000000	0.05858	0.002000	0.10522	0.017000	0.09413	-4.603000	0.00210	-0.769000	0.04620	0.260000	0.18958	AGA	.	.		0.388	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000465891.1	NM_003430	
ZNF569	148266	hgsc.bcm.edu	37	19	37904229	37904229	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr19:37904229C>T	ENST00000316950.6	-	6	1888	c.1331G>A	c.(1330-1332)gGg>gAg	p.G444E	ZNF569_ENST00000392150.2_Missense_Mutation_p.G285E|ZNF569_ENST00000392149.2_Missense_Mutation_p.G444E	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	444					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAAGCTTTCCCACATTCATT	0.373																																					p.G444E		Atlas-SNP	.											.	ZNF569	101	.	0			c.G1331A						.						72.0	69.0	70.0					19																	37904229		2203	4300	6503	SO:0001583	missense	148266	exon6			GCTTTCCCACATT	AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1331G>A	chr19.hg19:g.37904229C>T	ENSP00000325018:p.Gly444Glu	105.0	1.0		84.0	80.0	NM_152484	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	ENST00000316950.6	hg19	CCDS12503.1	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434040	0.62955	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.01221	5.15;5.15	4.33	4.33	0.51752	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38492	N	0.001671	T	0.07098	0.0180	L	0.61387	1.9	0.50813	D	0.999896	D;D	0.89917	1.0;1.0	D;D	0.91635	0.996;0.999	T	0.17623	-1.0363	10	0.52906	T	0.07	.	16.0897	0.81084	0.0:1.0:0.0:0.0	.	285;444	Q17RR6;Q5MCW4	.;ZN569_HUMAN	E	444;100;285	ENSP00000325018:G444E;ENSP00000375993:G285E	ENSP00000325018:G444E	G	-	2	0	ZNF569	42596069	0.614000	0.27017	1.000000	0.80357	0.998000	0.95712	1.269000	0.33074	2.397000	0.81536	0.655000	0.94253	GGG	.	.		0.373	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000109594.2	NM_152484	
ZNF780A	284323	hgsc.bcm.edu	37	19	40580707	40580707	+	Nonsense_Mutation	SNP	G	G	A	rs368327296		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr19:40580707G>A	ENST00000595687.2	-	6	1851	c.1642C>T	c.(1642-1644)Cga>Tga	p.R548*	ZNF780A_ENST00000414720.2_Intron|ZNF780A_ENST00000455521.1_Nonsense_Mutation_p.R549*|ZNF780A_ENST00000450241.2_Nonsense_Mutation_p.R514*|ZNF780A_ENST00000594395.1_Nonsense_Mutation_p.R549*|ZNF780A_ENST00000340963.5_Nonsense_Mutation_p.R548*|AC005614.5_ENST00000595508.1_RNA	NM_001010880.2	NP_001010880.2	O75290	Z780A_HUMAN	zinc finger protein 780A	548					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|upper_aerodigestive_tract(3)|urinary_tract(1)	31	all_cancers(60;9.55e-06)|all_lung(34;1.17e-07)|Lung NSC(34;1.41e-07)|Ovarian(47;0.0925)					TGAATACTTCGATGTTGATTA	0.378																																					p.R549X		Atlas-SNP	.											ZNF780A_ENST00000455521,colon,carcinoma,0,6	ZNF780A	156	.	0			c.C1645T						.	G	stop/ARG,stop/ARG,stop/ARG,	1,4405	2.1+/-5.4	0,1,2202	107.0	114.0	112.0		1642,1645,1642,	-1.3	0.0	19		112	0,8598		0,0,4299	no	stop-gained,stop-gained,stop-gained,intron	ZNF780A	NM_001010880.2,NM_001142577.1,NM_001142578.1,NM_001142579.1	,,,	0,1,6501	AA,AG,GG		0.0,0.0227,0.0077	,,,	548/642,549/643,548/642,	40580707	1,13003	2203	4299	6502	SO:0001587	stop_gained	284323	exon6			TACTTCGATGTTG	AK091274	CCDS33026.2, CCDS46078.1, CCDS46079.1	19q13.2	2014-02-12	2006-08-15		ENSG00000197782	ENSG00000197782		"""Zinc fingers, C2H2-type"", ""-"""	27603	protein-coding gene	gene with protein product							Standard	NM_001142577		Approved	ZNF780	uc010xvh.2	O75290	OTTHUMG00000155119	ENST00000595687.2:c.1642C>T	chr19.hg19:g.40580707G>A	ENSP00000472189:p.Arg548*	117.0	0.0		601.0	489.0	NM_001142577	E9PB48|Q6ZN87	Nonsense_Mutation	SNP	ENST00000595687.2	hg19	CCDS33026.2	.	.	.	.	.	.	.	.	.	.	g	38	6.890131	0.97912	2.27E-4	0.0	ENSG00000197782	ENST00000450241;ENST00000455521;ENST00000340963	.	.	.	1.93	-1.32	0.09201	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	6.9782	0.24688	0.0:0.0:0.5262:0.4738	.	.	.	.	X	548;549;548	.	ENSP00000341507:R548X	R	-	1	2	ZNF780A	45272547	0.000000	0.05858	0.010000	0.14722	0.974000	0.67602	-3.576000	0.00425	0.063000	0.16370	0.313000	0.20887	CGA	.	.		0.378	ZNF780A-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000470066.1	NM_001010880	
SIRPB1	10326	hgsc.bcm.edu	37	20	1551722	1551722	+	Silent	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr20:1551722G>A	ENST00000381605.4	-	4	877	c.813C>T	c.(811-813)acC>acT	p.T271T	SIRPB1_ENST00000262929.5_Intron|SIRPB1_ENST00000381603.3_Intron|RP4-576H24.4_ENST00000564763.1_Intron	NM_006065.3	NP_006056.2	O00241	SIRB1_HUMAN	signal-regulatory protein beta 1	271	Ig-like C1-type 2.				cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				central_nervous_system(2)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	31						TCACCTGGCAGGTGACGTTTG	0.542																																					p.T271T		Atlas-SNP	.											.	SIRPB1	83	.	0			c.C813T						.						102.0	95.0	97.0					20																	1551722		2203	4300	6503	SO:0001819	synonymous_variant	10326	exon4			CTGGCAGGTGACG	Y10376	CCDS13019.1, CCDS42850.1, CCDS46571.1	20p13	2013-01-11			ENSG00000101307	ENSG00000101307		"""Signal-regulatory proteins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	15928	protein-coding gene	gene with protein product		603889				9062191, 16339511	Standard	NM_001083910		Approved	SIRP-BETA-1, CD172b	uc010gai.3	O00241	OTTHUMG00000031676	ENST00000381605.4:c.813C>T	chr20.hg19:g.1551722G>A		120.0	0.0		263.0	83.0	NM_006065	A6NLM2|B2R8V0|Q5TFQ9|Q5TFR0|Q8TB12|Q9H1U5|Q9Y4V0	Silent	SNP	ENST00000381605.4	hg19	CCDS13019.1																																																																																			.	.		0.542	SIRPB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000077555.2	NM_006065	
BPIFA3	128861	hgsc.bcm.edu	37	20	31814800	31814800	+	Splice_Site	SNP	G	G	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr20:31814800G>C	ENST00000375454.3	+	6	895		c.e6+1		BPIFA3_ENST00000490499.1_Splice_Site|BPIFA3_ENST00000375452.3_Splice_Site	NM_178466.3	NP_848561.2	Q9BQP9	BPIA3_HUMAN	BPI fold containing family A, member 3							extracellular region (GO:0005576)	lipid binding (GO:0008289)										AGCCTCATAGGTGAGTGTCTG	0.577																																					.		Atlas-SNP	.											.	.	.	.	0			c.577+1G>C						.						112.0	109.0	110.0					20																	31814800		2203	4300	6503	SO:0001630	splice_region_variant	128861	exon5			TCATAGGTGAGTG		CCDS13216.2, CCDS42865.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000131059	ENSG00000131059		"""BPI fold containing"""	16204	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 71"""	C20orf71		11971875, 21787333	Standard	XR_244132		Approved	bA49G10.4, SPLUNC3	uc002wyr.3	Q9BQP9	OTTHUMG00000032245	ENST00000375454.3:c.685+1G>C	chr20.hg19:g.31814800G>C		68.0	0.0		137.0	36.0	NM_001042439	Q5JWG8|Q6NZ38	Splice_Site	SNP	ENST00000375454.3	hg19	CCDS13216.2	.	.	.	.	.	.	.	.	.	.	G	13.49	2.251882	0.39797	.	.	ENSG00000131059	ENST00000375454;ENST00000375452	.	.	.	4.02	0.986	0.19784	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.5977	0.08012	0.2102:0.0:0.5941:0.1957	.	.	.	.	.	-1	.	.	.	+	.	.	BPIFA3	31278461	1.000000	0.71417	0.965000	0.40720	0.891000	0.51852	1.484000	0.35508	0.261000	0.21753	-0.448000	0.05591	.	.	.		0.577	BPIFA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000078672.1	NM_178466	Intron
PREX1	57580	hgsc.bcm.edu	37	20	47273593	47273593	+	Missense_Mutation	SNP	G	G	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr20:47273593G>C	ENST00000371941.3	-	18	2130	c.2108C>G	c.(2107-2109)gCc>gGc	p.A703G	PREX1_ENST00000396220.1_Missense_Mutation_p.A703G	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	703	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GGCCTTCGTGGCCACCAGGAG	0.642																																					p.A703G		Atlas-SNP	.											.	PREX1	441	.	0			c.C2108G						.						54.0	43.0	47.0					20																	47273593		2203	4298	6501	SO:0001583	missense	57580	exon18			TTCGTGGCCACCA	AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.2108C>G	chr20.hg19:g.47273593G>C	ENSP00000361009:p.Ala703Gly	53.0	0.0		100.0	18.0	NM_020820	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	ENST00000371941.3	hg19	CCDS13410.1	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481397	0.63849	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.18016	2.24;2.24	5.12	5.12	0.69794	PDZ/DHR/GLGF (3);	0.000000	0.53938	U	0.000048	T	0.15349	0.0370	N	0.24115	0.695	0.58432	D	0.999999	B	0.12013	0.005	B	0.13407	0.009	T	0.04737	-1.0930	10	0.72032	D	0.01	.	18.5717	0.91137	0.0:0.0:1.0:0.0	.	703	Q8TCU6	PREX1_HUMAN	G	703	ENSP00000361009:A703G;ENSP00000379522:A703G	ENSP00000361009:A703G	A	-	2	0	PREX1	46707000	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	6.168000	0.71908	2.376000	0.81061	0.561000	0.74099	GCC	.	.		0.642	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	protein_coding	OTTHUMT00000079623.1	NM_020820	
LAMA5	3911	hgsc.bcm.edu	37	20	60907730	60907730	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr20:60907730T>C	ENST00000252999.3	-	27	3392	c.3326A>G	c.(3325-3327)tAt>tGt	p.Y1109C	MIR4758_ENST00000577688.1_RNA	NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1109	Domain IV 1 (domain IV B).				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			CACTAGGGCATAGCGGCCTGG	0.701																																					p.Y1109C		Atlas-SNP	.											.	LAMA5	268	.	0			c.A3326G						.						25.0	28.0	27.0					20																	60907730		2197	4295	6492	SO:0001583	missense	3911	exon27			AGGGCATAGCGGC	AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.3326A>G	chr20.hg19:g.60907730T>C	ENSP00000252999:p.Tyr1109Cys	82.0	0.0		149.0	49.0	NM_005560	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	ENST00000252999.3	hg19	CCDS33502.1	.	.	.	.	.	.	.	.	.	.	T	14.28	2.489108	0.44249	.	.	ENSG00000130702	ENST00000252999	T	0.35048	1.33	4.76	3.65	0.41850	.	0.000000	0.85682	U	0.000000	T	0.58366	0.2117	M	0.80332	2.49	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.63180	-0.6695	10	0.87932	D	0	.	9.701	0.40187	0.0:0.0836:0.0:0.9164	.	1109	O15230	LAMA5_HUMAN	C	1109	ENSP00000252999:Y1109C	ENSP00000252999:Y1109C	Y	-	2	0	LAMA5	60341125	1.000000	0.71417	0.251000	0.24312	0.038000	0.13279	4.900000	0.63252	1.765000	0.52091	0.240000	0.17902	TAT	.	.		0.701	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000080014.2	NM_005560	
SIM2	6493	hgsc.bcm.edu	37	21	38098595	38098595	+	Missense_Mutation	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr21:38098595T>C	ENST00000290399.6	+	6	1332	c.719T>C	c.(718-720)cTg>cCg	p.L240P	SIM2_ENST00000430056.3_Missense_Mutation_p.L240P	NM_005069.3	NP_005060.1	Q14190	SIM2_HUMAN	single-minded family bHLH transcription factor 2	240	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cell differentiation (GO:0030154)|embryonic pattern specification (GO:0009880)|lung development (GO:0030324)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(6)|prostate(1)|skin(2)	16						AGCCTTGACCTGAAGCTGATA	0.577																																					p.L240P		Atlas-SNP	.											.	SIM2	55	.	0			c.T719C						.						74.0	53.0	60.0					21																	38098595		2203	4300	6503	SO:0001583	missense	6493	exon6			TTGACCTGAAGCT		CCDS13646.1	21q22.2	2013-10-17	2013-10-17		ENSG00000159263	ENSG00000159263		"""Basic helix-loop-helix proteins"""	10883	protein-coding gene	gene with protein product	"""transcription factor SIM2"""	600892	"""single-minded (Drosophila) homolog 2"", ""single-minded homolog 2 (Drosophila)"""	SIM		7485157	Standard	NM_009586		Approved	MGC119447, bHLHe15	uc002yvr.2	Q14190	OTTHUMG00000086637	ENST00000290399.6:c.719T>C	chr21.hg19:g.38098595T>C	ENSP00000290399:p.Leu240Pro	46.0	0.0		62.0	24.0	NM_005069	O60766|Q15470|Q15471|Q15472|Q15473|Q16532|Q2TBD8	Missense_Mutation	SNP	ENST00000290399.6	hg19	CCDS13646.1	.	.	.	.	.	.	.	.	.	.	T	24.1	4.488329	0.84854	.	.	ENSG00000159263	ENST00000290399;ENST00000430056	T;T	0.17691	2.26;2.26	5.44	5.44	0.79542	PAS (2);	0.071377	0.56097	D	0.000037	T	0.39682	0.1087	M	0.90483	3.12	0.80722	D	1	P;P	0.49185	0.884;0.92	P;P	0.49561	0.465;0.615	T	0.52449	-0.8574	10	0.87932	D	0	.	15.804	0.78477	0.0:0.0:0.0:1.0	.	240;240	Q14190;Q14190-2	SIM2_HUMAN;.	P	240	ENSP00000290399:L240P;ENSP00000404176:L240P	ENSP00000290399:L240P	L	+	2	0	SIM2	37020465	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.505000	0.81655	2.193000	0.70182	0.533000	0.62120	CTG	.	.		0.577	SIM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000194692.1	NM_009586	
PRDM15	63977	hgsc.bcm.edu	37	21	43299446	43299446	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr21:43299446G>A	ENST00000269844.3	-	1	145	c.35C>T	c.(34-36)gCg>gTg	p.A12V	SNORA3_ENST00000515969.1_RNA|PRDM15_ENST00000398548.1_Missense_Mutation_p.A12V|PRDM15_ENST00000538201.1_5'UTR|AP001619.2_ENST00000432411.1_RNA|PRDM15_ENST00000422911.1_Missense_Mutation_p.A12V	NM_022115.3	NP_071398.3	P57071	PRD15_HUMAN	PR domain containing 15	12					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(11)|ovary(3)|skin(2)|stomach(2)|urinary_tract(1)	43						CGGAAACTGCGCAGCACCGGA	0.761																																					p.A12V		Atlas-SNP	.											.	PRDM15	110	.	0			c.C35T						.						4.0	6.0	5.0					21																	43299446		1901	3904	5805	SO:0001583	missense	63977	exon1			AACTGCGCAGCAC	AF276513	CCDS13676.1, CCDS42932.1, CCDS63370.1	21q22.3	2013-01-08	2002-07-31		ENSG00000141956	ENSG00000141956		"""Zinc fingers, C2H2-type"""	13999	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 83"""	ZNF298, C21orf83		12036297, 12036298	Standard	NM_022115		Approved		uc002yzq.1	P57071	OTTHUMG00000086781	ENST00000269844.3:c.35C>T	chr21.hg19:g.43299446G>A	ENSP00000269844:p.Ala12Val	28.0	0.0		32.0	12.0	NM_022115	E9PDJ6|E9PF37|E9PGL3|Q4W8S0|Q4W8S3|Q4W8S4|Q4W8S5|Q8N0X3|Q8NEX0|Q9NQV3	Missense_Mutation	SNP	ENST00000269844.3	hg19	CCDS13676.1	.	.	.	.	.	.	.	.	.	.	g	19.96	3.923243	0.73213	.	.	ENSG00000141956	ENST00000422911;ENST00000398548;ENST00000269844	T;T;T	0.10288	2.9;2.9;2.89	2.8	2.8	0.32819	.	.	.	.	.	T	0.14098	0.0341	N	0.08118	0	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.70716	0.97;0.97;0.97	T	0.28106	-1.0054	9	0.87932	D	0	.	12.5703	0.56332	0.0:0.0:1.0:0.0	.	12;12;12	P57071;E9PDJ6;E9PF37	PRD15_HUMAN;.;.	V	12	ENSP00000408592:A12V;ENSP00000381556:A12V;ENSP00000269844:A12V	ENSP00000269844:A12V	A	-	2	0	PRDM15	42172515	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	4.651000	0.61447	1.582000	0.49881	0.446000	0.29264	GCG	.	.		0.761	PRDM15-201	KNOWN	basic|CCDS	protein_coding	protein_coding		NM_022115	
ATF4	468	hgsc.bcm.edu	37	22	39917506	39917506	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr22:39917506C>T	ENST00000337304.2	+	1	938	c.56C>T	c.(55-57)cCc>cTc	p.P19L	ATF4_ENST00000404241.2_Missense_Mutation_p.P19L|ATF4_ENST00000396680.1_Missense_Mutation_p.P19L	NM_001675.2	NP_001666.2	P18848	ATF4_HUMAN	activating transcription factor 4	19					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular amino acid metabolic process (GO:0006520)|cellular protein metabolic process (GO:0044267)|circadian regulation of gene expression (GO:0032922)|endoplasmic reticulum unfolded protein response (GO:0030968)|gamma-aminobutyric acid signaling pathway (GO:0007214)|gluconeogenesis (GO:0006094)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress (GO:1990440)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|response to endoplasmic reticulum stress (GO:0034976)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite membrane (GO:0032590)|Lewy body core (GO:1990037)|neuron projection (GO:0043005)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	Melanoma(58;0.04)				Pseudoephedrine(DB00852)	TTGATGTCCCCCTTCGACCAG	0.537																																					p.P19L		Atlas-SNP	.											.	ATF4	27	.	0			c.C56T						.						66.0	65.0	66.0					22																	39917506		2203	4300	6503	SO:0001583	missense	468	exon1			TGTCCCCCTTCGA	D90209	CCDS13996.1	22q13.1	2013-05-23	2013-05-23		ENSG00000128272	ENSG00000128272		"""basic leucine zipper proteins"""	786	protein-coding gene	gene with protein product	"""tax-responsive enhancer element B67"""	604064	"""activating transcription factor 4 (tax-responsive enhancer element B67)"""	TXREB		1847461, 1534408	Standard	NM_182810		Approved	TAXREB67, CREB-2	uc003axz.3	P18848	OTTHUMG00000151099	ENST00000337304.2:c.56C>T	chr22.hg19:g.39917506C>T	ENSP00000336790:p.Pro19Leu	157.0	0.0		158.0	84.0	NM_001675	Q9UH31	Missense_Mutation	SNP	ENST00000337304.2	hg19	CCDS13996.1	.	.	.	.	.	.	.	.	.	.	C	21.8	4.201073	0.79015	.	.	ENSG00000128272	ENST00000404241;ENST00000337304;ENST00000396680	T;T;T	0.59772	0.24;0.24;0.24	4.37	4.37	0.52481	.	0.000000	0.85682	D	0.000000	T	0.74816	0.3766	M	0.72894	2.215	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.79460	-0.1794	10	0.87932	D	0	-10.014	16.9241	0.86170	0.0:1.0:0.0:0.0	.	19	P18848	ATF4_HUMAN	L	19	ENSP00000384587:P19L;ENSP00000336790:P19L;ENSP00000379912:P19L	ENSP00000336790:P19L	P	+	2	0	ATF4	38247452	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.037000	0.64170	1.983000	0.57843	0.561000	0.74099	CCC	.	.		0.537	ATF4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000321305.1	NM_001675	
SLC25A6	293	hgsc.bcm.edu	37	X	1506264	1506264	+	Missense_Mutation	SNP	A	A	G			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	A	A	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chrX:1506264A>G	ENST00000381401.5	-	3	1361	c.647T>C	c.(646-648)aTc>aCc	p.I216T	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	216					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	GGTCTGCGCGATCATCCAGCT	0.682																																					p.I216T		Atlas-SNP	.											.	SLC25A6	27	.	0			c.T647C						.						115.0	99.0	104.0					X																	1506264		2203	4296	6499	SO:0001583	missense	293	exon3			TGCGCGATCATCC	AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.647T>C	chrX.hg19:g.1506264A>G	ENSP00000370808:p.Ile216Thr	105.0	0.0		167.0	8.0	NM_001636	Q96C49	Missense_Mutation	SNP	ENST00000381401.5	hg19	CCDS14114.1	.	.	.	.	.	.	.	.	.	.	.	16.39	3.109126	0.56398	.	.	ENSG00000169100	ENST00000381401	T	0.78595	-1.19	1.87	1.87	0.25490	Mitochondrial carrier domain (2);	0.000000	0.56097	U	0.000032	T	0.80544	0.4643	M	0.81614	2.55	0.09310	N	1	P	0.46912	0.886	P	0.48901	0.594	T	0.73170	-0.4067	10	0.87932	D	0	.	9.5023	0.39026	1.0:0.0:0.0:0.0	.	216	P12236	ADT3_HUMAN	T	216	ENSP00000370808:I216T	ENSP00000370808:I216T	I	-	2	0	SLC25A6	1466264	1.000000	0.71417	0.807000	0.32361	0.681000	0.39784	7.001000	0.76297	0.808000	0.34231	0.333000	0.21579	ATC	.	.		0.682	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055596.1	NM_001636	
SHROOM2	357	hgsc.bcm.edu	37	X	9864618	9864618	+	Missense_Mutation	SNP	G	G	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chrX:9864618G>T	ENST00000380913.3	+	4	2760	c.2670G>T	c.(2668-2670)agG>agT	p.R890S		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	890					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				TGGAGGCCAGGAGCTCTGGGC	0.627																																					p.R890S		Atlas-SNP	.											.	SHROOM2	139	.	0			c.G2670T						.						26.0	23.0	24.0					X																	9864618		2201	4300	6501	SO:0001583	missense	357	exon4			GGCCAGGAGCTCT	X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.2670G>T	chrX.hg19:g.9864618G>T	ENSP00000370299:p.Arg890Ser	119.0	1.0		136.0	125.0	NM_001649	B9EIQ7	Missense_Mutation	SNP	ENST00000380913.3	hg19	CCDS14135.1	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593372	0.46214	.	.	ENSG00000146950	ENST00000380913	T	0.18960	2.18	5.02	3.25	0.37280	.	0.223008	0.47093	D	0.000259	T	0.35885	0.0947	M	0.64404	1.975	0.18873	N	0.999988	D	0.89917	1.0	D	0.69307	0.963	T	0.14980	-1.0453	10	0.72032	D	0.01	-18.7123	5.1183	0.14847	0.251:0.1473:0.6018:0.0	.	890	Q13796	SHRM2_HUMAN	S	890	ENSP00000370299:R890S	ENSP00000370299:R890S	R	+	3	2	SHROOM2	9824618	0.991000	0.36638	0.005000	0.12908	0.486000	0.33341	2.222000	0.42926	0.377000	0.24735	0.600000	0.82982	AGG	.	.		0.627	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055721.1	NM_001649	
TLR8	51311	hgsc.bcm.edu	37	X	12938752	12938752	+	Silent	SNP	T	T	C			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chrX:12938752T>C	ENST00000218032.6	+	2	1680	c.1593T>C	c.(1591-1593)caT>caC	p.H531H	TLR8_ENST00000311912.5_Silent_p.H549H	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	531					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	CCATTCCTCATGTCAAATATT	0.353																																					p.H531H		Atlas-SNP	.											.	TLR8	134	.	0			c.T1593C						.						53.0	48.0	49.0					X																	12938752		2203	4300	6503	SO:0001819	synonymous_variant	51311	exon2			TCCTCATGTCAAA	AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.1593T>C	chrX.hg19:g.12938752T>C		121.0	0.0		203.0	19.0	NM_138636	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Silent	SNP	ENST00000218032.6	hg19	CCDS14152.1																																																																																			.	.		0.353	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055784.2	NM_016610	
CDKL5	6792	hgsc.bcm.edu	37	X	18602433	18602433	+	Missense_Mutation	SNP	G	G	A			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	G	G	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chrX:18602433G>A	ENST00000379989.3	+	9	799	c.514G>A	c.(514-516)Gtt>Att	p.V172I	CDKL5_ENST00000379996.3_Missense_Mutation_p.V172I	NM_001037343.1	NP_001032420.1	O76039	CDKL5_HUMAN	cyclin-dependent kinase-like 5	172	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				neuron migration (GO:0001764)|positive regulation of axon extension (GO:0045773)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of Rac GTPase activity (GO:0032855)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite development (GO:0050773)	cytoplasm (GO:0005737)|dendrite cytoplasm (GO:0032839)|dendritic growth cone (GO:0044294)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|kinase activity (GO:0016301)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(12)|ovary(4)|skin(5)|stomach(1)	44	Hepatocellular(33;0.183)					CACAGAGTACGTTGCCACCAG	0.383																																					p.V172I		Atlas-SNP	.											.	CDKL5	124	.	0			c.G514A						.						162.0	137.0	145.0					X																	18602433		2203	4300	6503	SO:0001583	missense	6792	exon8			GAGTACGTTGCCA	Y15057	CCDS14186.1	Xp22	2011-11-04	2002-11-26	2002-11-29	ENSG00000008086	ENSG00000008086		"""Cyclin-dependent kinases"""	11411	protein-coding gene	gene with protein product		300203	"""serine/threonine kinase 9"""	STK9		9721213, 16935860	Standard	XM_005274584		Approved	EIEE2	uc004cym.3	O76039	OTTHUMG00000021214	ENST00000379989.3:c.514G>A	chrX.hg19:g.18602433G>A	ENSP00000369325:p.Val172Ile	89.0	0.0		103.0	99.0	NM_003159	G9B9X4|Q14198|Q5H985|Q8IYC7|Q9UJL6	Missense_Mutation	SNP	ENST00000379989.3	hg19	CCDS14186.1	.	.	.	.	.	.	.	.	.	.	G	32	5.152620	0.94645	.	.	ENSG00000008086	ENST00000379996;ENST00000379989	T;T	0.50548	0.74;0.74	5.74	5.74	0.90152	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.66376	0.2783	L	0.55990	1.75	0.58432	D	0.999999	D	0.76494	0.999	D	0.81914	0.995	T	0.67632	-0.5621	10	0.66056	D	0.02	-15.1468	18.8535	0.92241	0.0:0.0:1.0:0.0	.	172	O76039	CDKL5_HUMAN	I	172	ENSP00000369332:V172I;ENSP00000369325:V172I	ENSP00000369325:V172I	V	+	1	0	CDKL5	18512354	1.000000	0.71417	1.000000	0.80357	0.892000	0.51952	9.845000	0.99498	2.399000	0.81585	0.544000	0.68410	GTT	.	.		0.383	CDKL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000055945.2	NM_003159	
L1CAM	3897	hgsc.bcm.edu	37	X	153135853	153135853	+	Missense_Mutation	SNP	C	C	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	C	C	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chrX:153135853C>T	ENST00000370060.1	-	8	985	c.796G>A	c.(796-798)Gcc>Acc	p.A266T	L1CAM_ENST00000543994.1_Missense_Mutation_p.A268T|L1CAM_ENST00000361699.4_Missense_Mutation_p.A266T|L1CAM_ENST00000538883.1_Missense_Mutation_p.A268T|L1CAM_ENST00000361981.3_Missense_Mutation_p.A261T|L1CAM_ENST00000370057.3_Missense_Mutation_p.A266T|L1CAM_ENST00000370055.1_Missense_Mutation_p.A261T	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	266	Ig-like C2-type 3.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					AAGCCCTCGGCGATGCACTCC	0.667																																					p.A266T		Atlas-SNP	.											.	L1CAM	189	.	0			c.G796A						.						51.0	49.0	50.0					X																	153135853		2203	4300	6503	SO:0001583	missense	3897	exon7			CCTCGGCGATGCA	M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.796G>A	chrX.hg19:g.153135853C>T	ENSP00000359077:p.Ala266Thr	94.0	0.0		125.0	17.0	NM_000425	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	ENST00000370060.1	hg19	CCDS14733.1	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601892	0.87055	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32;-0.32;-0.32	5.04	5.04	0.67666	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000047	D	0.83078	0.5176	M	0.84773	2.715	0.44330	D	0.997212	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.71870	0.957;0.971;0.975	D	0.86358	0.1715	10	0.72032	D	0.01	.	16.2554	0.82515	0.0:1.0:0.0:0.0	.	261;266;266	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	T	266;268;266;268;261;261;266	ENSP00000359077:A266T;ENSP00000438430:A268T;ENSP00000359074:A266T;ENSP00000439645:A268T;ENSP00000354712:A261T;ENSP00000359072:A261T;ENSP00000355380:A266T	ENSP00000355380:A266T	A	-	1	0	L1CAM	152789047	0.971000	0.33674	0.180000	0.23079	0.863000	0.49368	2.789000	0.47813	2.091000	0.63221	0.529000	0.55759	GCC	.	.		0.667	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000061094.2	NM_024003	
TRIM13	10206	hgsc.bcm.edu	37	13	50588480	50588481	+	3'UTR	INS	-	-	T	rs2803837		TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:50588480_50588481insT	ENST00000378182.3	+	0	3142_3143				KCNRG_ENST00000312942.1_5'Flank|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000478111.1_Intron	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13						anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		aaaaaaaaaaaatatatatata	0.297																																					.		Atlas-INDEL	.											.	TRIM13	30	.	0			.						.																																			SO:0001624	3_prime_UTR_variant	10206	.			.	AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.*1181->T	chr13.hg19:g.50588480_50588481insT		38.0	0.0		35.0	21.0	.	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	RNA	INS	ENST00000378182.3	hg19	CCDS9423.1																																																																																			.	.		0.297	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	protein_coding	OTTHUMT00000354875.1	NM_001007278	
VWA8	23078	hgsc.bcm.edu	37	13	42390845	42390846	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	-	-	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr13:42390845_42390846insT	ENST00000379310.3	-	16	2003_2004	c.1935_1936insA	c.(1933-1938)acacagfs	p.Q646fs	VWA8_ENST00000281496.6_Frame_Shift_Ins_p.Q646fs	NM_015058.1	NP_055873.1	A3KMH1	VWA8_HUMAN	von Willebrand factor A domain containing 8	646						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)										GTTGGATCCTGTGTTTCTCTGA	0.356																																					p.Q646fs		Atlas-INDEL	.											.	.	.	.	0			c.1936_1937insA						.																																			SO:0001589	frameshift_variant	23078	exon16			.	AB011136	CCDS31963.1, CCDS41881.1	13q14.11	2013-11-18	2012-08-02	2012-08-02	ENSG00000102763	ENSG00000102763			29071	protein-coding gene	gene with protein product			"""KIAA0564"""	KIAA0564		9628581	Standard	NM_015058		Approved		uc001uyj.3	A3KMH1	OTTHUMG00000016799	ENST00000379310.3:c.1936dupA	chr13.hg19:g.42390846_42390846dupT	ENSP00000368612:p.Gln646fs	133.0	0.0		151.0	72.0	NM_015058	O60310|Q5JTP6|Q5VW08|Q7Z6I9|Q86YC9|Q8N3E4	Frame_Shift_Ins	INS	ENST00000379310.3	hg19	CCDS41881.1																																																																																			.	.		0.356	VWA8-005	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354828.2	NM_015058	
HMGCS1	3157	hgsc.bcm.edu	37	5	43298839	43298839	+	Frame_Shift_Del	DEL	T	T	-			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	T	T	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr5:43298839delT	ENST00000325110.6	-	3	435	c.229delA	c.(229-231)atgfs	p.M77fs	HMGCS1_ENST00000433297.2_Frame_Shift_Del_p.M77fs	NM_001098272.2	NP_001091742.1	Q01581	HMCS1_HUMAN	3-hydroxy-3-methylglutaryl-CoA synthase 1 (soluble)	77					brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cholesterol biosynthetic process (GO:0006695)|isoprenoid biosynthetic process (GO:0008299)|lipid metabolic process (GO:0006629)|liver development (GO:0001889)|male gonad development (GO:0008584)|response to acid chemical (GO:0001101)|response to drug (GO:0042493)|response to lipoprotein particle (GO:0055094)|response to low light intensity stimulus (GO:0009645)|response to purine-containing compound (GO:0014074)|response to tellurium ion (GO:0046690)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hydroxymethylglutaryl-CoA synthase activity (GO:0004421)|isomerase activity (GO:0016853)|organic acid binding (GO:0043177)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|stomach(1)|urinary_tract(1)	15						TTTCTCTCCATAAGATTCTGA	0.428																																					p.M77fs		Atlas-INDEL	.											.	HMGCS1	33	.	0			c.230delT						.						128.0	125.0	126.0					5																	43298839		2203	4300	6503	SO:0001589	frameshift_variant	3157	exon2			.		CCDS34154.1	5p14-p13	2012-10-02	2010-04-30			ENSG00000112972	2.3.3.10		5007	protein-coding gene	gene with protein product	"""3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) synthase"""	142940	"""3-hydroxy-3-methylglutaryl-Coenzyme A synthase 1 (soluble)"""	HMGCS			Standard	NM_001098272		Approved		uc003jnq.5	Q01581		ENST00000325110.6:c.229delA	chr5.hg19:g.43298839delT	ENSP00000322706:p.Met77fs	145.0	0.0		297.0	216.0	NM_002130	B2RDL8	Frame_Shift_Del	DEL	ENST00000325110.6	hg19	CCDS34154.1																																																																																			.	.		0.428	HMGCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000368022.1		
OR5H2	79310	hgsc.bcm.edu	37	3	98001914	98001945	+	Frame_Shift_Del	DEL	CATCCCCATGTACTTTTTTCTTGGGAGTTTAG	CATCCCCATGTACTTTTTTCTTGGGAGTTTAG	-	rs143349446|rs547108121	byFrequency	TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	CATCCCCATGTACTTTTTTCTTGGGAGTTTAG	CATCCCCATGTACTTTTTTCTTGGGAGTTTAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:98001914_98001945delCATCCCCATGTACTTTTTTCTTGGGAGTTTAG	ENST00000355273.2	+	1	183_214	c.183_214delCATCCCCATGTACTTTTTTCTTGGGAGTTTAG	c.(181-216)cacatccccatgtacttttttcttgggagtttagccfs	p.IPMYFFLGSLA62fs	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S70I(1)|p.G69W(1)		breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						CACAACTTCACATCCCCATGTACTTTTTTCTTGGGAGTTTAGCCTTTGTTGA	0.409																																					p.61_71del		Atlas-INDEL	.											.	OR5H2	63	.	2	Substitution - Missense(2)	ovary(1)|lung(1)	c.182_213del						.																																			SO:0001589	frameshift_variant	79310	exon1			.		CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.183_214delCATCCCCATGTACTTTTTTCTTGGGAGTTTAG	chr3.hg19:g.98001914_98001945delCATCCCCATGTACTTTTTTCTTGGGAGTTTAG	ENSP00000347418:p.Ile62fs	113.0	0.0		136.0	26.0	NM_001005482	Q6IF87	Frame_Shift_Del	DEL	ENST00000355273.2	hg19	CCDS33801.1																																																																																			.	.		0.409	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000359113.2		
TMEM39A	55254	hgsc.bcm.edu	37	3	119176876	119176878	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-DD-AACV-01A-11D-A40R-10	TCGA-DD-AACV-10A-01D-A40U-10	AAG	AAG	.	.	.	.	Unknown	Untested	Somatic	PhaseI	WXS	none	.		Illumina HiSeq	fcfe5003-d7c8-44d1-a477-87739185c5aa	6c521fa5-4471-4a49-9649-e0317e230699	g.chr3:119176876_119176878delAAG	ENST00000319172.5	-	3	743_745	c.323_325delCTT	c.(322-327)tcttgt>tgt	p.S108del	TMEM39A_ENST00000486159.1_5'UTR	NM_018266.1	NP_060736.1	Q9NV64	TM39A_HUMAN	transmembrane protein 39A	108						integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	13				GBM - Glioblastoma multiforme(114;0.244)		AGTGATGTACAAGAAGCAGGATG	0.34																																					p.108_109del		Atlas-INDEL	.											.	TMEM39A	36	.	0			c.324_326del						.																																			SO:0001651	inframe_deletion	55254	exon3			.	BC021277	CCDS2987.1	3q13.33	2005-01-10			ENSG00000176142	ENSG00000176142			25600	protein-coding gene	gene with protein product						12477932	Standard	NM_018266		Approved	FLJ10902	uc003eck.2	Q9NV64	OTTHUMG00000159361	ENST00000319172.5:c.323_325delCTT	chr3.hg19:g.119176879_119176881delAAG	ENSP00000326063:p.Ser108del	105.0	0.0		144.0	59.0	NM_018266	D3DN80|Q53FN4|Q53GI1|Q6PKB5	In_Frame_Del	DEL	ENST00000319172.5	hg19	CCDS2987.1																																																																																			.	.		0.340	TMEM39A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	protein_coding	OTTHUMT00000354941.3	NM_018266	
